Kim, Choon-Mee; Cho, Min Keun; Yun, Na-Ra; Kim, Seok Won; Jang, Sook Jin; Ahn, Young-Joon; Lim, Donghoon
2015-01-01
We retrospectively evaluated the accuracy of conventional PCR targeting the 16S rRNA gene (16S C-PCR) using the Ot-16sRF1/Ot-16sRR1 primers for diagnosing scrub typhus. The diagnosis of Orientia tsutsugamushi infection by 16S C-PCR presented an increased sensitivity of 87.0% and specificity of 100% compared with those obtained with other targets and is thus a simple and clinically useful method with good diagnostic accuracy. PMID:26491185
Kim, Jeong-Soon; Wang, Nian
2009-03-06
Citrus Huanglongbing (HLB) is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR) indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.
Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...
Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene
USDA-ARS?s Scientific Manuscript database
This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...
16S rRNA beacons for bacterial monitoring during human space missions.
Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E
2007-04-01
Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.
Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi
2006-01-01
Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.
Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina
2015-11-13
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification
Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina
2015-01-01
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586
Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.
Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M
2018-06-08
Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.
Kimura, Hiroyuki; Ishibashi, Jun-Ichiro; Masuda, Harue; Kato, Kenji; Hanada, Satoshi
2007-04-01
International drilling projects for the study of microbial communities in the deep-subsurface hot biosphere have been expanded. Core samples obtained by deep drilling are commonly contaminated with mesophilic microorganisms in the drilling fluid, making it difficult to examine the microbial community by 16S rRNA gene clone library analysis. To eliminate mesophilic organism contamination, we previously developed a new method (selective phylogenetic analysis [SePA]) based on the strong correlation between the guanine-plus-cytosine (G+C) contents of the 16S rRNA genes and the optimal growth temperatures of prokaryotes, and we verified the method's effectiveness (H. Kimura, M. Sugihara, K. Kato, and S. Hanada, Appl. Environ. Microbiol. 72:21-27, 2006). In the present study we ascertained SePA's ability to eliminate contamination by archaeal rRNA genes, using deep-sea hydrothermal fluid (117 degrees C) and surface seawater (29.9 degrees C) as substitutes for deep-subsurface geothermal samples and drilling fluid, respectively. Archaeal 16S rRNA gene fragments, PCR amplified from the surface seawater, were denatured at 82 degrees C and completely digested with exonuclease I (Exo I), while gene fragments from the deep-sea hydrothermal fluid remained intact after denaturation at 84 degrees C because of their high G+C contents. An examination using mixtures of DNAs from the two environmental samples showed that denaturation at 84 degrees C and digestion with Exo I completely eliminated archaeal 16S rRNA genes from the surface seawater. Our method was quite useful for culture-independent community analysis of hyperthermophilic archaea in core samples recovered from deep-subsurface geothermal environments.
Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin
2013-08-01
[Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.
Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.
2014-01-01
Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152
Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.
Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F
1989-10-20
Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.
NASA Astrophysics Data System (ADS)
Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.
2011-10-01
Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.
Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.
Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L
1996-01-01
Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200
Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...
Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude
2004-05-01
The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.
Tian, Yang; Li, Yan Hong
2017-01-01
To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys
Berry, David; Gutierrez, Tony
2017-01-01
Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035
Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.
Berry, David; Gutierrez, Tony
2017-01-01
Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.
Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J.; Ehresmann, Chantal; Portier, Claude
2015-01-01
Summary The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G•U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO–lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G•U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15–rpsO mRNA interactions can also be found, probably with A(−46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited. PMID:15101974
Detection of bacterial 16S rRNA using a molecular beacon-based X sensor
Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.
2012-01-01
We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850
NASA Technical Reports Server (NTRS)
Fox, G. E.
1985-01-01
Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.
Arfken, Ann M; Song, Bongkeun; Mallin, Michael A
2015-09-01
Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.
Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J
2017-11-02
Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had
Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas
2016-09-23
The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.
Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo
2009-04-01
For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.
Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes
O’Farrell, Katrina A.; Janssen, Peter H.
1999-01-01
Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454
Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...
Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing
Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro
2017-01-01
Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100
Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.
Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji
2017-02-28
High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin
Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary
2015-01-01
16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447
Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.
Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V
2003-01-01
Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).
Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.
2010-01-01
N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261
Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A
2007-02-23
N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.
Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent
2012-01-01
Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126
Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.
2003-01-01
The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285
Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung
2011-01-01
Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective
NASA Technical Reports Server (NTRS)
Gutell, R. R.; Larsen, N.; Woese, C. R.
1994-01-01
The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical
Hoshino, Tatsuhiko; Inagaki, Fumio
2017-01-01
Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and
Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike
2013-12-01
Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.
Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa.
Yokoyama, Keiko; Doi, Yohei; Yamane, Kunikazu; Kurokawa, Hiroshi; Shibata, Naohiro; Shibayama, Keigo; Yagi, Tetsuya; Kato, Haru; Arakawa, Yoshichika
2003-12-06
Bacteria develop resistance to aminoglycosides by producing aminoglycoside-modifying enzymes such as acetyltransferase, phosphorylase, and adenyltransferase. These enzymes, however, cannot confer consistent resistance to various aminoglycosides because of their substrate specificity. Notwithstanding, a Pseudomonas aeruginosa strain AR-2 showing high-level resistance (minimum inhibitory concentration >1024 mg/L) to various aminoglycosides was isolated clinically. We aimed to clone and characterise the genetic determinant of this resistance. We used conventional methods for DNA manipulation, susceptibility testing, and gene analyses to clone and characterise the genetic determinant of the resistance seen. PCR detection of the gene was also done on a stock of P aeruginosa strains that were isolated clinically since 1997. An aminoglycoside-resistance gene, designated rmtA, was identified in P aeruginosa AR-2. The Escherichia coli transformant and transconjugant harbouring the rmtA gene showed very high-level resistance to various aminoglycosides, including amikacin, tobramycin, isepamicin, arbekacin, kanamycin, and gentamicin. The 756-bp nucleotide rmtA gene encoded a protein, RmtA. This protein showed considerable similarity to the 16S rRNA methylases of aminoglycoside-producing actinomycetes, which protect bacterial 16S rRNA from intrinsic aminoglycosides by methylation. Incorporation of radiolabelled methyl groups into the 30S ribosome was detected in the presence of RmtA. Of 1113 clinically isolated P aeruginosa strains, nine carried the rmtA gene, as shown by PCR analyses. Our findings strongly suggest intergeneric lateral gene transfer of 16S rRNA methylase gene from some aminoglycoside-producing microorganisms to P aeruginosa. Further dissemination of the rmtA gene in nosocomial bacteria could be a matter of concern in the future.
Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.
McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary
2016-01-01
16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan
2015-04-01
Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite
The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.
Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R
As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.
The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science
Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.
2017-01-01
Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the
Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia
2014-08-01
We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.
How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity
NASA Technical Reports Server (NTRS)
Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr
1992-01-01
16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.
The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...
We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...
Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.
Chun, J; Huq, A; Colwell, R R
1999-05-01
Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.
Petti, C. A.; Polage, C. R.; Schreckenberger, P.
2005-01-01
Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109
Turankar, Ravindra P; Pandey, Shradha; Lavania, Mallika; Singh, Itu; Nigam, Astha; Darlong, Joydeepa; Darlong, Fam; Sengupta, Utpal
2015-03-01
PCR assay is a highly sensitive, specific and reliable diagnostic tool for the identification of pathogens in many infectious diseases. Genome sequencing Mycobacterium leprae revealed several gene targets that could be used for the detection of DNA from clinical and environmental samples. The PCR sensitivity of particular gene targets for specific clinical and environmental isolates has not yet been established. The present study was conducted to compare the sensitivity of RLEP, rpoT, Sod A and 16S rRNA gene targets in the detection of M. leprae in slit skin smear (SSS), blood, soil samples of leprosy patients and their surroundings. Leprosy patients were classified into Paucibacillary (PB) and Multibacillary (MB) types. Ziehl-Neelsen (ZN) staining method for all the SSS samples and Bacteriological Index (BI) was calculated for all patients. Standard laboratory protocol was used for DNA extraction from SSS, blood and soil samples. PCR technique was performed for the detection of M. leprae DNA from all the above-mentioned samples. RLEP gene target was able to detect the presence of M. leprae in 83% of SSS, 100% of blood samples and in 36% of soil samples and was noted to be the best out of all other gene targets (rpoT, Sod A and 16S rRNA). It was noted that the RLEP gene target was able to detect the highest number (53%) of BI-negative leprosy patients amongst all the gene targets used in this study. Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes. Copyright © 2015 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.
Triman, K L
1995-01-01
Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481
Ghosal, Anubrata; Babu, Vignesh M P; Walker, Graham C
2018-06-18
YbeY is a highly conserved, multifunctional endoribonuclease that plays a significant role in ribosome biogenesis and has several additional roles. Here, we show in Escherichia coli that overexpressing the conserved GTPase, Era, partially suppresses the growth defect of a ΔybeY strain while improving 16S rRNA processing and 70S ribosome assembly. This suppression requires both Era's ability to hydrolyze GTP and the function of three exoribonucleases, RNase II, RNase R and RNase PH, suggesting a model for Era's action. Overexpressing Vibrio cholerae Era similarly partially suppresses the defects of an E. coli ΔybeY strain indicating this property of Era is conserved in bacteria other than E. coli Importance This work provides additional insights into the critical, but still incompletely understood, mechanism of the processing of the E. coli 16S rRNA 3'-terminus. The highly conserved GTPase, Era, is known to bind to the precursor of the 16S rRNA near its 3-end. Both the endoribonuclease YbeY, which binds to Era, and four exoribonucleases have been implicated in this 3'-end processing. Results reported here offer additional insights into the role of Era in 16S rRNA 3'-maturation and into the relationship between the action of the endoribonuclease YbeY and the four exoribonucleases. This study also hints at why YbeY is only essential in some bacteria and suggests that the YbeY could be a target for a new class of antibiotic in these bacteria. Copyright © 2018 American Society for Microbiology.
We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...
A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.
Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda
2015-02-01
The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.
Sato, Mitsuharu; Miyazaki, Kentaro
2017-01-01
Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination
2011-01-01
Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978
Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A
2018-03-09
Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.
Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons
Haas, Brian J.; Gevers, Dirk; Earl, Ashlee M.; Feldgarden, Mike; Ward, Doyle V.; Giannoukos, Georgia; Ciulla, Dawn; Tabbaa, Diana; Highlander, Sarah K.; Sodergren, Erica; Methé, Barbara; DeSantis, Todd Z.; Petrosino, Joseph F.; Knight, Rob; Birren, Bruce W.
2011-01-01
Bacterial diversity among environmental samples is commonly assessed with PCR-amplified 16S rRNA gene (16S) sequences. Perceived diversity, however, can be influenced by sample preparation, primer selection, and formation of chimeric 16S amplification products. Chimeras are hybrid products between multiple parent sequences that can be falsely interpreted as novel organisms, thus inflating apparent diversity. We developed a new chimera detection tool called Chimera Slayer (CS). CS detects chimeras with greater sensitivity than previous methods, performs well on short sequences such as those produced by the 454 Life Sciences (Roche) Genome Sequencer, and can scale to large data sets. By benchmarking CS performance against sequences derived from a controlled DNA mixture of known organisms and a simulated chimera set, we provide insights into the factors that affect chimera formation such as sequence abundance, the extent of similarity between 16S genes, and PCR conditions. Chimeras were found to reproducibly form among independent amplifications and contributed to false perceptions of sample diversity and the false identification of novel taxa, with less-abundant species exhibiting chimera rates exceeding 70%. Shotgun metagenomic sequences of our mock community appear to be devoid of 16S chimeras, supporting a role for shotgun metagenomics in validating novel organisms discovered in targeted sequence surveys. PMID:21212162
Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.
2007-12-04
The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.
Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C
2012-04-01
Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.
Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C
1988-01-01
We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025
Wang, R F; Cao, W W; Cerniglia, C E
1996-01-01
In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).
Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D
1993-11-01
In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.
Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi
2012-01-01
Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668
Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W
2000-12-01
Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.
Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy
2005-03-01
Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.
Thurlow, D L; Ehresmann, C; Ehresmann, B
1983-01-01
Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037
Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.
1998-01-01
We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678
Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin
2015-03-01
The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific
Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel
2011-04-28
The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.
NASA Technical Reports Server (NTRS)
Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr
1992-01-01
A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V
2010-06-01
We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.
Use of 16S-23S rRNA spacer-region (SR)-PCR for identification of intestinal clostridia.
Song, Yuli; Liu, Chengxu; Molitoris, Denise; Tomzynski, Thomas J; Mc Teague, Maureen; Read, Erik; Finegold, Sydney M
2002-12-01
The suitability of a species identification technique based on PCR analysis of 16S-23S rRNA spacer region (SR) polymorphism for human intestinal Clostridium species was evaluated. This SR-PCR based technique is highly reproducible and successfully differentiated the strains tested, which included 17 ATCC type strains of Clostridium and 152 human stool Clostridium isolates, at the species or intraspecies level. Ninety-eight of 152 stool isolates, including C. bifermentans, C. butyricum, C. cadaveris, C. orbiscindens, C. paraputrificum, C. pefringens, C. ramosum, C. scindens, C. spiroforme, C. symbiosum and C. tertium, were identified to species level by SR-PCR patterns that were identical to those of their corresponding ATCC type strains. The other 54 stool isolates distributed among ten SR-PCR patterns that are unique and possibly represent ten novel Clostridium species or subspecies. The species identification obtained by SR-PCR pattern analysis completely agreed with that obtained by 16S rRNA sequencing, and led to identification that clearly differed from that obtained by cellular fatty acid analysis for 23/152 strains (15%). These results indicate that SR-PCR provides an accurate and rapid molecular method for the identification of human intestinal Clostridium species.
Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael
2002-01-01
For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358
Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.
Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu
2013-08-01
Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.
Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿
Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu
2008-01-01
The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345
Primer and platform effects on 16S rRNA tag sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien; Singh, Kanwar; Fern, Alison
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Primer and platform effects on 16S rRNA tag sequencing
Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...
2015-08-04
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Barb, Jennifer J; Oler, Andrew J; Kim, Hyung-Suk; Chalmers, Natalia; Wallen, Gwenyth R; Cashion, Ann; Munson, Peter J; Ames, Nancy J
2016-01-01
There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology. This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9) processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY). Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies) and their sequencing data is subjected to a novel analytical pipeline. Results are presented at family and genus level. The Kullback-Leibler divergence (DKL), a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst) average DKL while the V4 gave the lowest (best) average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria. The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points throughout a
The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy
Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng
2014-01-01
Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055
Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies
NASA Technical Reports Server (NTRS)
Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.
1991-01-01
Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".
Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng
2017-05-10
Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite
Röder, Christoph; König, Helmut; Fröhlich, Jürgen
2007-09-01
Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.
Piekarska, Katarzyna; Zacharczuk, Katarzyna; Wołkowicz, Tomasz; Rzeczkowska, Magdalena; Bareja, Elżbieta; Olak, Monika; Gierczyński, Rafał
2016-01-01
Aminoglycosides are a group of antimicrobial agents still the most commonly used in the treatment of life-threatening bacterial infections in human and animals. The emergence and spread of 16S rRNA methylases, which confer high-level resistance to the majority of clinically relevant aminoglycosides, constitute a major public health concern. Our goal was to evaluate the distribution of 16S rRNA methylases among different species of Enterobacteriaceae during a five month-long survey in a tertiary hospital in Warszawa, Poland. In the survey, a total of 1770 non-duplicate clinical isolates were collected from all hospital wards in a tertiary hospital in Warszawa, Poland. The survey was conducted between 19 April and 19 September 2010. The ability to produce 16S rRNA methylase was examined by determining MICs for gentamicin, kanamycin, amikacin by means of the agar dilution method. The isolates resistant to high concentration of aminoglycosides were PCR tested for genes: armA, rmtA, rmtB and rmtC. PCR products were subjected to DNA sequencing by the Sanger method. The genetic similarity of the ArmA-producing isolates was analysed by pulsed-filed gel electrophoresis (PFGE). ArmA was the only 16S rRNA methylase detected in 20 of 1770 tested isolates. The overall prevalence rate of ArmA was 1.13%. In K. pneumoniae (n = 742), P. mirabilis (n = 130), and E. cloacae (n = 253) collected in the survey, the prevalence of ArmA was 0.4%, 0.8% and 5.9%, respectively. The PFGE revealed both horizontal and clonal spread of the armA gene in the hospital. The prevalence of 16S rRNA methylase ArmA reported in this study is significantly higher than observed in other countries in Europe.
Almeida, Alexandre; Mitchell, Alex L; Tarkowska, Aleksandra; Finn, Robert D
2018-05-01
Taxonomic profiling of ribosomal RNA (rRNA) sequences has been the accepted norm for inferring the composition of complex microbial ecosystems. Quantitative Insights Into Microbial Ecology (QIIME) and mothur have been the most widely used taxonomic analysis tools for this purpose, with MAPseq and QIIME 2 being two recently released alternatives. However, no independent and direct comparison between these four main tools has been performed. Here, we compared the default classifiers of MAPseq, mothur, QIIME, and QIIME 2 using synthetic simulated datasets comprised of some of the most abundant genera found in the human gut, ocean, and soil environments. We evaluate their accuracy when paired with both different reference databases and variable sub-regions of the 16S rRNA gene. We show that QIIME 2 provided the best recall and F-scores at genus and family levels, together with the lowest distance estimates between the observed and simulated samples. However, MAPseq showed the highest precision, with miscall rates consistently <2%. Notably, QIIME 2 was the most computationally expensive tool, with CPU time and memory usage almost 2 and 30 times higher than MAPseq, respectively. Using the SILVA database generally yielded a higher recall than using Greengenes, while assignment results of different 16S rRNA variable sub-regions varied up to 40% between samples analysed with the same pipeline. Our results support the use of either QIIME 2 or MAPseq for optimal 16S rRNA gene profiling, and we suggest that the choice between the two should be based on the level of recall, precision, and/or computational performance required.
Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences
2018-01-01
Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424
Overzier, Evelyn; Pfister, Kurt; Thiel, Claudia; Herb, Ingrid; Mahling, Monia; Silaghi, Cornelia
2013-03-01
Urban, natural, and pasture areas were investigated for prevalences and 16S rRNA gene variants of Anaplasma phagocytophilum in questing Ixodes ricinus ticks. The prevalences differed significantly between habitat types, and year-to-year variations in prevalence and habitat-dependent occurrence of 16S rRNA gene variants were detected.
Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.
2010-01-01
We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909
Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng
2014-01-01
Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield. PMID:25381241
Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes
2016-03-01
Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.
Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys
Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E
2012-01-01
Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311
Ryu, Hodon; Griffith, John F.; Khan, Izhar U. H.; Hill, Stephen; Edge, Thomas A.; Toledo-Hernandez, Carlos; Gonzalez-Nieves, Joel
2012-01-01
Two novel gull-specific quantitative PCR (qPCR) assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR green assay targeting Streptococcus spp. (gull3) and a hydrolysis TaqMan assay targeting Catellicoccus marimammalium (gull4). The objectives of this study were to compare the host specificity of a previous C. marimammalium qPCR assay (gull2) with that of the new markers and to examine the presence of the three gull markers in environmental water samples from different geographic locations. Most of the gull fecal samples tested (n = 255) generated positive signals with the gull2 and gull4 assays (i.e., >86%), whereas only 28% were positive with gull3. Low prevalence and abundance of tested gull markers (0.6 to 15%) were observed in fecal samples from six nonavian species (n = 180 fecal samples), whereas the assays cross-reacted to some extent (13 to 31%) with other (nongull) avian fecal samples. The gull3 assay was positive against fecal samples from 11 of 15 avian species, including gull. Of the presumed gull-impacted water samples (n = 349), 86%, 59%, and 91% were positive with the gull2, the gull3, and the gull4 assays, respectively. Approximately 5% of 239 non-gull-impacted water samples were positive with the gull2 and the gull4 assays, whereas 21% were positive witg the gull3 assay. While the relatively high occurrence of gull2 and gull4 markers in waters impacted by gull feces suggests that these assays could be used in environmental monitoring studies, the data also suggest that multiple avian-specific assays will be needed to accurately assess the contribution of different avian sources in recreational waters. PMID:22226950
Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L.
2006-01-01
Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 101 and 102 target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 105 to 107 target copies g−1 of dry soil, whereas genes for 16S rRNA were found at 108 to 109 target copies g−1 of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils. PMID:16885263
Hinić, V; Straub, C; Schultheiss, E; Kaempfer, P; Frei, R; Goldenberger, D
2013-07-01
Little is known about the clinical significance and laboratory diagnosis of Actinomyces funkei. In this report we describe six clinical cases where A. funkei was isolated from purulent, polymicrobial infections. Conventional identification procedures were compared with molecular methods including matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique. Analysis of the full 16S rRNA gene sequence of the six investigated strains revealed differences from the A. funkei type strain. DNA-DNA hybridization showed that the clinical strains represent a novel 16S rRNA gene variant within the species of A. funkei. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.
Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying
2015-01-01
Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.
Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau
2015-01-01
The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.
Osman, Muhammad-Afiq; Neoh, Hui-Min; Ab Mutalib, Nurul-Syakima; Chin, Siok-Fong; Jamal, Rahman
2018-01-01
The human gut holds the densest microbiome ecosystem essential in maintaining a healthy host physiology, whereby disruption of this ecosystem has been linked to the development of colorectal cancer (CRC). The advent of next-generation sequencing technologies such as the 16S rRNA gene sequencing has enabled characterization of the CRC gut microbiome architecture in an affordable and culture-free approach. Nevertheless, the lack of standardization in handling and storage of biospecimens, nucleic acid extraction, 16S rRNA gene primer selection, length, and depth of sequencing and bioinformatics analyses have contributed to discrepancies found in various published studies of this field. Accurate characterization of the CRC microbiome found in different stages of CRC has the potential to be developed into a screening tool in the clinical setting. This mini review aims to concisely compile all available CRC microbiome studies performed till end of 2016 and to suggest standardized protocols that are crucial in developing a gut microbiome screening panel for CRC.
Romero, J; García-Varela, M; Laclette, J P; Espejo, R T
2002-11-01
To explore the bacterial microbiota in Chilean oyster (Tiostrea chilensis), a molecular approach that permits detection of different bacteria, independently of their capacity to grow in culture media, was used. Bacterial diversity was assessed by analysis of both the 16S rDNA and the 16S-23S intergenic region, obtained by PCR amplifications of DNA extracted from depurated oysters. RFLP of the PCR amplified 16S rDNA showed a prevailing pattern in most of the individuals analyzed, indicating that a few bacterial species were relatively abundant and common in oysters. Cloning and sequencing of the 16S rDNA with the prevailing RFLP pattern indicated that this rRNA was most closely related to Arcobacter spp. However, analysis by the size of the amplified 16S-23S rRNA intergenic regions revealed not Arcobacter spp. but Staphylococcus spp. related bacteria as a major and common component in oyster. These different results may be caused by the absence of target for one of the primers employed for amplification of the intergenic region. Neither of the two bacteria species found in large abundance was recovered after culturing under aerobic, anaerobic, or microaerophilic conditions. This result, however, is expected because the number of bacteria recovered after cultivation was less than 0.01% of the total. All together, these observations suggest that Arcobacter-related strains are probably abundant and common in the Chilean oyster bacterial microbiota.
Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.
2010-01-01
Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113
Ryu, Hodon; Henson, Michael; Elk, Michael; Toledo-Hernandez, Carlos; Griffith, John; Blackwood, Denene; Noble, Rachel; Gourmelon, Michèle; Glassmeyer, Susan
2013-01-01
The detection of environmental enterococci has been determined primarily by using culture-based techniques that might exclude some enterococcal species as well as those that are nonculturable. To address this, the relative abundances of enterococci were examined by challenging fecal and water samples against a currently available genus-specific assay (Entero1). To determine the diversity of enterococcal species, 16S rRNA gene-based group-specific quantitative PCR (qPCR) assays were developed and evaluated against eight of the most common environmental enterococcal species. Partial 16S rRNA gene sequences of 439 presumptive environmental enterococcal strains were analyzed to study further the diversity of enterococci and to confirm the specificities of group-specific assays. The group-specific qPCR assays showed relatively high amplification rates with targeted species (>98%), although some assays cross-amplified with nontargeted species (1.3 to 6.5%). The results with the group-specific assays also showed that different enterococcal species co-occurred in most fecal samples. The most abundant enterococci in water and fecal samples were Enterococcus faecalis and Enterococcus faecium, although we identified more water isolates as Enterococcus casseliflavus than as any of the other species. The prevalence of the Entero1 marker was in agreement with the combined number of positive signals determined by the group-specific assays in most fecal samples, except in gull feces. On the other hand, the number of group-specific assay signals was lower in all water samples tested, suggesting that other enterococcal species are present in these samples. While the results highlight the value of genus- and group-specific assays for detecting the major enterococcal groups in environmental water samples, additional studies are needed to determine further the diversity, distributions, and relative abundances of all enterococcal species found in water. PMID:23087032
Mundus, D; Wollenzien, P
1998-11-01
Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.
Peeters, Bart; Herijgers, Paul; Beuselinck, Kurt; Peetermans, Willy E.; Herregods, Marie-Christin
2016-01-01
Identification of the causative pathogen of infective endocarditis (IE) is crucial for adequate management and therapy. A broad-range PCR-electrospray ionization mass spectrometry (PCR-ESI-MS) technique was compared with broad-spectrum 16S rRNA PCR and amplicon sequencing (16S rRNA PCR) for the detection of bacterial pathogens in 40 heart valves obtained from 34 definite infective endocarditis patients according to the modified Duke criteria and six nonendocarditis patients. Concordance between the two molecular techniques was 98% for being positive or negative, 97% for concordant identification up to the genus level, and 77% for concordant identification up to the species level. Sensitivity for detecting the causative pathogen (up to the genus level) in excised heart valves was 88% for 16S rRNA PCR and 85% for PCR-ESI-MS; the specificity was 83% for both methods. The two molecular techniques were significantly more sensitive than valve culture (18%) and accurately identified bacteria in excised heart valves. In eight patients with culture-negative IE, the following results were obtained: concordant detection of Coxiella burnetii (n = 2), Streptococcus gallolyticus (n = 1), Propionibacterium acnes (n = 1), and viridans group streptococci (n = 1) by both molecular tests, detection of P. acnes by PCR-ESI-MS whereas the 16S rRNA PCR was negative (n = 1), and a false-negative result by both molecular techniques (n = 2). In one case of IE caused by viridans streptococci, PCR-ESI-MS was positive for Enterococcus spp. The advantages of PCR-ESI-MS compared to 16S rRNA PCR are its automated workflow and shorter turnaround times. PMID:27629895
Hot topic: 16S rRNA gene sequencing reveals the microbiome of the virgin and pregnant bovine uterus.
Moore, S G; Ericsson, A C; Poock, S E; Melendez, P; Lucy, M C
2017-06-01
We tested the hypothesis that the uterus of virgin heifers and pregnant cows possessed a resident microbiome by 16S rRNA gene sequencing of the virgin and pregnant bovine uterus. The endometrium of 10 virgin heifers in estrus and the amniotic fluid, placentome, intercotyledonary placenta, cervical lumen, and external cervix surface (control) of 5 pregnant cows were sampled using aseptic techniques. The DNA was extracted, the V4 hypervariable region of the 16S rRNA gene was amplified, and amplicons were sequenced using Illumina MiSeq technology (Illumina Inc., San Diego, CA). Operational taxonomic units (OTU) were generated from the sequences using Qiime v1.8 software, and taxonomy was assigned using the Greengenes database. The effect of tissue on the microbial composition within the pregnant uterus was tested using univariate (mixed model) and multivariate (permutational multivariate ANOVA) procedures. Amplicons of 16S rRNA gene were generated in all samples, supporting the contention that the uterus of virgin heifers and pregnant cows contained a microbiome. On average, 53, 199, 380, 382, 525, and 13,589 reads annotated as 16, 35, 43, 63, 48, and 176 OTU in the placentome, virgin endometrium, amniotic fluid, cervical lumen, intercotyledonary placenta, and external surface of the cervix, respectively, were generated. The 3 most abundant phyla in the uterus of the virgin heifers and pregnant cows were Firmicutes, Bacteroidetes, and Proteobacteria, and they accounted for approximately 40, 35, and 10% of the sequences, respectively. Phyla abundance was similar between the tissues of the pregnant uterus. Principal component analysis, one-way PERMANOVA analysis of the Bray-Curtis similarity index, and mixed model analysis of the Shannon diversity index and Chao1 index demonstrated that the microbiome of the control tissue (external surface of the cervix) was significantly different from that of the amniotic fluid, intercotyledonary placenta, and placentome tissues
Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau
2015-01-01
The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0–9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community. PMID:25798135
Tartar, Aurélien; Boucias, Drion G; Becnel, James J; Adams, Byron J
2003-11-01
The Helicosporidia are invertebrate pathogens that have recently been identified as non-photosynthetic green algae (Chlorophyta). In order to confirm the algal nature of the genus Helicosporidium, the presence of a retained chloroplast genome in Helicosporidia cells was investigated. Fragments homologous to plastid 16S rRNA (rrn16) genes were amplified successfully from cellular DNA extracted from two different Helicosporidium isolates. The fragment sequences are 1269 and 1266 bp long, are very AT-rich (60.7 %) and are similar to homologous genes sequenced from non-photosynthetic green algae. Maximum-parsimony, maximum-likelihood and neighbour-joining methods were used to infer phylogenetic trees from an rrn16 sequence alignment. All trees depicted the Helicosporidia as sister taxa to the non-photosynthetic, pathogenic alga Prototheca zopfii. Moreover, the trees identified Helicosporidium spp. as members of a clade that included the heterotrophic species Prototheca spp. and the mesotrophic species Chlorella protothecoides. The clade is always strongly supported by bootstrap values, suggesting that all these organisms share a most recent common ancestor. Phylogenetic analyses inferred from plastid 16S rRNA genes confirmed that the Helicosporidia are non-photosynthetic green algae, close relatives of the genus Prototheca (Chlorophyta, Trebouxiophyceae). Such phylogenetic affinities suggest that Helicosporidium spp. are likely to possess Prototheca-like organelles and organelle genomes.
Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.
Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong
2011-01-01
To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.
NASA Astrophysics Data System (ADS)
Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng
2015-07-01
This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.
Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H
2005-01-01
To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.
Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo
2016-01-01
High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA
Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo
2016-01-01
High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in
16S rRNA Amplicon Sequencing for Epidemiological Surveys of Bacteria in Wildlife
Razzauti, Maria; Bard, Emilie; Bernard, Maria; Brouat, Carine; Charbonnel, Nathalie; Dehne-Garcia, Alexandre; Loiseau, Anne; Tatard, Caroline; Tamisier, Lucie; Vayssier-Taussat, Muriel; Vignes, Helene
2016-01-01
ABSTRACT The human impact on natural habitats is increasing the complexity of human-wildlife interactions and leading to the emergence of infectious diseases worldwide. Highly successful synanthropic wildlife species, such as rodents, will undoubtedly play an increasingly important role in transmitting zoonotic diseases. We investigated the potential for recent developments in 16S rRNA amplicon sequencing to facilitate the multiplexing of the large numbers of samples needed to improve our understanding of the risk of zoonotic disease transmission posed by urban rodents in West Africa. In addition to listing pathogenic bacteria in wild populations, as in other high-throughput sequencing (HTS) studies, our approach can estimate essential parameters for studies of zoonotic risk, such as prevalence and patterns of coinfection within individual hosts. However, the estimation of these parameters requires cleaning of the raw data to mitigate the biases generated by HTS methods. We present here an extensive review of these biases and of their consequences, and we propose a comprehensive trimming strategy for managing these biases. We demonstrated the application of this strategy using 711 commensal rodents, including 208 Mus musculus domesticus, 189 Rattus rattus, 93 Mastomys natalensis, and 221 Mastomys erythroleucus, collected from 24 villages in Senegal. Seven major genera of pathogenic bacteria were detected in their spleens: Borrelia, Bartonella, Mycoplasma, Ehrlichia, Rickettsia, Streptobacillus, and Orientia. Mycoplasma, Ehrlichia, Rickettsia, Streptobacillus, and Orientia have never before been detected in West African rodents. Bacterial prevalence ranged from 0% to 90% of individuals per site, depending on the bacterial taxon, rodent species, and site considered, and 26% of rodents displayed coinfection. The 16S rRNA amplicon sequencing strategy presented here has the advantage over other molecular surveillance tools of dealing with a large spectrum of bacterial
Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B
1982-01-01
1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129
Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.
Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E
1999-09-01
Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.
Wangkheimayum, Jayalaxmi; Paul, Deepjyoti; Dhar, Debadatta; Nepram, Rajlakshmi; Chetri, Shiela; Bhowmik, Deepshikha; Chakravarty, Atanu
2017-01-01
ABSTRACT The methylation of a ribosomal target leads to a high level of resistance to all clinically relevant aminoglycoside antibiotics, so early detection of these resistance determinants will help to reduce the incidence of treatment failures as well as lessen the dissemination rate. Here, we characterized different 16S rRNA methyltransferases responsible for aminoglycoside resistance and their epidemiological background in clinical isolates of Enterobacteriaceae in a tertiary referral hospital in India. All aminoglycoside-resistant isolates were screened for different 16S rRNA methyltransferases by PCR assay, and incompatibility typing of the conjugable plasmid harboring resistance genes was performed by PCR-based replicon typing. An assay for the stability and elimination of these resistance plasmids was performed. The coexistence of extended-spectrum β-lactamases and metallo-β-lactamases was also detected, and the heterogeneity of these isolates was determined by enterobacterial repetitive intergenic consensus PCR. The PCR assay revealed the presence of armA, rmtA, rmtB, rmtC, and rmtD in single and multiple combinations, and these were carried by a diverse group of Inc plasmids. Plasmids harboring these resistance determinants were highly stable and maintained until the 55th serial passage, but SDS treatment could easily eliminate the plasmids harboring the resistance determinants. The coexistence of blaTEM, blaPER, blaGES, and blaSHV, as well as blaVIM and blaNDM, within these isolates was also detected. Strains with different clonal patterns of aminoglycoside resistance were found to spread in this hospital setting. We observed that the 16S rRNA methyltransferase genes were encoded within different Inc plasmid types, suggesting diverse origins and sources of acquisition. Therefore, the present study is of epidemiological importance and can have a role in infection control policy in hospital settings. PMID:28320725
Airell, Asa; Lindbäck, Emma; Ataker, Ferda; Pörnull, Kirsti Jalakas; Wretlind, Bengt
2005-06-01
We compared 956 samples for AMPLICOR Neisseria gonorrhoeae polymerase chain reaction (PCR) (Roche) with species verification using the 16S rRNA gene to verification using gyrA gene. Control was the culture method. The gyrA verification uses pyrosequencing of the quinolone resistance-determining region of gyrA. Of 52 samples with optical density >/=0.2 in PCR, 27 were negative in culture, two samples from pharynx were false negative in culture and four samples from pharynx were false positives in verification with 16S rRNA. Twenty-five samples showed growth of gonococci, 18 of the corresponding PCR samples were verified by both methods; three urine samples were positive only in gyrA ; and one pharynx specimen was positive only in 16S rRNA. Three samples were lost. We conclude that AMPLICOR N. gonorrhoeae PCR with verification in gyrA gene can be considered as a diagnostic tool in populations with low prevalence of gonorrhoea and that pharynx specimens should not be analysed by PCR.
NASA Astrophysics Data System (ADS)
Bird, Clare; Darling, Kate F.; Russell, Ann D.; Davis, Catherine V.; Fehrenbacher, Jennifer; Free, Andrew; Wyman, Michael; Ngwenya, Bryne T.
2017-02-01
We investigated the possibility of bacterial symbiosis in Globigerina bulloides, a palaeoceanographically important, planktonic foraminifer. This marine protist is commonly used in micropalaeontological investigations of climatically sensitive subpolar and temperate water masses as well as wind-driven upwelling regions of the world's oceans. G. bulloides is unusual because it lacks the protist algal symbionts that are often found in other spinose species. In addition, it has a large offset in its stable carbon and oxygen isotopic compositions compared to other planktonic foraminifer species, and also that predicted from seawater equilibrium. This is suggestive of novel differences in ecology and life history of G. bulloides, making it a good candidate for investigating the potential for bacterial symbiosis as a contributory factor influencing shell calcification. Such information is essential to evaluate fully the potential response of G. bulloides to ocean acidification and climate change. To investigate possible ecological interactions between G. bulloides and marine bacteria, 18S rRNA gene sequencing, fluorescence microscopy, 16S rRNA gene metabarcoding and transmission electron microscopy (TEM) were performed on individual specimens of G. bulloides (type IId) collected from two locations in the California Current. Intracellular DNA extracted from five G. bulloides specimens was subjected to 16S rRNA gene metabarcoding and, remarkably, 37-87 % of all 16S rRNA gene sequences recovered were assigned to operational taxonomic units (OTUs) from the picocyanobacterium Synechococcus. This finding was supported by TEM observations of intact Synechococcus cells in both the cytoplasm and vacuoles of G. bulloides. Their concentrations were up to 4 orders of magnitude greater inside the foraminifera than those reported for the California Current water column and approximately 5 % of the intracellular Synechococcus cells observed were undergoing cell division. This suggests
da Mota, F F; Gomes, E A; Paiva, E; Rosado, A S; Seldin, L
2004-01-01
To avoid the limitations of 16S rRNA-based phylogenetic analysis for Paenibacillus species, the usefulness of the RNA polymerase beta-subunit encoding gene (rpoB) was investigated as an alternative to the 16S rRNA gene for taxonomic studies. Partial rpoB sequences were generated for the type strains of eight nitrogen-fixing Paenibacillus species. The presence of only one copy of rpoB in the genome of P. graminis strain RSA19(T) was demonstrated by denaturing gradient gel electrophoresis and hybridization assays. A comparative analysis of the sequences of the 16S rRNA and rpoB genes was performed and the eight species showed between 91.6-99.1% (16S rRNA) and 77.9-97.3% (rpoB) similarity, allowing a more accurate discrimination between the different species using the rpoB gene. Finally, 24 isolates from the rhizosphere of different cultivars of maize previously identified as Paenibacillus spp. were assigned correctly to one of the nitrogen-fixing species. The data obtained in this study indicate that rpoB is a powerful identification tool, which can be used for the correct discrimination of the nitrogen-fixing species of agricultural and industrial importance within the genus Paenibacillus.
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Suchodolski, Jan S; Dowd, Scot E; Wilke, Vicky; Steiner, Jörg M; Jergens, Albert E
2012-01-01
Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001). Proportions of Fusobacteria (p = 0.010), Bacteroidaceae (p = 0.015), Prevotellaceae (p = 0.022), and Clostridiales (p = 0.019) were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044) and Acinetobacter (p = 0.040), were either more abundant or more frequently identified in IBD dogs. In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
Nazina, T N; Shumkova, E S; Sokolova, D Sh; Babich, T L; Zhurina, M V; Xue, Yan-Fen; Osipov, G A; Poltaraus, A B; Tourova, T P
2015-01-01
The taxonomic position of hydrocarbon-oxidizing bacterial strains 263 and 32d isolated from formation water of the Daqing petroleum reservoir (PRC) was determined by polyphasic taxonomy techniques, including analysis of the 16S rRNA and the gyrB genes. The major chemotaxonomic characteristics of both strains, including the IV type cell wall, composition of cell wall fatty acids, mycolic acids, and menaquinones, agreed with those typical of Dietzia strains. The DNA G+C content of strains 263 and 32d were 67.8 and 67.6 mol%, respectively. Phylogenetic analysis of the 16S rRNA gene of strain 32d revealed 99.7% similarity to the gene of D. maris, making it possible to identify strain 32d as belonging to this species. The 16S rRNA gene sequence of strain 263 exhibited 99.7 and 99.9% similarity to those of D. natronolimnaea and D. cercidiphylli YIM65002(T), respectively. Analysis of the gyrB genes of the subterranean isolates and of a number of Dietzia type strains confirmed classiffication of strain 32d as a D. maris strain and of strain 263, as a D. natronolimnaea strain. A conclusion was made concerning higher resolving power of phylogenetic analysis of the gyrB gene compared to the 16S rRNA gene analysis in the case of determination of the species position of Dietzia isolates.
Yu, Zhongtang; García-González, Rubén; Schanbacher, Floyd L.; Morrison, Mark
2008-01-01
Different hypervariable (V) regions of the archaeal 16S rRNA gene (rrs) were compared systematically to establish a preferred V region(s) for use in Archaea-specific PCR-denaturing gradient gel electrophoresis (DGGE). The PCR products of the V3 region produced the most informative DGGE profiles and permitted identification of common methanogens from rumen samples from sheep. This study also showed that different methanogens might be detected when different V regions are targeted by PCR-DGGE. Dietary fat appeared to transiently stimulate Methanosphaera stadtmanae but inhibit Methanobrevibacter sp. strain AbM4 in rumen samples. PMID:18083874
Bavykin, Sergei G.; Mirzabekov, Andrei D.
2007-10-30
The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.
Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens
Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.
2015-01-01
According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760
Ngugi, David Kamanda; Stingl, Ulrich
2012-01-01
Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592
Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita
2010-12-31
Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.
Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C
2005-03-01
The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.
Saxena, S; Saxena, V K; Tomar, S; Sapcota, D; Gonmei, G
2016-06-01
A comparative analysis of caecum and crop microbiota of chick, grower and adult stages of Indian indigenous chickens was conducted to investigate the role of the microbiota of the gastrointestinal tract, which play an important role in host performance, health and immunity. High-throughput Illumina sequencing was performed for V3, V4 and V4-V6 hypervariable regions of the 16S rRNA gene. M5RNA and M5NR databases under MG-RAST were used for metagenomic datasets annotation. In the crop, Firmicutes (~78%) and Proteobacteria (~16%) were the predominant phyla whereas in the caecum, Firmicutes (~50%), Bacteroidetes (~29%) and Actinobacteria (~10%) were predominant. The Shannon-Wiener diversity index suggested that sample richness and diversity increased as the chicken aged. For the first time, the presence of Lactobacillus species such as L. frumenti, L. antri, L. mucosae in the chicken crop along with Kineococcus radiotolerans, Desulfohalobium retbaense and L. jensenii in the caecum are reported. Many of these bacterial species have been found to be involved in immune response modulation and disease prevention in pigs and humans. The gut microbiome of the indigenous chicken was enriched with microbes having probiotic potential which might be essential for their adaptability.
Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.
2007-01-01
We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.
Maus, Irena; Kim, Yong Sung; Wibberg, Daniel; Stolze, Yvonne; Off, Sandra; Antonczyk, Sebastian; Pühler, Alfred; Scherer, Paul; Schlüter, Andreas
2017-02-28
Process surveillance within agricultural biogas plants (BGPs) was concurrently studied by high-throughput 16S rRNA gene amplicon sequencing and an optimized quantitative microscopic fingerprinting (QMF) technique. In contrast to 16S rRNA gene amplicons, digitalized microscopy is a rapid and cost-effective method that facilitates enumeration and morphological differentiation of the most significant groups of methanogens regarding their shape and characteristic autofluorescent factor 420. Moreover, the fluorescence signal mirrors cell vitality. In this study, four different BGPs were investigated. The results indicated stable process performance in the mesophilic BGPs and in the thermophilic reactor. Bacterial subcommunity characterization revealed significant differences between the four BGPs. Most remarkably, the genera Defluviitoga and Halocella dominated the thermophilic bacterial subcommunity, whereas members of another taxon, Syntrophaceticus , were found to be abundant in the mesophilic BGP. The domain Archaea was dominated by the genus Methanoculleus in all four BGPs, followed by Methanosaeta in BGP1 and BGP3. In contrast, Methanothermobacter members were highly abundant in the thermophilic BGP4. Furthermore, a high consistency between the sequencing approach and the QMF method was shown, especially for the thermophilic BGP. The differences elucidated that using this biphasic approach for mesophilic BGPs provided novel insights regarding disaggregated single cells of Methanosarcina and Methanosaeta species. Both dominated the archaeal subcommunity and replaced coccoid Methanoculleus members belonging to the same group of Methanomicrobiales that have been frequently observed in similar BGPs. This work demonstrates that combining QMF and 16S rRNA gene amplicon sequencing is a complementary strategy to describe archaeal community structures within biogas processes.
Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R
2006-01-01
As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome
Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens
Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...
2015-02-06
According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less
Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke
2017-09-18
Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
Suchodolski, Jan S.; Dowd, Scot E.; Wilke, Vicky; Steiner, Jörg M.; Jergens, Albert E.
2012-01-01
Background Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Methodology/Principal Findings Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001). Proportions of Fusobacteria (p = 0.010), Bacteroidaceae (p = 0.015), Prevotellaceae (p = 0.022), and Clostridiales (p = 0.019) were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044) and Acinetobacter (p = 0.040), were either more abundant or more frequently identified in IBD dogs. Conclusions/Significance In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation. PMID:22720094
Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita
2010-01-01
Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215
Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz
2012-01-01
The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887
Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz
2012-01-01
The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.
Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.
Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V
2010-10-01
The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.
Yu, Ting; He, Tao; Yao, Hong; Zhang, Jin-Bao; Li, Xiao-Na; Zhang, Rong-Ming; Wang, Gui-Qin
2015-09-01
The aim of this study is to understand the prevalence and molecular characterization of 16S rRNA methylase gene, rmtB, among Escherichia coli strains isolated from bovine mastitis in China. A total of 245 E. coli isolates were collected from bovine mastitis in China between 2013 and 2014 and were screened for 16S rRNA methylase genes (armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA) by polymerase chain reaction. About 5.3% (13/245) of the isolates carried the rmtB gene; the isolates were highly resistant to amikacin. Thirteen rmtB-positive strains were analyzed for the presence of extended-spectrum β-lactamase genes (bla(TEM), bla(CTX-M), bla(OXA), and bla(SHV)). All the isolates harbored both bla(TEM-1) and bla(CTX-M-15) genes and two of the isolates were also positive for bla(OXA-1). Pulsed-field gel electrophoresis (PFGE) analysis indicated that the nine rmtB-positive strains belonging to ST10 from one farm showed the similar PFGE pattern, indicating a clonal expansion in this farm. S1-PFGE and Southern blotting showed that 12 isolates harbored the rmtB gene in plasmids of two different sizes (≈45 kb [n=10] and ≈48 kb [n=2]), while only 1 strain harbored the rmtB gene in the chromosome. These plasmids were transferable by conjugation studies, and two isolates from two respective farms carried the same size of plasmid, suggesting that the horizontal transmission of plasmids also contributed to the spread of rmtB gene. This is the first report of prevalence of the 16S rRNA methylase gene rmtB among E. coli isolated from bovine mastitis in China, and rmtB-carrying E. coli may pose a threat to the treatment of bovine mastitis.
Yu, Fangyou; Wang, Liangxing; Pan, Jingye; Yao, Dan; Chen, Chan; Zhu, Tao; Lou, Qiang; Hu, Jian; Wu, Yang; Zhang, Xueqing; Chen, Zengqiang; Qu, Di
2009-05-01
16S rRNA methylase-mediated high-level resistance to aminoglycosides has been reported recently in clinical isolates of Gram-negative bacilli from several countries. Twenty-one (6.2%, 21/337) of 337 isolates of Klebsiella pneumoniae from a teaching hospital in Wenzhou, China, were positive for 16S rRNA methylase genes (3 for armA, 13 for rmtB, 5 for both armA and rmtB) and highly resistant to gentamicin, amikacin, and tobramycin (MICs, > or =256 microg/mL). Nineteen of 21 isolates harboring 16S rRNA methyalse genes were extended-spectrum beta-lactamase (ESBL) producers. The plasmids harboring 16S rRNA methylase genes from 14 of 21 donors were transferred into the recipients, Escherichia coli J53. The armA and the rmtB usually coexisted with ESBL genes in the same isolate in clinical isolates and cotransferred with ESBL genes on a self-transmissible conjugative plasmid to the recipients. Among 5 isolates harboring both armA and rmtB, the armA genes were located on the chromosomes, and the rmtB genes were located on the plasmids, as determined by Southern hybridization. The result of pulsed-field gel electrophoresis showed that horizontal gene transfer and clonal spread were responsible for the dissemination of the rmtB and the armA genes. 16S rRNA methylase-producing isolates of Klebsiella pneumoniae were commonly identified in the Chinese teaching hospital with coexistence of rmtB and armA genes in the same isolate.
Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing
Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa
2014-01-01
While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880
Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.
Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa
2014-01-01
While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.
MetaDP: a comprehensive web server for disease prediction of 16S rRNA metagenomic datasets.
Xu, Xilin; Wu, Aiping; Zhang, Xinlei; Su, Mingming; Jiang, Taijiao; Yuan, Zhe-Ming
2016-01-01
High-throughput sequencing-based metagenomics has garnered considerable interest in recent years. Numerous methods and tools have been developed for the analysis of metagenomic data. However, it is still a daunting task to install a large number of tools and complete a complicated analysis, especially for researchers with minimal bioinformatics backgrounds. To address this problem, we constructed an automated software named MetaDP for 16S rRNA sequencing data analysis, including data quality control, operational taxonomic unit clustering, diversity analysis, and disease risk prediction modeling. Furthermore, a support vector machine-based prediction model for intestinal bowel syndrome (IBS) was built by applying MetaDP to microbial 16S sequencing data from 108 children. The success of the IBS prediction model suggests that the platform may also be applied to other diseases related to gut microbes, such as obesity, metabolic syndrome, or intestinal cancer, among others (http://metadp.cn:7001/).
Liu, Minrui; Lin, Pengwu; Qi, Xing'e; Ni, Yongqing
2016-04-14
The purpose of the study was to reveal geographic region-related Acidithiobacillus spp. distribution and allopatric speciation. Phylogenetic and diversity analysis was done to expand our knowledge on microbial phylogeography, diversity-maintaining mechanisms and molecular biogeography. We amplified 16S rRNA gene and RubisCO genes to construct corresponding phylogenetic trees based on the sequence homology and analyzed genetic diversity of Acidithiobacillus spp.. Thirty-five strains were isolated from three different regions in China (Yunnan, Hubei, Xinjiang). The whole isolates were classified into five groups. Four strains were identified as A. ferrivorans, six as A. ferridurans, YNTR4-15 Leptspirillum ferrooxidans and HBDY3-31 as Leptospirillum ferrodiazotrophum. The remaining strains were identified as A. ferrooxidans. Analysis of cbbL and cbbM genes sequences of representative 26 strains indicated that cbbL gene of 19 were two copies (cbbL1 and cbbL2) and 7 possessed only cbbL1. cbbM gene was single copy. In nucleotide-based trees, cbbL1 gene sequences of strains were separated into three sequence types, and the cbbL2 was similar to cbbL1 with three types. Codon bias of RubisCO genes was not obvious in Acidithiobacillus spp.. Strains isolated from three different regions in China indicated a great genetic diversity in Acidithiobacillus spp. and their 16S rRNA/RubisCO genes sequence was of significant difference. Phylogenetic tree based on 16S rRNA genes and RubisCO genes was different in Acidithiobacillus spp..
Kenneth T. Belt; Christina Hohn; Aiah Gbakima; James A. Higgins
2007-01-01
Bacteria present in water samples taken on a weekly basis, from June 2004 through June 2005, from three streams, were cultured on Coliscan® Easygel® agar plates. Colonies representative of a variety of colors and morphologies were subjected to amplification and sequencing of a 1000-1100 nt portion of the 16S rRNA gene. A total of 528 colonies were...
Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R; Kelly, Paul
2018-04-01
Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower ( P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased ( P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS.
Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R.; Kelly, Paul
2018-01-01
Abstract. Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower (P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased (P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS. PMID:29436337
Guo, Wei; Li, Ying; Wang, Lizhi; Wang, Jiwen; Xu, Qin; Yan, Tianhai; Xue, Bai
2015-08-01
The Yak (Bos grunniens) is a unique species of ruminant animals that is important to agriculture of the Tibetan plateau, and has a complex intestinal microbial community. The objective of the present study was to characterize the composition and individual variability of microbiota in the rumen of yaks using 16S rRNA gene high-throughput sequencing technique. Rumen samples used in the present study were obtained from grazing adult male yaks (n = 6) in a commercial farm in Ganzi Autonomous Prefecture of Sichuan Province, China. Universal prokaryote primers were used to target the V4-V5 hypervariable region of 16S rRNA gene. A total of 7200 operational taxonomic units (OTUs) were obtained after sequence filtering and chimera removal. Within these OTUs, 0.56% belonged to Archaea (40 OTUs), 7.19% to unassigned species (518 OTUs), and the remaining OTUs (6642) in all samples were of bacterial origin. When examining the community structure of bacteria, we identified 23 phyla within 159 families after taxonomic summarization. Bacteroidetes and Firmicutes were the predominant phyla accounting for 39.68% (SD = 0.05) and 45.90% (SD = 0.06), respectively. Moreover, 3764 OTUs were identified as shared OTUs (i.e. represented in all yaks) and belonged to 35 genera, exhibiting highly variable abundance across individual samples. Phylogenetic placement of these genera across individual samples was examined. In addition, we evaluated the distance among the 6 rumen samples by adding taxon phylogeny using UniFrac, representing 24.1% of average distance. In summary, the current study reveals a shared rumen microbiome and phylogenetic lineage and presents novel information on composition and individual variability of the bacterial community in the rumen of yaks. Copyright © 2015. Published by Elsevier Ltd.
Dautzenberg, K H W; Polderman, F N; van Suylen, R J; Moviat, M A M
2017-05-01
Both purpura fulminans and toxic epidermal necrolysis (TEN) are rare and life-threatening disorders with a high mortality. We present a case of suspected rapidly progressive, severe pneumococcal sepsis-induced purpura fulminans complicated by multiple organ failure, severe epidermolysis and cutaneous necrosis. We show the diagnostic challenge to differentiate between purpura fulminans and TEN, as the extensive epidermolysis in purpura fulminans may mimic TEN and we highlight the additional value of repeated skin biopsies and 16S rRNA gene sequencing.
Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad
2014-11-01
Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species.
USDA-ARS?s Scientific Manuscript database
This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...
Jiang, Xuexia; Jiao, Nianzhi
2016-09-01
Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.
Flynn, A N; Lyndon, C A; Church, D L
2013-08-01
A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.
Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.
2002-01-01
Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Flynn, A. N.; Lyndon, C. A.
2013-01-01
A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532
Khamis, Atieh; Raoult, Didier; La Scola, Bernard
2005-01-01
Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024
Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard
2010-01-30
Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial
2010-01-01
Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for
Nayarisseri, Anuraj; Suppahia, Anjana; Nadh, Anuroopa G; Nair, Achuthsankar S
2015-06-01
Organophosphates like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, and this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon, or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted, and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with Accession Number: JN794045.
Nayarisseri, Anuraj; Suppahia, Anjana; Nadh, Anuroopa G; Nair, Achuthsankar S
2014-08-09
Organophosphates (OPs) like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest-control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with accession number JN794045.
NASA Astrophysics Data System (ADS)
Hidayat, Habibi
2017-03-01
16S rRNA gene analysis of bacteria lactic acid (LAB) isolate from Markisa Kuning Fruit (Passiflora edulis var. flavicarpa) as a producer of protease enzyme and probiotics has been done. The aim of the study is to determine the protease enzyme activity and 16S rRNA gene amplification using PCR. The calculation procedure was done to M4 isolate bacteria lactic acid (LAB) Isolate which has been resistant to acids with pH 2.0 in the manner of screening protease enzyme activity test result 6.5 to clear zone is 13 mm againts colony diametre is 2 mm. The results of study enzyme activity used spectrophotometer UV-Vis obtainable the regression equation Y=0.02983+0.001312X, with levels of protein M4 isolate is 0.6594 mg/mL and enzyme activity of obtainable is 0.8626 unit/ml while the spesific enzyme activity produced is 1.308 unit/mg. Then, 16S rRNA gene amplificatiom and DNA sequencing has been done. The results of study showed that the bacteria species contained from M4 bacteria lactic acid (LAB) isolate is Weisella cibiria strain II-I-59. Weisella cibiria strain II-I-59 is one of bacteria could be utilized in the digestive tract.
Piwat, S; Teanpaisan, R
2013-01-01
This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances.
Piwat, S.; Teanpaisan, R.
2013-01-01
This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances. PMID:24191230
Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.
2016-01-01
Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332
Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.
2011-01-01
Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395
Karaevskaia, E S; Demchenko, L S; Demidov, N É; Rivkina, E M; Bulat, S A; Gilichinskiĭ, D A
2014-01-01
Archaeal communities of permafrost deposits of King George Island and Bunger Hills Oasis (Antarctica) differing in the content of biogenic methane were analyzed using clone libraries of two 16S rRNA gene regions. Phylotypes belonging to methanogenic archaea were identified in all horizons.
Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K
2000-06-15
Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.
Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons
Fischer, Sandra; Kumar, Neeraj
2017-01-01
The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea. PMID:28097056
Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.
Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas
2017-01-01
The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.
16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria.
Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J; Thomas, David J
2017-09-01
The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12-14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa.
16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria
Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A.; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J.; Thomas, David J.
2018-01-01
The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12–14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa. PMID:29551950
Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S
2016-02-25
Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. Copyright © 2016 Mehetre et al.
Moreno Andrade, Vicente D.; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P.; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A.; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A.; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B.; Ramírez, Natanahel Salvador; Jones, George H.
2018-01-01
ABSTRACT Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. PMID:29773615
Vasconcelos, Elton J R; Billeter, Sarah A; Jett, Lindsey A; Meinersmann, Richard J; Barr, Margaret C; Diniz, Pedro P V P; Oakley, Brian B
2018-06-12
Flea-borne diseases (FBDs) impact both human and animal health worldwide. Because adult fleas are obligately hematophagous and can harbor potential pathogens, fleas act as ectoparasites of vertebrates, as well as zoonotic disease vectors. Cat fleas (Ctenocephalides felis) are important vectors of two zoonotic bacterial genera listed as priority pathogens by the National Institute of Allergy and Infectious Diseases (NIAID-USA): Bartonella spp. and Rickettsia spp., causative agents of bartonelloses and rickettsioses, respectively. In this study, we introduce the first microbiome analysis of C. felis samples from California, determining the presence and abundance of relevant pathogenic genera by characterizing the cat flea microbiome through 16S rRNA next-generation sequencing (16S-NGS). Samples from both northern (NoCal) and southern (SoCal) California were assessed to expand current knowledge regarding FBDs in the state. We identified Rickettsia and Bartonella, as well as the endosymbiont Wolbachia, as the most abundant genera, followed by less abundant taxa. In comparison to our previous study screening Californian cat fleas for rickettsiae using PCR/digestion/sequencing of the ompB gene, the 16S-NGS approach applied herein showed a 95% level of agreement in detecting Rickettsia spp. There was no overall difference in microbiome diversity between NoCal and SoCal samples. Bacterial taxa identified by 16S-NGS in this study may help to improve epidemiological investigations, pathogen surveillance efforts, and clinical diagnostics of FBDs in California and elsewhere.
Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets
Yu, Guoqin; Fadrosh, Doug; Goedert, James J.; Ravel, Jacques; Goldstein, Alisa M.
2015-01-01
Background Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. Results In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon’s index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Conclusions Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work
Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis
2010-04-01
An arbitrary primed community PCR fingerprinting technique based on capillary electrophoresis was developed to study maple sap microbial community characteristics among 19 production sites in Québec over the tapping season. Presumptive fragment identification was made with corresponding fingerprint profiles of bacterial isolate cultures. Maple sap microbial communities were subsequently compared using a representative subset of 13 16S rRNA gene clone libraries followed by gene sequence analysis. Results from both methods indicated that all maple sap production sites and flow periods shared common microbiota members, but distinctive features also existed. Changes over the season in relative abundance of predominant populations showed evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most abundantly and frequently represented genera of the 2239 sequences analyzed. Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilithonimonas and Sphingomonas were revealed as occasional contaminants in maple sap. Maple sap microbiota showed a low level of deep diversity along with a high variation of similar 16S rRNA gene sequences within the Pseudomonas genus. Predominance of Pseudomonas is suggested as a typical feature of maple sap microbiota across geographical regions, production sites, and sap flow periods.
Wachi, M; Kaga, N; Umitsuki, G; Clark, D P; Nagai, K
2001-12-21
Escherichia coli RNase G, encoded by the rng gene, is involved in both the processing of 16S rRNA precursor and the degradation of adhE mRNA. Consequently, defects in RNase G result in elevation of AdhE levels. Furthermore, the adhR430 mutant strain, DC430, is reported to overproduce the AdhE protein in a manner dependent on the adhC81 mutation. We found that overproduction of AdhE by DC430 was reversed to wild-type levels by introduction of a plasmid carrying the wild-type allele of rng. Mapping by P1-phage-mediated transduction also indicated that a mutation involved in AdhE overproduction was located around the rng region in DC430. DNA sequencing of the rng region revealed that DC430 indeed had a mutation in the rng gene: a G1022 to A transition that caused substitution of Gly341 with Ser and which was named rng430. This lies in the highly conserved region of the RNase E/RNase G family, called high similarity region 2 (HSR2). However, very interestingly, rng430 mutant strains did not accumulate the 16.3S precursor of 16S rRNA unlike rng::cat mutants. We also found that the Rng1 mutant protein, which is truncated in its C-terminal domain encompassing HSR2, exhibited a residual processing activity against the 16S rRNA precursor, when overproduced. These results indicate that the HSR2 of RNase G plays an important role in substrate recognition and/or ribonucleolytic action.
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.
Pulk, Arto; Maiväli, Ulo; Remme, Jaanus
2006-05-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association
Pulk, Arto; Maiväli, Ülo; Remme, Jaanus
2006-01-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933
Increased 5S rRNA oxidation in Alzheimer's disease.
Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R
2012-01-01
It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.
Identification by 16S rRNA Gene Sequencing of Lactobacillus salivarius Bacteremic Cholecystitis
Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Yuen, Kwok-Yung
2002-01-01
An anaerobic, nonsporulating, gram-positive bacterium was isolated from blood and bile pus cultures of a 70-year-old man with bacteremic acute cholecystitis. The API 20A system showed that it was 70% Actinomyces naeslundii and 30% Bifidobacterium species, whereas the Vitek ANI system and the ATB ID32A Expression system showed that it was “unidentified.” The 16S rRNA gene of the strain was amplified and sequenced. There were 3 base differences between the nucleotide sequence of the isolate and that of Lactobacillus salivarius subsp. salivarius or L. salivarius subsp. salicinius, indicating that the isolate was a strain of L. salivarius. The patient responded to cholecystectomy and a 2-week course of antibiotic treatment. Identification of the organism in the present study was important because the duration of antibiotic therapy would have been entirely different depending on the organism. If the bacterium had been identified as Actinomyces, penicillin for 6 months would have been the regimen of choice. However, it was Lactobacillus, and a 2-week course of antibiotic was sufficient. PMID:11773128
Moreno Andrade, Vicente D; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B; Ramírez, Natanahel Salvador; Jones, George H; Hernandez-Flores, Jose Luis; Campos-Guillén, Juan
2018-05-17
Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. Copyright © 2018 Moreno Andrade et al.
Machado, V S; Oikonomou, G; Bicalho, M L S; Knauer, W A; Gilbert, R; Bicalho, R C
2012-10-12
The objective of this study was the use of metagenomic pyrosequencing of the 16S rRNA gene for the investigation of postpartum dairy cows' uterine bacterial diversity. The effect of subcutaneous supplementation of a trace mineral supplement containing Zn, Mn, Se, and Cu (Multimin North America, Inc., Fort Collins, CO) at 230 days of gestation and 260 days of gestation on dairy cows' uterine microbiota was also evaluated. Uterine lavage samples were collected at 35 DIM and were visually scored for the presence of purulent or mucopurulent secretion. The same samples were also used for the acquisition of bacterial DNA. The 16S rRNA genes were individually amplified from each sample. Pyrosequencing of the samples was carried at the Cornell University Life Sciences Core Laboratories Center using Roche 454 GS-FLX System Titanium Chemistry. The Ribosomal Database Project online tools were used for the analysis of the obtained sequences library. Bacteroides spp., Ureaplasma spp., Fusobacterium spp., Peptostreptococcus spp., Sneathia spp., Prevotella spp. and Arcanobacterium spp. prevalence was significantly (P<0.05) higher in samples derived from cows that had a higher uterine lavage sample score. Bacteroides spp., Ureaplasma spp., Fusobacterium spp., and Arcanobacterium spp. prevalence was significantly (P<0.05) higher in samples derived from cows that were not pregnant by 200 DIM. Anaerococcus spp., Peptostreptococcus spp., Parabacteroides spp., and Propionibacterium spp. prevalence was significantly (P<0.05) lower in samples derived from cows that were trace mineral supplemented. Copyright © 2012 Elsevier B.V. All rights reserved.
Comparison of synovial fluid culture and 16S rRNA PCR in dogs with suspected septic arthritis.
Scharf, V F; Lewis, D D; Wellehan, J F; Wamsley, H L; Richardson, R
2015-06-01
To prospectively compare the sensitivity and specificity of 16S rRNA PCR with culture for identifying the causative organism in synovial fluid obtained from dogs with suspected septic arthritis. Synovial fluid cytology, PCR analysis and aerobic, anaerobic and Mycoplasma culture of samples from the affected joints of 18 dogs presenting with suspected septic arthritis were performed. Synovial fluid samples from the corresponding contralateral joints of 7 dogs were also analysed as negative controls. There was no significant difference between the sensitivity of bacterial detection via culture (63.2%) versus PCR (73.7%) of synovial fluid (P=0.728) or between culture and combined PCR and culture (89.5%) of synovial fluid (P=0.124). The specificity of PCR (42.9%) was significantly lower than culture specificity (100%) (P=0.07). Although 16S PCR may hold potential as an ancillary diagnostic test for identifying the causative organism in dogs with septic arthritis, our study failed to demonstrate improved accuracy compared with traditional synovial fluid culture. © 2015 Australian Veterinary Association.
Heilek, G M; Noller, H F
1996-01-01
Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688
NASA Technical Reports Server (NTRS)
Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.
1992-01-01
Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.
Witek, Marta A; Conn, Graeme L
2014-09-01
The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m(1)A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m(1)A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m(1)A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm that each hypothetical enzyme is a functional 16S rRNA (m(1)A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. Copyright © 2014 Elsevier B.V. All rights reserved.
Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R
1999-12-01
A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.
Gross, Erin L.; Beall, Clifford J.; Kutsch, Stacey R.; Firestone, Noah D.; Leys, Eugene J.; Griffen, Ann L.
2012-01-01
Dental caries in very young children may be severe, result in serious infection, and require general anesthesia for treatment. Dental caries results from a shift within the biofilm community specific to the tooth surface, and acidogenic species are responsible for caries. Streptococcus mutans, the most common acid producer in caries, is not always present and occurs as part of a complex microbial community. Understanding the degree to which multiple acidogenic species provide functional redundancy and resilience to caries-associated communities will be important for developing biologic interventions. In addition, microbial community interactions in health and caries pathogenesis are not well understood. The purpose of this study was to investigate bacterial community profiles associated with the onset of caries in the primary dentition. In a combination cross-sectional and longitudinal design, bacterial community profiles at progressive stages of caries and over time were examined and compared to those of health. 16S rRNA gene sequencing was used for bacterial community analysis. Streptococcus mutans was the dominant species in many, but not all, subjects with caries. Elevated levels of S. salivarius, S. sobrinus, and S. parasanguinis were also associated with caries, especially in subjects with no or low levels of S. mutans, suggesting these species are alternative pathogens, and that multiple species may need to be targeted for interventions. Veillonella, which metabolizes lactate, was associated with caries and was highly correlated with total acid producing species. Among children without previous history of caries, Veillonella, but not S. mutans or other acid-producing species, predicted future caries. Bacterial community diversity was reduced in caries as compared to health, as many species appeared to occur at lower levels or be lost as caries advanced, including the Streptococcus mitis group, Neisseria, and Streptococcus sanguinis. This may have
Randazzo, Cinzia L; Torriani, Sandra; Akkermans, Antoon D L; de Vos, Willem M; Vaughan, Elaine E
2002-04-01
The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene, respectively. DGGE profiles from samples taken during cheese production indicated dramatic shifts in the microbial community structure. Cloning and sequencing of rDNA amplicons revealed that mesophilic lactic acid bacteria (LAB), including species of Leuconostoc, Lactococcus lactis, and Macrococcus caseolyticus were dominant in the raw milk, while Streptococcus thermophilus prevailed during lactic fermentation. Other thermophilic LAB, especially Lactobacillus delbrueckii and Lactobacillus fermentum, also flourished during ripening. Comparison of the rRNA-derived patterns obtained by RT-PCR to the rDNA DGGE patterns indicated a substantially different degree of metabolic activity for the microbial groups detected. Identification of cultivated LAB isolates by phenotypic characterization and 16S rDNA analysis indicated a variety of species, reflecting to a large extent the results obtained from the 16S rDNA clone libraries, with the significant exception of the Lactobacillus delbrueckii species, which dominated in the ripening cheese but was not detected by cultivation. The present molecular approaches combined with culture can effectively describe the complex ecosystem of natural fermented dairy products, giving useful information for starter culture design and preservation of artisanal fermented food technology.
Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.
Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam
2018-01-01
Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains < 0.1%. The abundance of some Pseudomonas species in wastewaters containing algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.
Mathur, Rinku; Adlakha, Neeru
2014-06-01
Phylogenetic trees give the information about the vertical relationships of ancestors and descendants but phylogenetic networks are used to visualize the horizontal relationships among the different organisms. In order to predict reticulate events there is a need to construct phylogenetic networks. Here, a Linear Programming (LP) model has been developed for the construction of phylogenetic network. The model is validated by using data sets of chloroplast of 16S rRNA sequences of photosynthetic organisms and Influenza A/H5N1 viruses. Results obtained are in agreement with those obtained by earlier researchers.
Bouvet, Philippe; Ferraris, Laurent; Dauphin, Brunhilde; Popoff, Michel-Robert; Butel, Marie Jose
2014-01-01
In 2002, an outbreak of necrotizing enterocolitis in a Canadian neonatal intensive care unit was associated with a proposed novel species of Clostridium, “Clostridium neonatale.” To date, there are no data about the isolation, identification, or clinical significance of this species. Additionally, C. neonatale has not been formally classified as a new species, rendering its identification challenging. Indeed, the C. neonatale 16S rRNA gene sequence shows high similarity to another Clostridium species involved in neonatal necrotizing enterocolitis, Clostridium butyricum. By performing a polyphasic study combining phylogenetic analysis (16S rRNA gene sequencing and multilocus sequence analysis) and phenotypic characterization with mass spectrometry, we demonstrated that C. neonatale is a new species within the Clostridium genus sensu stricto, for which we propose the name Clostridium neonatale sp. nov. Now that the status of C. neonatale has been clarified, matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) can be used for better differential identification of C. neonatale and C. butyricum clinical isolates. This is necessary to precisely define the role and clinical significance of C. neonatale, a species that may have been misidentified and underrepresented during previous neonatal necrotizing enterocolitis studies. PMID:25232167
Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.
Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M
2015-01-01
Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by
Avershina, Ekaterina; Angell, Inga Leena; Simpson, Melanie; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut
2018-05-01
The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types ( Bifidobacterium longum and Enterococcus faecalis ). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis . We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation.
Angell, Inga Leena; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut
2018-01-01
The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types (Bifidobacterium longum and Enterococcus faecalis). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis. We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation. PMID:29724017
Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons
Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.
2017-01-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516
Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción
2018-01-01
Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.
Tremblay, Julien
2018-01-22
Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien
2012-06-01
Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.
Ravi, Anuradha; Avershina, Ekaterina; Angell, Inga Leena; Ludvigsen, Jane; Manohar, Prasanth; Padmanaban, Sumathi; Nachimuthu, Ramesh; Snipen, Lars; Rudi, Knut
2018-06-01
Use of the 16S rRNA gene in microbiota studies is limited by the lack of taxonomic and functional resolution. High resolution analyses are particularly important for understanding transmission and persistence of bacteria. The aim of our work was therefore to compare a novel reduced metagenome sequencing (RMS) approach with 16S rRNA gene sequencing to determine both the metagenome genetic diversity and the mother-to-child sharing of the microbiota in a cohort of 17 mother-child pairs. We found that although both approaches gave comparable results with respect to sample separation and taxonomy, RMS gave higher resolution and the potential for genomic-/functional assignment. Using RMS we estimated that the metagenome size increased from about 60 Mbp for 4-day-old children to about 225 Mbp for mothers. The 4-day-old children shared 7% of the metagenome sequences with the mothers, while the metagenome sequence sharing was >30% among the mothers. We found 15 genomes shared across >50% of the mothers, of which 10 belonged to Clostridia. Only Bacteroides showed a direct mother-child association, with B. vulgatus being abundant in both 4-day-old children and mothers. For the functional assignments, we identified a significant association between antibiotic usage during labor, and quantity of Fosfomycin resistance genes. In conclusion, our results show a higher functional and taxonomic resolution for RMS compared to 16S rRNA gene sequencing, where RMS enabled a detailed description of mother to child gut microbiota transmission - supporting a late recruitment of most gut bacteria and an effect of antibiotic treatment during labor on infant antibiotic resistance gene patterns. Copyright © 2018. Published by Elsevier B.V.
Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew
2008-08-01
Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Simon, Holly M
2012-04-01
We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the "root" clade, we detected no corresponding amoA gene. The amoA-containing archaea were present in media with either organic or inorganic amendments, whereas archaea representing the root clade were present only when organic amendment was used. Analysis of amoA gene abundance and expression, together with nitrification-coupled growth assays, indicated potential growth by autotrophic ammonia oxidation for members of two group 1.1b clades. Increased abundance of one of these clades, however, also occurred upon the addition of organic amendment. Finally, although amoA-containing group 1.1a archaea were present in enrichments, we detected neither expression of amoA genes nor evidence for nitrification-coupled growth of these organisms. These data support a model of a diverse metabolic community in mesophilic soil archaea that is just beginning to be characterized.
Valiente Moro, Claire; Thioulouse, Jean; Chauve, Claude; Normand, Philippe; Zenner, Lionel
2009-01-01
Dermanyssus gallinae (Arthropoda, Mesostigmata) is suspected to be involved in the transmission of a wide variety of pathogens, but nothing is known about its associated non-pathogenic bacterial community. To address this question, we examined the composition of bacterial communities in D. gallinae collected from standard poultry farms in Brittany, France. Genetic fingerprints of bacterial communities were generated by temporal temperature gradient gel electrophoresis (TTGE) separation of individual polymerase chain reaction (PCR)-amplified 16S rRNA gene fragments, followed by DNA sequence analysis. Most of the sequences belonged to the Proteobacteria and Firmicute phyla, with a majority of sequences corresponding to the Enterobacteriales order and the Staphylococcus genus. By using statistical analysis, we showed differences in biodiversity between poultry farms. We also determined the major phylotypes that compose the characteristic microbiota associated with D. gallinae. Saprophytes, opportunistic pathogens and pathogenic agents such as Pasteurella multocida, Erysipelothrix rhusiopathiae and sequences close to the genus Aerococcus were identified. Endosymbionts such as Schineria sp., Spiroplasma sp. Anistosticta, "Candidatus Cardinium hertigii" and Rickettsiella sp. were also present in the subdominant bacterial community. Identification of potential targets within the symbiont community may be considered in the future as a means of ectoparasite control.
NASA Astrophysics Data System (ADS)
Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.
2008-08-01
Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early
Vierheilig, J.; Savio, D.; Ley, R. E.; Mach, R. L.; Farnleitner, A. H.
2016-01-01
The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multicompartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems. PMID:26606090
The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.
2012-03-26
Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whethermore » Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.« less
Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei
2013-01-01
Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms. PMID:24058905
Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei
2013-01-01
Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.
Stackebrandt, E; Charfreitag, O
1990-01-01
The intra- and intergeneric relationships of the genus Actinomyces were determined by comparing long 16S rRNA sequences, generated by reverse transcriptase. All species formed a phylogenetically coherent cluster in which Actinomyces bovis, A. viscosus, A. naeslundii, A. odontolyticus and A. israelii constituted genetically well defined species. A. israelii DSM 43322 (serotype 2) was not closely related to three other strains of this species (serotype 1) and, as judged from phylogenetic distances, could be accommodated within A. naeslundii, or represent a new species. In contrast to previous findings, members of the genus Actinomyces appear to be related to Bifidobacterium bifidum. Sequence information was used to develop an oligonucleotide probe for the A. israelii serotype 1 strains, which did not react with the serotype 2 strain or with rRNA from strains of eight Actinomyces species.
Perkins, Matthew J; Snesrud, Erik; McGann, Patrick; Duplessis, Christopher A
2017-01-01
We report a case of successful treatment of chronic osteomyelitis (emanating from contaminated soil exposure) caused by Clostridium sphenoides, an organism infrequently identified as a cause of human infection and more saliently osteomyelitis (only 1 reported case in the literature). Additional impetus for reporting this case resides in the insights gained regarding pathogen identification exploiting sophisticated molecular platforms coupled to traditional microbial culture-based methods. The fastidious nature of cultivating anaerobic organisms required initial attempts at 16S rRNA sequencing to identify a Clostridium species (Clostridium celerecrescens). However, on exploiting matrix-assisted laser desorption ionization time of flight (MALDI TOF) technology, C. sphenoides was identified, and confirmed on whole genome sequencing. The discrepancies noted in the varying platforms require vigilance to seek complementary testing for conflicting results. Although highly accurate, the MALDI TOF and 16S rRNA sequencing platforms are not immune to false identification particularly in differentiating closely related organisms. More germane, whole genome sequencing should be entertained when conflicting results are obtained from MALDI TOF and 16S rRNA sequencing. Precise species and/or strain level identification can be clinically relevant as antimicrobial sensitivity profiles may be discrepant between closely related species influencing clinical outcomes. Thus, it is incumbent on us to strive to acquire the correct species characterization when resources allow to dictate optimal treatment. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.
Lee, I M; Bartoszyk, I M; Gundersen-Rindal, D E; Davis, R E
1997-07-01
A phylogenetic analysis by parsimony of 16S rRNA gene sequences (16S rDNA) revealed that species and subspecies of Clavibacter and Rathayibacter form a discrete monophyletic clade, paraphyletic to Corynebacterium species. Within the Clavibacter-Rathayibacter clade, four major phylogenetic groups (subclades) with a total of 10 distinct taxa were recognized: (I) species C. michiganensis; (II) species C. xyli; (III) species R. iranicus and R. tritici; and (IV) species R. rathayi. The first three groups form a monophyletic cluster, paraphyletic to R. rathayi. On the basis of the phylogeny inferred, reclassification of members of Clavibacter-Rathayibacter group is proposed. A system for classification of taxa in Clavibacter and Rathayibacter was developed based on restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S rDNA sequences. The groups delineated on the basis of RFLP patterns of 16S rDNA coincided well with the subclades delineated on the basis of phylogeny. In contrast to previous classification systems, which are based primarily on phenotypic properties and are laborious, the RFLP analyses allow for rapid differentiation among species and subspecies in the two genera.
Lynch, T; Gregson, D; Church, D L
2016-03-01
Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Gregson, D.; Church, D. L.
2016-01-01
Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization–time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. PMID:26739153
CATCh, an Ensemble Classifier for Chimera Detection in 16S rRNA Sequencing Studies
Mysara, Mohamed; Saeys, Yvan; Leys, Natalie; Raes, Jeroen
2014-01-01
In ecological studies, microbial diversity is nowadays mostly assessed via the detection of phylogenetic marker genes, such as 16S rRNA. However, PCR amplification of these marker genes produces a significant amount of artificial sequences, often referred to as chimeras. Different algorithms have been developed to remove these chimeras, but efforts to combine different methodologies are limited. Therefore, two machine learning classifiers (reference-based and de novo CATCh) were developed by integrating the output of existing chimera detection tools into a new, more powerful method. When comparing our classifiers with existing tools in either the reference-based or de novo mode, a higher performance of our ensemble method was observed on a wide range of sequencing data, including simulated, 454 pyrosequencing, and Illumina MiSeq data sets. Since our algorithm combines the advantages of different individual chimera detection tools, our approach produces more robust results when challenged with chimeric sequences having a low parent divergence, short length of the chimeric range, and various numbers of parents. Additionally, it could be shown that integrating CATCh in the preprocessing pipeline has a beneficial effect on the quality of the clustering in operational taxonomic units. PMID:25527546
Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander
2010-04-01
Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.
Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F
2007-03-01
In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.
Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.
1999-01-01
The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338
Ortiz-Martínez, Sebastían; Silva, Andrea X.; Lavandero, Blas
2018-01-01
Bacterial endosymbionts that produce important phenotypic effects on their hosts are common among plant sap-sucking insects. Aphids have become a model system of insect-symbiont interactions. However, endosymbiont research has focused on a few aphid species, making it necessary to make greater efforts to other aphid species through different regions, in order to have a better understanding of the role of endosymbionts in aphids as a group. Aphid endosymbionts have frequently been studied by PCR-based techniques, using species-specific primers, nevertheless this approach may omit other non-target bacteria cohabiting a particular host species. Advances in high-throughput sequencing technologies are complementing our knowledge of microbial communities by allowing us the study of whole microbiome of different organisms. We used a 16S rRNA amplicon sequencing approach to study the microbiome of aphids in order to describe the bacterial community diversity in introduced populations of the cereal aphids, Sitobion avenae and Rhopalosiphum padi in Chile (South America). An absence of secondary endosymbionts and two common secondary endosymbionts of aphids were found in the aphids R. padi and S. avenae, respectively. Of those endosymbionts, Regiella insecticola was the dominant secondary endosymbiont among the aphid samples. In addition, the presence of a previously unidentified bacterial species closely related to a phytopathogenic Pseudomonad species was detected. We discuss these results in relation to the bacterial endosymbiont diversity found in other regions of the native and introduced range of S. avenae and R. padi. A similar endosymbiont diversity has been reported for both aphid species in their native range. However, variation in the secondary endosymbiont infection could be observed among the introduced and native populations of the aphid S. avenae, indicating that aphid-endosymbiont associations can vary across the geographic range of an aphid species. In
Mieszkin, Sophie; Furet, Jean-Pierre; Corthier, Gérard; Gourmelon, Michèle
2009-01-01
The microbiological quality of coastal or river water can be affected by fecal contamination from human or animal sources. To discriminate pig fecal pollution from other pollution, a library-independent microbial source tracking method targeting Bacteroidales host-specific 16S rRNA gene markers by real-time PCR was designed. Two pig-specific Bacteroidales markers (Pig-1-Bac and Pig-2-Bac) were designed using 16S rRNA gene Bacteroidales clone libraries from pig feces and slurry. For these two pig markers, 98 to 100% sensitivity and 100% specificity were obtained when tested by TaqMan real-time PCR. A decrease in the concentrations of Pig-1-Bac and Pig-2-Bac markers was observed throughout the slurry treatment chain. The two newly designed pig-specific Bacteroidales markers, plus the human-specific (HF183) and ruminant-specific (BacR) Bacteroidales markers, were then applied to river water samples (n = 24) representing 14 different sites from the French Daoulas River catchment (Brittany, France). Pig-1-Bac and Pig-2-Bac were quantified in 25% and 62.5%, respectively, of samples collected around pig farms, with concentrations ranging from 3.6 to 4.1 log10 copies per 100 ml of water. They were detected in water samples collected downstream from pig farms but never detected near cattle farms. HF183 was quantified in 90% of water samples collected downstream near Daoulas town, with concentrations ranging between 3.6 and 4.4 log10 copies per 100 ml of water, and BacR in all water samples collected around cattle farms, with concentrations ranging between 4.6 and 6.0 log10 copies per 100 ml of water. The results of this study highlight that pig fecal contamination was not as frequent as human or bovine fecal contamination and that fecal pollution generally came from multiple origins. The two pig-specific Bacteroidales markers can be applied to environmental water samples to detect pig fecal pollution. PMID:19329663
Har, Jia Y; Helbig, Tim; Lim, Ju H; Fernando, Samodha C; Reitzel, Adam M; Penn, Kevin; Thompson, Janelle R
2015-01-01
We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N
Har, Jia Y.; Helbig, Tim; Lim, Ju H.; Fernando, Samodha C.; Reitzel, Adam M.; Penn, Kevin; Thompson, Janelle R.
2015-01-01
We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N
Scholz, Christian F. P.; Poulsen, Knud
2012-01-01
The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered specific for S. pneumoniae hamper the exact identification of S. pneumoniae. Based on sequence analysis of 16S rRNA genes of a collection of 634 streptococcal strains, identified by multilocus sequence analysis, we detected a cytosine at position 203 present in all 440 strains of S. pneumoniae but replaced by an adenosine residue in all strains representing other species of mitis group streptococci. The S. pneumoniae-specific sequence signature could be demonstrated by sequence analysis or indirectly by restriction endonuclease digestion of a PCR amplicon covering the site. The S. pneumoniae-specific signature offers an inexpensive means for validation of the identity of clinical isolates and should be used as an integrated marker in the annotation procedure employed in 16S rRNA-based molecular studies of complex human microbiotas. This may avoid frequent misidentifications such as those we demonstrate to have occurred in previous reports and in reference sequence databases. PMID:22442329
Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang
2015-10-01
The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.
Bowman, Jeff S.; Piehler, Michael
2017-01-01
The eastern oyster (Crassostrea virginica) is a foundation species providing significant ecosystem services. However, the roles of oyster microbiomes have not been integrated into any of the services, particularly nitrogen removal through denitrification. We investigated the composition and denitrification potential of oyster microbiomes with an approach that combined 16S rRNA gene analysis, metabolic inference, qPCR of the nitrous oxide reductase gene (nosZ), and N2 flux measurements. Microbiomes of the oyster digestive gland, the oyster shell, and sediments adjacent to the oyster reef were examined based on next generation sequencing (NGS) of 16S rRNA gene amplicons. Denitrification potentials of the microbiomes were determined by metabolic inferences using a customized denitrification gene and genome database with the paprica (PAthway PRediction by phylogenetIC plAcement) bioinformatics pipeline. Denitrification genes examined included nitrite reductase (nirS and nirK) and nitrous oxide reductase (nosZ), which was further subdivided by genotype into clade I (nosZI) or clade II (nosZII). Continuous flow through experiments measuring N2 fluxes were conducted with the oysters, shells, and sediments to compare denitrification activities. Paprica properly classified the composition of microbiomes, showing similar classification results from Silva, Greengenes and RDP databases. Microbiomes of the oyster digestive glands and shells were quite different from each other and from the sediments. The relative abundance of denitrifying bacteria inferred by paprica was higher in oysters and shells than in sediments suggesting that oysters act as hotspots for denitrification in the marine environment. Similarly, the inferred nosZI gene abundances were also higher in the oyster and shell microbiomes than in the sediment microbiome. Gene abundances for nosZI were verified with qPCR of nosZI genes, which showed a significant positive correlation (F1,7 = 14.7, p = 6.0x10-3, R2 = 0
Arfken, Ann; Song, Bongkeun; Bowman, Jeff S; Piehler, Michael
2017-01-01
The eastern oyster (Crassostrea virginica) is a foundation species providing significant ecosystem services. However, the roles of oyster microbiomes have not been integrated into any of the services, particularly nitrogen removal through denitrification. We investigated the composition and denitrification potential of oyster microbiomes with an approach that combined 16S rRNA gene analysis, metabolic inference, qPCR of the nitrous oxide reductase gene (nosZ), and N2 flux measurements. Microbiomes of the oyster digestive gland, the oyster shell, and sediments adjacent to the oyster reef were examined based on next generation sequencing (NGS) of 16S rRNA gene amplicons. Denitrification potentials of the microbiomes were determined by metabolic inferences using a customized denitrification gene and genome database with the paprica (PAthway PRediction by phylogenetIC plAcement) bioinformatics pipeline. Denitrification genes examined included nitrite reductase (nirS and nirK) and nitrous oxide reductase (nosZ), which was further subdivided by genotype into clade I (nosZI) or clade II (nosZII). Continuous flow through experiments measuring N2 fluxes were conducted with the oysters, shells, and sediments to compare denitrification activities. Paprica properly classified the composition of microbiomes, showing similar classification results from Silva, Greengenes and RDP databases. Microbiomes of the oyster digestive glands and shells were quite different from each other and from the sediments. The relative abundance of denitrifying bacteria inferred by paprica was higher in oysters and shells than in sediments suggesting that oysters act as hotspots for denitrification in the marine environment. Similarly, the inferred nosZI gene abundances were also higher in the oyster and shell microbiomes than in the sediment microbiome. Gene abundances for nosZI were verified with qPCR of nosZI genes, which showed a significant positive correlation (F1,7 = 14.7, p = 6.0x10-3, R2 = 0
Bacterial DNA detected on pathologically changed heart valves using 16S rRNA gene amplification.
Chalupova, Miroslava; Skalova, Anna; Hajek, Tomas; Geigerova, Lenka; Kralova, Dana; Liska, Pavel; Hecova, Hana; Molacek, Jiri; Hrabak, Jaroslav
2018-05-22
Nowadays, dental diseases are one of the most common illnesses in the world. Some of them can lead to translocation of oral bacteria to the bloodstream causing intermittent bacteraemia. Therefore, a potential association between oral infection and cardiovascular diseases has been discussed in recent years as a result of adhesion of oral microbes to the heart valves. The aim of this study was to detect oral bacteria on pathologically changed heart valves not caused by infective endocarditis. In the study, patients with pathologically changed heart valves were involved. Samples of heart valves removed during heart valve replacement surgery were cut into two parts. One aliquot was cultivated aerobically and anaerobically. Bacterial DNA was extracted using Ultra-Deep Microbiome Prep (Molzym GmbH, Bremen, Germany) followed by a 16S rRNA gene PCR amplification using Mastermix 16S Complete kit (Molzym GmbH, Bremen, Germany). Positive PCR products were sequenced and the sequences were analyzed using BLAST database ( http://www.ncbi.nlm.nih/BLAST ). During the study period, 41 samples were processed. Bacterial DNA of the following bacteria was detected in 21 samples: Cutibacterium acnes (formerly Propionibacterium acnes) (n = 11; 52.38% of patients with positive bacterial DNA detection), Staphylococcus sp. (n = 9; 42.86%), Streptococcus sp. (n = 1; 4.76%), Streptococcus sanguinis (n = 4; 19.05%), Streptococcus oralis (n = 1; 4.76%), Carnobacterium sp. (n = 1; 4.76%), Bacillus sp. (n = 2; 9.52%), and Bergeyella sp. (n = 1; 4.76%). In nine samples, multiple bacteria were found. Our results showed significant appearance of bacteria on pathologically changed heart valves in patients with no symptoms of infective endocarditis.
Vacek, A T; Bourque, D P
1980-09-01
Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.
Lenehan, Claire E; Tobe, Shanan S; Smith, Renee J; Popelka-Filcoff, Rachel S
2017-01-01
Many archaeological science studies use the concept of "provenance", where the origins of cultural material can be determined through physical or chemical properties that relate back to the origins of the material. Recent studies using DNA profiling of bacteria have been used for the forensic determination of soils, towards determination of geographic origin. This manuscript presents a novel approach to the provenance of archaeological minerals and related materials through the use of 16S rRNA sequencing analysis of microbial DNA. Through the microbial DNA characterization from ochre and multivariate statistics, we have demonstrated the clear discrimination between four distinct Australian cultural ochre sites.
Duthoit, Frédérique; Godon, Jean-Jacques; Montel, Marie-Christine
2003-01-01
Microbial dynamics during processing and ripening of traditional cheeses such as registered designation of origin Salers cheese, an artisanal cheese produced in France, play an important role in the elaboration of sensory qualities. The aim of the present study was to obtain a picture of the dynamics of the microbial ecosystem of RDO Salers cheese by using culture-independent methods. This included DNA extraction, PCR, and single-strand conformation polymorphism (SSCP) analysis. Bacterial and high-GC% gram-positive bacterial primers were used to amplify V2 or V3 regions of the 16S rRNA gene. SSCP patterns revealed changes during the manufacturing of the cheese. Patterns of the ecosystems of cheeses that were provided by three farmers were also quite different. Cloning and sequencing of the 16S rRNA gene revealed sequences related to lactic acid bacteria (Lactococcus lactis, Streptococcus thermophilus, Enterococcus faecium, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Lactobacillus plantarum, and Lactobacillus pentosus), which were predominant during manufacturing and ripening. Bacteria belonging to the high-GC% gram-positive group (essentially corynebacteria) were found by using specific primers. The present molecular approach can effectively describe the ecosystem of artisanal dairy products. PMID:12839752
Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W
1995-04-01
Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.
Chakravorty, S; Sarkar, S; Gachhui, R
2015-01-01
The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.
Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko
2018-01-01
Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.
Youssef, Noha; Sheik, Cody S.; Krumholz, Lee R.; Najar, Fares Z.; Roe, Bruce A.; Elshahed, Mostafa S.
2009-01-01
Pyrosequencing-based 16S rRNA gene surveys are increasingly utilized to study highly diverse bacterial communities, with special emphasis on utilizing the large number of sequences obtained (tens to hundreds of thousands) for species richness estimation. However, it is not yet clear how the number of operational taxonomic units (OTUs) and, hence, species richness estimates determined using shorter fragments at different taxonomic cutoffs correlates with the number of OTUs assigned using longer, nearly complete 16S rRNA gene fragments. We constructed a 16S rRNA clone library from an undisturbed tallgrass prairie soil (1,132 clones) and used it to compare species richness estimates obtained using eight pyrosequencing candidate fragments (99 to 361 bp in length) and the nearly full-length fragment. Fragments encompassing the V1 and V2 (V1+V2) region and the V6 region (generated using primer pairs 8F-338R and 967F-1046R) overestimated species richness; fragments encompassing the V3, V7, and V7+V8 hypervariable regions (generated using primer pairs 338F-530R, 1046F-1220R, and 1046F-1392R) underestimated species richness; and fragments encompassing the V4, V5+V6, and V6+V7 regions (generated using primer pairs 530F-805R, 805F-1046R, and 967F-1220R) provided estimates comparable to those obtained with the nearly full-length fragment. These patterns were observed regardless of the alignment method utilized or the parameter used to gauge comparative levels of species richness (number of OTUs observed, slope of scatter plots of pairwise distance values for short and nearly complete fragments, and nonparametric and parametric species richness estimates). Similar results were obtained when analyzing three other datasets derived from soil, adult Zebrafish gut, and basaltic formations in the East Pacific Rise. Regression analysis indicated that these observed discrepancies in species richness estimates within various regions could readily be explained by the proportions of
Marques, Lívia Érika Carlos; Frota, Cristiane Cunha; Quetz, Josiane da Silva; Bindá, Alexandre Havt; Mota, Rosa Maria Salane; Pontes, Maria Araci de Andrade; Gonçalves, Heitor de Sá; Kendall, Carl; Kerr, Ligia Regina Franco Sansigolo
2017-12-26
Mycobacterium leprae bacilli are mainly transmitted by the dissemination of nasal aerosols from multibacillary (MB) patients to susceptible individuals through inhalation. The upper respiratory tract represents the main entry and exit routes of M. leprae. Therefore, this study aimed to evaluate the sensitivity and specificity of real-time quantitative polymerase chain reaction (qPCR) in detecting M. leprae in nasal secretion (NS) and skin biopsy (SB) samples from MB and paucibacillary (PB) cases. Fifty-four NS samples were obtained from leprosy patients at the Dona Libânia National Reference Centre for Sanitary Dermatology in Ceará, Brazil. Among them, 19 MB cases provided both NS and SB samples. Bacilloscopy index assays were conducted and qPCR amplification was performed using specific primers for M. leprae 16S rRNA gene, generating a 124-bp fragment. Primer specificity was verified by determining the amplicon melting temperature (T m = 79.5 °C) and detection limit of qPCR was 20 fg of M. leprae DNA. Results were positive for 89.7 and 73.3% of NS samples from MB and PB cases, respectively. SB samples from MB patients were 100% positive. The number of bacilli detected in NS samples were 1.39 × 10 3 -8.02 × 10 5 , and in SB samples from MB patients were 1.87 × 10 3 -1.50 × 10 6 . Therefore, qPCR assays using SYBR Green targeting M. leprae 16S rRNA region can be employed in detecting M. leprae in nasal swabs from leprosy patients, validating this method for epidemiological studies aiming to identify healthy carriers among household contacts or within populations of an endemic area.
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
NASA Technical Reports Server (NTRS)
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
Pron, B; Poyart, C; Abachin, E; Fest, T; Belanger, C; Bonnet, C; Capelle, P; Bretagne, J F; Fabianek, A; Girard, L; Hagège, H; Berche, P
1999-01-01
Amplification of the 16S rRNA gene of Tropheryma whippelii was performed in eight patients with Whipple's disease and 34 control patients to confirm a diagnosis of Whipple's disease and to monitor the course of disease. Polymerase chain reaction (PCR) tests were positive before treatment in 13 of 15 tissue samples from Whipple's disease patients (gut 8/8; lymph nodes 2/2; bone marrow 1/2; peripheral blood 2/3), in contrast to none of 54 tissue samples from controls. PCR tests converted to negative within 4-6 months in six of the Whipple's disease patients undergoing therapy. These results show that PCR is a reliable and useful tool for diagnosis of Whipple's disease and for monitoring bacterial elimination during antibiotic therapy.
16S rRNA Gene Survey of Microbial Communities in Winogradsky Columns
Rundell, Ethan A.; Banta, Lois M.; Ward, Doyle V.; Watts, Corey D.; Birren, Bruce; Esteban, David J.
2014-01-01
A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities. PMID:25101630
Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.
2001-01-01
The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645
The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...
Pettengill, James B; Rand, Hugh
2017-01-01
Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP) represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella , we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria , respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb). These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species), but it was surprising how often methods differ in classifying reads-even at higher taxonomic ranks (e.g., family). This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal's Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype).
Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H
1996-01-01
Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607
Chandok, Harshpreet; Shah, Pratik; Akare, Uday Raj; Hindala, Maliram; Bhadoriya, Sneha Singh; Ravi, G V; Sharma, Varsha; Bandaru, Srinivas; Rathore, Pragya; Nayarisseri, Anuraj
2015-09-01
16S rDNA sequencing which has gained wide popularity amongst microbiologists for the molecular characterization and identification of newly discovered isolates provides accurate identification of isolates down to the level of sub-species (strain). Its most important advantage over the traditional biochemical characterization methods is that it can provide an accurate identification of strains with atypical phenotypic characters as well. The following work is an application of 16S rRNA gene sequencing approach to identify a novel species of Probiotic Lactobacillus acidophilus. The sample was collected from pond water samples of rural and urban areas of Krishna district, Vijayawada, Andhra Pradesh, India. Subsequently, the sample was serially diluted and the aliquots were incubated for a suitable time period following which the suspected colony was subjected to 16S rDNA sequencing. The sequence aligned against other species was concluded to be a novel, Probiotic L. acidophilus bacteria, further which were named L. acidophilus strain EMBS081 & EMBS082. After the sequence characterization, the isolate was deposited in GenBank Database, maintained by the National Centre for Biotechnology Information NCBI. The sequence can also be retrieve from EMBL and DDBJ repositories with accession numbers JX255677 and KC150145.
Duan, Shan; Hu, Xiaoxi; Li, Mengru; Miao, Jianyin; Du, Jinghe; Wu, Rongli
2016-03-30
The bacterial community and the metabolic activities involved at the flavor-forming stage during the fermentation of shrimp sauce were investigated using metatranscriptome and 16S rRNA gene sequencings. Results showed that the abundance of Tetragenococcus was 95.1%. Tetragenococcus halophilus was identified in 520 of 588 transcripts annotated in the Nr database. Activation of the citrate cycle and oxidative phosphorylation, along with the absence of lactate dehydrogenase gene expression, in T. halophilus suggests that T. halophilus probably underwent aerobic metabolism during shrimp sauce fermentation. The metabolism of amino acids, production of peptidase, and degradation of limonene and pinene were very active in T. halophilus. Carnobacterium, Pseudomonas, Escherichia, Staphylococcus, Bacillus, and Clostridium were also metabolically active, although present in very small populations. Enterococcus, Abiotrophia, Streptococcus, and Lactobacillus were detected in metatranscriptome sequencing, but not in 16S rRNA gene sequencing. Many minor taxa showed no gene expression, suggesting that they were in dormant status.
Wei, Yulong; Silke, Jordan R; Xia, Xuhua
2017-12-15
Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.
Ayeni, Funmilola A; Andersen, Camilla; Nørskov-Lauritsen, Niels
2017-04-01
Mannitol salt agar (MSA) is often used in resources' limited laboratories for identification of S. aureus however, coagulase-negative staphylococci (CoNS) grows and ferments mannitol on MSA. 171 strains of CoNS which have been previously misidentified as S. aureus due to growth on MSA were collected from different locations in Nigeria and two methods for identification of CoNS were compared i.e. ViTEK 2 and MALDI-TOF MS with partial 16S rRNA gene sequencing as gold standard. Partial tuf gene sequencing was used for contradicting identification. All 171 strains (13 species) grew on MSA and ferments mannitol. All tested strains of S. epidermidis, S. haemolyticus, S. nepalensis, S. pasteuri, S. sciuri,, S. warneri, S. xylosus, S. capitis were correctly identified by MALDI-TOF while variable identification were observed in S. saprophyticus and S. cohnii (90%, 81%). There was low identification of S. arlettae (14%) while all strains of S. kloosii and S. gallinarum were misidentified. There is absence of S. gallinarum in the MALDI-TOF database at the period of this study. All tested strains of S. epidermidis, S. gallinarum, S. haemolyticus, S. sciuri,, S. warneri, S. xylosus and S. capitis were correctly identified by ViTEK while variable identification were observed in S. saprophyticus, S. arlettae, S. cohnii, S. kloosii, (84%, 86%, 75%, 60%) and misidentification of S. nepalensis, S. pasteuri. Partial sequencing of 16S rRNA gene was used as gold standard for most strains except S. capitis and S. xylosus where the two species were misidentified by partial sequencing of 16S rRNA contrary to MALDI-TOF and ViTEK identification. Tuf gene sequencing was used for correct identification. Characteristic growth on MSA for CoNS is also identical to S. aureus growth on the media and therefore, MSA could not differentiate between S. aureus and CoNS. The percentage accuracy of ViTEK was better than MALDI-TOF in identification of CoNS. Although partial sequencing of
Chen, Jing; Zhou, Zhichao; Gu, Ji-Dong
2015-02-01
In the present work, both 16S rRNA and pmoA gene-based PCR primers were employed successfully to study the diversity and distribution of n-damo bacteria in the surface and lower layer sediments at the coastal Mai Po wetland. The occurrence of n-damo bacteria in both the surface and subsurface sediments with high diversity was confirmed in this study. Unlike the two other known n-damo communities from coastal areas, the pmoA gene-amplified sequences in the present work clustered not only with some freshwater subclusters but also within three newly erected marine subclusters mostly, indicating the unique niche specificity of n-damo bacteria in this wetland. Results suggested vegetation affected the distribution and community structures of n-damo bacteria in the sediments and n-damo could coexist with sulfate-reducing methanotrophs in the coastal ecosystem. Community structures of the Mai Po n-damo bacteria based on 16S rRNA gene were different from those of either the freshwater or the marine. In contrast, structures of the Mai Po n-damo communities based on pmoA gene grouped with the marine ones and were clearly distinguished from the freshwater ones. The abundance of n-damo bacteria at this wetland was quantified using 16S rRNA gene PCR primers to be 2.65-6.71 × 10(5) copies/g dry sediment. Ammonium and nitrite strongly affected the community structures and distribution of n-damo bacteria in the coastal Mai Po wetland sediments.
DECIPHER, a Search-Based Approach to Chimera Identification for 16S rRNA Sequences
Wright, Erik S.; Yilmaz, L. Safak
2012-01-01
DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu). PMID:22101057
Piao, Hailan; Lachman, Medora; Malfatti, Stephanie; Sczyrba, Alexander; Knierim, Bernhard; Auer, Manfred; Tringe, Susannah G; Mackie, Roderick I; Yeoman, Carl J; Hess, Matthias
2014-01-01
The rumen microbial ecosystem is known for its biomass-degrading and methane-producing phenotype. Fermentation of recalcitrant plant material, comprised of a multitude of interwoven fibers, necessitates the synergistic activity of diverse microbial taxonomic groups that inhabit the anaerobic rumen ecosystem. Although interspecies hydrogen (H2) transfer, a process during which bacterially generated H2 is transferred to methanogenic Archaea, has obtained significant attention over the last decades, the temporal variation of the different taxa involved in in situ biomass-degradation, H2 transfer and the methanogenesis process remains to be established. Here we investigated the temporal succession of microbial taxa and its effect on fiber composition during rumen incubation using 16S rRNA amplicon sequencing. Switchgrass filled nylon bags were placed in the rumen of a cannulated cow and collected at nine time points for DNA extraction and 16S pyrotag profiling. The microbial community colonizing the air-dried and non-incubated (0 h) switchgrass was dominated by members of the Bacilli (recruiting 63% of the pyrotag reads). During in situ incubation of the switchgrass, two major shifts in the community composition were observed: Bacilli were replaced within 30 min by members belonging to the Bacteroidia and Clostridia, which recruited 34 and 25% of the 16S rRNA reads generated, respectively. A second significant shift was observed after 16 h of rumen incubation, when members of the Spirochaetes and Fibrobacteria classes became more abundant in the fiber-adherent community. During the first 30 min of rumen incubation ~13% of the switchgrass dry matter was degraded, whereas little biomass degradation appeared to have occurred between 30 min and 4 h after the switchgrass was placed in the rumen. Interestingly, methanogenic members of the Euryarchaeota (i.e., Methanobacteria) increased up to 3-fold during this period of reduced biomass-degradation, with peak abundance just
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
Role of conserved nucleotides in building the 16S rRNA binding site of E. coli ribosomal protein S8.
Allmang, C; Mougel, M; Westhof, E; Ehresmann, B; Ehresmann, C
1994-01-01
Ribosomal protein S8 specifically recognizes a helical and irregular region of 16S rRNA that is highly evolutionary constrained. Despite its restricted size, the precise conformation of this region remains a question of debate. Here, we used chemical probing to analyze the structural consequences of mutations in this RNA region. These data, combined with computer modelling and previously published data on protein binding were used to investigate the conformation of the RNA binding site. The experimental data confirm the model in which adenines A595, A640 and A642 bulge out in the deep groove. In addition to the already proposed non canonical U598-U641 interaction, the structure is stabilized by stacking interactions (between A595 and A640) and an array of hydrogen bonds involving bases and the sugar phosphate backbone. Mutations that alter the ability to form these interdependent interactions result in a local destabilization or reorganization. The specificity of recognition by protein S8 is provided by the irregular and distorted backbone and the two bulged adenines 640 and 642 in the deep groove. The third adenine (A595) is not a direct recognition site but must adopt a bulged position. The U598-U641 pair should not be directly in contact with the protein. Images PMID:7937081
2010-01-01
Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957
Shahinas, Dea; Silverman, Michael; Sittler, Taylor; Chiu, Charles; Kim, Peter; Allen-Vercoe, Emma; Weese, Scott; Wong, Andrew; Low, Donald E.; Pillai, Dylan R.
2012-01-01
ABSTRACT Fecal microbiome transplantation by low-volume enema is an effective, safe, and inexpensive alternative to antibiotic therapy for patients with chronic relapsing Clostridium difficile infection (CDI). We explored the microbial diversity of pre- and posttransplant stool specimens from CDI patients (n = 6) using deep sequencing of the 16S rRNA gene. While interindividual variability in microbiota change occurs with fecal transplantation and vancomycin exposure, in this pilot study we note that clinical cure of CDI is associated with an increase in diversity and richness. Genus- and species-level analysis may reveal a cocktail of microorganisms or products thereof that will ultimately be used as a probiotic to treat CDI. PMID:23093385
Ciganda, Martin; Williams, Noreen
2012-01-01
The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
Machado de Oliveira, J C; Siqueira, J F; Alves, G B; Hirata, R; Andrade, A F
2000-12-01
Porphyromonas endodontalis has been isolated from the endodontic infections mainly in symptomatic teeth. This study evaluated the occurrence of P. endodontalis in both symptomatic and asymptomatic endodontic infections using 16S rRNA gene-directed polymerase chain reaction. P. endodontalis was detected in 39.5% of the cases (17 of 43 teeth). It was present in 4 of the 6 cases with acute periradicular abscess (66.7%) and in 13 of the 37 other cases (35.1%). The presence of P. endodontalis was associated with an asymptomatic periradicular lesion in 6 cases (25%) and in 10 teeth with tenderness to percussion (52.6%). P. endodontalis was also found in one asymptomatic case without evidence of periradicular pathosis. Our results indicated that, although P. endodontalis is commonly detected in symptomatic cases, it can be present in asymptomatic root canal infections. Further studies should determine if this bacterial species is really an important endodontopathogen.
Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae
Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.
2001-01-01
rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264
None
2014-12-01
The recent development of methods applying next-generation sequencing to microbial community characterization has led to the proliferation of these studies in a wide variety of sample types. Yet, variation in the physical properties of environmental samples demands that optimal DNA extraction techniques be explored for each new environment. The microbiota associated with many species of insects offer an extraction challenge as they are frequently surrounded by an armored exoskeleton, inhibiting disruption of the tissues within. In this study, we examine the efficacy of several commonly used protocols for extracting bacterial DNA from ants. While bacterial community composition recovered using Illuminamore » 16S rRNA amplicon sequencing was not detectably biased by any method, the quantity of bacterial DNA varied drastically, reducing the number of samples that could be amplified and sequenced. These results indicate that the concentration necessary for dependable sequencing is around 10,000 copies of target DNA per microliter. Exoskeletal pulverization and tissue digestion increased the reliability of extractions, suggesting that these steps should be included in any study of insect-associated microorganisms that relies on obtaining microbial DNA from intact body segments. Although laboratory and analysis techniques should be standardized across diverse sample types as much as possible, minimal modifications such as these will increase the number of environments in which bacterial communities can be successfully studied.« less
Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Dickinson, Matthew
2009-01-01
Primers and probes based on the 23S rRNA gene have been utilized to design a range of real-time PCR assays for routine phytoplasma diagnostics. These assays have been authenticated as phytoplasma specific and shown to be at least as sensitive as nested PCR. A universal assay to detect all phytoplasmas has been developed, along with a multiplex assay to discriminate 16SrI group phytoplasmas from members of all of the other 16Sr groups. Assays for the 16SrII, 16SrIV, and 16SrXII groups have also been developed to confirm that the 23S rRNA gene can be used to design group-specific assays. PMID:19270148
How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?
Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T
2018-03-15
The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA
Kramna, Lenka; Oikarinen, Sami; Sipilä, Markku; Rautiainen, Markus; Aittoniemi, Janne; Laranne, Jussi; Hyöty, Heikki; Cinek, Ondrej
2017-01-01
ABSTRACT The aim of the study was to analyze the bacteriome of acute otitis media with a novel modification of next-generation sequencing techniques. Outpatient children with acute otitis media were enrolled in the study, and middle ear fluids were collected during 90 episodes from 79 subjects aged 5 to 42 months (median age, 19 months). The bacteriome profiles of middle ear fluid samples were determined by a nested-PCR amplification of the 16S rRNA gene (V4 region), followed by mass sequencing. The profiling results were compared to the results of specific PCR assays targeting selected prevalent pathogens. Bacteriome profiling using nested amplification of low-volume samples was aided by a bioinformatic subtraction of signal contaminants from the recombinant polymerase, achieving a sensitivity slightly lower than that of specific PCR detection. Streptococcus pneumoniae was detected in 28 (31%) samples, Haemophilus influenzae in 24 (27%), Moraxella catarrhalis in 18 (20%), Staphylococcus spp. in 21 (23%), Turicella otitidis in 5 (5.6%), Alloiococcus otitidis in 3 (3.3%), and other bacteria in 14 (16%) using bacteriome profiling. S. pneumoniae was the dominant pathogen in 14 (16%) samples, H. influenzae in 15 (17%), M. catarrhalis in 5 (5.6%), T. otitidis in 2, and Staphylococcus auricularis in 2. Weaker signals of Prevotella melaninogenica, Veillonella dispar, and Veillonella montpellierensis were noted in several samples. Fourteen samples (16%) were not explainable by bacterial pathogens; novel causative agents were not detected. In conclusion, unbiased bacteriome profiling helped in depicting the true mutual quantitative ratios of ear bacteria, but at present, its complicated protocol impedes its routine clinical use. IMPORTANCE Although S. pneumoniae, H. influenzae, and M. catarrhalis have been long established as the most important pathogens in acute otitis media using culture and specific PCR assays, the knowledge of their mutual quantitative relations
Janvier, Monique; Regnault, Béatrice; Grimont, Patrick
2003-09-01
Methylotrophic bacteria are widespread in nature. They may play an important role in the cycling of carbon and in the metabolism of dimethylsulfide in a marine environment. Bacteria belonging to the genus Methylophaga are a unique group of aerobic, halophilic, non-methane-utilizing methylotrophs. Two 16S rRNA-targeted oligonucleotide probes were developed for the specific detection of Methylophaga species, marine methylobacteria, by fluorescence in situ hybridization. Probe MPH-730 was highly specific for all members of the genus Methylophaga while probe MPHm-994 targeted exclusively M. marina. The application of these probes were demonstrated by the detection of Methylophaga species in enrichment cultures from various marine sediments. All isolates recovered were visualized by using the genus specific probe MPH-730. The results were confirmed by 16S rDNA sequencing which demonstrated that all selected isolates belong to Methylophaga. Five isolates could be detected by the M. marina-specific probe MPHm-994 and were confirmed by rRNA gene restriction pattern (ribotyping). With the development of these specific probes, fluorescence in situ hybridization shows that the genus Methylophaga is widespread in marine samples.
Fernandes, Telmo J R; Costa, Joana; Oliveira, M Beatriz P P; Mafra, Isabel
2018-04-15
Fish is one of the most common allergenic foods that should be accurately labelled to protect the health of allergic consumers. In this work, two real-time PCR systems based on the EvaGreen dye and a TaqMan probe are proposed and compared. New primers were designed to target the 16S rRNA gene, as a universal maker for fish detection, with fully demonstrated specificity for a wide range of fish species. Both systems showed similar absolute sensitivities, down to 0.01 pg of fish DNA, and adequate real-time PCR performance parameters. The probe system showed higher relative sensitivity and dynamic range (0.0001-50%) than the EvaGreen (0.05-50%). They were both precise, but trueness was compromised at the highest tested level with the EvaGreen assay. Therefore, both systems were successful, although the probe one exhibited the best performance. Its application to verify labelling compliance of foodstuffs suggested a high level of mislabelling and/or fraudulent practices. Copyright © 2017 Elsevier Ltd. All rights reserved.
Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung
2007-01-01
This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845
Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J
1992-01-01
Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving
Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan
2014-05-04
The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.
Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae
Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.
2005-01-01
5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201
Abdul-Redha, Rawaa Jalil; Kemp, Michael; Bangsborg, Jette M; Arpi, Magnus; Christensen, Jens Jørgen
2010-01-01
Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamination of blood cultures. Vitek 2 and partial sequencing of the 16S rRNA gene were applied in order to compare the results of both methods. STRAINS ORIGINATED FROM TWO GROUPS OF PATIENTS: 149 strains from patients with infective endocarditis and 181 strains assessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing results, 251 (76%) were VS strains, 10 (3%) were pyogenic streptococcal strains, 54 (16%) were E. faecalis strains and 15 (5%) strains belonged to a group of miscellaneous catalase-negative, Gram-positive cocci. Among VS strains, respectively, 220 (87,6%) and 31 (12,3%) obtained agreeing and non-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed.Only 67 of 150 strains in the mitis group strains obtained identical species identifications by the two methods. Most VS strains belonging to the groups of salivarius, anginosus, and mutans obtained agreeing species identifications with the two methods, while this only was the case for 13 of the 21 bovis strains. Pyogenic strains (n=10), Enterococcus faecalis strains (n=54) and a miscellaneous group of catalase-negative, Gram-positive cocci (n=15) seemed well identified by both methods, except that disagreements in identifications in the miscellaneous group of strains occurred for 6 of 15 strains.
Fennell, Donna E; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M; Kerkhof, Lee J
2004-02-01
Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate.
Fennell, Donna E.; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M.; Kerkhof, Lee J.
2004-01-01
Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate. PMID:14766602
Yu, Meng; Jia, Hongmei; Zhou, Chao; Yang, Yong; Zhao, Yang; Yang, Maohua; Zou, Zhongmei
2017-05-10
As a prevalent, life-threatening and highly recurrent psychiatric illness, depression is characterized by a wide range of pathological changes; however, its etiology remains incompletely understood. Accumulating evidence supports that gut microbiota affects not only gastrointestinal physiology but also central nervous system (CNS) function and behavior through the microbiota-gut-brain axis. To assess the impact of gut microbiota on fecal metabolic phenotype in depressive conditions, an integrated approach of 16S rRNA gene sequencing combined with ultra high-performance liquid chromatography-mass spectrometry (UHPLC-MS) based metabolomics was performed in chronic variable stress (CVS)-induced depression rat model. Interestingly, depression led to significant gut microbiota changes, at the phylum and genus levels in rats treated with CVS compared to controls. The relative abundances of the bacterial genera Marvinbryantia, Corynebacterium, Psychrobacter, Christensenella, Lactobacillus, Peptostreptococcaceae incertae sedis, Anaerovorax, Clostridiales incertae sedis and Coprococcus were significantly decreased, whereas Candidatus Arthromitus and Oscillibacter were markedly increased in model rats compared with normal controls. Meanwhile, distinct changes in fecal metabolic phenotype of depressive rats were also found, including lower levels of amino acids, and fatty acids, and higher amounts of bile acids, hypoxanthine and stercobilins. Moreover, there were substantial associations of perturbed gut microbiota genera with the altered fecal metabolites, especially compounds involved in the metabolism of tryptophan and bile acids. These results showed that the gut microbiota was altered in association with fecal metabolism in depressive conditions. These findings suggest that the 16S rRNA gene sequencing and LC-MS based metabolomics approach can be further applied to assess pathogenesis of depression. Copyright © 2017 Elsevier B.V. All rights reserved.
Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota
Ellegaard, Kirsten M.; Engel, Philipp
2016-01-01
Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities. PMID:27708630
Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota.
Ellegaard, Kirsten M; Engel, Philipp
2016-01-01
Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities.
Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.
Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane
2018-05-14
The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; Willson, Richard C.; Fox, George E.
2002-01-01
MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.
Deutscher, Ania T; Burke, Catherine M; Darling, Aaron E; Riegler, Markus; Reynolds, Olivia L; Chapman, Toni A
2018-05-05
Gut microbiota affects tephritid (Diptera: Tephritidae) fruit fly development, physiology, behavior, and thus the quality of flies mass-reared for the sterile insect technique (SIT), a target-specific, sustainable, environmentally benign form of pest management. The Queensland fruit fly, Bactrocera tryoni (Tephritidae), is a significant horticultural pest in Australia and can be managed with SIT. Little is known about the impacts that laboratory-adaptation (domestication) and mass-rearing have on the tephritid larval gut microbiome. Read lengths of previous fruit fly next-generation sequencing (NGS) studies have limited the resolution of microbiome studies, and the diversity within populations is often overlooked. In this study, we used a new near full-length (> 1300 nt) 16S rRNA gene amplicon NGS approach to characterize gut bacterial communities of individual B. tryoni larvae from two field populations (developing in peaches) and three domesticated populations (mass- or laboratory-reared on artificial diets). Near full-length 16S rRNA gene sequences were obtained for 56 B. tryoni larvae. OTU clustering at 99% similarity revealed that gut bacterial diversity was low and significantly lower in domesticated larvae. Bacteria commonly associated with fruit (Acetobacteraceae, Enterobacteriaceae, and Leuconostocaceae) were detected in wild larvae, but were largely absent from domesticated larvae. However, Asaia, an acetic acid bacterium not frequently detected within adult tephritid species, was detected in larvae of both wild and domesticated populations (55 out of 56 larval gut samples). Larvae from the same single peach shared a similar gut bacterial profile, whereas larvae from different peaches collected from the same tree had different gut bacterial profiles. Clustering of the Asaia near full-length sequences at 100% similarity showed that the wild flies from different locations had different Asaia strains. Variation in the gut bacterial communities of B
NASA Astrophysics Data System (ADS)
Čanković, Milan; Petrić, Ines; Marguš, Marija; Ciglenečki, Irena
2017-08-01
Highly eutrophic and euxinic seawater system of Rogoznica Lake (Croatia) was used as a study site for investigation of distribution, diversity and abundance of sulfate-reducing bacteria (SRB) during stratified conditions in the summer and winter season, by targeting 6 phylogenetic subgroups of SRB. 16S rRNA gene sequences indicated that community cannot be directly related to cultured SRB species but rather that Rogoznica Lake harbors habitat-specific SRB populations associated to bacteria belonging to δ-Proteobacteria with few Firmicutes and Verrucomicrobium-related populations. Clear spatial-temporal shifts in the SRB community structure were observed. Results implied existence of distinct SRB populations between the water column and sediment, as well as higher diversity of the SRB occupying water layer then the ones found in the sediment. Likewise, seasonal variations in populations were observed. While SRB community was more diverse in the winter compared to the summer season in the water layer, situation was opposite in the sediment. Water layer communities seem to be more susceptible to changes of physico-chemical parameters, while those in the sediment have prorogated response to these changes. Results indicate that SRB diversity is still highly underestimated in natural environments, especially in specific habitats such as Rogoznica Lake. Presented data show a complex SRB diversity and distribution supporting the idea that habitat-specific SRB communities are important part of the anaerobic food chain in degradation of organic matter as well as cycling of sulfur and carbon species in the Lake and similar anoxic environment.
Rasoul-Amini, S; Ghasemi, Y; Morowvat, M H; Ghoshoon, M B; Raee, M J; Mosavi-Azam, S B; Montazeri-Najafabady, N; Nouri, F; Parvizi, R; Negintaji, N; Khoubani, S
2010-01-01
A unicellular cyanobacterium, Synechococcus nidulans (Pringsheim) Komárek, was isolated from paddy-fields and applied in the biotransformation experiment of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The obtained products were chromatographically purified followed by their characterization using spectroscopic methods. 11beta,17beta-dihydroxyandrost-4-en-3-one (2), 11beta-hydroxyandrost-4-en-3,17-dione (3), and androst-4-ene-3,17-dione (4) were the main bioproducts in the hydrocortisone bioconversion. The observed bioreaction characteristics were the side chain degradation of the substrate to prepare compounds (2) and (3) following the 11beta-dehydroxylation for accumulation of the compound (4). Time course study showed the accumulation of the product (2) from the second day of the fermentation and compounds (3) and (4) from the third day. All the metabolites reached their maximum concentration in seven days. Cyanobacterial 16S rRNA gene was also amplified by PCR. Sequences were amplified using the universal prokaryotic primers which amplify a approximately 400-bp region of the 16S rRNA gene. PCR products were sequenced to confirm their authenticity as 16S rRNA gene of cyanobacteria. The result of PCR blasted with other sequenced cyanobacteria in NCBI showed 99% identity to the 16S small subunit rRNA of seven Synechococcus species.
Li, Meiju; Zhou, Mi; Adamowicz, Elizabeth; Basarab, John A; Guan, Le Luo
2012-02-24
Currently, knowledge regarding the ecology and function of bacteria attached to the epithelial tissue of the rumen wall is limited. In this study, the diversity of the bacterial community attached to the rumen epithelial tissue was compared to the rumen content bacterial community using 16S rRNA gene sequencing, PCR-DGGE, and qRT-PCR analysis. Sequence analysis of 2785 randomly selected clones from six 16S rDNA (∼1.4kb) libraries showed that the community structures of three rumen content libraries clustered together and were separated from the rumen tissue libraries. The diversity index of each library revealed that ruminal content bacterial communities (4.12/4.42/4.88) were higher than ruminal tissue communities (2.90/2.73/3.23), based on 97% similarity. The phylum Firmicutes was predominant in the ruminal tissue communities, while the phylum Bacteroidetes was predominant in the ruminal content communities. The phyla Fibrobacteres, Planctomycetes, and Verrucomicrobia were only detected in the ruminal content communities. PCR-DGGE analysis of the bacterial profiles of the rumen content and ruminal epithelial tissue samples from 22 steers further confirmed that there is a distinct bacterial community that inhibits the rumen epithelium. The distinctive epimural bacterial communities suggest that Firmicutes, together with other epithelial-specific species, may have additional functions other than food digestion. Copyright © 2011 Elsevier B.V. All rights reserved.
An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum
NASA Technical Reports Server (NTRS)
Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.
1993-01-01
The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.
Swearingen, Matthew C; DiBartola, Alex C; Dusane, Devendra; Granger, Jeffrey; Stoodley, Paul
2016-10-01
Bacterial biofilms are the main etiological agent of periprosthetic joint infections (PJI); however, it is unclear if biofilms colonize one or multiple components. Because biofilms can colonize a variety of surfaces, we hypothesized that biofilms would be present on all components. 16S ribosomal RNA (rRNA) gene sequencing analysis was used to identify bacteria recovered from individual components and non-absorbable suture material recovered from three PJI total knee revision cases. Bray-Curtis non-metric multidimensional scaling analysis revealed no significant differences in similarity when factoring component, material type, or suture versus non-suture material, but did reveal significant differences in organism profile between patients (P < 0.001) and negative controls (P < 0.001). Confocal microscopy and a novel agar encasement culturing method also confirmed biofilm growth on a subset of components. While 16S sequencing suggested that the microbiology was more complex than revealed by culture contaminating, bacterial DNA generates a risk of false positives. This report highlights that biofilm bacteria may colonize all infected prosthetic components including braided suture material, and provides further evidence that clinical culture can fail to sufficiently identify the full pathogen profile in PJI cases. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Xia, Jing; Fang, Liang-Xing; Cheng, Ke; Xu, Guo-Hao; Wang, Xi-Ran; Liao, Xiao-Ping; Liu, Ya-Hong; Sun, Jian
2017-01-01
We screened 30 Klebsiella pneumoniae isolates from dogs and cats at a single animal hospital in Guangdong Province, China. Among them, 12 K. pneumoniae strains possessed high-level resistance to amikacin and gentamicin and these were screened for 16S rRNA methyltransferase (16S-RMTase) genes. And then the genes positive isolates were detected for ESBLs (extended spectrum β-lactamases) and analyzed by pulsed-field gel electrophoresis, multilocus sequence typing, PCR-based replicon typing and plasmid analysis. The genetic profiles of rmtB were also determined by PCR mapping. The twelve 16S-RMTase gene-positive isolates were rmtB (11/30) and armA (2/30) with one isolate carrying both genes. Extended spectrum β-lactamases genes were represented by blaCTX-M-55 (9/12), blaCTX-M-27 (2/12) and blaCTX-M-14 (1/12). The twelve 16S-RMTase containing strains were grouped into five clonal patterns and ST37 was the most prevalent sequence type. Ten rmtB-bearing plasmids conjugated successfully and all belonged to IncN and IncF (F33:A-:B-) incompatibility groups. Nine of the transconjugants carried a 97 kb plasmid and the other harbored both ∼60 and ∼200 kb plasmids. rmtB and blaCTX-M-55 were present on the same plasmid and indicated the co-transfer of these two genes, with the rmtB gene showing highly relevant relationships with IS26 and Tn3. Our findings suggested a high prevalence of 16S-RMTase genes in K. pneumonia ST37 from dogs and cats. Additional studies are needed to trace the evolutionary path of this type of resistance among the K. pneumonia isolates, and to determine whether they have been transferred to humans. PMID:28446899
rRNA fragmentation induced by a yeast killer toxin.
Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm
2014-02-01
Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.
Recent phylogenetic studies have used DNA as the target molecule for the development of environmental 16S rDNA clone libraries. As DNA may persist in the environment, DNA-based libraries cannot be used to identify metabolically active bacteria in water systems. In this study, a...
Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S
2016-08-01
Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site.
Inoue, Ryo; Ohue-Kitano, Ryuji; Tsukahara, Takamitsu; Tanaka, Masashi; Masuda, Shinya; Inoue, Takayuki; Yamakage, Hajime; Kusakabe, Toru; Hasegawa, Koji; Shimatsu, Akira; Satoh-Asahara, Noriko
2017-11-01
We assessed whether gut microbial functional profiles predicted from 16S rRNA metagenomics differed in Japanese type 2 diabetic patients. A total of 22 Japanese subjects were recruited from our outpatient clinic in an observational study. Fecal samples were obtained from 12 control and 10 type 2 diabetic subjects. 16S rRNA metagenomic data were generated and functional profiles predicted using "Phylogenetic Investigation of Communities by Reconstruction of Unobserved States" software. We measured the parameters of glucose metabolism, gut bacterial taxonomy and functional profile, and examined the associations in a cross-sectional manner. Eleven of 288 "Kyoto Encyclopedia of Genes and Genomes" pathways were significantly enriched in diabetic patients compared with control subjects ( p <0.05, q<0.1). The relative abundance of almost all pathways, including the Insulin signaling pathway and Glycolysis/Gluconeogenesis , showed strong, positive correlations with hemoglobin A 1c (HbA 1c ) and fasting plasma glucose (FPG) levels. Bacterial taxonomic analysis showed that genus Blautia significantly differed between groups and had negative correlations with HbA 1c and FPG levels. Our findings suggest a novel pathophysiological relationship between gut microbial communities and diabetes, further highlighting the significance and utility of combining prediction of functional profiles with ordinal bacterial taxonomic analysis (UMIN Clinical Trails Registry number: UMIN000026592).
Staley, C.; Sadowsky, M. J.; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.
2015-01-01
In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on
Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S
2015-10-01
In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on
Microbial community in persistent apical periodontitis: a 16S rRNA gene clone library analysis.
Zakaria, M N; Takeshita, T; Shibata, Y; Maeda, H; Wada, N; Akamine, A; Yamashita, Y
2015-08-01
To characterize the microbial composition of persistent periapical lesions of root filled teeth using a molecular genetics approach. Apical lesion samples were collected from 12 patients (23-80 years old) who visited the Kyushu University Hospital for apicectomy with persistent periapical lesions associated with root filled teeth. DNA was directly extracted from each sample and the microbial composition was comprehensively analysed using clone library analysis of the 16S rRNA gene. Enterococcus faecalis, Candida albicans and specific fimA genotypes of Porphyromonas gingivalis were confirmed using polymerase chain reaction (PCR) analysis with specific primers. Bacteria were detected in all samples, and the dominant findings were P. gingivalis (19.9%), Fusobacterium nucleatum (11.2%) and Propionibacterium acnes (9%). Bacterial diversity was greater in symptomatic lesions than in asymptomatic ones. In addition, the following bacteria or bacterial combinations were characteristic to symptomatic lesions: Prevotella spp., Treponema spp., Peptostreptococcaceae sp. HOT-113, Olsenella uli, Slackia exigua, Selemonas infelix, P. gingivalis with type IV fimA, and a combination of P. gingivalis, F. nucleatum, and Peptostreptococcaceae sp. HOT-113 and predominance of Streptococcus spp. On the other hand, neither Enterococcus faecalis nor C. albicans were detected in any of the samples. Whilst a diverse bacterial species were observed in the persistent apical lesions, some characteristic patterns of bacterial community were found in the symptomatic lesions. The diverse variation of community indicates that bacterial combinations as a community may cause persistent inflammation in periapical tissues rather than specific bacterial species. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.
16S rRNA analysis of diversity of manure microbial community in dairy farm environment
Miao, Max; Wang, Yi; Settles, Matthew; del Rio, Noelia Silva; Castillo, Alejandro; Souza, Alex; Pereira, Richard
2018-01-01
Dairy farms generate a considerable amount of manure, which is applied in cropland as fertilizer. While the use of manure as fertilizer reduces the application of chemical fertilizers, the main concern with regards to manure application is microbial pollution. Manure is a reservoir of a broad range of microbial populations, including pathogens, which have potential to cause contamination and pose risks to public and animal health. Despite the widespread use of manure fertilizer, the change in microbial diversity of manure under various treatment processes is still not well-understood. We hypothesize that the microbial population of animal waste changes with manure handling used in a farm environment. Consequential microbial risk caused by animal manure may depend on manure handling. In this study, a reconnaissance effort for sampling dairy manure in California Central Valley followed by 16S rRNA analysis of content and diversity was undertaken to understand the microbiome of manure after various handling processes. The microbial community analysis of manure revealed that the population in liquid manure differs from that in solid manure. For instance, the bacteria of genus Sulfuriomonas were unique in liquid samples, while the bacteria of genus Thermos were observed only in solid samples. Bacteria of genus Clostridium were present in both solid and liquid samples. The population among liquid samples was comparable, as was the population among solid samples. These findings suggest that the mode of manure application (i.e., liquid versus solid) could have a potential impact on the microbiome of cropland receiving manure as fertilizers. PMID:29304047
Rudi, Knut; Zimonja, Monika; Kvenshagen, Bente; Rugtveit, Jarle; Midtvedt, Tore; Eggesbø, Merete
2007-01-01
We present a novel approach for comparing 16S rRNA gene clone libraries that is independent of both DNA sequence alignment and definition of bacterial phylogroups. These steps are the major bottlenecks in current microbial comparative analyses. We used direct comparisons of taxon density distributions in an absolute evolutionary coordinate space. The coordinate space was generated by using alignment-independent bilinear multivariate modeling. Statistical analyses for clone library comparisons were based on multivariate analysis of variance, partial least-squares regression, and permutations. Clone libraries from both adult and infant gastrointestinal tract microbial communities were used as biological models. We reanalyzed a library consisting of 11,831 clones covering complete colons from three healthy adults in addition to a smaller 390-clone library from infant feces. We show that it is possible to extract detailed information about microbial community structures using our alignment-independent method. Our density distribution analysis is also very efficient with respect to computer operation time, meeting the future requirements of large-scale screenings to understand the diversity and dynamics of microbial communities. PMID:17337554
Lee, Imchang; Chalita, Mauricio; Ha, Sung-Min; Na, Seong-In; Yoon, Seok-Hwan; Chun, Jongsik
2017-06-01
Thanks to the recent advancement of DNA sequencing technology, the cost and time of prokaryotic genome sequencing have been dramatically decreased. It has repeatedly been reported that genome sequencing using high-throughput next-generation sequencing is prone to contaminations due to its high depth of sequencing coverage. Although a few bioinformatics tools are available to detect potential contaminations, these have inherited limitations as they only use protein-coding genes. Here we introduce a new algorithm, called ContEst16S, to detect potential contaminations using 16S rRNA genes from genome assemblies. We screened 69 745 prokaryotic genomes from the NCBI Assembly Database using ContEst16S and found that 594 were contaminated by bacteria, human and plants. Of the predicted contaminated genomes, 8 % were not predicted by the existing protein-coding gene-based tool, implying that both methods can be complementary in the detection of contaminations. A web-based service of the algorithm is available at www.ezbiocloud.net/tools/contest16s.
Li, X; De Boer, S H
1995-10-01
Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.
Nakagawa, Tatsunori; Ishibashi, Jun-Ichiro; Maruyama, Akihiko; Yamanaka, Toshiro; Morimoto, Yusuke; Kimura, Hiroyuki; Urabe, Tetsuro; Fukui, Manabu
2004-01-01
This study describes the occurrence of unique dissimilatory sulfite reductase (DSR) genes at a depth of 1,380 m from the deep-sea hydrothermal vent field at the Suiyo Seamount, Izu-Bonin Arc, Western Pacific, Japan. The DSR genes were obtained from microbes that grew in a catheter-type in situ growth chamber deployed for 3 days on a vent and from the effluent water of drilled holes at 5°C and natural vent fluids at 7°C. DSR clones SUIYOdsr-A and SUIYOdsr-B were not closely related to cultivated species or environmental clones. Moreover, samples of microbial communities were examined by PCR-denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA gene. The sequence analysis of 16S rRNA gene fragments obtained from the vent catheter after a 3-day incubation revealed the occurrence of bacterial DGGE bands affiliated with the Aquificae and γ- and ɛ-Proteobacteria as well as the occurrence of archaeal phylotypes affiliated with the Thermococcales and of a unique archaeon sequence that clustered with “Nanoarchaeota.” The DGGE bands obtained from drilled holes and natural vent fluids from 7 to 300°C were affiliated with the δ-Proteobacteria, genus Thiomicrospira, and Pelodictyon. The dominant DGGE bands retrieved from the effluent water of casing pipes at 3 and 4°C were closely related to phylotypes obtained from the Arctic Ocean. Our results suggest the presence of microorganisms corresponding to a unique DSR lineage not detected previously from other geothermal environments. PMID:14711668
Nakagawa, Tatsunori; Ishibashi, Jun-Ichiro; Maruyama, Akihiko; Yamanaka, Toshiro; Morimoto, Yusuke; Kimura, Hiroyuki; Urabe, Tetsuro; Fukui, Manabu
2004-01-01
This study describes the occurrence of unique dissimilatory sulfite reductase (DSR) genes at a depth of 1,380 m from the deep-sea hydrothermal vent field at the Suiyo Seamount, Izu-Bonin Arc, Western Pacific, Japan. The DSR genes were obtained from microbes that grew in a catheter-type in situ growth chamber deployed for 3 days on a vent and from the effluent water of drilled holes at 5 degrees C and natural vent fluids at 7 degrees C. DSR clones SUIYOdsr-A and SUIYOdsr-B were not closely related to cultivated species or environmental clones. Moreover, samples of microbial communities were examined by PCR-denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA gene. The sequence analysis of 16S rRNA gene fragments obtained from the vent catheter after a 3-day incubation revealed the occurrence of bacterial DGGE bands affiliated with the Aquificae and gamma- and epsilon-Proteobacteria as well as the occurrence of archaeal phylotypes affiliated with the Thermococcales and of a unique archaeon sequence that clustered with "Nanoarchaeota." The DGGE bands obtained from drilled holes and natural vent fluids from 7 to 300 degrees C were affiliated with the delta-Proteobacteria, genus Thiomicrospira, and Pelodictyon. The dominant DGGE bands retrieved from the effluent water of casing pipes at 3 and 4 degrees C were closely related to phylotypes obtained from the Arctic Ocean. Our results suggest the presence of microorganisms corresponding to a unique DSR lineage not detected previously from other geothermal environments.
Zhang, Junyi; Zhu, Congming; Guan, Rui; Xiong, Zhipeng; Zhang, Wen; Shi, Junzhe; Sheng, Yi; Zhu, Bingchuan; Tu, Jing; Ge, Qinyu; Chen, Ting; Lu, Zuhong
2017-05-01
Understanding of the bacterial community structure in drinking water resources helps to enhance the security of municipal water supplies. In this study, bacterial communities were surveyed in water and sediment during a heavy cyanobacterial bloom in a drinking water resource of Lake Taihu, China. A total of 325,317 high-quality sequences were obtained from different 16S ribosomal RNA (rRNA) regions (V3, V4, and V6) using the Miseq sequencing platform. A notable difference was shown between the water and sediment samples, as predominated by Cyanobacteria, Proteobacteria, and Actinobacteria in the water and Proteobacteria, Chloroflexi, and Verrucomicrobia in the sediment, respectively. The LD12 family dominated the water surface and was tightly associated with related indicators of cyanobacterial propagation, indicating involvement in the massive proliferation of cyanobacterial blooms. Alternatively, the genus Nitrospira dominated the sediment samples, which indicates that nitrite oxidation was very active in the sediment. Although pathogenic bacteria were not detected in a large amount, some genera such as Mycobacterium, Acinetobacter, and Legionella were still identified but in very low abundance. In addition, the effects of different V regions on bacterial diversity survey were evaluated. Overall, V4 and V3 were proven to be more promising V regions for bacterial diversity survey in water and sediment samples during heavy water blooms in Lake Taihu, respectively. As longer, cheaper, and faster DNA sequencing technologies become more accessible, we expect that bacterial community structures based on 16S rRNA amplicons as an indicator could be used alongside with physical and chemical indicators, to conduct comprehensive assessments for drinking water resource management.
Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J
1981-01-01
We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619
Sun, Beili; Zhou, Dongrui; Tu, Jing; Lu, Zuhong
2017-01-01
The characteristics of tongue coating are very important symbols for disease diagnosis in traditional Chinese medicine (TCM) theory. As a habitat of oral microbiota, bacteria on the tongue dorsum have been proved to be the cause of many oral diseases. The high-throughput next-generation sequencing (NGS) platforms have been widely applied in the analysis of bacterial 16S rRNA gene. We developed a methodology based on genus-specific multiprimer amplification and ligation-based sequencing for microbiota analysis. In order to validate the efficiency of the approach, we thoroughly analyzed six tongue coating samples from lung cancer patients with different TCM types, and more than 600 genera of bacteria were detected by this platform. The results showed that ligation-based parallel sequencing combined with enzyme digestion and multiamplification could expand the effective length of sequencing reads and could be applied in the microbiota analysis.
Wood, Jacqueline; Scott, Karen P.; Avguštin, Gorazd; Newbold, C. James; Flint, Harry J.
1998-01-01
We describe an approach for determining the genetic composition of Bacteroides and Prevotella populations in gut contents based on selective amplification of 16S rRNA gene sequences (rDNA) followed by cleavage of the amplified material with restriction enzymes. The relative contributions of different ribotypes to total Bacteroides and Prevotella 16S rDNA are estimated after end labelling of one of the PCR primers, and the contribution of Bacteroides and Prevotella sequences to total eubacterial 16S rDNA is estimated by measuring the binding of oligonucleotide probes to amplified DNA. Bacteroides and Prevotella 16S rDNA accounted for between 12 and 62% of total eubacterial 16S rDNA in samples of ruminal contents from six sheep and a cow. Ribotypes 4, 5, 6, and 7, which include most cultivated rumen Prevotella strains, together accounted for between 20 and 86% of the total amplified Bacteroides and Prevotella rDNA in these samples. The most abundant Bacteroides or Prevotella ribotype in four animals, however, was ribotype 8, for which there is only one known cultured isolate, while ribotypes 1 and 2, which include many colonic Bacteroides spp., were the most abundant in two animals. This indicates that some abundant Bacteroides and Prevotella groups in the rumen are underrepresented among cultured rumen Prevotella isolates. The approach described here provides a rapid, convenient, and widely applicable method for comparing the genotypic composition of bacterial populations in gut samples. PMID:9758785
Fogarty, Lisa R; Voytek, Mary A
2005-10-01
To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.
Fogarty, Lisa R.; Voytek, Mary A.
2005-01-01
To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment. PMID:16204514
Fogarty, L.R.; Voytek, M.A.
2005-01-01
To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.
Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).
Douzery, E; Catzeflis, F M
1995-11-01
The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced
Problem-Based Test: Functional Analysis of Mutant 16S rRNAs
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2010-01-01
Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…
Lopes, Ana R; Manaia, Célia M; Nunes, Olga C
2014-03-01
Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu
2015-09-24
Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.
Use of 16S Ribosomal RNA Sequences to Infer Relationships among Archaebacteria.
1987-04-16
the rRNAs of one or both other kingdoms , and among the archaebacteria there are also substantial variations) (1), echinoderms (5, 11), major...Security Classification) Ln Use of 16S Ribosomal RNA Sequences to infer Relationships among Archaebacteria : Annual Report (U) q 12 PERSONAL AUTHOR(S...FIELD GROUP SUB-GROUP Archaebacteria ; Eubacteria; Eukaryotes; 16S Ribosomal RNA; 08 I Phylogeny; rRNA; RNA Sequencing; Molecular Clock; Urkingdoms; r
Fontana, Carla; Favaro, Marco; Pelliccioni, Marco; Pistoia, Enrico Salvatore; Favalli, Cartesio
2005-01-01
Reliable automated identification and susceptibility testing of clinically relevant bacteria is an essential routine for microbiology laboratories, thus improving patient care. Examples of automated identification systems include the Phoenix (Becton Dickinson) and the VITEK 2 (bioMérieux). However, more and more frequently, microbiologists must isolate “difficult” strains that automated systems often fail to identify. An alternative approach could be the genetic identification of isolates; this is based on 16S rRNA gene sequencing and analysis. The aim of the present study was to evaluate the possible use of MicroSeq 500 (Applera) for sequencing the 16S rRNA gene to identify isolates whose identification is unobtainable by conventional systems. We analyzed 83 “difficult” clinical isolates: 25 gram-positive and 58 gram-negative strains that were contemporaneously identified by both systems—VITEK 2 and Phoenix—while genetic identification was performed by using the MicroSeq 500 system. The results showed that phenotypic identifications by VITEK 2 and Phoenix were remarkably similar: 74% for gram-negative strains (43 of 58) and 80% for gram-positive strains were concordant by both systems and also concordant with genetic characterization. The exceptions were the 15 gram-negative and 9 gram-positive isolates whose phenotypic identifications were contrasting or inconclusive. For these, the use of MicroSeq 500 was fundamental to achieving species identification. In clinical microbiology the use of MicroSeq 500, particularly for strains with ambiguous biochemical profiles (including slow-growing strains), identifies strains more easily than do conventional systems. Moreover, MicroSeq 500 is easy to use and cost-effective, making it applicable also in the clinical laboratory. PMID:15695654
A critical role for noncoding 5S rRNA in regulating Mdmx stability.
Li, Muyang; Gu, Wei
2011-09-16
Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.
Comparative analysis of vaginal microbiota sampling using 16S rRNA gene analysis.
Virtanen, Seppo; Kalliala, Ilkka; Nieminen, Pekka; Salonen, Anne
2017-01-01
Molecular methods such as next-generation sequencing are actively being employed to characterize the vaginal microbiota in health and disease. Previous studies have focused on characterizing the biological variation in the microbiota, and less is known about how factors related to sampling contribute to the results. Our aim was to investigate the impact of a sampling device and anatomical sampling site on the quantitative and qualitative outcomes relevant for vaginal microbiota research. We sampled 10 Finnish women representing diverse clinical characteristics with flocked swabs, the Evalyn® self-sampling device, sterile plastic spatulas and a cervical brush that were used to collect samples from fornix, vaginal wall and cervix. Samples were compared on DNA and protein yield, bacterial load, and microbiota diversity and species composition based on Illumina MiSeq sequencing of the 16S rRNA gene. We quantified the relative contributions of sampling variables versus intrinsic variables in the overall microbiota variation, and evaluated the microbiota profiles using several commonly employed metrics such as alpha and beta diversity as well as abundance of major bacterial genera and species. The total DNA yield was strongly dependent on the sampling device and to a lesser extent on the anatomical site of sampling. The sampling strategy did not affect the protein yield or the bacterial load. All tested sampling methods produced highly comparable microbiota profiles based on MiSeq sequencing. The sampling method explained only 2% (p-value = 0.89) of the overall microbiota variation, markedly surpassed by intrinsic factors such as clinical status (microscopy for bacterial vaginosis 53%, p = 0.0001), bleeding (19%, p = 0.0001), and the variation between subjects (11%, p-value 0.0001). The results indicate that different sampling strategies yield comparable vaginal microbiota composition and diversity. Hence, past and future vaginal microbiota studies employing different
Comparative analysis of vaginal microbiota sampling using 16S rRNA gene analysis
Kalliala, Ilkka; Nieminen, Pekka; Salonen, Anne
2017-01-01
Background Molecular methods such as next-generation sequencing are actively being employed to characterize the vaginal microbiota in health and disease. Previous studies have focused on characterizing the biological variation in the microbiota, and less is known about how factors related to sampling contribute to the results. Our aim was to investigate the impact of a sampling device and anatomical sampling site on the quantitative and qualitative outcomes relevant for vaginal microbiota research. We sampled 10 Finnish women representing diverse clinical characteristics with flocked swabs, the Evalyn® self-sampling device, sterile plastic spatulas and a cervical brush that were used to collect samples from fornix, vaginal wall and cervix. Samples were compared on DNA and protein yield, bacterial load, and microbiota diversity and species composition based on Illumina MiSeq sequencing of the 16S rRNA gene. We quantified the relative contributions of sampling variables versus intrinsic variables in the overall microbiota variation, and evaluated the microbiota profiles using several commonly employed metrics such as alpha and beta diversity as well as abundance of major bacterial genera and species. Results The total DNA yield was strongly dependent on the sampling device and to a lesser extent on the anatomical site of sampling. The sampling strategy did not affect the protein yield or the bacterial load. All tested sampling methods produced highly comparable microbiota profiles based on MiSeq sequencing. The sampling method explained only 2% (p-value = 0.89) of the overall microbiota variation, markedly surpassed by intrinsic factors such as clinical status (microscopy for bacterial vaginosis 53%, p = 0.0001), bleeding (19%, p = 0.0001), and the variation between subjects (11%, p-value 0.0001). Conclusions The results indicate that different sampling strategies yield comparable vaginal microbiota composition and diversity. Hence, past and future vaginal
Roux-Michollet, Dad D; Schimel, Joshua P; Holden, Patricia A
2010-12-01
Identifying microorganisms that are active under specific conditions in ecosystems is a challenge in microbial ecology. Recently, the bromodeoxyuridine (BrdU) technique was developed to label actively growing cells. BrdU, a thymidine analog, is incorporated into newly synthesized DNA, and the BrdU-labeled DNA is then isolated from total extractable DNA by immunocapture using a BrdU-specific antibody. Analyzing the BrdU-labeled DNA allows for assessing the actively growing community, which can then be compared to the unlabeled DNA that represents the total community. However, applying the BrdU approach to study soils has been problematic due to low DNA amounts and soil contaminants. To address these challenges, we developed a protocol, optimizing specificity and reproducibility, to amplify BrdU-labeled gene fragments encoding 16S rRNA. We found that the determining factor was the DNA polymerase: among the 13 different polymerases we tested, only 3 provided adequate yields with minimal contamination, and only two of those three produced similar amplification patterns of community DNA. Copyright © 2010 Elsevier B.V. All rights reserved.
Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.
2012-01-01
Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or negative. We evaluated two conventional primer pairs in common use and a new primer pair based on the dual priming oligonucleotide (DPO) principle. Cross-reactivity was observed when both conventional primer pairs were used, resulting in interpretation difficulties. No cross-reactivity was observed using the DPOs even in specimens with a high ratio of human to bacterial DNA. In addition to reducing cross-reactivity, the DPO principle also offers a high degree of flexibility in the design of primers and should be considered for any PCR assay intended for detection and identification of pathogens directly from human clinical specimens. PMID:22278843
Ehresmann, C; Moine, H; Mougel, M; Dondon, J; Grunberg-Manago, M; Ebel, J P; Ehresmann, B
1986-01-01
The initiation factor IF3 is platinated with trans-diamminedichloroplatinum(II) and cross-linked to Escherichia coli 30S ribosomal subunit. Two cross-linking sites are unambiguously identified on the 16S rRNA: a major one, in the region 819-859 in the central domain, and a minor one, in the region 1506-1529 in the 3'-terminal domain. Specific features of these sequences together with their particular location within the 30S subunit lead us to postulate a role for IF3, that conciliates topographical and functional observations made so far. Images PMID:2425339
van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J
1995-06-01
Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.
Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E
2012-01-01
Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.
Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo
2002-12-01
The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.
An Archaea 5S rRNA analog is stably expressed in Escherichia coli
NASA Technical Reports Server (NTRS)
Yang, Y.; Fox, G. E.
1996-01-01
Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.
RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing
Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander
2002-01-01
The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103
Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity
ERIC Educational Resources Information Center
Guan, Min-Xin
2005-01-01
The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
Kvitt, H; Ucko, M; Colorni, A; Batargias, C; Zlotkin, A; Knibb, W
2002-04-05
A PCR protocol for the rapid diagnosis of fish 'pasteurellosis' based on 16S rRNA gene sequences was developed. The procedure combines low annealing temperature that detects low titers of Photobacterium damselae but also related species, and high annealing temperature for the specific identification of P. damselae directly from infected fish. The PCR protocol was validated on 19 piscine isolates of P. damselae ssp. piscicida from different geographic regions (Japan, Italy, Spain, Greece and Israel), on spontaneously infected sea bream Sparus aurata and sea bass Dicentrarchus labrax, and on closely related American Type Culture Collection (ATCC) reference strains. PCR using high annealing temperature (64 degrees C) discriminated between P. damselae and closely related reference strains, including P. histaminum. Sixteen isolates of P. damselae ssp. piscicida, 2 P. damselae ssp. piscicida reference strains and 1 P. damselae ssp. damselae reference strain were subjected to Amplified Fragment Length Polymorphism (AFLP) analysis, and a similarity matrix was produced. Accordingly, the Japanese isolates of P. damselae ssp. piscicida were distinguished from the Mediterranean/European isolates at a cut-off value of 83% similarity. A further subclustering at a cut-off value of 97% allowed discrimination between the Israeli P. damselae ssp. piscicida isolates and the other Mediterranean/European isolates. The combination of PCR direct amplification and AFLP provides a 2-step procedure, where P. damselae is rapidly identified at genus level on the basis of its 16S rRNA gene sequence and then grouped into distinct clusters on the basis of AFLP polymorphisms. The first step of direct amplification is highly sensitive and has immediate practical consequences, offering fish farmers a rapid diagnosis, while the AFLP is more specific and detects intraspecific variation which, in our study, also reflected geographic correspondence. Because of its superior discriminative properties
Treede, Irina; Jakobsen, Lene; Kirpekar, Finn; Vester, Birte; Weitnauer, Gabriele; Bechthold, Andreas; Douthwaite, Stephen
2003-07-01
Avilamycin is an orthosomycin antibiotic that has shown considerable potential for clinical use, although it is presently used as a growth promoter in animal feed. Avilamycin inhibits bacterial protein synthesis by binding to the 50S ribosomal subunit. The ribosomes of the producer strain, Streptomyces viridochromogenes Tü57, are protected from the drug by the action of three resistance factors located in the avilamycin biosynthetic gene cluster. Two of the resistance factors, aviRa and aviRb, encode rRNA methyltransferases that specifically target 23S rRNA. Recombinant AviRa and AviRb proteins retain their activity after purification, and both specifically methylate in vitro transcripts of 23S rRNA domain V. Reverse transcriptase primer extension indicated that AviRa is an N-methyltransferase that targets G2535 within helix 91 of the rRNA, whereas AviRb modified the 2'-O-ribose position of nucleotide U2479 within helix 89. MALDI mass spectrometry confirmed the exact positions of each of these modifications, and additionally established that a single methyl group is added at each nucleotide. Neither of these two nucleotides have previously been described as a target for enzymatic methylation. Molecular models of the 50S subunit crystal structure show that the N-1 of the G2535 base and the 2'-hydroxyl of U2479 are separated by approximately 10 A, a distance that can be spanned by avilamycin. In addition to defining new resistance mechanisms, these data refine our understanding of the probable ribosome contacts made by orthosomycins and of how these antibiotics inhibit protein synthesis.
Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio
2009-08-01
Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.
Zuo, Yu; Xie, Wenfang; Pang, Yue; Li, Tiesong; Li, Qingwei; Li, Yingying
2017-01-01
The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.
2017-01-01
The diversity of microbiota is best explored by understanding the phylogenetic structure of the microbial communities. Traditionally, sequence alignment has been used for phylogenetic inference. However, alignment-based approaches come with significant challenges and limitations when massive amounts of data are analyzed. In the recent decade, alignment-free approaches have enabled genome-scale phylogenetic inference. Here we evaluate three alignment-free methods: ACS, CVTree, and Kr for phylogenetic inference with 16s rRNA gene data. We use a taxonomic gold standard to compare the accuracy of alignment-free phylogenetic inference with that of common microbiome-wide phylogenetic inference pipelines based on PyNAST and MUSCLE alignments with FastTree and RAxML. We re-simulate fecal communities from Human Microbiome Project data to evaluate the performance of the methods on datasets with properties of real data. Our comparisons show that alignment-free methods are not inferior to alignment-based methods in giving accurate and robust phylogenic trees. Moreover, consensus ensembles of alignment-free phylogenies are superior to those built from alignment-based methods in their ability to highlight community differences in low power settings. In addition, the overall running times of alignment-based and alignment-free phylogenetic inference are comparable. Taken together our empirical results suggest that alignment-free methods provide a viable approach for microbiome-wide phylogenetic inference. PMID:29136663
Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA
Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W. Brad
2009-01-01
Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element. PMID:19211543
Maheux, Andrée F; Bouchard, Sébastien; Bérubé, Ève; Bergeron, Michel G
2017-06-01
The MI, Chromocult ® coliform, and Compass CC chromogenic culture-based methods used to assess water quality by the detection of Escherichia coli and total coliforms were compared in terms of their specificity and sensitivity, using 16S rRNA sequencing for colony identification. A sewage water sample was divided in 2-μL subsamples for testing by all three culture-based methods. All growing colonies were harvested and subjected to 16S rRNA sequencing. Test results showed that all E. coli colonies were correctly identified by all three methods, for a specificity and a sensitivity of 100%. However, for the total coliform detection, the MI agar, Chromocult ® coliform agar, and Compass CC agar were specific for only 69.2% (9/13), 47.2% (25/53), and 40.5% (17/42), whereas sensitive for 97.8% (45/46), 97.5% (39/40), and 85.7% (24/28), respectively. Thus, given the low level of specificity of these methods for the detection of total coliforms, confirming the identity of total coliform colonies could help to take public health decisions, in particular for cities connected to a public drinking water distribution system since the growth of few putative total coliform colonies on chromogenic agar is problematic and can lead to unnecessary and costly boiling notices from public health authorities.
Moreira, João Luiz S; Mota, Rodrigo M; Horta, Maria F; Teixeira, Santuza MR; Neumann, Elisabeth; Nicoli, Jacques R; Nunes, Álvaro C
2005-01-01
Background The accurate identification of Lactobacillus and other co-isolated bacteria during microbial ecological studies of ecosystems such as the human or animal intestinal tracts and food products is a hard task by phenotypic methods requiring additional tests such as protein and/or lipids profiling. Results Bacteria isolated in different probiotic prospecting studies, using de Man, Rogosa and Sharpe medium (MRS), were typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR products. The set of enzymes chosen differentiates most species of Lactobacillus genus and also co-isolated bacteria such as Enterococcus, Streptococcus, Weissella, Staphylococcus, and Escherichia species. The in silico predictions of restriction patterns generated by the Lactobacillus shorter spacers digested with 11 restriction enzymes with 6 bp specificities allowed us to distinguish almost all isolates at the species level but not at the subspecies one. Simultaneous theoretical digestions of the three spacers (long, medium and short) with the same set of enzymes provided more complex patterns and allowed us to distinguish the species without purifying and cloning of PCR products. Conclusion Lactobacillus isolates and several other strains of bacteria co-isolated on MRS medium from gastrointestinal ecosystem and fermented food products could be identified using DNA fingerprints generated by restriction endonucleases. The methodology based on amplified ribosomal DNA restriction analysis (ARDRA) is easier, faster and more accurate than the current methodologies based on fermentation profiles, used in most laboratories for the purpose of identification of these bacteria in different prospecting studies. PMID:15788104
Thollesson, M.
1999-01-01
The phylogeny of Euthyneura is analysed by using DNA sequences of the mitochondrial 16S rRNA gene. Despite the common notion that this gene is too variable to provide useful information at high taxonomic levels, such as in the present study, bootstrap proportions are high for several clades in the study. This indicates that there is a useful amount of variation despite the noise due to multiple substitutions. The analyses furthermore indicate that (i) Gymnosomata (represented by Clione) is not a part of Euthyneura, but Clione forms a clade with the caenogastropods; (ii) Acteon is the sister group to the remaining euthyneuran taxa in the study; (iii) the nudibranch taxa form two clades, one comprising Dendronotoidea, Arminoidea and Aeolidoidea (together Cladobranchia) with Notaspidea (represented by Berthella) as sister group, while the fourth nudibranch taxon, Doridoidea, forms a separate clade; (iv) Cephalaspidea s.s. and Anaspidea form clades that are each other's sister groups (together Pleurocoela). Finally, there is no clade present in the analyses corresponding to the taxon Opisthobranchia in the traditional sense, and the use of this name is probably better abandoned altogether.
Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina
2018-01-01
Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion
Schwieger, Frank; Tebbe, Christoph C.
2000-01-01
Fourteen weeks after field release of luciferase gene-tagged Sinorhizobium meliloti L33 in field plots seeded with Medicago sativa, we found that the inoculant also occurred in bulk soil from noninoculated control plots. In rhizospheres of M. sativa plants, S. meliloti L33 could be detected in noninoculated plots 12 weeks after inoculation, indicating that growth in the rhizosphere preceded spread into bulk soil. To determine whether inoculation affected bacterial diversity, 1,119 bacteria were isolated from the rhizospheres of M. sativa and Chenopodium album, which was the dominant weed in the field plots. Amplified ribosomal DNA restriction analysis (ARDRA) revealed plant-specific fragment size frequencies. Dominant ARDRA groups were identified by 16S rRNA gene nucleotide sequencing. Database comparisons indicated that the rhizospheres contained members of the Proteobacteria (α, β, and γ subgroups), members of the Cytophaga-Flavobacterium group, and gram-positive bacteria with high G+C DNA contents. The levels of many groups were affected by the plant species and, in the case of M. sativa, by inoculation. The most abundant isolates were related to Variovorax sp., Arthrobacter ramosus, and Acinetobacter calcoaceticus. In the rhizosphere of M. sativa, inoculation reduced the numbers of cells of A. calcoaceticus and members of the genus Pseudomonas and increased the number of rhizobia. Cultivation-independent PCR–single-strand conformation polymorphism (SSCP) profiles of a 16S rRNA gene region confirmed the existence of plant-specific rhizosphere communities and the effect of the inoculant. All dominant ARDRA groups except Variovorax species could be detected. On the other hand, the SSCP profiles revealed products which could not be assigned to the dominant cultured isolates, indicating that the bacterial diversity was greater than the diversity suggested by cultivation. PMID:10919821
Restrepo-Ortiz, C X; Merbt, S N; Barrero-Canossa, J; Fuchs, B M; Casamayor, E O
2018-04-28
The Thaumarchaeota SAGMCG-1 group and, in particular, members of the genus Nitrosotalea have high occurrence in acidic soils, the rhizosphere, groundwater and oligotrophic lakes, and play a potential role in nitrogen cycling. In this study, the specific oligonucleotide fluorescence in situ hybridization probe SAG357 was designed for this Thaumarchaeota group based on the available 16S rRNA gene sequences in databases, and included the ammonia-oxidizing species Nitrosotalea devanaterra. Cell permeabilization for catalyzed reporter deposition fluorescence in situ detection and the hybridization conditions were optimized on enrichment cultures of the target species N. devanaterra, as well as the non-target ammonia-oxidizing archaeon Nitrosopumilus maritimus. Probe specificity was improved with a competitor oligonucleotide, and fluorescence intensity and cell visualization were enhanced by the design and application of two adjacent helpers. Probe performance was tested in soil samples along a pH gradient, and counting results matched the expected in situ distributions. Probe SAG357 and the CARD-FISH protocol developed in the present study will help to improve the current understanding of the ecology and physiology of N. devanaterra and its relatives in natural environments. Copyright © 2018 Elsevier GmbH. All rights reserved.
Novel variants of the 5S rRNA genes in Eruca sativa.
Singh, K; Bhatia, S; Lakshmikumaran, M
1994-02-01
The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)
Muir, Peter; Fox, Robin; Wu, Qiang; Baker, Theresa A; Zitzer, Nina C; Hudson, Alan P; Manley, Paul A; Schaefer, Susan L; Hao, Zhengling
2010-02-24
An underappreciated cause and effect relationship between environmental bacteria and arthritis may exist. Previously, we found that stifle arthritis in dogs was associated with the presence of environmental bacteria within synovium. Cranial cruciate ligament rupture (CCLR) is often associated with stifle arthritis in dogs. We now wished to determine whether seasonal variation in detection of bacterial material may exist in affected dogs, and to also conduct analyses of both synovium and synovial fluid. We also wished to analyze a larger clone library of the 16S rRNA gene to further understanding of the microbial population in the canine stifle. Synovial biopsies were obtained from 117 affected dogs from January to December 2006. Using PCR, synovium and synovial fluid were tested for Borrelia burgdorferi and Stenotrophomonas maltophilia DNA. Broad-ranging 16S rRNA primers were also used and PCR products were cloned and sequenced for bacterial identification. Overall, 41% of arthritic canine stifle joints contained bacterial DNA. Detection of bacterial DNA in synovial fluid samples was increased, when compared with synovium (p<0.01). Detection rates were highest in the winter and spring and lowest in the summer period, suggesting environmental factors influence the risk of translocation to the stifle. Organisms detected were predominately Gram's negative Proteobacteria, particularly the orders Rhizobiales (32.8% of clones) and Burkholderiales (20.0% of clones), usually as part of a polymicrobial population. PCR-positivity was inversely correlated with severity of arthritis assessed radiographically and with dog age. Bacterial translocation to the canine stifle may be associated with changes to the indoor environment. Copyright 2009 Elsevier B.V. All rights reserved.
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.
between the relative abundance, species richness and phylogenetic diversity of the microbial communities associated with the leaf midribs of HLB symptomatic and asymptomatic citrus trees were investigated using high-density 16S rDNA microarray PhyloChip and 16S rRNA gene clone library methods.« less
Połka, Justyna; Rebecchi, Annalisa; Pisacane, Vincenza; Morelli, Lorenzo; Puglisi, Edoardo
2015-04-01
The bacterial diversity involved in food fermentations is one of the most important factors shaping the final characteristics of traditional foods. Knowledge about this diversity can be greatly improved by the application of high-throughput sequencing technologies (HTS) coupled to the PCR amplification of the 16S rRNA subunit. Here we investigated the bacterial diversity in batches of Salame Piacentino PDO (Protected Designation of Origin), a dry fermented sausage that is typical of a regional area of Northern Italy. Salami samples from 6 different local factories were analysed at 0, 21, 49 and 63 days of ripening; raw meat at time 0 and casing samples at 21 days of ripening where also analysed, and the effect of starter addition was included in the experimental set-up. Culture-based microbiological analyses and PCR-DGGE were carried out in order to be compared with HTS results. A total of 722,196 high quality sequences were obtained after trimming, paired-reads assembly and quality screening of raw reads obtained by Illumina MiSeq sequencing of the two bacterial 16S hypervariable regions V3 and V4; manual curation of 16S database allowed a correct taxonomical classification at the species for 99.5% of these reads. Results confirmed the presence of main bacterial species involved in the fermentation of salami as assessed by PCR-DGGE, but with a greater extent of resolution and quantitative assessments that are not possible by the mere analyses of gel banding patterns. Thirty-two different Staphylococcus and 33 Lactobacillus species where identified in the salami from different producers, while the whole data set obtained accounted for 13 main families and 98 rare ones, 23 of which were present in at least 10% of the investigated samples, with casings being the major sources of the observed diversity. Multivariate analyses also showed that batches from 6 local producers tend to cluster altogether after 21 days of ripening, thus indicating that HTS has the potential
Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.
Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J
2017-11-02
One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.
Cremonesi, P; Zottola, T; Locatelli, C; Pollera, C; Castiglioni, B; Scaccabarozzi, L; Moroni, P
2013-01-01
Staphylococcus aureus is an important human and animal pathogen, and is regarded as an important cause of intramammary infection (IMI) in ruminants. Staphylococcus aureus genetic variability and virulence factors have been well studied in veterinary medicine, especially in cows as support for control and management of IMI. The aim of the present study was to genotype 71 Staph. aureus isolates from the bulk tank and foremilk of water buffaloes (n=40) and from udder tissue (n=7) and foremilk (n=24) from small ruminants. The method used was previously applied to bovine Staph. aureus and is based on the amplification of the 16S-23S rRNA intergenic spacer region. The technique applied was able to identify different Staph. aureus genotypes isolated from dairy species other than the bovine species, and cluster the genotypes according to species and herds. Virulence gene distribution was consistent with genotype differentiation. The isolates were also characterized through determination of the presence of 19 virulence-associated genes by specific PCR. Enterotoxins A, C, D, G, I, J, and L were associated with Staph. aureus isolates from buffaloes, whereas enterotoxins C and L were linked to small ruminants. Genes coding for methicillin resistance, Panton-Valentine leukocidin, exfoliative toxins A and B, and enterotoxins B, E, and H were undetected. These findings indicate that RNA template-specific PCR is a valid technique for typing Staph. aureus from buffaloes and small ruminants and is a useful tool for understanding udder infection epidemiology. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.
Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M
2009-07-01
RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S
2016-10-01
The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies
Mendes-Soares, Helena; Krishnan, Vandhana; Settles, Matthew L.; Ravel, Jacques; Brown, Celeste J.; Forney, Larry J.
2015-01-01
Although vaginal microbial communities of some healthy women have high proportions of Atopobium vaginae, the genus Atopobium is more commonly associated with bacterial vaginosis, a syndrome associated with an increased risk of adverse pregnancy outcomes and the transmission of sexually transmitted diseases. Genetic differences within Atopobium species may explain why single species can be associated with both health and disease. We used 16S rRNA gene sequences from previously published studies to explore the taxonomic diversity of the genus Atopobium in vaginal microbial communities of healthy women. Although A. vaginae was the species most commonly found, we also observed three other Atopobium species in the vaginal microbiota, one of which, A. parvulum, was not previously known to reside in the human vagina. Furthermore, we found several potential novel species of the genus Atopobium and multiple phylogenetic clades of A. vaginae. The diversity of Atopobium found in our study, which focused only on samples from healthy women, is greater than previously recognized, suggesting that analysis of samples from women with BV would yield even more diversity. Classification of microbes only to the genus level may thus obfuscate differences that might be important to better understand health or disease. PMID:25778779
Suau, Antonia; Bonnet, Régis; Sutren, Malène; Godon, Jean-Jacques; Gibson, Glenn R.; Collins, Matthew D.; Doré, Joel
1999-01-01
The human intestinal tract harbors a complex microbial ecosystem which plays a key role in nutrition and health. Although this microbiota has been studied in great detail by culture techniques, microscopic counts on human feces suggest that 60 to 80% of the observable bacteria cannot be cultivated. Using comparative analysis of cloned 16S rRNA gene (rDNA) sequences, we have investigated the bacterial diversity (both cultivated and noncultivated bacteria) within an adult-male fecal sample. The 284 clones obtained from 10-cycle PCR were classified into 82 molecular species (at least 98% similarity). Three phylogenetic groups contained 95% of the clones: the Bacteroides group, the Clostridium coccoides group, and the Clostridium leptum subgroup. The remaining clones were distributed among a variety of phylogenetic clusters. Only 24% of the molecular species recovered corresponded to described organisms (those whose sequences were available in public databases), and all of these were established members of the dominant human fecal flora (e.g., Bacteroides thetaiotaomicron, Fusobacterium prausnitzii, and Eubacterium rectale). However, the majority of generated rDNA sequences (76%) did not correspond to known organisms and clearly derived from hitherto unknown species within this human gut microflora. PMID:10543789
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18
Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan
2011-01-01
5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
Chen, Xianfeng; Johnson, Stephen; Jeraldo, Patricio; Wang, Junwen; Chia, Nicholas; Kocher, Jean-Pierre A; Chen, Jun
2018-03-01
Illumina paired-end sequencing has been increasingly popular for 16S rRNA gene-based microbiota profiling. It provides higher phylogenetic resolution than single-end reads due to a longer read length. However, the reverse read (R2) often has significant low base quality, and a large proportion of R2s will be discarded after quality control, resulting in a mixture of paired-end and single-end reads. A typical 16S analysis pipeline usually processes either paired-end or single-end reads but not a mixture. Thus, the quantification accuracy and statistical power will be reduced due to the loss of a large amount of reads. As a result, rare taxa may not be detectable with the paired-end approach, or low taxonomic resolution will result in a single-end approach. To have both the higher phylogenetic resolution provided by paired-end reads and the higher sequence coverage by single-end reads, we propose a novel OTU-picking pipeline, hybrid-denovo, that can process a hybrid of single-end and paired-end reads. Using high-quality paired-end reads as a gold standard, we show that hybrid-denovo achieved the highest correlation with the gold standard and performed better than the approaches based on paired-end or single-end reads in terms of quantifying the microbial diversity and taxonomic abundances. By applying our method to a rheumatoid arthritis (RA) data set, we demonstrated that hybrid-denovo captured more microbial diversity and identified more RA-associated taxa than a paired-end or single-end approach. Hybrid-denovo utilizes both paired-end and single-end 16S sequencing reads and is recommended for 16S rRNA gene targeted paired-end sequencing data.
Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming
2015-12-21
5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Phylogenetic tree of 16s rRNA sequences from sulfate-reducing bacteria in a sandy marine sediment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Devereux, R.; Mundfrom, G.W.
1994-01-01
Phylogenetic divergence among sulfate-reducing bateria in an estuarine sediment sample was investigated by PCR amplification and comparison of partial 16S rDNA sequences. Twenty unique 16S rDNA sequences were found, 12 from delta subclass bacteria based on overall sequence similarity (82-91%). Two successive PCR amplifications were used to obtain and clone the 16S rDNA. The first reaction used templates derived from phosphate-buffered saline washed sediment with primers designed to amplify nearly full-length bacterial domain 16S rDNA. A produce from a first reaction was used as template in a second reaction with primers designed to selectivity amplify a region of 16S rDNAmore » genes of sulfate-reducing bacteria. A phylogenetic tree incorporating the cloned sequences suggests the presence of yet to be cultivated lines of sulfate-reducing bacteria within the sediment sample.« less
Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.
Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258
Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR
Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo
2005-01-01
A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001
Voordouw, G; Armstrong, S M; Reimer, M F; Fouts, B; Telang, A J; Shen, Y; Gevertz, D
1996-05-01
Oil field bacteria were characterized by cloning and sequencing of PCR-amplified 16S rRNA genes. A variety of gram-negative, sulfate-reducing bacteria was detected (16 members of the family Desulfovibrionaceae and 8 members of the family Desulfobacteriaceae). In contrast, a much more limited number of anaerobic, fermentative, or acetogenic bacteria was found (one Clostridium sp., one Eubacterium sp., and one Synergistes sp.). Potential sulfide oxidizers and/or microaerophiles (Thiomicrospira, Arcobacter, Campylobacter, and Oceanospirillum spp.) were also detected. The first two were prominently amplified from uncultured production water DNA and represented 28 and 47% of all clones, respectively. Growth on media containing sulfide as the electron donor and nitrate as the electron acceptor and designed for the isolation of Thiomicrospira spp. gave only significant enrichment of the Campylobacter sp., which was shown to be present in different western Canadian oil fields. This newly discovered sulfide oxidizer may provide a vital link in the oil field sulfur cycle by reoxidizing sulfide formed by microbial sulfate or sulfur reduction.
Voordouw, G; Armstrong, S M; Reimer, M F; Fouts, B; Telang, A J; Shen, Y; Gevertz, D
1996-01-01
Oil field bacteria were characterized by cloning and sequencing of PCR-amplified 16S rRNA genes. A variety of gram-negative, sulfate-reducing bacteria was detected (16 members of the family Desulfovibrionaceae and 8 members of the family Desulfobacteriaceae). In contrast, a much more limited number of anaerobic, fermentative, or acetogenic bacteria was found (one Clostridium sp., one Eubacterium sp., and one Synergistes sp.). Potential sulfide oxidizers and/or microaerophiles (Thiomicrospira, Arcobacter, Campylobacter, and Oceanospirillum spp.) were also detected. The first two were prominently amplified from uncultured production water DNA and represented 28 and 47% of all clones, respectively. Growth on media containing sulfide as the electron donor and nitrate as the electron acceptor and designed for the isolation of Thiomicrospira spp. gave only significant enrichment of the Campylobacter sp., which was shown to be present in different western Canadian oil fields. This newly discovered sulfide oxidizer may provide a vital link in the oil field sulfur cycle by reoxidizing sulfide formed by microbial sulfate or sulfur reduction. PMID:8633860
Zhang, Rong-Yue; Li, Wen-Feng; Huang, Ying-Kun; Wang, Xiao-Yan; Shan, Hong-Li; Luo, Zhi-Ming; Yin, Jiong
2016-01-01
Sugar cane white leaf (SCWL) is a serious disease caused by phytoplasmas. In this study, we performed nested PCR with phytoplasma universal primer pairs (P1/P7 and R16F2n/R16R2) for the 16S rRNA gene to detect SCWL phytoplasmas in 31 SCWL samples collected from Baoshan and Lincang, Yunnan, China. We cloned and sequenced the nested PCR products, revealing that the 16S rRNA gene sequences from 31 SCWL samples were all 1247 bp in length and shared more than 99 % nucleotide sequence similarity with the 16S rRNA gene sequences of SCWL phytoplasmas from various countries. Based on the reported 16S rRNA gene sequence data from SCWL isolates of various countries, we conducted phylogenetic and virtual RFLP analysis. In the resulting phylogenetic tree, all SCWL isolates clustered into two branches, with the Lincang and Baoshan SCWL phytoplasma isolates belonging to different branches. The virtual RFLP patterns show that phytoplasmas of the Lincang branch belong to subgroup 16SrXI-B. However, the virtual RFLP patterns revealed by HaeIII digestion of phytoplasmas of the Baoshan branch differed from those of subgroup 16SrXI-B. According to the results of phylogenetic and virtual RFLP analysis, we propose that the phytoplasmas of the Baoshan branch represent a new subgroup, 16SrXI-D. These findings suggest that SCWL is caused by phytoplasmas from group 16SrXI, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D.
Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu
2007-01-01
Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838
Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling
Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.
2015-01-01
RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636
Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko
2013-01-01
Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046
Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko
2013-08-01
Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.
Yeates, Christine; Saunders, Aaron M; Crocetti, Gregory R; Blackall, Linda L
2003-05-01
The 23S rRNA-targeted probes GAM42a and BET42a provided equivocal results with the uncultured gammaproteobacterium 'Candidatus Competibacter phosphatis' where some cells bound GAM42a and other cells bound BET42a in fluorescence in situ hybridization (FISH) experiments. Probes GAM42a and BET42a span positions 1027-1043 in the 23S rRNA and differ from each other by one nucleotide at position 1033. Clone libraries were prepared from PCR products spanning the 16S rRNA genes, intergenic spacer region and 23S rRNA genes from two mixed cultures enriched in 'Candidatus C. phosphatis'. With individual clone inserts, the 16S rDNA portion was used to confirm the source organism as 'Candidatus C. phosphatis' and the 23S rDNA portion was used to determine the sequence of the GAM42a/BET42a probe target region. Of the 19 clones sequenced, 8 had the GAM42a probe target (T at position 1033) and 11 had G at position 1033, the only mismatch with GAM42a. However, none of the clones had the BET42a probe target (A at 1033). Non-canonical base-pairing between the 23S rRNA of 'Candidatus C. phosphatis' with G at position 1033 and GAM42a (G-A) or BET42a (G-T) is likely to explain the probing anomalies. A probe (GAM42_C1033) was optimized for use in FISH, targeting cells with G at position 1033, and was found to highlight not only some 'Candidatus C. phosphatis' cells, but also other bacteria. This demonstrates that there are bacteria in addition to 'Candidatus C. phosphatis' with the GAM42_C1033 probe target and not the BET42a or GAM42a probe target.
Decelle, Johan; Romac, Sarah; Stern, Rowena F; Bendif, El Mahdi; Zingone, Adriana; Audic, Stéphane; Guiry, Michael D; Guillou, Laure; Tessier, Désiré; Le Gall, Florence; Gourvil, Priscillia; Dos Santos, Adriana L; Probert, Ian; Vaulot, Daniel; de Vargas, Colomban; Christen, Richard
2015-11-01
Photosynthetic eukaryotes have a critical role as the main producers in most ecosystems of the biosphere. The ongoing environmental metabarcoding revolution opens the perspective for holistic ecosystems biological studies of these organisms, in particular the unicellular microalgae that often lack distinctive morphological characters and have complex life cycles. To interpret environmental sequences, metabarcoding necessarily relies on taxonomically curated databases containing reference sequences of the targeted gene (or barcode) from identified organisms. To date, no such reference framework exists for photosynthetic eukaryotes. In this study, we built the PhytoREF database that contains 6490 plastidial 16S rDNA reference sequences that originate from a large diversity of eukaryotes representing all known major photosynthetic lineages. We compiled 3333 amplicon sequences available from public databases and 879 sequences extracted from plastidial genomes, and generated 411 novel sequences from cultured marine microalgal strains belonging to different eukaryotic lineages. A total of 1867 environmental Sanger 16S rDNA sequences were also included in the database. Stringent quality filtering and a phylogeny-based taxonomic classification were applied for each 16S rDNA sequence. The database mainly focuses on marine microalgae, but sequences from land plants (representing half of the PhytoREF sequences) and freshwater taxa were also included to broaden the applicability of PhytoREF to different aquatic and terrestrial habitats. PhytoREF, accessible via a web interface (http://phytoref.fr), is a new resource in molecular ecology to foster the discovery, assessment and monitoring of the diversity of photosynthetic eukaryotes using high-throughput sequencing. © 2015 John Wiley & Sons Ltd.
Chim Chan, On; Casper, Peter; Sha, Li Qing; Feng, Zhi Li; Fu, Yun; Yang, Xiao Dong; Ulrich, Andreas; Zou, Xiao Ming
2008-06-01
Bacterial community structure is influenced by vegetation, climate and soil chemical properties. To evaluate these influences, terminal restriction fragment length polymorphism (T-RFLP) and cloning of the 16S rRNA gene were used to analyze the soil bacterial communities in different ecosystems in southwestern China. We compared (1) broad-leaved forest, shrub and pastures in a high-plateau region, (2) three broad-leaved forests representing a climate gradient from high-plateau temperate to subtropical and tropical regions and (3) the humus and mineral soil layers of forests, shrub lands and pastures with open and restricted grazing activities, having varied soil carbon and nutrient contents. Principal component analysis of the T-RFLP patterns revealed that soil bacterial communities of the three vegetation types were distinct. The broad-leaved forests in different climates clustered together, and relatively minor differences were observed between the soil layers or the grazing regimes. Acidobacteria dominated the broad-leaved forests (comprising 62% of the total clone sequences), but exhibited lower relative abundances in the soils of shrub (31%) and pasture (23%). Betaproteobacteria was another dominant taxa of shrub land (31%), whereas Alpha- (19%) and Gammaproteobacteria (13%) and Bacteriodetes (16%) were major components of pasture. Vegetation exerted more pronounced influences than climate and soil chemical properties.
Salzman, Nita H; de Jong, Hendrik; Paterson, Yvonne; Harmsen, Hermie J M; Welling, Gjalt W; Bos, Nicolaas A
2002-11-01
Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of these sequences, 25% (10/40) corresponded to described intestinal organisms of the mouse, including Lactobacillus spp., Helicobacter spp., segmented filamentous bacteria and members of the altered Schaedler flora (ASF360, ASF361, ASF502 and ASF519); 75% (30/40) represented novel sequences. A large number (11/40) of the novel sequences revealed a new operational taxonomic unit (OTU) belonging to the Cytophaga-Flavobacter-Bacteroides phylum, which the authors named 'mouse intestinal bacteria'. 16S rRNA probes were developed for this new OTU. Upon analysis of the novel sequences, eight were found to cluster within the Eubacterium rectale-Clostridium coccoides group and three clustered within the Bacteroides group. One of the novel sequences was distantly related to Verrucomicrobium spinosum and one was distantly related to Bacillus mycoides. Oligonucleotide probes specific for the 16S rRNA of these novel clones were generated. Using a combination of four previously described and four newly designed probes, approximately 80% of bacteria recovered from the murine large intestine and 71% of bacteria recovered from the murine caecum could be identified by fluorescence in situ hybridization (FISH).
Deciphering chicken gut microbial dynamics based on high-throughput 16S rRNA metagenomics analyses.
Mohd Shaufi, Mohd Asrore; Sieo, Chin Chin; Chong, Chun Wie; Gan, Han Ming; Ho, Yin Wan
2015-01-01
Chicken gut microbiota has paramount roles in host performance, health and immunity. Understanding the topological difference in gut microbial community composition is crucial to provide knowledge on the functions of each members of microbiota to the physiological maintenance of the host. The gut microbiota profiling of the chicken was commonly performed previously using culture-dependent and early culture-independent methods which had limited coverage and accuracy. Advances in technology based on next-generation sequencing (NGS), offers unparalleled coverage and depth in determining microbial gut dynamics. Thus, the aim of this study was to investigate the ileal and caecal microbiota development as chicken aged, which is important for future effective gut modulation. Ileal and caecal contents of broiler chicken were extracted from 7, 14, 21 and 42-day old chicken. Genomic DNA was then extracted and amplified based on V3 hyper-variable region of 16S rRNA. Bioinformatics, ecological and statistical analyses such as Principal Coordinate Analysis (PCoA) was performed in mothur software and plotted using PRIMER 6. Additional analyses for predicted metagenomes were performed through PICRUSt and STAMP software package based on Greengenes databases. A distinctive difference in bacterial communities was observed between ilea and caeca as the chicken aged (P < 0.001). The microbial communities in the caeca were more diverse in comparison to the ilea communities. The potentially pathogenic bacteria such as Clostridium were elevated as the chicken aged and the population of beneficial microbe such as Lactobacillus was low at all intervals. On the other hand, based on predicted metagenomes analysed, clear distinction in functions and roles of gut microbiota such as gene pathways related to nutrient absorption (e.g. sugar and amino acid metabolism), and bacterial proliferation and colonization (e.g. bacterial motility proteins, two-component system and bacterial secretion
Auer, Lucas; Mariadassou, Mahendra; O'Donohue, Michael; Klopp, Christophe; Hernandez-Raquet, Guillermina
2017-11-01
Next-generation sequencing technologies give access to large sets of data, which are extremely useful in the study of microbial diversity based on 16S rRNA gene. However, the production of such large data sets is not only marred by technical biases and sequencing noise but also increases computation time and disc space use. To improve the accuracy of OTU predictions and overcome both computations, storage and noise issues, recent studies and tools suggested removing all single reads and low abundant OTUs, considering them as noise. Although the effect of applying an OTU abundance threshold on α- and β-diversity has been well documented, the consequences of removing single reads have been poorly studied. Here, we test the effect of singleton read filtering (SRF) on microbial community composition using in silico simulated data sets as well as sequencing data from synthetic and real communities displaying different levels of diversity and abundance profiles. Scalability to large data sets is also assessed using a complete MiSeq run. We show that SRF drastically reduces the chimera content and computational time, enabling the analysis of a complete MiSeq run in just a few minutes. Moreover, SRF accurately determines the actual community diversity: the differences in α- and β-community diversity obtained with SRF and standard procedures are much smaller than the intrinsic variability of technical and biological replicates. © 2017 John Wiley & Sons Ltd.
Nelson, Karis N.; Neilson, Julia W.; Root, Robert A.; Chorover, Jon; Maier, Raina M.
2014-01-01
Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nifH, and amoA were monitored during a nine month phytostabilization study using buffalo grass and quailbush grown in compost-amended, metalliferous tailings. The compost amendment provided a greater than 5-log increase in bacterial abundance, and survival of this compost-inoculum was more stable in planted treatments. Despite increased abundance, the activity of the introduced community was low, and significant increases were not detected until six and nine months in quailbush, and unplanted compost and buffalo grass treatments, respectively. In addition, increased abundances of nitrogen-fixation (nifH) and ammonia-oxidizing (amoA) genes were observed in rhizospheres of buffalo grass and quailbush, respectively. Thus, plant establishment facilitated the short term stabilization of introduced bacterial biomass and supported the growth of two key nitrogen-cycling populations in compost-amended tailings. PMID:25495940
Nelson, Karis N; Neilson, Julia W; Root, Robert A; Chorover, Jon; Maier, Raina M
2015-01-01
Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nifH, and amoA were monitored during a nine month phytostabilization study using buffalo grass and quailbush grown in compost-amended, metalliferous tailings. The compost amendment provided a greater than 5-log increase in bacterial abundance, and survival of this compost-inoculum was more stable in planted treatments. Despite increased abundance, the activity of the introduced community was low, and significant increases were not detected until six and nine months in quailbush, and unplanted compost and buffalo grass treatments, respectively. In addition, increased abundances of nitrogen-fixation (nifH) and ammonia-oxidizing (amoA) genes were observed in rhizospheres of buffalo grass and quailbush, respectively. Thus, plant establishment facilitated the short term stabilization of introduced bacterial biomass and supported the growth of two key nitrogen-cycling populations in compost-amended tailings.
Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M
2012-07-01
Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
Common 5S rRNA variants are likely to be accepted in many sequence contexts
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.
2003-01-01
Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The
Horz, Hans-Peter; Yimga, Merlin Tchawa; Liesack, Werner
2001-01-01
The diversity of methanotrophic bacteria associated with roots of submerged rice plants was assessed using cultivation-independent techniques. The research focused mainly on the retrieval of pmoA, which encodes the α subunit of the particulate methane monooxygenase. A novel methanotroph-specific community-profiling method was established using the terminal restriction fragment length polymorphism (T-RFLP) technique. The T-RFLP profiles clearly revealed a more complex root-associated methanotrophic community than did banding patterns obtained by pmoA-based denaturing gradient gel electrophoresis. The comparison of pmoA-based T-RFLP profiles obtained from rice roots and bulk soil of flooded rice microcosms suggested that there was a substantially higher abundance of type I methanotrophs on rice roots than in the bulk soil. These were affiliated to the genera Methylomonas, Methylobacter, Methylococcus, and to a novel type I methanotroph sublineage. By contrast, type II methanotrophs of the Methylocystis-Methylosinus group could be detected with high relative signal intensity in both soil and root compartments. Phylogenetic treeing analyses and a set of substrate-diagnostic amino acid residues provided evidence that a novel pmoA lineage was detected. This branched distinctly from all currently known methanotrophs. To examine whether the retrieval of pmoA provided a complete view of root-associated methanotroph diversity, we also assessed the diversity detectable by recovery of genes coding for subunits of soluble methane monooxygenase (mmoX) and methanol dehydrogenase (mxaF). In addition, both 16S rRNA and 16S ribosomal DNA (rDNA) were retrieved using a PCR primer set specific to type I methanotrophs. The overall methanotroph diversity detected by recovery of mmoX, mxaF, and 16S rRNA and 16S rDNA corresponded well to the diversity detectable by retrieval of pmoA. PMID:11526021
Rölleke, S; Muyzer, G; Wawer, C; Wanner, G; Lubitz, W
1996-01-01
Medieval wall paintings are often affected by biodecay. An inventory of the existing microorganisms associated with the damage to the paintings is not yet an integral part of the restoration process. This stems from the lack of effective means for such a stocktaking. Nevertheless, fungi and bacteria cause severe damage through mechanical processes from growth into the painting and its grounding and through their metabolism. Detailed information on the bacterial colonization of ancient wall paintings is essential for the protection of the paintings. We used a molecular approach based on the detection and identification of DNA sequences encoding rRNA (rDNA) to identify bacteria present on an ancient wall painting without prior cultivation of the organisms, since it has been shown that most of these bacteria cannot be cultivated under laboratory conditions. To trace the noncultivated fraction of bacteria, total DNA from a biodegraded wall painting sample from a 13th century fresco was extracted and 194-bp fragments of the 16S rDNA were amplified with eubacterial primers. The 16S rDNA fragments of uniform length obtained from the different bacterial species were separated according to their sequence differences by denaturing gradient gel electrophoresis (DGGE). By sequencing excised and reamplified individual DNA bands, we characterized the phylogenetic affiliation of the corresponding bacteria. Using this approach, we identified members or close relatives of the genera Halomonas, Clostridium, and Frankia. To our knowledge, these groups of bacteria have not yet been isolated and implicated by conventional microbiological techniques as contributing to the biodegradation of wall paintings. PMID:8787403
Meyer, Birte; Kuever, Jan
2008-08-01
Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species), whereas 26% appeared to be P. cf. corticata specifically associated microorganisms ("specialists"); 21% of the phylotypes were confirmed to represent seawater- and sediment-derived proteobacterial species ("contaminants") acquired by filtration processes from the host environment. Consistently, the aprA and amoA gene-based analyses indicated the presence of environmentally derived sulfur- and ammonia-oxidizers besides putative sponge-specific sulfur-oxidizing Gammaproteobacteria and Alphaproteobacteria and a sulfate-reducing archaeon. A sponge-specific, endosymbiotic sulfur cycle as described for marine oligochaetes is proposed to be also present in P. cf. corticata. Overall, the results of this work support the recent studies that demonstrated the sponge species specificity of the associated microbial community while the biogeography of the host collection site has only a minor influence on the composition. In P. cf. corticata, the specificity of the sponge-microbe associations is even extended to the spatial distribution of the microorganisms within the sponge body; distinct bacterial populations were associated with the different tissue sections, papillae, outer and inner cortex, and choanosome. The local distribution of a phylotype within P. cf. corticata correlated with its (1) phylogenetic affiliation, (2) classification as sponge-specific or nonspecifically associated microorganism, and (3) potential ecological role in the host sponge.
Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C
2013-01-16
The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.
Microvariation Artifacts Introduced by PCR and Cloning of Closely Related 16S rRNA Gene Sequences†
Speksnijder, Arjen G. C. L.; Kowalchuk, George A.; De Jong, Sander; Kline, Elizabeth; Stephen, John R.; Laanbroek, Hendrikus J.
2001-01-01
A defined template mixture of seven closely related 16S-rDNA clones was used in a PCR-cloning experiment to assess and track sources of artifactual sequence variation in 16S rDNA clone libraries. At least 14% of the recovered clones contained aberrations. Artifact sources were polymerase errors, a mutational hot spot, and cloning of heteroduplexes and chimeras. These data may partially explain the high degree of microheterogeneity typical of sequence clusters detected in environmental clone libraries. PMID:11133483
Marino, Marilena; Innocente, Nadia; Maifreni, Michela; Mounier, Jérôme; Cobo-Díaz, José F.; Coton, Emmanuel; Carraro, Lisa; Cardazzo, Barbara
2017-01-01
This study explored the bacterial diversity of brines used for cheesemaking in Italy, as well as their physicochemical characteristics. In this context, 19 brines used to salt soft, semi-hard, and hard Italian cheeses were collected in 14 commercial cheese plants and analyzed using a culture-independent amplicon sequencing approach in order to describe their bacterial microbiota. Large NaCl concentration variations were observed among the selected brines, with hard cheese brines exhibiting the highest values. Acidity values showed a great variability too, probably in relation to the brine use prior to sampling. Despite their high salt content, brine microbial loads ranged from 2.11 to 6.51 log CFU/mL for the total mesophilic count. Microbial community profiling assessed by 16S rRNA gene sequencing showed that these ecosystems were dominated by Firmicutes and Proteobacteria, followed by Actinobacteria and Bacteroidetes. Cheese type and brine salinity seem to be the main parameters accountable for brine microbial diversity. On the contrary, brine pH, acidity and protein concentration, correlated to cheese brine age, did not have any selective effect on the microbiota composition. Nine major genera were present in all analyzed brines, indicating that they might compose the core microbiome of cheese brines. Staphylococcus aureus was occasionally detected in brines using selective culture media. Interestingly, bacterial genera associated with a functional and technological use were frequently detected. Indeed Bifidobacteriaceae, which might be valuable probiotic candidates, and specific microbial genera such as Tetragenococcus, Corynebacterium and non-pathogenic Staphylococcus, which can contribute to sensorial properties of ripened cheeses, were widespread within brines. PMID:29163411
Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo
2018-01-01
AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291
Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette
2012-07-01
Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Stamper, David M.; Walch, Marianne; Jacobs, Rachel N.
2003-01-01
The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD5), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time. PMID:12571004
Stamper, David M; Walch, Marianne; Jacobs, Rachel N
2003-02-01
The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD(5)), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time.
Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo
2018-04-14
To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .
Wald, Regina; Baumgartner, Martina; Urbantke, Verena; Stessl, Beatrix; Wittek, Thomas
2017-02-01
Bacteriological examination of milk samples is a prerequisite for pathogen-specific therapy and aids in limiting antimicrobial resistance. The aims of this study were to establish a standardized scheme for reliable Streptococcus uberis identification in routine diagnosis and to evaluate the accuracy of conventional tests and growing patterns of Strep. uberis on a selective medium (modified Rambach agar medium, MRAM) using 16S rRNA gene sequencing analysis as a reference method. We obtained isolates of presumptive Strep. uberis (n = 336) from quarter milk samples of dairy cows with intramammary infections and classified the isolates into 2 clusters using biochemical characterization. In cluster 1 (n = 280), cocci grew as non-hemolytic colonies, hydrolyzing esculin, carrying no Lancefield antigen (A/B/C/D/G) or Christie Atkins Munch-Petersen factor, and their growth was inhibited on an Enterococcus agar. Production of β-d-galactosidase on MRAM was shown by 257 of the cluster 1 isolates (91.79%), and 16S rRNA gene sequencing verified 271 (96.79%) of the isolates to be Strep. uberis. In 264 isolates (94.29%), MRAM agreed with the sequencing results. In cluster 2 (n = 56), isolates showed different characteristics: 37 (66.07%) were β-d-galactosidase-positive, and based on 16S sequencing results, 36 (64.29%) were identified correctly as Strep. uberis using biochemical methods. Identification success in this group differed significantly between routine diagnosis and MRAM application: MRAM agreed with sequencing results in 47 isolates (83.93%). To identify Strep. uberis and differentiate it from other lactic acid bacteria in routine diagnosis, we suggest using catalase reaction, hemolysis, esculin hydrolysis, and growth on enterococci agar. Isolates that show a typical biochemical profile can be identified satisfactorily with these tests. For Strep. uberis isolates with divergent patterns, application of MRAM as a follow-up test increased the diagnostic accuracy to 94
Wu, Shijin; Li, Yuan; Wang, Penghua; Zhong, Li; Qiu, Lequan; Chen, Jianmeng
2016-04-01
The environmental risk of fluoride and chloride pollution is pronounced in soils adjacent to solar photovoltaic sites. The elevated levels of fluoride and chloride in these soils have had significant impacts on the population size and overall biological activity of the soil microbial communities. The microbial community also plays an essential role in remediation of these soils. Questions remain as to how the fluoride and chloride contamination and subsequent remediation at these sites have impacted the population structure of the soil microbial communities. We analyzed the microbial communities in soils collected from close to a solar photovoltaic enterprise by pyrosequencing of the 16S rRNA tag. In addition, we used multivariate statistics to identity the relationships shared between sequence diversity and heterogeneity in the soil environment. The overall microbial communities were surprisingly diverse, harboring a wide variety of taxa and sharing significant correlations with different degrees of fluoride and chloride contamination. The contaminated soils harbored abundant bacteria that were probably resistant to the high acidity, high fluoride and chloride concentration, and high osmotic pressure environment. The dominant genera were Sphingomonas, Subgroup_6_norank, Clostridium sensu stricto, Nitrospira, Rhizomicrobium, and Acidithiobacillus. The results of this study provide new information regarding a previously uncharacterized ecosystem and show the value of high-throughput sequencing in the study of complex ecosystems.
Vogel, B F; Jørgensen, K; Christensen, H; Olsen, J E; Gram, L
1997-01-01
Seventy-six presumed Shewanella putrefaciens isolates from fish, oil drillings, and clinical specimens, the type strain of Shewanella putrefaciens (ATCC 8071), the type strain of Shewanella alga (IAM 14159), and the type strain of Shewanella hanedai (ATCC 33224) were compared by several typing methods. Numerical analysis of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell protein and ribotyping patterns showed that the strains were separated into two distinct clusters with 56% +/- 10% and 40% +/- 14% similarity for whole-cell protein profiling and ribotyping, respectively. One cluster consisted of 26 isolates with 52 to 55 mol% G + C and included 15 human isolates, mostly clinical specimens, 8 isolates from marine waters, and the type strain of S. alga. This homogeneous cluster of mesophilic, halotolerant strains was by all analyses identical to the recently defined species S. alga (U. Simidu et al., Int. J. Syst. Bacteriol, 40:331-336, 1990). Fifty-two typically psychrotolerant strains formed the other, more heterogeneous major cluster, with 43 to 47 mol% G + C. The type strain of S. putrefaciens was included in this group. The two groups were confirmed by 16S rRNA gene sequence analysis. It is concluded that the isolates must be considered two different species, S. alga and S. putrefaciens, and that most mesophilic isolates formerly identified as S. putrefaciens belong to S. alga. The ecological role and potential pathogenicity of S. alga can be evaluated only if the organism is correctly identified. PMID:9172338
Sharma, Kishor; Tollervey, David
1999-01-01
The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548
N6-Methylation Assessment in Escherichia coli 23S rRNA Utilizing a Bulge Loop in an RNA-DNA Hybrid.
Yoshioka, Kyoko; Kurita, Ryoji
2018-06-07
We propose a sequence-selective assay of N6-methyl-adenosine (m6A) in RNA without PCR or reverse transcription, by employing a hybridization assay with a DNA probe designed to form a bulge loop at the position of a target modified nucleotide. The m6A in the bulge in the RNA-DNA hybrid was assumed to be sufficiently mobile to be selectively recognized by an anti-m6A antibody with a high affinity. By employing a surface-plasmon-resonance measurement or using a microtiter-plate immunoassay method, a specific m6A in the Escherichia coli 23S rRNA sequence could be detected at the nanomolar level when synthesized and purified oligo-RNA fragments were used for measurement. We have successfully achieved the first selective detection of m6A 2030 specifically in 23S rRNA from real samples of E. coli total RNA by using our immunochemical approach.
Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodríguez-Hilario, Arnold; González, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G; Westra, William; Koch, Wayne; Sidransky, David
2016-08-09
Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from Oropharyngeal (OPSCC), Oral Cavity Squamous Cell Carcinoma (OCSCC) patients and normal epithelium controls, to characterize the HNSCC saliva microbiota and examine their abundance before and after surgical resection.The analyses identified a predominance of Firmicutes, Proteobacteria and Bacteroidetes, with less frequent presence of Actinobacteria and Fusobacteria before surgery. At lower taxonomic levels, the most abundant genera were Streptococcus, Prevotella, Haemophilus, Lactobacillus and Veillonella, with lower numbers of Citrobacter and Neisseraceae genus Kingella. HNSCC patients had a significant loss in richness and diversity of microbiota species (p<0.05) compared to the controls. Overall, the Operational Taxonomic Units network shows that the relative abundance of OTU's within genus Streptococcus, Dialister, and Veillonella can be used to discriminate tumor from control samples (p<0.05). Tumor samples lost Neisseria, Aggregatibacter (Proteobacteria), Haemophillus (Firmicutes) and Leptotrichia (Fusobacteria). Paired taxa within family Enterobacteriaceae, together with genus Oribacterium, distinguish OCSCC samples from OPSCC and normal samples (p<0.05). Similarly, only HPV positive samples have an abundance of genus Gemellaceae and Leuconostoc (p<0.05). Longitudinal analyses of samples taken before and after surgery, revealed a reduction in the alpha diversity measure after surgery, together with an increase of this measure in patients that recurred (p<0.05). These results suggest that microbiota may be used as HNSCC diagnostic and prognostic biomonitors.
Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodríguez-Hilario, Arnold; González, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G.; Westra, William; Koch, Wayne; Sidransky, David
2016-01-01
Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from Oropharyngeal (OPSCC), Oral Cavity Squamous Cell Carcinoma (OCSCC) patients and normal epithelium controls, to characterize the HNSCC saliva microbiota and examine their abundance before and after surgical resection. The analyses identified a predominance of Firmicutes, Proteobacteria and Bacteroidetes, with less frequent presence of Actinobacteria and Fusobacteria before surgery. At lower taxonomic levels, the most abundant genera were Streptococcus, Prevotella, Haemophilus, Lactobacillus and Veillonella, with lower numbers of Citrobacter and Neisseraceae genus Kingella. HNSCC patients had a significant loss in richness and diversity of microbiota species (p<0.05) compared to the controls. Overall, the Operational Taxonomic Units network shows that the relative abundance of OTU's within genus Streptococcus, Dialister, and Veillonella can be used to discriminate tumor from control samples (p<0.05). Tumor samples lost Neisseria, Aggregatibacter (Proteobacteria), Haemophillus (Firmicutes) and Leptotrichia (Fusobacteria). Paired taxa within family Enterobacteriaceae, together with genus Oribacterium, distinguish OCSCC samples from OPSCC and normal samples (p<0.05). Similarly, only HPV positive samples have an abundance of genus Gemellaceae and Leuconostoc (p<0.05). Longitudinal analyses of samples taken before and after surgery, revealed a reduction in the alpha diversity measure after surgery, together with an increase of this measure in patients that recurred (p<0.05). These results suggest that microbiota may be used as HNSCC diagnostic and prognostic biomonitors. PMID:27259999
Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong
2017-02-01
PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH 4 + and NH 4 + /Σ(NO 3 - + NO 2 - ) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox
Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon
2012-07-17
In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.
Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA
Ciganda, Martin; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864
Sprockett, Daniel D.; Ammons, Christine G.; Tuttle, Marie S.
2016-01-01
Clinical diagnosis of infection in chronic wounds is currently limited to subjective clinical signs and culture-based methods that underestimate the complexity of wound microbial bioburden as revealed by DNA-based microbial identification methods. Here, we use 16S rRNA next generation sequencing and quantitative polymerase chain reaction to characterize weekly changes in bacterial load, community structure, and diversity associated with a chronic venous leg ulcer over the 15-week course of treatment and healing. Our DNA-based methods and detailed sampling scheme reveal that the bacterial bioburden of the wound is unexpectedly dynamic, including changes in the bacterial load and community structure that correlate with wound expansion, antibiotic therapy, and healing. We demonstrate that these multidimensional changes in bacterial bioburden can be summarized using swabs taken prior to debridement, and therefore, can be more easily collected serially than debridement or biopsy samples. Overall, this case illustrates the importance of detailed clinical indicators and longitudinal sampling to determine the pathogenic significance of chronic wound microbial dynamics and guide best use of antimicrobials for improvement of healing outcomes. PMID:25902876
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Dalmay, Tamas
2018-01-01
RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379
Bolhuis, Henk; Stal, Lucas J
2011-11-01
Coastal microbial mats are small-scale and largely closed ecosystems in which a plethora of different functional groups of microorganisms are responsible for the biogeochemical cycling of the elements. Coastal microbial mats play an important role in coastal protection and morphodynamics through stabilization of the sediments and by initiating the development of salt-marshes. Little is known about the bacterial and especially archaeal diversity and how it contributes to the ecological functioning of coastal microbial mats. Here, we analyzed three different types of coastal microbial mats that are located along a tidal gradient and can be characterized as marine (ST2), brackish (ST3) and freshwater (ST3) systems. The mats were sampled during three different seasons and subjected to massive parallel tag sequencing of the V6 region of the 16S rRNA genes of Bacteria and Archaea. Sequence analysis revealed that the mats are among the most diverse marine ecosystems studied so far and consist of several novel taxonomic levels ranging from classes to species. The diversity between the different mat types was far more pronounced than the changes between the different seasons at one location. The archaeal community for these mats have not been studied before and revealed a strong reaction on a short period of draught during summer resulting in a massive increase in halobacterial sequences, whereas the bacterial community was barely affected. We concluded that the community composition and the microbial diversity were intrinsic of the mat type and depend on the location along the tidal gradient indicating a relation with salinity.
Ovine pedomics: the first study of the ovine foot 16S rRNA-based microbiome
USDA-ARS?s Scientific Manuscript database
We report the first study of the bacterial microbiome of ovine interdigital skin based on 16S rRNA by pyrosequencing and conventional cloning with Sanger-sequencing. Ovine foot rot is an infectious, contagious disease of sheep that causes severe lameness and economic loss from decreased flock produc...
NASA Astrophysics Data System (ADS)
Choi, D. H.; Noh, J. H.; Selph, K. E.; Lee, C. M.
2016-02-01
Photosynthetic picoeukaryotes (PPEs) are major oceanic primary producers. However, the diversity of such communities remains poorly understood, especially in the northwestern (NW) Pacific. We investigated the abundance and diversity of PPEs, and recorded environmental variables, along a transect from the coast to the open Pacific Ocean. High-throughput tag sequencing (using the MiSeq system) revealed the diversity of plastid 16S rRNA genes. The dominant PPEs changed at the class level along the transect. Prymnesiophyceae were the only dominant PPEs in the warm pool of the NW Pacific, but Mamiellophyceae dominated in coastal waters of the East China Sea. Phylogenetically, most Prymnesiophyceae sequences could not be resolved at lower taxonomic levels because no close relatives have been cultured. Within the Mamiellophyceae, the genera Micromonas and Ostreococcus dominated in marginal coastal areas affected by open water, whereas Bathycoccus dominated in the lower euphotic depths of open oligotrophic waters. Cryptophyceae and Phaeocystis (of the Prymnesiophyceae) dominated in areas affected principally by coastal water. We also defined the biogeographical distributions of Chrysophyceae, Prasinophyceae, Bacillariophyceaea, and Pelagophyceae. These distributions were influenced by temperature, salinity, and chlorophyll a and nutrient concentrations.
Shiraishi, Tsukasa; Fukuda, Kazumasa; Morotomi, Nobuo; Imamura, Yuri; Mishima, Junko; Imai, Shigeo; Miyazawa, Kiyoshi; Taniguchi, Hatsumi
2011-01-01
The aim of this study was to determine the influence of menstruation on the bacterial population of healthy Japanese women's vulvas, especially the labia minora. Labia minora swabs were obtained from 10 premenopausal, nonpregnant Japanese women at premenstruation and on day 2 of menstruation. Vaginal swabs were also obtained from 3 out of the 10 women. No significant difference was found in the average bacterial cell count between the menstruation and premenstruation samples. Molecular analysis using a 16S rRNA gene-based clone library method detected 22 genera from the labia minora swabs (total 20), with the genus Lactobacillus being predominant at both premenstruation and during menstruation in 7 out of the 10 women. Of the other 3 women, 2 showed various kinds of bacterial species, including oral and fecal bacteria, with Atopobium vaginae and Gardnerella vaginalis predominating in the remaining woman's vulva in both conditions. In total, 6 out of 10 cases (60%) showed significantly different microbiota of the labia minora between the two conditions. These results imply that menstruation may promote a distortion of the bacterial flora around the vulva, although it causes no significant increase of the bacterial count.
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-01
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591
Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M
2009-10-19
Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.
USDA-ARS?s Scientific Manuscript database
The 16S rRNA and gyrB genes of 22 Streptomyces species belonging to the Streptomyces griseus cluster were sequenced, and their taxonomic positions were re-evaluated. For correct analysis, all of the publicly available sequences of the species were collected and compared with those obtained in this s...
16S rRNA Next Generation Sequencing Analysis Shows Bacteria in Alzheimer’s Post-Mortem Brain
Emery, David C.; Shoemark, Deborah K.; Batstone, Tom E.; Waterfall, Christy M.; Coghill, Jane A.; Cerajewska, Tanya L.; Davies, Maria; West, Nicola X.; Allen, Shelley J.
2017-01-01
The neurological deterioration associated with Alzheimer’s disease (AD), involving accumulation of amyloid-beta peptides and neurofibrillary tangles, is associated with evident neuroinflammation. This is now seen to be a significant contributor to pathology. Recently the tenet of the privileged status of the brain, regarding microbial compromise, has been questioned, particularly in terms of neurodegenerative diseases. It is now being considered that microbiological incursion into the central nervous system could be either an initiator or significant contributor to these. This is a novel study using 16S ribosomal gene-specific Next generation sequencing (NGS) of extracted brain tissue. A comparison was made of the bacterial species content of both frozen and formaldehyde fixed sections of a small cohort of Alzheimer-affected cases with those of cognitively unimpaired (normal). Our findings suggest an increase in bacterial populations in Alzheimer brain tissue compared with normal. PMID:28676754
Adderson, Elisabeth E.; Boudreaux, Jan W.; Cummings, Jessica R.; Pounds, Stanley; Wilson, Deborah A.; Procop, Gary W.; Hayden, Randall T.
2008-01-01
We compared the relative levels of effectiveness of three commercial identification kits and three nucleic acid amplification tests for the identification of coryneform bacteria by testing 50 diverse isolates, including 12 well-characterized control strains and 38 organisms obtained from pediatric oncology patients at our institution. Between 33.3 and 75.0% of control strains were correctly identified to the species level by phenotypic systems or nucleic acid amplification assays. The most sensitive tests were the API Coryne system and amplification and sequencing of the 16S rRNA gene using primers optimized for coryneform bacteria, which correctly identified 9 of 12 control isolates to the species level, and all strains with a high-confidence call were correctly identified. Organisms not correctly identified were species not included in the test kit databases or not producing a pattern of reactions included in kit databases or which could not be differentiated among several genospecies based on reaction patterns. Nucleic acid amplification assays had limited abilities to identify some bacteria to the species level, and comparison of sequence homologies was complicated by the inclusion of allele sequences obtained from uncultivated and uncharacterized strains in databases. The utility of rpoB genotyping was limited by the small number of representative gene sequences that are currently available for comparison. The correlation between identifications produced by different classification systems was poor, particularly for clinical isolates. PMID:18160450
Fang, Shaoming; Xiong, Xingwei; Su, Ying; Huang, Lusheng; Chen, Congying
2017-07-19
Intramuscular fat (IMF) that deposits among muscle fibers or within muscle cells is an important meat quality trait in pigs. Previous studies observed the effects of dietary nutrients and additives on improving the pork IMF. Gut microbiome plays an important role in host metabolism and energy harvest. Whether gut microbiota exerts effect on IMF remains unknown. In this study, we investigated the microbial community structure of 500 samples from porcine cecum and feces using high-throughput 16S rRNA gene sequencing. We found that phylogenetic composition and potential function capacity of microbiome varied between two types of samples. Bacteria wide association study identified 119 OTUs significantly associated with IMF in the two types of samples (FDR < 0.1). Most of the IMF-associated OTUs belong to the bacteria related to polysaccharide degradation and amino acid metabolism (such as Prevotella, Treponema, Bacteroides and Clostridium). Potential function capacities related to metabolisms of carbohydrate, energy and amino acids, cell motility, and membrane transport were significantly associated with IMF content. FishTaco analysis suggested that the shifts of potential function capacities of microbiome associated with IMF might be caused by the IMF-associated microbial taxa. This study firstly evaluated the contribution of gut microbiome to porcine IMF content. The results presented a potential capacity for improving IMF through modulating gut microbiota.
Mills, DeEtta K; Entry, James A; Voss, Joshua D; Gillevet, Patrick M; Mathee, Kalai
2006-09-01
Amplicon length heterogeneity PCR (LH-PCR) was investigated for its ability to distinguish between microbial community patterns from the same soil type under different land management practices. Natural sagebrush and irrigated mouldboard-ploughed soils from Idaho were queried as to which hypervariable domains, or combinations of 16S rRNA gene domains, were the best molecular markers. Using standard ecological indices to measure richness, diversity and evenness, the combination of three domains, V1, V3 and V1+V2, or the combined V1 and V3 domains were the markers that could best distinguish the undisturbed natural sagebrush communities from the mouldboard-ploughed microbial communities. Bray-Curtis similarity and multidimensional scaling were found to be better metrics to ordinate and cluster the LH-PCR community profiling data. The use/misuse of traditional ecological indices such as diversity and evenness to study microbial community profiles will remain a major point to consider when performing metagenomic studies.
The rRNA evolution and procaryotic phylogeny
NASA Technical Reports Server (NTRS)
Fox, G. E.
1986-01-01
Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.
Prest, E I; El-Chakhtoura, J; Hammes, F; Saikaly, P E; van Loosdrecht, M C M; Vrouwenvelder, J S
2014-10-15
The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5 min intervals for 1 h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345 ± 15 × 10(3) to 425 ± 35 × 10(3) cells mL(-1)) and in the percentage of intact bacterial cells (from 39 ± 3.5% to 53 ± 4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. Copyright © 2014 Elsevier Ltd. All rights reserved.
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
Païssé, Sandrine; Valle, Carine; Servant, Florence; Courtney, Michael; Burcelin, Rémy; Amar, Jacques; Lelouvier, Benjamin
2016-05-01
Recent studies have revealed that the blood of healthy humans is not as sterile as previously supposed. The objective of this study was to provide a comprehensive description of the microbiome present in different fractions of the blood of healthy individuals. The study was conducted in 30 healthy blood donors to the French national blood collection center (Établissement Français du Sang). We have set up a 16S rDNA quantitative polymerase chain reaction assay as well as a 16S targeted metagenomics sequencing pipeline specifically designed to analyze the blood microbiome, which we have used on whole blood as well as on different blood fractions (buffy coat [BC], red blood cells [RBCs], and plasma). Most of the blood bacterial DNA is located in the BC (93.74%), and RBCs contain more bacterial DNA (6.23%) than the plasma (0.03%). The distribution of 16S DNA is different for each fraction and spreads over a relatively broad range among donors. At the phylum level, blood fractions contain bacterial DNA mostly from the Proteobacteria phylum (more than 80%) but also from Actinobacteria, Firmicutes, and Bacteroidetes. At deeper taxonomic levels, there are striking differences between the bacterial profiles of the different blood fractions. We demonstrate that a diversified microbiome exists in healthy blood. This microbiome has most likely an important physiologic role and could be implicated in certain transfusion-transmitted bacterial infections. In this regard, the amount of 16S bacterial DNA or the microbiome profile could be monitored to improve the safety of the blood supply. © 2016 AABB.
Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio
2001-01-01
Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387
Laothanachareon, Thanaporn; Kanchanasuta, Suwimon; Mhuanthong, Wuttichai; Phalakornkule, Chantaraporn; Pisutpaisal, Nipon; Champreda, Verawat
2014-11-01
Dark fermentation is an attractive process for generation of biohydrogen, which involves complex microbial processes on decomposition of organic wastes and subsequent conversion of metabolic intermediates to hydrogen. The microbes present in an upflow anaerobic sludge blanket (UASB) reactor for waste water treatment were tested for application in batch dark fermentation of food waste at varying ratios of feedstock to heat-treated microbial inoculum (F/M) of 1-8 (g TVS/g TVS). Biohydrogen yields between 0.39 and 2.68 mol H2/mol hexose were obtained, indicating that the yields were highly dependent on the starting F/M ratio. The highest H2 purity of 66% was obtained from the first 8 h of fermentation at the F/M ratio of 2, whereas the highest H2 production was obtained after 35 h of fermentation at the F/M ratio of 5. Tagged 16S rRNA gene pyrosequencing showed that the seed culture comprised largely of uncultured bacteria with various Proteobacteria, Bacteroidetes, and Firmicutes, while the starting food waste contained mainly lactic acid bacteria. Enrichment of Firmicutes, particularly Clostridia and lactic acid bacteria occurred within 8 h of the dark fermentation and the H2 producing microcosm at 35 h was dominated >80% by Clostridium spp. The major H2 producer was identified as a Clostridial strain related to Clostridium frigidicarnis. This work demonstrated the adaption of the microbial community during the dark fermentation of complex food waste and revealed the major roles of Clostridia in both substrate degradation and biohydrogen production. Copyright © 2014 Elsevier Ltd. All rights reserved.
Here we report results from a multi-laboratory (n=11) evaluation of four different PCR methods targeting the 16S rRNA gene of Catellicoccus marimammalium used to detect fecal contamination from birds in coastal environments. The methods included conventional end-point PCR, a SYBR...
Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax
Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis
2013-01-01
The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex
Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
Baumgardt, Kathrin; Gilet, Laetitia; Figaro, Sabine; Condon, Ciarán
2018-06-05
Ribosomal RNAs are processed from primary transcripts containing 16S, 23S and 5S rRNAs in most bacteria. Maturation generally occurs in a two-step process, consisting of a first crude separation of the major species by RNase III during transcription, followed by precise trimming of 5' and 3' extensions on each species upon accurate completion of subunit assembly. The various endo- and exoribonucleases involved in the final processing reactions are strikingly different in Escherichia coli and Bacillus subtilis, the two best studied representatives of Gram-negative and Gram-positive bacteria, respectively. Here, we show that the one exception to this rule is the protein involved in the maturation of the 3' end of 16S rRNA. Cells depleted for the essential B. subtilis YqfG protein, a homologue of E. coli YbeY, specifically accumulate 16S rRNA precursors bearing 3' extensions. Remarkably, the essential nature of YqfG can be suppressed by deleting the ribosomal RNA degrading enzyme RNase R, i.e. a ΔyqfG Δrnr mutant is viable. Our data suggest that 70S ribosomes containing 30S subunits with 3' extensions of 16S rRNA are functional to a degree, but become substrates for degradation by RNase R and are eliminated.
Yang, Qi; Franco, Christopher M M; Zhang, Wei
2015-10-01
Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.
Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua
2009-03-01
A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Estruch, G.; Collado, M. C.; Peñaranda, D. S.; Tomás Vidal, A.; Jover Cerdá, M.; Pérez Martínez, G.; Martinez-Llorens, S.
2015-01-01
Recent studies have demonstrated the impact of diet on microbiota composition, but the essential need for the optimization of production rates and costs forces farms and aquaculture production to carry out continuous dietary tests. In order to understand the effect of total fishmeal replacement by vegetable-based feed in the sea bream (Sparus aurata), the microbial composition of the stomach, foregut, midgut and hindgut was analysed using high-throughput 16S rDNA sequencing, also considering parameters of growth, survival and nutrient utilisation indices.A total of 91,539 16S rRNA filtered-sequences were analysed, with an average number of 3661.56 taxonomically assigned, high-quality sequences per sample. The dominant phyla throughout the whole gastrointestinal tract were Actinobacteria, Protebacteria and Firmicutes. A lower diversity in the stomach in comparison to the other intestinal sections was observed. The microbial composition of the Recirculating Aquaculture System was totally different to that of the sea bream gastrointestinal tract. Total fishmeal replacement had an important impact on microbial profiles but not on diversity. Streptococcus (p-value: 0.043) and Photobacterium (p-value: 0.025) were highly represented in fish fed with fishmeal and vegetable-meal diets, respectively. In the stomach samples with the vegetable diet, reads of chloroplasts and mitochondria from vegetable dietary ingredients were rather abundant. Principal Coordinate Analysis showed a clear differentiation between diets in the microbiota present in the gut, supporting the presence of specific bacterial consortia associated with the diet.Although differences in growth and nutritive parameters were not observed, a negative effect of the vegetable diet on the survival rate was determined. Further studies are required to shed more light on the relationship between the immune system and sea bream gastrointestinal tract microbiota and should consider the modulation of the microbiota to
Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid
2014-01-01
Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.
Peng, Xin; Yu, Ke-Qiang; Deng, Guan-Hua; Jiang, Yun-Xia; Wang, Yu; Zhang, Guo-Xia; Zhou, Hong-Wei
2013-12-01
Low cost and high throughput capacity are major advantages of using next generation sequencing (NGS) techniques to determine metagenomic 16S rRNA tag sequences. These methods have significantly changed our view of microorganisms in the fields of human health and environmental science. However, DNA extraction using commercial kits has shortcomings of high cost and time constraint. In the present study, we evaluated the determination of fecal microbiomes using a direct boiling method compared with 5 different commercial extraction methods, e.g., Qiagen and MO BIO kits. Principal coordinate analysis (PCoA) using UniFrac distances and clustering showed that direct boiling of a wide range of feces concentrations gave a similar pattern of bacterial communities as those obtained from most of the commercial kits, with the exception of the MO BIO method. Fecal concentration by boiling method affected the estimation of α-diversity indices, otherwise results were generally comparable between boiling and commercial methods. The operational taxonomic units (OTUs) determined through direct boiling showed highly consistent frequencies with those determined through most of the commercial methods. Even those for the MO BIO kit were also obtained by the direct boiling method with high confidence. The present study suggested that direct boiling could be used to determine the fecal microbiome and using this method would significantly reduce the cost and improve the efficiency of the sample preparation for studying gut microbiome diversity. © 2013 Elsevier B.V. All rights reserved.
Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B
2012-12-01
Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.
Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B
2012-01-01
Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185
Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site
Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard
2018-01-01
Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred
Gould, Virginia C; Okazaki, Aki; Howe, Robin A; Avison, Matthew B
2004-08-01
To determine the level of variation in the smeDEF efflux pump and smeT transcriptional regulator genes among three defined 16S rRNA sequence subgroups of clinical Stenotrophomonas maltophilia isolates. smeDEF sequencing used a PCR genome walking approach. Determination of the sequence surrounding smeDEF used a flanking primer PCR method and specific primers anchored in smeD or smeF together with random primers. smeDEF is chromosomal and located in the same position in the chromosome in all three subgroups of isolates. Flanking smeD is a gene, smeT, encoding a putative transcriptional repressor for smeDEF. Variation at these loci among the isolates is considerably lower (up to 10%) than at intrinsic beta-lactamase loci (up to 30%) in the same isolates, implying greater functional constraint. The smeD-smeT intergenic region contains a highly conserved section, which maps with previously predicted promoter/operator regions, and a hypervariable untranslated region, which can be used to subgroup clinical isolates. These data provide further evidence that it is possible to group clinical isolates of the inherently variable species, S. maltophilia, based on genotypic properties. Isolate D457, in which most work concerning smeDEF expression has been performed, does not fall into S. maltophilia subgroup A, which is the most typical.
DOE Office of Scientific and Technical Information (OSTI.GOV)
McKinsey, P.C.
2000-05-05
The U.S. Dept of Energy (DOE) Subsurface Microbial Culture Collection (SMCC) contains nearly 10,000 strains of microorganisms isolated from terrestrial subsurface environments. Many of the aerobic, gram-negative, chemoheterotrophs isolated from the DOE Savannah River Site (SRS) have previously been identified by phylogenetic analysis of 16S ribosomal RNA (rRNA) gene nucleotide sequences. These SMCC isolates are currently being examined using Biolog GN Microplates and the Biolog Microstation System in order to gain knowledge of their metabolic capabilities and to compare Biolog IDs with 16S IDs. To accommodate the particular needs of these subsurface isolates, which are often incapable of growing undermore » high-nutrient conditions, Biolog's recommendations for inoculating isolates into Biolog GN Microplates have been altered. The isolates are grown on low nutrient media, sodium thioglycolate (3mM) is added to the culture media to inhibit capsule formation, and a low density of bacteria is inoculated into the microplate. Using these altered inoculation criteria, 60 percent of these SMCC isolates have a Biolog genus ID that matches the 16S rRNA ID. These results indicate that the Biolog System can be a good means of identifying unusual environmental isolates, even when recommended inoculation procedures are altered to accommodate particular isolate needs.« less
Deng, Yongcui; Cui, Xiaoyong; Hernández, Marcela; Dumont, Marc G.
2014-01-01
The wetlands of the Qinghai-Tibetan Plateau are believed to play an important role in global nutrient cycling, but the composition and diversity of microorganisms in this ecosystem are poorly characterized. An understanding of the effects of geography and microtopography on microbial populations will provide clues to the underlying mechanisms that structure microbial communities. In this study, we used pyrosequencing-based analysis of 16S rRNA gene sequences to assess and compare the composition of soil microbial communities present in hummock and hollow soils from three wetlands (Dangxiong, Hongyuan and Maduo) on the Qinghai-Tibetan Plateau, the world’s highest plateau. A total of 36 bacterial phyla were detected. Proteobacteria (34.5% average relative abundance), Actinobacteria (17.3%) and Bacteroidetes (11%) had the highest relative abundances across all sites. Chloroflexi, Acidobacteria, Verrucomicrobia, Firmicutes, and Planctomycetes were also relatively abundant (1–10%). In addition, archaeal sequences belonging to Euryarchaea, Crenarchaea and Thaumarchaea were detected. Alphaproteobacteria sequences, especially of the order Rhodospirillales, were significantly more abundant in Maduo than Hongyuan and Dangxiong wetlands. Compared with Hongyuan soils, Dangxiong and Maduo had significantly higher relative abundances of Gammaproteobacteria sequences (mainly order Xanthomonadales). Hongyuan wetland had a relatively high abundance of methanogens (mainly genera Methanobacterium, Methanosarcina and Methanosaeta) and methanotrophs (mainly Methylocystis) compared with the other two wetlands. Principal coordinate analysis (PCoA) indicated that the microbial community structure differed between locations and microtopographies and canonical correspondence analysis indicated an association between microbial community structure and soil properties or geography. These insights into the microbial community structure and the main controlling factors in wetlands of the
Thorsen, Jonathan; Brejnrod, Asker; Mortensen, Martin; Rasmussen, Morten A; Stokholm, Jakob; Al-Soud, Waleed Abu; Sørensen, Søren; Bisgaard, Hans; Waage, Johannes
2016-11-25
There is an immense scientific interest in the human microbiome and its effects on human physiology, health, and disease. A common approach for examining bacterial communities is high-throughput sequencing of 16S rRNA gene hypervariable regions, aggregating sequence-similar amplicons into operational taxonomic units (OTUs). Strategies for detecting differential relative abundance of OTUs between sample conditions include classical statistical approaches as well as a plethora of newer methods, many borrowing from the related field of RNA-seq analysis. This effort is complicated by unique data characteristics, including sparsity, sequencing depth variation, and nonconformity of read counts to theoretical distributions, which is often exacerbated by exploratory and/or unbalanced study designs. Here, we assess the robustness of available methods for (1) inference in differential relative abundance analysis and (2) beta-diversity-based sample separation, using a rigorous benchmarking framework based on large clinical 16S microbiome datasets from different sources. Running more than 380,000 full differential relative abundance tests on real datasets with permuted case/control assignments and in silico-spiked OTUs, we identify large differences in method performance on a range of parameters, including false positive rates, sensitivity to sparsity and case/control balances, and spike-in retrieval rate. In large datasets, methods with the highest false positive rates also tend to have the best detection power. For beta-diversity-based sample separation, we show that library size normalization has very little effect and that the distance metric is the most important factor in terms of separation power. Our results, generalizable to datasets from different sequencing platforms, demonstrate how the choice of method considerably affects analysis outcome. Here, we give recommendations for tools that exhibit low false positive rates, have good retrieval power across effect sizes
Demas, Allison; Oberstaller, Jenna; DeBarry, Jeremy; Lucchi, Naomi W.; Srinivasamoorthy, Ganesh; Sumari, Deborah; Kabanywanyi, Abdunoor M.; Villegas, Leopoldo; Escalante, Ananias A.; Kachur, S. Patrick; Barnwell, John W.; Peterson, David S.; Udhayakumar, Venkatachalam; Kissinger, Jessica C.
2011-01-01
Accurate and rapid diagnosis of malaria infections is crucial for implementing species-appropriate treatment and saving lives. Molecular diagnostic tools are the most accurate and sensitive method of detecting Plasmodium, differentiating between Plasmodium species, and detecting subclinical infections. Despite available whole-genome sequence data for Plasmodium falciparum and P. vivax, the majority of PCR-based methods still rely on the 18S rRNA gene targets. Historically, this gene has served as the best target for diagnostic assays. However, it is limited in its ability to detect mixed infections in multiplex assay platforms without the use of nested PCR. New diagnostic targets are needed. Ideal targets will be species specific, highly sensitive, and amenable to both single-step and multiplex PCRs. We have mined the genomes of P. falciparum and P. vivax to identify species-specific, repetitive sequences that serve as new PCR targets for the detection of malaria. We show that these targets (Pvr47 and Pfr364) exist in 14 to 41 copies and are more sensitive than 18S rRNA when utilized in a single-step PCR. Parasites are routinely detected at levels of 1 to 10 parasites/μl. The reaction can be multiplexed to detect both species in a single reaction. We have examined 7 P. falciparum strains and 91 P. falciparum clinical isolates from Tanzania and 10 P. vivax strains and 96 P. vivax clinical isolates from Venezuela, and we have verified a sensitivity and specificity of ∼100% for both targets compared with a nested 18S rRNA approach. We show that bioinformatics approaches can be successfully applied to identify novel diagnostic targets and improve molecular methods for pathogen detection. These novel targets provide a powerful alternative molecular diagnostic method for the detection of P. falciparum and P. vivax in conventional or multiplex PCR platforms. PMID:21525225
Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne
2006-01-01
Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.
NASA Astrophysics Data System (ADS)
Chong, N. M.; Fan, C. H.; Yang, Y. C.
2017-01-01
The molecular biology method of high-throughput pyrosequencing was employed to examine the change of activated sludge community structures during the process in which activated sludge was acclimated to and degraded a target xenobiotic. The sample xenobiotic organic compound used as the activated sludge acclimation target was the herbicide 2,4-dichlorphenoxyacetic acid (2,4-D). Indigenous activated sludge microorganisms were acclimated to 2,4-D as the sole carbon source in both the batch and the continuous-flow reaction modes. Sludge masses at multiple time points during the course of acclimation were subjected to pyrosequencing targeting the microorganisms’ 16S rRNA genes. With the bacterial 16S rRNA sequencing results the genera that increased in abundance were checked with degradative pathway databases or literature to confirm that they are commonly seen as potent degraders of 2,4-D. From this systematic examination of degrader changes at time points during activated sludge acclimation and degradation of the target xenobiotic, the trend of degrader evolution in activated sludge over the sludge’s acclimation process to a xenobiotic was traced.
Duan, Chuanren; Cui, Yamin; Zhao, Yi; Zhai, Jun; Zhang, Baoyun; Zhang, Kun; Sun, Da; Chen, Hang
2016-10-01
A genetic marker within the 16S rRNA gene of Faecalibacterium was identified for use in a quantitative PCR (qPCR) assay to detect swine faecal contamination in water. A total of 146,038 bacterial sequences were obtained using 454 pyrosequencing. By comparative bioinformatics analysis of Faecalibacterium sequences with those of numerous swine and other animal species, swine-specific Faecalibacterium 16S rRNA gene sequences were identified and Polymerase Chain Okabe (PCR) primer sets designed and tested against faecal DNA samples from swine and non-swine sources. Two PCR primer sets, PFB-1 and PFB-2, showed the highest specificity to swine faecal waste and had no cross-reaction with other animal samples. PFB-1 and PFB-2 amplified 16S rRNA gene sequences from 50 samples of swine with positive ratios of 86 and 90%, respectively. We compared swine-specific Faecalibacterium qPCR assays for the purpose of quantifying the newly identified markers. The quantification limits (LOQs) of PFB-1 and PFB-2 markers in environmental water were 6.5 and 2.9 copies per 100 ml, respectively. Of the swine-associated assays tested, PFB-2 was more sensitive in detecting the swine faecal waste and quantifying the microbial load. Furthermore, the microbial abundance and diversity of the microbiomes of swine and other animal faeces were estimated using operational taxonomic units (OTUs). The species specificity was demonstrated for the microbial populations present in various animal faeces. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Zhao, H.; Yang, D.; Woese, C. R.; Bryant, M. P.
1993-01-01
After enrichment from Chinese rural anaerobic digestor sludge, anaerobic, sporing and nonsporing, saturated fatty acid-beta-oxidizing syntrophic bacteria were isolated as cocultures with H2- and formate-utilizing Methanospirillum hungatei or Desulfovibrio sp. strain G-11. The syntrophs degraded C4 to C8 saturated fatty acids, including isobutyrate and 2-methylbutyrate. They were adapted to grow on crotonate and were isolated as pure cultures. The crotonate-grown pure cultures alone did not grow on butyrate in either the presence or the absence of some common electron acceptors. However, when they were reconstituted with M. hungatei, growth on butyrate again occurred. In contrast, crotonate-grown Clostridium kluyveri and Clostridium sticklandii, as well as Clostridium sporogenes, failed to grow on butyrate when these organisms were cocultured with M. hungatei. The crotonate-grown pure subcultures of the syntrophs described above were subjected to 16S rRNA sequence analysis. Several previously documented fatty acid-beta-oxidizing syntrophs grown in pure cultures with crotonate were also subjected to comparative sequence analyses. The sequence analyses revealed that the new sporing and nonsporing isolates and other syntrophs that we sequenced, which had either gram-negative or gram-positive cell wall ultrastructure, all belonged to the phylogenetically gram-positive phylum. They were not closely related to any of the previously known subdivisions in the gram-positive phylum with which they were compared, but were closely related to each other, forming a new subdivision in the phylum. We recommend that this group be designated Syntrophomonadaceae fam. nov.; a description is given.
Parulekar, Niranjan Nitin; Kolekar, Pandurang; Jenkins, Andrew; Kleiven, Synne; Utkilen, Hans; Johansen, Anette; Sawant, Sangeeta; Kulkarni-Kale, Urmila; Kale, Mohan; Sæbø, Mona
2017-01-01
Interactions between different phytoplankton taxa and heterotrophic bacterial communities within aquatic environments can differentially support growth of various heterotrophic bacterial species. In this study, phytoplankton diversity was studied using traditional microscopic techniques and the bacterial communities associated with phytoplankton bloom were studied using High Throughput Sequencing (HTS) analysis of 16S rRNA gene amplicons from the V1-V3 and V3-V4 hypervariable regions. Samples were collected from Lake Akersvannet, a eutrophic lake in South Norway, during the growth season from June to August 2013. Microscopic examination revealed that the phytoplankton community was mostly represented by Cyanobacteria and the dinoflagellate Ceratium hirundinella. The HTS results revealed that Proteobacteria (Alpha, Beta, and Gamma), Bacteriodetes, Cyanobacteria, Actinobacteria and Verrucomicrobia dominated the bacterial community, with varying relative abundances throughout the sampling season. Species level identification of Cyanobacteria showed a mixed population of Aphanizomenon flos-aquae, Microcystis aeruginosa and Woronichinia naegeliana. A significant proportion of the microbial community was composed of unclassified taxa which might represent locally adapted freshwater bacterial groups. Comparison of cyanobacterial species composition from HTS and microscopy revealed quantitative discrepancies, indicating a need for cross validation of results. To our knowledge, this is the first study that uses HTS methods for studying the bacterial community associated with phytoplankton blooms in a Norwegian lake. The study demonstrates the value of considering results from multiple methods when studying bacterial communities.
Singh, Ajay; Gupta, Vivek Kumar; Kumar, Amit; Singh, Vikas Kumar; Nayakwadi, Shivasharanappa
2013-01-01
Brucellosis is a reemerging infectious zoonotic disease of worldwide importance. In human, it is mainly caused by Brucella melitensis, a natural pathogen for goats. In India, a large number of goats are reared in semi-intensive to intensive system within the close vicinity of human being. At present, there is no vaccination and control strategy for caprine brucellosis in the country. Thus, to formulate an effective control strategy, the status of etiological agent is essential. To cope up with these, the present study was conducted to isolate and identify the prevalent Brucella species in caprine brucellosis in India. The 30 samples (fetal membrane, fetal stomach content and vaginal swabs) collected throughout India from the aborted fetus of goats revealed the isolation of 05 isolates all belonging to Brucella melitensis biovars 3. All the isolates produced amplification products of 1412 and 720 bp in polymerase chain reaction with genus and species specific 16S rRNA and omp31 gene based primers, respectively. Moreover, the amplification of omp31 gene in all the isolates confirmed the presence of immuno dominant outer membrane protein (31 kDa omp) in all the field isolates of B. melitensis in aborted foetus of goats in India. These findings can support the development of omp31 based specific serodiagnostic test as well as vaccine for the control of caprine brucellosis in India. PMID:24453799
Hayashimoto, Nobuhito; Ueno, Masami; Tkakura, Akira; Itoh, Toshio
2007-06-01
Phylogenetic analysis based on 16S rRNA sequences with sequence data of some bacterial species of Pasteurellaceae related to rodents deposited in GenBank was performed along with biochemical characterization for the 20 strains of V-factor dependent members of Pasteurellaceae derived from laboratory rats to obtain basic information and to investigate the taxonomic positions. The results of biochemical tests for all strains were identical except for three tests, the ornithine decarboxylase test, and fermentation tests of D(+) mannose and D(+) xylose. The biochemical properties of 8 of 20 strains that showed negative results for the fermentation test of D(+) xylose agreed with those of Haemophilus parainfluenzae complex. By phylogenetic analysis, the strains were divided into two clusters that agreed with the results of the fermentation test of xylose (group I: negative reaction for xylose, group II: positive reaction for xylose). The clusters were independent of other bacterial species of Pasteurellaceae tested. The sequences of the strains in group I showed 99.7-99.8% similarity and the strains in group II showed 99.3-99.7% similarity. None of the strains in group I had a close relation with Haemophilus parainfluenzae by phylogenetic analysis, although they showed the same biochemical properties. In conclusion, the strains had characteristic biochemical properties and formed two independent groups within the "rodent cluster" of Pasteurellaceae that differed in the results of the fermentation test of xylose. Therefore, they seemed to be hitherto undescribed taxa in Pasteurellaceae.
Pettersson, B; Kodjo, A; Ronaghi, M; Uhlén, M; Tønjum, T
1998-01-01
Thirty-three strains previously classified into 11 species in the bacterial family Moraxellaceae were subjected to phylogenetic analysis based on 16S rRNA sequences. The family Moraxellaceae formed a distinct clade consisting of four phylogenetic groups as judged from branch lengths, bootstrap values and signature nucleotides. Group I contained the classical moraxellae and strains of the coccal moraxellae, previously known as Branhamella, with 16S rRNA similarity of > or = 95%. A further division of group I into five tentative clusters is discussed. Group II consisted of two strains representing Moraxella atlantae and Moraxella osloensis. These strains were only distantly related to each other (93.4%) and also to the other members of the Moraxellaceae (< or = 93%). Therefore, reasons for reclassification of these species into separate and new genera are discussed. Group III harboured strains of the genus Psychrobacter and strain 752/52 of [Moraxella] phenylpyruvica. This strain of [M.] phenylpyruvica formed an early branch from the group III line of descent. Interestingly, a distant relationship was found between Psychrobacter phenylpyruvicus strain ATCC 23333T (formerly classified as [M.] phenylpyruvica) and [M.] phenylpyruvica strain 752/52, exhibiting less than 96% nucleotide similarity between their 16S rRNA sequences. The establishment of a new genus for [M.] phenylpyruvica strain 752/52 is therefore suggested. Group IV contained only two strains of the genus Acinetobacter. Strategies for the development of diagnostic probes and distinctive sequences for 16S rRNA-based species-specific assays within group I are suggested. Although these findings add to the classificatory placements within the Moraxellaceae, analysis of a more comprehensive selection of strains is still needed to obtain a complete classification system within this family.
Wang, Deguo; Liu, Yanhong
2015-05-26
Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.
Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad
2014-01-01
In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.
Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad
2014-01-01
In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935
The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction
NASA Technical Reports Server (NTRS)
Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.
1989-01-01
Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.
Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan
2012-01-01
5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.
Xin, De-Dong; Wen, Jian-Fan
2012-01-01
Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID
Garcia, S; Kovařík, A
2013-07-01
In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.
NASA Astrophysics Data System (ADS)
Silva, H.; Cruz, J.; Sánchez-Benítez, A. M.; Santos, C.; Luís, H.; Fonseca, M.; Jesus, A. P.
2017-09-01
In recent decades, the processes of fusion of 16O were studied both theoretically and experimentally. However, the theoretical calculations are unable to fit both elastic scattering cross sections and fusion S-factors. The use of 16O thin transmission targets is required to measure the elastic forward scattering 16O + 16O reaction. The areal density of the target must be high to maximize the reaction products yields, but not so high as to allow a correct calculation of the effective beam energy. Besides this, the target must withstand beam interactions without noticeable deterioration, and contaminants must be minimal. In this study, the production of thin targets is performed with an innovative technique. Beam characterization and preliminary spectrum for the elastic scattering are also presented, showing the suitability of these targets for the proposed reaction.
Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher
2008-10-31
A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.
Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko
2015-01-01
Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244
Hotto, Amber M; Huston, Zoe E; Stern, David B
2010-09-29
The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.
Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.
2017-01-01
RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse
Jean, Audrey; Tardy, Florence; Allatif, Omran; Grosjean, Isabelle; Blanquier, Bariza
2017-01-01
Mycoplasmas (a generic name for Mollicutes) are a predominant bacterial contaminant of cell culture and cell derived products including viruses. This prokaryote class is characterized by very small size and lack of a cell wall. Consequently, mycoplasmas escape ultrafiltration and visualization under routine microscopic examination, hence the ease with which cells in culture can be contaminated, with routinely more than 10% of cell lines being contaminated. Mycoplasma are a formidable threat both in fundamental research by perverting a whole range of cell properties and functions and in the pharmacological use of cells and cell derived products. Although many methods have been developed, there is still a need for a sensitive, universal assay. Here is reported the development and validation of a quantitative polymerase chain reaction (qPCR) based on the amplification of a 1.5 kb fragment covering the 16S rDNA of the Mollicute class by real-time PCR using universal U1 and U8 degenerate primers. The method includes the addition of a DNA loading probe to each sample to monitor DNA extraction and the absence of PCR inhibitors in the extracted DNA, a positive mycoplasma 16S rDNA traceable reference sample to exclude any accidental contamination of an unknown sample with this reference DNA, an analysis procedure based on the examination of the melting curve and the size of the PCR amplicon, followed by quantification of the number of 16S rDNA copies (with a lower limit of 19 copies) when relevant, and, if useful, the identification of the contaminating prokaryote by sequencing. The method was validated on a collection of mycoplasma strains and by testing over 100 samples of unknown contamination status including stocks of viruses requiring biosafety level 2, 3 or 4 containments. When compared to four established methods, the m16S_qPCR technique exhibits the highest sensitivity in detecting mycoplasma contamination. PMID:28225826
Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko
2015-10-15
Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Technical Reports Server (NTRS)
Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.
1990-01-01
The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.
The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA
Toh, Seok-Ming; Xiong, Liqun; Bae, Taeok; Mankin, Alexander S.
2008-01-01
A2503 in 23S rRNA of the Gram-negative bacterium Escherichia coli is located in a functionally important region of the ribosome, at the entrance to the nascent peptide exit tunnel. In E. coli, and likely in other species, this adenosine residue is post-transcriptionally modified to m2A. The enzyme responsible for this modification was previously unknown. We identified E. coli protein YfgB, which belongs to the radical SAM enzyme superfamily, as the methyltransferase that modifies A2503 of 23S rRNA to m2A. Inactivation of the yfgB gene in E. coli led to the loss of modification at nucleotide A2503 of 23S rRNA as revealed by primer extension analysis and thin layer chromatography. The A2503 modification was restored when YfgB protein was expressed in the yfgB knockout strain. A similar protein was shown to catalyze post-transcriptional modification of A2503 in 23S rRNA in Gram-positive Staphylococcus aureus. The yfgB knockout strain loses in competition with wild type in a co-growth experiment, indicating functional importance of A2503 modification. The location of A2503 in the exit tunnel suggests its possible involvement in interaction with the nascent peptide and raises the possibility that its post-transcriptional modification may influence such an interaction. PMID:18025251
Garcia, S; Kovařík, A
2013-01-01
In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008
Deng, Yongcui; Cui, Xiaoyong; Hernández, Marcela; Dumont, Marc G
2014-01-01
The wetlands of the Qinghai-Tibetan Plateau are believed to play an important role in global nutrient cycling, but the composition and diversity of microorganisms in this ecosystem are poorly characterized. An understanding of the effects of geography and microtopography on microbial populations will provide clues to the underlying mechanisms that structure microbial communities. In this study, we used pyrosequencing-based analysis of 16S rRNA gene sequences to assess and compare the composition of soil microbial communities present in hummock and hollow soils from three wetlands (Dangxiong, Hongyuan and Maduo) on the Qinghai-Tibetan Plateau, the world's highest plateau. A total of 36 bacterial phyla were detected. Proteobacteria (34.5% average relative abundance), Actinobacteria (17.3%) and Bacteroidetes (11%) had the highest relative abundances across all sites. Chloroflexi, Acidobacteria, Verrucomicrobia, Firmicutes, and Planctomycetes were also relatively abundant (1-10%). In addition, archaeal sequences belonging to Euryarchaea, Crenarchaea and Thaumarchaea were detected. Alphaproteobacteria sequences, especially of the order Rhodospirillales, were significantly more abundant in Maduo than Hongyuan and Dangxiong wetlands. Compared with Hongyuan soils, Dangxiong and Maduo had significantly higher relative abundances of Gammaproteobacteria sequences (mainly order Xanthomonadales). Hongyuan wetland had a relatively high abundance of methanogens (mainly genera Methanobacterium, Methanosarcina and Methanosaeta) and methanotrophs (mainly Methylocystis) compared with the other two wetlands. Principal coordinate analysis (PCoA) indicated that the microbial community structure differed between locations and microtopographies and canonical correspondence analysis indicated an association between microbial community structure and soil properties or geography. These insights into the microbial community structure and the main controlling factors in wetlands of the Qinghai
Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C
2015-03-11
A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Choi, Dong H; An, Sung M; Chun, Sungjun; Yang, Eun C; Selph, Karen E; Lee, Charity M; Noh, Jae H
2016-02-01
Photosynthetic picoeukaryotes (PPEs) are major oceanic primary producers. However, the diversity of such communities remains poorly understood, especially in the northwestern (NW) Pacific. We investigated the abundance and diversity of PPEs, and recorded environmental variables, along a transect from the coast to the open Pacific Ocean. High-throughput tag sequencing (using the MiSeq system) revealed the diversity of plastid 16S rRNA genes. The dominant PPEs changed at the class level along the transect. Prymnesiophyceae were the only dominant PPEs in the warm pool of the NW Pacific, but Mamiellophyceae dominated in coastal waters of the East China Sea. Phylogenetically, most Prymnesiophyceae sequences could not be resolved at lower taxonomic levels because no close relatives have been cultured. Within the Mamiellophyceae, the genera Micromonas and Ostreococcus dominated in marginal coastal areas affected by open water, whereas Bathycoccus dominated in the lower euphotic depths of oligotrophic open waters. Cryptophyceae and Phaeocystis (of the Prymnesiophyceae) dominated in areas affected principally by coastal water. We also defined the biogeographical distributions of Chrysophyceae, prasinophytes, Bacillariophyceaea and Pelagophyceae. These distributions were influenced by temperature, salinity and chlorophyll a and nutrient concentrations. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek
2014-01-01
The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.
Patel, S; Yates, M; Saunders, N A
1997-01-01
A PCR-enzyme-linked immunosorbent assay (ELISA) for amplification and rapid identification of mycobacterial DNA coding for 16S rRNA was developed. The PCR selectively targeted and amplified part of the 16S rRNA gene from all mycobacteria while simultaneously labelling one strand of the amplified product with a 5' fluorescein-labelled primer. The identity of the labelled strand was subsequently determined by hybridization to a panel of mycobacterial species-specific capture probes, which were immobilized via their 5' biotin ends to a streptavidin-coated microtiter plate. Specific hybridization of a 5' fluorescein-labelled strand to a species probe was detected colorimetrically with an anti-fluorescein enzyme conjugate. The assay was able to identify 10 Mycobacterium spp. A probe able to hybridize to all Mycobacterium species (All1) was also included. By a heminested PCR, the assay was sensitive enough to detect as little as 10 fg of DNA, which is equivalent to approximately three bacilli. The assay was able to detect and identify mycobacteria directly from sputa. The specificities of the capture probes were assessed by analysis of 60 mycobacterial strains corresponding to 18 species. Probes Avi1, Int1, Kan1, Xen1, Che1, For1, Mal1, Ter1, and Gor1 were specific. The probe Tbc1 cross-hybridized with the Mycobacterium terrae amplicon. Analysis of 35 strains tested blind resulted in 34 strains being correctly identified. This method could be used for rapid identification of early cultures and may be suitable for the detection and concurrent identification of mycobacteria within clinical specimens. PMID:9276419
Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong
2016-03-01
Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Dempsey, Kate E; Riggio, Marcello P; Lennon, Alan; Hannah, Victoria E; Ramage, Gordon; Allan, David; Bagg, Jeremy
2007-01-01
It has been postulated that bacteria attached to the surface of prosthetic hip joints can cause localised inflammation, resulting in failure of the replacement joint. However, diagnosis of infection is difficult with traditional microbiological culture methods, and evidence exists that highly fastidious or non-cultivable organisms have a role in implant infections. The purpose of this study was to use culture and culture-independent methods to detect the bacteria present on the surface of prosthetic hip joints removed during revision arthroplasties. Ten consecutive revisions were performed by two surgeons, which were all clinically and radiologically loose. Five of the hip replacement revision surgeries were performed because of clinical infections and five because of aseptic loosening. Preoperative and perioperative specimens were obtained from each patient and subjected to routine microbiological culture. The prostheses removed from each patient were subjected to mild ultrasonication to dislodge adherent bacteria, followed by aerobic and anaerobic microbiological culture. Bacterial DNA was extracted from each sonicate and the 16S rRNA gene was amplified with the universal primer pair 27f/1387r. All 10 specimens were positive for the presence of bacteria by both culture and PCR. PCR products were then cloned, organised into groups by RFLP analysis and one clone from each group was sequenced. Bacteria were identified by comparison of the 16S rRNA gene sequences obtained with those deposited in public access sequence databases. A total of 512 clones were analysed by RFLP analysis, of which 118 were sequenced. Culture methods identified species from the genera Leifsonia (54.3%), Staphylococcus (21.7%), Proteus (8.7%), Brevundimonas (6.5%), Salibacillus (4.3%), Methylobacterium (2.2%) and Zimmermannella (2.2%). Molecular detection methods identified a more diverse microflora. The predominant genus detected was Lysobacter, representing 312 (60.9%) of 512 clones
Fykse, Else Marie; Aarskaug, Tone; Madslien, Elisabeth H; Dybwad, Marius
2016-12-01
High-throughput amplicon sequencing of six biomass samples from a full-scale anaerobic reactor at a Norwegian wood and pulp factory using Biothane Biobed Expanded Granular Sludge Bed (EGSB) technology during start-up and first year of operation was performed. A total of 106,166 16S rRNA gene sequences (V3-V5 region) were obtained. The number of operational taxonomic units (OTUs) ranged from 595 to 2472, and a total of 38 different phyla and 143 families were observed. The predominant phyla were Bacteroidetes, Chloroflexi, Firmicutes, Proteobacteria, and Spirochaetes. A more diverse microbial community was observed in the inoculum biomass coming from an Upflow Anaerobic Sludge Blanket (USAB) reactor, reflecting an adaptation of the inoculum diversity to the specific conditions of the new reactor. In addition, no taxa classified as obligate pathogens were identified and potentially opportunistic pathogens were absent or observed in low abundances. No Legionella bacteria were identified by traditional culture-based and molecular methods. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ruan, Yunze; Xue, Chao; Zhang, Jian; Li, Rong; Shen, Qirong
2014-01-01
Our previous work demonstrated that application of a bio-organic fertilizer (BIO) to a banana mono-culture orchard with serious Fusarium wilt disease effectively decreased the number of soil Fusarium sp. and controlled the soil-borne disease. Because bacteria are an abundant and diverse group of soil organisms that responds to soil health, deep 16 S rRNA pyrosequencing was employed to characterize the composition of the bacterial community to investigate how it responded to BIO or the application of other common composts and to explore the potential correlation between bacterial community, BIO application and Fusarium wilt disease suppression. After basal quality control, 137,646 sequences and 9,388 operational taxonomic units (OTUs) were obtained from the 15 soil samples. Proteobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes and Actinobacteria were the most frequent phyla and comprised up to 75.3% of the total sequences. Compared to the other soil samples, BIO-treated soil revealed higher abundances of Gemmatimonadetes and Acidobacteria, while Bacteroidetes were found in lower abundance. Meanwhile, on genus level, higher abundances compared to other treatments were observed for Gemmatimonas and Gp4. Correlation and redundancy analysis showed that the abundance of Gemmatimonas and Sphingomonas and the soil total nitrogen and ammonium nitrogen content were higher after BIO application, and they were all positively correlated with disease suppression. Cumulatively, the reduced Fusarium wilt disease incidence that was seen after BIO was applied for 1-year might be attributed to the general suppression based on a shift within the bacteria soil community, including specific enrichment of Gemmatimonas and Sphingomonas. PMID:24871319
Will, Christiane; Thürmer, Andrea; Wollherr, Antje; Nacke, Heiko; Herold, Nadine; Schrumpf, Marion; Gutknecht, Jessica; Wubet, Tesfaye; Buscot, François; Daniel, Rolf
2010-01-01
The diversity of bacteria in soil is enormous, and soil bacterial communities can vary greatly in structure. Here, we employed a pyrosequencing-based analysis of the V2-V3 16S rRNA gene region to characterize the overall and horizon-specific (A and B horizons) bacterial community compositions in nine grassland soils, which covered three different land use types. The entire data set comprised 752,838 sequences, 600,544 of which could be classified below the domain level. The average number of sequences per horizon was 41,824. The dominant taxonomic groups present in all samples and horizons were the Acidobacteria, Betaproteobacteria, Actinobacteria, Gammaproteobacteria, Alphaproteobacteria, Deltaproteobacteria, Chloroflexi, Firmicutes, and Bacteroidetes. Despite these overarching dominant taxa, the abundance, diversity, and composition of bacterial communities were horizon specific. In almost all cases, the estimated bacterial diversity (H′) was higher in the A horizons than in the corresponding B horizons. In addition, the H′ was positively correlated with the organic carbon content, the total nitrogen content, and the C-to-N ratio, which decreased with soil depth. It appeared that lower land use intensity results in higher bacterial diversity. The majority of sequences affiliated with the Actinobacteria, Bacteroidetes, Cyanobacteria, Fibrobacteres, Firmicutes, Spirochaetes, Verrucomicrobia, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria were derived from A horizons, whereas the majority of the sequences related to Acidobacteria, Chloroflexi, Gemmatimonadetes, Nitrospira, TM7, and WS3 originated from B horizons. The distribution of some bacterial phylogenetic groups and subgroups in the different horizons correlated with soil properties such as organic carbon content, total nitrogen content, or microbial biomass. PMID:20729324
Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita
2015-12-01
Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)]. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.
Howe, LeAnn; Ausió, Juan
1998-01-01
We sought to study the binding constraints placed on the nine-zinc-finger protein transcription factor IIIA (TFIIIA) by a histone octamer. To this end, five overlapping fragments of the Xenopus laevis oocyte and somatic 5S rRNA genes were reconstituted into nucleosomes, and it was subsequently shown that nucleosome translational positioning is a major determinant of the binding of TFIIIA to the 5S rRNA genes. Furthermore, it was found that histone acetylation cannot override the TFIIIA binding constraints imposed by unfavorable translational positions. PMID:9488430
Moreno, Y; Moreno-Mesonero, L; Amorós, I; Pérez, R; Morillo, J A; Alonso, J L
2018-01-01
Understanding waterborne protozoan parasites (WPPs) diversity has important implications in public health. In this study, we evaluated a NGS-based method as a detection approach to identify simultaneously most important WPPs using 18S rRNA high-throughput sequencing. A set of primers to target the V4 18S rRNA region of WPPs such as Cryptosporidium spp., Giardia sp., Blastocystis sp., Entamoeba spp, Toxoplasma sp. and free-living amoebae (FLA) was designed. In order to optimize PCR conditions before sequencing, both a mock community with a defined composition of representative WPPs and a real water sample inoculated with specific WPPs DNA were prepared. Using the method proposed in this study, we have detected the presence of Giardia intestinalis, Acanthamoeba castellanii, Toxoplasma gondii, Entamoeba histolytica and Blastocystis sp. at species level in real irrigation water samples. Our results showed that untreated surface irrigation water in open fields can provide an important source of WPPs. Therefore, the methodology proposed in this study can establish a basis for an accurate and effective diagnostic of WPPs to provide a better understanding of the risk associated to irrigation water. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.
48 CFR 52.216-16 - Incentive Price Revision-Firm Target.
Code of Federal Regulations, 2010 CFR
2010-10-01
...-Firm Target. 52.216-16 Section 52.216-16 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.216-16 Incentive Price Revision—Firm Target. As prescribed in 16.406(a), insert the following clause: Incentive Price Revision—Firm Target (OCT 1997) (a) General. The supplies or services identified...
48 CFR 52.216-16 - Incentive Price Revision-Firm Target.
Code of Federal Regulations, 2011 CFR
2011-10-01
...-Firm Target. 52.216-16 Section 52.216-16 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.216-16 Incentive Price Revision—Firm Target. As prescribed in 16.406(a), insert the following clause: Incentive Price Revision—Firm Target (OCT 1997) (a) General. The supplies or services identified...
Whiteson, Katrine L.; Lazarevic, Vladimir; Tangomo-Bento, Manuela; Girard, Myriam; Maughan, Heather; Pittet, Didier; Francois, Patrice; Schrenzel, Jacques
2014-01-01
We aim to understand the microbial ecology of noma (cancrum oris), a devastating ancient illness which causes severe facial disfigurement in>140,000 malnourished children every year. The cause of noma is still elusive. A chaotic mix of microbial infection, oral hygiene and weakened immune system likely contribute to the development of oral lesions. These lesions are a plausible entry point for unidentified microorganisms that trigger gangrenous facial infections. To catalog bacteria present in noma lesions and identify candidate noma-triggering organisms, we performed a cross-sectional sequencing study of 16S rRNA gene amplicons from sixty samples of gingival fluid from twelve healthy children, twelve children suffering from noma (lesion and healthy sites), and twelve children suffering from Acute Necrotizing Gingivitis (ANG) (lesion and healthy sites). Relative to healthy individuals, samples taken from lesions in diseased mouths were enriched with Spirochaetes and depleted for Proteobacteria. Samples taken from healthy sites of diseased mouths had proportions of Spirochaetes and Proteobacteria that were similar to healthy control individuals. Samples from noma mouths did not have a higher abundance of Fusobacterium, casting doubt on its role as a causative agent of noma. Microbial communities sampled from noma and ANG lesions were dominated by the same Prevotella intermedia OTU, which was much less abundant in healthy sites sampled from the same mouths. Multivariate analysis confirmed that bacterial communities in healthy and lesion sites were significantly different. Several OTUs in the Orders Erysipelotrichales, Clostridiales, Bacteroidales, and Spirochaetales were identified as indicators of noma, suggesting that one or more microbes within these Orders is associated with the development of noma lesions. Future studies should include longitudinal sampling of viral and microbial components of this community, before and early in noma lesion development. PMID
Tunney, Michael M.; Patrick, Sheila; Curran, Martin D.; Ramage, Gordon; Hanna, Donna; Nixon, James R.; Gorman, Sean P.; Davis, Richard I.; Anderson, Neil
1999-01-01
In this study the detection rates of bacterial infection of hip prostheses by culture and nonculture methods were compared for 120 patients with total hip revision surgery. By use of strict anaerobic bacteriological practice during the processing of samples and without enrichment, the incidence of infection by culture of material dislodged from retrieved prostheses after ultrasonication (sonicate) was 22%. Bacteria were observed by immunofluorescence microscopy in 63% of sonicate samples with a monoclonal antibody specific for Propionibacterium acnes and polyclonal antiserum specific for Staphylococcus spp. The bacteria were present either as single cells or in aggregates of up to 300 bacterial cells. These aggregates were not observed without sonication to dislodge the biofilm. Bacteria were observed in all of the culture-positive samples, and in some cases in which only one type of bacterium was identified by culture, both coccoid and coryneform bacteria were observed by immunofluorescence microscopy. Bacteria from skin-flake contamination were readily distinguishable from infecting bacteria by immunofluorescence microscopy. Examination of skin scrapings did not reveal large aggregates of bacteria but did reveal skin cells. These were not observed in the sonicates. Bacterial DNA was detected in 72% of sonicate samples by PCR amplification of a region of the bacterial 16S rRNA gene with universal primers. All of the culture-positive samples were also positive for bacterial DNA. Evidence of high-level infiltration either of neutrophils or of lymphocytes or macrophages into associated tissue was observed in 73% of patients. Our results indicate that the incidence of prosthetic joint infection is grossly underestimated by current culture detection methods. It is therefore imperative that current clinical practice with regard to the detection and subsequent treatment of prosthetic joint infection be reassessed in the light of these results. PMID:10488193
[Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].
Petrov, N B; Vladychenskaia, N S
2005-01-01
Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.
Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G
2015-06-01
Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation
Identification of a novel subgroup 16SrII-U phytoplasma associated with papaya little leaf disease.
Yang, Yi; Jiang, Lei; Che, Haiyan; Cao, Xueren; Luo, Daquan
2016-09-01
Papaya is an important fruit crop cultivated in tropical and subtropical regions. Papaya little leaf (PLL) disease was observed in China. The phytoplasma 16S rRNA gene was detected from symptomatic papaya trees via PCR using phytoplasma universal primers P1/P7 followed by R16F2n/R16R2. No amplification products were obtained from templates of asymptomatic papaya trees. These results indicated a direct association between phytoplasma infection and PLL disease. Comparative and phylogenetic analyses of 16S rRNA gene sequences indicated that the papaya-infecting phytoplasmas under study belonged to the peanut witches' broom phytoplasma group (16SrII). Genotyping through use of computer-simulated RFLP analysis of 16S rRNA genes and coefficients of RFLP pattern similarities (0.97) reveal that the PLL phytoplasma was placed in a new subgroup. In this article, we describe the molecular characterization of a new phytoplasma associated with PLL disease and propose that the PLL phytoplasma be considered as a novel subgroup, 16SrII-U.
Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome
Garone, Caterina; D’Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal
2017-01-01
Abstract Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2’-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2’-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. PMID:28973171
Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome.
Garone, Caterina; D'Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal
2017-11-01
Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. © The Author 2017. Published by Oxford University Press.
Sergeant, Martin J.; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W.; Pallen, Mark J.
2012-01-01
The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers. PMID:22666455
Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J
2012-01-01
The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.
Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis
Liiv, Aivar; Karitkina, Diana; Maiväli, Ülo; Remme, Jaanus
2005-01-01
Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes. PMID:16053518
Wang, Zuo; Elekwachi, Chijioke; Jiao, Jinzhen; Wang, Min; Tang, Shaoxun; Zhou, Chuanshe; Tan, Zhiliang; Forster, Robert J
2017-01-01
The objective of this present study was to explore the initial establishment of metabolically active bacteria and subsequent evolution in four fractions: rumen solid-phase (RS), liquid-phase (RL), protozoa-associated (RP), and epithelium-associated (RE) through early weaning and supplementing rhubarb root powder in 7 different age groups (1, 10, 20, 38, 41, 50, and 60 d) during rumen development. Results of the 16S rRNA sequencing based on RNA isolated from the four fractions revealed that the potentially active bacterial microbiota in four fractions were dominated by the phyla Proteobacteria, Firmicutes , and Bacteroidetes regardless of different ages. An age-dependent increment of Chao 1 richness was observed in the fractions of RL and RE. The principal coordinate analysis (PCoA) indicated that samples in four fractions all clustered based on different age groups, and the structure of the bacterial community in RE was distinct from those in other three fractions. The abundances of Proteobacteria decreased significantly ( P < 0.05) with age, while increases in the abundances of Firmicutes and Bacteroidetes were noted. At the genus level, the abundance of the predominant genus Mannheimia in the Proteobacteria phylum decreased significantly ( P < 0.05) after 1 d, while the genera Quinella, Prevotella, Fretibacterium, Ruminococcus, Lachnospiraceae NK3A20 group , and Atopobium underwent different manners of increases and dominated the bacterial microbiota across four fractions. Variations of the distributions of some specific bacterial genera across fractions were observed, and supplementation of rhubarb affected the relative abundance of various genera of bacteria.
Wang, Zuo; Elekwachi, Chijioke; Jiao, Jinzhen; Wang, Min; Tang, Shaoxun; Zhou, Chuanshe; Tan, Zhiliang; Forster, Robert J.
2017-01-01
The objective of this present study was to explore the initial establishment of metabolically active bacteria and subsequent evolution in four fractions: rumen solid-phase (RS), liquid-phase (RL), protozoa-associated (RP), and epithelium-associated (RE) through early weaning and supplementing rhubarb root powder in 7 different age groups (1, 10, 20, 38, 41, 50, and 60 d) during rumen development. Results of the 16S rRNA sequencing based on RNA isolated from the four fractions revealed that the potentially active bacterial microbiota in four fractions were dominated by the phyla Proteobacteria, Firmicutes, and Bacteroidetes regardless of different ages. An age-dependent increment of Chao 1 richness was observed in the fractions of RL and RE. The principal coordinate analysis (PCoA) indicated that samples in four fractions all clustered based on different age groups, and the structure of the bacterial community in RE was distinct from those in other three fractions. The abundances of Proteobacteria decreased significantly (P < 0.05) with age, while increases in the abundances of Firmicutes and Bacteroidetes were noted. At the genus level, the abundance of the predominant genus Mannheimia in the Proteobacteria phylum decreased significantly (P < 0.05) after 1 d, while the genera Quinella, Prevotella, Fretibacterium, Ruminococcus, Lachnospiraceae NK3A20 group, and Atopobium underwent different manners of increases and dominated the bacterial microbiota across four fractions. Variations of the distributions of some specific bacterial genera across fractions were observed, and supplementation of rhubarb affected the relative abundance of various genera of bacteria. PMID:28223972
Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der
2017-11-06
Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.