Abasic pivot substitution harnesses target specificity of RNA interference
Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook
2015-01-01
Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372
Evaluation and control of miRNA-like off-target repression for RNA interference.
Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook
2018-03-01
RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
Cardiovascular RNA interference therapy: the broadening tool and target spectrum.
Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina
2013-08-16
Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.
Ethical Perspectives on RNA Interference Therapeutics
Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou
2008-01-01
RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370
RNA interference targets arbovirus replication in Culicoides cells.
Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain
2013-03-01
Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.
Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu
2013-01-01
Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330
Generation of siRNA Nanosheets for Efficient RNA Interference
NASA Astrophysics Data System (ADS)
Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum
2016-04-01
After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of
RNA virus interference via CRISPR/Cas13a system in plants.
Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy
2018-01-04
CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
RNA Interference in Infectious Tropical Diseases
Hong, Young S.
2008-01-01
Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671
RNA targeting with CRISPR-Cas13.
Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng
2017-10-12
RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.
Advance of RNA interference technique in Hemipteran insects.
Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia
2012-07-24
RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
RNA therapeutics: Beyond RNA interference and antisense oligonucleotides
Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney
2016-01-01
Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036
RNA Interference Therapies for an HIV-1 Functional Cure.
Scarborough, Robert J; Gatignol, Anne
2017-12-27
HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.
Prokaryotic Argonautes - variations on the RNA interference theme.
van der Oost, John; Swarts, Daan C; Jore, Matthijs M
2014-04-15
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.
Prokaryotic Argonautes - variations on the RNA interference theme
van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.
2014-01-01
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...
Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.
2012-01-01
Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330
Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.
Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M
2018-05-01
Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.
Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao
2013-02-01
To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.
Photoinduced RNA interference.
Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi
2012-07-17
Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of
Respiratory viral diseases: access to RNA interference therapy
Bitko, Vira; Barik, Sailen
2008-01-01
This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824
Domain motions of Argonaute, the catalytic engine of RNA interference
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-01-01
Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142
Domain motions of Argonaute, the catalytic engine of RNA interference.
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-11-30
The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.
Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang
2016-11-20
To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.
Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia
2018-06-01
When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...
Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.
2013-01-01
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Modulating drug resistance by targeting BCRP/ABCG2 using retrovirus-mediated RNA interference.
Xie, Ni; Mou, Lisha; Yuan, Jianhui; Liu, Wenlan; Deng, Tingting; Li, Zigang; Jing, Yi; Jin, Yi; Hu, Zhangli
2014-01-01
The BCRP/ABCG2 transporter, which mediates drug resistance in many types of cells, depends on energy provided by ATP hydrolysis. Here, a retrovirus encoding a shRNA targeting the ATP-binding domain of this protein was used to screen for highly efficient agents that could reverse drug resistance and improve cell sensitivity to drugs, thus laying the foundation for further studies and applications. To target the ATP-binding domain of BCRP/ABCG2, pLenti6/BCRPsi shRNA recombinant retroviruses, with 20 bp target sequences starting from the 270th, 745th and 939th bps of the 6th exon, were constructed and packaged. The pLenti6/BCRPsi retroviruses (V-BCRPi) that conferred significant knockdown effects were screened using a drug-sensitivity experiment and flow cytometry. The human choriocarcinoma cell line JAR, which highly expresses endogenous BCRP/ABCG2, was injected under the dorsal skin of a hairless mouse to initiate a JAR cytoma. After injecting V-BCRPi-infected JAR tumor cells into the dorsal skin of hairless mice, BCRP/ABCG2 expression in the tumor tissue was determined using immunohistochemistry, fluorescent quantitative RT-PCR and Western blot analyses. After intraperitoneal injection of BCRP/ABCG2-tolerant 5-FU, the tumor volume, weight change, and apoptosis rate of the tumor tissue were determined using in situ hybridization. V-BCRPi increased the sensitivity of the tumor histiocytes to 5-FU and improved the cell apoptosis-promoting effects of 5-FU in the tumor. The goal of the in vivo and in vitro studies was to screen for an RNA interference recombinant retrovirus capable of stably targeting the ATP-binding domain of BCRP/ABCG2 (V-BCRPi) to inhibit its function. A new method to improve the chemo-sensitivity of breast cancer and other tumor cells was discovered, and this method could be used for gene therapy and functional studies of malignant tumors.
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea
Marraffini, Luciano A.; Sontheimer, Erik J.
2010-01-01
Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085
2006-12-01
Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential
Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A
2017-02-01
RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.
Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R
2016-08-01
To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth
PsOr1, a potential target for RNA interference-based pest management.
Zhao, Y Y; Liu, F; Yang, G; You, M S
2011-02-01
Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.
RNA Interference: Biology, Mechanism, and Applications
Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.
2003-01-01
Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679
[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].
Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente
2010-01-01
RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.
Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease
Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John
2012-01-01
Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703
Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.
O'Connell, Mitchell
2018-06-22
Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.
Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying
2016-01-01
RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro
Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.
2013-01-01
Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792
Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang
2014-01-01
Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
RNA interference-based nanosystems for inflammatory bowel disease therapy
Guo, Jian; Jiang, Xiaojing; Gui, Shuangying
2016-01-01
Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo
2012-08-01
A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.
Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian
2017-10-01
Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.
RNA therapeutics targeting osteoclast-mediated excessive bone resorption
Wang, Yuwei; Grainger, David W
2011-01-01
RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356
Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.
Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu
2014-02-04
TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.
Efficacy of a Novel Class of RNA Interference Therapeutic Agents
Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki
2012-01-01
RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145
Current siRNA Targets in Atherosclerosis and Aortic Aneurysm
Pradhan-Nabzdyk, Leena; Huang, Chenyu; Logerfo, Frank W.; Nabzdyk, Christoph S.
2014-01-01
Atherosclerosis (ATH) and aortic aneurysms (AA) remain challenging chronic diseases that confer high morbidity and mortality despite advances in medical, interventional, and surgical care. RNA interference represents a promising technology that may be utilized to silence genes contributing to ATH and AA. Despite positive results in preclinical and some clinical feasibility studies, challenges such as target/sequence validation, tissue specificity, transfection efficiency, and mitigation of unwanted off-target effects remain to be addressed. In this review the most current targets and some novel approaches in siRNA delivery are being discussed. Due to the plethora of investigated targets, only studies published between 2010 and 2014 were included. PMID:24882715
Yang, Wenbin; Zhao, Xiaoqing; Liang, Ran; Chen, Da
2017-09-01
To investigate the effects of small RNA interference targeting mammalian target of rapamycin (mTOR) expression on paraquat-induced pulmonary fibrosis in rats. Human embryonic kidney cells HEK-293 were cultured in vitro. The mTOR small interfering RNA (mTOR-siRNA) expression plasmid transfection lentivirus was constructed, and non-specific sequence plasmid with no homology to mTOR gene was set as the control. Seventy-two healthy male Sprague-Dawley (SD) rats were randomly divided into normal saline (NS) control group, paraquat model group, mTOR unrelated sequence group, and mTOR-siRNA group, with 18 rats in each group. Paraquat poisoning animal model was reproduced by intraperitoneally injecting 20% paraquat solution 15 mg/kg, while the NS control group was intraperitoneally injected the same volumes of NS. Rats in the mTOR unrelated sequence group and mTOR-siRNA group were injected 1×10 9 TU/mL lentivirus solution 50 μL into the airway, respectively, while in the NS control group and paraquat model group were injected the same volumes of NS. At 7, 14 and 28 days after treatment, 6 rats in each group were sacrificed respectively for lung tissue, the pathological changes and fibrosis of lung tissues were observed under light microscope. The levels of hydroxyproline (HYP) in lung tissues were determined by alkaline hydrolysis. The mRNA and protein expressions of mTOR in lung tissues were determined by reverse transcription-polymerase chain reaction (RT-PCR) and Western Blot. Under light microscope, there was no obvious pathological changes in the lung tissues in the NS control group, while in the paraquat model group and mTOR unrelated sequence group, lung tissue in rats were damaged, there were a lot of inflammatory cell infiltration, a large number of matrix collagen and fibrous tissues hyperplasia, and gradually increased with time, and it was consistent with paraquat-induced lung tissue fibrosis process. The pathological and fibrotic changes in lung tissue of mTOR-siRNA
Targeting a KH-domain protein with RNA decoys.
Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A
2002-09-01
RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins.
Targeting a KH-domain protein with RNA decoys.
Makeyev, Aleksandr V; Eastmond, Dawn L; Liebhaber, Stephen A
2002-01-01
RNA-binding proteins are involved in the regulation of many aspects of eukaryotic gene expression. Targeted interference with RNA-protein interactions could offer novel approaches to modulation of expression profiles, alteration of developmental pathways, and reversal of certain disease processes. Here we investigate a decoy strategy for the study of the alphaCP subgroup of KH-domain RNA-binding proteins. These poly(C)-binding proteins have been implicated in a wide spectrum of posttranscriptional controls. Three categories of RNA decoys to alphaCPs were studied: poly(C) homopolymers, native mRNA-binding sites, and a high-affinity structure selected from a combinatorial library. Native chemistry was found to be essential for alphaCP decoy action. Because alphaCP proteins are found in both the nucleus and cytoplasm, decoy cassettes were incorporated within both nuclear (U1 snRNA) and cytoplasmic (VA1 RNA) RNA frameworks. Several sequences demonstrated optimal decoy properties when assayed for protein-binding and decoy bioactivity in vitro. A subset of these transcripts was shown to mediate targeted inhibition of alphaCP-dependent translation when expressed in either the nucleus or cytoplasm of transfected cells. Significantly, these studies establish the feasibility of developing RNA decoys that can selectively target biologic functions of abundant and widely expressed RNA binding proteins. PMID:12358435
Molecular mechanisms influencing efficiency of RNA interference in insects.
Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan
2018-06-21
RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.
Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko
2015-12-01
RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
RNA interference in the clinic: challenges and future directions
Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.
2011-01-01
Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526
RNA Interference for improving the Outcome of Islet Transplantation
Li, Feng; Mahato, Ram I
2010-01-01
Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190
Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting
De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.
2007-01-01
RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355
Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang
2013-01-01
Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
On future's doorstep: RNA interference and the pharmacopeia of tomorrow.
Gewirtz, Alan M
2007-12-01
Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.
Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.
2009-01-01
Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors.
Konermann, Silvana; Lotfy, Peter; Brideau, Nicholas J; Oki, Jennifer; Shokhirev, Maxim N; Hsu, Patrick D
2018-04-19
Class 2 CRISPR-Cas systems endow microbes with diverse mechanisms for adaptive immunity. Here, we analyzed prokaryotic genome and metagenome sequences to identify an uncharacterized family of RNA-guided, RNA-targeting CRISPR systems that we classify as type VI-D. Biochemical characterization and protein engineering of seven distinct orthologs generated a ribonuclease effector derived from Ruminococcus flavefaciens XPD3002 (CasRx) with robust activity in human cells. CasRx-mediated knockdown exhibits high efficiency and specificity relative to RNA interference across diverse endogenous transcripts. As one of the most compact single-effector Cas enzymes, CasRx can also be flexibly packaged into adeno-associated virus. We target virally encoded, catalytically inactive CasRx to cis elements of pre-mRNA to manipulate alternative splicing, alleviating dysregulated tau isoform ratios in a neuronal model of frontotemporal dementia. Our results present CasRx as a programmable RNA-binding module for efficient targeting of cellular RNA, enabling a general platform for transcriptome engineering and future therapeutic development. Copyright © 2018 Elsevier Inc. All rights reserved.
RNAi revised--target mRNA-dependent enhancement of gene silencing.
Dornseifer, Simon; Willkomm, Sarah; Far, Rosel Kretschmer-Kazemi; Liebschwager, Janine; Beltsiou, Foteini; Frank, Kirsten; Laufer, Sandra D; Martinetz, Thomas; Sczakiel, Georg; Claussen, Jens Christian; Restle, Tobias
2015-12-15
The discovery of RNA interference (RNAi) gave rise to the development of new nucleic acid-based technologies as powerful investigational tools and potential therapeutics. Mechanistic key details of RNAi in humans need to be deciphered yet, before such approaches take root in biomedicine and molecular therapy. We developed and validated an in silico-based model of siRNA-mediated RNAi in human cells in order to link in vitro-derived pre-steady state kinetic data with a quantitative and time-resolved understanding of RNAi on the cellular level. The observation that product release by Argonaute 2 is accelerated in the presence of an excess of target RNA in vitro inspired us to suggest an associative mechanism for the RNA slicer reaction where incoming target mRNAs actively promote dissociation of cleaved mRNA fragments. This novel associative model is compatible with high multiple turnover rates of RNAi-based gene silencing in living cells and accounts for target mRNA concentration-dependent enhancement of the RNAi machinery. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells
2005-07-01
pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23. My initial studies
Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.
2012-01-01
Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421
Hassan, Ali
2006-06-01
RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.
Huang, Mei; Wu, Joseph C
2011-01-01
Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.
Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia
Huang, Mei; Wu, Joseph C.
2011-01-01
Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.
Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C
2017-01-01
The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems
Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther
2017-01-01
ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect
Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.
Gredell, Joseph A; Berger, Angela K; Walton, S Patrick
2008-07-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si
Impact of target mRNA structure on siRNA silencing efficiency: a large-scale study
Gredell, Joseph A.; Berger, Angela K.; Walton, S. Patrick
2009-01-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5’- and 3’-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5’-end or 3’-end were silenced, on average, ~10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate siRNAs. PMID
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans
Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635
Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao
2014-04-01
During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.
Multimodality Imaging of RNA Interference
Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo
2013-01-01
The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-01-01
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-03-03
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.
The promises and pitfalls of RNA-interference-based therapeutics
Castanotto, Daniela; Rossi, John J.
2009-01-01
The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789
Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.
Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K
1995-01-01
We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978
RNA interference: from biology to drugs and therapeutics.
Appasani, Krishnarao
2004-07-01
RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
DeVincenzo, John P
2009-10-01
A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Targeting Promoter-Associated Noncoding RNA In Vivo.
Civenni, Gianluca
2017-01-01
There are many classes of noncoding RNAs (ncRNAs), with wide-ranging functionalities (e.g., RNA editing, mediation of mRNA splicing, ribosomal function). MicroRNAs (miRNAs) and long ncRNAs (lncRNAs) are implicated in a wide variety of cellular processes, including the regulation of gene expression. Incorrect expression or mutation of lncRNAs has been reported to be associated with several disease conditions, such a malignant transformation in humans. Importantly, pivotal players in tumorigenesis and cancer progression, such as c-Myc, may be regulated by lncRNA at promoter level. The function of lncRNA can be reduced with antisense oligonucleotides that sequester or degrade mature lncRNAs. In alternative, lncRNA transcription can be blocked by small interference RNA (RNAi), which had acquired, recently, broad interested in clinical applications. In vivo-jetPEI™ is a linear polyethylenimine mediating nucleic acid (DNA, shRNA, siRNA, oligonucelotides) delivery with high efficiency. Different in vivo delivery routes have been validated: intravenous (IV), intraperitoneal (IP), intratumoral, subcutaneous, topical, and intrathecal. High levels of nucleic acid delivery are achieved into a broad range of tissues, such as lung, salivary glands, heart, spleen, liver, and prostate upon systemic administration. In addition, in vivo-jetPEI™ is also an efficient carrier for local gene and siRNA delivery such as intratumoral or topical application on the skin. After systemic injection, siRNA can be detected and the levels can be validated in target tissues by qRT-PCR. Targeting promoter-associated lncRNAs with siRNAs (small interfering RNAs) in vivo is becoming an exciting breakthrough for the treatment of human disease.
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
RNA interference-mediated intrinsic antiviral immunity in invertebrates.
Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul
2013-01-01
In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.
RNA Interference in Moths: Mechanisms, Applications, and Progress
Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He
2016-01-01
The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...
2016-10-13
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon
2012-01-01
Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300
Silence of the transcripts: RNA interference in medicine.
Barik, Sailen
2005-10-01
Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.
RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.
Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil
2017-01-01
Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
EGF receptor targeted lipo-oligocation polyplexes for antitumoral siRNA and miRNA delivery
NASA Astrophysics Data System (ADS)
Müller, Katharina; Klein, Philipp M.; Heissig, Philipp; Roidl, Andreas; Wagner, Ernst
2016-11-01
Antitumoral siRNA and miRNA delivery was demonstrated by epidermal growth factor receptor (EGFR) targeted oligoaminoamide polyplexes. For this purpose, the T-shaped lipo-oligomer 454 was used to complex RNA into a core polyplex, which was subsequently functionalized with the targeting peptide ligand GE11 via a polyethylene glycol (PEG) linker. To this end, free cysteines on the surface of 454 polyplex were coupled with a maleimide-PEG-GE11 reagent (Mal-GE11). Resulting particles with sizes of 120-150 nm showed receptor-mediated uptake into EGFR-positive T24 bladder cancer cells, MDA-MB 231 breast cancer cells and Huh7 liver cancer cells. Furthermore, these formulations led to ligand-dependent gene silencing. RNA interference (RNAi) triggered antitumoral effects were observed for two different therapeutic RNAs, a miRNA-200c mimic or EG5 siRNA. Using polyplexes modified with a ratio of 0.8 molar equivalents of Mal-GE11, treatment of T24 or MDA-MB 231 cancer cells with miR-200c led to the expected decreased proliferation and migration, changes in cell cycle and enhanced sensitivity towards doxorubicin. Delivery of EG5 siRNA into Huh7 cells resulted in antitumoral activity with G2/M arrest, triggered by loss of mitotic spindle separation and formation of mono-astral spindles. These findings demonstrate the potential of GE11 ligand-containing RNAi polyplexes for cancer treatment.
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
Short hairpin RNA interference therapy for ischemic heart disease.
Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C
2008-09-30
During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by
He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi
2009-02-01
The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight
Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu
2016-12-01
RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing
Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom
2015-01-01
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.
Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom
2015-05-14
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.
Bellissimo, Teresa; Masciarelli, Silvia; Poser, Elena; Genovese, Ilaria; Del Rio, Alberto; Colotti, Gianni; Fazi, Francesco
2017-01-01
The development of small-molecule-based target therapy design for human disease and cancer is object of growing attention. Recently, specific microRNA (miRNA) mimicking compounds able to bind the miRNA-binding domain of Argonaute 2 protein (AGO2) to inhibit miRNA loading and its functional activity were described. Computer-aided molecular design techniques and RNA immunoprecipitation represent suitable approaches to identify and experimentally determine if a compound is able to impair the loading of miRNAs on AGO2 protein. Here, we describe these two methodologies that we recently used to select a specific compound able to interfere with the AGO2 functional activity and able to improve the retinoic acid-dependent myeloid differentiation of leukemic cells.
RNA interference therapy: a new solution for intracranial atherosclerosis?
Tang, Tao; Wong, Ka-Sing
2014-01-01
Intracranial atherosclerotic stenosis (ICAS) of a major intracranial artery, especially middle cerebral artery (MCA), is reported to be one leading cause of ischemic stroke throughout the world. Compared with other stroke subtypes, ICAS is associated with a higher risk of recurrent stroke despite aggressive medical therapy. Increased understanding of the pathophysiology of ICAS has highlighted several possible targets for therapeutic interventions. Both luminal stenosis and plaque components of ICAS have been found to be associated with ischemic stroke based a post-mortem study. Recent application of high-resolution magnetic resonance imaging (HRMRI) in evaluating ICAS provides new insight into the vascular biology of plaque morphology and component. High signal on T1-weighted fat-suppressed images (HST1) within MCA plaque of HRMRI, highly suggested of fresh or recent intraplaque hemorrhage, has been found to be associated with ipsilateral brain infarction. Thus, the higher prevalence of intraplaque hemorrhage and neovasculature in symptomatic patients with MCA stenosis may provide a potential target for plaque stabilization. We hypothesize that RNA interference (RNAi) therapy delivered by modified nanoparticles may achieve in vivo biomedical imaging and targeted therapy. With the rapid developments in studies about therapeutic and diagnostic nanomaterials, future studies further exploring the molecular biology of atherosclerosis may provide more drug targets for plaque stabilization. PMID:25333054
Small molecules targeting viral RNA.
Hermann, Thomas
2016-11-01
Highly conserved noncoding RNA (ncRNA) elements in viral genomes and transcripts offer new opportunities to expand the repertoire of drug targets for the development of antiinfective therapy. Ligands binding to ncRNA architectures are able to affect interactions, structural stability or conformational changes and thereby block processes essential for viral replication. Proof of concept for targeting functional RNA by small molecule inhibitors has been demonstrated for multiple viruses with RNA genomes. Strategies to identify antiviral compounds as inhibitors of ncRNA are increasingly emphasizing consideration of drug-like properties of candidate molecules emerging from screening and ligand design. Recent efforts of antiviral lead discovery for RNA targets have provided drug-like small molecules that inhibit viral replication and include inhibitors of human immunodeficiency virus (HIV), hepatitis C virus (HCV), severe respiratory syndrome coronavirus (SARS CoV), and influenza A virus. While target selectivity remains a challenge for the discovery of useful RNA-binding compounds, a better understanding is emerging of properties that define RNA targets amenable for inhibition by small molecule ligands. Insight from successful approaches of targeting viral ncRNA in HIV, HCV, SARS CoV, and influenza A will provide a basis for the future exploration of RNA targets for therapeutic intervention in other viral pathogens which create urgent, unmet medical needs. Viruses for which targeting ncRNA components in the genome or transcripts may be promising include insect-borne flaviviruses (Dengue, Zika, and West Nile) and filoviruses (Ebola and Marburg). WIREs RNA 2016, 7:726-743. doi: 10.1002/wrna.1373 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.
Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin
2012-02-01
Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.
HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.
Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J
2015-01-01
MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.
Targeted delivery of siRNA into breast cancer cells via phage fusion proteins.
Bedi, Deepa; Gillespie, James W; Petrenko, Vasily A; Ebner, Andreas; Leitner, Michael; Hinterdorfer, Peter; Petrenko, Valery A
2013-02-04
Nucleic acids, including antisense oligonucleotides, small interfering RNA (siRNA), aptamers, and rybozymes, emerged as versatile therapeutics due to their ability to interfere in a well-planned manner with the flow of genetic information from DNA to protein. However, a systemic use of NAs is hindered by their instability in physiological liquids and inability of intracellular accumulation in the site of action. We first evaluated the potential of cancer specific phage fusion proteins as targeting ligands that provide encapsulation, protection, and navigation of siRNA to the target cell. The tumor-specific proteins were isolated from phages that were affinity selected from a landscape phage library against target breast cancer cells. It was found that fusion phage coat protein fpVIII displaying cancer-targeting peptides can effectively encapsulate siRNAs and deliver them into the cells leading to specific silencing of the model gene GAPDH. Complexes of siRNA and phage protein form nanoparticles (nanophages), which were characterized by atomic force microscopy and ELISA, and their stability was demonstrated by resistance of encapsulated siRNA to degradation by serum nucleases. The phage protein/siRNA complexes can make a new type of highly selective, stable, active, and physiologically acceptable cancer nanomedicine.
Kenesi, Erzsébet; Lózsa, Rita
2017-01-01
Abstract In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. PMID:28499009
RNA-dependent RNA targeting by CRISPR-Cas9
Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A
2018-01-01
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo. We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. These results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications. PMID:29303478
Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P
2016-11-15
cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.
2016-01-01
the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. PMID:27581979
Short hairpin RNA interference therapy for ischemic heart disease
Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.
2013-01-01
Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to
Yau, Edwin H.; Butler, Mark C.; Sullivan, Jack M.
2016-01-01
Major bottlenecks in development of therapeutic post transcriptional gene silencing (PTGS) agents (e.g. ribozymes, RNA interference, antisense) include the challenge of mapping rare accessible regions of the mRNA target that are open for annealing and cleavage, testing and optimization of agents in human cells to identify lead agents, testing for cellular toxicity, and preclinical evaluation in appropriate animal models of disease. Methods for rapid and reliable cellular testing of PTGS agents are needed to identify potent lead candidates for optimization. Our goal was to develop a means of rapid assessment of many RNA agents to identify a lead candidate for a given mRNA associated with a disease state. We developed a rapid human cell-based screening platform to test efficacy of hammerhead ribozyme (hhRz) or RNA interference (RNAi) constructs, using a model retinal degeneration target, human rod opsin (RHO) mRNA. The focus is on RNA Drug Discovery for diverse retinal degeneration targets. To validate the approach, candidate hhRzs were tested against NUH↓ cleavage sites (N=G,C,A,U; H=C,A,U) within the target mRNA of secreted alkaline phosphatase (SEAP), a model gene expression reporter, based upon in silico predictions of mRNA accessibility. HhRzs were embedded in a larger stable adenoviral VAI RNA scaffold for high cellular expression, cytoplasmic trafficking, and stability. Most hhRz expression plasmids exerted statistically significant knockdown of extracellular SEAP enzyme activity when readily assayed by a fluorescence enzyme assay intended for high throughput screening (HTS). Kinetics of PTGS knockdown of cellular targets is measureable in live cells with the SEAP reporter. The validated SEAP HTS platform was transposed to identify lead PTGS agents against a model hereditary retinal degeneration target, RHO mRNA. Two approaches were used to physically fuse the model retinal gene target mRNA to the SEAP reporter mRNA. The most expedient way to evaluate a
Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J
2005-01-01
Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.
RNA interference-based therapeutics: new strategies to fight infectious disease.
López-Fraga, M; Wright, N; Jiménez, A
2008-12-01
For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.
Drug Target Interference in Immunogenicity Assays: Recommendations and Mitigation Strategies.
Zhong, Zhandong Don; Clements-Egan, Adrienne; Gorovits, Boris; Maia, Mauricio; Sumner, Giane; Theobald, Valerie; Wu, Yuling; Rajadhyaksha, Manoj
2017-11-01
Sensitive and specific methodology is required for the detection and characterization of anti-drug antibodies (ADAs). High-quality ADA data enables the evaluation of potential impact of ADAs on the drug pharmacokinetic profile, patient safety, and efficacious response to the drug. Immunogenicity assessments are typically initiated at early stages in preclinical studies and continue throughout the drug development program. One of the potential bioanalytical challenges encountered with ADA testing is the need to identify and mitigate the interference mediated by the presence of soluble drug target. A drug target, when present at sufficiently high circulating concentrations, can potentially interfere with the performance of ADA and neutralizing antibody (NAb) assays, leading to either false-positive or, in some cases, false-negative ADA and NAb assay results. This publication describes various mechanisms of assay interference by soluble drug target, as well as strategies to recognize and mitigate such target interference. Pertinent examples are presented to illustrate the impact of target interference on ADA and NAb assays as well as several mitigation strategies, including the use of anti-target antibodies, soluble versions of the receptors, target-binding proteins, lectins, and solid-phase removal of targets. Furthermore, recommendations for detection and mitigation of such interference in different formats of ADA and NAb assays are provided.
Zhou, Yinjian; Zhang, Chunling; Liang, Wei
2014-11-10
RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.
RNA-dependent RNA targeting by CRISPR-Cas9
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strutt, Steven C.; Torrez, Rachel M.; Kaya, Emine
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo.more » We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. In conclusion, these results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications.« less
RNA-dependent RNA targeting by CRISPR-Cas9
Strutt, Steven C.; Torrez, Rachel M.; Kaya, Emine; ...
2018-01-05
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo.more » We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. In conclusion, these results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications.« less
Liu, Shi-He; Rao, Donald D.; Nemunaitis, John; Senzer, Neil; Zhou, Guisheng; Dawson, David; Gingras, Marie-Claude; Wang, Zhaohui; Gibbs, Richard; Norman, Michael; Templeton, Nancy S.; DeMayo, Francesco J.; O'Malley, Bert; Sanchez, Robbi; Fisher, William E.; Brunicardi, F. Charles
2012-01-01
Pancreatic and duodenal homeobox-1 (PDX-1) is a transcription factor that regulates insulin expression and islet maintenance in the adult pancreas. Our recent studies demonstrate that PDX-1 is an oncogene for pancreatic cancer and is overexpressed in pancreatic cancer. The purpose of this study was to demonstrate that PDX-1 is a therapeutic target for both hormonal symptoms and tumor volume in mouse models of pancreatic cancer, insulinoma and islet neoplasia. Immunohistochemistry of human pancreatic and islet neoplasia specimens revealed marked PDX-1 overexpression, suggesting PDX-1 as a “drugable” target within these diseases. To do so, a novel RNA interference effector platform, bifunctional shRNAPDX-1, was developed and studied in mouse and human cell lines as well as in mouse models of pancreatic cancer, insulinoma and islet neoplasia. Systemic delivery of bi-shRNAhumanPDX-1 lipoplexes resulted in marked reduction of tumor volume and improved survival in a human pancreatic cancer xenograft mouse model. bi-shRNAmousePDX-1 lipoplexes prevented death from hyperinsulinemia and hypoglycemia in an insulinoma mouse model. shRNAmousePDX-1 lipoplexes reversed hyperinsulinemia and hypoglycemia in an immune-competent mouse model of islet neoplasia. PDX-1 was overexpressed in pancreatic neuroendocrine tumors and nesidioblastosis. These data demonstrate that PDX-1 RNAi therapy controls hormonal symptoms and tumor volume in mouse models of pancreatic cancer, insulinoma and islet neoplasia, therefore, PDX-1 is a potential therapeutic target for these pancreatic diseases. PMID:22905092
Scavenger receptor mediates systemic RNA interference in ticks.
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.
Scavenger Receptor Mediates Systemic RNA Interference in Ticks
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043
Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.
2016-01-01
RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800
Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt
2017-07-27
In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Palanca-Wessels, Maria C.; Booth, Garrett C.; Convertine, Anthony J.; Lundy, Brittany B.; Berguig, Geoffrey Y.; Press, Michael F.; Stayton, Patrick S.; Press, Oliver W.
2016-01-01
The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5′ RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5′ RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy. PMID:26840082
Palanca-Wessels, Maria C; Booth, Garrett C; Convertine, Anthony J; Lundy, Brittany B; Berguig, Geoffrey Y; Press, Michael F; Stayton, Patrick S; Press, Oliver W
2016-02-23
The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5' RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5' RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
RNA interference tools for the western flower thrips, Frankliniella occidentalis.
Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E
2015-05-01
The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced
Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia
2005-12-01
RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.
Memory for found targets interferes with subsequent performance in multiple-target visual search.
Cain, Matthew S; Mitroff, Stephen R
2013-10-01
Multiple-target visual searches--when more than 1 target can appear in a given search display--are commonplace in radiology, airport security screening, and the military. Whereas 1 target is often found accurately, additional targets are more likely to be missed in multiple-target searches. To better understand this decrement in 2nd-target detection, here we examined 2 potential forms of interference that can arise from finding a 1st target: interference from the perceptual salience of the 1st target (a now highly relevant distractor in a known location) and interference from a newly created memory representation for the 1st target. Here, we found that removing found targets from the display or making them salient and easily segregated color singletons improved subsequent search accuracy. However, replacing found targets with random distractor items did not improve subsequent search accuracy. Removing and highlighting found targets likely reduced both a target's visual salience and its memory load, whereas replacing a target removed its visual salience but not its representation in memory. Collectively, the current experiments suggest that the working memory load of a found target has a larger effect on subsequent search accuracy than does its perceptual salience. PsycINFO Database Record (c) 2013 APA, all rights reserved.
RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA
Cui, Yalei; Huang, Tianzhi; Zhang, Xiaobo
2015-01-01
MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex. PMID:26674414
Exploring Fusarium head blight disease control by RNA interference
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...
RNA interference mediated in human primary cells via recombinant baculoviral vectors.
Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T
2005-04-01
The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.
Genetic Validation of Aminoacyl-tRNA Synthetases as Drug Targets in Trypanosoma brucei
Kalidas, Savitha; Cestari, Igor; Monnerat, Severine; Li, Qiong; Regmi, Sandesh; Hasle, Nicholas; Labaied, Mehdi; Parsons, Marilyn; Stuart, Kenneth
2014-01-01
Human African trypanosomiasis (HAT) is an important public health threat in sub-Saharan Africa. Current drugs are unsatisfactory, and new drugs are being sought. Few validated enzyme targets are available to support drug discovery efforts, so our goal was to obtain essentiality data on genes with proven utility as drug targets. Aminoacyl-tRNA synthetases (aaRSs) are known drug targets for bacterial and fungal pathogens and are required for protein synthesis. Here we survey the essentiality of eight Trypanosoma brucei aaRSs by RNA interference (RNAi) gene expression knockdown, covering an enzyme from each major aaRS class: valyl-tRNA synthetase (ValRS) (class Ia), tryptophanyl-tRNA synthetase (TrpRS-1) (class Ib), arginyl-tRNA synthetase (ArgRS) (class Ic), glutamyl-tRNA synthetase (GluRS) (class 1c), threonyl-tRNA synthetase (ThrRS) (class IIa), asparaginyl-tRNA synthetase (AsnRS) (class IIb), and phenylalanyl-tRNA synthetase (α and β) (PheRS) (class IIc). Knockdown of mRNA encoding these enzymes in T. brucei mammalian stage parasites showed that all were essential for parasite growth and survival in vitro. The reduced expression resulted in growth, morphological, cell cycle, and DNA content abnormalities. ThrRS was characterized in greater detail, showing that the purified recombinant enzyme displayed ThrRS activity and that the protein localized to both the cytosol and mitochondrion. Borrelidin, a known inhibitor of ThrRS, was an inhibitor of T. brucei ThrRS and showed antitrypanosomal activity. The data show that aaRSs are essential for T. brucei survival and are likely to be excellent targets for drug discovery efforts. PMID:24562907
Runo, Steven
2011-01-01
RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.
Oulas, Anastasis; Karathanasis, Nestoras; Louloupi, Annita; Pavlopoulos, Georgios A; Poirazi, Panayiota; Kalantidis, Kriton; Iliopoulos, Ioannis
2015-01-01
Computational methods for miRNA target prediction are currently undergoing extensive review and evaluation. There is still a great need for improvement of these tools and bioinformatics approaches are looking towards high-throughput experiments in order to validate predictions. The combination of large-scale techniques with computational tools will not only provide greater credence to computational predictions but also lead to the better understanding of specific biological questions. Current miRNA target prediction tools utilize probabilistic learning algorithms, machine learning methods and even empirical biologically defined rules in order to build models based on experimentally verified miRNA targets. Large-scale protein downregulation assays and next-generation sequencing (NGS) are now being used to validate methodologies and compare the performance of existing tools. Tools that exhibit greater correlation between computational predictions and protein downregulation or RNA downregulation are considered the state of the art. Moreover, efficiency in prediction of miRNA targets that are concurrently verified experimentally provides additional validity to computational predictions and further highlights the competitive advantage of specific tools and their efficacy in extracting biologically significant results. In this review paper, we discuss the computational methods for miRNA target prediction and provide a detailed comparison of methodologies and features utilized by each specific tool. Moreover, we provide an overview of current state-of-the-art high-throughput methods used in miRNA target prediction.
RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA.
Cui, Yalei; Huang, Tianzhi; Zhang, Xiaobo
2015-12-01
MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex. © 2015 The Authors.
RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.
Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana
2018-01-01
Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.
Endogenous miRNA and Target Concentrations Determine Susceptibility to Potential ceRNA Competition
Bosson, Andrew D.; Zamudio, Jesse R.; Sharp, Phillip A.
2016-01-01
SUMMARY Target competition (ceRNA crosstalk) within miRNA-regulated gene networks has been proposed to influence biological systems. To assess target competition, we characterize and quantitate miRNA networks in two cell types. Argonaute iCLIP reveals that hierarchical binding of high- to low-affinity miRNA targets is a key characteristic of in vivo activity. Quantification of cellular miRNA and mRNA/ncRNA target pool levels indicates that miRNA:target pool ratios and an affinity partitioned target pool accurately predict in vivo Ago binding profiles and miRNA susceptibility to target competition. Using single-cell reporters, we directly test predictions and estimate that ~3,000 additional high-affinity target sites can affect active miRNA families with low endogenous miRNA:target ratios, such as miR-92/25. In contrast, the highly expressed miR-294 and let-7 families are not susceptible to increases of nearly 10,000 sites. These results show differential susceptibility based on endogenous miRNA:target pool ratios and provide a physiological context for ceRNA competition in vivo. PMID:25449132
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.
Wang, Leo L; Burdick, Jason A
2017-01-01
It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V
2018-06-01
The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.
Mechanism of MicroRNA-Target Interaction: Molecular Dynamics Simulations and Thermodynamics Analysis
Wang, Yonghua; Li, Yan; Ma, Zhi; Yang, Wei; Ai, Chunzhi
2010-01-01
MicroRNAs (miRNAs) are endogenously produced ∼21-nt riboregulators that associate with Argonaute (Ago) proteins to direct mRNA cleavage or repress the translation of complementary RNAs. Capturing the molecular mechanisms of miRNA interacting with its target will not only reinforce the understanding of underlying RNA interference but also fuel the design of more effective small-interfering RNA strands. To address this, in the present work the RNA-bound (Ago-miRNA, Ago-miRNA-target) and RNA-free Ago forms were analyzed by performing both molecular dynamics simulations and thermodynamic analysis. Based on the principal component analysis results of the simulation trajectories as well as the correlation analysis in fluctuations of residues, we discover that: 1) three important (PAZ, Mid and PIWI) domains exist in Argonaute which define the global dynamics of the protein; 2) the interdomain correlated movements are so crucial for the interaction of Ago-RNAs that they not only facilitate the relaxation of the interactions between residues surrounding the RNA binding channel but also induce certain conformational changes; and 3) it is just these conformational changes that expand the cavity of the active site and open putative pathways for both the substrate uptake and product release. In addition, by thermodynamic analysis we also discover that for both the guide RNA 5′-end recognition and the facilitated site-specific cleavage of the target, the presence of two metal ions (of Mg2+) plays a predominant role, and this conclusion is consistent with the observed enzyme catalytic cleavage activity in the ternary complex (Ago-miRNA-mRNA). Our results find that it is the set of arginine amino acids concentrated in the nucleotide-binding channel in Ago, instead of the conventionally-deemed seed base-paring, that makes greater contributions in stabilizing the binding of the nucleic acids to Ago. PMID:20686687
Chemical modification: the key to clinical application of RNA interference?
Corey, David R.
2007-01-01
RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019
Qian, Yuan; Qiao, Sha; Dai, Yanfeng; Xu, Guoqiang; Dai, Bolei; Lu, Lisen; Yu, Xiang; Luo, Qingming; Zhang, Zhihong
2017-09-26
Tumor-associated macrophages (TAMs) are a promising therapeutic target for cancer immunotherapy. Targeted delivery of therapeutic drugs to the tumor-promoting M2-like TAMs is challenging. Here, we developed M2-like TAM dual-targeting nanoparticles (M2NPs), whose structure and function were controlled by α-peptide (a scavenger receptor B type 1 (SR-B1) targeting peptide) linked with M2pep (an M2 macrophage binding peptide). By loading anti-colony stimulating factor-1 receptor (anti-CSF-1R) small interfering RNA (siRNA) on the M2NPs, we developed a molecular-targeted immunotherapeutic approach to specifically block the survival signal of M2-like TAMs and deplete them from melanoma tumors. We confirmed the validity of SR-B1 for M2-like TAM targeting and demonstrated the synergistic effect of the two targeting units (α-peptide and M2pep) in the fusion peptide (α-M2pep). After being administered to tumor-bearing mice, M2NPs had higher affinity to M2-like TAMs than to tissue-resident macrophages in liver, spleen, and lung. Compared with control treatment groups, M2NP-based siRNA delivery resulted in a dramatic elimination of M2-like TAMs (52%), decreased tumor size (87%), and prolonged survival. Additionally, this molecular-targeted strategy inhibited immunosuppressive IL-10 and TGF-β production and increased immunostimulatory cytokines (IL-12 and IFN-γ) expression and CD8 + T cell infiltration (2.9-fold) in the tumor microenvironment. Moreover, the siRNA-carrying M2NPs down-regulated expression of the exhaustion markers (PD-1 and Tim-3) on the infiltrating CD8 + T cells and stimulated their IFN-γ secretion (6.2-fold), indicating the restoration of T cell immune function. Thus, the dual-targeting property of M2NPs combined with RNA interference provides a potential strategy of molecular-targeted cancer immunotherapy for clinical application.
Wei, Jie; Jones, Jeffrey; Kang, Jing; Card, Ananda; Krimm, Michael; Hancock, Paula; Pei, Yi; Ason, Brandon; Payson, Elmer; Dubinina, Natalya; Cancilla, Mark; Stroh, Mark; Burchard, Julja; Sachs, Alan B; Hochman, Jerome H; Flanagan, W Michael; Kuklin, Nelly A
2011-06-01
Deeper knowledge of pharmacokinetic and pharmacodynamic (PK/PD) concepts for RNA therapeutics is important to streamline the drug development process and for rigorous selection of best performing drug candidates. Here we characterized the PK/PD relationship for small interfering RNAs (siRNAs) targeting luciferase by examining siRNA concentration in plasma and liver, the temporal RNA-induced silencing complex binding profiles, mRNA reduction, and protein inhibition measured by noninvasive bioluminescent imaging. A dose-dependent and time-related decrease in bioluminescence was detected over 25 days after a single treatment of a lipid nanoparticle-formulated siRNA targeting luciferase messenger RNA. A direct relationship was observed between the degree of in vivo mRNA and protein reduction and the Argonaute2 (Ago2)-bound siRNA fraction but not with the total amount of siRNA found in the liver, suggesting that the Ago2-siRNA complex is the key determinant of target inhibition. These observations were confirmed for an additional siRNA that targets endogenously expressed Sjögren syndrome antigen B (Ssb) mRNA, indicating that our observations are not limited to a transgenic mouse system. Our data provide detailed information of the temporal regulation of siRNA liver delivery, Ago2 loading, mRNA reduction, and protein inhibition that are essential for the rapid and cost-effective clinical development of siRNAs therapeutics.
[RNA interference library research progress and its application in cancer research].
Zhao, Ning; Cai, Li
2013-02-01
RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.
Killiny, Nabil; Kishk, Abdelaziz
2017-06-01
RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.
Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy
2017-11-01
RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A
2017-01-01
CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.
Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H
2016-03-20
RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.
Targeting the kinesin Eg5 to monitor siRNA transfection in mammalian cells.
Weil, D; Garçon, L; Harper, M; Duménil, D; Dautry, F; Kress, M
2002-12-01
RNA interference, the inhibition of gene expression by double-stranded RNA, provides a powerful tool for functional studies once the sequence of a gene is known. In most mammalian cells, only short molecules can be used because long ones induce the interferon pathway. With the identification of a proper target sequence, the penetration of the oligonucleotides constitutes the most serious limitation in the application of this technique. Here we show that a small interfering RNA (siRNA) targeting the mRNA of the kinesin Eg5 induces a rapid mitotic arrest and provides a convenient assay for the optimization of siRNA transfection. Thus, dose responses can be established for different transfection techniques, highlighting the great differences in response to transfection techniques of various cell types. We report that the calcium phosphate precipitation technique can be an efficient and cost-effective alternative to Oligofectamine in some adherent cells, while electroporation can be efficient for some cells growing in suspension such as hematopoietic cells and some adherent cells. Significantly, the optimal parameters for the electroporation of siRNA differ from those for plasmids, allowing the use of milder conditions that induce less cell toxicity. In summary, a single siRNA leading to an easily assayed phenotype can be used to monitor the transfection of siRNA into any type of proliferating cells of both human and murine origin.
Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E
2018-05-04
Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for
2011-01-01
Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546
McCAIN, JACK
2004-01-01
Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Interfering RNA with multi-targets for efficient gene suppression in HCC cells.
Li, Tiejun; Zhu, York Yuanyuan; Ji, Yi; Zhou, Songfeng
2018-06-01
RNA interference (RNAi) technology has been widely used in therapeutics development, especially multiple targeted RNAi strategy, which is a better method for multiple gene suppression. In the study, interfering RNAs (iRNAs) were designed for carrying two or three different siRNA sequences in different secondary structure formats (loop or cloverleaf). By using these types of iRNAs, co-inhibition of survivin and B-cell lymphoma-2 (Bcl-2) was investigated in hepatocellular carcinoma (HCC) cells, and we obtained promising gene silencing effects without showing undesirable interferon response. Furthermore, suppression effects on proliferation, invasion, and induced apoptosis in HCC cells were validated. The results suggest that long iRNAs with secondary structure may be a preferred strategy for multigenic disease therapy, especially for cancer and viral gene therapy and their iRNA drug development.
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Crooke, Stanley T; Witztum, Joseph L; Bennett, C Frank; Baker, Brenda F
2018-04-03
RNA-targeted therapies represent a platform for drug discovery involving chemically modified oligonucleotides, a wide range of cellular RNAs, and a novel target-binding motif, Watson-Crick base pairing. Numerous hurdles considered by many to be impassable have been overcome. Today, four RNA-targeted therapies are approved for commercial use for indications as diverse as Spinal Muscular Atrophy (SMA) and reduction of low-density lipoprotein cholesterol (LDL-C) and by routes of administration including subcutaneous, intravitreal, and intrathecal delivery. The technology is efficient and supports approaching "undruggable" targets. Three additional agents are progressing through registration, and more are in clinical development, representing several chemical and structural classes. Moreover, progress in understanding the molecular mechanisms by which these drugs work has led to steadily better clinical performance and a wide range of mechanisms that may be exploited for therapeutic purposes. Here we summarize the progress, future challenges, and opportunities for this drug discovery platform. Copyright © 2018 Elsevier Inc. All rights reserved.
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
Structural basis for microRNA targeting
Schirle, Nicole T.; Sheu-Gruttadauria, Jessica; MacRae, Ian J.
2014-10-31
MicroRNAs (miRNAs) control expression of thousands of genes in plants and animals. miRNAs function by guiding Argonaute proteins to complementary sites in messenger RNAs (mRNAs) targeted for repression. In this paper, we determined crystal structures of human Argonaute-2 (Ago2) bound to a defined guide RNA with and without target RNAs representing miRNA recognition sites. These structures suggest a stepwise mechanism, in which Ago2 primarily exposes guide nucleotides (nt) 2 to 5 for initial target pairing. Pairing to nt 2 to 5 promotes conformational changes that expose nt 2 to 8 and 13 to 16 for further target recognition. Interactions withmore » the guide-target minor groove allow Ago2 to interrogate target RNAs in a sequence-independent manner, whereas an adenosine binding-pocket opposite guide nt 1 further facilitates target recognition. Spurious slicing of miRNA targets is avoided through an inhibitory coordination of one catalytic magnesium ion. Finally, these results explain the conserved nucleotide-pairing patterns in animal miRNA target sites first observed over two decades ago.« less
Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs
2015-01-01
Development of nontoxic, tumor-targetable, and potent in vivo RNA delivery systems remains an arduous challenge for clinical application of RNAi therapeutics. Herein, we report a versatile RNAi nanoplatform based on tumor-targeted and pH-responsive nanoformulas (NFs). The NF was engineered by combination of an artificial RNA receptor, Zn(II)-DPA, with a tumor-targetable and drug-loadable hyaluronic acid nanoparticle, which was further modified with a calcium phosphate (CaP) coating by in situ mineralization. The NF can encapsulate small-molecule drugs within its hydrophobic inner core and strongly secure various RNA molecules (siRNAs, miRNAs, and oligonucleotides) by utilizing Zn(II)-DPA and a robust CaP coating. We substantiated the versatility of the RNAi nanoplatform by demonstrating effective delivery of siRNA and miRNA for gene silencing or miRNA replacement into different human types of cancer cells in vitro and into tumor-bearing mice in vivo by intravenous administration. The therapeutic potential of NFs coloaded with an anticancer drug doxorubicin (Dox) and multidrug resistance 1 gene target siRNA (siMDR) was also demonstrated in this study. NFs loaded with Dox and siMDR could successfully sensitize drug-resistant OVCAR8/ADR cells to Dox and suppress OVCAR8/ADR tumor cell proliferation in vitro and tumor growth in vivo. This gene/drug delivery system appears to be a highly effective nonviral method to deliver chemo- and RNAi therapeutics into host cells. PMID:24779637
Literature-based condition-specific miRNA-mRNA target prediction.
Oh, Minsik; Rhee, Sungmin; Moon, Ji Hwan; Chae, Heejoon; Lee, Sunwon; Kang, Jaewoo; Kim, Sun
2017-01-01
miRNAs are small non-coding RNAs that regulate gene expression by binding to the 3'-UTR of genes. Many recent studies have reported that miRNAs play important biological roles by regulating specific mRNAs or genes. Many sequence-based target prediction algorithms have been developed to predict miRNA targets. However, these methods are not designed for condition-specific target predictions and produce many false positives; thus, expression-based target prediction algorithms have been developed for condition-specific target predictions. A typical strategy to utilize expression data is to leverage the negative control roles of miRNAs on genes. To control false positives, a stringent cutoff value is typically set, but in this case, these methods tend to reject many true target relationships, i.e., false negatives. To overcome these limitations, additional information should be utilized. The literature is probably the best resource that we can utilize. Recent literature mining systems compile millions of articles with experiments designed for specific biological questions, and the systems provide a function to search for specific information. To utilize the literature information, we used a literature mining system, BEST, that automatically extracts information from the literature in PubMed and that allows the user to perform searches of the literature with any English words. By integrating omics data analysis methods and BEST, we developed Context-MMIA, a miRNA-mRNA target prediction method that combines expression data analysis results and the literature information extracted based on the user-specified context. In the pathway enrichment analysis using genes included in the top 200 miRNA-targets, Context-MMIA outperformed the four existing target prediction methods that we tested. In another test on whether prediction methods can re-produce experimentally validated target relationships, Context-MMIA outperformed the four existing target prediction methods. In summary
NASA Astrophysics Data System (ADS)
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.
Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H
2012-12-11
Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.
Virtual targeting in three-dimensional space with sound and light interference
NASA Astrophysics Data System (ADS)
Chua, Florence B.; DeMarco, Robert M.; Bergen, Michael T.; Short, Kenneth R.; Servatius, Richard J.
2006-05-01
Law enforcement and the military are critically concerned with the targeting and firing accuracy of opponents. Stimuli which impede opponent targeting and firing accuracy can be incorporated into defense systems. An automated virtual firing range was developed to assess human targeting accuracy under conditions of sound and light interference, while avoiding dangers associated with live fire. This system has the ability to quantify sound and light interference effects on targeting and firing accuracy in three dimensions. This was achieved by development of a hardware and software system that presents the subject with a sound or light target, preceded by a sound or light interference. SonyXplod. TM 4-way speakers present sound interference and sound targeting. The Martin ® MiniMAC TM Profile operates as a source of light interference, while a red laser light serves as a target. A tracking system was created to monitor toy gun movement and firing in three-dimensional space. Data are collected via the Ascension ® Flock of Birds TM tracking system and a custom National Instrument ® LabVIEW TM 7.0 program to monitor gun movement and firing. A test protocol examined system parameters. Results confirm that the system enables tracking of virtual shots from a fired simulation gun to determine shot accuracy and location in three dimensions.
Suppression of RNA Interference by Adenovirus Virus-Associated RNA†
Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran
2005-01-01
We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917
van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D; Arnold, Jamie J; Cameron, Craig E; Verdaguer, Nuria; Neyts, Johan; van Kuppeveld, Frank J M
2015-03-01
The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the
van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M.; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D.; Arnold, Jamie J.; Cameron, Craig E.; Verdaguer, Nuria
2015-01-01
The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the
Smith, Justin D; Suresh, Sundari; Schlecht, Ulrich; Wu, Manhong; Wagih, Omar; Peltz, Gary; Davis, Ronald W; Steinmetz, Lars M; Parts, Leopold; St Onge, Robert P
2016-03-08
Genome-scale CRISPR interference (CRISPRi) has been used in human cell lines; however, the features of effective guide RNAs (gRNAs) in different organisms have not been well characterized. Here, we define rules that determine gRNA effectiveness for transcriptional repression in Saccharomyces cerevisiae. We create an inducible single plasmid CRISPRi system for gene repression in yeast, and use it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identifies previously described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments using gRNA libraries allows us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility are clearly more effective. We also find that the best region to target gRNAs is between the transcription start site (TSS) and 200 bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, the specificity of truncated gRNAs (18 nt of complementarity to the target) is not clearly superior to full-length gRNAs (20 nt of complementarity), as truncated gRNAs are generally less potent against both mismatched and perfectly matched targets. Our results establish a powerful functional and chemical genomics screening method and provide guidelines for designing effective gRNAs, which consider chromatin state and position relative to the target gene TSS. These findings will enable effective library design and genome-wide programmable gene repression in many genetic backgrounds.
Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.
2013-01-01
Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.
2012-01-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J
2012-05-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.
Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua
2015-01-01
Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836
Kandeel, Mahmoud; Kitade, Yukio
2013-07-01
RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.
Whitten, Miranda; Dyson, Paul
2017-03-01
Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.
Common features of microRNA target prediction tools
Peterson, Sarah M.; Thompson, Jeffrey A.; Ufkin, Melanie L.; Sathyanarayana, Pradeep; Liaw, Lucy; Congdon, Clare Bates
2014-01-01
The human genome encodes for over 1800 microRNAs (miRNAs), which are short non-coding RNA molecules that function to regulate gene expression post-transcriptionally. Due to the potential for one miRNA to target multiple gene transcripts, miRNAs are recognized as a major mechanism to regulate gene expression and mRNA translation. Computational prediction of miRNA targets is a critical initial step in identifying miRNA:mRNA target interactions for experimental validation. The available tools for miRNA target prediction encompass a range of different computational approaches, from the modeling of physical interactions to the incorporation of machine learning. This review provides an overview of the major computational approaches to miRNA target prediction. Our discussion highlights three tools for their ease of use, reliance on relatively updated versions of miRBase, and range of capabilities, and these are DIANA-microT-CDS, miRanda-mirSVR, and TargetScan. In comparison across all miRNA target prediction tools, four main aspects of the miRNA:mRNA target interaction emerge as common features on which most target prediction is based: seed match, conservation, free energy, and site accessibility. This review explains these features and identifies how they are incorporated into currently available target prediction tools. MiRNA target prediction is a dynamic field with increasing attention on development of new analysis tools. This review attempts to provide a comprehensive assessment of these tools in a manner that is accessible across disciplines. Understanding the basis of these prediction methodologies will aid in user selection of the appropriate tools and interpretation of the tool output. PMID:24600468
Common features of microRNA target prediction tools.
Peterson, Sarah M; Thompson, Jeffrey A; Ufkin, Melanie L; Sathyanarayana, Pradeep; Liaw, Lucy; Congdon, Clare Bates
2014-01-01
The human genome encodes for over 1800 microRNAs (miRNAs), which are short non-coding RNA molecules that function to regulate gene expression post-transcriptionally. Due to the potential for one miRNA to target multiple gene transcripts, miRNAs are recognized as a major mechanism to regulate gene expression and mRNA translation. Computational prediction of miRNA targets is a critical initial step in identifying miRNA:mRNA target interactions for experimental validation. The available tools for miRNA target prediction encompass a range of different computational approaches, from the modeling of physical interactions to the incorporation of machine learning. This review provides an overview of the major computational approaches to miRNA target prediction. Our discussion highlights three tools for their ease of use, reliance on relatively updated versions of miRBase, and range of capabilities, and these are DIANA-microT-CDS, miRanda-mirSVR, and TargetScan. In comparison across all miRNA target prediction tools, four main aspects of the miRNA:mRNA target interaction emerge as common features on which most target prediction is based: seed match, conservation, free energy, and site accessibility. This review explains these features and identifies how they are incorporated into currently available target prediction tools. MiRNA target prediction is a dynamic field with increasing attention on development of new analysis tools. This review attempts to provide a comprehensive assessment of these tools in a manner that is accessible across disciplines. Understanding the basis of these prediction methodologies will aid in user selection of the appropriate tools and interpretation of the tool output.
Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach
Cambronne, Xiaolu A.; Shen, Rongkun; Auer, Paul L.; Goodman, Richard H.
2012-01-01
Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA– RNA-induced silencing complex (RISC)–messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs. PMID:23184980
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells
Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-01-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.
Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-03-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).
An mRNA-Derived Noncoding RNA Targets and Regulates the Ribosome
Pircher, Andreas; Bakowska-Zywicka, Kamilla; Schneider, Lukas; Zywicki, Marek; Polacek, Norbert
2014-01-01
Summary The structural and functional repertoire of small non-protein-coding RNAs (ncRNAs) is central for establishing gene regulation networks in cells and organisms. Here, we show that an mRNA-derived 18-nucleotide-long ncRNA is capable of downregulating translation in Saccharomyces cerevisiae by targeting the ribosome. This 18-mer ncRNA binds to polysomes upon salt stress and is crucial for efficient growth under hyperosmotic conditions. Although the 18-mer RNA originates from the TRM10 locus, which encodes a tRNA methyltransferase, genetic analyses revealed the 18-mer RNA nucleotide sequence, rather than the mRNA-encoded enzyme, as the translation regulator. Our data reveal the ribosome as a target for a small regulatory ncRNA and demonstrate the existence of a yet unkown mechanism of translation regulation. Ribosome-targeted small ncRNAs are found in all domains of life and represent a prevalent but so far largely unexplored class of regulatory molecules. PMID:24685157
Validated MicroRNA Target Databases: An Evaluation.
Lee, Yun Ji Diana; Kim, Veronica; Muth, Dillon C; Witwer, Kenneth W
2015-11-01
Preclinical Research Positive findings from preclinical and clinical studies involving depletion or supplementation of microRNA (miRNA) engender optimism about miRNA-based therapeutics. However, off-target effects must be considered. Predicting these effects is complicated. Each miRNA may target many gene transcripts, and the rules governing imperfectly complementary miRNA: target interactions are incompletely understood. Several databases provide lists of the relatively small number of experimentally confirmed miRNA: target pairs. Although incomplete, this information might allow assessment of at least some of the off-target effects. We evaluated the performance of four databases of experimentally validated miRNA: target interactions (miRWalk 2.0, miRTarBase, miRecords, and TarBase 7.0) using a list of 50 alphabetically consecutive genes. We examined the provided citations to determine the degree to which each interaction was experimentally supported. To assess stability, we tested at the beginning and end of a five-month period. Results varied widely by database. Two of the databases changed significantly over the course of 5 months. Most reported evidence for miRNA: target interactions were indirect or otherwise weak, and relatively few interactions were supported by more than one publication. Some returned results appear to arise from simplistic text searches that offer no insight into the relationship of the search terms, may not even include the reported gene or miRNA, and may thus, be invalid. We conclude that validation databases provide important information, but not all information in all extant databases is up-to-date or accurate. Nevertheless, the more comprehensive validation databases may provide useful starting points for investigation of off-target effects of proposed small RNA therapies. © 2015 Wiley Periodicals, Inc.
RNase H-assisted RNA-primed rolling circle amplification for targeted RNA sequence detection.
Takahashi, Hirokazu; Ohkawachi, Masahiko; Horio, Kyohei; Kobori, Toshiro; Aki, Tsunehiro; Matsumura, Yukihiko; Nakashimada, Yutaka; Okamura, Yoshiko
2018-05-17
RNA-primed rolling circle amplification (RPRCA) is a useful laboratory method for RNA detection; however, the detection of RNA is limited by the lack of information on 3'-terminal sequences. We uncovered that conventional RPRCA using pre-circularized probes could potentially detect the internal sequence of target RNA molecules in combination with RNase H. However, the specificity for mRNA detection was low, presumably due to non-specific hybridization of non-target RNA with the circular probe. To overcome this technical problem, we developed a method for detecting a sequence of interest in target RNA molecules via RNase H-assisted RPRCA using padlocked probes. When padlock probes are hybridized to the target RNA molecule, they are converted to the circular form by SplintR ligase. Subsequently, RNase H creates nick sites only in the hybridized RNA sequence, and single-stranded DNA is finally synthesized from the nick site by phi29 DNA polymerase. This method could specifically detect at least 10 fmol of the target RNA molecule without reverse transcription. Moreover, this method detected GFP mRNA present in 10 ng of total RNA isolated from Escherichia coli without background DNA amplification. Therefore, this method can potentially detect almost all types of RNA molecules without reverse transcription and reveal full-length sequence information.
Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C.
2014-01-01
Summary Argonaute proteins (AGOs) are key nuclease effectors of RNA interference (RNAi) [1]. Although purified AGOs can mediate a single round of target-RNA cleavage in vitro, accessory factors are required for short-interfering (si)RNAs loading and to achieve multiple-target turnover [2, 3]. To identify AGO co-factors we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi [4]. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 co-localizes with WAGO-1 in germline P-granules and in cytoplasmic and peri-nuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1) where it promotes small-RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. PMID:24684931
Suppression of Bedbug’s Reproduction by RNA Interference of Vitellogenin
Moriyama, Minoru; Hosokawa, Takahiro; Tanahashi, Masahiko; Nikoh, Naruo; Fukatsu, Takema
2016-01-01
Recent resurgence of the bedbug Cimex lectularius is a global problem on the public health. On account of the worldwide rise of insecticide-resistant bedbug populations, exploration of new approaches to the bedbug control and management is anticipated. In this context, gene silencing by RNA interference (RNAi) has been considered for its potential application to pest control and management, because RNAi enables specific suppression of target genes and thus flexible selection of target traits to be disrupted. In this study, in an attempt to develop a control strategy targeting reproduction of the bedbug, we investigated RNAi-mediated gene silencing of vitellogenin (Vg), a major yolk protein precursor essential for oogenesis. From the bedbug transcriptomes, we identified a typical Vg gene and a truncated Vg gene, which were designated as ClVg and ClVg-like, respectively. ClVg gene was highly expressed mainly in the fat body of adult females, which was more than 100 times higher than the expression level of ClVg-like gene, indicating that ClVg gene is the primary functional Vg gene in the bedbug. RNAi-mediated suppression of ClVg gene expression in adult females resulted in drastically reduced egg production, atrophied ovaries, and inflated abdomen due to hypertrophied fat bodies. These phenotypic consequences are expected not only to suppress the bedbug reproduction directly but also to deteriorate its feeding and survival indirectly via behavioral modifications. These results suggest the potential of ClVg gene as a promising target for RNAi-based population management of the bedbug. PMID:27096422
Regulation of Nicotine Biosynthesis by an Endogenous Target Mimicry of MicroRNA in Tobacco.
Li, Fangfang; Wang, Weidi; Zhao, Nan; Xiao, Bingguang; Cao, Peijian; Wu, Xingfu; Ye, Chuyu; Shen, Enhui; Qiu, Jie; Zhu, Qian-Hao; Xie, Jiahua; Zhou, Xueping; Fan, Longjiang
2015-10-01
The interaction between noncoding endogenous target mimicry (eTM) and its corresponding microRNA (miRNA) is a newly discovered regulatory mechanism and plays pivotal roles in various biological processes in plants. Tobacco (Nicotiana tabacum) is a model plant for studying secondary metabolite alkaloids, of which nicotine accounts for approximately 90%. In this work, we identified four unique tobacco-specific miRNAs that were predicted to target key genes of the nicotine biosynthesis and catabolism pathways and an eTM, novel tobacco miRNA (nta)-eTMX27, for nta-miRX27 that targets QUINOLINATE PHOSPHORIBOSYLTRANSFERASE2 (QPT2) encoding a quinolinate phosphoribosyltransferase. The expression level of nta-miRX27 was significantly down-regulated, while that of QPT2 and nta-eTMX27 was significantly up-regulated after topping, and consequently, nicotine content increased in the topping-treated plants. The topping-induced down-regulation of nta-miRX27 and up-regulation of QPT2 were only observed in plants with a functional nta-eTMX27 but not in transgenic plants containing an RNA interference construct targeting nta-eTMX27. Our results demonstrated that enhanced nicotine biosynthesis in the topping-treated tobacco plants is achieved by nta-eTMX27-mediated inhibition of the expression and functions of nta-miRX27. To our knowledge, this is the first report about regulation of secondary metabolite biosynthesis by an miRNA-eTM regulatory module in plants. © 2015 American Society of Plant Biologists. All Rights Reserved.
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
Pham, John W; Sontheimer, Erik J
2005-11-25
Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.
A designed recombinant fusion protein for targeted delivery of siRNA to the mouse brain.
Haroon, Mohamed Mohamed; Dar, Ghulam Hassan; Jeyalakshmi, Durga; Venkatraman, Uthra; Saba, Kamal; Rangaraj, Nandini; Patel, Anant Bahadur; Gopal, Vijaya
2016-04-28
RNA interference represents a novel therapeutic approach to modulate several neurodegenerative disease-related genes. However, exogenous delivery of siRNA restricts their transport into different tissues and specifically into the brain mainly due to its large size and the presence of the blood-brain barrier (BBB). To overcome these challenges, we developed here a strategy wherein a peptide known to target specific gangliosides was fused to a double-stranded RNA binding protein to deliver siRNA to the brain parenchyma. The designed fusion protein designated as TARBP-BTP consists of a double-stranded RNA-binding domain (dsRBD) of human Trans Activation response element (TAR) RNA Binding Protein (TARBP2) fused to a brain targeting peptide that binds to monosialoganglioside GM1. Conformation-specific binding of TARBP2 domain to siRNA led to the formation of homogenous serum-stable complex with targeting potential. Further, uptake of the complex in Neuro-2a, IMR32 and HepG2 cells analyzed by confocal microscopy and fluorescence activated cell sorting, revealed selective requirement of GM1 for entry. Remarkably, systemic delivery of the fluorescently labeled complex (TARBP-BTP:siRNA) in ΑβPP-PS1 mouse model of Alzheimer's disease (AD) led to distinctive localization in the cerebral hemisphere. Further, the delivery of siRNA mediated by TARBP-BTP led to significant knockdown of BACE1 in the brain, in both ΑβPP-PS1 mice and wild type C57BL/6. The study establishes the growing importance of fusion proteins in delivering therapeutic siRNA to brain tissues. Copyright © 2016 Elsevier B.V. All rights reserved.
RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A
2008-12-23
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.
2008-01-01
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934
Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland
2018-05-18
Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.
About miRNAs, miRNA seeds, target genes and target pathways.
Kehl, Tim; Backes, Christina; Kern, Fabian; Fehlmann, Tobias; Ludwig, Nicole; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas
2017-12-05
miRNAs are typically repressing gene expression by binding to the 3' UTR, leading to degradation of the mRNA. This process is dominated by the eight-base seed region of the miRNA. Further, miRNAs are known not only to target genes but also to target significant parts of pathways. A logical line of thoughts is: miRNAs with similar (seed) sequence target similar sets of genes and thus similar sets of pathways. By calculating similarity scores for all 3.25 million pairs of 2,550 human miRNAs, we found that this pattern frequently holds, while we also observed exceptions. Respective results were obtained for both, predicted target genes as well as experimentally validated targets. We note that miRNAs target gene set similarity follows a bimodal distribution, pointing at a set of 282 miRNAs that seems to target genes with very high specificity. Further, we discuss miRNAs with different (seed) sequences that nonetheless regulate similar gene sets or pathways. Most intriguingly, we found miRNA pairs that regulate different gene sets but similar pathways such as miR-6886-5p and miR-3529-5p. These are jointly targeting different parts of the MAPK signaling cascade. The main goal of this study is to provide a general overview on the results, to highlight a selection of relevant results on miRNAs, miRNA seeds, target genes and target pathways and to raise awareness for artifacts in respective comparisons. The full set of information that allows to infer detailed results on each miRNA has been included in miRPathDB, the miRNA target pathway database (https://mpd.bioinf.uni-sb.de).
The RNA-induced silencing complex: a versatile gene-silencing machine.
Pratt, Ashley J; MacRae, Ian J
2009-07-03
RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.
Modulating the tumor microenvironment with RNA interference as a cancer treatment strategy.
Zins, Karin; Sioud, Mouldy; Aharinejad, Seyedhossein; Lucas, Trevor; Abraham, Dietmar
2015-01-01
The tumor microenvironment is composed of accessory cells and immune cells in addition to extracellular matrix (ECM) components. The stromal compartment interacts with cancer cells in a complex crosstalk to support tumor development. Growth factors and cytokines produced by stromal cells support the growth of tumor cells and promote interaction with the vasculature to enhance tumor progression and invasion. The activation of autocrine and paracrine oncogenic signaling pathways by growth factors, cytokines, and proteases derived from both tumor cells and the stromal compartment is thought to play a major role in assisting tumor cells during metastasis. Consequently, targeting tumor-stroma interactions by RNA interference (RNAi)-based approaches is a promising strategy in the search for novel treatment modalities in human cancer. Recent advances in packaging technology including the use of polymers, peptides, liposomes, and nanoparticles to deliver small interfering RNAs (siRNAs) into target cells may overcome limitations associated with potential RNAi-based therapeutics. Newly developed nonviral gene delivery approaches have shown improved anticancer efficacy suggesting that RNAi-based therapeutics provide novel opportunities to elicit significant gene silencing and induce regression of tumor growth. This chapter summarizes our current understanding of the tumor microenvironment and highlights some potential targets for therapeutic intervention with RNAi-based cancer therapeutics.
An Unsolved Mystery: The Target-Recognizing RNA Species of MicroRNA Genes
Chen, Chang-Zheng
2013-01-01
MicroRNAs (miRNAs) are an abundant class of endogenous ~ 21-nucleotide (nt) RNAs. These small RNAs are produced from long primary miRNA transcripts — pri-miRNAs — through sequential endonucleolytic maturation steps that yield precursor miRNA (pre-miRNA) intermediates and then the mature miRNAs. The mature miRNAs are loaded into the RNA-induced silencing complexes (RISC), and guide RISC to target mRNAs for cleavage and/or translational repression. This paradigm, which represents one of major discoveries of modern molecular biology, is built on the assumption that mature miRNAs are the only species produced from miRNA genes that recognize targets. This assumption has guided the miRNA field for more than a decade and has led to our current understanding of the mechanisms of target recognition and repression by miRNAs. Although progress has been made, fundamental questions remain unanswered with regard to the principles of target recognition and mechanisms of repression. Here I raise questions about the assumption that mature miRNAs are the only target-recognizing species produced from miRNA genes and discuss the consequences of working under an incomplete or incorrect assumption. Moreover, I present evolution-based and experimental evidence that support the roles of pri-/pre-miRNAs in target recognition and repression. Finally, I propose a conceptual framework that integrates the functions of pri-/pre-miRNAs and mature miRNAs in target recognition and repression. The integrated framework opens experimental enquiry and permits interpretation of fundamental problems that have so far been precluded. PMID:23685275
Wang, Weixia; Wan, Pinjun; Lai, Fengxiang; Zhu, Tingheng; Fu, Qiang
2018-07-01
Calmodulin (CaM) is an essential protein in cellular activity and plays important roles in many processes in insect development. RNA interference (RNAi) has been hypothesized to be a promising method for pest control. CaM is a good candidate for RNAi target. However, the sequence and function of CaM in Nilaparvata lugens are unknown. Furthermore, the double-stranded RNA (dsRNA) target to CaM gene in pest control is still unavailable. In the present study, two alternatively spliced variants of CaM transcripts, designated NlCaM1 and NlCaM2, were cloned from N. lugens. The two cDNA sequences exhibited 100% identity to each other in the open reading frame (ORF), and only differed in the 3' untranslated region (UTR). NlCaM including NlCaM1 and NlCaM2 mRNA was detectable in all developmental stages and tissues of N. lugens, with significantly increased expression in the salivary glands. Knockdown of NlCaM expression by RNAi with different dsRNAs led to an inability to molt properly, increased mortality, which ranged from 49.7 to 92.5%, impacted development of the ovaries and led to female infertility. There were no significant reductions in the transcript levels of vitellogenin and its receptor or in the total vitellogenin protein level relative to the control group. However, a significant reduction in vitellogenin protein was detected in ovaries injected with dsNlCaM. In addition, a specific dsRNA of NlCaM for control of N. lugens was designed and tested. NlCaM plays important roles mainly in nymph development and uptake of vitellogenin by ovaries in vitellogenesis in N. lugens. dsRNA derived from the less conserved 3'-UTR of NlCaM shows great potential for RNAi-based N. lugens management. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng
2013-11-01
Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.
A biochemical approach to identifying microRNA targets
Karginov, Fedor V.; Conaco, Cecilia; Xuan, Zhenyu; Schmidt, Bryan H.; Parker, Joel S.; Mandel, Gail; Hannon, Gregory J.
2007-01-01
Identifying the downstream targets of microRNAs (miRNAs) is essential to understanding cellular regulatory networks. We devised a direct biochemical method for miRNA target discovery that combined RNA-induced silencing complex (RISC) purification with microarray analysis of bound mRNAs. Because targets of miR-124a have been analyzed, we chose it as our model. We honed our approach both by examining the determinants of stable binding between RISC and synthetic target RNAs in vitro and by determining the dependency of both repression and RISC coimmunoprecipitation on miR-124a seed sites in two of its well characterized targets in vivo. Examining the complete spectrum of miR-124 targets in 293 cells yielded both a set that were down-regulated at the mRNA level, as previously observed, and a set whose mRNA levels were unaffected by miR-124a. Reporter assays validated both classes, extending the spectrum of mRNA targets that can be experimentally linked to the miRNA pathway. PMID:18042700
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C
2015-01-29
Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi
Tsai, Hsin-Yue; Chen, Chun-Chieh G.; Conte, Darryl; Moresco, James J.; Chaves, Daniel A.; Mitani, Shohei; Yates, John R.; Tsai, Ming-Daw; Mello, Craig C.
2015-01-01
SUMMARY Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering (si) RNAs are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3′ uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3’ uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. PMID:25635455
Shen, Min; Zhu, Kangshun; Cheng, Du; Liu, Zhihao; Shan, Hong
2013-01-01
RNA interference (RNAi) has significant therapeutic promise for the genetic treatment of hepatocellular carcinoma (HCC). Targeted vectors are able to deliver small interfering RNA (siRNA) into HCC cells with high transfection efficiency and stability. The tripeptide arginine glycine aspartic acid (RGD)-modified non-viral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles (RGD-PEG-g-PEI-SPION), was constructed as a magnetic resonance imaging (MRI)-visible nanocarrier for the delivery of Survivin siRNA targeting the human HCC cell line Bel-7402. The biophysical characterization of the RGD-PEG-g-PEI-SPION was performed. The RGD-modified complexes exhibited a higher transfection efficiency in transferring Survivin siRNA into Bel-7402 cells compared with a non-targeted delivery system, which resulted in more significant gene suppression at both the Survivin mRNA and protein expression levels. Then, the level of caspase-3 activation was significantly elevated, and a remarkable level of tumor cell apoptosis was induced. As a result, the tumor growth in the nude mice Bel-7402 hepatoma model was significantly inhibited. The targeting ability of the RGD-PEG-g-PEI-SPION was successfully imaged by MRI scans performed in vitro and in vivo. Our results strongly indicated that the RGD-PEG-g-PEI-SPION can potentially be used as a targeted non-viral vector for altering gene expression in the treatment of hepatocellular carcinoma and for detecting the tumor in vivo as an effective MRI probe. PMID:23922634
Therapeutic RNA interference for neurodegenerative diseases: From promise to progress.
Gonzalez-Alegre, Pedro
2007-04-01
RNA interference (RNAi) has emerged as a powerful tool to manipulate gene expression in the laboratory. Due to its remarkable discriminating properties, individual genes, or even alleles can be targeted with exquisite specificity in cultured cells or living animals. Among its many potential biomedical applications, silencing of disease-linked genes stands out as a promising therapeutic strategy for many incurable disorders. Neurodegenerative diseases represent one of the more attractive targets for the development of therapeutic RNAi. In this group of diseases, the progressive loss of neurons leads to the gradual appearance of disabling neurological symptoms and premature death. Currently available therapies aim to improve the symptoms but not to halt the process of neurodegeneration. The increasing prevalence and economic burden of some of these diseases, such as Alzheimer's disease (AD) or Parkinson's disease (PD), has boosted the efforts invested in the development of interventions, such as RNAi, aimed at altering their natural course. This review will summarize where we stand in the therapeutic application of RNAi for neurodegenerative diseases. The basic principles of RNAi will be reviewed, focusing on features important for its therapeutic manipulation. Subsequently, a stepwise strategy for the development of therapeutic RNAi will be presented. Finally, the different preclinical trials of therapeutic RNAi completed in disease models will be summarized, stressing the experimental questions that need to be addressed before planning application in human disease.
Regulation of Nicotine Biosynthesis by an Endogenous Target Mimicry of MicroRNA in Tobacco1[OPEN
Li, Fangfang; Wang, Weidi; Zhao, Nan; Xiao, Bingguang; Cao, Peijian; Wu, Xingfu; Ye, Chuyu; Shen, Enhui; Qiu, Jie; Zhu, Qian-Hao; Xie, Jiahua; Zhou, Xueping; Fan, Longjiang
2015-01-01
The interaction between noncoding endogenous target mimicry (eTM) and its corresponding microRNA (miRNA) is a newly discovered regulatory mechanism and plays pivotal roles in various biological processes in plants. Tobacco (Nicotiana tabacum) is a model plant for studying secondary metabolite alkaloids, of which nicotine accounts for approximately 90%. In this work, we identified four unique tobacco-specific miRNAs that were predicted to target key genes of the nicotine biosynthesis and catabolism pathways and an eTM, novel tobacco miRNA (nta)-eTMX27, for nta-miRX27 that targets QUINOLINATE PHOSPHORIBOSYLTRANSFERASE2 (QPT2) encoding a quinolinate phosphoribosyltransferase. The expression level of nta-miRX27 was significantly down-regulated, while that of QPT2 and nta-eTMX27 was significantly up-regulated after topping, and consequently, nicotine content increased in the topping-treated plants. The topping-induced down-regulation of nta-miRX27 and up-regulation of QPT2 were only observed in plants with a functional nta-eTMX27 but not in transgenic plants containing an RNA interference construct targeting nta-eTMX27. Our results demonstrated that enhanced nicotine biosynthesis in the topping-treated tobacco plants is achieved by nta-eTMX27-mediated inhibition of the expression and functions of nta-miRX27. To our knowledge, this is the first report about regulation of secondary metabolite biosynthesis by an miRNA-eTM regulatory module in plants. PMID:26246450
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
ERIC Educational Resources Information Center
Bowman, Caitlin R.; Sine, Shalome L.; Dennis, Nancy A.
2017-01-01
To better understand neural recollection processing, we induced interference in target recollection by presenting related lures before their respective targets and facilitated recollection rejection of lures by presenting targets before their related lures. Target recollection following interference recruited visual and prefrontal cortices,…
MicroRNA-targeted therapeutics for lung cancer treatment.
Xue, Jing; Yang, Jiali; Luo, Meihui; Cho, William C; Liu, Xiaoming
2017-02-01
Lung cancer is one of the leading causes of cancer-related mortality worldwide. MicroRNAs (miRNAs) are endogenous non-coding small RNAs that repress the expression of a broad array of target genes. Many efforts have been made to therapeutically target miRNAs in cancer treatments using miRNA mimics and miRNA antagonists. Areas covered: This article summarizes the recent findings with the role of miRNAs in lung cancer, and discusses the potential and challenges of developing miRNA-targeted therapeutics in this dreadful disease. Expert opinion: The development of miRNA-targeted therapeutics has become an important anti-cancer strategy. Results from both preclinical and clinical trials of microRNA replacement therapy have shown some promise in cancer treatment. However, some obstacles, including drug delivery, specificity, off-target effect, toxicity mediation, immunological activation and dosage determination should be addressed. Several delivery strategies have been employed, including naked oligonucleotides, liposomes, aptamer-conjugates, nanoparticles and viral vectors. However, delivery remains a main challenge in miRNA-targeting therapeutics. Furthermore, immune-related serious adverse events are also a concern, which indicates the complexity of miRNA-based therapy in clinical settings.
Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S
2018-06-19
Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992
Frnakenstein: multiple target inverse RNA folding.
Lyngsø, Rune B; Anderson, James W J; Sizikova, Elena; Badugu, Amarendra; Hyland, Tomas; Hein, Jotun
2012-10-09
RNA secondary structure prediction, or folding, is a classic problem in bioinformatics: given a sequence of nucleotides, the aim is to predict the base pairs formed in its three dimensional conformation. The inverse problem of designing a sequence folding into a particular target structure has only more recently received notable interest. With a growing appreciation and understanding of the functional and structural properties of RNA motifs, and a growing interest in utilising biomolecules in nano-scale designs, the interest in the inverse RNA folding problem is bound to increase. However, whereas the RNA folding problem from an algorithmic viewpoint has an elegant and efficient solution, the inverse RNA folding problem appears to be hard. In this paper we present a genetic algorithm approach to solve the inverse folding problem. The main aims of the development was to address the hitherto mostly ignored extension of solving the inverse folding problem, the multi-target inverse folding problem, while simultaneously designing a method with superior performance when measured on the quality of designed sequences. The genetic algorithm has been implemented as a Python program called Frnakenstein. It was benchmarked against four existing methods and several data sets totalling 769 real and predicted single structure targets, and on 292 two structure targets. It performed as well as or better at finding sequences which folded in silico into the target structure than all existing methods, without the heavy bias towards CG base pairs that was observed for all other top performing methods. On the two structure targets it also performed well, generating a perfect design for about 80% of the targets. Our method illustrates that successful designs for the inverse RNA folding problem does not necessarily have to rely on heavy biases in base pair and unpaired base distributions. The design problem seems to become more difficult on larger structures when the target structures are
Frnakenstein: multiple target inverse RNA folding
2012-01-01
Background RNA secondary structure prediction, or folding, is a classic problem in bioinformatics: given a sequence of nucleotides, the aim is to predict the base pairs formed in its three dimensional conformation. The inverse problem of designing a sequence folding into a particular target structure has only more recently received notable interest. With a growing appreciation and understanding of the functional and structural properties of RNA motifs, and a growing interest in utilising biomolecules in nano-scale designs, the interest in the inverse RNA folding problem is bound to increase. However, whereas the RNA folding problem from an algorithmic viewpoint has an elegant and efficient solution, the inverse RNA folding problem appears to be hard. Results In this paper we present a genetic algorithm approach to solve the inverse folding problem. The main aims of the development was to address the hitherto mostly ignored extension of solving the inverse folding problem, the multi-target inverse folding problem, while simultaneously designing a method with superior performance when measured on the quality of designed sequences. The genetic algorithm has been implemented as a Python program called Frnakenstein. It was benchmarked against four existing methods and several data sets totalling 769 real and predicted single structure targets, and on 292 two structure targets. It performed as well as or better at finding sequences which folded in silico into the target structure than all existing methods, without the heavy bias towards CG base pairs that was observed for all other top performing methods. On the two structure targets it also performed well, generating a perfect design for about 80% of the targets. Conclusions Our method illustrates that successful designs for the inverse RNA folding problem does not necessarily have to rely on heavy biases in base pair and unpaired base distributions. The design problem seems to become more difficult on larger structures
Misra, Ashish; Green, Michael R
2017-01-01
Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.
Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1
Barbie, David A.; Tamayo, Pablo; Boehm, Jesse S.; Kim, So Young; Moody, Susan E.; Dunn, Ian F.; Schinzel, Anna C.; Sandy, Peter; Meylan, Etienne; Scholl, Claudia; Fröhling, Stefan; Chan, Edmond M.; Sos, Martin L.; Michel, Kathrin; Mermel, Craig; Silver, Serena J.; Weir, Barbara A.; Reiling, Jan H.; Sheng, Qing; Gupta, Piyush B.; Wadlow, Raymond C.; Le, Hanh; Hoersch, Sebastian; Wittner, Ben S.; Ramaswamy, Sridhar; Livingston, David M.; Sabatini, David M.; Meyerson, Matthew; Thomas, Roman K.; Lander, Eric S.; Mesirov, Jill P.; Root, David E.; Gilliland, D. Gary; Jacks, Tyler; Hahn, William C.
2009-01-01
The proto-oncogene KRAS is mutated in a wide array of human cancers, most of which are aggressive and respond poorly to standard therapies. Although the identification of specific oncogenes has led to the development of clinically effective, molecularly targeted therapies in some cases, KRAS has remained refractory to this approach. A complementary strategy for targeting KRAS is to identify gene products that, when inhibited, result in cell death only in the presence of an oncogenic allele1,2. Here we have used systematic RNA interference (RNAi) to detect synthetic lethal partners of oncogenic KRAS and found that the non-canonical IκB kinase, TBK1, was selectively essential in cells that harbor mutant KRAS. Suppression of TBK1 induced apoptosis specifically in human cancer cell lines that depend on oncogenic KRAS expression. In these cells, TBK1 activated NF-κB anti-apoptotic signals involving cREL and BCL-XL that were essential for survival, providing mechanistic insights into this synthetic lethal interaction. These observations identify TBK1 and NF-κB signaling as essential in KRAS mutant tumors and establish a general approach for the rational identification of co-dependent pathways in cancer. PMID:19847166
SeedVicious: Analysis of microRNA target and near-target sites.
Marco, Antonio
2018-01-01
Here I describe seedVicious, a versatile microRNA target site prediction software that can be easily fitted into annotation pipelines and run over custom datasets. SeedVicious finds microRNA canonical sites plus other, less efficient, target sites. Among other novel features, seedVicious can compute evolutionary gains/losses of target sites using maximum parsimony, and also detect near-target sites, which have one nucleotide different from a canonical site. Near-target sites are important to study population variation in microRNA regulation. Some analyses suggest that near-target sites may also be functional sites, although there is no conclusive evidence for that, and they may actually be target alleles segregating in a population. SeedVicious does not aim to outperform but to complement existing microRNA prediction tools. For instance, the precision of TargetScan is almost doubled (from 11% to ~20%) when we filter predictions by the distance between target sites using this program. Interestingly, two adjacent canonical target sites are more likely to be present in bona fide target transcripts than pairs of target sites at slightly longer distances. The software is written in Perl and runs on 64-bit Unix computers (Linux and MacOS X). Users with no computing experience can also run the program in a dedicated web-server by uploading custom data, or browse pre-computed predictions. SeedVicious and its associated web-server and database (SeedBank) are distributed under the GPL/GNU license.
Tangudu, Naveen K; Verma, Vinod K; Clemons, Tristan D; Beevi, Syed S; Hay, Trevor; Mahidhara, Ganesh; Raja, Meera; Nair, Rekha A; Alexander, Liza E; Patel, Anant B; Jose, Jedy; Smith, Nicole M; Zdyrko, Bogdan; Bourdoncle, Anne; Luzinov, Igor; Iyer, K Swaminathan; Clarke, Alan R; Dinesh Kumar, Lekha
2015-05-01
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge facing the clinical success of RNAi technology is in the difficulty of delivery of RNAi inducers, due to low transfection efficiency, difficulties of integration into host DNA and unstable expression. Using the macromolecule polyglycidal methacrylate (PGMA) as a platform to graft multiple polyethyleneimine (PEI) chains, we demonstrate effective delivery of small oligos (anti-miRs and mimics) and larger DNAs (encoding shRNAs) in a wide variety of cancer cell lines by successful silencing/activation of their respective target genes. Furthermore, the effectiveness of this therapy was validated for in vivo tumor suppression using two transgenic mouse models; first, tumor growth arrest and increased animal survival was seen in mice bearing Brca2/p53-mutant mammary tumors following daily intratumoral treatment with nanoparticles conjugated to c-Myc shRNA. Second, oral delivery of the conjugate to an Apc-deficient crypt progenitor colon cancer model increased animal survival and returned intestinal tissue to a non-wnt-deregulated state. This study demonstrates, through careful design of nonviral nanoparticles and appropriate selection of therapeutic gene targets, that RNAi technology can be made an affordable and amenable therapy for cancer. ©2015 American Association for Cancer Research.
Visualization and Analysis of MiRNA-Targets Interactions Networks.
León, Luis E; Calligaris, Sebastián D
2017-01-01
MicroRNAs are a class of small, noncoding RNA molecules of 21-25 nucleotides in length that regulate the gene expression by base-pairing with the target mRNAs, mainly leading to down-regulation or repression of the target genes. MicroRNAs are involved in diverse regulatory pathways in normal and pathological conditions. In this context, it is highly important to identify the targets of specific microRNA in order to understand the mechanism of its regulation and consequently its involvement in disease. However, the microRNA target identification is experimentally laborious and time-consuming. The in silico prediction of microRNA targets is an extremely useful approach because you can identify potential mRNA targets, reduce the number of possibilities and then, validate a few microRNA-mRNA interactions in an in vitro experimental model. In this chapter, we describe, in a simple way, bioinformatics guidelines to use miRWalk database and Cytoscape software for analyzing microRNA-mRNA interactions through their visualization as a network.
Korde, Asawari; Rosselot, Jessica M.; Donze, David
2014-01-01
The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746
psRNATarget: a plant small RNA target analysis server
Dai, Xinbin; Zhao, Patrick Xuechun
2011-01-01
Plant endogenous non-coding short small RNAs (20–24 nt), including microRNAs (miRNAs) and a subset of small interfering RNAs (ta-siRNAs), play important role in gene expression regulatory networks (GRNs). For example, many transcription factors and development-related genes have been reported as targets of these regulatory small RNAs. Although a number of miRNA target prediction algorithms and programs have been developed, most of them were designed for animal miRNAs which are significantly different from plant miRNAs in the target recognition process. These differences demand the development of separate plant miRNA (and ta-siRNA) target analysis tool(s). We present psRNATarget, a plant small RNA target analysis server, which features two important analysis functions: (i) reverse complementary matching between small RNA and target transcript using a proven scoring schema, and (ii) target-site accessibility evaluation by calculating unpaired energy (UPE) required to ‘open’ secondary structure around small RNA’s target site on mRNA. The psRNATarget incorporates recent discoveries in plant miRNA target recognition, e.g. it distinguishes translational and post-transcriptional inhibition, and it reports the number of small RNA/target site pairs that may affect small RNA binding activity to target transcript. The psRNATarget server is designed for high-throughput analysis of next-generation data with an efficient distributed computing back-end pipeline that runs on a Linux cluster. The server front-end integrates three simplified user-friendly interfaces to accept user-submitted or preloaded small RNAs and transcript sequences; and outputs a comprehensive list of small RNA/target pairs along with the online tools for batch downloading, key word searching and results sorting. The psRNATarget server is freely available at http://plantgrn.noble.org/psRNATarget/. PMID:21622958
Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil
2017-03-01
Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.
RNA Interference in Insect Vectors for Plant Viruses.
Kanakala, Surapathrudu; Ghanim, Murad
2016-12-12
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.
RNA Interference in Insect Vectors for Plant Viruses
Kanakala, Surapathrudu; Ghanim, Murad
2016-01-01
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446
A quick reality check for microRNA target prediction.
Kast, Juergen
2011-04-01
The regulation of protein abundance by microRNA (miRNA)-mediated repression of mRNA translation is a rapidly growing area of interest in biochemical research. In animal cells, the miRNA seed sequence does not perfectly match that of the mRNA it targets, resulting in a large number of possible miRNA targets and varied extents of repression. Several software tools are available for the prediction of miRNA targets, yet the overlap between them is limited. Jovanovic et al. have developed and applied a targeted, quantitative approach to validate predicted miRNA target proteins. Using a proteome database, they have set up and tested selected reaction monitoring assays for approximately 20% of more than 800 predicted let-7 targets, as well as control genes in Caenorhabditis elegans. Their results demonstrate that such assays can be developed quickly and with relative ease, and applied in a high-throughput setup to verify known and identify novel miRNA targets. They also show, however, that the choice of the biological system and material has a noticeable influence on the frequency, extent and direction of the observed changes. Nonetheless, selected reaction monitoring assays, such as those developed by Jovanovic et al., represent an attractive new tool in the study of miRNA function at the organism level.
Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G
2016-06-25
To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were
Musiyenko, Alla; Majumdar, Tanmay; Andrews, Joel; Adams, Brian; Barik, Sailen
2013-01-01
Summary Argonaute (Ago) plays a central role in RNA interference in metazoans, but its status in lower organisms remains ill-defined. We report on the Ago complex of the unicellular protozoan, Toxoplasma gondii (Tg), an obligatory pathogen of mammalian hosts. The PIWI-like domain of TgAgo lacked the canonical DDE/H catalytic triad, explaining its weak target RNA cleavage activity. However, TgAgo associated with a stronger RNA slicer, a Tudor staphylococcal nuclease (TSN), and with a protein Arg methyl transferase, PRMT1. Mutational analysis suggested that the N-terminal RGG-repeat domain of TgAgo was methylated by PRMT1, correlating with the recruitment of TSN. The slicer activity of TgAgo was Mg2+-dependent and required perfect complementarity between the guide RNA and the target. In contrast, the TSN activity was Ca2+-dependent and required an imperfectly paired guide RNA. Ago knockout parasites showed essentially normal growth, but in contrast, the PRMT1 knockouts grew abnormally. Chemical inhibition of Arg-methylation also had an anti-parasitic effect. These results suggest that the parasitic PRMT1 plays multiple roles, and its loss affects the recruitment of a more potent second slicer to the parasitic RNA silencing complex, the exact mechanism of which remains to be determined. PMID:22309152
A tale of two sequences: microRNA-target chimeric reads.
Broughton, James P; Pasquinelli, Amy E
2016-04-04
In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.
Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.
Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien
2017-08-01
RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.
Induction of RNA interference in dendritic cells.
Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping
2004-01-01
Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.
Interference of hepatitis C virus RNA replication by short interfering RNAs
NASA Astrophysics Data System (ADS)
Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.
2003-02-01
Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.
Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe
2018-01-01
Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260
Wuriyanghan, Hada; Falk, Bryce W.
2013-01-01
The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will
RNA interference for performance enhancement and detection in doping control.
Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2011-10-01
RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.
Evans, James C; Malhotra, Meenakshi; Sweeney, Katrina; Darcy, Raphael; Nelson, Colleen C; Hollier, Brett G; O'Driscoll, Caitriona M
2017-10-30
The main barrier to the development of an effective RNA interference (RNAi) therapy is the lack of a suitable delivery vector. Modified cyclodextrins have emerged in recent years for the delivery of siRNA. In the present study, a folate-targeted amphiphilic cyclodextrin was formulated using DSPE-PEG 5000 -folate to target prostate cancer cells. The fusogenic peptide GALA was included in the formulation to aid in the endosomal release of siRNA. Targeted nanoparticles were less than 200nm in size with a neutral surface charge. The complexes were able to bind siRNA and protect it from serum nucleases. Incubation with excess free folate resulted in a significant decrease in the uptake of targeted nanoparticles in LNCaP and PC3 cells, both of which have been reported to have differing pathways of folate uptake. There was a significant reduction in the therapeutic targets, ZEB1 and NRP1 at mRNA and protein level following treatment with targeted complexes. In preliminary functional assays using 3D spheroids, treatment of PC3 tumours with targeted complexes with ZEB1 and NRP1 siRNA resulted in more compact colonies relative to the untargeted controls and inhibited infiltration into the Matrigel™ layer. Copyright © 2017 Elsevier B.V. All rights reserved.
Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran
2015-12-01
A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.
Special Issue: Gene Therapy with Emphasis on RNA Interference
Lundstrom, Kenneth
2015-01-01
Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255
Therapeutic targeting of RNA splicing in myelodysplasia.
Kim, Young Joon; Abdel-Wahab, Omar
2017-07-01
Genomic analysis of patients with myelodysplastic syndromes (MDS) has identified that mutations within genes encoding RNA splicing factors represent the most common class of genetic alterations in MDS. These mutations primarily affect SF3B1, SRSF2, U2AF1, and ZRSR2. Current data suggest that these mutations perturb RNA splicing catalysis in a manner distinct from loss of function but how exactly the global changes in RNA splicing imparted by these mutations result in MDS is not well delineated. At the same time, cells bearing mutations in RNA splicing factors are exquisitely dependent on the presence of the remaining wild-type (WT) allele to maintain residual normal splicing for cell survival. The high frequency of these mutations in MDS, combined with their mutual exclusivity and noteworthy dependence on the WT allele, make targeting RNA splicing attractive in MDS. To this end, two promising therapeutic approaches targeting RNA splicing are being tested clinically currently. These include molecules targeting core RNA splicing catalysis by interfering with the ability of the SF3b complex to interact with RNA, as well as molecules degrading the auxiliary RNA splicing factor RBM39. The preclinical and clinical evaluation of these compounds are discussed here in addition to their potential as therapies for spliceosomal mutant MDS. Copyright © 2017 Elsevier Inc. All rights reserved.
Targeting BTK through microRNA in chronic lymphocytic leukemia
Bottoni, Arianna; Rizzotto, Lara; Lai, Tzung-Huei; Liu, Chaomei; Smith, Lisa L.; Mantel, Rose; Reiff, Sean; El-Gamal, Dalia; Larkin, Karilyn; Johnson, Amy J.; Lapalombella, Rosa; Lehman, Amy; Plunkett, William; Byrd, John C.; Blachly, James S.; Woyach, Jennifer A.
2016-01-01
Bruton’s tyrosine kinase (BTK) is a critical mediator of survival in B-cell neoplasms. Although BTK inhibitors have transformed therapy in chronic lymphocytic leukemia (CLL), patients with high-risk genetics are at risk for relapse and have a poor prognosis. Identification of novel therapeutic strategies for this group of patients is an urgent unmet clinical need, and therapies that target BTK via alternative mechanisms may fill this niche. Herein, we identify a set of microRNAs (miRs) that target BTK in primary CLL cells and show that the histone deacetylase (HDAC) repressor complex is recruited to these miR promoters to silence their expression. Targeting the HDACs by using either RNA interference against HDAC1 in CLL or a small molecule inhibitor (HDACi) in CLL and mantle cell lymphoma restored the expression of the BTK-targeting miRs with loss of BTK protein and downstream signaling and consequent cell death. We have also made the novel and clinically relevant discovery that inhibition of HDAC induces the BTK-targeting miRs in ibrutinib-sensitive and resistant CLL to effectively reduce both wild-type and C481S-mutant BTK. This finding identifies a novel strategy that may be promising as a therapeutic modality to eliminate the C481S-mutant BTK clone that drives resistance to ibrutinib and provides the rationale for a combination strategy that includes ibrutinib to dually target BTK to suppress its prosurvival signaling. PMID:27756747
Targeting BTK through microRNA in chronic lymphocytic leukemia.
Bottoni, Arianna; Rizzotto, Lara; Lai, Tzung-Huei; Liu, Chaomei; Smith, Lisa L; Mantel, Rose; Reiff, Sean; El-Gamal, Dalia; Larkin, Karilyn; Johnson, Amy J; Lapalombella, Rosa; Lehman, Amy; Plunkett, William; Byrd, John C; Blachly, James S; Woyach, Jennifer A; Sampath, Deepa
2016-12-29
Bruton's tyrosine kinase (BTK) is a critical mediator of survival in B-cell neoplasms. Although BTK inhibitors have transformed therapy in chronic lymphocytic leukemia (CLL), patients with high-risk genetics are at risk for relapse and have a poor prognosis. Identification of novel therapeutic strategies for this group of patients is an urgent unmet clinical need, and therapies that target BTK via alternative mechanisms may fill this niche. Herein, we identify a set of microRNAs (miRs) that target BTK in primary CLL cells and show that the histone deacetylase (HDAC) repressor complex is recruited to these miR promoters to silence their expression. Targeting the HDACs by using either RNA interference against HDAC1 in CLL or a small molecule inhibitor (HDACi) in CLL and mantle cell lymphoma restored the expression of the BTK-targeting miRs with loss of BTK protein and downstream signaling and consequent cell death. We have also made the novel and clinically relevant discovery that inhibition of HDAC induces the BTK-targeting miRs in ibrutinib-sensitive and resistant CLL to effectively reduce both wild-type and C481S-mutant BTK. This finding identifies a novel strategy that may be promising as a therapeutic modality to eliminate the C481S-mutant BTK clone that drives resistance to ibrutinib and provides the rationale for a combination strategy that includes ibrutinib to dually target BTK to suppress its prosurvival signaling. © 2016 by The American Society of Hematology.
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound
McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.
Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.
Dendritic mRNA targeting and translation.
Kindler, Stefan; Kreienkamp, Hans-Jürgen
2012-01-01
Selective targeting of specific mRNAs into neuronal dendrites and their locally regulated translation at particular cell contact sites contribute to input-specific synaptic plasticity. Thus, individual synapses become decision-making units, which control gene expression in a spatially restricted and nucleus-independent manner. Dendritic targeting of mRNAs is achieved by active, microtubule-dependent transport. For this purpose, mRNAs are packaged into large ribonucleoprotein (RNP) particles containing an array of trans-acting RNA-binding proteins. These are attached to molecular motors, which move their RNP cargo into dendrites. A variety of proteins may be synthesized in dendrites, including signalling and scaffold proteins of the synapse and neurotransmitter receptors. In some cases, such as the alpha subunit of the calcium/calmodulin-dependent protein kinase II (αCaMKII) and the activity-regulated gene of 3.1 kb (Arg3.1, also referred to as activity-regulated cDNA, Arc), their local synthesis at synapses can modulate long-term changes in synaptic efficiency. Local dendritic translation is regulated by several signalling cascades including Akt/mTOR and Erk/MAP kinase pathways, which are triggered by synaptic activity. More recent findings show that miRNAs also play an important role in protein synthesis at synapses. Disruption of local translation control at synapses, as observed in the fragile X syndrome (FXS) and its mouse models and possibly also in autism spectrum disorders, interferes with cognitive abilities in mice and men.
O'Grady, Michael; Raha, Debasish; Hanson, Bonnie J; Bunting, Michaeline; Hanson, George T
2005-01-01
Background The transcription factor activator protein-1 (AP-1) has been implicated in a large variety of biological processes including oncogenic transformation. The tyrosine kinases of the epidermal growth factor receptor (EGFR) constitute the beginning of one signal transduction cascade leading to AP-1 activation and are known to control cell proliferation and differentiation. Drug discovery efforts targeting this receptor and other pathway components have centred on monoclonal antibodies and small molecule inhibitors. Resistance to such inhibitors has already been observed, guiding the prediction of their use in combination therapies with other targeted agents such as RNA interference (RNAi). This study examines the use of RNAi and kinase inhibitors for qualification of components involved in the EGFR/AP-1 pathway of ME180 cells, and their inhibitory effects when evaluated individually or in tandem against multiple components of this important disease-related pathway. Methods AP-1 activation was assessed using an ME180 cell line stably transfected with a beta-lactamase reporter gene under the control of AP-1 response element following epidermal growth factor (EGF) stimulation. Immunocytochemistry allowed for further quantification of small molecule inhibition on a cellular protein level. RNAi and RT-qPCR experiments were performed to assess the amount of knockdown on an mRNA level, and immunocytochemistry was used to reveal cellular protein levels for the targeted pathway components. Results Increased potency of kinase inhibitors was shown by combining RNAi directed towards EGFR and small molecule inhibitors acting at proximal or distal points in the pathway. After cellular stimulation with EGF and analysis at the level of AP-1 activation using a β-lactamase reporter gene, a 10–12 fold shift or 2.5–3 fold shift toward greater potency in the IC50 was observed for EGFR and MEK-1 inhibitors, respectively, in the presence of RNAi targeting EGFR. Conclusion EGFR
Zha, Lisha; He, Lichun; Xie, Weidong; Cheng, Jin; Li, Tong; Mohsen, Mona O; Lei, Fan; Storni, Federico; Bachmann, Martin; Chen, Hongquan; Zhang, Yaou
2017-01-01
Pleiotrophin (PTN) is a secreted cytokine that is expressed in various cancer cell lines and human tumor such as colon cancer, lung cancer, gastric cancer and melanoma. It plays significant roles in angiogenesis, metastasis, differentiation and cell growth. The expression of PTN in the adult is limited to the hippocampus in an activity-dependent manner, making it a very attractive target for cancer therapy. RNA interference (RNAi) offers great potential as a new powerful therapeutic strategy based on its highly specific and efficient silencing of a target gene. However, efficient delivery of small interfering RNA (siRNA) in vivo remains a significant hurdle for its successful therapeutic application. In this study, we first identified, on a cell-based experiment, applying a 1:1 mixture of two PTN specific siRNA engenders a higher silencing efficiency on both mRNA and protein level than using any of them discretely at the same dose. As a consequence, slower melanoma cells growth was also observed for using two specific siRNA combinatorially. To establish a robust way for siRNA delivery in vivo and further investigate how silence of PTN affects tumor growth, we tested three different methods to deliver siRNA in vivo: first non-targeted in-vivo delivery of siRNA via jetPEI; second lung targeted delivery of siRNA via microbubble coated jetPEI; third tumor cell targeted delivery of siRNA via transferrin-polyethylenimine (Tf-PEI). As a result, we found that all three in-vivo siRNAs delivery methods led to an evident inhibition of melanoma growth in non-immune deficiency C57BL/6 mice without a measureable change of ALT and AST activities. Both targeted delivery methods showed more significant curative effect than jetPEI. The lung targeted delivery by microbubble coated jetPEI revealed a comparable therapeutic effect with Tf-PEI, indicating its potential application for target delivery of siRNA in vivo.
Xie, Weidong; Cheng, Jin; Li, Tong; Mohsen, Mona O.; Lei, Fan; Storni, Federico; Bachmann, Martin; Chen, Hongquan; Zhang, Yaou
2017-01-01
Pleiotrophin (PTN) is a secreted cytokine that is expressed in various cancer cell lines and human tumor such as colon cancer, lung cancer, gastric cancer and melanoma. It plays significant roles in angiogenesis, metastasis, differentiation and cell growth. The expression of PTN in the adult is limited to the hippocampus in an activity-dependent manner, making it a very attractive target for cancer therapy. RNA interference (RNAi) offers great potential as a new powerful therapeutic strategy based on its highly specific and efficient silencing of a target gene. However, efficient delivery of small interfering RNA (siRNA) in vivo remains a significant hurdle for its successful therapeutic application. In this study, we first identified, on a cell-based experiment, applying a 1:1 mixture of two PTN specific siRNA engenders a higher silencing efficiency on both mRNA and protein level than using any of them discretely at the same dose. As a consequence, slower melanoma cells growth was also observed for using two specific siRNA combinatorially. To establish a robust way for siRNA delivery in vivo and further investigate how silence of PTN affects tumor growth, we tested three different methods to deliver siRNA in vivo: first non-targeted in-vivo delivery of siRNA via jetPEI; second lung targeted delivery of siRNA via microbubble coated jetPEI; third tumor cell targeted delivery of siRNA via transferrin-polyethylenimine (Tf-PEI). As a result, we found that all three in-vivo siRNAs delivery methods led to an evident inhibition of melanoma growth in non-immune deficiency C57BL/6 mice without a measureable change of ALT and AST activities. Both targeted delivery methods showed more significant curative effect than jetPEI. The lung targeted delivery by microbubble coated jetPEI revealed a comparable therapeutic effect with Tf-PEI, indicating its potential application for target delivery of siRNA in vivo. PMID:28562667
Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de
2014-01-01
The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.
Delivery of RNA interference therapeutics using polycation-based nanoparticles.
Howard, Kenneth Alan
2009-07-25
RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.
Assembly and analysis of eukaryotic Argonaute–RNA complexes in microRNA-target recognition
Gan, Hin Hark; Gunsalus, Kristin C.
2015-01-01
Experimental studies have uncovered a variety of microRNA (miRNA)–target duplex structures that include perfect, imperfect and seedless duplexes. However, non-canonical binding modes from imperfect/seedless duplexes are not well predicted by computational approaches, which rely primarily on sequence and secondary structural features, nor have their tertiary structures been characterized because solved structures to date are limited to near perfect, straight duplexes in Argonautes (Agos). Here, we use structural modeling to examine the role of Ago dynamics in assembling viable eukaryotic miRNA-induced silencing complexes (miRISCs). We show that combinations of low-frequency, global modes of motion of Ago domains are required to accommodate RNA duplexes in model human and C. elegans Ago structures. Models of viable miRISCs imply that Ago adopts variable conformations at distinct target sites that generate distorted, imperfect miRNA-target duplexes. Ago's ability to accommodate a duplex is dependent on the region where structural distortions occur: distortions in solvent-exposed seed and 3′-end regions are less likely to produce steric clashes than those in the central duplex region. Energetic analyses of assembled miRISCs indicate that target recognition is also driven by favorable Ago-duplex interactions. Such structural insights into Ago loading and target recognition mechanisms may provide a more accurate assessment of miRNA function. PMID:26432829
Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J
2011-03-01
Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.
RISC RNA sequencing for context-specific identification of in vivo microRNA targets.
Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W
2011-01-07
MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.
Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum
Tomoyasu, Yoshinori
2014-01-01
The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485
MicroRNA as therapeutic targets for treatment of depression
Hansen, Katelin F; Obrietan, Karl
2013-01-01
Depression is a potentially life-threatening mental disorder affecting approximately 300 million people worldwide. Despite much effort, the molecular underpinnings of clinical depression remain poorly defined, and current treatments carry limited therapeutic efficacy and potentially burdensome side effects. Recently, small noncoding RNA molecules known as microRNA (miRNA) have gained prominence as a target for therapeutic intervention, given their capacity to regulate neuronal physiology. Further, mounting evidence suggests a prominent role for miRNA in depressive molecular signaling. Recent studies have demonstrated that dysregulation of miRNA expression occurs in animal models of depression, and in the post-mortem tissue of clinically depressed patients. Investigations into depression-associated miRNA disruption reveals dramatic effects on downstream targets, many of which are thought to contribute to depressive symptoms. Furthermore, selective serotonin reuptake inhibitors, as well as other antidepressant drugs, have the capacity to reverse aberrant depressive miRNA expression and their downstream targets. Given the powerful effects that miRNA have on the central nervous system transcriptome, and the aforementioned studies, there is a compelling rationale to begin to assess the potential contribution of miRNA to depressive etiology. Here, we review the molecular biology of miRNA, our current understanding of miRNA in relation to clinical depression, and the utility of targeting miRNA for antidepressant treatment. PMID:23935365
Musashi RNA-Binding Proteins as Cancer Drivers and Novel Therapeutic Targets.
Kudinov, Alexander E; Karanicolas, John; Golemis, Erica A; Boumber, Yanis
2017-05-01
Aberrant gene expression that drives human cancer can arise from epigenetic dysregulation. Although much attention has focused on altered activity of transcription factors and chromatin-modulating proteins, proteins that act posttranscriptionally can potently affect expression of oncogenic signaling proteins. The RNA-binding proteins (RBP) Musashi-1 (MSI1) and Musashi-2 (MSI2) are emerging as regulators of multiple critical biological processes relevant to cancer initiation, progression, and drug resistance. Following identification of Musashi as a regulator of progenitor cell identity in Drosophila , the human Musashi proteins were initially linked to control of maintenance of hematopoietic stem cells, then stem cell compartments for additional cell types. More recently, the Musashi proteins were found to be overexpressed and prognostic of outcome in numerous cancer types, including colorectal, lung, and pancreatic cancers; glioblastoma; and several leukemias. MSI1 and MSI2 bind and regulate the mRNA stability and translation of proteins operating in essential oncogenic signaling pathways, including NUMB/Notch, PTEN/mTOR, TGFβ/SMAD3, MYC, cMET, and others. On the basis of these activities, MSI proteins maintain cancer stem cell populations and regulate cancer invasion, metastasis, and development of more aggressive cancer phenotypes, including drug resistance. Although RBPs are viewed as difficult therapeutic targets, initial efforts to develop MSI-specific inhibitors are promising, and RNA interference-based approaches to inhibiting these proteins have had promising outcomes in preclinical studies. In the interim, understanding the function of these translational regulators may yield insight into the relationship between mRNA expression and protein expression in tumors, guiding tumor-profiling analysis. This review provides a current overview of Musashi as a cancer driver and novel therapeutic target. Clin Cancer Res; 23(9); 2143-53. ©2017 AACR . ©2017
Role of RNA interference in plant improvement
NASA Astrophysics Data System (ADS)
Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant
2011-06-01
Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.
TAPIR, a web server for the prediction of plant microRNA targets, including target mimics.
Bonnet, Eric; He, Ying; Billiau, Kenny; Van de Peer, Yves
2010-06-15
We present a new web server called TAPIR, designed for the prediction of plant microRNA targets. The server offers the possibility to search for plant miRNA targets using a fast and a precise algorithm. The precise option is much slower but guarantees to find less perfectly paired miRNA-target duplexes. Furthermore, the precise option allows the prediction of target mimics, which are characterized by a miRNA-target duplex having a large loop, making them undetectable by traditional tools. The TAPIR web server can be accessed at: http://bioinformatics.psb.ugent.be/webtools/tapir. Supplementary data are available at Bioinformatics online.
Probing Xist RNA Structure in Cells Using Targeted Structure-Seq
Rutenberg-Schoenberg, Michael; Simon, Matthew D.
2015-01-01
The long non-coding RNA (lncRNA) Xist is a master regulator of X-chromosome inactivation in mammalian cells. Models for how Xist and other lncRNAs function depend on thermodynamically stable secondary and higher-order structures that RNAs can form in the context of a cell. Probing accessible RNA bases can provide data to build models of RNA conformation that provide insight into RNA function, molecular evolution, and modularity. To study the structure of Xist in cells, we built upon recent advances in RNA secondary structure mapping and modeling to develop Targeted Structure-Seq, which combines chemical probing of RNA structure in cells with target-specific massively parallel sequencing. By enriching for signals from the RNA of interest, Targeted Structure-Seq achieves high coverage of the target RNA with relatively few sequencing reads, thus providing a targeted and scalable approach to analyze RNA conformation in cells. We use this approach to probe the full-length Xist lncRNA to develop new models for functional elements within Xist, including the repeat A element in the 5’-end of Xist. This analysis also identified new structural elements in Xist that are evolutionarily conserved, including a new element proximal to the C repeats that is important for Xist function. PMID:26646615
Kinetic analysis of the effects of target structure on siRNA efficiency
NASA Astrophysics Data System (ADS)
Chen, Jiawen; Zhang, Wenbing
2012-12-01
RNAi efficiency for target cleavage and protein expression is related to the target structure. Considering the RNA-induced silencing complex (RISC) as a multiple turnover enzyme, we investigated the effect of target mRNA structure on siRNA efficiency with kinetic analysis. The 4-step model was used to study the target cleavage kinetic process: hybridization nucleation at an accessible target site, RISC-mRNA hybrid elongation along with mRNA target structure melting, target cleavage, and enzyme reactivation. At this model, the terms accounting for the target accessibility, stability, and the seed and the nucleation site effects are all included. The results are in good agreement with that of experiments which show different arguments about the structure effects on siRNA efficiency. It shows that the siRNA efficiency is influenced by the integrated factors of target's accessibility, stability, and the seed effects. To study the off-target effects, a simple model of one siRNA binding to two mRNA targets was designed. By using this model, the possibility for diminishing the off-target effects by the concentration of siRNA was discussed.
In-silico analysis for RNA-interference mechanism of α-synuclein to treat Parkinson's disease.
Seema, S; Seenivasagam, R; Hemavathi, K
2013-01-01
Parkinson's Disease (PD) causing mutations in α-synuclein gene are ALA30PRO, GLU46LYS and ALA53THR. The conformational changes in proteins with respect to all the three mutations were analysed. These were used to predict the structures of Short Interfering RNA (siRNA) antisense strand and siRNA region. The siRNA binds with the argonaute protein forming RNA Induced Silencing Complex (RISC). Then, siRNA antisense-strand was attached to RISC. The structure of dicer (RNase-III-enzyme) cleaves double-stranded RNA (dsRNA) into two siRNA-strands. Incorporation of single siRNA-strand into RISC guides to pair with the complementary α-synuclein target-messenger RNA (mRNA) thereby enabling it to cleave the target.
Mapping interactions between the RNA chaperone FinO and its RNA targets
Arthur, David C.; Tsutakawa, Susan; Tainer, John A.; Frost, Laura S.; Glover, J. N. Mark
2011-01-01
Bacterial conjugation is regulated by two-component repression comprising the antisense RNA FinP, and its protein co-factor FinO. FinO mediates base-pairing of FinP to the 5′-untranslated region (UTR) of traJ mRNA, which leads to translational inhibition of the transcriptional activator TraJ and subsequent down regulation of conjugation genes. Yet, little is known about how FinO binds to its RNA targets or how this interaction facilitates FinP and traJ mRNA pairing. Here, we use solution methods to determine how FinO binds specifically to its minimal high affinity target, FinP stem–loop II (SLII), and its complement SLIIc from traJ mRNA. Ribonuclease footprinting reveals that FinO contacts the base of the stem and the 3′ single-stranded tails of these RNAs. The phosphorylation or oxidation of the 3′-nucleotide blocks FinO binding, suggesting FinO binds the 3′-hydroxyl of its RNA targets. The collective results allow the generation of an energy-minimized model of the FinO–SLII complex, consistent with small-angle X-ray scattering data. The repression complex model was constrained using previously reported cross-linking data and newly developed footprinting results. Together, these data lead us to propose a model of how FinO mediates FinP/traJ mRNA pairing to down regulate bacterial conjugation. PMID:21278162
New basic approach to treat non-small cell lung cancer based on RNA-interference.
Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias
2014-03-01
To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.
Cas9-mediated targeting of viral RNA in eukaryotic cells.
Price, Aryn A; Sampson, Timothy R; Ratner, Hannah K; Grakoui, Arash; Weiss, David S
2015-05-12
Clustered, regularly interspaced, short palindromic repeats-CRISPR associated (CRISPR-Cas) systems are prokaryotic RNA-directed endonuclease machineries that act as an adaptive immune system against foreign genetic elements. Using small CRISPR RNAs that provide specificity, Cas proteins recognize and degrade nucleic acids. Our previous work demonstrated that the Cas9 endonuclease from Francisella novicida (FnCas9) is capable of targeting endogenous bacterial RNA. Here, we show that FnCas9 can be directed by an engineered RNA-targeting guide RNA to target and inhibit a human +ssRNA virus, hepatitis C virus, within eukaryotic cells. This work reveals a versatile and portable RNA-targeting system that can effectively function in eukaryotic cells and be programmed as an antiviral defense.
Cas9-mediated targeting of viral RNA in eukaryotic cells
Price, Aryn A.; Sampson, Timothy R.; Ratner, Hannah K.; Grakoui, Arash; Weiss, David S.
2015-01-01
Clustered, regularly interspaced, short palindromic repeats–CRISPR associated (CRISPR-Cas) systems are prokaryotic RNA-directed endonuclease machineries that act as an adaptive immune system against foreign genetic elements. Using small CRISPR RNAs that provide specificity, Cas proteins recognize and degrade nucleic acids. Our previous work demonstrated that the Cas9 endonuclease from Francisella novicida (FnCas9) is capable of targeting endogenous bacterial RNA. Here, we show that FnCas9 can be directed by an engineered RNA-targeting guide RNA to target and inhibit a human +ssRNA virus, hepatitis C virus, within eukaryotic cells. This work reveals a versatile and portable RNA-targeting system that can effectively function in eukaryotic cells and be programmed as an antiviral defense. PMID:25918406
How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference
ERIC Educational Resources Information Center
Kuldell, Natalie H.
2006-01-01
It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…
Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim
2018-06-12
During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.
Liu, Yali; Liu, Li; Zhan, Yonghao; Zhuang, Chengle; Lin, Junhao; Chen, Mingwei; Li, Jianfa; Cai, Zhiming; Huang, Weiren; Zhang, Yong
2016-01-01
CRISPR-Cas9 system uses a guide RNA which functions in conjunction with Cas9 proteins to target a DNA and cleaves double-strand DNA. This phenomenon raises a question whether an artificial small RNA (asRNA), composed of a Dicer–binding RNA element and an antisense RNA, could also be used to induce Dicer to process and degrade a specific RNA. If so, we could develop a new method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, we selected MALAT-1 as target and used Hela and MDA-MB-231 cells as experimental models. The results of qRT-PCR showed that the introduction of asRNA decreased the relative expression level of target gene significantly. Next, we analyzed cell proliferation using CCK-8 and EdU staining assays, and then cell migration using wound scratch and Transwell invasion assays. We found that cell proliferation and cell migration were both suppressed remarkably after asRNA was expressed in Hela and MDA-MB-231 cells. Cell apoptosis was also detected through Hoechst staining and ELISA assays and the data indicated that he numbers of apoptotic cell in experimental groups significantly increased compared with negative controls. In order to prove that the gene silencing effects were caused by Dicer, we co-transfected shRNA silencing Dicer and asRNA. The relative expression levels of Dicer and MALAT-1 were both detected and the results indicated that when the cleavage role of Dicer was silenced, the relative expression level of MALAT-1 was not affected after the introduction of asRNA. All the above results demonstrated that these devices directed by Dicer effectively excised target RNA and repressed the target genes, thus causing phenotypic changes. Our works adds a new dimension to gene regulating technologies and may have broad applications in construction of gene circuits. PMID:27231846
Xu, Wen; Liu, Yuchen; Liu, Yali; Liu, Li; Zhan, Yonghao; Zhuang, Chengle; Lin, Junhao; Chen, Mingwei; Li, Jianfa; Cai, Zhiming; Huang, Weiren; Zhang, Yong
2016-08-23
CRISPR-Cas9 system uses a guide RNA which functions in conjunction with Cas9 proteins to target a DNA and cleaves double-strand DNA. This phenomenon raises a question whether an artificial small RNA (asRNA), composed of a Dicer-binding RNA element and an antisense RNA, could also be used to induce Dicer to process and degrade a specific RNA. If so, we could develop a new method which is named DICERi for gene silencing or RNA editing. To prove the feasibility of asRNA, we selected MALAT-1 as target and used Hela and MDA-MB-231 cells as experimental models. The results of qRT-PCR showed that the introduction of asRNA decreased the relative expression level of target gene significantly. Next, we analyzed cell proliferation using CCK-8 and EdU staining assays, and then cell migration using wound scratch and Transwell invasion assays. We found that cell proliferation and cell migration were both suppressed remarkably after asRNA was expressed in Hela and MDA-MB-231 cells. Cell apoptosis was also detected through Hoechst staining and ELISA assays and the data indicated that he numbers of apoptotic cell in experimental groups significantly increased compared with negative controls. In order to prove that the gene silencing effects were caused by Dicer, we co-transfected shRNA silencing Dicer and asRNA. The relative expression levels of Dicer and MALAT-1 were both detected and the results indicated that when the cleavage role of Dicer was silenced, the relative expression level of MALAT-1 was not affected after the introduction of asRNA. All the above results demonstrated that these devices directed by Dicer effectively excised target RNA and repressed the target genes, thus causing phenotypic changes. Our works adds a new dimension to gene regulating technologies and may have broad applications in construction of gene circuits.
Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S
2014-05-16
Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.
Development of a microcapillary column for detecting targeted messenger RNA molecules.
Ohnishi, Michihiro
2006-03-24
A capillary column in a rapid-flow system has been developed for detecting targeted messenger RNA (mRNA) molecules. The column has a structure made of two beds-one bed of porous microbeads and one bed of microbeads with a polythymidine base sequence. The targeted eukaryotic mRNA molecules are detected by two-step hybridization (sandwich hybridization) composed of polyadenosine selection of mRNA molecules and formation of a probe-target (targeted mRNA) hybrid. The sandwich hybridization, which is accomplished within 1 h, was tested using synthetic polydeoxynucleotides. Ten picomoles of the targeted polydeoxynucleotide were detected.
Benchmarking CRISPR on-target sgRNA design.
Yan, Jifang; Chuai, Guohui; Zhou, Chi; Zhu, Chenyu; Yang, Jing; Zhang, Chao; Gu, Feng; Xu, Han; Wei, Jia; Liu, Qi
2017-02-15
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-based gene editing has been widely implemented in various cell types and organisms. A major challenge in the effective application of the CRISPR system is the need to design highly efficient single-guide RNA (sgRNA) with minimal off-target cleavage. Several tools are available for sgRNA design, while limited tools were compared. In our opinion, benchmarking the performance of the available tools and indicating their applicable scenarios are important issues. Moreover, whether the reported sgRNA design rules are reproducible across different sgRNA libraries, cell types and organisms remains unclear. In our study, a systematic and unbiased benchmark of the sgRNA predicting efficacy was performed on nine representative on-target design tools, based on six benchmark data sets covering five different cell types. The benchmark study presented here provides novel quantitative insights into the available CRISPR tools. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Basnet, Sanjay; Kamble, Shripat T
2018-05-01
Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-04-01
Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.
New support vector machine-based method for microRNA target prediction.
Li, L; Gao, Q; Mao, X; Cao, Y
2014-06-09
MicroRNA (miRNA) plays important roles in cell differentiation, proliferation, growth, mobility, and apoptosis. An accurate list of precise target genes is necessary in order to fully understand the importance of miRNAs in animal development and disease. Several computational methods have been proposed for miRNA target-gene identification. However, these methods still have limitations with respect to their sensitivity and accuracy. Thus, we developed a new miRNA target-prediction method based on the support vector machine (SVM) model. The model supplies information of two binding sites (primary and secondary) for a radial basis function kernel as a similarity measure for SVM features. The information is categorized based on structural, thermodynamic, and sequence conservation. Using high-confidence datasets selected from public miRNA target databases, we obtained a human miRNA target SVM classifier model with high performance and provided an efficient tool for human miRNA target gene identification. Experiments have shown that our method is a reliable tool for miRNA target-gene prediction, and a successful application of an SVM classifier. Compared with other methods, the method proposed here improves the sensitivity and accuracy of miRNA prediction. Its performance can be further improved by providing more training examples.
TarPmiR: a new approach for microRNA target site prediction.
Ding, Jun; Li, Xiaoman; Hu, Haiyan
2016-09-15
The identification of microRNA (miRNA) target sites is fundamentally important for studying gene regulation. There are dozens of computational methods available for miRNA target site prediction. Despite their existence, we still cannot reliably identify miRNA target sites, partially due to our limited understanding of the characteristics of miRNA target sites. The recently published CLASH (crosslinking ligation and sequencing of hybrids) data provide an unprecedented opportunity to study the characteristics of miRNA target sites and improve miRNA target site prediction methods. Applying four different machine learning approaches to the CLASH data, we identified seven new features of miRNA target sites. Combining these new features with those commonly used by existing miRNA target prediction algorithms, we developed an approach called TarPmiR for miRNA target site prediction. Testing on two human and one mouse non-CLASH datasets, we showed that TarPmiR predicted more than 74.2% of true miRNA target sites in each dataset. Compared with three existing approaches, we demonstrated that TarPmiR is superior to these existing approaches in terms of better recall and better precision. The TarPmiR software is freely available at http://hulab.ucf.edu/research/projects/miRNA/TarPmiR/ CONTACTS: haihu@cs.ucf.edu or xiaoman@mail.ucf.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
Santangeloyz, K.S.; Bertoneyz, A.L.
2011-01-01
targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742
Santangelo, K S; Bertone, A L
2011-12-01
in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Kai, Yoshiro; Tomoda, Koichi; Yoneyama, Hiroyuki; Yoshikawa, Masanori; Kimura, Hiroshi
2015-12-09
Chondroitin sulfate proteoglycans are an important mediators in inflammation and leukocyte trafficking. However, their roles in pulmonary emphysema have not been explored. In a murine model of elastase-induced pulmonary emphysema, we found increased carbohydrate sulfotransferase 3 (CHST3), a specific enzyme that synthesizes chondroitin 6-sulfate proteoglycan (C6SPG). To elucidate the role of C6SPG, we investigated the effect of small interfering RNA (siRNA) targeting CHST3 that inhibits C6SPG-synthesis on the pathogenesis of pulmonary emphysema. Mice were intraperitoneally injected with CHST3 siRNA or negative control siRNA on day0 and 7 after intratracheal instillation of elastase. Histology, respiratory function, glycosaminoglycans (GAGs) content, bronchoalveolar lavage (BAL), elastin staining and gene expressions of tumor necrosis factor (TNF)-α and matrix metalloproteinase (MMP)-9 mRNA were evaluated on day7 and/or day21. CHST3 mRNA increased at day 7 and decreased thereafter in lung. CHST3 siRNA successfully inhibited the expression of CHST3 mRNA throughout the study and this was associated with significant reduction of GAGs and C6SPG. Airway destruction and respiratory function were improved by the treatment with CHST3 siRNA. CHST3 siRNA reduced the number of macrophages both in BAL and lung parenchyma and also suppressed the increased expressions of TNF-α and MMP-9 mRNA. Futhermore, CHST3 siRNA improved the reduction of the elastin in the alveolar walls. CHST3 siRNA diminishes accumulation of excessive macrophages and the mediators, leading to accelerate the functional recovery from airway damage by repair of the elastin network associated with pulmonary emphysema.
Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A
2017-02-01
Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.
Virus-Derived Gene Expression and RNA Interference Vector for Grapevine
Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.
2012-01-01
The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553
Ultrasound-Targeted Microbubble Destruction to Deliver siRNA Cancer Therapy
Carson, Andrew R; McTiernan, Charles F; Lavery, Linda; Grata, Michelle; Leng, Xiaoping; Wang, Jianjun; Chen, Xucai; Villanueva, Flordeliza S
2012-01-01
Microbubble contrast agents can specifically deliver nucleic acids to target tissues when exposed to ultrasound treatment parameters that mediate microbubble destruction. In this study, we evaluated whether microbubbles and ultrasound targeted microbubble destruction (UTMD) could be used to enhance delivery of EGFR-directed small inhibitory RNA (siRNA) to murine squamous cell carcinomas. Custom designed microbubbles efficiently bound siRNA and mediated RNAse protection. UTMD-mediated delivery of microbubbles loaded with EGFR-directed siRNA to murine squamous carcinoma cells in vitro reduced EGFR expression and EGF-dependent growth, relative to delivery of control siRNA. Similarly, serial UTMD-mediated delivery of EGFR siRNA to squamous cell carcinoma in vivo decreased EGFR expression and increased tumor doubling times, relative to controls receiving EGFR siRNA loaded microbubbles but not ultrasound or control siRNA loaded microbubbles and UTMD. Taken together, our results offer a preclinical proof of concept for customized microbubbles and UTMD to deliver gene-targeted siRNA for cancer therapy. PMID:23010078
Identification of human microRNA targets from isolated argonaute protein complexes.
Beitzinger, Michaela; Peters, Lasse; Zhu, Jia Yun; Kremmer, Elisabeth; Meister, Gunter
2007-06-01
MicroRNAs (miRNAs) constitute a class of small non-coding RNAs that regulate gene expression on the level of translation and/or mRNA stability. Mammalian miRNAs associate with members of the Argonaute (Ago) protein family and bind to partially complementary sequences in the 3' untranslated region (UTR) of specific target mRNAs. Computer algorithms based on factors such as free binding energy or sequence conservation have been used to predict miRNA target mRNAs. Based on such predictions, up to one third of all mammalian mRNAs seem to be under miRNA regulation. However, due to the low degree of complementarity between the miRNA and its target, such computer programs are often imprecise and therefore not very reliable. Here we report the first biochemical identification approach of miRNA targets from human cells. Using highly specific monoclonal antibodies against members of the Ago protein family, we co-immunoprecipitate Ago-bound mRNAs and identify them by cloning. Interestingly, most of the identified targets are also predicted by different computer programs. Moreover, we randomly analyzed six different target candidates and were able to experimentally validate five as miRNA targets. Our data clearly indicate that miRNA targets can be experimentally identified from Ago complexes and therefore provide a new tool to directly analyze miRNA function.
Engineering RNA for Targeted siRNA Delivery and Medical Application
Guo, Peixuan; Coban, Oana; Snead, Nick; Trebley, Joe; Hoeprich, Steve; Guo, Songchuan; Shu, Yi
2010-01-01
RNA engineering for nanotechnology and medical applications is an exciting emerging research field. RNA has intrinsically defined features on the nanometer scale and is a particularly interesting candidate for such applications due to its amazing diversity, flexibility and versatility in structure and function. Specifically, the current use of siRNA to silence target genes involved in disease has generated much excitement in the scientific community. The intrinsic ability to sequence-specifically down-regulate gene expression in a temporally- and spatially-controlled fashion has led to heightened interest and rapid development of siRNA-based therapeutics. Though methods for gene silencing with high efficacy and specificity have been achieved in vitro, the effective delivery of nucleic acids to specific cells in vivo has been a hurdle for RNA therapeutics. This review covers different RNA-based approaches for diagnosis, prevention and treatment of human disease, with a focus on the latest developments of nonviral carriers of siRNA for delivery in vivo. The applications and challenges of siRNA therapy, as well as potential solutions to these problems, the approaches for using phi29 pRNA-based vectors as polyvalent vehicles for specific delivery of siRNA, ribozymes, drugs or other therapeutic agents to specific cells for therapy will also be addressed. PMID:20230868
RNA-modifying proteins as anticancer drug targets.
Boriack-Sjodin, P Ann; Ribich, Scott; Copeland, Robert A
2018-06-01
All major biological macromolecules (DNA, RNA, proteins and lipids) undergo enzyme-catalysed covalent modifications that impact their structure, function and stability. A variety of covalent modifications of RNA have been identified and demonstrated to affect RNA stability and translation to proteins; these mechanisms of translational control have been termed epitranscriptomics. Emerging data suggest that some epitranscriptomic mechanisms are altered in human cancers as well as other human diseases. In this Review, we examine the current understanding of RNA modifications with a focus on mRNA methylation, highlight their possible roles in specific cancer indications and discuss the emerging potential of RNA-modifying proteins as therapeutic targets.
Aminoacyl-tRNA synthetases as drug targets in eukaryotic parasites☆
Pham, James S.; Dawson, Karen L.; Jackson, Katherine E.; Lim, Erin E.; Pasaje, Charisse Flerida A.; Turner, Kelsey E.C.; Ralph, Stuart A.
2013-01-01
Aminoacyl-tRNA synthetases are central enzymes in protein translation, providing the charged tRNAs needed for appropriate construction of peptide chains. These enzymes have long been pursued as drug targets in bacteria and fungi, but the past decade has seen considerable research on aminoacyl-tRNA synthetases in eukaryotic parasites. Existing inhibitors of bacterial tRNA synthetases have been adapted for parasite use, novel inhibitors have been developed against parasite enzymes, and tRNA synthetases have been identified as the targets for compounds in use or development as antiparasitic drugs. Crystal structures have now been solved for many parasite tRNA synthetases, and opportunities for selective inhibition are becoming apparent. For different biological reasons, tRNA synthetases appear to be promising drug targets against parasites as diverse as Plasmodium (causative agent of malaria), Brugia (causative agent of lymphatic filariasis), and Trypanosoma (causative agents of Chagas disease and human African trypanosomiasis). Here we review recent developments in drug discovery and target characterisation for parasite aminoacyl-tRNA synthetases. PMID:24596663
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977
Huang, Jingshan; Gutierrez, Fernando; Strachan, Harrison J; Dou, Dejing; Huang, Weili; Smith, Barry; Blake, Judith A; Eilbeck, Karen; Natale, Darren A; Lin, Yu; Wu, Bin; Silva, Nisansa de; Wang, Xiaowei; Liu, Zixing; Borchert, Glen M; Tan, Ming; Ruttenberg, Alan
2016-01-01
As a special class of non-coding RNAs (ncRNAs), microRNAs (miRNAs) perform important roles in numerous biological and pathological processes. The realization of miRNA functions depends largely on how miRNAs regulate specific target genes. It is therefore critical to identify, analyze, and cross-reference miRNA-target interactions to better explore and delineate miRNA functions. Semantic technologies can help in this regard. We previously developed a miRNA domain-specific application ontology, Ontology for MIcroRNA Target (OMIT), whose goal was to serve as a foundation for semantic annotation, data integration, and semantic search in the miRNA field. In this paper we describe our continuing effort to develop the OMIT, and demonstrate its use within a semantic search system, OmniSearch, designed to facilitate knowledge capture of miRNA-target interaction data. Important changes in the current version OMIT are summarized as: (1) following a modularized ontology design (with 2559 terms imported from the NCRO ontology); (2) encoding all 1884 human miRNAs (vs. 300 in previous versions); and (3) setting up a GitHub project site along with an issue tracker for more effective community collaboration on the ontology development. The OMIT ontology is free and open to all users, accessible at: http://purl.obolibrary.org/obo/omit.owl. The OmniSearch system is also free and open to all users, accessible at: http://omnisearch.soc.southalabama.edu/index.php/Software.
ERIC Educational Resources Information Center
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E
2010-05-01
The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.
Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima
2011-02-01
Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.
RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L
2009-04-01
RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.
TargetSpy: a supervised machine learning approach for microRNA target prediction.
Sturm, Martin; Hackenberg, Michael; Langenberger, David; Frishman, Dmitrij
2010-05-28
Virtually all currently available microRNA target site prediction algorithms require the presence of a (conserved) seed match to the 5' end of the microRNA. Recently however, it has been shown that this requirement might be too stringent, leading to a substantial number of missed target sites. We developed TargetSpy, a novel computational approach for predicting target sites regardless of the presence of a seed match. It is based on machine learning and automatic feature selection using a wide spectrum of compositional, structural, and base pairing features covering current biological knowledge. Our model does not rely on evolutionary conservation, which allows the detection of species-specific interactions and makes TargetSpy suitable for analyzing unconserved genomic sequences.In order to allow for an unbiased comparison of TargetSpy to other methods, we classified all algorithms into three groups: I) no seed match requirement, II) seed match requirement, and III) conserved seed match requirement. TargetSpy predictions for classes II and III are generated by appropriate postfiltering. On a human dataset revealing fold-change in protein production for five selected microRNAs our method shows superior performance in all classes. In Drosophila melanogaster not only our class II and III predictions are on par with other algorithms, but notably the class I (no-seed) predictions are just marginally less accurate. We estimate that TargetSpy predicts between 26 and 112 functional target sites without a seed match per microRNA that are missed by all other currently available algorithms. Only a few algorithms can predict target sites without demanding a seed match and TargetSpy demonstrates a substantial improvement in prediction accuracy in that class. Furthermore, when conservation and the presence of a seed match are required, the performance is comparable with state-of-the-art algorithms. TargetSpy was trained on mouse and performs well in human and drosophila
TargetSpy: a supervised machine learning approach for microRNA target prediction
2010-01-01
Background Virtually all currently available microRNA target site prediction algorithms require the presence of a (conserved) seed match to the 5' end of the microRNA. Recently however, it has been shown that this requirement might be too stringent, leading to a substantial number of missed target sites. Results We developed TargetSpy, a novel computational approach for predicting target sites regardless of the presence of a seed match. It is based on machine learning and automatic feature selection using a wide spectrum of compositional, structural, and base pairing features covering current biological knowledge. Our model does not rely on evolutionary conservation, which allows the detection of species-specific interactions and makes TargetSpy suitable for analyzing unconserved genomic sequences. In order to allow for an unbiased comparison of TargetSpy to other methods, we classified all algorithms into three groups: I) no seed match requirement, II) seed match requirement, and III) conserved seed match requirement. TargetSpy predictions for classes II and III are generated by appropriate postfiltering. On a human dataset revealing fold-change in protein production for five selected microRNAs our method shows superior performance in all classes. In Drosophila melanogaster not only our class II and III predictions are on par with other algorithms, but notably the class I (no-seed) predictions are just marginally less accurate. We estimate that TargetSpy predicts between 26 and 112 functional target sites without a seed match per microRNA that are missed by all other currently available algorithms. Conclusion Only a few algorithms can predict target sites without demanding a seed match and TargetSpy demonstrates a substantial improvement in prediction accuracy in that class. Furthermore, when conservation and the presence of a seed match are required, the performance is comparable with state-of-the-art algorithms. TargetSpy was trained on mouse and performs well
DNA targeting specificity of RNA-guided Cas9 nucleases.
Hsu, Patrick D; Scott, David A; Weinstein, Joshua A; Ran, F Ann; Konermann, Silvana; Agarwala, Vineeta; Li, Yinqing; Fine, Eli J; Wu, Xuebing; Shalem, Ophir; Cradick, Thomas J; Marraffini, Luciano A; Bao, Gang; Zhang, Feng
2013-09-01
The Streptococcus pyogenes Cas9 (SpCas9) nuclease can be efficiently targeted to genomic loci by means of single-guide RNAs (sgRNAs) to enable genome editing. Here, we characterize SpCas9 targeting specificity in human cells to inform the selection of target sites and avoid off-target effects. Our study evaluates >700 guide RNA variants and SpCas9-induced indel mutation levels at >100 predicted genomic off-target loci in 293T and 293FT cells. We find that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches. We also show that SpCas9-mediated cleavage is unaffected by DNA methylation and that the dosage of SpCas9 and sgRNA can be titrated to minimize off-target modification. To facilitate mammalian genome engineering applications, we provide a web-based software tool to guide the selection and validation of target sequences as well as off-target analyses.
RNA-guided genome editing for target gene mutations in wheat.
Upadhyay, Santosh Kumar; Kumar, Jitesh; Alok, Anshu; Tuli, Rakesh
2013-12-09
The clustered, regularly interspaced, short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) system has been used as an efficient tool for genome editing. We report the application of CRISPR-Cas-mediated genome editing to wheat (Triticum aestivum), the most important food crop plant with a very large and complex genome. The mutations were targeted in the inositol oxygenase (inox) and phytoene desaturase (pds) genes using cell suspension culture of wheat and in the pds gene in leaves of Nicotiana benthamiana. The expression of chimeric guide RNAs (cgRNA) targeting single and multiple sites resulted in indel mutations in all the tested samples. The expression of Cas9 or sgRNA alone did not cause any mutation. The expression of duplex cgRNA with Cas9 targeting two sites in the same gene resulted in deletion of DNA fragment between the targeted sequences. Multiplexing the cgRNA could target two genes at one time. Target specificity analysis of cgRNA showed that mismatches at the 3' end of the target site abolished the cleavage activity completely. The mismatches at the 5' end reduced cleavage, suggesting that the off target effects can be abolished in vivo by selecting target sites with unique sequences at 3' end. This approach provides a powerful method for genome engineering in plants.
New target for inhibition of bacterial RNA polymerase: 'switch region'.
Srivastava, Aashish; Talaue, Meliza; Liu, Shuang; Degen, David; Ebright, Richard Y; Sineva, Elena; Chakraborty, Anirban; Druzhinin, Sergey Y; Chatterjee, Sujoy; Mukhopadhyay, Jayanta; Ebright, Yon W; Zozula, Alex; Shen, Juan; Sengupta, Sonali; Niedfeldt, Rui Rong; Xin, Cai; Kaneko, Takushi; Irschik, Herbert; Jansen, Rolf; Donadio, Stefano; Connell, Nancy; Ebright, Richard H
2011-10-01
A new drug target - the 'switch region' - has been identified within bacterial RNA polymerase (RNAP), the enzyme that mediates bacterial RNA synthesis. The new target serves as the binding site for compounds that inhibit bacterial RNA synthesis and kill bacteria. Since the new target is present in most bacterial species, compounds that bind to the new target are active against a broad spectrum of bacterial species. Since the new target is different from targets of other antibacterial agents, compounds that bind to the new target are not cross-resistant with other antibacterial agents. Four antibiotics that function through the new target have been identified: myxopyronin, corallopyronin, ripostatin, and lipiarmycin. This review summarizes the switch region, switch-region inhibitors, and implications for antibacterial drug discovery. Copyright © 2011 Elsevier Ltd. All rights reserved.
Whole-Genome Thermodynamic Analysis Reduces siRNA Off-Target Effects
Chen, Xi; Liu, Peng; Chou, Hui-Hsien
2013-01-01
Small interfering RNAs (siRNAs) are important tools for knocking down targeted genes, and have been widely applied to biological and biomedical research. To design siRNAs, two important aspects must be considered: the potency in knocking down target genes and the off-target effect on any nontarget genes. Although many studies have produced useful tools to design potent siRNAs, off-target prevention has mostly been delegated to sequence-level alignment tools such as BLAST. We hypothesize that whole-genome thermodynamic analysis can identify potential off-targets with higher precision and help us avoid siRNAs that may have strong off-target effects. To validate this hypothesis, two siRNA sets were designed to target three human genes IDH1, ITPR2 and TRIM28. They were selected from the output of two popular siRNA design tools, siDirect and siDesign. Both siRNA design tools have incorporated sequence-level screening to avoid off-targets, thus their output is believed to be optimal. However, one of the sets we tested has off-target genes predicted by Picky, a whole-genome thermodynamic analysis tool. Picky can identify off-target genes that may hybridize to a siRNA within a user-specified melting temperature range. Our experiments validated that some off-target genes predicted by Picky can indeed be inhibited by siRNAs. Similar experiments were performed using commercially available siRNAs and a few off-target genes were also found to be inhibited as predicted by Picky. In summary, we demonstrate that whole-genome thermodynamic analysis can identify off-target genes that are missed in sequence-level screening. Because Picky prediction is deterministic according to thermodynamics, if a siRNA candidate has no Picky predicted off-targets, it is unlikely to cause off-target effects. Therefore, we recommend including Picky as an additional screening step in siRNA design. PMID:23484018
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689
Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José
2017-12-01
Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.
DeepMirTar: a deep-learning approach for predicting human miRNA targets.
Wen, Ming; Cong, Peisheng; Zhang, Zhimin; Lu, Hongmei; Li, Tonghua
2018-06-01
MicroRNAs (miRNAs) are small noncoding RNAs that function in RNA silencing and post-transcriptional regulation of gene expression by targeting messenger RNAs (mRNAs). Because the underlying mechanisms associated with miRNA binding to mRNA are not fully understood, a major challenge of miRNA studies involves the identification of miRNA-target sites on mRNA. In silico prediction of miRNA-target sites can expedite costly and time-consuming experimental work by providing the most promising miRNA-target-site candidates. In this study, we reported the design and implementation of DeepMirTar, a deep-learning-based approach for accurately predicting human miRNA targets at the site level. The predicted miRNA-target sites are those having canonical or non-canonical seed, and features, including high-level expert-designed, low-level expert-designed, and raw-data-level, were used to represent the miRNA-target site. Comparison with other state-of-the-art machine-learning methods and existing miRNA-target-prediction tools indicated that DeepMirTar improved overall predictive performance. DeepMirTar is freely available at https://github.com/Bjoux2/DeepMirTar_SdA. lith@tongji.edu.cn, hongmeilu@csu.edu.cn. Supplementary data are available at Bioinformatics online.
Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA
2012-01-01
utilization of dsRNA as a bio-insecticide against mosquitoes has only recently begun to be evaluated. Double-stranded RNA targeting chitin syn- thase...double- stranded RNA nanoparticle-mediated RNA interference to silence chitin synthase genes through larval feeding in the African malaria mosquito
New insights into siRNA amplification and RNAi
Zhang, Chi; Ruvkun, Gary
2012-01-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes. PMID:22858672
New insights into siRNA amplification and RNAi.
Zhang, Chi; Ruvkun, Gary
2012-08-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.
Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua
2018-06-12
Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.
Current Progress of siRNA/shRNA Therapeutics in Clinical Trials
Burnett, John C.; Rossi, John J.; Tiemann, Katrin
2012-01-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. For some of the drugs, advancements in bioengineering and nanotechnology have led to improved control of delivery and release of the siRNA. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. PMID:21744502
HomoTarget: a new algorithm for prediction of microRNA targets in Homo sapiens.
Ahmadi, Hamed; Ahmadi, Ali; Azimzadeh-Jamalkandi, Sadegh; Shoorehdeli, Mahdi Aliyari; Salehzadeh-Yazdi, Ali; Bidkhori, Gholamreza; Masoudi-Nejad, Ali
2013-02-01
MiRNAs play an essential role in the networks of gene regulation by inhibiting the translation of target mRNAs. Several computational approaches have been proposed for the prediction of miRNA target-genes. Reports reveal a large fraction of under-predicted or falsely predicted target genes. Thus, there is an imperative need to develop a computational method by which the target mRNAs of existing miRNAs can be correctly identified. In this study, combined pattern recognition neural network (PRNN) and principle component analysis (PCA) architecture has been proposed in order to model the complicated relationship between miRNAs and their target mRNAs in humans. The results of several types of intelligent classifiers and our proposed model were compared, showing that our algorithm outperformed them with higher sensitivity and specificity. Using the recent release of the mirBase database to find potential targets of miRNAs, this model incorporated twelve structural, thermodynamic and positional features of miRNA:mRNA binding sites to select target candidates. Copyright © 2012 Elsevier Inc. All rights reserved.
The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.
Li, Bai-Ling; Zhang, Guan-Xin; Hou, Xiao-Lei; Tan, Meng-Wei; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Huang, Sheng-Dong
2009-03-01
To study the inhibition of angiogenin (ANG) expression in human lung squamous cancer cell strain-A549 through adeno-associated virus (AAV)-mediated RNA-interference, and therefore to observe its effect on the growth of cancer cells and tumor formation. Recombinant AAV expressing H1-promoter-induced small-interference- RNA (siRNA) targeting ANG (AAV-shANG) was constructed, and then transfected into A549 cells. A549 cells and cells transfected with AAV-Null were used as the control groups. The effects of the reduced expression of ANG by RNAi from AAV-shANG on the growth, formation, reproduction, apoptosis, and microvessel-density of the carcinoma were observed. In vitro experiment showed that AAV-shANG was constructed successfully, There was an significant decrease in the expression of ANG protein 72 h after transfection, compared with the normal A459 cells and AAV-Null cells (P < 0.01). Cell cycle analysis showed that the proliferation index (PI) of normal A549 cells, AAV-Null cells and AAVshANG cells were 0.32 +/- 0.29, 0.35 +/- 0.38 and 0.31 +/- 0.43, respectively. There was no statistic difference in the PIs among the 3 groups (P > 0.05). In vivo experiment using thymus-defect mice showed that, there was an remarkable reduction in the mass and volume of tumors in AAV-shANG transfected group, compared to the control groups. Microvessel-density was 9.4 +/- 1.5, 9.8 +/- 2.1 and 5.7 +/- 1.9, respectively in the 3 groups, a statistic difference among the AAV-shANG-transfected group, the normal A549 group and the AAV-Null transfected group. The percentages of apoptotic cells in each group were (7.7 +/- 3.1)%, (8.5 +/- 5.4)%, (17.1 +/- 8.6)%, respectively, the experimental group being higher than those of the control groups. Positive rates of PCNA were (84.8 +/- 9.7)%, (85.8 +/- 9.8)%, and (70.4 +/- 10.1)%, respectively, the AAV-shANG transfected cancer cells showing a lower PCNA index than the control groups. AAV-mediated expression of siRNA could reduce the expression
Methods to enable the design of bioactive small molecules targeting RNA.
Disney, Matthew D; Yildirim, Ilyas; Childs-Disney, Jessica L
2014-02-21
RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including structure-activity relationships through sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome.
Ahadi, Alireza; Sablok, Gaurav; Hutvagner, Gyorgy
2017-04-07
MicroRNAs (miRNAs) are ∼19-22 nucleotides (nt) long regulatory RNAs that regulate gene expression by recognizing and binding to complementary sequences on mRNAs. The key step in revealing the function of a miRNA, is the identification of miRNA target genes. Recent biochemical advances including PAR-CLIP and HITS-CLIP allow for improved miRNA target predictions and are widely used to validate miRNA targets. Here, we present miRTar2GO, which is a model, trained on the common rules of miRNA-target interactions, Argonaute (Ago) CLIP-Seq data and experimentally validated miRNA target interactions. miRTar2GO is designed to predict miRNA target sites using more relaxed miRNA-target binding characteristics. More importantly, miRTar2GO allows for the prediction of cell-type specific miRNA targets. We have evaluated miRTar2GO against other widely used miRNA target prediction algorithms and demonstrated that miRTar2GO produced significantly higher F1 and G scores. Target predictions, binding specifications, results of the pathway analysis and gene ontology enrichment of miRNA targets are freely available at http://www.mirtar2go.org. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chapter 17. Extension of endogenous primers as a tool to detect micro-RNA targets.
Vatolin, Sergei; Weil, Robert J
2008-01-01
Mammalian cells express a large number of small, noncoding RNAs, including micro-RNAs (miRNAs), that can regulate both the level of a target mRNA and the protein produced by the target mRNA. Recognition of miRNA targets is a complicated process, as a single target mRNA may be regulated by several miRNAs. The potential for combinatorial miRNA-mediated regulation of miRNA targets complicates diagnostic and therapeutic applications of miRNAs. Despite significant progress in understanding the biology of miRNAs and advances in computational predictions of miRNA targets, methods that permit direct physical identification of miRNA-mRNA complexes in eukaryotic cells are still required. Several groups have utilized coimmunoprecipitation of RNA associated with a protein(s) that is part of the RNA silencing macromolecular complex. This chapter describes a detailed but straightforward strategy that identifies miRNA targets based on the assumption that small RNAs base paired with a complementary target mRNA can be used as a primer to synthesize cDNA that may be used for cloning, identification, and functional analysis.
Perkins, Gillian A; Van de Walle, Gerlinde R; Pusterla, Nicola; Erb, Hollis N; Osterrieder, Nikolaus
2013-02-01
To evaluate metaphylactic RNA interference to prevent equine herpesvirus type 1 (EHV-1) infection in experimental herpesvirus myeloencephalopathy in horses and to determine whether horses infected with a neuropathogenic strain of the virus that develop equine herpesvirus myeloencephalopathy (EHM) have differences in viremia. 13 seronegative horses. EHV-1 strain Ab4 was administered intranasally on day 0, and small interfering RNAs (siRNAs [EHV-1 specific siRNAs {n = 7} or an irrelevant siRNA {6}]) were administered intranasally 24 hours before and 12, 24, 36, and 48 hours after infection. Physical and neurologic examinations, nasal swab specimens, and blood samples were collected for virus isolation and quantitative PCR assay. Data from the study were combined with data from a previous study of 14 horses. No significant difference was detected in clinical variables, viremia, or detection of EHV-1 in nasal swab specimens of horses treated with the EHV-1 targeted siRNAs (sigB3-siOri2) versus controls. No significant differences in viremia were detected between horses that developed EHM and those that did not. Administration of siRNAs targeted against EHV-1 around the time of EHV-1 infection was not protective with this experimental design. Horses infected with the neuropathogenic EHV-1 strain Ab4 that developed EHM did not have a more pronounced viremia.
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
Combined RT-qPCR of mRNA and microRNA Targets within One Fluidigm Integrated Fluidic Circuit.
Baldwin, Don A; Horan, Annamarie D; Hesketh, Patrick J; Mehta, Samir
2016-07-01
The ability to profile expression levels of a large number of mRNAs and microRNAs (miRNAs) within the same sample, using a single assay method, would facilitate investigations of miRNA effects on mRNA abundance and streamline biomarker screening across multiple RNA classes. A protocol is described for reverse transcription of long RNA and miRNA targets, followed by preassay amplification of the pooled cDNAs and quantitative PCR (qPCR) detection for a mixed panel of candidate RNA biomarkers. The method provides flexibility for designing custom target panels, is robust over a range of input RNA amounts, and demonstrated a high assay success rate.
Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F
2018-05-02
Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.
Methods to enable the design of bioactive small molecules targeting RNA
Disney, Matthew D.; Yildirim, Ilyas; Childs-Disney, Jessica L.
2014-01-01
RNA is an immensely important target for small molecule therapeutics or chemical probes of function. However, methods that identify, annotate, and optimize RNA-small molecule interactions that could enable the design of compounds that modulate RNA function are in their infancies. This review describes recent approaches that have been developed to understand and optimize RNA motif-small molecule interactions, including Structure-Activity Relationships Through Sequencing (StARTS), quantitative structure-activity relationships (QSAR), chemical similarity searching, structure-based design and docking, and molecular dynamics (MD) simulations. Case studies described include the design of small molecules targeting RNA expansions, the bacterial A-site, viral RNAs, and telomerase RNA. These approaches can be combined to afford a synergistic method to exploit the myriad of RNA targets in the transcriptome. PMID:24357181
Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics
Hong, Cheol Am; Nam, Yoon Sung
2014-01-01
Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170
Brungart, Douglas S; Simpson, Brian D
2007-09-01
Similarity between the target and masking voices is known to have a strong influence on performance in monaural and binaural selective attention tasks, but little is known about the role it might play in dichotic listening tasks with a target signal and one masking voice in the one ear and a second independent masking voice in the opposite ear. This experiment examined performance in a dichotic listening task with a target talker in one ear and same-talker, same-sex, or different-sex maskers in both the target and the unattended ears. The results indicate that listeners were most susceptible to across-ear interference with a different-sex within-ear masker and least susceptible with a same-talker within-ear masker, suggesting that the amount of across-ear interference cannot be predicted from the difficulty of selectively attending to the within-ear masking voice. The results also show that the amount of across-ear interference consistently increases when the across-ear masking voice is more similar to the target speech than the within-ear masking voice is, but that no corresponding decline in across-ear interference occurs when the across-ear voice is less similar to the target than the within-ear voice. These results are consistent with an "integrated strategy" model of speech perception where the listener chooses a segregation strategy based on the characteristics of the masker present in the target ear and the amount of across-ear interference is determined by the extent to which this strategy can also effectively be used to suppress the masker in the unattended ear.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.
2008-05-06
The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less
A Simple Method for Amplifying RNA Targets (SMART)
McCalla, Stephanie E.; Ong, Carmichael; Sarma, Aartik; Opal, Steven M.; Artenstein, Andrew W.; Tripathi, Anubhav
2012-01-01
We present a novel and simple method for amplifying RNA targets (named by its acronym, SMART), and for detection, using engineered amplification probes that overcome existing limitations of current RNA-based technologies. This system amplifies and detects optimal engineered ssDNA probes that hybridize to target RNA. The amplifiable probe-target RNA complex is captured on magnetic beads using a sequence-specific capture probe and is separated from unbound probe using a novel microfluidic technique. Hybridization sequences are not constrained as they are in conventional target-amplification reactions such as nucleic acid sequence amplification (NASBA). Our engineered ssDNA probe was amplified both off-chip and in a microchip reservoir at the end of the separation microchannel using isothermal NASBA. Optimal solution conditions for ssDNA amplification were investigated. Although KCl and MgCl2 are typically found in NASBA reactions, replacing 70 mmol/L of the 82 mmol/L total chloride ions with acetate resulted in optimal reaction conditions, particularly for low but clinically relevant probe concentrations (≤100 fmol/L). With the optimal probe design and solution conditions, we also successfully removed the initial heating step of NASBA, thus achieving a true isothermal reaction. The SMART assay using a synthetic model influenza DNA target sequence served as a fundamental demonstration of the efficacy of the capture and microfluidic separation system, thus bridging our system to a clinically relevant detection problem. PMID:22691910
Identification and consequences of miRNA-target interactions--beyond repression of gene expression.
Hausser, Jean; Zavolan, Mihaela
2014-09-01
Comparative genomics analyses and high-throughput experimental studies indicate that a microRNA (miRNA) binds to hundreds of sites across the transcriptome. Although the knockout of components of the miRNA biogenesis pathway has profound phenotypic consequences, most predicted miRNA targets undergo small changes at the mRNA and protein levels when the expression of the miRNA is perturbed. Alternatively, miRNAs can establish thresholds in and increase the coherence of the expression of their target genes, as well as reduce the cell-to-cell variability in target gene expression. Here, we review the recent progress in identifying miRNA targets and the emerging paradigms of how miRNAs shape the dynamics of target gene expression.
DIANA-microT web server: elucidating microRNA functions through target prediction.
Maragkakis, M; Reczko, M; Simossis, V A; Alexiou, P; Papadopoulos, G L; Dalamagas, T; Giannopoulos, G; Goumas, G; Koukis, E; Kourtis, K; Vergoulis, T; Koziris, N; Sellis, T; Tsanakas, P; Hatzigeorgiou, A G
2009-07-01
Computational microRNA (miRNA) target prediction is one of the key means for deciphering the role of miRNAs in development and disease. Here, we present the DIANA-microT web server as the user interface to the DIANA-microT 3.0 miRNA target prediction algorithm. The web server provides extensive information for predicted miRNA:target gene interactions with a user-friendly interface, providing extensive connectivity to online biological resources. Target gene and miRNA functions may be elucidated through automated bibliographic searches and functional information is accessible through Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The web server offers links to nomenclature, sequence and protein databases, and users are facilitated by being able to search for targeted genes using different nomenclatures or functional features, such as the genes possible involvement in biological pathways. The target prediction algorithm supports parameters calculated individually for each miRNA:target gene interaction and provides a signal-to-noise ratio and a precision score that helps in the evaluation of the significance of the predicted results. Using a set of miRNA targets recently identified through the pSILAC method, the performance of several computational target prediction programs was assessed. DIANA-microT 3.0 achieved there with 66% the highest ratio of correctly predicted targets over all predicted targets. The DIANA-microT web server is freely available at www.microrna.gr/microT.
Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam
2012-01-01
Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770
He, Hongbin; Ding, Fangrong; Yang, Hongjun; Cheng, Lei; Liu, Wenhao; Zhong, Jifeng; Dai, Yunping; Li, Guangpeng; He, Chengqiang; Yu, Li; Li, Jianbin
2012-01-01
Background Although it is known that RNA interference (RNAi) targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV), it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. Principal Finding Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2), VP3 (RNAi-VP3), or VP4 (RNAi-VP4) of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. Conclusion RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV. PMID:22905125
Targeting RNA in mammalian systems with small molecules.
Donlic, Anita; Hargrove, Amanda E
2018-05-03
The recognition of RNA functions beyond canonical protein synthesis has challenged the central dogma of molecular biology. Indeed, RNA is now known to directly regulate many important cellular processes, including transcription, splicing, translation, and epigenetic modifications. The misregulation of these processes in disease has led to an appreciation of RNA as a therapeutic target. This potential was first recognized in bacteria and viruses, but discoveries of new RNA classes following the sequencing of the human genome have invigorated exploration of its disease-related functions in mammals. As stable structure formation is evolving as a hallmark of mammalian RNAs, the prospect of utilizing small molecules to specifically probe the function of RNA structural domains and their interactions is gaining increased recognition. To date, researchers have discovered bioactive small molecules that modulate phenotypes by binding to expanded repeats, microRNAs, G-quadruplex structures, and RNA splice sites in neurological disorders, cancers, and other diseases. The lessons learned from achieving these successes both call for additional studies and encourage exploration of the plethora of mammalian RNAs whose precise mechanisms of action remain to be elucidated. Efforts toward understanding fundamental principles of small molecule-RNA recognition combined with advances in methodology development should pave the way toward targeting emerging RNA classes such as long noncoding RNAs. Together, these endeavors can unlock the full potential of small molecule-based probing of RNA-regulated processes and enable us to discover new biology and underexplored avenues for therapeutic intervention in human disease. This article is categorized under: RNA Methods > RNA Analyses In Vitro and In Silico RNA Interactions with Proteins and Other Molecules > Small Molecule-RNA Interactions RNA in Disease and Development > RNA in Disease. © 2018 Wiley Periodicals, Inc.
Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S
2011-11-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular
Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen
2011-01-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury
Individual microRNAs (miRNAs) display distinct mRNA targeting "rules".
Wang, Wang-Xia; Wilfred, Bernard R; Xie, Kevin; Jennings, Mary H; Hu, Yanling Hu; Stromberg, Arnold J; Nelson, Peter T
2010-01-01
MicroRNAs (miRNAs) guide Argonaute (AGO)-containing microribonucleoprotein (miRNP) complexes to target mRNAs.It has been assumed that miRNAs behave similarly to each other with regard to mRNA target recognition. The usual assumptions, which are based on prior studies, are that miRNAs target preferentially sequences in the 3'UTR of mRNAs,guided by the 5' "seed" portion of the miRNAs. Here we isolated AGO- and miRNA-containing miRNPs from human H4 tumor cells by co-immunoprecipitation (co-IP) with anti-AGO antibody. Cells were transfected with miR-107, miR-124,miR-128, miR-320, or a negative control miRNA. Co-IPed RNAs were subjected to downstream high-density Affymetrix Human Gene 1.0 ST microarray analyses using an assay we validated previously-a "RIP-Chip" experimental design. RIP-Chip data provided a list of mRNAs recruited into the AGO-miRNP in correlation to each miRNA. These experimentally identified miRNA targets were analyzed for complementary six nucleotide "seed" sequences within the transfected miRNAs. We found that miR-124 targets tended to have sequences in the 3'UTR that would be recognized by the 5' seed of miR-124, as described in previous studies. By contrast, miR-107 targets tended to have 'seed' sequences in the mRNA open reading frame, but not the 3' UTR. Further, mRNA targets of miR-128 and miR-320 are less enriched for 6-mer seed sequences in comparison to miR-107 and miR-124. In sum, our data support the importance of the 5' seed in determining binding characteristics for some miRNAs; however, the "binding rules" are complex, and individual miRNAs can have distinct sequence determinants that lead to mRNA targeting.
2008-01-01
siRNA delivery method in his animal model, it remains to be studied whether this general pproach is safe in humans. Often cited as an advantage of siRNAs...way studying the intravenous delivery f ASO drug candidates targeting Bcl-2 (Genasense®, Genta) nd c-myc (Resten-NG®, AVI BioPharma), while completed... studies have been published investigating MOs as a treatment for EBOV infection, with both showing fficacy in animal models. PMOs were designed to
Dysregulation of RNA Interference in Breast Cancer
2007-07-01
of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative
Long Non-Coding RNA in Glioma: Target miRNA and Signaling Pathways.
Dang, Yuan; Wei, Xudong; Xue, Laien; Wen, Fuli; Gu, Jianjun; Zheng, Heping
2018-06-01
Glioma is one of the most common and aggressive malignant tumors of the central nervous system. Here, we review and explore the use of long noncoding RNA (lncRNA) as a therapeutic strategy for the targeting of gliomas. LncRNA is a functional RNA molecule with no protein coding function and is involved in the occurrence and progression of glioma. It is reported that the activation of several signaling pathways, including the MAPK, p53, Wnt/β-catenin, PI3K/AKT/mTOR, and epithelial mesenchymal transformation (EMT) pathways, are involved in the regulation of gliomas. In addition, microRNAs in glioma may also interact with lncRNAs and affect tumor growth and progression. Therefore, the exploration of lncRNA participation in signaling pathway regulatory mechanisms and the determination of the interaction between lncRNA and miRNA may help to develop new effective therapies for the treatment of glioma.
Farazi, Thalia A.; Leonhardt, Carl S.; Mukherjee, Neelanjan; Mihailovic, Aleksandra; Li, Song; Max, Klaas E.A.; Meyer, Cindy; Yamaji, Masashi; Cekan, Pavol; Jacobs, Nicholas C.; Gerstberger, Stefanie; Bognanni, Claudia; Larsson, Erik; Ohler, Uwe; Tuschl, Thomas
2014-01-01
Recent studies implicated the RNA-binding protein with multiple splicing (RBPMS) family of proteins in oocyte, retinal ganglion cell, heart, and gastrointestinal smooth muscle development. These RNA-binding proteins contain a single RNA recognition motif (RRM), and their targets and molecular function have not yet been identified. We defined transcriptome-wide RNA targets using photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) in HEK293 cells, revealing exonic mature and intronic pre-mRNA binding sites, in agreement with the nuclear and cytoplasmic localization of the proteins. Computational and biochemical approaches defined the RNA recognition element (RRE) as a tandem CAC trinucleotide motif separated by a variable spacer region. Similar to other mRNA-binding proteins, RBPMS family of proteins relocalized to cytoplasmic stress granules under oxidative stress conditions suggestive of a support function for mRNA localization in large and/or multinucleated cells where it is preferentially expressed. PMID:24860013
Therapeutic synergy between microRNA and siRNA in ovarian cancer treatment.
Nishimura, Masato; Jung, Eun-Jung; Shah, Maitri Y; Lu, Chunhua; Spizzo, Riccardo; Shimizu, Masayoshi; Han, Hee Dong; Ivan, Cristina; Rossi, Simona; Zhang, Xinna; Nicoloso, Milena S; Wu, Sherry Y; Almeida, Maria Ines; Bottsford-Miller, Justin; Pecot, Chad V; Zand, Behrouz; Matsuo, Koji; Shahzad, Mian M; Jennings, Nicholas B; Rodriguez-Aguayo, Cristian; Lopez-Berestein, Gabriel; Sood, Anil K; Calin, George A
2013-11-01
Development of improved RNA interference-based strategies is of utmost clinical importance. Although siRNA-mediated silencing of EphA2, an ovarian cancer oncogene, results in reduction of tumor growth, we present evidence that additional inhibition of EphA2 by a microRNA (miRNA) further "boosts" its antitumor effects. We identified miR-520d-3p as a tumor suppressor upstream of EphA2, whose expression correlated with favorable outcomes in two independent patient cohorts comprising 647 patients. Restoration of miR-520d-3p prominently decreased EphA2 protein levels, and suppressed tumor growth and migration/invasion both in vitro and in vivo. Dual inhibition of EphA2 in vivo using 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) nanoliposomes loaded with miR-520d-3p and EphA2 siRNA showed synergistic antitumor efficiency and greater therapeutic efficacy than either monotherapy alone. This synergy is at least in part due to miR-520d-3p targeting EphB2, another Eph receptor. Our data emphasize the feasibility of combined miRNA-siRNA therapy, and will have broad implications for innovative gene silencing therapies for cancer and other diseases. This study addresses a new concept of RNA inhibition therapy by combining miRNA and siRNA in nanoliposomal particles to target oncogenic pathways altered in ovarian cancer. Combined targeting of the Eph pathway using EphA2-targeting siRNA and the tumor suppressor miR-520d-3p exhibits remarkable therapeutic synergy and enhanced tumor suppression in vitro and in vivo compared with either monotherapy alone. ©2013 AACR.
The role of Cas8 in type I CRISPR interference.
Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L
2015-05-05
CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.
Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G
2010-04-01
Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for
RNA interference: Applications and advances in insect toxicology and insect pest management.
Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan
2015-05-01
Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.
Pu, Jiarui; Mei, Hong; Zhao, Jun; Huang, Kai; Zeng, Fuqing; Tong, Qiangsong
2012-01-01
Heparanase (HPA), an endo-h-D-glucuronidase that cleaves the heparan sulfate chain of heparan sulfate proteoglycans, is overexpressed in majority of human cancers. Recent evidence suggests that small interfering RNA (siRNA) induces transcriptional gene silencing (TGS) in human cells. In this study, transfection of siRNA against −9/+10 bp (siH3), but not −174/−155 bp (siH1) or −134/−115 bp (siH2) region relative to transcription start site (TSS) locating at 101 bp upstream of the translation start site, resulted in TGS of heparanase in human prostate cancer, bladder cancer, and gastric cancer cells in a sequence-specific manner. Methylation-specific PCR and bisulfite sequencing revealed no DNA methylation of CpG islands within heparanase promoter in siH3-transfected cells. The TGS of heparanase did not involve changes of epigenetic markers histone H3 lysine 9 dimethylation (H3K9me2), histone H3 lysine 27 trimethylation (H3K27me3) or active chromatin marker acetylated histone H3 (AcH3). The regulation of alternative splicing was not involved in siH3-mediated TGS. Instead, siH3 interfered with transcription initiation via decreasing the binding of both RNA polymerase II and transcription factor II B (TFIIB), but not the binding of transcription factors Sp1 or early growth response 1, on the heparanase promoter. Moreover, Argonaute 1 and Argonaute 2 facilitated the decreased binding of RNA polymerase II and TFIIB on heparanase promoter, and were necessary in siH3-induced TGS of heparanase. Stable transfection of the short hairpin RNA construct targeting heparanase TSS (−9/+10 bp) into cancer cells, resulted in decreased proliferation, invasion, metastasis and angiogenesis of cancer cells in vitro and in athymic mice models. These results suggest that small RNAs targeting TSS can induce TGS of heparanase via interference with transcription initiation, and significantly suppress the tumor growth, invasion, metastasis and angiogenesis of cancer cells. PMID
USDA-ARS?s Scientific Manuscript database
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...
Current progress of siRNA/shRNA therapeutics in clinical trials.
Burnett, John C; Rossi, John J; Tiemann, Katrin
2011-09-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers, including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. Advancements in bioengineering and nanotechnology have led to improved control of delivery and release of some siRNA therapeutics. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.
Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy
2018-06-01
Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Cooper, Lauren A.; Stringer, Anne M.
2018-01-01
ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291
Employing machine learning for reliable miRNA target identification in plants.
Jha, Ashwani; Shankar, Ravi
2011-12-29
miRNAs are ~21 nucleotide long small noncoding RNA molecules, formed endogenously in most of the eukaryotes, which mainly control their target genes post transcriptionally by interacting and silencing them. While a lot of tools has been developed for animal miRNA target system, plant miRNA target identification system has witnessed limited development. Most of them have been centered around exact complementarity match. Very few of them considered other factors like multiple target sites and role of flanking regions. In the present work, a Support Vector Regression (SVR) approach has been implemented for plant miRNA target identification, utilizing position specific dinucleotide density variation information around the target sites, to yield highly reliable result. It has been named as p-TAREF (plant-Target Refiner). Performance comparison for p-TAREF was done with other prediction tools for plants with utmost rigor and where p-TAREF was found better performing in several aspects. Further, p-TAREF was run over the experimentally validated miRNA targets from species like Arabidopsis, Medicago, Rice and Tomato, and detected them accurately, suggesting gross usability of p-TAREF for plant species. Using p-TAREF, target identification was done for the complete Rice transcriptome, supported by expression and degradome based data. miR156 was found as an important component of the Rice regulatory system, where control of genes associated with growth and transcription looked predominant. The entire methodology has been implemented in a multi-threaded parallel architecture in Java, to enable fast processing for web-server version as well as standalone version. This also makes it to run even on a simple desktop computer in concurrent mode. It also provides a facility to gather experimental support for predictions made, through on the spot expression data analysis, in its web-server version. A machine learning multivariate feature tool has been implemented in parallel and
Lin, Yi-Zhen; Ou, Da-Liang; Chang, Hsin-Yuan; Lin, Wei-Yu; Hsu, Chiun; Chang, Po-Ling
2017-09-01
The family of microRNAs (miRNAs) not only plays an important role in gene regulation but is also useful for the diagnosis of diseases. A reliable method with high sensitivity may allow researchers to detect slight fluctuations in ultra-trace amounts of miRNA. In this study, we propose a sensitive imaging method for the direct probing of miR-10b (miR-10b-3p, also called miR-10b*) and its target ( HOXD10 mRNA) in fixed cells based on the specific recognition of molecular beacons combined with highly inclined and laminated optical sheet (HILO) fluorescence microscopy. The designed dye-quencher-labelled molecular beacons offer excellent efficiencies of fluorescence resonance energy transfer that allow us to detect miRNA and the target mRNA simultaneously in hepatocellular carcinoma cells using HILO fluorescence microscopy. Not only can the basal trace amount of miRNA be observed in each individual cell, but the obtained images also indicate that this method is useful for monitoring the fluctuations in ultra-trace amounts of miRNA when the cells are transfected with a miRNA precursor or a miRNA inhibitor (anti-miR). Furthermore, a reasonable causal relation between the miR-10b and HOXD10 expression levels was observed in miR-10b* precursor-transfected cells and miR-10b* inhibitor-transfected cells. The trends of the miRNA alterations obtained using HILO microscopy completely matched the RT-qPCR data and showed remarkable reproducibility (the coefficient of variation [CV] = 0.86%) and sensitivity (<1.0 fM). This proposed imaging method appears to be useful for the simultaneous visualisation of ultra-trace amounts of miRNA and target mRNA and excludes the procedures for RNA extraction and amplification. Therefore, the visualisation of miRNA and the target mRNA should facilitate the exploration of the functions of ultra-trace amounts of miRNA in fixed cells in biological studies and may serve as a powerful tool for diagnoses based on circulating cancer cells.
Lista, María José; Martins, Rodrigo Prado; Angrand, Gaelle; Quillévéré, Alicia; Daskalogianni, Chrysoula; Voisset, Cécile; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Blondel, Marc
2017-08-31
The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1. Indeed, EBNA1 is essential for viral genome replication and maintenance but also highly antigenic. Hence, EBV evolved a system in which the glycine-alanine repeat (GAr) of EBNA1 limits the translation of its own mRNA at a minimal level to ensure its essential function thereby, at the same time, minimizing immune recognition. Defining intervention points where to interfere with EBNA1 immune evasion is an important step to trigger an immune response against EBV-carrying cancers. Thanks to a yeast-based assay that recapitulates all the aspects of EBNA1 self-limitation of expression, a recent study by Lista et al. [Nature Communications (2017) 7, 435-444] has uncovered the role of the host cell nucleolin (NCL) in this process via a direct interaction of this protein with G-quadruplexes (G4) formed in GAr-encoding sequence of EBNA1 mRNA. In addition, the G4 ligand PhenDC3 prevents NCL binding on EBNA1 mRNA and reverses GAr-mediated repression of translation and antigen presentation. This shows that the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to unveil EBV-carrying cancers to the immune system and that the yeast model can be successfully used for uncovering drugs and host factors that interfere with EBV stealthiness.
2010-01-01
Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical
Targeting of cytosolic mRNA to mitochondria: naked RNA can bind to the mitochondrial surface.
Michaud, Morgane; Maréchal-Drouard, Laurence; Duchêne, Anne-Marie
2014-05-01
Mitochondria contain hundreds of proteins but only a few are encoded by the mitochondrial genome. The other proteins are nuclear-encoded and imported into mitochondria. These proteins can be translated on free cytosolic polysomes, then targeted and imported into mitochondria. Nonetheless, numerous cytosolic mRNAs encoding mitochondrial proteins are detected at the surface of mitochondria in yeast, plants and animals. The localization of mRNAs to the vicinity of mitochondria would be a way for mitochondrial protein sorting. The mechanisms responsible for mRNA targeting to mitochondria are not clearly identified. Sequences within the mRNA molecules (cis-elements), as well as a few trans-acting factors, have been shown to be essential for targeting of some mRNAs. In order to identify receptors involved in mRNA docking to the mitochondrial surface, we have developed an in vitro mRNA binding assay with isolated plant mitochondria. We show that naked mRNAs are able to bind to isolated mitochondria, and our results strongly suggest that mRNA docking to the plant mitochondrial outer membrane requires at least one component of TOM complex. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun
2018-01-01
Abstract Background Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. Findings We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with
Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun
2018-03-01
Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Our results prove that d
RNA major groove modifications improve siRNA stability and biological activity
Terrazas, Montserrat; Kool, Eric T.
2009-01-01
RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976
Identification of MicroRNA Targets of Capsicum spp. Using MiRTrans—a Trans-Omics Approach
Zhang, Lu; Qin, Cheng; Mei, Junpu; Chen, Xiaocui; Wu, Zhiming; Luo, Xirong; Cheng, Jiaowen; Tang, Xiangqun; Hu, Kailin; Li, Shuai C.
2017-01-01
The microRNA (miRNA) can regulate the transcripts that are involved in eukaryotic cell proliferation, differentiation, and metabolism. Especially for plants, our understanding of miRNA targets, is still limited. Early attempts of prediction on sequence alignments have been plagued by enormous false positives. It is helpful to improve target prediction specificity by incorporating the other data sources such as the dependency between miRNA and transcript expression or even cleaved transcripts by miRNA regulations, which are referred to as trans-omics data. In this paper, we developed MiRTrans (Prediction of MiRNA targets by Trans-omics data) to explore miRNA targets by incorporating miRNA sequencing, transcriptome sequencing, and degradome sequencing. MiRTrans consisted of three major steps. First, the target transcripts of miRNAs were predicted by scrutinizing their sequence characteristics and collected as an initial potential targets pool. Second, false positive targets were eliminated if the expression of miRNA and its targets were weakly correlated by lasso regression. Third, degradome sequencing was utilized to capture the miRNA targets by examining the cleaved transcripts that regulated by miRNAs. Finally, the predicted targets from the second and third step were combined by Fisher's combination test. MiRTrans was applied to identify the miRNA targets for Capsicum spp. (i.e., pepper). It can generate more functional miRNA targets than sequence-based predictions by evaluating functional enrichment. MiRTrans identified 58 miRNA-transcript pairs with high confidence from 18 miRNA families conserved in eudicots. Most of these targets were transcription factors; this lent support to the role of miRNA as key regulator in pepper. To our best knowledge, this work is the first attempt to investigate the miRNA targets of pepper, as well as their regulatory networks. Surprisingly, only a small proportion of miRNA-transcript pairs were shared between degradome sequencing
Fox, Melanie J; Gao, Hongyu; Smith-Kinnaman, Whitney R; Liu, Yunlong; Mosley, Amber L
2015-01-01
The exosome and its nuclear specific subunit Rrp6 form a 3'-5' exonuclease complex that regulates diverse aspects of RNA biology including 3' end processing and degradation of a variety of noncoding RNAs (ncRNAs) and unstable transcripts. Known targets of the nuclear exosome include short (<1000 bp) RNAPII transcripts such as small noncoding RNAs (snRNAs), cryptic unstable transcripts (CUTs), and some stable unannotated transcripts (SUTs) that are terminated by an Nrd1, Nab3, and Sen1 (NNS) dependent mechanism. NNS-dependent termination is coupled to RNA 3' end processing and/or degradation by the Rrp6/exosome in yeast. Recent work suggests Nrd1 is necessary for transcriptome surveillance, regulating promoter directionality and suppressing antisense transcription independently of, or prior to, Rrp6 activity. It remains unclear whether Rrp6 is directly involved in termination; however, Rrp6 has been implicated in the 3' end processing and degradation of ncRNA transcripts including CUTs. To determine the role of Rrp6 in NNS termination globally, we performed RNA sequencing (RNA-Seq) on total RNA and perform ChIP-exo analysis of RNA Polymerase II (RNAPII) localization. Deletion of RRP6 promotes hyper-elongation of multiple NNS-dependent transcripts resulting from both improperly processed 3' RNA ends and faulty transcript termination at specific target genes. The defects in RNAPII termination cause transcriptome-wide changes in mRNA expression through transcription interference and/or antisense repression, similar to previously reported effects of depleting Nrd1 from the nucleus. Elongated transcripts were identified within all classes of known NNS targets with the largest changes in transcription termination occurring at CUTs. Interestingly, the extended transcripts that we have detected in our studies show remarkable similarity to Nrd1-unterminated transcripts at many locations, suggesting that Rrp6 acts with the NNS complex globally to promote transcription
Optimizing prognosis-related key miRNA-target interactions responsible for cancer metastasis.
Zhao, Hongying; Yuan, Huating; Hu, Jing; Xu, Chaohan; Liao, Gaoming; Yin, Wenkang; Xu, Liwen; Wang, Li; Zhang, Xinxin; Shi, Aiai; Li, Jing; Xiao, Yun
2017-12-12
Increasing evidence suggests that the abnormality of microRNAs (miRNAs) and their downstream targets is frequently implicated in the pathogenesis of human cancers, however, the clinical benefit of causal miRNA-target interactions has been seldom studied. Here, we proposed a computational method to optimize prognosis-related key miRNA-target interactions by combining transcriptome and clinical data from thousands of TCGA tumors across 16 cancer types. We obtained a total of 1,956 prognosis-related key miRNA-target interactions between 112 miRNAs and 1,443 their targets. Interestingly, these key target genes are specifically involved in tumor progression-related functions, such as 'cell adhesion' and 'cell migration'. Furthermore, they are most significantly correlated with 'tissue invasion and metastasis', a hallmark of metastasis, in ten distinct types of cancer through the hallmark analysis. These results implicated that the prognosis-related key miRNA-target interactions were highly associated with cancer metastasis. Finally, we observed that the combination of these key miRNA-target interactions allowed to distinguish patients with good prognosis from those with poor prognosis both in most TCGA cancer types and independent validation sets, highlighting their roles in cancer metastasis. We provided a user-friendly database named miRNATarget (freely available at http://biocc.hrbmu.edu.cn/miRNATar/), which provides an overview of the prognosis-related key miRNA-target interactions across 16 cancer types.
Bandyopadhyay, Sanghamitra; Mitra, Ramkrishna
2009-10-15
Prediction of microRNA (miRNA) target mRNAs using machine learning approaches is an important area of research. However, most of the methods suffer from either high false positive or false negative rates. One reason for this is the marked deficiency of negative examples or miRNA non-target pairs. Systematic identification of non-target mRNAs is still not addressed properly, and therefore, current machine learning approaches are compelled to rely on artificially generated negative examples for training. In this article, we have identified approximately 300 tissue-specific negative examples using a novel approach that involves expression profiling of both miRNAs and mRNAs, miRNA-mRNA structural interactions and seed-site conservation. The newly generated negative examples are validated with pSILAC dataset, which elucidate the fact that the identified non-targets are indeed non-targets.These high-throughput tissue-specific negative examples and a set of experimentally verified positive examples are then used to build a system called TargetMiner, a support vector machine (SVM)-based classifier. In addition to assessing the prediction accuracy on cross-validation experiments, TargetMiner has been validated with a completely independent experimental test dataset. Our method outperforms 10 existing target prediction algorithms and provides a good balance between sensitivity and specificity that is not reflected in the existing methods. We achieve a significantly higher sensitivity and specificity of 69% and 67.8% based on a pool of 90 feature set and 76.5% and 66.1% using a set of 30 selected feature set on the completely independent test dataset. In order to establish the effectiveness of the systematically generated negative examples, the SVM is trained using a different set of negative data generated using the method in Yousef et al. A significantly higher false positive rate (70.6%) is observed when tested on the independent set, while all other factors are kept the
PEGylated poly(ethylene imine) copolymer-delivered siRNA inhibits HIV replication in vitro.
Weber, Nick D; Merkel, Olivia M; Kissel, Thomas; Muñoz-Fernández, María Ángeles
2012-01-10
RNA interference is increasingly being utilized for the specific targeting and down-regulation of disease-causing genes, including targeting viral infections such as HIV. T lymphocytes, the primary target for HIV, are very difficult to treat with gene therapy applications such as RNA interference because of issues with drug delivery. To circumvent these problems, we investigated poly(ethylene imine) (PEI) as a method of improving transfection efficiency of siRNA to T lymphocytes. Additionally, polyethylene glycol (PEG) moieties were engrafted to the PEI polymers with the goals of improving stability and reducing cytotoxicity. Initial studies on PEG-PEI/siRNA polyplex formation, size and their interaction with cell membranes demonstrated their feasibility as drug delivery agents. Assays with lymphocytes revealed low cytotoxicity profiles of the polyplexes at pharmacologically relevant concentrations with PEGylated copolymers obtaining the best results. Successful transfection of a T cell line or primary T cells with siRNA was observed via flow cytometry and confocal microscopy. Finally, the biological effect of copolymer-delivered siRNA was measured. Of particular significance, siRNA targeted to the HIV gene nef and delivered by one of the PEG-PEI copolymers in repetitive treatments every 2-3 days was observed to inhibit HIV replication to the same extent as azidothymidine over the course of 15 days. Copyright © 2011 Elsevier B.V. All rights reserved.
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.
Xie, Yuran; Merkel, Olivia M
2015-10-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma
Xie, Yuran; Merkel, Olivia M
2015-01-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454
The influence of target-masker similarity on across-ear interference in dichotic listening
NASA Astrophysics Data System (ADS)
Brungart, Douglas; Simpson, Brian
2004-05-01
In most dichotic listening tasks, the comprehension of a target speech signal presented in one ear is unaffected by the presence of irrelevant speech in the opposite ear. However, recent results have shown that contralaterally presented interfering speech signals do influence performance when a second interfering speech signal is present in the same ear as the target speech. In this experiment, we examined the influence of target-masker similarity on this effect by presenting ipsilateral and contralateral masking phrases spoken by the same talker, a different same-sex talker, or a different-sex talker than the one used to generate the target speech. The results show that contralateral target-masker similarity has the greatest influence on performance when an easily segregated different-sex masker is presented in the target ear, and the least influence when a difficult-to-segregate same-talker masker is presented in the target ear. These results indicate that across-ear interference in dichotic listening is not directly related to the difficulty of the segregation task in the target ear, and suggest that contralateral maskers are least likely to interfere with dichotic speech perception when the same general strategy could be used to segregate the target from the masking voices in the ipsilateral and contralateral ears.
Approaches to Validate and Manipulate RNA Targets with Small Molecules in Cells.
Childs-Disney, Jessica L; Disney, Matthew D
2016-01-01
RNA has become an increasingly important target for therapeutic interventions and for chemical probes that dissect and manipulate its cellular function. Emerging targets include human RNAs that have been shown to directly cause cancer, metabolic disorders, and genetic disease. In this review, we describe various routes to obtain bioactive compounds that target RNA, with a particular emphasis on the development of small molecules. We use these cases to describe approaches that are being developed for target validation, which include target-directed cleavage, classic pull-down experiments, and covalent cross-linking. Thus, tools are available to design small molecules to target RNA and to identify the cellular RNAs that are their targets.
Kishk, Abdelaziz; Hijaz, Faraj; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Killiny, Nabil
2017-11-01
The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Lividae) transmits the Candidatus Liberibacter asiaticus, which causes citrus greening disease or Huanglongbing, (HLB). To date, there is no efficient cure for HLB disease and the control of D. citri using insecticides became the most important tools for the management of HLB. However, the extensive use of insecticides could increase D. citri resistance to these insecticides. The objective of this study was to investigate the effect of RNA interference of acetylcholinesterase (AChE) on the mortality and susceptibility of D. citri to the four major insecticides used in Florida. In this study, we used a consensus sequence derived from the two AChE genes and cholinesterase 2-like (ChE-2-like) gene to target all of the three genes. Treatment with dsRNA-AChE increased the mortality percentages of both nymphs and adults of D. citri. The mortality percentage increased with the increase in the concentration of applied dsRNA-AChE, and the highest mortality (> 60%) was observed at the highest applied concentration (125ng/μl). Treatments of nymphs or adults with dsRNA-AChE down-regulated the expression of the three targeted genes of D. citri. Silencing of AChE and ChE in D. citri nymphs increased the susceptibility of emerged adults to chlorpyrifos and carbaryl, which act as AChE inhibitors. However, treatment with dsRNA-AChE did not increase the susceptibility of emerged adults to imidacloprid, which acts as an agonist of nicotinic acetylcholine receptors. In the same manner, treatment of adults with dsRNA-AChE increased their susceptibility to chlorpyrifos and carbaryl, but did not affect their susceptibility to imidacloprid. The ANOVA did not show any significant increase in susceptibility of D. citri adults to fenpropathrin after treatment with dsRNA-AChE, either as nymphs or as adults. However, simple linear regression showed that treatment with dsRNA-AChE increased D. citri susceptibility to fenpropathrin
Target mimicry provides a new mechanism for regulation of microRNA activity.
Franco-Zorrilla, José Manuel; Valli, Adrián; Todesco, Marco; Mateos, Isabel; Puga, María Isabel; Rubio-Somoza, Ignacio; Leyva, Antonio; Weigel, Detlef; García, Juan Antonio; Paz-Ares, Javier
2007-08-01
MicroRNAs (miRNA) regulate key aspects of development and physiology in animals and plants. These regulatory RNAs act as guides of effector complexes to recognize specific mRNA sequences based on sequence complementarity, resulting in translational repression or site-specific cleavage. In plants, most miRNA targets are cleaved and show almost perfect complementarity with the miRNAs around the cleavage site. Here, we examined the non-protein coding gene IPS1 (INDUCED BY PHOSPHATE STARVATION 1) from Arabidopsis thaliana. IPS1 contains a motif with sequence complementarity to the phosphate (Pi) starvation-induced miRNA miR-399, but the pairing is interrupted by a mismatched loop at the expected miRNA cleavage site. We show that IPS1 RNA is not cleaved but instead sequesters miR-399. Thus, IPS1 overexpression results in increased accumulation of the miR-399 target PHO2 mRNA and, concomitantly, in reduced shoot Pi content. Engineering of IPS1 to be cleavable abolishes its inhibitory activity on miR-399. We coin the term 'target mimicry' to define this mechanism of inhibition of miRNA activity. Target mimicry can be generalized beyond the control of Pi homeostasis, as demonstrated using artificial target mimics.
Recent advances in developing small molecules targeting RNA.
Guan, Lirui; Disney, Matthew D
2012-01-20
RNAs are underexploited targets for small molecule drugs or chemical probes of function. This may be due, in part, to a fundamental lack of understanding of the types of small molecules that bind RNA specifically and the types of RNA motifs that specifically bind small molecules. In this review, we describe recent advances in the development and design of small molecules that bind to RNA and modulate function that aim to fill this void.
Targets of small interfering RNA restriction during human immunodeficiency virus type 1 replication.
Gao, Yong; Lobritz, Michael A; Roth, Justin; Abreha, Measho; Nelson, Kenneth N; Nankya, Immaculate; Moore-Dudley, Dawn M; Abraha, Awet; Gerson, Stanton L; Arts, Eric J
2008-03-01
Small interfering RNAs (siRNAs) have been shown to effectively inhibit human immunodeficiency virus type 1 (HIV-1) replication in vitro. The mechanism(s) for this inhibition is poorly understood, as siRNAs may interact with multiple HIV-1 RNA species during different steps of the retroviral life cycle. To define susceptible HIV-1 RNA species, siRNAs were first designed to specifically inhibit two divergent primary HIV-1 isolates via env and gag gene targets. A self-inactivating lentiviral vector harboring these target sequences confirmed that siRNA cannot degrade incoming genomic RNA. Disruption of the incoming core structure by rhesus macaque TRIM5alpha did, however, provide siRNA-RNA-induced silencing complex access to HIV-1 genomic RNA and promoted degradation. In the absence of accelerated core disruption, only newly transcribed HIV-1 mRNA in the cytoplasm is sensitive to siRNA degradation. Inhibitors of HIV-1 mRNA nuclear export, such as leptomycin B and camptothecin, blocked siRNA restriction. All HIV-1 RNA regions and transcripts found 5' of the target sequence, including multiply spliced HIV-1 RNA, were degraded by unidirectional 3'-to-5' siRNA amplification and spreading. In contrast, HIV-1 RNA 3' of the target sequence was not susceptible to siRNA. Even in the presence of siRNA, full-length HIV-1 RNA is still encapsidated into newly assembled viruses. These findings suggest that siRNA can target only a relatively "naked" cytoplasmic HIV-1 RNA despite the involvement of viral RNA at nearly every step in the retroviral life cycle. Protection of HIV-1 RNA within the core following virus entry, during encapsidation/virus assembly, or within the nucleus may reflect virus evolution in response to siRNA, TRIM5alpha, or other host restriction factors.
Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P
2017-06-01
Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.
Employing machine learning for reliable miRNA target identification in plants
2011-01-01
Background miRNAs are ~21 nucleotide long small noncoding RNA molecules, formed endogenously in most of the eukaryotes, which mainly control their target genes post transcriptionally by interacting and silencing them. While a lot of tools has been developed for animal miRNA target system, plant miRNA target identification system has witnessed limited development. Most of them have been centered around exact complementarity match. Very few of them considered other factors like multiple target sites and role of flanking regions. Result In the present work, a Support Vector Regression (SVR) approach has been implemented for plant miRNA target identification, utilizing position specific dinucleotide density variation information around the target sites, to yield highly reliable result. It has been named as p-TAREF (plant-Target Refiner). Performance comparison for p-TAREF was done with other prediction tools for plants with utmost rigor and where p-TAREF was found better performing in several aspects. Further, p-TAREF was run over the experimentally validated miRNA targets from species like Arabidopsis, Medicago, Rice and Tomato, and detected them accurately, suggesting gross usability of p-TAREF for plant species. Using p-TAREF, target identification was done for the complete Rice transcriptome, supported by expression and degradome based data. miR156 was found as an important component of the Rice regulatory system, where control of genes associated with growth and transcription looked predominant. The entire methodology has been implemented in a multi-threaded parallel architecture in Java, to enable fast processing for web-server version as well as standalone version. This also makes it to run even on a simple desktop computer in concurrent mode. It also provides a facility to gather experimental support for predictions made, through on the spot expression data analysis, in its web-server version. Conclusion A machine learning multivariate feature tool has been
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui
2015-10-01
The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.
Ensemble Methods for MiRNA Target Prediction from Expression Data.
Le, Thuc Duy; Zhang, Junpeng; Liu, Lin; Li, Jiuyong
2015-01-01
microRNAs (miRNAs) are short regulatory RNAs that are involved in several diseases, including cancers. Identifying miRNA functions is very important in understanding disease mechanisms and determining the efficacy of drugs. An increasing number of computational methods have been developed to explore miRNA functions by inferring the miRNA-mRNA regulatory relationships from data. Each of the methods is developed based on some assumptions and constraints, for instance, assuming linear relationships between variables. For such reasons, computational methods are often subject to the problem of inconsistent performance across different datasets. On the other hand, ensemble methods integrate the results from individual methods and have been proved to outperform each of their individual component methods in theory. In this paper, we investigate the performance of some ensemble methods over the commonly used miRNA target prediction methods. We apply eight different popular miRNA target prediction methods to three cancer datasets, and compare their performance with the ensemble methods which integrate the results from each combination of the individual methods. The validation results using experimentally confirmed databases show that the results of the ensemble methods complement those obtained by the individual methods and the ensemble methods perform better than the individual methods across different datasets. The ensemble method, Pearson+IDA+Lasso, which combines methods in different approaches, including a correlation method, a causal inference method, and a regression method, is the best performed ensemble method in this study. Further analysis of the results of this ensemble method shows that the ensemble method can obtain more targets which could not be found by any of the single methods, and the discovered targets are more statistically significant and functionally enriched. The source codes, datasets, miRNA target predictions by all methods, and the ground truth
Ensemble Methods for MiRNA Target Prediction from Expression Data
Le, Thuc Duy; Zhang, Junpeng; Liu, Lin; Li, Jiuyong
2015-01-01
Background microRNAs (miRNAs) are short regulatory RNAs that are involved in several diseases, including cancers. Identifying miRNA functions is very important in understanding disease mechanisms and determining the efficacy of drugs. An increasing number of computational methods have been developed to explore miRNA functions by inferring the miRNA-mRNA regulatory relationships from data. Each of the methods is developed based on some assumptions and constraints, for instance, assuming linear relationships between variables. For such reasons, computational methods are often subject to the problem of inconsistent performance across different datasets. On the other hand, ensemble methods integrate the results from individual methods and have been proved to outperform each of their individual component methods in theory. Results In this paper, we investigate the performance of some ensemble methods over the commonly used miRNA target prediction methods. We apply eight different popular miRNA target prediction methods to three cancer datasets, and compare their performance with the ensemble methods which integrate the results from each combination of the individual methods. The validation results using experimentally confirmed databases show that the results of the ensemble methods complement those obtained by the individual methods and the ensemble methods perform better than the individual methods across different datasets. The ensemble method, Pearson+IDA+Lasso, which combines methods in different approaches, including a correlation method, a causal inference method, and a regression method, is the best performed ensemble method in this study. Further analysis of the results of this ensemble method shows that the ensemble method can obtain more targets which could not be found by any of the single methods, and the discovered targets are more statistically significant and functionally enriched. The source codes, datasets, miRNA target predictions by all methods, and
Proteomics for understanding miRNA biology
Huang, Tai-Chung; Pinto, Sneha M.; Pandey, Akhilesh
2013-01-01
MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. PMID:23125164
Genome-Wide Analysis of miRNA targets in Brachypodium and Biomass Energy Crops
DOE Office of Scientific and Technical Information (OSTI.GOV)
Green, Pamela J.
2015-08-11
MicroRNAs (miRNAs) contribute to the control of numerous biological processes through the regulation of specific target mRNAs. Although the identities of these targets are essential to elucidate miRNA function, the targets are much more difficult to identify than the small RNAs themselves. Before this work, we pioneered the genome-wide identification of the targets of Arabidopsis miRNAs using an approach called PARE (German et al., Nature Biotech. 2008; Nature Protocols, 2009). Under this project, we applied PARE to Brachypodium distachyon (Brachypodium), a model plant in the Poaceae family, which includes the major food grain and bioenergy crops. Through in-depth global analysismore » and examination of specific examples, this research greatly expanded our knowledge of miRNAs and target RNAs of Brachypodium. New regulation in response to environmental stress or tissue type was found, and many new miRNAs were discovered. More than 260 targets of new and known miRNAs with PARE sequences at the precise sites of miRNA-guided cleavage were identified and characterized. Combining PARE data with the small RNA data also identified the miRNAs responsible for initiating approximately 500 phased loci, including one of the novel miRNAs. PARE analysis also revealed that differentially expressed miRNAs in the same family guide specific target RNA cleavage in a correspondingly tissue-preferential manner. The project included generation of small RNA and PARE resources for bioenergy crops, to facilitate ongoing discovery of conserved miRNA-target RNA regulation. By associating specific miRNA-target RNA pairs with known physiological functions, the research provides insights about gene regulation in different tissues and in response to environmental stress. This, and release of new PARE and small RNA data sets should contribute basic knowledge to enhance breeding and may suggest new strategies for improvement of biomass energy crops.« less
Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly
2015-01-01
Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3’untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3’ UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3’UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3’UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3’ UTRs. Additionally, the inhibition of packaging in-trans with inhibitory
Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly
2015-12-01
Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3'untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3' UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3'UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3'UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3' UTRs. Additionally, the inhibition of packaging in-trans with inhibitory ORNs
Kaplan, Craig D.; Larsson, Karl-Magnus; Kornberg, Roger D.
2008-01-01
Summary Structural, biochemical and genetic studies have led to proposals that a mobile element of multi-subunit RNA polymerases, the Trigger Loop (TL), plays a critical role in catalysis and can be targeted by antibiotic inhibitors. Here we present evidence that the Saccharomyces cerevisiae RNA Polymerase II (Pol II) TL participates in substrate selection. Amino acid substitutions within the Pol II TL preferentially alter substrate usage and enzyme fidelity, as does inhibition of transcription by α-amanitin. Finally, substitution of His1085 in the TL specifically renders Pol II highly resistant to α-amanitin, indicating a functional interaction between His1085 and α-amanitin that is supported by re-refinement of an α-amanitin-Pol II crystal structure. We propose that α-amanitin inhibited Pol II elongation, which is slow and exhibits reduced substrate selectivity, results from direct α-amanitin interference with the TL. PMID:18538653
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo
2008-02-05
Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less
IIKmTA: Inter and Intra Kingdom miRNA-Target Analyzer.
Mal, Chittabrata; Aftabuddin, Md; Kundu, Sudip
2018-03-16
Growing evidences suggest that microRNAs (miRNAs) can efficiently regulate gene expression at intracellular and extracellular levels. It has been previously reported that plant/food-derived miRNAs are highly enriched in human serum or serum from phytophagous animals, and they are responsible for regulating mammalian gene expression. Thus, miRNAs could function as active signaling molecules, which carry information across distinct species or even kingdoms. However, the mode of miRNA shuttling among various organisms is still a mystery to unravel. The intra and inter kingdom miRNA transfer has boosted up the hypothesis about the potential impact of plant or animal miRNAs on each other. To our knowledge, the software for analyzing cross-kingdom miRNA-targets is lacking. We have developed a web-tool "IIKmTA: Inter and Intra Kingdom miRNA-Target Analyzer" utilizing a database; the data of which have been collected from another web server. Here, user can analyze the targeting potential of (i) plant miRNAs on animal UTRs (Untranslated regions), and vice versa (i.e., inter kingdom), (ii) plant miRNAs on plant UTRs and animal miRNAs on animal UTRs (i.e., intra kingdom). Further, user can analyze (i) miRNAs to targets, (ii) targets to miRNAs, and (iii) miRNA sets targeting sets of targets. For a wide variety of animal and plant species, IIKmTA can identify the miRNA binding sites in the probable target UTRs. Moreover, GC% and AU% of miRNAs will be calculated. All the results can be saved as .csv file. Recent researches identified miRNAs in plants and human secretions and their role in regulating the human genes. Such findings indicate the therapeutic role of secretory miRNAs of such plants which exhibits medicinal value and in near future many diseases may be treated by consumption of these plant miRNAs through food. Using our newly developed database and analyzing tool, one can easily determine the different relationships between miRNAs and their targets across kingdoms
Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome
NASA Astrophysics Data System (ADS)
Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei
2004-11-01
Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity
He, Liang; Chen, Yan; Hao, Shuqing; Qian, Jinqiao
2018-05-01
Protein coding sequences account for around 3% of the human genome, the rest are noncoding RNA (ncRNA) including long ncRNA (lncRNA) and miRNA. Accumulating evidence indicates that lncRNAs and miRNAs are candidate biomarkers for diagnosis, prognosis and therapy of cardiovascular diseases. The lncRNAs act as sponge-like effects on numerous miRNAs, subsequently regulating miRNAs and their targets, mRNA functions. The role of lncRNA-miRNA-mRNA axis in pathogenesis of cardiovascular diseases has been recently reported and highlighted. Herein, this review discusses emerging roles of lncRNA-miRNA-mRNA axis in cardiovascular pathophysiology and regulation, with a novel focus on cardioprotective network activities of the two subgroup ncRNAs.
PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.
Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří
2015-07-01
The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hau; Florens, Laurence; Mak, Ho Yi
2012-01-01
The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans. PMID:22508728
Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hua; Li, Hau; Florens, Laurence; Mak, Ho Yi
2012-04-15
The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans.
C-mii: a tool for plant miRNA and target identification.
Numnark, Somrak; Mhuantong, Wuttichai; Ingsriswang, Supawadee; Wichadakul, Duangdao
2012-01-01
MicroRNAs (miRNAs) have been known to play an important role in several biological processes in both animals and plants. Although several tools for miRNA and target identification are available, the number of tools tailored towards plants is limited, and those that are available have specific functionality, lack graphical user interfaces, and restrict the number of input sequences. Large-scale computational identifications of miRNAs and/or targets of several plants have been also reported. Their methods, however, are only described as flow diagrams, which require programming skills and the understanding of input and output of the connected programs to reproduce. To overcome these limitations and programming complexities, we proposed C-mii as a ready-made software package for both plant miRNA and target identification. C-mii was designed and implemented based on established computational steps and criteria derived from previous literature with the following distinguishing features. First, software is easy to install with all-in-one programs and packaged databases. Second, it comes with graphical user interfaces (GUIs) for ease of use. Users can identify plant miRNAs and targets via step-by-step execution, explore the detailed results from each step, filter the results according to proposed constraints in plant miRNA and target biogenesis, and export sequences and structures of interest. Third, it supplies bird's eye views of the identification results with infographics and grouping information. Fourth, in terms of functionality, it extends the standard computational steps of miRNA target identification with miRNA-target folding and GO annotation. Fifth, it provides helper functions for the update of pre-installed databases and automatic recovery. Finally, it supports multi-project and multi-thread management. C-mii constitutes the first complete software package with graphical user interfaces enabling computational identification of both plant miRNA genes and miRNA
C-mii: a tool for plant miRNA and target identification
2012-01-01
Background MicroRNAs (miRNAs) have been known to play an important role in several biological processes in both animals and plants. Although several tools for miRNA and target identification are available, the number of tools tailored towards plants is limited, and those that are available have specific functionality, lack graphical user interfaces, and restrict the number of input sequences. Large-scale computational identifications of miRNAs and/or targets of several plants have been also reported. Their methods, however, are only described as flow diagrams, which require programming skills and the understanding of input and output of the connected programs to reproduce. Results To overcome these limitations and programming complexities, we proposed C-mii as a ready-made software package for both plant miRNA and target identification. C-mii was designed and implemented based on established computational steps and criteria derived from previous literature with the following distinguishing features. First, software is easy to install with all-in-one programs and packaged databases. Second, it comes with graphical user interfaces (GUIs) for ease of use. Users can identify plant miRNAs and targets via step-by-step execution, explore the detailed results from each step, filter the results according to proposed constraints in plant miRNA and target biogenesis, and export sequences and structures of interest. Third, it supplies bird's eye views of the identification results with infographics and grouping information. Fourth, in terms of functionality, it extends the standard computational steps of miRNA target identification with miRNA-target folding and GO annotation. Fifth, it provides helper functions for the update of pre-installed databases and automatic recovery. Finally, it supports multi-project and multi-thread management. Conclusions C-mii constitutes the first complete software package with graphical user interfaces enabling computational identification of
Biomimetic RNA-silencing nanocomplexes: overcoming multidrug resistance in cancer cells.
Wang, Zhongliang; Wang, Zhe; Liu, Dingbin; Yan, Xuefeng; Wang, Fu; Niu, Gang; Yang, Min; Chen, Xiaoyuan
2014-02-10
RNA interference (RNAi) is an RNA-dependent gene silencing approach controlled by an RNA-induced silencing complex (RISC). Herein, we present a synthetic RISC-mimic nanocomplex, which can actively cleave its target RNA in a sequence-specific manner. With high enzymatic stability and efficient self-delivery to target cells, the designed nanocomplex can selectively and potently induce gene silencing without cytokine activation. These nanocomplexes, which target multidrug resistance, are not only able to bypass the P-glycoprotein (Pgp) transporter, due to their nano-size effect, but also effectively suppress Pgp expression, thus resulting in successful restoration of drug sensitivity of OVCAR8/ADR cells to Pgp-transportable cytotoxic agents. This nanocomplex approach has the potential for both functional genomics and cancer therapy. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Proteomics for understanding miRNA biology.
Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh
2013-02-01
MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F
2010-04-08
RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.
Aedes aegypti uses RNA interference in defense against Sindbis virus infection.
Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D
2008-03-17
RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.
RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds
Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.
2012-01-01
Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571
Targeting RNA Splicing for Disease Therapy
Havens, Mallory A.; Duelli, Dominik M.
2013-01-01
Splicing of pre-messenger RNA into mature messenger RNA is an essential step for expression of most genes in higher eukaryotes. Defects in this process typically affect cellular function and can have pathological consequences. Many human genetic diseases are caused by mutations that cause splicing defects. Furthermore, a number of diseases are associated with splicing defects that are not attributed to overt mutations. Targeting splicing directly to correct disease-associated aberrant splicing is a logical approach to therapy. Splicing is a favorable intervention point for disease therapeutics, because it is an early step in gene expression and does not alter the genome. Significant advances have been made in the development of approaches to manipulate splicing for therapy. Splicing can be manipulated with a number of tools including antisense oligonucleotides, modified small nuclear RNAs (snRNAs), trans-splicing, and small molecule compounds, all of which have been used to increase specific alternatively spliced isoforms or to correct aberrant gene expression resulting from gene mutations that alter splicing. Here we describe clinically relevant splicing defects in disease states, the current tools used to target and alter splicing, specific mutations and diseases that are being targeted using splice-modulating approaches, and emerging therapeutics. PMID:23512601
Targeting RNA splicing for disease therapy.
Havens, Mallory A; Duelli, Dominik M; Hastings, Michelle L
2013-01-01
Splicing of pre-messenger RNA into mature messenger RNA is an essential step for the expression of most genes in higher eukaryotes. Defects in this process typically affect cellular function and can have pathological consequences. Many human genetic diseases are caused by mutations that cause splicing defects. Furthermore, a number of diseases are associated with splicing defects that are not attributed to overt mutations. Targeting splicing directly to correct disease-associated aberrant splicing is a logical approach to therapy. Splicing is a favorable intervention point for disease therapeutics, because it is an early step in gene expression and does not alter the genome. Significant advances have been made in the development of approaches to manipulate splicing for therapy. Splicing can be manipulated with a number of tools including antisense oligonucleotides, modified small nuclear RNAs (snRNAs), trans-splicing, and small molecule compounds, all of which have been used to increase specific alternatively spliced isoforms or to correct aberrant gene expression resulting from gene mutations that alter splicing. Here we describe clinically relevant splicing defects in disease states, the current tools used to target and alter splicing, specific mutations and diseases that are being targeted using splice-modulating approaches, and emerging therapeutics. Copyright © 2013 John Wiley & Sons, Ltd.
A review on current status of antiviral siRNA.
Qureshi, Abid; Tantray, Vaqar Gani; Kirmani, Altaf Rehman; Ahangar, Abdul Ghani
2018-04-15
Viral diseases like influenza, AIDS, hepatitis, and Ebola cause severe epidemics worldwide. Along with their resistant strains, new pathogenic viruses continue to be discovered so creating an ongoing need for new antiviral treatments. RNA interference is a cellular gene-silencing phenomenon in which sequence-specific degradation of target mRNA is achieved by means of complementary short interfering RNA (siRNA) molecules. Short interfering RNA technology affords a potential tractable strategy to combat viral pathogenesis because siRNAs are specific, easy to design, and can be directed against multiple strains of a virus by targeting their conserved gene regions. In this review, we briefly summarize the current status of siRNA therapy for representative examples from different virus families. In addition, other aspects like their design, delivery, medical significance, bioinformatics resources, and limitations are also discussed. Copyright © 2018 John Wiley & Sons, Ltd.
Xu, Yan; Chen, Yan; Li, Daliang; Liu, Qing; Xuan, Zhenyu; Li, Wen-Hong
2017-02-01
MicroRNAs are small non-coding RNAs acting as posttranscriptional repressors of gene expression. Identifying mRNA targets of a given miRNA remains an outstanding challenge in the field. We have developed a new experimental approach, TargetLink, that applied locked nucleic acid (LNA) as the affinity probe to enrich target genes of a specific microRNA in intact cells. TargetLink also consists a rigorous and systematic data analysis pipeline to identify target genes by comparing LNA-enriched sequences between experimental and control samples. Using miR-21 as a test microRNA, we identified 12 target genes of miR-21 in a human colorectal cancer cell by this approach. The majority of the identified targets interacted with miR-21 via imperfect seed pairing. Target validation confirmed that miR-21 repressed the expression of the identified targets. The cellular abundance of the identified miR-21 target transcripts varied over a wide range, with some targets expressed at a rather low level, confirming that both abundant and rare transcripts are susceptible to regulation by microRNAs, and that TargetLink is an efficient approach for identifying the target set of a specific microRNA in intact cells. C20orf111, one of the novel targets identified by TargetLink, was found to reside in the nuclear speckle and to be reliably repressed by miR-21 through the interaction at its coding sequence.
Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.
Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D
2016-06-01
Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi
2018-02-12
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.
Chen, Y; Redinbaugh, M G; Michel, A P
2015-06-01
Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.
Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei
2017-04-01
Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.
Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C
2005-02-22
RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.
Identification of targets of miRNA-221 and miRNA-222 in fulvestrant-resistant breast cancer
Liu, Pengfei; Sun, Manna; Jiang, Wenhua; Zhao, Jinkun; Liang, Chunyong; Zhang, Huilai
2016-01-01
The present study aimed to identify the differentially expressed genes (DEGs) regulated by microRNA (miRNA)-221 and miRNA-222 that are associated with the resistance of breast cancer to fulvestrant. The GSE19777 transcription profile was downloaded from the Gene Expression Omnibus database, and includes data from three samples of antisense miRNA-221-transfected fulvestrant-resistant MCF7-FR breast cancer cells, three samples of antisense miRNA-222-transfected fulvestrant-resistant MCF7-FR cells and three samples of control inhibitor (green fluorescent protein)-treated fulvestrant-resistant MCF7-FR cells. The linear models for microarray data package in R/Bioconductor was employed to screen for DEGs in the miRNA-transfected cells, and the pheatmap package in R was used to perform two-way clustering. Pathway enrichment was conducted using the Gene Set Enrichment Analysis tool. Furthermore, a miRNA-messenger (m) RNA regulatory network depicting interactions between miRNA-targeted upregulated DEGs was constructed and visualized using Cytoscape. In total, 492 and 404 DEGs were identified for the antisense miRNA-221-transfected MCF7-FR cells and the antisense miRNA-222-transfected MCF7-FR cells, respectively. Genes of the pentose phosphate pathway (PPP) were significantly enriched in the antisense miRNA-221-transfected MCF7-FR cells. In addition, components of the Wnt signaling pathway and cell adhesion molecules (CAMs) were significantly enriched in the antisense miRNA-222-transfected MCF7-FR cells. In the miRNA-mRNA regulatory network, miRNA-222 was demonstrated to target protocadherin 10 (PCDH10). The results of the present study suggested that the PPP and Wnt signaling pathways, as well as CAMs and PCDH10, may be associated with the resistance of breast cancer to fulvestrant. PMID:27895744
Features of Modularly Assembled Compounds That Impart Bioactivity Against an RNA Target
Rzuczek, Suzanne G.; Gao, Yu; Tang, Zhen-Zhi; Thornton, Charles A.; Kodadek, Thomas; Disney, Matthew D.
2013-01-01
Transcriptomes provide a myriad of potential RNAs that could be the targets of therapeutics or chemical genetic probes of function. Cell permeable small molecules, however, generally do not exploit these targets, owing to the difficulty in the design of high affinity, specific small molecules targeting RNA. As part of a general program to study RNA function using small molecules, we designed bioactive, modularly assembled small molecules that target the non-coding expanded RNA repeat that causes myotonic dystrophy type 1 (DM1), r(CUG)exp. Herein, we present a rigorous study to elucidate features in modularly assembled compounds that afford bioactivity. Different modular assembly scaffolds were investigated including polyamines, α-peptides, β-peptides, and peptide tertiary amides (PTAs). Based on activity as assessed by improvement of DM1-associated defects, stability against proteases, cellular permeability, and toxicity, we discovered that constrained backbones, namely PTAs, are optimal. Notably, we determined that r(CUG)exp is the target of the optimal PTA in cellular models and that the optimal PTA improves DM1-associated defects in a mouse model. Biophysical analyses were employed to investigate potential sources of bioactivity. These investigations show that modularly assembled compounds have increased residence times on their targets and faster on rates than the RNA-binding modules from which they were derived and faster on rates than the protein that binds r(CUG)exp, the inactivation of which gives rise to DM1-associated defects. These studies provide information about features of small molecules that are programmable for targeting RNA, allowing for the facile optimization of therapeutics or chemical probes against other cellular RNA targets. PMID:24032410
Features of modularly assembled compounds that impart bioactivity against an RNA target.
Rzuczek, Suzanne G; Gao, Yu; Tang, Zhen-Zhi; Thornton, Charles A; Kodadek, Thomas; Disney, Matthew D
2013-10-18
Transcriptomes provide a myriad of potential RNAs that could be the targets of therapeutics or chemical genetic probes of function. Cell-permeable small molecules, however, generally do not exploit these targets, owing to the difficulty in the design of high affinity, specific small molecules targeting RNA. As part of a general program to study RNA function using small molecules, we designed bioactive, modularly assembled small molecules that target the noncoding expanded RNA repeat that causes myotonic dystrophy type 1 (DM1), r(CUG)(exp). Herein, we present a rigorous study to elucidate features in modularly assembled compounds that afford bioactivity. Different modular assembly scaffolds were investigated, including polyamines, α-peptides, β-peptides, and peptide tertiary amides (PTAs). On the basis of activity as assessed by improvement of DM1-associated defects, stability against proteases, cellular permeability, and toxicity, we discovered that constrained backbones, namely, PTAs, are optimal. Notably, we determined that r(CUG)(exp) is the target of the optimal PTA in cellular models and that the optimal PTA improves DM1-associated defects in a mouse model. Biophysical analyses were employed to investigate potential sources of bioactivity. These investigations show that modularly assembled compounds have increased residence times on their targets and faster on rates than the RNA-binding modules from which they were derived. Moreover, they have faster on rates than the protein that binds r(CUG)(exp), the inactivation of which gives rise to DM1-associated defects. These studies provide information about features of small molecules that are programmable for targeting RNA, allowing for the facile optimization of therapeutics or chemical probes against other cellular RNA targets.
Yao, Juan; Zhang, Zhang; Deng, Zhenghua; Wang, Youqiang; Guo, Yongcan
2017-10-23
An isothermal, enzyme free, ultra-specific and ultra-sensitive protocol for electrochemical detection of miRNAs is proposed based on the toehold-mediated strand displacement reaction (SDR) and non-enzymatic catalytic hairpin reaction (CHA) recycling. The SDR was first triggered only in the presence of target miRNA and this process also affects other miRNA interferences having similar target sequences, thus guaranteeing a high discrimination factor and could be used in rare content miRNA detection with various amounts of interferences having similar target sequences. The output protector strand then triggered enzyme free CHA amplification and generates plenty of hairpin self-assembly products. This process in turn influences SDR equilibrium to move to the right and generates large amounts of protector output to ensure analysis sensitivity. Compared with traditional CHA, our proposed method greatly improved the signal to noise ratio and shows excellent performance in rare miRNA detection with miRNA analogue interference. Under the optimal experimental conditions and using square wave voltammetry, the established biosensor could detect target miRNA-21 down to 30 fM (S/N = 3) with a dynamic range from 100 fM to 2 nM, and discriminate rare target miRNA-21 from mismatched miRNA with high selectivity. This method holds great promise in miRNA detection from human cancer cell lines and would be a versatile and powerful tool for clinical molecular diagnostics.
MicroRNA Targeting Specificity in Mammals: Determinants Beyond Seed Pairing
Grimson, Andrew; Farh, Kyle Kai-How; Johnston, Wendy K.; Garrett-Engele, Philip; Lim, Lee P.; Bartel, David P.
2013-01-01
Summary Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are ~7-nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for co-expressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13–16, and positioning within the 3'UTR at least 15 nt from the stop codon and away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets. PMID:17612493
Statistical Use of Argonaute Expression and RISC Assembly in microRNA Target Identification
Stanhope, Stephen A.; Sengupta, Srikumar; den Boon, Johan; Ahlquist, Paul; Newton, Michael A.
2009-01-01
MicroRNAs (miRNAs) posttranscriptionally regulate targeted messenger RNAs (mRNAs) by inducing cleavage or otherwise repressing their translation. We address the problem of detecting m/miRNA targeting relationships in homo sapiens from microarray data by developing statistical models that are motivated by the biological mechanisms used by miRNAs. The focus of our modeling is the construction, activity, and mediation of RNA-induced silencing complexes (RISCs) competent for targeted mRNA cleavage. We demonstrate that regression models accommodating RISC abundance and controlling for other mediating factors fit the expression profiles of known target pairs substantially better than models based on m/miRNA expressions alone, and lead to verifications of computational target pair predictions that are more sensitive than those based on marginal expression levels. Because our models are fully independent of exogenous results from sequence-based computational methods, they are appropriate for use as either a primary or secondary source of information regarding m/miRNA target pair relationships, especially in conjunction with high-throughput expression studies. PMID:19779550
Statistical use of argonaute expression and RISC assembly in microRNA target identification.
Stanhope, Stephen A; Sengupta, Srikumar; den Boon, Johan; Ahlquist, Paul; Newton, Michael A
2009-09-01
MicroRNAs (miRNAs) posttranscriptionally regulate targeted messenger RNAs (mRNAs) by inducing cleavage or otherwise repressing their translation. We address the problem of detecting m/miRNA targeting relationships in homo sapiens from microarray data by developing statistical models that are motivated by the biological mechanisms used by miRNAs. The focus of our modeling is the construction, activity, and mediation of RNA-induced silencing complexes (RISCs) competent for targeted mRNA cleavage. We demonstrate that regression models accommodating RISC abundance and controlling for other mediating factors fit the expression profiles of known target pairs substantially better than models based on m/miRNA expressions alone, and lead to verifications of computational target pair predictions that are more sensitive than those based on marginal expression levels. Because our models are fully independent of exogenous results from sequence-based computational methods, they are appropriate for use as either a primary or secondary source of information regarding m/miRNA target pair relationships, especially in conjunction with high-throughput expression studies.
Chen, Shu-Chuan; Jeng, King-Song; Lai, Michael M C
2017-10-15
Influenza A virus (IAV) replication relies on an intricate interaction between virus and host cells. How the cellular proteins are usurped for IAV replication remains largely obscure. The aim of this study was to search for novel and potential cellular factors that participate in IAV replication. ZBTB25, a transcription repressor of a variety of cellular genes, was identified by an RNA interference (RNAi) genomic library screen. Depletion of ZBTB25 significantly reduced IAV production. Conversely, overexpression of ZBTB25 enhanced it. ZBTB25 interacted with the viral RNA-dependent RNA polymerase (RdRp) protein and modulated its transcription activity. In addition, ZBTB25 also functioned as a viral RNA (vRNA)-binding protein, binding preferentially to the U-rich sequence within the 5' untranslated region (UTR) of vRNA. Both protein-protein and protein-RNA interactions involving ZBTB25 facilitated viral RNA transcription and replication. In addition, ZBTB25 suppressed interferon production, further enhancing viral replication. ZBTB25-associated functions required an intact zinc finger domain and posttranslational SUMO-1 modification of ZBTB25. Furthermore, treatment with disulfiram (a zinc ejector) of ZBTB25-overexpressing cells showed significantly reduced IAV production as a result of reduced RNA synthesis. Our findings indicate that IAV usurps ZBTB25 for IAV RNA synthesis and serves as a novel and potential therapeutic antiviral target. IMPORTANCE IAV-induced seasonal influenza causes severe illness and death in high-risk populations. However, IAV has developed resistance to current antiviral drugs due to its high mutation rate. Therefore, development of drugs targeting cellular factors required for IAV replication is an attractive alternative for IAV therapy. Here, we discovered a cellular protein, ZBTB25, that enhances viral RdRp activity by binding to both viral RdRp and viral RNA to stimulate viral RNA synthesis. A unique feature of ZBTB25 in the regulation of
Chen, Shu-Chuan; Jeng, King-Song
2017-01-01
ABSTRACT Influenza A virus (IAV) replication relies on an intricate interaction between virus and host cells. How the cellular proteins are usurped for IAV replication remains largely obscure. The aim of this study was to search for novel and potential cellular factors that participate in IAV replication. ZBTB25, a transcription repressor of a variety of cellular genes, was identified by an RNA interference (RNAi) genomic library screen. Depletion of ZBTB25 significantly reduced IAV production. Conversely, overexpression of ZBTB25 enhanced it. ZBTB25 interacted with the viral RNA-dependent RNA polymerase (RdRp) protein and modulated its transcription activity. In addition, ZBTB25 also functioned as a viral RNA (vRNA)-binding protein, binding preferentially to the U-rich sequence within the 5′ untranslated region (UTR) of vRNA. Both protein-protein and protein-RNA interactions involving ZBTB25 facilitated viral RNA transcription and replication. In addition, ZBTB25 suppressed interferon production, further enhancing viral replication. ZBTB25-associated functions required an intact zinc finger domain and posttranslational SUMO-1 modification of ZBTB25. Furthermore, treatment with disulfiram (a zinc ejector) of ZBTB25-overexpressing cells showed significantly reduced IAV production as a result of reduced RNA synthesis. Our findings indicate that IAV usurps ZBTB25 for IAV RNA synthesis and serves as a novel and potential therapeutic antiviral target. IMPORTANCE IAV-induced seasonal influenza causes severe illness and death in high-risk populations. However, IAV has developed resistance to current antiviral drugs due to its high mutation rate. Therefore, development of drugs targeting cellular factors required for IAV replication is an attractive alternative for IAV therapy. Here, we discovered a cellular protein, ZBTB25, that enhances viral RdRp activity by binding to both viral RdRp and viral RNA to stimulate viral RNA synthesis. A unique feature of ZBTB25 in the
Loop nucleotides control primary and mature miRNA function in target recognition and repression
Yue, Si-Biao; Deis Trujillo, Robin; Tang, Yujie; O'Gorman, William E
2011-01-01
MicroRNA (miRNA) genes produce three major RNA products; primary (pri-), precursor (pre-), and mature miRNAs. Each product includes sequences complementary to cognate targets, thus they all can in principle interact with the targets. In a recent study we showed that pri-miRNAs play a direct role in target recognition and repression in the absence of functional mature miRNAs. Here we examined the functional contribution of pri-miRNAs in target regulation when full-length functional miRNAs are present. We found that pri-let-7 loop nucleotides control the production of the 5′ end of mature miRNAs and modulate the activity of the miRNA gene. This insight enabled us to modulate biogenesis of functional mature miRNAs and dissect the causal relationships between mature miRNA biogenesis and target repression. We demonstrate that both pri- and mature miRNAs can contribute to target repression and that their contributions can be distinguished by the differences between the pri- and mature miRNAs' sensitivity to bind to the first seed nucleotide. Our results demonstrate that the regulatory information encoded in the pri-/pre-miRNA loop nucleotides controls the activities of pri-miRNAs and mature let-7 by influencing pri-miRNA and target complex formation and the fidelity of mature miRNA seed generation. PMID:22142974
Crystal structure of the Csm3-Csm4 subcomplex in the type III-A CRISPR-Cas interference complex.
Numata, Tomoyuki; Inanaga, Hideko; Sato, Chikara; Osawa, Takuo
2015-01-30
Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci play a pivotal role in the prokaryotic host defense system against invading genetic materials. The CRISPR loci are transcribed to produce CRISPR RNAs (crRNAs), which form interference complexes with CRISPR-associated (Cas) proteins to target the invading nucleic acid for degradation. The interference complex of the type III-A CRISPR-Cas system is composed of five Cas proteins (Csm1-Csm5) and a crRNA, and targets invading DNA. Here, we show that the Csm1, Csm3, and Csm4 proteins from Methanocaldococcus jannaschii form a stable subcomplex. We also report the crystal structure of the M. jannaschii Csm3-Csm4 subcomplex at 3.1Å resolution. The complex structure revealed the presence of a basic concave surface around their interface, suggesting the RNA and/or DNA binding ability of the complex. A gel retardation analysis showed that the Csm3-Csm4 complex binds single-stranded RNA in a non-sequence-specific manner. Csm4 structurally resembles Cmr3, a component of the type III-B CRISPR-Cas interference complex. Based on bioinformatics, we constructed a model structure of the Csm1-Csm4-Csm3 ternary complex, which provides insights into its role in the Csm interference complex. Copyright © 2014 Elsevier Ltd. All rights reserved.
Targeted RNA-Sequencing with Competitive Multiplex-PCR Amplicon Libraries
Blomquist, Thomas M.; Crawford, Erin L.; Lovett, Jennie L.; Yeo, Jiyoun; Stanoszek, Lauren M.; Levin, Albert; Li, Jia; Lu, Mei; Shi, Leming; Muldrew, Kenneth; Willey, James C.
2013-01-01
Whole transcriptome RNA-sequencing is a powerful tool, but is costly and yields complex data sets that limit its utility in molecular diagnostic testing. A targeted quantitative RNA-sequencing method that is reproducible and reduces the number of sequencing reads required to measure transcripts over the full range of expression would be better suited to diagnostic testing. Toward this goal, we developed a competitive multiplex PCR-based amplicon sequencing library preparation method that a) targets only the sequences of interest and b) controls for inter-target variation in PCR amplification during library preparation by measuring each transcript native template relative to a known number of synthetic competitive template internal standard copies. To determine the utility of this method, we intentionally selected PCR conditions that would cause transcript amplification products (amplicons) to converge toward equimolar concentrations (normalization) during library preparation. We then tested whether this approach would enable accurate and reproducible quantification of each transcript across multiple library preparations, and at the same time reduce (through normalization) total sequencing reads required for quantification of transcript targets across a large range of expression. We demonstrate excellent reproducibility (R2 = 0.997) with 97% accuracy to detect 2-fold change using External RNA Controls Consortium (ERCC) reference materials; high inter-day, inter-site and inter-library concordance (R2 = 0.97–0.99) using FDA Sequencing Quality Control (SEQC) reference materials; and cross-platform concordance with both TaqMan qPCR (R2 = 0.96) and whole transcriptome RNA-sequencing following “traditional” library preparation using Illumina NGS kits (R2 = 0.94). Using this method, sequencing reads required to accurately quantify more than 100 targeted transcripts expressed over a 107-fold range was reduced more than 10,000-fold, from 2.3×109 to 1
RNA therapeutics: RNAi and antisense mechanisms and clinical applications.
Chery, Jessica
2016-07-01
RNA therapeutics refers to the use of oligonucleotides to target primarily ribonucleic acids (RNA) for therapeutic efforts or in research studies to elucidate functions of genes. Oligonucleotides are distinct from other pharmacological modalities, such as small molecules and antibodies that target mainly proteins, due to their mechanisms of action and chemical properties. Nucleic acids come in two forms: deoxyribonucleic acids (DNA) and ribonucleic acids (RNA). Although DNA is more stable, RNA offers more structural variety ranging from messenger RNA (mRNA) that codes for protein to non-coding RNAs, microRNA (miRNA), transfer RNA (tRNA), short interfering RNAs (siRNAs), ribosomal RNA (rRNA), and long-noncoding RNAs (lncRNAs). As our understanding of the wide variety of RNAs deepens, researchers have sought to target RNA since >80% of the genome is estimated to be transcribed. These transcripts include non-coding RNAs such as miRNAs and siRNAs that function in gene regulation by playing key roles in the transfer of genetic information from DNA to protein, the final product of the central dogma in biology 1 . Currently there are two main approaches used to target RNA: double stranded RNA-mediated interference (RNAi) and antisense oligonucleotides (ASO). Both approaches are currently in clinical trials for targeting of RNAs involved in various diseases, such as cancer and neurodegeneration. In fact, ASOs targeting spinal muscular atrophy and amyotrophic lateral sclerosis have shown positive results in clinical trials 2 . Advantages of ASOs include higher affinity due to the development of chemical modifications that increase affinity, selectivity while decreasing toxicity due to off-target effects. This review will highlight the major therapeutic approaches of RNA medicine currently being applied with a focus on RNAi and ASOs.
Tran, Thi Phuong Anh; Vo, Duc Duy; Di Giorgio, Audrey; Duca, Maria
2015-09-01
MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression at the post-transcriptional level. It is now well established that the overexpression of some miRNAs (oncogenic miRNAs) is responsible for initiation and progression of human cancers and the discovery of new molecules able to interfere with their production and/or function represents one of the most important challenges of current medicinal chemistry of RNA ligands. In this work, we studied the ability of 18 different antibiotics, known as prokaryotic ribosomal RNA, to bind to oncogenic miRNA precursors (stem-loop structured pre-miRNAs) in order to inhibit miRNAs production. In vitro inhibition, binding constants, thermodynamic parameters and binding sites were investigated and highlighted that aminoglycosides and tetracyclines represent interesting pre-miRNA ligands with the ability to inhibit Dicer processing. Copyright © 2015 Elsevier Ltd. All rights reserved.
A quantitative framework for the forward design of synthetic miRNA circuits.
Bloom, Ryan J; Winkler, Sally M; Smolke, Christina D
2014-11-01
Synthetic genetic circuits incorporating regulatory components based on RNA interference (RNAi) have been used in a variety of systems. A comprehensive understanding of the parameters that determine the relationship between microRNA (miRNA) and target expression levels is lacking. We describe a quantitative framework supporting the forward engineering of gene circuits that incorporate RNAi-based regulatory components in mammalian cells. We developed a model that captures the quantitative relationship between miRNA and target gene expression levels as a function of parameters, including mRNA half-life and miRNA target-site number. We extended the model to synthetic circuits that incorporate protein-responsive miRNA switches and designed an optimized miRNA-based protein concentration detector circuit that noninvasively measures small changes in the nuclear concentration of β-catenin owing to induction of the Wnt signaling pathway. Our results highlight the importance of methods for guiding the quantitative design of genetic circuits to achieve robust, reliable and predictable behaviors in mammalian cells.
Gandhi, Nishant S.; Tekade, Rakesh K.; Chougule, Mahavir B.
2014-01-01
Chemotherapeutic agents have certain limitations when it comes to treating cancer, the most important being severe side effects along with multidrug resistance developed against them. Tumor cells exhibits drug resistance due to activation of various cellular level processes viz. activation of drug efflux pumps, anti-apoptotic defense mechanisms etc. Currently, RNA interference (RNAi) based therapeutic approaches are under vibrant scrutinization to seek cancer cure. Especially small interfering RNA (siRNA) and micro RNA (miRNA), are able to knock down the carcinogenic genes by targeting the mRNA expression, which underlies the uniqueness of this therapeutic approach. Recent research focus in the regime of cancer therapy involves the engagement of targeted delivery of siRNA/miRNA in combinations with other therapeutic agents (such as gene, DNA or chemotherapeutic drug) for targeting permeability glycoprotein (P-gp), Multidrug resistant protein 1(MRP-1), B-cell lymphoma (BCL-2) and other targets that are mainly responsible for resistance in cancer therapy. RNAi-chemotherapeutic drug combinations have also been found to be effective against different molecular targets as well and can increase the sensitization of cancer cells to therapy several folds. However, due to stability issues associated with siRNA/miRNA suitable protective carrier is needed and nanotechnology based approaches have been widely explored to overcome these drawbacks. Furthermore, it has been univocally advocated that the co-delivery of siRNA/miRNA with other chemodrugs significantly enhances their capability to overcome cancer resistance compared to naked counterparts. The objective of this article is to review recent nanocarrier based approaches adopted for the delivery of siRNA/miRNA combinations with other anticancer agents (siRNA/miRNA/pDNA/chemodrugs) to treat cancer. PMID:25204288
Gandhi, Nishant S; Tekade, Rakesh K; Chougule, Mahavir B
2014-11-28
Chemotherapeutic agents have certain limitations when it comes to treating cancer, the most important being severe side effects along with multidrug resistance developed against them. Tumor cells exhibit drug resistance due to activation of various cellular level processes viz. activation of drug efflux pumps, anti-apoptotic defense mechanisms, etc. Currently, RNA interference (RNAi) based therapeutic approaches are under vibrant scrutinization to seek cancer cure. Especially small interfering RNA (siRNA) and micro RNA (miRNA), are able to knock down the carcinogenic genes by targeting the mRNA expression, which underlies the uniqueness of this therapeutic approach. Recent research focus in the regime of cancer therapy involves the engagement of targeted delivery of siRNA/miRNA in combinations with other therapeutic agents (such as gene, DNA or chemotherapeutic drug) for targeting permeability glycoprotein (P-gp), multidrug resistant protein 1 (MRP-1), B-cell lymphoma (BCL-2) and other targets that are mainly responsible for resistance in cancer therapy. RNAi-chemotherapeutic drug combinations have also been found to be effective against different molecular targets as well and can increase the sensitization of cancer cells to therapy several folds. However, due to stability issues associated with siRNA/miRNA suitable protective carrier is needed and nanotechnology based approaches have been widely explored to overcome these drawbacks. Furthermore, it has been univocally advocated that the co-delivery of siRNA/miRNA with other chemodrugs significantly enhances their capability to overcome cancer resistance compared to naked counterparts. The objective of this article is to review recent nanocarrier based approaches adopted for the delivery of siRNA/miRNA combinations with other anticancer agents (siRNA/miRNA/pDNA/chemodrugs) to treat cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
Jagtap, Soham; Shivaprasad, Padubidri V
2014-12-02
Micro (mi)RNAs are important regulators of plant development. Across plant lineages, Dicer-like 1 (DCL1) proteins process long ds-like structures to produce micro (mi) RNA duplexes in a stepwise manner. These miRNAs are incorporated into Argonaute (AGO) proteins and influence expression of RNAs that have sequence complementarity with miRNAs. Expression levels of AGOs are greatly regulated by plants in order to minimize unwarranted perturbations using miRNAs to target mRNAs coding for AGOs. AGOs may also have high promoter specificity-sometimes expression of AGO can be limited to just a few cells in a plant. Viral pathogens utilize various means to counter antiviral roles of AGOs including hijacking the host encoded miRNAs to target AGOs. Two host encoded miRNAs namely miR168 and miR403 that target AGOs have been described in the model plant Arabidopsis and such a mechanism is thought to be well conserved across plants because AGO sequences are well conserved. We show that the interaction between AGO mRNAs and miRNAs is species-specific due to the diversity in sequences of two miRNAs that target AGOs, sequence diversity among corresponding target regions in AGO mRNAs and variable expression levels of these miRNAs among vascular plants. We used miRNA sequences from 68 plant species representing 31 plant families for this analysis. Sequences of miR168 and miR403 are not conserved among plant lineages, but surprisingly they differ drastically in their sequence diversity and expression levels even among closely related plants. Variation in miR168 expression among plants correlates well with secondary structures/length of loop sequences of their precursors. Our data indicates a complex AGO targeting interaction among plant lineages due to miRNA sequence diversity and sequences of miRNA targeting regions among AGO mRNAs, thus leading to the assumption that the perturbations by viruses that use host miRNAs to target antiviral AGOs can only be species-specific. We also show
Singh, Aditi D.; Wong, Sylvia; Ryan, Calen P.; Whyard, Steven
2013-01-01
RNA interference has already proven itself to be a highly versatile molecular biology tool for understanding gene function in a limited number of insect species, but its widespread use in other species will be dependent on the development of easier methods of double-stranded RNA (dsRNA) delivery. This study demonstrates that RNA interference can be induced in the mosquito Aedes aegypti L. (Diptera: Culicidae) simply by soaking larvae in a solution of dsRNA for two hours. The mRNA transcripts for β-tubulin, chitin synthase-1 and -2, and heat shock protein 83 were reduced between 30 and 50% three days post-dsRNA treatment. The dsRNA was mixed with a visible dye to identify those individuals that fed on the dsRNA, and based on an absence of RNA interference in those individuals that contained no dye within their guts, the primary route of entry of dsRNA is likely through the gut epithelium. RNA interference was systemic in the insects, inducing measurable knock down of gene expression in tissues beyond the gut. Silencing of the β-tubulin and chitin synthase-1 genes resulted in reduced growth and/or mortality of the larvae, demonstrating the utility of dsRNA as a potential mosquito larvicide. Silencing of chitin synthase-2 did not induce mortality in the larvae, and silencing of heat shock protein 83 only induced mortality in the insects if they were subsequently subjected to a heat stress. Drosophila melanogaster Meigen (Diptera: Drosophilidae) larvae were also soaked in dsRNA designed to specifically target either their own β-tubulin gene, or that of A. aegypti, and significant mortality was only seen in larvae treated with dsRNA targeting their own gene, which suggests that dsRNA pesticides could be designed to be species-limited. PMID:24224468
The past and presence of gene targeting: from chemicals and DNA via proteins to RNA.
Geel, T M; Ruiters, M H J; Cool, R H; Halby, L; Voshart, D C; Andrade Ruiz, L; Niezen-Koning, K E; Arimondo, P B; Rots, M G
2018-06-05
The ability to target DNA specifically at any given position within the genome allows many intriguing possibilities and has inspired scientists for decades. Early gene-targeting efforts exploited chemicals or DNA oligonucleotides to interfere with the DNA at a given location in order to inactivate a gene or to correct mutations. We here describe an example towards correcting a genetic mutation underlying Pompe's disease using a nucleotide-fused nuclease (TFO-MunI). In addition to the promise of gene correction, scientists soon realized that genes could be inactivated or even re-activated without inducing potentially harmful DNA damage by targeting transcriptional modulators to a particular gene. However, it proved difficult to fuse protein effector domains to the first generation of programmable DNA-binding agents. The engineering of gene-targeting proteins (zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs)) circumvented this problem. The disadvantage of protein-based gene targeting is that a fusion protein needs to be engineered for every locus. The recent introduction of CRISPR/Cas offers a flexible approach to target a (fusion) protein to the locus of interest using cheap designer RNA molecules. Many research groups now exploit this platform and the first human clinical trials have been initiated: CRISPR/Cas has kicked off a new era of gene targeting and is revolutionizing biomedical sciences.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'. © 2018 The Author(s).
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara
2011-01-01
RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198
Nonenzymatic microorganism identification based on ribosomal RNA
NASA Astrophysics Data System (ADS)
Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.
1999-11-01
Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.
Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing
2016-01-01
Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .
Design of siRNA Therapeutics from the Molecular Scale
Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick
2013-01-01
While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875
RNA-Targeted Therapies and Amyotrophic Lateral Sclerosis
Le Masson, Gwendal
2018-01-01
Amyotrophic lateral sclerosis (ALS) is a fatal motor disease in adults. Its pathophysiology remains mysterious, but tremendous advances have been made with the discovery of the most frequent mutations of its more common familial form linked to the C9ORF72 gene. Although most cases are still considered sporadic, these genetic mutations have revealed the role of RNA production, processing and transport in ALS, and may be important players in all ALS forms. There are no disease-modifying treatments for adult human neurodegenerative diseases, including ALS. As in spinal muscular atrophy, RNA-targeted therapies have been proposed as potential strategies for treating this neurodegenerative disorder. Successes achieved in various animal models of ALS have proven that RNA therapies are both safe and effective. With careful consideration of the applicability of such therapies in humans, it is possible to anticipate ongoing in vivo research and clinical trial development of RNA therapies for treating ALS. PMID:29342921
RNA-Targeted Therapies and Amyotrophic Lateral Sclerosis.
Mathis, Stéphane; Le Masson, Gwendal
2018-01-15
Amyotrophic lateral sclerosis (ALS) is a fatal motor disease in adults. Its pathophysiology remains mysterious, but tremendous advances have been made with the discovery of the most frequent mutations of its more common familial form linked to the C9ORF72 gene. Although most cases are still considered sporadic, these genetic mutations have revealed the role of RNA production, processing and transport in ALS, and may be important players in all ALS forms. There are no disease-modifying treatments for adult human neurodegenerative diseases, including ALS. As in spinal muscular atrophy, RNA-targeted therapies have been proposed as potential strategies for treating this neurodegenerative disorder. Successes achieved in various animal models of ALS have proven that RNA therapies are both safe and effective. With careful consideration of the applicability of such therapies in humans, it is possible to anticipate ongoing in vivo research and clinical trial development of RNA therapies for treating ALS.
Target mimics: an embedded layer of microRNA-involved gene regulatory networks in plants.
Meng, Yijun; Shao, Chaogang; Wang, Huizhong; Jin, Yongfeng
2012-05-21
MicroRNAs (miRNAs) play an essential role in gene regulation in plants. At the same time, the expression of miRNA genes is also tightly controlled. Recently, a novel mechanism called "target mimicry" was discovered, providing another layer for modulating miRNA activities. However, except for the artificial target mimics manipulated for functional studies on certain miRNA genes, only one example, IPS1 (Induced by Phosphate Starvation 1)-miR399 was experimentally confirmed in planta. To date, few analyses for comprehensive identification of natural target mimics have been performed in plants. Thus, limited evidences are available to provide detailed information for interrogating the questionable issue whether target mimicry was widespread in planta, and implicated in certain biological processes. In this study, genome-wide computational prediction of endogenous miRNA mimics was performed in Arabidopsis and rice, and dozens of target mimics were identified. In contrast to a recent report, the densities of target mimic sites were found to be much higher within the untranslated regions (UTRs) when compared to those within the coding sequences (CDSs) in both plants. Some novel sequence characteristics were observed for the miRNAs that were potentially regulated by the target mimics. GO (Gene Ontology) term enrichment analysis revealed some functional insights into the predicted mimics. After degradome sequencing data-based identification of miRNA targets, the regulatory networks constituted by target mimics, miRNAs and their downstream targets were constructed, and some intriguing subnetworks were further exploited. These results together suggest that target mimicry may be widely implicated in regulating miRNA activities in planta, and we hope this study could expand the current understanding of miRNA-involved regulatory networks.
Zhang, Yidan; Jia, Renbing; Wang, Jing; Xu, Xiaofang; Yao, Yuting; Ge, Shengfan; Fan, Xianqun
2013-01-01
Uveal melanoma (UM) is the most common primary intraocular malignancy and the leading potentially fatal primary intraocular disease in adults. Melanoma antigen recognized by T-cells (MART-1) has been studied extensively as a clinically important diagnostic marker for melanoma, however, its biological function remains unclear. In the present study, the UM cell line SP6.5, which showed a high level of MART-1 expression, was subjected to small interfering RNA-mediated silencing of MART-1. Silencing of MART-1 expression increased the migration ability of SP6.5 cells and down-regulated the expression of the metastasis suppressor NM23. Our results suggest that MART-1 is a candidate target for the development of therapeutic strategies for UM and in particular for the suppression of metastasis associated with this malignancy. PMID:23877836
Establishment of conditional vectors for hairpin siRNA knockdowns
Matsukura, Shiro; Jones, Peter A.; Takai, Daiya
2003-01-01
Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529
A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gumpper, Ryan H.; Li, Weike; Castañeda, Carlos H.
Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, wasmore » found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCENegative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth
A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid.
Gumpper, Ryan H; Li, Weike; Castañeda, Carlos H; Scuderi, M José; Bashkin, James K; Luo, Ming
2018-04-15
Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, was found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCE Negative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth. The
Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing
Goldfarb, Katherine C.; Cech, Thomas R.
2017-01-01
MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR–Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor—analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing—implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. PMID:28115465
Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.
Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L
2016-12-05
Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.
USDA-ARS?s Scientific Manuscript database
Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...
Liu, Yang; Guo, Yubo; An, Sai; Kuang, Yuyang; He, Xi; Ma, Haojun; Li, Jianfeng; Lu, Jing; Lv, Jing; Zhang, Ning; Jiang, Chen
2013-01-01
The activation of caspase-3 is an important hallmark in Parkinson's disease. It could induce neuron death by apoptosis and microglia activation by inflammation. As a result, inhibition the activation of caspase-3 would exert synergistic dual effect in brain in order to prevent the progress of Parkinson's disease. Silencing caspase-3 genes by RNA interference could inhibit the activation of caspase-3. We developed a brain-targeted gene delivery system based on non-viral gene vector, dendrigraft poly-L-lysines. A rabies virus glycoprotein peptide with 29 amino-acid linked to dendrigraft poly-L-lysines could render gene vectors the ability to get across the blood brain barrier by specific receptor mediated transcytosis. The resultant brain-targeted vector was complexed with caspase-3 short hairpin RNA coding plasmid DNA, yielding nanoparticles. In vivo imaging analysis indicated the targeted nanoparticles could accumulate in brain more efficiently than non-targeted ones. A multiple dosing regimen by weekly intravenous administration of the nanoparticles could reduce activated casapse-3 levels, significantly improve locomotor activity and rescue dopaminergic neuronal loss and in Parkinson's disease rats' brain. These results indicated the rabies virus glycoprotein peptide modified brain-targeted nanoparticles were promising gene delivery system for RNA interference to achieve anti-apoptotic and anti-inflammation synergistic therapeutic effects by down-regulation the expression and activation of caspase-3.
psRNATarget: a plant small RNA target analysis server (2017 release).
Dai, Xinbin; Zhuang, Zhaohong; Zhao, Patrick Xuechun
2018-04-30
Plant regulatory small RNAs (sRNAs), which include most microRNAs (miRNAs) and a subset of small interfering RNAs (siRNAs), such as the phased siRNAs (phasiRNAs), play important roles in regulating gene expression. Although generated from genetically distinct biogenesis pathways, these regulatory sRNAs share the same mechanisms for post-translational gene silencing and translational inhibition. psRNATarget was developed to identify plant sRNA targets by (i) analyzing complementary matching between the sRNA sequence and target mRNA sequence using a predefined scoring schema and (ii) by evaluating target site accessibility. This update enhances its analytical performance by developing a new scoring schema that is capable of discovering miRNA-mRNA interactions at higher 'recall rates' without significantly increasing total prediction output. The scoring procedure is customizable for the users to search both canonical and non-canonical targets. This update also enables transmitting and analyzing 'big' data empowered by (a) the implementation of multi-threading chunked file uploading, which can be paused and resumed, using HTML5 APIs and (b) the allocation of significantly more computing nodes to its back-end Linux cluster. The updated psRNATarget server has clear, compelling and user-friendly interfaces that enhance user experiences and present data clearly and concisely. The psRNATarget is freely available at http://plantgrn.noble.org/psRNATarget/.
Wang, Wei-Xia; Lai, Feng-Xiang; Fu, Qiang
2015-01-01
Ran (RanGTPase) in insects participates in the 20-hydroxyecdysone signal transduction pathway in which downstream genes, FTZ-F1, Krüppel-homolog 1 (Kr-h1) and vitellogenin, are involved. A putative Ran gene (NlRan) was cloned from Nilaparvata lugens, a destructive phloem-feeding pest of rice. NlRan has the typical Ran primary structure features that are conserved in insects. NlRan showed higher mRNA abundance immediately after molting and peaked in newly emerged female adults. Among the examined tissues ovary had the highest transcript level, followed by fat body, midgut and integument, and legs. Three days after dsNlRan injection the NlRan mRNA abundance in the third-, fourth-, and fifth-instar nymphs was decreased by 94.3%, 98.4% and 97.0%, respectively. NlFTZ-F1 expression levels in treated third- and fourth-instar nymphs were reduced by 89.3% and 23.8%, respectively. In contrast, NlKr-h1 mRNA levels were up-regulated by 67.5 and 1.5 folds, respectively. NlRan knockdown significantly decreased the body weights, delayed development, and killed >85% of the nymphs at day seven. Two apparent phenotypic defects were observed: (1) Extended body form, and failed to molt; (2) The cuticle at the notum was split open but cannot completely shed off. The newly emerged female adults from dsNlRan injected fifth-instar nymphs showed lower levels of NlRan and vitellogenin, lower weight gain and honeydew excretion comparing with the blank control, and no offspring. Those results suggest that NlRan encodes a functional protein that was involved in development and reproduction. The study established proof of concept that NlRan could serve as a target for dsRNA-based pesticides for N. lugens control. PMID:26554926
RISC RNA sequencing for context-specific identification of in vivo miR targets
Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W
2010-01-01
Rationale MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. Objective To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). Methods and Results We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias, and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1,645 mRNAs consistently targeted to mouse cardiac RISCs. We employed this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing ‘seed’ sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. Conclusions RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context, and is applicable to any tissue and any disease state. Summary MicroRNAs (miRs) are key regulators of mRNA translation in health and disease. While bioinformatic predictions suggest that a single miR may target hundreds of mRNAs, the number of experimentally verified targets of miRs is low. To enable comprehensive, unbiased examination of miR targets, we have performed deep RNA sequencing of cardiac transcriptomes in parallel with cardiac RNA-induced silencing complex
RNA interference-based therapeutics for inherited long QT syndrome.
Li, Guoliang; Ma, Shuting; Sun, Chaofeng
2015-08-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.
RNA interference-based therapeutics for inherited long QT syndrome
LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG
2015-01-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327
miRNA-216 and miRNA-499 target cyb561d2 in zebrafish in response to fipronil exposure.
Zhou, Yongyong; Huang, Hannian; Zhang, Kai; Ding, Xianfeng; Jia, Longlue; Yu, Liang; Zhu, Guonian; Guo, Jiangfeng
2016-07-01
MicroRNA (miRNA) can regulate the expression of its target gene by mediating mRNA cleavage or by translational repression at a post-transcriptional level. Usually, one miRNA may regulate many genes as its targets, while one gene may also be targeted by many miRNAs. We previously demonstrated that cyb561d2, whose protein product is involved in cell defense, and chemical stress, is targeted by miR-155 in adult zebrafish (Danio rerio) when exposed to fipronil (5-amino-1-[2,6-dichloro-4-(trifluoromethyl) phenyl]-4-[(trifluoromethyl) sulphinyl]-1H-pyrazole-3-carbonitrile). Microcosm Targets prediction showed that the cyb561d2 gene is also highly possibly targeted by miR-194a, miR-216b, miR-429, and miR-499. These interactions need to be further validated experimentally. In this study, we evaluated the effects of fipronil on miR-194a, miR-216b, miR-429, miR-499 and cyb561d2 in zebrafish and investigated whether these four miRNAs could regulate the expression of cyb561d2 in both mRNA and protein levels. The expression of cyb561d2 was upregulated in both mRNA and protein level in a dose-dependent manner upon stimulation of fipronil, and miR-216b and miR-499 were downregulated concurrently, whereas there was no significant changes were observed in the expression level of miR-194a and miR-429. The dual luciferase report assay demonstrated that miR-216b and miR-499 interacted with cyb561d2 3'-untranslated regions (3'-UTR), miR-194a and miR-429 did not stimulate degradation of cyb561d2 mRNA. The expression of cyb561d2 was reduced in both mRNA and protein level when ZF4 cells were transfected with miR-499 mimic, whereas expression level of both mRNA and protein was increased when endogenous miR-499 was inhibited by transfection with miR-499 inhibitor. Likewise, the mRNA and protein level of cyb561d2 was affected by treatment with the mimics and the inhibitor of miR-216b. In contrast, when ZF4 cells were transfected with a mimic of miR-194a or miR-429, the expression of cyb561d2
Targeted delivery of miRNA therapeutics for cardiovascular diseases: opportunities and challenges.
Kwekkeboom, Rick F J; Lei, Zhiyong; Doevendans, Pieter A; Musters, René J P; Sluijter, Joost P G
2014-09-01
Dysregulation of miRNA expression has been associated with many cardiovascular diseases in animal models, as well as in patients. In the present review, we summarize recent findings on the role of miRNAs in cardiovascular diseases and discuss the opportunities, possibilities and challenges of using miRNAs as future therapeutic targets. Furthermore, we focus on the different approaches that can be used to deliver these newly developed miRNA therapeutics to their sites of action. Since siRNAs are structurally homologous with the miRNA therapeutics, important lessons learned from siRNA delivery strategies are discussed that might be applicable to targeted delivery of miRNA therapeutics, thereby reducing costs and potential side effects, and improving efficacy.
Novel Modeling of Combinatorial miRNA Targeting Identifies SNP with Potential Role in Bone Density
Coronnello, Claudia; Hartmaier, Ryan; Arora, Arshi; Huleihel, Luai; Pandit, Kusum V.; Bais, Abha S.; Butterworth, Michael; Kaminski, Naftali; Stormo, Gary D.; Oesterreich, Steffi; Benos, Panayiotis V.
2012-01-01
MicroRNAs (miRNAs) are post-transcriptional regulators that bind to their target mRNAs through base complementarity. Predicting miRNA targets is a challenging task and various studies showed that existing algorithms suffer from high number of false predictions and low to moderate overlap in their predictions. Until recently, very few algorithms considered the dynamic nature of the interactions, including the effect of less specific interactions, the miRNA expression level, and the effect of combinatorial miRNA binding. Addressing these issues can result in a more accurate miRNA:mRNA modeling with many applications, including efficient miRNA-related SNP evaluation. We present a novel thermodynamic model based on the Fermi-Dirac equation that incorporates miRNA expression in the prediction of target occupancy and we show that it improves the performance of two popular single miRNA target finders. Modeling combinatorial miRNA targeting is a natural extension of this model. Two other algorithms show improved prediction efficiency when combinatorial binding models were considered. ComiR (Combinatorial miRNA targeting), a novel algorithm we developed, incorporates the improved predictions of the four target finders into a single probabilistic score using ensemble learning. Combining target scores of multiple miRNAs using ComiR improves predictions over the naïve method for target combination. ComiR scoring scheme can be used for identification of SNPs affecting miRNA binding. As proof of principle, ComiR identified rs17737058 as disruptive to the miR-488-5p:NCOA1 interaction, which we confirmed in vitro. We also found rs17737058 to be significantly associated with decreased bone mineral density (BMD) in two independent cohorts indicating that the miR-488-5p/NCOA1 regulatory axis is likely critical in maintaining BMD in women. With increasing availability of comprehensive high-throughput datasets from patients ComiR is expected to become an essential tool for miRNA
Differential Expression of MicroRNA and Predicted Targets in Pulmonary Sarcoidosis
Crouser, Elliott D.; Julian, Mark W.; Crawford, Melissa; Shao, Guohong; Yu, Lianbo; Planck, Stephen R.; Rosenbaum, James T.; Nana-Sinkam, S. Patrick
2014-01-01
Background Recent studies show that various inflammatory diseases are regulated at the level of RNA translation by small non-coding RNAs, termed microRNAs (miRNAs). We sought to determine whether sarcoidosis tissues harbor a distinct pattern of miRNA expression and then considered their potential molecular targets. Methods and Results Genome-wide microarray analysis of miRNA expression in lung tissue and peripheral blood mononuclear cells (PBMCs) was performed and differentially expressed (DE)-miRNAs were then validated by real-time PCR. A distinct pattern of DE-miRNA expression was identified in both lung tissue and PBMCs of sarcoidosis patients. A subgroup of DE-miRNAs common to lung and lymph node tissues were predicted to target transforming growth factor (TGFβ)-regulated pathways. Likewise, the DE-miRNAs identified in PBMCs of sarcoidosis patients were predicted to target the TGFβ-regulated “wingless and integrase-1” (WNT) pathway. Conclusions This study is the first to profile miRNAs in sarcoidosis tissues and to consider their possible roles in disease pathogenesis. Our results suggest that miRNA regulate TGFβ and related WNT pathways in sarcoidosis tissues, pathways previously incriminated in the pathogenesis of sarcoidosis. PMID:22209793
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.
2016-01-01
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N
2016-02-26
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.
Exploiting CRISPR/Cas: Interference Mechanisms and Applications
Richter, Hagen; Randau, Lennart; Plagens, André
2013-01-01
The discovery of biological concepts can often provide a framework for the development of novel molecular tools, which can help us to further understand and manipulate life. One recent example is the elucidation of the prokaryotic adaptive immune system, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) that protects bacteria and archaea against viruses or conjugative plasmids. The immunity is based on small RNA molecules that are incorporated into versatile multi-domain proteins or protein complexes and specifically target viral nucleic acids via base complementarity. CRISPR/Cas interference machines are utilized to develop novel genome editing tools for different organisms. Here, we will review the latest progress in the elucidation and application of prokaryotic CRISPR/Cas systems and discuss possible future approaches to exploit the potential of these interference machineries. PMID:23857052
Exploiting CRISPR/Cas: interference mechanisms and applications.
Richter, Hagen; Randau, Lennart; Plagens, André
2013-07-12
The discovery of biological concepts can often provide a framework for the development of novel molecular tools, which can help us to further understand and manipulate life. One recent example is the elucidation of the prokaryotic adaptive immune system, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) that protects bacteria and archaea against viruses or conjugative plasmids. The immunity is based on small RNA molecules that are incorporated into versatile multi-domain proteins or protein complexes and specifically target viral nucleic acids via base complementarity. CRISPR/Cas interference machines are utilized to develop novel genome editing tools for different organisms. Here, we will review the latest progress in the elucidation and application of prokaryotic CRISPR/Cas systems and discuss possible future approaches to exploit the potential of these interference machineries.
Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei
2016-01-01
This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.
Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins
Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel
2010-01-01
The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585
Walker, William B; Allen, Margaret L
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.
Walker, William B.; Allen, Margaret L.
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205
Marovca, Blerim; Vonderheit, Andreas; Grotzer, Michael A.; Eckert, Cornelia; Cario, Gunnar; Wollscheid, Bernd; Horvath, Peter
2014-01-01
Interactions with the bone marrow microenvironment are essential for leukemia survival and disease progression. We developed an imaging-based RNAi platform to identify protective cues from bone marrow derived mesenchymal stromal cells (MSC) that promote survival of primary acute lymphoblastic leukemia (ALL) cells. Using a candidate gene approach, we detected distinct responses of individual ALL cases to RNA interference with stromal targets. The strongest effects were observed when interfering with solute carrier family 3 member 2 (SLC3A2) expression, which forms the cystine transporter xc− when associated with SLC7A11. Import of cystine and metabolism to cysteine by stromal cells provides the limiting substrate to generate and maintain glutathione in ALL. This metabolic interaction reduces oxidative stress in ALL cells that depend on stromal xc−. Indeed, cysteine depletion using cysteine dioxygenase resulted in leukemia cell death. Thus, functional evaluation of intercellular interactions between leukemia cells and their microenvironment identifies a selective dependency of ALL cells on stromal metabolism for a relevant subgroup of cases, providing new opportunities to develop more personalized approaches to leukemia treatment. PMID:25415224
USDA-ARS?s Scientific Manuscript database
Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...
Slattery, Martha L; Herrick, Jennifer S; Stevens, John R; Wolff, Roger K; Mullany, Lila E
2017-01-01
Determination of functional pathways regulated by microRNAs (miRNAs), while an essential step in developing therapeutics, is challenging. Some miRNAs have been studied extensively; others have limited information. In this study, we focus on 254 miRNAs previously identified as being associated with colorectal cancer and their database-identified validated target genes. We use RNA-Seq data to evaluate messenger RNA (mRNA) expression for 157 subjects who also had miRNA expression data. In the replication phase of the study, we replicated associations between 254 miRNAs associated with colorectal cancer and mRNA expression of database-identified target genes in normal colonic mucosa. In the discovery phase of the study, we evaluated expression of 18 miR-NAs (those with 20 or fewer database-identified target genes along with miR-21-5p, miR-215-5p, and miR-124-3p which have more than 500 database-identified target genes) with expression of 17 434 mRNAs to identify new targets in colon tissue. Seed region matches between miRNA and newly identified targeted mRNA were used to help determine direct miRNA-mRNA associations. From the replication of the 121 miRNAs that had at least 1 database-identified target gene using mRNA expression methods, 97.9% were expressed in normal colonic mucosa. Of the 8622 target miRNA-mRNA associations identified in the database, 2658 (30.2%) were associated with gene expression in normal colonic mucosa after adjusting for multiple comparisons. Of the 133 miRNAs with database-identified target genes by non-mRNA expression methods, 97.2% were expressed in normal colonic mucosa. After adjustment for multiple comparisons, 2416 miRNA-mRNA associations remained significant (19.8%). Results from the discovery phase based on detailed examination of 18 miRNAs identified more than 80 000 miRNA-mRNA associations that had not previously linked to the miRNA. Of these miRNA-mRNA associations, 15.6% and 14.8% had seed matches for CRCh38 and CRCh37
Hyodo, Kiwamu; Kaido, Masanori; Okuno, Tetsuro
2014-01-01
Many plant viruses have positive-strand RNA [(+)RNA] as their genome. Therefore, it is not surprising that RNA-binding proteins (RBPs) play important roles during (+)RNA virus infection in host plants. Increasing evidence demonstrates that viral and host RBPs play critical roles in multiple steps of the viral life cycle, including translation and replication of viral genomic RNAs, and their intra- and intercellular movement. Although studies focusing on the RNA-binding activities of viral and host proteins, and their associations with membrane targeting, and intercellular movement of viral genomes have been limited to a few viruses, these studies have provided important insights into the molecular mechanisms underlying the replication and movement of viral genomic RNAs. In this review, we briefly overview the currently defined roles of viral and host RBPs whose RNA-binding activity have been confirmed experimentally in association with their membrane targeting, and intercellular movement of plant RNA virus genomes. PMID:25071804
Nawaz, Ghazala; Kang, Hunseung
2017-01-01
The yields and productivity of crops are greatly diminished by various abiotic stresses, including drought, cold, heat, and high salinity. Chloroplasts and mitochondria are cellular organelles that can sense diverse environmental stimuli and alter gene expression to cope with adverse environmental stresses. Organellar gene expression is mainly regulated at posttranscriptional levels, including RNA processing, intron splicing, RNA editing, RNA turnover, and translational control, during which a variety of nucleus-encoded RNA-binding proteins (RBPs) are targeted to chloroplasts or mitochondria where they play essential roles in organellar RNA metabolism. DEAD-box RNA helicases (RHs) are enzymes that can alter RNA structures and affect RNA metabolism in all living organisms. Although a number of DEAD-box RHs have been found to play important roles in RNA metabolism in the nucleus and cytoplasm, our understanding on the roles of DEAD-box RHs in the regulation of RNA metabolism in chloroplasts and mitochondria is only at the beginning. Considering that organellar RNA metabolism and gene expression are tightly regulated by anterograde signaling from the nucleus, it is imperative to determine the functions of nucleus-encoded organellar RBPs. In this review, we summarize the emerging roles of nucleus-encoded chloroplast- or mitochondria-targeted DEAD-box RHs in organellar RNA metabolism and plant response to diverse abiotic stresses. PMID:28596782
PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences
Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří
2015-01-01
The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580
Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.
Goldfarb, Katherine C; Cech, Thomas R
2017-01-01
MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.
Moyle, Richard L.; Carvalhais, Lilia C.; Pretorius, Lara-Simone; Nowak, Ekaterina; Subramaniam, Gayathery; Dalton-Morgan, Jessica; Schenk, Peer M.
2017-01-01
Studies investigating the action of small RNAs on computationally predicted target genes require some form of experimental validation. Classical molecular methods of validating microRNA action on target genes are laborious, while approaches that tag predicted target sequences to qualitative reporter genes encounter technical limitations. The aim of this study was to address the challenge of experimentally validating large numbers of computationally predicted microRNA-target transcript interactions using an optimized, quantitative, cost-effective, and scalable approach. The presented method combines transient expression via agroinfiltration of Nicotiana benthamiana leaves with a quantitative dual luciferase reporter system, where firefly luciferase is used to report the microRNA-target sequence interaction and Renilla luciferase is used as an internal standard to normalize expression between replicates. We report the appropriate concentration of N. benthamiana leaf extracts and dilution factor to apply in order to avoid inhibition of firefly LUC activity. Furthermore, the optimal ratio of microRNA precursor expression construct to reporter construct and duration of the incubation period post-agroinfiltration were determined. The optimized dual luciferase assay provides an efficient, repeatable and scalable method to validate and quantify microRNA action on predicted target sequences. The optimized assay was used to validate five predicted targets of rice microRNA miR529b, with as few as six technical replicates. The assay can be extended to assess other small RNA-target sequence interactions, including assessing the functionality of an artificial miRNA or an RNAi construct on a targeted sequence. PMID:28979287
Cancer-targeting siRNA delivery from porous silicon nanoparticles.
Wan, Yuan; Apostolou, Sinoula; Dronov, Roman; Kuss, Bryone; Voelcker, Nicolas H
2014-10-01
Porous silicon nanoparticles (pSiNPs) with tunable pore size are biocompatible and biodegradable, suggesting that they are suitable biomaterials as vehicles for drug delivery. Loading of small interfering RNA (siRNA) into the pores of pSiNPs can protect siRNA from degradation as well as improve the cellular uptake. We aimed to deliver MRP1 siRNA loaded into pSiNPs to glioblastoma cells, and to demonstrate downregulation of MRP1 at the mRNA and protein levels. 50-220 nm pSiNPs with an average pore size of 26 nm were prepared, followed by electrostatic adsorption of siRNA into pores. Oligonucleotide loading and release profiles were investigated; MRP1 mRNA and protein expression, cell viability and cell apoptosis were studied. Approximately 7.7 µg of siRNA was loaded per mg of pSiNPs. Cells readily took up nanoparticles after 30 min incubation. siRNA-loaded pSiNPs were able to effectively downregulate target mRNA (~40%) and protein expression (31%), and induced cell apoptosis and necrosis (33%). siRNA loaded pSiNPs downregulated mRNA and protein expression and induced cell death. This novel siRNA delivery system may pave the way towards developing more effective tumor therapies.
StarScan: a web server for scanning small RNA targets from degradome sequencing data.
Liu, Shun; Li, Jun-Hao; Wu, Jie; Zhou, Ke-Ren; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu
2015-07-01
Endogenous small non-coding RNAs (sRNAs), including microRNAs, PIWI-interacting RNAs and small interfering RNAs, play important gene regulatory roles in animals and plants by pairing to the protein-coding and non-coding transcripts. However, computationally assigning these various sRNAs to their regulatory target genes remains technically challenging. Recently, a high-throughput degradome sequencing method was applied to identify biologically relevant sRNA cleavage sites. In this study, an integrated web-based tool, StarScan (sRNA target Scan), was developed for scanning sRNA targets using degradome sequencing data from 20 species. Given a sRNA sequence from plants or animals, our web server performs an ultrafast and exhaustive search for potential sRNA-target interactions in annotated and unannotated genomic regions. The interactions between small RNAs and target transcripts were further evaluated using a novel tool, alignScore. A novel tool, degradomeBinomTest, was developed to quantify the abundance of degradome fragments located at the 9-11th nucleotide from the sRNA 5' end. This is the first web server for discovering potential sRNA-mediated RNA cleavage events in plants and animals, which affords mechanistic insights into the regulatory roles of sRNAs. The StarScan web server is available at http://mirlab.sysu.edu.cn/starscan/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Identifying mRNA sequence elements for target recognition by human Argonaute proteins
Li, Jingjing; Kim, TaeHyung; Nutiu, Razvan; Ray, Debashish; Hughes, Timothy R.; Zhang, Zhaolei
2014-01-01
It is commonly known that mammalian microRNAs (miRNAs) guide the RNA-induced silencing complex (RISC) to target mRNAs through the seed-pairing rule. However, recent experiments that coimmunoprecipitate the Argonaute proteins (AGOs), the central catalytic component of RISC, have consistently revealed extensive AGO-associated mRNAs that lack seed complementarity with miRNAs. We herein test the hypothesis that AGO has its own binding preference within target mRNAs, independent of guide miRNAs. By systematically analyzing the data from in vivo cross-linking experiments with human AGOs, we have identified a structurally accessible and evolutionarily conserved region (∼10 nucleotides in length) that alone can accurately predict AGO–mRNA associations, independent of the presence of miRNA binding sites. Within this region, we further identified an enriched motif that was replicable on independent AGO-immunoprecipitation data sets. We used RNAcompete to enumerate the RNA-binding preference of human AGO2 to all possible 7-mer RNA sequences and validated the AGO motif in vitro. These findings reveal a novel function of AGOs as sequence-specific RNA-binding proteins, which may aid miRNAs in recognizing their targets with high specificity. PMID:24663241
Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.
Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha
2009-08-01
Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-01-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750
Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54
Chu, Chia-ying
2006-01-01
RNA interference is triggered by double-stranded RNA that is processed into small interfering RNAs (siRNAs) by Dicer enzyme. Endogenously, RNA interference triggers are created from small noncoding RNAs called microRNAs (miRNAs). RNA-induced silencing complexes (RISC) in human cells can be programmed by exogenously introduced siRNA or endogenously expressed miRNA. siRNA-programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA-induced silencing complexes (miRISC) inhibits translation by binding imperfectly matched sequences in the 3′ UTR of target mRNA. Both RISCs contain Argonaute2 (Ago2), which catalyzes target mRNA cleavage by siRISC and localizes to cytoplasmic mRNA processing bodies (P-bodies). Here, we show that RCK/p54, a DEAD box helicase, interacts with argonaute proteins, Ago1 and Ago2, in affinity-purified active siRISC or miRISC from human cells; directly interacts with Ago1 and Ago2 in vivo, facilitates formation of P-bodies, and is a general repressor of translation. Disrupting P-bodies by depleting Lsm1 did not affect RCK/p54 interactions with argonaute proteins and its function in miRNA-mediated translation repression. Depletion of RCK/p54 disrupted P-bodies and dispersed Ago2 throughout the cytoplasm but did not significantly affect siRNA-mediated RNA functions of RISC. Depleting RCK/p54 released general, miRNA-induced, and let-7-mediated translational repression. Therefore, we propose that translation repression is mediated by miRISC via RCK/p54 and its specificity is dictated by the miRNA sequence binding multiple copies of miRISC to complementary 3′ UTR sites in the target mRNA. These studies also suggest that translation suppression by miRISC does not require P-body structures, and location of miRISC to P-bodies is the consequence of translation repression. PMID:16756390
MicroRNA-mediated gene regulation: potential applications for plant genetic engineering.
Zhou, Man; Luo, Hong
2013-09-01
Food security is one of the most important issues challenging the world today. Any strategies to solve this problem must include increasing crop yields and quality. MicroRNA-based genetic modification technology (miRNA-based GM tech) can be one of the most promising solutions that contribute to agricultural productivity directly by developing superior crop cultivars with enhanced biotic and abiotic stress tolerance and increased biomass yields. Indirectly, the technology may increase usage of marginal soils and decrease pesticide use, among other benefits. This review highlights the most recent progress of transgenic studies utilizing various miRNAs and their targets for plant trait modifications, and analyzes the potential of miRNA-mediated gene regulation for use in crop improvement. Strategies for manipulating miRNAs and their targets in transgenic plants including constitutive, stress-induced, or tissue-specific expression of miRNAs or their targets, RNA interference, expressing miRNA-resistant target genes, artificial target mimic and artificial miRNAs were discussed. We also discussed potential risks of utilizing miRNA-based GM tech. In general, miRNAs and their targets not only provide an invaluable source of novel transgenes, but also inspire the development of several new GM strategies, allowing advances in breeding novel crop cultivars with agronomically useful characteristics.
Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.
Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong
2016-01-01
We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.
Current siRNA Targets in the Prevention and Treatment of Intimal Hyperplasia
Pradhan-Nabzdyk, Leena; Huang, Chenyu; LoGerfo, Frank W.; Nabzdyk, Christoph S.
2014-01-01
Intimal hyperplasia (IH) is the leading cause of late vein and prosthetic bypass graft failure. Injury at the time of graft implantation leading to the activation of endothelial cells and dedifferentiation of vascular smooth muscle cells to a synthetic phenotype are known causes of IH. Prior attempts to develop therapy to mitigate these cellular changes to prevent IH and graft failure have failed. Small interfering RNA (siRNA) mediated targeted gene silencing is a promising tool to prevent IH. Several studies have been performed in this direction to target genes that are involved in IH. In this review we discuss siRNA targets that are being investigated for prevention and treatment of IH. PMID:25227753
Prediction of microRNA target genes using an efficient genetic algorithm-based decision tree.
Rabiee-Ghahfarrokhi, Behzad; Rafiei, Fariba; Niknafs, Ali Akbar; Zamani, Behzad
2015-01-01
MicroRNAs (miRNAs) are small, non-coding RNA molecules that regulate gene expression in almost all plants and animals. They play an important role in key processes, such as proliferation, apoptosis, and pathogen-host interactions. Nevertheless, the mechanisms by which miRNAs act are not fully understood. The first step toward unraveling the function of a particular miRNA is the identification of its direct targets. This step has shown to be quite challenging in animals primarily because of incomplete complementarities between miRNA and target mRNAs. In recent years, the use of machine-learning techniques has greatly increased the prediction of miRNA targets, avoiding the need for costly and time-consuming experiments to achieve miRNA targets experimentally. Among the most important machine-learning algorithms are decision trees, which classify data based on extracted rules. In the present work, we used a genetic algorithm in combination with C4.5 decision tree for prediction of miRNA targets. We applied our proposed method to a validated human datasets. We nearly achieved 93.9% accuracy of classification, which could be related to the selection of best rules.
Prediction of microRNA target genes using an efficient genetic algorithm-based decision tree
Rabiee-Ghahfarrokhi, Behzad; Rafiei, Fariba; Niknafs, Ali Akbar; Zamani, Behzad
2015-01-01
MicroRNAs (miRNAs) are small, non-coding RNA molecules that regulate gene expression in almost all plants and animals. They play an important role in key processes, such as proliferation, apoptosis, and pathogen–host interactions. Nevertheless, the mechanisms by which miRNAs act are not fully understood. The first step toward unraveling the function of a particular miRNA is the identification of its direct targets. This step has shown to be quite challenging in animals primarily because of incomplete complementarities between miRNA and target mRNAs. In recent years, the use of machine-learning techniques has greatly increased the prediction of miRNA targets, avoiding the need for costly and time-consuming experiments to achieve miRNA targets experimentally. Among the most important machine-learning algorithms are decision trees, which classify data based on extracted rules. In the present work, we used a genetic algorithm in combination with C4.5 decision tree for prediction of miRNA targets. We applied our proposed method to a validated human datasets. We nearly achieved 93.9% accuracy of classification, which could be related to the selection of best rules. PMID:26649272
Reduction of bilirubin by targeting human heme oxygenase-1 through siRNA.
Xia, Zhen-Wei; Li, Chun-E; Jin, You-Xin; Shi, Yi; Xu, Li-Qing; Zhong, Wen-Wei; Li, Yun-Zhu; Yu, Shan-Chang; Zhang, Zi-Li
2007-04-01
Neonatal hyperbilirubinemia is a common clinical condition caused mainly by the increased production and decreased excretion of bilirubin. Current treatment is aimed at reducing the serum levels of bilirubin. Heme oxygenase-1 (HO-1) is a rate-limiting enzyme that generates bilirubin. In this study we intended to suppress HO-1 using the RNA interference technique. Small interfering RNA (siRNA)-A, -B, and -C were designed based on human HO-1 (hHO-1) mRNA sequences. siRNA was transfected into a human hepatic cell line (HL-7702). hHO-1 transcription and protein levels were then determined. In addition, the inhibitory effect of siRNA on hHO-1 was assessed in cells treated with hemin or transfected with an hHO-1 plasmid. siRNA-C showed the most potent suppressive effect on hHO-1. This inhibition is dose and time dependent. Compared with control, both hemin and hHO-1 plasmids up-regulated hHO-1 expression in HL-7702 cells. However, the up-regulation was significantly attenuated by siRNA-C. Furthermore, the decrease in hHO-1 activity was coincident with the suppression of its transcription. Finally, siRNA-C was shown to reduce hHO-1 enzymatic activity and bilirubin levels. Thus, this study provides a novel therapeutic rationale by blocking bilirubin formation via siRNA for preventing and treating neonatal hyperbilirubinemia and bilirubin encephalopathy at an early clinical stage.
Guide-bound structures of an RNA-targeting A-cleaving CRISPR-Cas13a enzyme
Knott, Gavin J.; East-Seletsky, Alexandra; Cofsky, Joshua C.; Holton, James M.; Charles, Emeric; O’Connell, Mitchell R.; Doudna, Jennifer A.
2018-01-01
CRISPR adaptive immune systems protect bacteria from infections by deploying CRISPR RNA (crRNA)-guided enzymes to recognize and cut foreign nucleic acids. Type VI-A CRISPR-Cas systems include the Cas13a enzyme, an RNA-activated ribonuclease (RNase) capable of crRNA processing and single-stranded RNA degradation upon target transcript binding. Here we present the 2.0 Å resolution crystal structure of a crRNA-bound L. bacterium Cas13a (LbaCas13a), representing a recently discovered Cas13a enzyme subtype. This structure and accompanying biochemical experiments define for the first time the Cas13a catalytic residues that are directly responsible for crRNA maturation. In addition, the orientation of the foreign-derived target RNA-specifying sequence in the protein interior explains the conformational gating of Cas13a nuclease activation. These results describe how Cas13a enzymes generate functional crRNAs and how catalytic activity is blocked prior to target RNA recognition, with implications for both bacterial immunity and diagnostic applications. PMID:28892041
Guide-bound structures of an RNA-targeting A-cleaving CRISPR–Cas13a enzyme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Knott, Gavin J.; East-Seletsky, Alexandra; Cofsky, Joshua C.
CRISPR adaptive immune systems protect bacteria from infections by deploying CRISPR RNA (crRNA)-guided enzymes to recognize and cut foreign nucleic acids. Type VI-A CRISPR–Cas systems include the Cas13a enzyme, an RNA-activated RNase capable of crRNA processing and single-stranded RNA degradation upon target-transcript binding. Here we present the 2.0-Å resolution crystal structure of a crRNA-bound Lachnospiraceae bacterium Cas13a (LbaCas13a), representing a recently discovered Cas13a enzyme subtype. This structure and accompanying biochemical experiments define the Cas13a catalytic residues that are directly responsible for crRNA maturation. In addition, the orientation of the foreign-derived target-RNA-specifying sequence in the protein interior explains the conformational gatingmore » of Cas13a nuclease activation. These results describe how Cas13a enzymes generate functional crRNAs and how catalytic activity is blocked before target-RNA recognition, with implications for both bacterial immunity and diagnostic applications.« less
Guide-bound structures of an RNA-targeting A-cleaving CRISPR–Cas13a enzyme
Knott, Gavin J.; East-Seletsky, Alexandra; Cofsky, Joshua C.; ...
2017-09-11
CRISPR adaptive immune systems protect bacteria from infections by deploying CRISPR RNA (crRNA)-guided enzymes to recognize and cut foreign nucleic acids. Type VI-A CRISPR–Cas systems include the Cas13a enzyme, an RNA-activated RNase capable of crRNA processing and single-stranded RNA degradation upon target-transcript binding. Here we present the 2.0-Å resolution crystal structure of a crRNA-bound Lachnospiraceae bacterium Cas13a (LbaCas13a), representing a recently discovered Cas13a enzyme subtype. This structure and accompanying biochemical experiments define the Cas13a catalytic residues that are directly responsible for crRNA maturation. In addition, the orientation of the foreign-derived target-RNA-specifying sequence in the protein interior explains the conformational gatingmore » of Cas13a nuclease activation. These results describe how Cas13a enzymes generate functional crRNAs and how catalytic activity is blocked before target-RNA recognition, with implications for both bacterial immunity and diagnostic applications.« less
Fang, Lingzhao; Sørensen, Peter; Sahana, Goutam; Panitz, Frank; Su, Guosheng; Zhang, Shengli; Yu, Ying; Li, Bingjie; Ma, Li; Liu, George; Lund, Mogens Sandø; Thomsen, Bo
2018-06-19
MicroRNAs (miRNA) are key modulators of gene expression and so act as putative fine-tuners of complex phenotypes. Here, we hypothesized that causal variants of complex traits are enriched in miRNAs and miRNA-target networks. First, we conducted a genome-wide association study (GWAS) for seven functional and milk production traits using imputed sequence variants (13~15 million) and >10,000 animals from three dairy cattle breeds, i.e., Holstein (HOL), Nordic red cattle (RDC) and Jersey (JER). Second, we analyzed for enrichments of association signals in miRNAs and their miRNA-target networks. Our results demonstrated that genomic regions harboring miRNA genes were significantly (P < 0.05) enriched with GWAS signals for milk production traits and mastitis, and that enrichments within miRNA-target gene networks were significantly higher than in random gene-sets for the majority of traits. Furthermore, most between-trait and across-breed correlations of enrichments with miRNA-target networks were significantly greater than with random gene-sets, suggesting pleiotropic effects of miRNAs. Intriguingly, genes that were differentially expressed in response to mammary gland infections were significantly enriched in the miRNA-target networks associated with mastitis. All these findings were consistent across three breeds. Collectively, our observations demonstrate the importance of miRNAs and their targets for the expression of complex traits.
Lee, Soo Hyeon; Chung, Bong Hyun; Park, Tae Gwan; Nam, Yoon Sung; Mok, Hyejung
2012-07-17
Because of RNA's ability to encode structure and functional information, researchers have fabricated diverse geometric structures from this polymer at the micro- and nanoscale. With their tunable structures, rigidity, and biocompatibility, novel two-dimensional and three-dimensional RNA structures can serve as a fundamental platform for biomedical applications, including engineered tissues, biosensors, and drug delivery vehicles. The discovery of the potential of small-interfering RNA (siRNA) has underscored the applications of RNA-based micro- and nanostructures in medicine. Small-interfering RNA (siRNA), synthetic double-stranded RNA consisting of approximately 21 base pairs, suppresses problematic target genes in a sequence-specific manner via inherent RNA interference (RNAi) processing. As a result, siRNA offers a potential strategy for treatment of many human diseases. However, due to inefficient delivery to cells and off-target effects, the clinical application of therapeutic siRNA has been very challenging. To address these issues, researchers have studied a variety of nanocarrier systems for siRNA delivery. In this Account, we describe several strategies for efficient siRNA delivery and selective gene silencing. We took advantage of facile chemical conjugation and complementary hybridization to design novel siRNA-based micro- and nanostructures. Using chemical crosslinkers and hydrophobic/hydrophilic polymers at the end of siRNA, we produced various RNA-based structures, including siRNA block copolymers, micelles, linear siRNA homopolymers, and microhydrogels. Because of their increased charge density and flexibility compared with conventional siRNA, these micro- and nanostructures can form polyelectrolyte complexes with poorly charged and biocompatible cationic carriers that are both more condensed and more homogenous than the complexes formed in other carrier systems. In addition, the fabricated siRNA-based structures are linked by cleavable disulfide
Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T
2018-04-17
In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA
ATRX Directs Binding of PRC2 to Xist RNA and Polycomb Targets
Sarma, Kavitha; Cifuentes-Rojas, Catherine; Ergun, Ayla; del Rosario, Amanda; Jeon, Yesu; White, Forest; Sadreyev, Ruslan; Lee, Jeannie T.
2015-01-01
SUMMARY X chromosome inactivation (XCI) depends on the long noncoding RNA Xist and its recruitment of Polycomb Repressive Complex 2 (PRC2). PRC2 is also targeted to other sites throughout the genome to effect transcriptional repression. Using XCI as a model, we apply an unbiased proteomics approach to isolate Xist and PRC2 regulators and identified ATRX. ATRX unexpectedly functions as a high-affinity RNA-binding protein that directly interacts with RepA/Xist RNA to promote loading of PRC2 in vivo. Without ATRX, PRC2 cannot load onto Xist RNA nor spread in cis along the X chromosome. Moreover, epigenomic profiling reveals that genome-wide targeting of PRC2 depends on ATRX, as loss of ATRX leads to spatial redistribution of PRC2 and derepression of Polycomb responsive genes. Thus, ATRX is a required specificity determinant for PRC2 targeting and function. PMID:25417162
Targeted delivery of siRNA to macrophages for anti-inflammatory treatment.
Kim, Sang-Soo; Ye, Chunting; Kumar, Priti; Chiu, Isaac; Subramanya, Sandesh; Wu, Haoquan; Shankar, Premlata; Manjunath, N
2010-05-01
Inflammation mediated by tumor necrosis factor-alpha (TNF-alpha) and the associated neuronal apoptosis characterizes a number of neurologic disorders. Macrophages and microglial cells are believed to be the major source of TNF-alpha in the central nervous system (CNS). Here, we show that suppression of TNF-alpha by targeted delivery of small interfering RNA (siRNA) to macrophage/microglial cells dramatically reduces lipopolysaccharide (LPS)-induced neuroinflammation and neuronal apoptosis in vivo. Because macrophage/microglia express the nicotinic acetylcholine receptor (AchR) on their surface, we used a short AchR-binding peptide derived from the rabies virus glycoprotein (RVG) as a targeting ligand. This peptide was fused to nona-D-arginine residues (RVG-9dR) to enable siRNA binding. RVG-9dR was able to deliver siRNA to induce gene silencing in macrophages and microglia cells from wild type, but not AchR-deficient mice, confirming targeting specificity. Treatment with anti-TNF-alpha siRNA complexed to RVG-9dR achieved efficient silencing of LPS-induced TNF-alpha production by primary macrophages and microglia cells in vitro. Moreover, intravenous injection with RVG-9dR-complexed siRNA in mice reduced the LPS-induced TNF-alpha levels in blood as well as in the brain, leading to a significant reduction in neuronal apoptosis. These results demonstrate that RVG-9dR provides a tool for siRNA delivery to macrophages and microglia and that suppression of TNF-alpha can potentially be used to suppress neuroinflammation in vivo.
2016-09-07
sequences of the target mRNA, and a double stranded stem at the 5′ end that forms a stem -loop to function as a forceps to stabilize the secondary...E-mjournal homepage: www.elsevier.com/locate/bbrepDetection of siRNA-mediated target mRNA cleavage activities in human cells by a novel stem -loop...challenges for the accurate and efficient detection and verification of cleavage sites on target mRNAs. Here we used a sensitive stem -loop array reverse
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-05-23
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
Effects of RNA interference therapy against herpes simplex virus type 1 encephalitis.
da Silva, Alexandre S; Raposo, Jéssica V; Pereira, Tiago C; Pinto, Marcelo A; de Paula, Vanessa S
2016-01-01
Herpetic encephalitis (HSE) is caused mainly by herpes simplex virus type 1 (HSV-1) with an annual incidence of 1-4 cases/million inhabitants. Currently, HSE treatment faces difficulties such as the use of antivirals with elevated toxicity, metabolic side effects and HSV-1 resistance. An alternative to antivirals is the use of small interfering RNA (siRNA) as a viral replication inhibitor. In this work, siRNA targeting the UL-39 region was evaluated for HSE treatment in vivo. BALB/c mice were inoculated with HSV-1 and treated with siRNA. The treatment was evaluated through kinetics of HSV-1 replication inhibition, number of siRNA doses administered and treatment with siRNA plus acyclovir. All groups were evaluated for signs of HSE, mortality and HSV-1 replication inhibition. The treated group of the kinetic experiment demonstrated a reduction of HSE signs and an HSV-1 replication inhibition of 43.6-99.9% in the brain and 53-98% in trigeminal ganglia (TG). Animals treated with one or two doses of siRNA had a prolonged survival time, reduced clinical signs of HSE and HSV-1 replication inhibition of 67.7% in brains and 85.7% in TG of animals treated with two doses of siRNA. Also, animals treated with siRNA plus acyclovir demonstrated reduced signs of HSE and mortality, as well as HSV-1 replication inhibition in the brain (83.2%) and TG (74.5%). These findings demonstrated that siRNA was capable of reducing HSE clinical signs, prolonging survival time and inhibiting HSV-1 replication in mice. Thus, siRNA can be a potential alternative to the standard HSE treatment especially to reduce clinical signs and extend survival time in vivo.