Sample records for tc triglycerides tg

  1. A case-control study of apoA5 -1131T-->C polymorphism that examines the role of triglyceride levels in diabetic nephropathy.

    PubMed

    Baum, Larry; Ng, Maggie C Y; So, Wing-Yee; Poon, Emily; Wang, Ying; Lam, Vincent K L; Tomlinson, Brian; Chan, Juliana C N

    2007-01-01

    Patients with diabetic nephropathy (DN) have increased plasma fasting triglyceride (TG) levels, and most prospective studies report that elevated TG precedes DN. TG-rich lipoprotein particles might promote progression of DN. To test the hypothesis that elevated TG levels contribute to the development of DN, one may examine whether a polymorphism strongly associated with TG levels affects DN risk. The apolipoprotein A5 (apoA5) -1131T-->C polymorphism has a large effect on the TG level, and all three genotypes are relatively common in East Asians. Therefore, we sought to examine the association of this polymorphism with DN. We genotyped the apoA5 -1131T-->C polymorphism in a case-control study involving 367 Chinese Type 2 diabetes patients with DN and 382 without DN, as well as 198 subjects without diabetes. Mean fasting TG levels were higher in CC than in TT carriers by 41%, 54%, and 62% in each of the three subject groups, respectively. However, the genotype distributions did not differ between patients with and without nephropathy (P=.69). Therefore, these results weigh against the hypothesis that high fasting TG per se causes DN. The strong association between TG level and DN may be due to a factor that is usually closely linked to TG level but that is not affected by the apoA5 polymorphism.

  2. Elevated levels of triglyceride and triglyceride-rich lipoprotein triglyceride induced by a high-carbohydrate diet is associated with polymorphisms of APOA5-1131T>C and APOC3-482C>T in Chinese healthy young adults.

    PubMed

    Lin, Jia; Fang, Ding Zhi; Du, Juan; Shigdar, Sarah; Xiao, Li Ying; Zhou, Xue Dong; Duan, Wei

    2011-01-01

    Changes in lipid profiles have been shown to be associated with diet and apolipoprotein (APO) polymorphisms. Therefore, 2 polymorphisms, i.e. APOA5-1131T>C and APOC3-482C>T, and serum lipids were examined in a Chinese healthy young population with high-carbohydrate/low-fat (HC/LF) diet intervention. After a wash-out diet for 7 days, 56 young adults (22.89 ± 1.80 years) received the HC/LF diet for 6 days. Body mass index (BMI) and fasting serum lipid profiles at baseline, after the wash-out diet, and after the HC/LF diet were measured. APOA5-1131C carriers had higher triglyceride (TG) and TG-rich lipoprotein TG (TRL-TG) levels at baseline and after the HC/LF diet, though this mainly corresponded to the female cohort. APOC3-482T carriers had higher TRL-TG levels following the wash-out and HC/LF diets, but these were not directly attributable to a single gender. Both polymorphisms may play an important role in the elevated TG and TRL-TG levels induced by the HC/LF diet, especially in females, thus indicating a potential dietary prevention of coronary heart disease in this Chinese cohort. Copyright © 2011 S. Karger AG, Basel.

  3. Serum total cholesterol and triglycerides levels in patients with lung cancer.

    PubMed

    Siemianowicz, K; Gminski, J; Stajszczyk, M; Wojakowski, W; Goss, M; Machalski, M; Telega, A; Brulinski, K; Magiera-Molendowska, H

    2000-02-01

    Epidemiological studies indicate that low serum total cholesterol level may increase the risk of death due to cancer, mainly lung cancer. The aim of our study was to evaluate serum levels of total cholesterol (TC) and triglycerides (TG) in patients with squamous cell and small cell lung cancer and their dependence on the histological type and the clinical stage of the neoplasm. Lung cancer patients (n=135) and healthy controls (n=39) entered the study. All lung cancer patients had higher rate of hypocholesterolemia and lower TC and TG levels than the control group. TC concentration was lower in lung cancer patients and in both histological types in comparison with the control group, TG level was lower only in patients with squamous cell lung cancer. There were no statistically significant differences of TC and TG levels between the histological types, or between the clinical stages of each histological type.

  4. The levels of triglyceride and total cholesterol in methamphetamine dependence.

    PubMed

    Zhang, Meijuan; Lv, Dezhao; Zhou, Wu; Ji, Lili; Zhou, Beibei; Chen, Han; Gu, Yingying; Zhao, Jiyun; He, Jincai

    2017-04-01

    The serum triglyceride (TG) and total cholesterol (TC) levels have been reported altered in the traditional drug-dependence (such as marijuana and heroin). However, studies assessing the relationships among serum TC, TG, and methamphetamine (MA)-dependence have not been described well. In this study, our aim is to explore the serum TG and TC levels in large sample of MA-dependent patients. A retrospective study was conducted in 938 MA-dependent patients who were recruited between February 2, 2008 and March 11, 2013, with social characteristics and drug-dependence history (duration of MA use, routes of drug administration, and daily dose were collected). Then, the serum levels of TC, TG, glucose (GLU), body mass index (BMI), and blood pressure were measured among the participants. Meanwhile, 985 age- and gender-matched healthy people in the physical examination center were selected as control group. Compared with the control group, significant decreases of TC, TG, GLU, and BMI were observed in MA-dependent patients (P < 0.05). Besides, we found that the daily dose of MA use was associated with TC (β = -0.079, P = 0.015) and the duration of MA use was independently related to BMI (β = -0.071, P = 0.031). This study demonstrated that the levels of TC, TG, GLU, and BMI factors altered in the MA-dependent patients. In addition, there is a negative association between MA dependence and TC and BMI.

  5. Waist-to-height ratio (WHtR) and triglyceride to HDL-C ratio (TG/HDL-c) as predictors of cardiometabolic risk.

    PubMed

    Weiler Miralles, Clara Silvana; Wollinger, Luana Maria; Marin, Débora; Genro, Julia Pasqualini; Contini, Veronica; Morelo Dal Bosco, Simone

    2015-05-01

    The excessive concentration of fat in the abdominal region is related to a higher risk of developing cardiovascular disease (CVD). Studies have been performed to identify simple and effective indicators of abdominal obesity and associated cardiometabolic risk through the use of simple parameters such as anthropometric and biochemical measures. The Triglyceride / High-density Lipoprotein Cholesterol (TG/HDL-c) has been proposed as a more practical and easy to use atherogenic marker, along with the Waist-to-Height Ratio (WHtR), which makes a superior tool for separating cardiometabolic risk related to overweight/obesity when comparing to Body Mass Index (BMI). To verify the applicability of the WHtR and the TG/HDL-c ratio as predictors of cardiometabolic risk. This cross-sectional study was performed at the Department of Nutrition of the UNIVATES University Center, where the participant's anthropometric and biochemical data were collected. Statistical analysis was performed by the Statistical Package for the Social Sciences software (SPSS) 20.0, with a significance level of 5% (p < 0.05). A total of 498 individuals took part on this research, 77.5% female and with a mean age of 25.5 ± 6.5. A high percentage of fat was found in both men and women (19.9 ± 5.80% and 29.24 ± 5.43%, respectively). The prevalence of overweight/obesity (BMI ≥ 25Kg/m(2)) was 35.05%. The WHtR marker was significantly correlated to Low-density Lipoprotein Cholesterol (LDL-c), Triglyceride (TG) and Anthropometric BMI values, waist circumference (WC) and body fat percentage (BF%). For the TG/HDL-c ratio, there was a positive and significant correlation to the same markers, beyond TC. There was also a correlation between WHtR and TG/HDL-c, and both presented a negative and significant correlation with HDL-c. WHtR and TG/HDL-c values were found to be good markers for the cardiometabolic risk ratio in the studied sample. Several studies, original articles and academic reviews confirm the use

  6. Assessment of triglyceride and cholesterol in overweight people based on multiple linear regression and artificial intelligence model.

    PubMed

    Ma, Jing; Yu, Jiong; Hao, Guangshu; Wang, Dan; Sun, Yanni; Lu, Jianxin; Cao, Hongcui; Lin, Feiyan

    2017-02-20

    The prevalence of high hyperlipemia is increasing around the world. Our aims are to analyze the relationship of triglyceride (TG) and cholesterol (TC) with indexes of liver function and kidney function, and to develop a prediction model of TG, TC in overweight people. A total of 302 adult healthy subjects and 273 overweight subjects were enrolled in this study. The levels of fasting indexes of TG (fs-TG), TC (fs-TC), blood glucose, liver function, and kidney function were measured and analyzed by correlation analysis and multiple linear regression (MRL). The back propagation artificial neural network (BP-ANN) was applied to develop prediction models of fs-TG and fs-TC. The results showed there was significant difference in biochemical indexes between healthy people and overweight people. The correlation analysis showed fs-TG was related to weight, height, blood glucose, and indexes of liver and kidney function; while fs-TC was correlated with age, indexes of liver function (P < 0.01). The MRL analysis indicated regression equations of fs-TG and fs-TC both had statistic significant (P < 0.01) when included independent indexes. The BP-ANN model of fs-TG reached training goal at 59 epoch, while fs-TC model achieved high prediction accuracy after training 1000 epoch. In conclusions, there was high relationship of fs-TG and fs-TC with weight, height, age, blood glucose, indexes of liver function and kidney function. Based on related variables, the indexes of fs-TG and fs-TC can be predicted by BP-ANN models in overweight people.

  7. Long-chain fatty acid triglyceride (TG) metabolism disorder impairs male fertility: a study using adipose triglyceride lipase deficient mice.

    PubMed

    Masaki, Hidetake; Kim, Namhyo; Nakamura, Hitomi; Kumasawa, Keiichi; Kamata, Eriko; Hirano, Ken-Ichi; Kimura, Tadashi

    2017-07-01

    Does the deletion of adipose triglyceride lipase (Atgl) gene impair male fertility? The deletion of Atgl gene impaired male fertility but the effect was partially reversed by a low long-chain triglyceride (TG) diet. ATGL specifically hydrolyses long-chain fatty acid TG to diacylglycerol and a high level of expression of ATGL in testes has been reported. However, the role of ATGL in male fertility is unknown. To investigate the effect of deletion of Atgl gene on male fertility, cauda epididymides and testes were collected from wild-type, heterozygous and homozygous Atgl-deficient mice at 10 weeks of age and epididymal sperm analysis and histological analysis of the testes were performed. To investigate whether a medium-chain triglycerides (MCTs) replacement diet mitigated the impaired male fertility by deletion of Atgl gene, homozygous Atgl-deficient mice were fed a MCT replacement diet, or a standard diet including long-chain triglycerides (LCTs) in a control group, for 6 weeks from 5 weeks of age (n = 22). The systematic and local effects of the MCT replacement diet on spermatogenesis and sperm maturation in the epididymis were analyzed at 10 weeks of age. Hematoxylin and eosin staining in paraffin-embedded sections of testes and Oil Red O staining in frozen sections of testes were performed. The epididymal sperm concentrations were analyzed. Statistical analyses were performed using the Student's t-test or Mann-Whitney U test with Shapiro-Wilk Normality test. Although heterozygous mice were fertile and showed a similar number of epididymal total and motile sperm concentrations to wild-type mice, the deletion of Atgl gene in homozygous mice led to accumulation of TG deposits in testes and impaired spermatogenesis. The deletion of Atgl gene also impaired the sperm maturation process required for sperm to acquire the ability to move forward in the epididymis. The MCT replacement diet for 6 weeks increased the plasma level of non-esterified fatty acid (NEFA) (1

  8. A single nucleotide polymorphism -1131T>C in the apolipoprotein A5 gene is associated with an increased risk of coronary artery disease and alters triglyceride metabolism in Chinese.

    PubMed

    Bi, Nan; Yan, Sheng-kai; Li, Guo-ping; Yin, Zhi-nong; Chen, Bao-sheng

    2004-11-01

    The disorder of triglyceride (TG) metabolism leading to hypertriglyceridemia is an independent risk factor for coronary artery disease (CAD). Variants in the newly identified apolipoprotein APOA5 gene were found to be strongly associated with elevated TG levels in different racial groups. In this study, we investigated the phenotypic effects of two polymorphisms (APOA5-1131T>C and APOC3-482C>T) on susceptibility to CAD in 312 Chinese CAD patients diagnosed by angiography. The frequency of the APOA5-1131C allele in these patients was significantly higher than that of the control group (39.9 vs. 33.3%, P=0.02). Compared with the wild type TT, CC homozygotes had a significantly increased CAD risk (OR=1.93 and OR=1.80 using unadjusted and adjusted logistic regression models, respectively). This association still existed after adjustment for the APOC3-482 variant. The APOA5-1131C allele also showed a correlation with increasing plasma TG levels (P<0.001). These data suggest that the APOA5-1131T>C polymorphism might contribute to an increased risk of CAD among Chinese as a result of its effect on TG metabolism; this effect was found to be independent of the APOC3-482C>T variant.

  9. The triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio as a predictor of insulin resistance but not of β cell function in a Chinese population with different glucose tolerance status.

    PubMed

    Zhou, Meicen; Zhu, Lixin; Cui, Xiangli; Feng, Linbo; Zhao, Xuefeng; He, Shuli; Ping, Fan; Li, Wei; Li, Yuxiu

    2016-06-07

    Triglyceride/high-density lipoprotein-cholesterol (TG/HDL-C) ratio was a surrogate marker of IR; however, the relationship of TG/HDL-C with IR might vary by ethnicity. This study aims to investigate whether lipid ratios-TG/HDL-C, cholesterol/high-density lipoprotein-cholesterol (TC/HDL-C) ratio, low-density lipoprotein-cholesterol/high-density lipoprotein-cholesterol (LDL-C/HDL-C)) could be potential clinical markers of insulin resistance (IR) and β cell function and further to explore the optimal cut-offs in a Chinese population with different levels of glucose tolerance. Four hundred seventy-nine subjects without a history of diabetes underwent a 75 g 2 h Oral Glucose Tolerance Test (OGTT). New-onset diabetes (n = 101), pre-diabetes (n = 186), and normal glucose tolerance (n = 192) were screened. IR was defined by HOMA-IR > 2.69. Based on indices (HOMA-β, early-phase disposition index [DI30], (ΔIns30/ΔGlu30)/HOMA-IR and total-phase index [DI120]) that indicated different phases of insulin secretion, the subjects were divided into two groups, and the lower group was defined as having inadequate β cell compensation. Logistic regression models and accurate estimates of the areas under receiver operating characteristic curves (AUROC) were obtained. In all of the subjects, TG/HDL, TC/HDL-C, LDL-C/HDL-C, and TG were significantly associated with IR. The AUROCs of TG/HDL-C and TG were 0.71 (95 % CI: 0.66-0.75) and 0.71 (95 % CI: 0.65-0.75), respectively. The optimal cut-offs of TG/HDL-C and TG for IR diagnosis were 1.11 and 1.33 mmol/L, respectively. The AUROCs of TC/HDL-C and LDL-C/HDL-C were 0.66 and 0.65, respectively, but they were not acceptable for IR diagnosis. TG/HDL-C,LDL-C/HDL-C and TG were significantly associated with HOMA-β, but AUROCs were less than 0.50; therefore, the lipid ratios could not be predictors of basal β cell dysfunction. None of the lipid ratios was associated with early-phase insulin secretion. Only TG/HDL-C and

  10. APOA5-1131T>C genotype effects on apolipoprotein A5 and triglyceride levels in response to dietary intervention and regular exercise (DIRE) in hypertriglyceridemic subjects.

    PubMed

    Jang, Yangsoo; Chae, Jey Sook; Kim, Oh Yoen; Park, Hey Jun; Kim, Ji Young; Paik, Jean Kyung; Lee, Sang-Hyun; Lee, Jong Ho

    2010-08-01

    We aimed to determine the influence of apolipoprotein A5 gene (APOA5)-1131T>C single nucleotide polymorphism on the effects of dietary intervention and regular exercise (DIRE) targeting ApoA5 and triglyceride (TG) concentrations. Hypertriglyceridemia patients (TG, 150-500mg/dL, n=283) undertook a 12-week DIRE (replacing 1/3 of refined rice in their diets with legumes, increasing vegetable intake, and regular walking). Pre-treatment, no genotype-related differences were detected in ApoA5, TG, or HDL cholesterol levels; however, post-treatment, subjects homozygous (T/T) for the T allele had lower serum TG (P=0.009) and higher HDL cholesterol (P=0.036) than other subjects. In T/T subjects, after adjustments for age, sex and weight changes (r1) or initial TG levels (r2), changes in ApoA5 levels negatively correlated with TG changes (r1=-0.29, P=0.05, r2=-0.28, P<0.1) and positively correlated with changes in HDL cholesterol (r1=0.30, P<0.05, r2=0.32, P<0.05) and free fatty acid (r1=0.38, P<0.01, r2=0.40, P<0.01). In those with moderate hypertriglyceridemia (TG, 200-500mg/dL, n=130), APOA5-1131T/T carriers achieved significantly lower TG (P=0.007) and higher HDL cholesterol (P<0.001) than -1131C allele carriers. Additionally, statistically significant interactions between the -1131T>C and the compliance of DIRE were found for the change in TG (P=0.002) and HDL cholesterol (P=0.039). In good compliance group, T/T subjects showed greater reduction of TG and higher increase of HDL cholesterol than other subjects. On the other hand, non-good compliance group had no significant improvement in these variables. APOA5-1131T/T carriers may benefit more from the DIRE than C allele carriers. These effects were remarkable in patients with moderate hypertriglyceridemia and the individuals with good compliance. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  11. APOE Modulates the Correlation Between Triglycerides, Cholesterol, and CHD Through Pleiotropy, and Gene-by-Gene Interactions

    PubMed Central

    Maxwell, Taylor J.; Ballantyne, Christie M.; Cheverud, James M.; Guild, Cameron S.; Ndumele, Chiadi E.; Boerwinkle, Eric

    2013-01-01

    Relationship loci (rQTL) exist when the correlation between multiple traits varies by genotype. rQTL often occur due to gene-by-gene (G × G) or gene-by-environmental interactions, making them a powerful tool for detecting G × G. Here we present an empirical analysis of apolipoprotein E (APOE) with respect to lipid traits and incident CHD leading to the discovery of loci that interact with APOE to affect these traits. We found that the relationship between total cholesterol (TC) and triglycerides (ln TG) varies by APOE isoform genotype in African-American (AA) and European-American (EA) populations. The e2 allele is associated with strong correlation between ln TG and TC while the e4 allele leads to little or no correlation. This led to a priori hypotheses that APOE genotypes affect the relationship of TC and/or ln TG with incident CHD. We found that APOE*TC was significant (P = 0.016) for AA but not EA while APOE*ln TG was significant for EA (P = 0.027) but not AA. In both cases, e2e2 and e2e3 had strong relationships between TC and ln TG with CHD while e2e4 and e4e4 results in little or no relationship between TC and ln TG with CHD. Using ARIC GWAS data, scans for loci that significantly interact with APOE produced four loci for African Americans (one CHD, one TC, and two HDL). These interactions contribute to the rQTL pattern. rQTL are a powerful tool to identify loci that modify the relationship between risk factors and disease and substantially increase statistical power for detecting G × G. PMID:24097412

  12. Nonalcoholic fatty liver disease severity is associated with the ratios of total cholesterol and triglycerides to high-density lipoprotein cholesterol.

    PubMed

    Wu, Kuan-Ta; Kuo, Po-Lin; Su, Shih-Bin; Chen, Yi-Yu; Yeh, Ming-Lum; Huang, Ching-I; Yang, Jeng-Fu; Lin, Chia-I; Hsieh, Meng-Hsuan; Hsieh, Ming-Yen; Huang, Chung-Feng; Lin, Wen-Yi; Yu, Ming-Lung; Dai, Chia-Yen; Wang, Hsien-Yi

    2016-01-01

    Limited data support the notion that lipid ratios are risk factors for nonalcoholic fatty liver disease (NAFLD). We evaluated the association between lipid ratios and NAFLD. This was a large population, cross-sectional, retrospective study. Data on NAFLD severity, blood pressure, fasting glucose, total cholesterol (TC), triglyceride (TG), and high-density lipoprotein cholesterol (HDL-C) levels were obtained from 44,767 examinees at single health checkup center. The enrollees were stratified into four subgroups based on their TC/HDL-C and TG/HDL-C ratios. We used multivariate analyses to evaluate the odds between lipid ratios and NAFLD. The prevalence rate of fatty liver in this study was 53.76%. In the baseline subgroup with the lowest TC/HDL-C and TG/HDL-C ratios, the prevalence of NAFLD, hypertension, and diabetes was lower than that of the other three subgroups. Patients with higher lipid ratios had a significantly greater risk for advanced NAFLD. Adults with high TC/HDL-C or TG/HDL-C ratios, or both, have a greater risk for NAFLD, especially advanced NAFLD. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  13. Association of triglycerides and new lipid markers with the incidence of hypertension in a Spanish cohort.

    PubMed

    Sánchez-Íñigo, Laura; Navarro-González, David; Pastrana-Delgado, Juan; Fernández-Montero, Alejandro; Martínez, J Alfredo

    2016-07-01

    Triglycerides and high-density lipoprotein cholesterol (HDL-C) are known to be risk factors for cardiovascular disease. However, there has been limited knowledge on the relationship between triglycerides and incident hypertension. The associations of incident hypertension with triglycerides and triglycerides-related indices such as triglycerides to HDL-C ratio (TG/HDL-C) and triglyceride-glucose index (TyG) were evaluated. Data from 3637 participants from the Vascular Metabolic Clinica Universidad Navarra cohort were followed-up during a mean of 8.49 years. A Cox proportional hazard ratio with repeated measures analyses was performed to assess the risk of developing hypertension across the quintiles of triglycerides, TG/HDL-C ratio, and TyG index. The risk of developing hypertension was 47% and 73% greater for those in the fourth and fifth quintiles of triglycerides, after adjusting for age, sex, BMI, cigarette smoking, daily alcohol intake, lifestyle pattern, type 2 diabetes, antiaggregation therapy, low-density lipoprotein cholesterol, SBP, and DBP. In men, those in the top quintile of triglycerides, TG/HDL-C ratio or TyG index were two times more likely to develop hypertension than those in the bottom quintile. In women, the effect was attenuated although the risk of hypertension rose with increasing quintiles (P for trend <0.05). The results were consistent when analyses were restricted to those participants without diabetes and obesity at baseline. Our results evidenced the associations between triglycerides-related variables and incident hypertension independently of adiposity. This association was stronger than those observed for other commonly used lipid parameters or lipid ratios, such as the TC/HDL-C ratio. : http://links.lww.com/HJH/A620.

  14. Triglycerides Test

    MedlinePlus

    ... Other names for a triglycerides test: TG, TRIG, lipid panel, fasting lipoprotein panel What is it used ... A triglycerides test is usually part of a lipid profile. Lipid is another word for fat. A ...

  15. Association of Serum Triglyceride Level and Gemfibrozil Consumption With Periodontal Status.

    PubMed

    Sayar, Ferena; Akhondi, Nasrin; Fallah, Soltanali; Moalemnia, Amir Abbas; Cheraghi, Azra

    2017-05-01

    Hyperlipidemia is a major risk factor for cardiovascular diseases. Considering the suggested association between periodontal and cardiovascular diseases, this study sought to assess the association, if any, between serum triglyceride (TG) levels and gemfibrozil consumption with periodontal parameters. This cross-sectional study was conducted on 90 participants, including 30 individuals with a normal lipid profile (group H), 30 patients with hypertriglyceridemia and not on medication (group N), and 30 patients with hypertriglyceridemia and taking gemfibrozil over a 3-month period (group M). Periodontal parameters including probing depth (PD), clinical attachment level (CAL), bleeding on probing (BOP), and plaque index were measured at four sites of each tooth. Serum levels of total cholesterol (TC), TG, low-density lipoprotein, and high-density lipoprotein were measured. Mean values for PD and CAL in the two hypertriglyceridemic groups were significantly higher than those of the H group (P <0.001). After controlling for confounding variables, significant linear correlations were noted between PD and BOP, PD and TC, PD and TG, and CAL and TG in each group (P <0.01). Patients with hypertriglyceridemia had worse periodontal status than healthy controls. Patients with hypertriglyceridemia who were taking gemfibrozil did not show significant differences in CAL and PD compared with untreated patients with hypertriglyceridemia.

  16. Interactions of the apolipoprotein C-III 3238C>G polymorphism and alcohol consumption on serum triglyceride levels

    PubMed Central

    2010-01-01

    Background Both apolipoprotein (Apo) C-III gene polymorphism and alcohol consumption have been associated with increased serum triglyceride (TG) levels, but their interactions on serum TG levels are not well known. The present study was undertaken to detect the interactions of the ApoC-III 3238C>G (rs5128) polymorphism and alcohol consumption on serum TG levels. Methods A total of 516 unrelated nondrinkers and 514 drinkers aged 15-89 were randomly selected from our previous stratified randomized cluster samples. Genotyping of the ApoC-III 3238C>G was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Interactions of the ApoC-III 3238C>G genotype and alcohol consumption was assessed by using a cross-product term between genotypes and the aforementioned factor. Results Serum total cholesterol (TC), TG, high-density lipoprotein cholesterol (HDL-C), ApoA-I and ApoB levels were higher in drinkers than in nondrinkers (P < 0.05-0.001). There was no significant difference in the genotypic and allelic frequencies between the two groups. Serum TG levels in nondrinkers were higher in CG genotype than in CC genotype (P < 0.01). Serum TC, TG, low-density lipoprotein cholesterol (LDL-C) and ApoB levels in drinkers were higher in GG genotype than in CC or CG genotype (P < 0.01 for all). Serum HDL-C levels in drinkers were higher in CG genotype than in CC genotype (P < 0.01). Serum TC, TG, HDL-C and ApoA-I levels in CC genotype, TC, HDL-C, ApoA-I levels and the ratio of ApoA-I to ApoB in CG genotype, and TC, TG, LDL-C, ApoA-I and ApoB levels in GG genotype were higher in drinkers than in nondrinkers (P < 0.05-0.01). But the ratio of ApoA-I to ApoB in GG genotype was lower in drinkers than in nondrinkers (P < 0.01). Multivariate logistic regression analysis showed that the levels of TC, TG and ApoB were correlated with genotype in nondrinkers (P < 0.05 for all). The levels

  17. Interactions of the apolipoprotein C-III 3238C>G polymorphism and alcohol consumption on serum triglyceride levels.

    PubMed

    Ruixing, Yin; Yiyang, Li; Meng, Li; Kela, Li; Xingjiang, Long; Lin, Zhang; Wanying, Liu; Jinzhen, Wu; Dezhai, Yang; Weixiong, Lin

    2010-08-17

    Both apolipoprotein (Apo) C-III gene polymorphism and alcohol consumption have been associated with increased serum triglyceride (TG) levels, but their interactions on serum TG levels are not well known. The present study was undertaken to detect the interactions of the ApoC-III 3238C>G (rs5128) polymorphism and alcohol consumption on serum TG levels. A total of 516 unrelated nondrinkers and 514 drinkers aged 15-89 were randomly selected from our previous stratified randomized cluster samples. Genotyping of the ApoC-III 3238C>G was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Interactions of the ApoC-III 3238C>G genotype and alcohol consumption was assessed by using a cross-product term between genotypes and the aforementioned factor. Serum total cholesterol (TC), TG, high-density lipoprotein cholesterol (HDL-C), ApoA-I and ApoB levels were higher in drinkers than in nondrinkers (P < 0.05-0.001). There was no significant difference in the genotypic and allelic frequencies between the two groups. Serum TG levels in nondrinkers were higher in CG genotype than in CC genotype (P < 0.01). Serum TC, TG, low-density lipoprotein cholesterol (LDL-C) and ApoB levels in drinkers were higher in GG genotype than in CC or CG genotype (P < 0.01 for all). Serum HDL-C levels in drinkers were higher in CG genotype than in CC genotype (P < 0.01). Serum TC, TG, HDL-C and ApoA-I levels in CC genotype, TC, HDL-C, ApoA-I levels and the ratio of ApoA-I to ApoB in CG genotype, and TC, TG, LDL-C, ApoA-I and ApoB levels in GG genotype were higher in drinkers than in nondrinkers (P < 0.05-0.01). But the ratio of ApoA-I to ApoB in GG genotype was lower in drinkers than in nondrinkers (P < 0.01). Multivariate logistic regression analysis showed that the levels of TC, TG and ApoB were correlated with genotype in nondrinkers (P < 0.05 for all). The levels of TC, LDL-C and ApoB were

  18. Relevance of the triglyceride-to-high-density lipoprotein cholesterol ratio as an important lipid fraction in apparently healthy, young, and middle-aged Indian men

    PubMed Central

    Kohli, Aparna; Siddhu, Anupa; Pandey, Ravindra M.; Reddy, K. Srinath

    2017-01-01

    Context: Cardiovascular disease (CVD) is the largest cause of mortality in Indians. Insulin resistance and related dyslipidemia of increased triglyceride (TG), small dense low-density lipoprotein (sd-LDL) particles, and decreased high-density lipoprotein-cholesterol (HDL-C) are associated with increased risk of CVD. TG/HDL-C ratio could be a potential surrogate marker for this South Asian phenotype. Data are scarce on the relevance of TG/HDL-C ratio as a useful lipid marker among Indians. Aims: To study the prevalence of TG/HDL-C ratio among healthy, young, and middle-aged Indian men (25–44 years) and its relationship with other lipid and nonlipid factors. Subjects and Methods: In this cross-sectional analysis, fasting blood samples from 236 healthy participants recruited from an urban community setting were tested for TG/HDL-C ratio, HDL-C, TG, total cholesterol (TC), non-HDL-C, TC/HDL-C, high-sensitivity C-reactive protein, body mass index (BMI), and body fat. Results: Mean (standard deviation) age of participants was 34.7 (7.7) years; median (interquartile range) TG/HDL-C ratio was 4 (2.85-5.2). More than half (51.3%) the participants (n = 121) recorded abnormal TG/HDL-C ratio (≥4.0). Across tertiles of TG/HDL-C ratio, there was a significant trend of higher conventional lipid parameters such as non-HDL-C*, TC/HDL-C ratio*, TG*, HDL-C*, TC**; and non-lipid parameters body-fat* and BMI*** (*P < 0.001, **P = 0.015, ***P = 0.002). LDL-C showed moderate and nonsignificant (P = 0.646) increase across tertiles. Conclusion: In a sample of apparently healthy, young, and middle-aged Indian men abnormal TG/HDL-C ratio levels were observed among more than half the participants. The TG/HDL-C ratio was closely associated with other lipid parameters and measures of adiposity, such as BMI and body fat, apart from its previously documented unique association with sd-LDL particles. TG/HDL-C ratio should be evaluated in future for risk prediction of incident CVD among Indians

  19. Relevance of the triglyceride-to-high-density lipoprotein cholesterol ratio as an important lipid fraction in apparently healthy, young, and middle-aged Indian men.

    PubMed

    Kohli, Aparna; Siddhu, Anupa; Pandey, Ravindra M; Reddy, K Srinath

    2017-01-01

    Cardiovascular disease (CVD) is the largest cause of mortality in Indians. Insulin resistance and related dyslipidemia of increased triglyceride (TG), small dense low-density lipoprotein (sd-LDL) particles, and decreased high-density lipoprotein-cholesterol (HDL-C) are associated with increased risk of CVD. TG/HDL-C ratio could be a potential surrogate marker for this South Asian phenotype. Data are scarce on the relevance of TG/HDL-C ratio as a useful lipid marker among Indians. To study the prevalence of TG/HDL-C ratio among healthy, young, and middle-aged Indian men (25-44 years) and its relationship with other lipid and nonlipid factors. In this cross-sectional analysis, fasting blood samples from 236 healthy participants recruited from an urban community setting were tested for TG/HDL-C ratio, HDL-C, TG, total cholesterol (TC), non-HDL-C, TC/HDL-C, high-sensitivity C-reactive protein, body mass index (BMI), and body fat. Mean (standard deviation) age of participants was 34.7 (7.7) years; median (interquartile range) TG/HDL-C ratio was 4 (2.85-5.2). More than half (51.3%) the participants ( n = 121) recorded abnormal TG/HDL-C ratio (≥4.0). Across tertiles of TG/HDL-C ratio, there was a significant trend of higher conventional lipid parameters such as non-HDL-C*, TC/HDL-C ratio*, TG*, HDL-C*, TC**; and non-lipid parameters body-fat* and BMI*** (* P < 0.001, ** P = 0.015, *** P = 0.002). LDL-C showed moderate and nonsignificant ( P = 0.646) increase across tertiles. In a sample of apparently healthy, young, and middle-aged Indian men abnormal TG/HDL-C ratio levels were observed among more than half the participants. The TG/HDL-C ratio was closely associated with other lipid parameters and measures of adiposity, such as BMI and body fat, apart from its previously documented unique association with sd-LDL particles. TG/HDL-C ratio should be evaluated in future for risk prediction of incident CVD among Indians.

  20. Long-Term Effects of Docosahexaenoic Acid-Bound Phospholipids and the Combination of Docosahexaenoic Acid-Bound Triglyceride and Egg Yolk Phospholipid on Lipid Metabolism in Mice

    NASA Astrophysics Data System (ADS)

    Che, Hongxia; Cui, Jie; Wen, Min; Xu, Jie; Yanagita, Teruyoshi; Wang, Qi; Xue, Changhu; Wang, Yuming

    2018-04-01

    The bioavailability of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) depends on their chemical forms. This study investigated the long-term effects of DHA-bound triglyceride (TG-DHA), DHA-bound phospholipid (PL-DHA), and the combination of TG-DHA and egg yolk phospholipid (Egg-PL) on lipid metabolism in mice fed with a high-fat diet (fat levels of 22.5%). Male C57BL/6J mice were fed with different formulations containing 0.5% DHA, including TG-DHA, PL-DHA, and the combination of TG-DHA and Egg-PL, for 6 weeks. Serum, hepatic, and cerebral lipid concentrations and the fatty acid compositions of the liver and brain were determined. The concentrations of serum total triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-c), and hepatic TG in the PL-DHA group and the combination group were significantly lower than those in the high-fat (HF) group ( P < 0.05). Atherogenic index (AI) of the PL-DHA group was significantly lower than that of the combination group ( P < 0.05). Hepatic TC level in the combination group was significantly lower than that in the HF group ( P < 0.05), but no significant difference was observed between the combination group and the PL-DHA group. Both the PL-DHA and the combination groups showed significantly increased DHA levels in the liver compared with the HF group ( P < 0.05). However, there were no obvious increases in the cerebral DHA levels in all DHA diet groups. These results suggest that PL-DHA was superior to the combination of TG-DHA and Egg-PL in decreasing the AI. Long-term dietary supplementation with low amount of DHA (0.5%) may improve hepatic DHA levels, although cerebral DHA levels may not be enhanced.

  1. The triglyceride-to-high density lipoprotein cholesterol ratio in overweight Korean children and adolescents.

    PubMed

    Yoo, Dong-Yoon; Kang, Yu Sun; Kwon, Eun Byul; Yoo, Eun-Gyong

    2017-09-01

    The triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio has recently been reported as a biomarker of cardiometabolic risk in obese children and adolescents. The purpose of this study is to describe the TG/HDL-C ratio and related factors in overweight and normal weight Korean children and to evaluate whether the high TG/HDL-C ratio is associated with insulin resistance in overweight children and adolescents. Data from 255 overweight (aged 8.7±2.0 years) and 514 normal weight (aged 8.9±1.8 years) children and adolescents were evaluated. Glucose, insulin, total cholesterol (TC), HDL-C and TG levels were measured after overnight fasting, and the TG/HDL-C ratio, non-HDL-C and the homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. The TG/HDL-C ratio was higher in overweight group compared to normal weight group (P<0.001). Among overweight children and adolescents, alanine aminotransferase (P=0.018), non-HDL-C (P<0.001), and HOMA-IR (P=0.004) were different between the TG/HDL-C ratio tertile groups. The prevalence of elevated HOMA-IR was increased with increasing TG/HDL-C ratio tertiles (P for trend=0.003). On regression analysis adjusted for age and sex, the BMI (β=0.402, P=0.001) and TG/HDL-C ratio (β=0.251, P=0.014) were independently associated with HOMA-IR (adjusted R2=0.324). The TG/HDL-C ratio of 2.0 or more showed higher sensitivity (55.6%) and specificity (72.9%), when compared to TC (≥200 mg/dL), non-HDL-C (≥145 mg/dL), and LDL-C (≥130 mg/dL) for identifying overweight children with elevated HOMA-IR. The TG/HDL-C ratio is independently associated with insulin resistance in overweight children and adolescents, and it can be useful in identifying those at higher cardiometabolic risk.

  2. The triglyceride-to-high density lipoprotein cholesterol ratio in overweight Korean children and adolescents

    PubMed Central

    Yoo, Dong-Yoon; Kang, Yu Sun; Kwon, Eun Byul

    2017-01-01

    Purpose The triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio has recently been reported as a biomarker of cardiometabolic risk in obese children and adolescents. The purpose of this study is to describe the TG/HDL-C ratio and related factors in overweight and normal weight Korean children and to evaluate whether the high TG/HDL-C ratio is associated with insulin resistance in overweight children and adolescents. Methods Data from 255 overweight (aged 8.7±2.0 years) and 514 normal weight (aged 8.9±1.8 years) children and adolescents were evaluated. Glucose, insulin, total cholesterol (TC), HDL-C and TG levels were measured after overnight fasting, and the TG/HDL-C ratio, non–HDL-C and the homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. Results The TG/HDL-C ratio was higher in overweight group compared to normal weight group (P<0.001). Among overweight children and adolescents, alanine aminotransferase (P=0.018), non–HDL-C (P<0.001), and HOMA-IR (P=0.004) were different between the TG/HDL-C ratio tertile groups. The prevalence of elevated HOMA-IR was increased with increasing TG/HDL-C ratio tertiles (P for trend=0.003). On regression analysis adjusted for age and sex, the BMI (β=0.402, P=0.001) and TG/HDL-C ratio (β=0.251, P=0.014) were independently associated with HOMA-IR (adjusted R2=0.324). The TG/HDL-C ratio of 2.0 or more showed higher sensitivity (55.6%) and specificity (72.9%), when compared to TC (≥200 mg/dL), non–HDL-C (≥145 mg/dL), and LDL-C (≥130 mg/dL) for identifying overweight children with elevated HOMA-IR. Conclusions The TG/HDL-C ratio is independently associated with insulin resistance in overweight children and adolescents, and it can be useful in identifying those at higher cardiometabolic risk. PMID:29025201

  3. [Reference values for cholesterol, triglycerides and glucose in a population of Hispanic children from 6 to 11 y, in the northern border of Mexico and the United States of America].

    PubMed

    Arenas Berumen, Ever; Gómez Miranda, Luis Mario; Torres Balcázar, Elías; Padilla Alvarado, Victor Hugo; Renteria, Ivan

    2014-10-31

    Overweight and obesity in children in the Mexico-USA border have evolved differently to the rest of their respective countries. New reference values of cholesterol, triglycerides and glucose are required to treatment. To determine the reference values of cholesterol, triglycerides and glucose in Hispanic children between 6 and 11 years in the Mexico-USA border. A prospective, cross-sectional, descriptive and observational study. A population of Hispanic children between 6 and 11 years of both boys and girls, belonging to three public institutions in the cities of Ensenada and Chihuahua, randomly selected, were studied. The study variables were the levels of total cholesterol (TC), triglycerides (TG) and glucose (G). From 300 subjects studied just 54 children completed the study. Higher average values of TC (168.7 ± 27.2 mg / dl), TG (80.6 ± 48.4 mg / dl) and G (88.3 ± 8.9 mg / dl) were observed. An additional behavior was founded, never reported previously to the limit of the knowledge of the authors; glucose levels of the children studied decreased with increased of cholesterol and triglycerides. To discard a random relationship between the variables, the Pearson correlation coefficient was determined between waist circumference and BMI, verifying an inverse association with G and direct with the TG. The reference values for Hispanic children between 6 and 11 years living on the northern border of Mexico-USA differ with respect to the national average values of the countries studied. Further studies are needed in larger populations to confirm the trend ob served in glucose levels of normal children, overweight and obese. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  4. Should triglycerides and the triglycerides to high-density lipoprotein cholesterol ratio be used as surrogates for insulin resistance?

    PubMed

    Kim-Dorner, Su-Jong; Deuster, Patricia A; Zeno, Stacey A; Remaley, Alan T; Poth, Merrily

    2010-02-01

    The aims of the present study were to examine whether triglycerides (TG) and the triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) could predict insulin resistance in healthy African Americans and whites. This cross-sectional study included 99 African American and 50 white men and women between 18 and 45 years of age with body mass indexes between 18.5 and 38.0 kg/m(2). Anthropometric measures were obtained; and overnight fasting blood was collected for TG, HDL-C, glucose, and insulin. Insulin resistance was defined by fasting insulin concentration of at least 13.13 microU/mL and homeostasis model assessment of insulin resistance (HOMA-IR) of at least 2.5. Receiver operating characteristic curves were used to analyze the data. African Americans and whites had comparable demographic and anthropometric measures. Fasting insulin was higher in African Americans (12.4 +/- 7.8 microU/mL) than whites (10.2 +/- 7.5 microU/mL), but HOMA-IR did not differ significantly (African Americans, 2.9 +/- 2.0; whites, 2.4 +/- 1.9). Triglycerides and TG/HDL-C were significantly lower in African Americans (TG, 68.2 +/- 43.3 mg/dL; TG/HDL-C, 1.8 +/- 2.1) compared with whites (TG, 105.4 +/- 55.2 mg/dL; TG/HDL-C, 2.8 +/- 1.8). Area under the receiver operating characteristic curves revealed that both TG and TG/HDL-C were acceptable markers of insulin resistance, as defined by fasting insulin concentration, in whites, 0.770 and 0.765, respectively, but poor predictors in African Americans, 0.633 and 0.651, respectively. Similarly, TG and TG/HDL-C were acceptable in predicting insulin resistance, as measured by HOMA-IR, in whites, 0.763 and 0.770, respectively, but poor in predicting HOMA-IR in African Americans, with areas of 0.625 and 0.639, respectively. In conclusion, the relationship between TG and TG/HDL-C with insulin resistance differs by ethnicity; and using TG and TG/HDL-C to predict insulin resistance in African Americans would not be appropriate. Copyright

  5. Influence of chronic stress on the compositions of hepatic cholesterol and triglyceride in male Wistar rats fed a high fat diet.

    PubMed

    Gao, Siyuan; Han, Xue; Fu, Jihua; Yuan, Xiaoling; Sun, Xing; Li, Qiang

    2012-07-01

      We determined the influence of chronic stress (CS) on the compositions of hepatic cholesterol and triglyceride (TG) in rats fed a high fat diet (HFD).   Male Wistar rats were fed either a standard diet or a HFD and half of the HFD fed rats were given CS (electric foot shock assisted with noise) for 8 weeks.   Compared with the control group, the levels of hepatic total cholesterol (TC) and TG were significantly elevated in the HFD and HFD with chronic stress (HFD+CS) groups, and the more severe elevations of them were found in the HFD group. Inversely, the more severe elevations of hepatic water-soluble parts of TC and TG were found in the HFD+CS group, as the elevations of low-density lipoprotein cholesterol, very low-density lipoprotein cholesterol in liver and serum, tumor necrosis factor-α, interleukin-1β and malondialdehyde in liver. Meanwhile, downregulated mRNA expressions of hepatic liver X receptor-α (LXR-α) and peroxisome proliferator-activated receptor-γ (PPAR-γ) were also more severe in the HFD+CS group.   CS can aggravate the high levels of water-soluble compositions of hepatic TC and TG induced by HFD as it aggravates hepatic inflammation and oxidative stress; in spite of that, however, it cannot further promote hepatic lipidosis. This is consistent with the downregulated mRNA expressions of LXR-α and PPAR-γ. © 2012 The Japan Society of Hepatology.

  6. Relative contribution of variation within the APOC3/A4/A5 gene cluster in determining plasma triglycerides.

    PubMed

    Talmud, Philippa J; Hawe, Emma; Martin, Steve; Olivier, Michael; Miller, George J; Rubin, Edward M; Pennacchio, Len A; Humphries, Steve E

    2002-11-15

    Since triglycerides (TG) are a major independent risk factor for coronary heart disease, understanding their genetic and environmental determinants is of major importance. Mouse models indicate an inverse relationship between levels of the newly identified apolipoprotein AV (APOAV) and TG concentrations. We have examined the relative influence of human APOA5 variants on plasma lipids, compared to the impact of variation in APOC3 and APOA4 which lie in the same cluster. Single nucleotide polymorphisms (SNPs) in APOA5 (S19W, -1131T>C) and APOA4 (T347S, Q360H) and an APOA4/A5 intergenic T>C SNP were examined in a large study of healthy middle-aged men (n=2808). APOA5 19WW and -1131CC men had 52% and 40% higher TG (P<0.003) compared to common allele homozygotes, respectively, effects which were independent and additive. APOA4 347SS men had 23% lower TG compared to TT men (P<0.002). Haplotype analysis was carried out to identify TG-raising alleles and included, in addition, four previously genotyped APOC3 SNPs (-2845T>G, -482C>T, 1100C>T, and 3238C>G). The major TG-raising alleles were defined by APOA5 W19 and APOC3 -482T. This suggests that the TG-lowering effect of APOA4 S347 might merely reflect the strong negative linkage disequilibrium with the common alleles of these variants. Thus variation in APOA5 is associated with differences in TGs in healthy men, independent of those previously reported for APOC3, while association between APOA4 and TG reflects linkage disequilibrium with these sites. The molecular mechanisms for these effects remain to be determined.

  7. Triglyceride to high-density lipoprotein cholesterol ratio and carotid intima-medial thickness in Chinese adolescents with newly diagnosed type 2 diabetes mellitus.

    PubMed

    Li, Xin; Deng, You-Ping; Yang, Miao; Wu, Yu-Wen; Sun, Su-Xin; Sun, Jia-Zhong

    2016-03-01

    To investigate the relationship between triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio and carotid intima-medial thickness (CIMT) in Chinese youth and adolescents with newly diagnosed type 2 diabetes mellitus (T2DM). Ninety-eight subjects aged 10-24 yr with newly-diagnosed T2DM had general inflammation, anthropometric, laboratory and CIMT data collected, and were divided into three groups based on TG/HDL-C tertiles. There were no significant differences in gender, age, fasting plasma glucose (FPG), hemoglobin A1c (HbA1c), and carotid arterial diameter (CAD) among the groups based on TG/HDL-C tertiles. Across TG/HDL-C tertiles, there was a significant progressive increase in body mass index (BMI), systolic blood pressure (SBP), diastolic blood pressure (DBP), homeostasis model assessment-estimated insulin resistance (HOMA-IR), TG, total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-C) and CIMT (all P < 0.01 or P < 0.05), while HDL-C was decreased significantly across the groups (P < 0.01). In general linear regression model, TG/HDL-C was an independent determinant of CIMT even after adjusting for BMI, SBP, DBP, TG, TC, LDL-C, HDL-C, HbA1c and HOMA-IR. TG/HDL-C ratio, the marker of small dense LDL particles, is an independent determinant of CIMT in Chinese youth and adolescents with newly diagnosed T2DM, and may be a simple and helpful tool in predicting the increased CIMT in such patients. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Apolipoprotein A-V: a potential modulator of plasma triglyceride levels in Turks.

    PubMed

    Hodoglugil, Ugur; Tanyolaç, Sinan; Williamson, David W; Huang, Yadong; Mahley, Robert W

    2006-01-01

    The apolipoprotein A-V gene (APOA5) plays an important role in determining plasma triglyceride levels. We studied the effects of APOA5 polymorphisms on plasma triglyceride levels in Turks, a population with low levels of HDL cholesterol and a high prevalence of coronary artery disease. We found 15 polymorphisms, three of which were novel. Seven haplotype-tagging single nucleotide polymorphisms (SNPs) were chosen and genotyped in approximately 3,000 subjects. The rare alleles of the -1464T>C, -1131T>C, S19W, and 1259T>C SNPs were significantly associated with increased triglyceride levels (19-86 mg/dl; P < 0.05) and had clear gene-dose effects. Haplotype analysis of the nine common APOA5 haplotypes revealed significant effects on triglyceride levels (P < 0.001). Detailed analysis of haplotypes clearly showed that the -1464T>C polymorphism had no effect by itself but was a marker for the -1131T>C, S19W, and 1259T>C polymorphisms. The -1131T>C and 1259T>C polymorphisms were in a strong but incomplete linkage disequilibrium and appeared to have independent effects. Thus, the APOA5 -1131T>C, S19W, and 1259T>C rare alleles were associated with significant increases in plasma triglyceride levels. At least one of these alleles was present in approximately 40% of the Turks. Similar associations were observed for -1131T>C and S19W in white Americans living in San Francisco, California.

  9. Association between Triglyceride to HDL-C Ratio (TG/HDL-C) and Insulin Resistance in Chinese Patients with Newly Diagnosed Type 2 Diabetes Mellitus

    PubMed Central

    Ren, Xingxing; Chen, Zeng.ai; Zheng, Shuang; Han, Tingting; Li, Yangxue; Liu, Wei; Hu, Yaomin

    2016-01-01

    Objectives To explore the association between the triglyceride to HDL-C ratio (TG/HDL-C) and insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus. Methods Patients with newly diagnosed type 2 diabetes mellitus (272 men and 288 women) were enrolled and divided into three groups according to TG/HDL-C tertiles. Insulin resistance was defined by homeostatic model assessment of insulin resistance (HOMA-IR). Demographic information and clinical characteristics were obtained. Spearman’s correlation was used to estimate the association between TG/HDL-C and other variables. Multiple logistic regression analyses were adopted to obtain probabilities of insulin resistance. A receiver operating characteristic analysis was conducted to evaluate the ability of TG/HDL-C to discriminate insulin resistance. Results TG/HDL-C was associated with insulin resistance in Chinese patients with newly diagnosed T2DM (Spearman’s correlation coefficient = 0.21, P < 0.01). Patients in the higher tertiles of TG/HDL-C had significantly higher HOMA-IR values than patients in the lower tertiles [T1: 2.68(1.74–3.70); T2: 2.96(2.29–4.56); T3: 3.09(2.30–4.99)]. Multiple logistic regression analysis showed that TG/HDL-C was significantly associated with HOMA-IR, and patients in the higher TG/HDL-C tertile had a higher OR than those in the lower TG/HDL-C tertile, after adjusting for multiple covariates including indices for central obesity [T1: 1; T2: 4.02(1.86–8.71); T3: 4.30(1.99–9.29)]. Following stratification of waist circumference into quartiles, the effect of TG/HDL-C on insulin resistance remained significant irrespective of waist circumference. Conclusions TG/HDL-C was associated with insulin resistance independent of waist circumference. Whether it could be a surrogate marker for insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus still needs to be confirmed by more researches. PMID:27115999

  10. Association between Triglyceride to HDL-C Ratio (TG/HDL-C) and Insulin Resistance in Chinese Patients with Newly Diagnosed Type 2 Diabetes Mellitus.

    PubMed

    Ren, Xingxing; Chen, Zeng Ai; Zheng, Shuang; Han, Tingting; Li, Yangxue; Liu, Wei; Hu, Yaomin

    2016-01-01

    To explore the association between the triglyceride to HDL-C ratio (TG/HDL-C) and insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus. Patients with newly diagnosed type 2 diabetes mellitus (272 men and 288 women) were enrolled and divided into three groups according to TG/HDL-C tertiles. Insulin resistance was defined by homeostatic model assessment of insulin resistance (HOMA-IR). Demographic information and clinical characteristics were obtained. Spearman's correlation was used to estimate the association between TG/HDL-C and other variables. Multiple logistic regression analyses were adopted to obtain probabilities of insulin resistance. A receiver operating characteristic analysis was conducted to evaluate the ability of TG/HDL-C to discriminate insulin resistance. TG/HDL-C was associated with insulin resistance in Chinese patients with newly diagnosed T2DM (Spearman's correlation coefficient = 0.21, P < 0.01). Patients in the higher tertiles of TG/HDL-C had significantly higher HOMA-IR values than patients in the lower tertiles [T1: 2.68(1.74-3.70); T2: 2.96(2.29-4.56); T3: 3.09(2.30-4.99)]. Multiple logistic regression analysis showed that TG/HDL-C was significantly associated with HOMA-IR, and patients in the higher TG/HDL-C tertile had a higher OR than those in the lower TG/HDL-C tertile, after adjusting for multiple covariates including indices for central obesity [T1: 1; T2: 4.02(1.86-8.71); T3: 4.30(1.99-9.29)]. Following stratification of waist circumference into quartiles, the effect of TG/HDL-C on insulin resistance remained significant irrespective of waist circumference. TG/HDL-C was associated with insulin resistance independent of waist circumference. Whether it could be a surrogate marker for insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus still needs to be confirmed by more researches.

  11. Central effects of humanin on hepatic triglyceride secretion.

    PubMed

    Gong, Zhenwei; Su, Kai; Cui, Lingguang; Tas, Emir; Zhang, Ting; Dong, H Henry; Yakar, Shoshana; Muzumdar, Radhika H

    2015-08-01

    Humanin (HN) is an endogenous mitochondria-associated peptide that has been shown to protect against various Alzheimer's disease-associated insults, myocardial ischemia-reperfusion injury, and reactive oxygen species-induced cell death. We have shown previously that HN improves whole body glucose homeostasis by improving insulin sensitivity and increasing glucose-stimulated insulin secretion (GSIS) from the β-cells. Here, we report that intraperitoneal treatment with one of HN analogs, HNG, decreases body weight gain, visceral fat, and hepatic triglyceride (TG) accumulation in high-fat diet-fed mice. The decrease in hepatic TG accumulation is due to increased activity of hepatic microsomal triglyceride transfer protein (MTTP) and increased hepatic TG secretion. Both intravenous (iv) and intracerebroventricular (icv) infusion of HNG acutely increase TG secretion from the liver. Vagotomy blocks the effect on both iv and icv HNG on TG secretion, suggesting that the effects of HNG on hepatic TG flux are centrally mediated. Our data suggest that HN is a new player in central regulation of peripheral lipid metabolism. Copyright © 2015 the American Physiological Society.

  12. Risk prediction with triglycerides in patients with stable coronary disease on statin treatment.

    PubMed

    Werner, Christian; Filmer, Anja; Fritsch, Marco; Groenewold, Stephanie; Gräber, Stefan; Böhm, Michael; Laufs, Ulrich

    2014-12-01

    The aim of the prospective Homburg Cream and Sugar study was to analyze the role of fasting and postprandial serum triglycerides (TG) as risk modifiers in patients with coronary artery disease (CAD). A sequential oral triglyceride and glucose tolerance test was developed to obtain standardized measurements of postprandial TG kinetics and glucose in 514 consecutive patients with stable CAD confirmed by angiography (95% were treated with a statin). Fasting and postprandial TG predicted the primary outcome measure of cardiovascular death and hospitalizations after 48 months follow-up (fasting TG >150 vs. <106 mg/dl: Hazard ratio (HR) 1.79, 95% confidence interval (CI) 1.31-2.45, p = 0.0001; area under the curve >1120 vs. <750 mg/dl/5 hr: HR 1.78, 95% CI 1.29-2.45, p = 0.0003). Parameters of the postprandial TG increase did not improve risk prediction compared to fasting TG. The number of cardiovascular deaths and myocardial infarctions was higher in the upper tertile of fasting TG (HR 1.79, 95%-CI 1.04-3.09, p = 0.03). Risk prediction by TG was independent of traditional risk factors, medication, glucose metabolism, LDL- and HDL-cholesterol. Total cholesterol, LDL- and HDL-cholesterol concentrations were not associated with the primary outcome. Fasting serum triglycerides >150 mg/dl independently predict cardiovascular events in patients with coronary artery disease on guideline-recommended medication. Assessment of postprandial TG does not improve risk prediction compared to fasting TG in these patients.

  13. The Impact of CDH13 Polymorphism and Statin Administration on TG/HDL Ratio in Cardiovascular Patients

    PubMed Central

    Choi, Jung Ran; Kim Yoon, Sungjoo; Park, Jong Keun; Sorn, Sungbin Richard; Park, Mi-Young

    2015-01-01

    Purpose Adiponectin is expressed in adipose tissue, and is affected by smoking, obesity, and genetic factors, such as CDH13 polymorphism, contributing to the development of coronary vascular diseases (CVDs). Materials and Methods We investigated the effect of genetic variations of CDH13 (rs3865188) on blood chemistry and adiponectin levels in 345 CVD patients undergoing statin-free or statin treatment. Results Genetic variation in CDH13 was significantly correlated with several clinical factors, including adiponectin, diastolic blood pressure, triglyceride (TG), and insulin levels. Subjects with the T allele (mutant form) had significantly lower adiponectin levels than those with the A allele. Total cholesterol (TC), low-density lipoprotein cholesterol (LDLc), TG/high-density lipoprotein cholesterol (HDLc) ratio, and HDL3b subtype were markedly decreased in statin treated subjects regardless of having the A or T allele. TG and TG/HDL in the statin-free group with TT genotype of the rs3865188 was higher than in the others but they were not different in the statin-treated subjects. We observed a significant difference in adiponectin levels between patients with the A and T alleles in the statin-free group; meanwhile, no difference in adiponectin levels was noted in the statin group. Plasma levels of other cytokines, leptin, visfatin, interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), were not different among the CDH13 genotypes according to statin administration. Body mass index (BMI), TG, insulin, HDL3b, and TG/HDL ratio showed negative correlations with adiponectin levels. Conclusion Plasma adiponectin levels and TG/HDL ratio were significantly different according to variants of CDH13 and statin administration in Korean patients with CVD. PMID:26446643

  14. The Impact of CDH13 Polymorphism and Statin Administration on TG/HDL Ratio in Cardiovascular Patients.

    PubMed

    Choi, Jung Ran; Jang, Yangsoo; Kim Yoon, Sungjoo; Park, Jong Keun; Sorn, Sungbin Richard; Park, Mi-Young; Lee, Myoungsook

    2015-11-01

    Adiponectin is expressed in adipose tissue, and is affected by smoking, obesity, and genetic factors, such as CDH13 polymorphism, contributing to the development of coronary vascular diseases (CVDs). We investigated the effect of genetic variations of CDH13 (rs3865188) on blood chemistry and adiponectin levels in 345 CVD patients undergoing statin-free or statin treatment. Genetic variation in CDH13 was significantly correlated with several clinical factors, including adiponectin, diastolic blood pressure, triglyceride (TG), and insulin levels. Subjects with the T allele (mutant form) had significantly lower adiponectin levels than those with the A allele. Total cholesterol (TC), low-density lipoprotein cholesterol (LDLc), TG/high-density lipoprotein cholesterol (HDLc) ratio, and HDL3b subtype were markedly decreased in statin treated subjects regardless of having the A or T allele. TG and TG/HDL in the statin-free group with TT genotype of the rs3865188 was higher than in the others but they were not different in the statin-treated subjects. We observed a significant difference in adiponectin levels between patients with the A and T alleles in the statin-free group; meanwhile, no difference in adiponectin levels was noted in the statin group. Plasma levels of other cytokines, leptin, visfatin, interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), were not different among the CDH13 genotypes according to statin administration. Body mass index (BMI), TG, insulin, HDL3b, and TG/HDL ratio showed negative correlations with adiponectin levels. Plasma adiponectin levels and TG/HDL ratio were significantly different according to variants of CDH13 and statin administration in Korean patients with CVD.

  15. Studying the Relation of Postprandial Triglyceride with Coronary Artery Disease (CAD).

    PubMed

    Manochehri, Mohammad; Moghadam, Adel Johari

    2016-07-27

    Coronary artery disease (CAD) is the most common cause of mortality worldwide and determination of contributing factors is essential. This study was conducted to study the relation of postprandial triglyceride as a risk of coronary artery disease in patients with proven CAD by angiography, referred to 502 Hospital of Army in 2015. This observational study conducted as a case-control and contained 80 male participants referred to 502 Hospital of Army. Half of these participants had proven CAD by angiography test and the other ones were healthy as a control group. Fasting serum triglyceride was evaluated in all participants and postprandial TG was checked 4 hours after a standard meal. Obtained data were analyzed by SPSS ver. 13. The results indicated that fasting TG and postprandial TG level were significantly higher in CAD patients (P-value=0.001). It was also shown evaluation of postprandial TG is more sensitive test than fasting TG in case of CAD patients. Our obtained results shown, evaluation of high level of postprandial TG is more reliable than fasting TG for patients whom suffer from CAD.

  16. Triglyceride/high-density lipoprotein cholesterol (TG/HDL-C) index as a reference criterion of risk for metabolic syndrome (MetS) and low insulin sensitivity in apparently healthy subjects.

    PubMed

    Baez-Duarte, Blanca Guadalupe; Zamora-Gínez, Irma; González-Duarte, Ramiro; Torres-Rasgado, Enrique; Ruiz-Vivanco, Guadalupe; Pérez-Fuentes, Ricardo; Celis, The Multidisciplinary Research Group Of Diabetes

    To evaluate if the TG/HDL-C index can be considered as a reference criterion of MetS and low insulin sensitivity in apparently healthy subjects. The subjects were Mexican mestizos who resided in Puebla City, Mexico, who were anthropometrically, biochemically, and clinically characterized. The TG/HDL-C index was calculated by dividing triglyceride (TG) levels by HDL-C levels. MetS was diagnosed by the Third Report from the Adult Treatment Panel-National Cholesterol Education Program (ATP-III NCEP) criteria, while insulin sensitivity was evaluated by the Quantitative Insulin sensitivity Check Index (QUICKI). The study included 813 subjects, with an average age of 38.6 ± 12.1 years, of which 564 were women and 249 men. An association was found between high TG/HDL-C index and low insulin sensitivity (Odds ratio [OR]: 4.09; p < 0.01) and with MetS (OR: 15.29; p < 0.01). A correlation was found between the TG/HDL-C index and QUICKI (rho: -0.4989; p < 0.01) and with MetS (rho: 0.6581; p < 0.01). The results indicate that the TG/HDL-C index is associated with low insulin sensitivity and MetS in apparently healthy subjects, suggesting this index as a reference criterion of risk for low insulin sensitivity and MetS.

  17. Studying the Relation of Postprandial Triglyceride with Coronary Artery Disease (CAD)

    PubMed Central

    Manochehri, Mohammad; Moghadam, Adel Johari

    2016-01-01

    Background: Coronary artery disease (CAD) is the most common cause of mortality worldwide and determination of contributing factors is essential. Aim: This study was conducted to study the relation of postprandial triglyceride as a risk of coronary artery disease in patients with proven CAD by angiography, referred to 502 Hospital of Army in 2015. Material and Methods: This observational study conducted as a case-control and contained 80 male participants referred to 502 Hospital of Army. Half of these participants had proven CAD by angiography test and the other ones were healthy as a control group. Fasting serum triglyceride was evaluated in all participants and postprandial TG was checked 4 hours after a standard meal. Obtained data were analyzed by SPSS ver. 13. Results: The results indicated that fasting TG and postprandial TG level were significantly higher in CAD patients (P-value=0.001). It was also shown evaluation of postprandial TG is more sensitive test than fasting TG in case of CAD patients. Conclusion: Our obtained results shown, evaluation of high level of postprandial TG is more reliable than fasting TG for patients whom suffer from CAD. PMID:27703285

  18. Triglyceride to high-density lipoprotein cholesterol ratio predicts worse outcomes after acute ischaemic stroke.

    PubMed

    Deng, Q-W; Wang, H; Sun, C-Z; Xing, F-L; Zhang, H-Q; Zuo, L; Gu, Z-T; Yan, F-L

    2017-02-01

    The effect of the triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) on clinical outcomes of acute ischaemic stroke (AIS) patients is unclear. This study sought to determine whether the TG/HDL-C ratio in AIS patients is associated with worse outcomes at 3 months. Acute ischaemic stroke patients who were admitted from 2011 to 2014 were enrolled in this study. TG, total cholesterol (TC), HDL-C and low-density lipoprotein cholesterol (LDL-C) were collected on admission. Three end-points were defined according to the modified Rankin scale (mRS) score at 3 months after symptom onset (excellent outcome, mRS 0-1; good outcome, mRS 0-2; and death, mRS 6). In all, 1006 patients were included (median age 68.5 years; 58.2% male). Higher TG, non-HDL-C and TG/HDL-C were strongly associated with the three end-points after adjustments: excellent [odds ratio (OR) = 1.39, OR 1.89 and OR 2.34, respectively] and good (OR 1.48, OR 2.90 and OR 4.12) outcomes, and death (OR 0.59, OR 0.29 and OR 0.26). According to receiver operating characteristic (ROC) analysis, the best discriminating factor was a TG/HDL-C ≥ 0.87 for excellent outcomes [area under the ROC curve (AUC) 0.596; sensitivity 73.3%; specificity 42.7%] and non-death (AUC 0.674; sensitivity 67.8%; specificity 60.6%) as well as a TG/HDL-C ≥ 1.01 for a good outcome (AUC 0.652; sensitivity 61.6%; specificity 63.2%). Patients with a TG/HDL-C < 0.87 had a 2.94-fold increased risk of death (95% confidence interval 1.89-4.55) compared with patients with a TG/HDL-C ≥ 0.87. A lower TG/HDL-C was independently associated with death and worse outcome at 3 months in AIS. © 2016 EAN.

  19. Comparison of two methods using plasma triglyceride concentration as a surrogate estimate of insulin action in nondiabetic subjects: triglycerides × glucose versus triglyceride/high-density lipoprotein cholesterol.

    PubMed

    Abbasi, Fahim; Reaven, Gerald M

    2011-12-01

    The objective was to compare relationships between insulin-mediated glucose uptake and surrogate estimates of insulin action, particularly those using fasting triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C) concentrations. Insulin-mediated glucose uptake was quantified by determining the steady-state plasma glucose (SSPG) concentration during the insulin suppression test in 455 nondiabetic subjects. Fasting TG, HDL-C, glucose, and insulin concentrations were measured; and calculations were made of the following: (1) plasma concentration ratio of TG/HDL-C, (2) TG × fasting glucose (TyG index), (3) homeostasis model assessment of insulin resistance, and (4) insulin area under the curve (insulin-AUC) during a glucose tolerance test. Insulin-AUC correlated most closely with SSPG (r ∼ 0.75, P < .001), with lesser but comparable correlations between SSPG and TG/HDL-C ratio, TyG index, homeostasis model assessment of insulin resistance, and fasting TG and insulin (r ∼ 0.60, P < .001). Calculations of TG/HDL-C ratio and TyG index correlated with SSPG concentration to a similar degree, and the relationships were comparable to estimates using fasting insulin. The strongest relationship was between SSPG and insulin-AUC. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Genetic mutations in adipose triglyceride lipase and myocardial up-regulation of peroxisome proliferated activated receptor-γ in patients with triglyceride deposit cardiomyovasculopathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hirano, Ken-ichi, E-mail: khirano@cnt-osaka.com; Department of Cardiovascular Medicine, Graduate School of Medicine, Osaka University, 2-2, Yamadaoka, Suita, Osaka 565-0871; Tanaka, Tatsuya

    2014-01-10

    Highlights: •Triglyceride deposit cardiomyovasculopathy (TGCV) is a rare severe heart disease. •PPARγ is up-regulated in myocardium in patients with TGCV. •Possible vicious cycle for fatty acid may be involved in pathophysiology of TGCV. -- Abstract: Adipose triglyceride lipase (ATGL, also known as PNPLA2) is an essential molecule for hydrolysis of intracellular triglyceride (TG). Genetic ATGL deficiency is a rare multi-systemic neutral lipid storage disease. Information regarding its clinical profile and pathophysiology, particularly for cardiac involvement, is still very limited. A previous middle-aged ATGL-deficient patient in our institute (Case 1) with severe heart failure required cardiac transplantation (CTx) and exhibited amore » novel phenotype, “Triglyceride deposit cardiomyovasculopathy (TGCV)”. Here, we tried to elucidate molecular mechanism underlying TGCV. The subjects were two cases with TGCV, including our second case who was a 33-year-old male patient (Case 2) with congestive heart failure requiring CTx. Case 2 was homozygous for a point mutation in the 5′ splice donor site of intron 5 in the ATGL, which results in at least two types of mRNAs due to splicing defects. The myocardium of both patients (Cases 1 and 2) showed up-regulation of peroxisome proliferated activated receptors (PPARs), key transcription factors for metabolism of long chain fatty acids (LCFAs), which was in contrast to these molecules’ lower expression in ATGL-targeted mice. We investigated the intracellular metabolism of LCFAs under human ATGL-deficient conditions using patients’ passaged skin fibroblasts as a model. ATGL-deficient cells showed higher uptake and abnormal intracellular transport of LCFA, resulting in massive TG accumulation. We used these findings from cardiac specimens and cell-biological experiments to construct a hypothetical model to clarify the pathophysiology of the human disorder. In patients with TGCV, even when hydrolysis of

  1. Relationship of the triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio to the remainder of the lipid profile: The Very Large Database of Lipids-4 (VLDL-4) study.

    PubMed

    Quispe, Renato; Manalac, Raoul J; Faridi, Kamil F; Blaha, Michael J; Toth, Peter P; Kulkarni, Krishnaji R; Nasir, Khurram; Virani, Salim S; Banach, Maciej; Blumenthal, Roger S; Martin, Seth S; Jones, Steven R

    2015-09-01

    High levels of the triglycerides to high-density lipoprotein cholesterol (TG/HDL-C) ratio are associated with obesity, metabolic syndrome, and insulin resistance. We evaluated variability in the remaining lipid profile, especially remnant lipoprotein particle cholesterol (RLP-C) and its components (very low-density lipoprotein cholesterol subfraction 3 and intermediate-density lipoprotein cholesterol), with variability in the TG/HDL-C ratio in a very large study cohort representative of the general U.S. We examined data from 1,350,908 US individuals who were clinically referred for lipoprotein cholesterol ultracentrifugation (Atherotech, Birmingham, AL) from 2009 to 2011. Demographic information other than age and sex was not available. Changes to the remaining lipid profile across percentiles of the TG/HDL-C ratio were quantified, as well as by three TG/HDL-C cut-off points previously proposed in the literature: 2.5 (male) and 2 (female), 3.75 (male) and 3 (female), and 3.5 (male and female). The mean age of our study population was 58.7 years, and 48% were men. The median TG/HDL-C ratio was 2.2. Across increasing TG/HDL-C ratios, we found steadily increasing levels of RLP-C, non-HDL-C and LDL density. Among the lipid parameters studied, RLP-C and LDL density had the highest relative increase when comparing individuals with elevated TG/HDL-C levels to those with lower TG/HDL-C levels using established cut-off points. Approximately 47% of TG/HDL-C ratio variance was attributable to RLP-C. In the present analysis, a higher TG/HDL-C ratio was associated with an increasingly atherogenic lipid phenotype, characterized by higher RLP-C along with higher non-HDL-C and LDL density. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Additive effects of LPL, APOA5 and APOE variant combinations on triglyceride levels and hypertriglyceridemia: results of the ICARIA genetic sub-study

    PubMed Central

    2010-01-01

    Background Hypertriglyceridemia (HTG) is a well-established independent risk factor for cardiovascular disease and the influence of several genetic variants in genes related with triglyceride (TG) metabolism has been described, including LPL, APOA5 and APOE. The combined analysis of these polymorphisms could produce clinically meaningful complementary information. Methods A subgroup of the ICARIA study comprising 1825 Spanish subjects (80% men, mean age 36 years) was genotyped for the LPL-HindIII (rs320), S447X (rs328), D9N (rs1801177) and N291S (rs268) polymorphisms, the APOA5-S19W (rs3135506) and -1131T/C (rs662799) variants, and the APOE polymorphism (rs429358; rs7412) using PCR and restriction analysis and TaqMan assays. We used regression analyses to examine their combined effects on TG levels (with the log-transformed variable) and the association of variant combinations with TG levels and hypertriglyceridemia (TG ≥ 1.69 mmol/L), including the covariates: gender, age, waist circumference, blood glucose, blood pressure, smoking and alcohol consumption. Results We found a significant lowering effect of the LPL-HindIII and S447X polymorphisms (p < 0.0001). In addition, the D9N, N291S, S19W and -1131T/C variants and the APOE-ε4 allele were significantly associated with an independent additive TG-raising effect (p < 0.05, p < 0.01, p < 0.001, p < 0.0001 and p < 0.001, respectively). Grouping individuals according to the presence of TG-lowering or TG-raising polymorphisms showed significant differences in TG levels (p < 0.0001), with the lowest levels exhibited by carriers of two lowering variants (10.2% reduction in TG geometric mean with respect to individuals who were homozygous for the frequent alleles of all the variants), and the highest levels in carriers of raising combinations (25.1% mean TG increase). Thus, carrying two lowering variants was protective against HTG (OR = 0.62; 95% CI, 0.39-0.98; p = 0.042) and having one single raising polymorphism (OR

  3. Triglyceride kinetics in fasted and fed E. coli septic rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lanza-Jacoby, S.; Tabares, A.

    1990-02-26

    The mechanism for the development of hypertriglyceridemia during gram-negative sepsis was studies by examining the liver production and clearance of very-low-density lipoprotein (VLDL) triglyceride (TG). To assess the liver output and peripheral clearance the kinetics of VLDL-TG were determined by a constant intravenous infusion of (2-{sup 3}H) glycerol-labeled VLDL in fasted control, fasted E. coli-treated, fed control, and fed E.coli-treated rats. Lewis inbred rats, 275-300 g, were made septic with 8 {times} 10{sup 7} live E.coli colonies per 100 g body weight. Twenty-four hours following E.coli injection serum TG of fasted E.coli-treated rats was elevated by 170% which was attributedmore » to a 67% decrease in the clearance rate of VLDL-TG in fasted E.coli-treated rats compared with their fasted controls. The secretion of VLDL-TG declined by 31% in the livers of the fasted E.coli-treated rats which was accompanied by a 2-fold increase in the composition of liver TG. In a second series of experiments control and E.coli-treated rats were fed intragastrically (IG) a balanced solution containing glucose plus fat as the sources of nonprotein calories. Serum TG were 26% lower in the fed E.coli-treated rats because the clearance rate increased by 86%. The secretion of TG in the fed septic rats increased by 40% but this difference was not significant. In the septic rat the ability to clear triglycerides from the plasma depends upon the nutritional state.« less

  4. Triglyceride to HDL-C ratio and increased arterial stiffness in apparently healthy individuals.

    PubMed

    Wen, Jiang-Hua; Zhong, Yu-Yu; Wen, Zhi-Gang; Kuang, Chao-Qun; Liao, Jie-Rong; Chen, Li-Hua; Wang, Pei-Shen; Wu, Yue-Xia; Ouyang, Chu-Jun; Chen, Zhi-Jin

    2015-01-01

    High triglycerides and low high density lipoprotein cholesterol are important cardiovascular risk factors. Triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) has been reported to be useful in predicting cardiovascular disease. Brachial-ankle pulse wave velocity (baPWV) is a valid and reproducible measurement by which to assess arterial stiffness and a surrogate marker of atherosclerosis. However, there is limited evidence about the relationship between them. Therefore, we tested the hypotheses that TG/HDL-C is associated with baPWV in healthy individuals. Fasting lipid profiles, baPWV and clinical data were measured in 1498 apparently healthy, medication-free subjects (926 men, 572 women) who participated in a routine health screening from 2011 to 2013. Participants were stratified into quartiles of TG/HDL-C ratio. BaPWV > 1400 cm/s was defined as abnormal baPWV, Multivariable logistic regression was used to identify associations of TG/HDL-C quartiles and baPWV, after adjusting for the presence of conventional cardiovascular risk factors. In both genders, we observed positive relationships between TG/HDL-C quartiles and BMI, systolic BP, diastolic BP, fasting glucose, total cholesterol, LDL-C, triglycerides, uric acid, and percentages of high baPWV. Multivariable logistic regression revealed that baPWV abnormality OR value of the highest TG/HDL-C quartiles was 1.91 (95% CI: 1.11-3.30, P < 0.05) and 2.91 (95% CI: 1.02-8.30, P < 0.05) in male and female after adjusting for age, systolic BP, diastolic BP, BMI, fasting plasma glucose, LDL-C, uric acid and estimated glomerular filtration rate when compared with the lowest TG/HDL-C quartiles. Increased TG/HDL-C was independently associated with baPWV abnormality in apparently healthy individuals.

  5. Triglyceride to HDL-C ratio and increased arterial stiffness in apparently healthy individuals

    PubMed Central

    Wen, Jiang-Hua; Zhong, Yu-Yu; Wen, Zhi-Gang; Kuang, Chao-Qun; Liao, Jie-Rong; Chen, Li-Hua; Wang, Pei-Shen; Wu, Yue-Xia; Ouyang, Chu-Jun; Chen, Zhi-Jin

    2015-01-01

    Objectives: High triglycerides and low high density lipoprotein cholesterol are important cardiovascular risk factors. Triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) has been reported to be useful in predicting cardiovascular disease. Brachial-ankle pulse wave velocity (baPWV) is a valid and reproducible measurement by which to assess arterial stiffness and a surrogate marker of atherosclerosis. However, there is limited evidence about the relationship between them. Therefore, we tested the hypotheses that TG/HDL-C is associated with baPWV in healthy individuals. Methods: Fasting lipid profiles, baPWV and clinical data were measured in 1498 apparently healthy, medication-free subjects (926 men, 572 women) who participated in a routine health screening from 2011 to 2013. Participants were stratified into quartiles of TG/HDL-C ratio. BaPWV > 1400 cm/s was defined as abnormal baPWV, Multivariable logistic regression was used to identify associations of TG/HDL-C quartiles and baPWV, after adjusting for the presence of conventional cardiovascular risk factors. Results: In both genders, we observed positive relationships between TG/HDL-C quartiles and BMI, systolic BP, diastolic BP, fasting glucose, total cholesterol, LDL-C, triglycerides, uric acid, and percentages of high baPWV. Multivariable logistic regression revealed that baPWV abnormality OR value of the highest TG/HDL-C quartiles was 1.91 (95% CI: 1.11-3.30, P < 0.05) and 2.91 (95% CI: 1.02-8.30, P < 0.05) in male and female after adjusting for age, systolic BP, diastolic BP, BMI, fasting plasma glucose, LDL-C, uric acid and estimated glomerular filtration rate when compared with the lowest TG/HDL-C quartiles. Conclusion: Increased TG/HDL-C was independently associated with baPWV abnormality in apparently healthy individuals. PMID:26064351

  6. Triglyceride to high-density lipoprotein cholesterol (HDL-C) ratio and arterial stiffness in Japanese population: a secondary analysis based on a cross-sectional study.

    PubMed

    Chen, Chi; Dai, Jia-Lin

    2018-05-29

    Previous studies have revealed that triglyceride to high-density lipoprotein cholesterol (HDL-C) ratio (henceforth TG/HDL-C) is one of major risk factors of cardiovascular diseases, insulin resistance and metabolism syndrome. However, there are fewer scientific dissertations about the correlation between TG/HDL-C and bapWV. This study was undertaken to investigate the relationship between Triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio and brachial-ankle pulse wave velocity (baPWV) in Japanese. The present study was a cross-sectional study. 912 Japanese men and women, aging 24-84 years old, received a health medical a health check-up program including the results from baPWV inspection and various standardized questionnaire in a health examination Center in Japan. Main outcome measures included TG/HDL-C ratio, baPWV, fatty liver, postmenopausal status. Abdominal ultrasonography was used to diagnose fatty liver. Postmenopausal state was defined as beginning 1 year after the cessation of menses. It was noted that the entire study was completed by Fukuda et al., and uploaded the data to the DATADRYAD website. The author only used this data for secondary analysis. After adjusting potential confounders (age, sex, BMI, SBP, DBP, AST, ALT, GGT, uric acid, fasting glucose, TC, LDL, eGFR, smoking and exercise status, fatty liver, alcohol consumption and ABI), non-linear relationship was detected between TG/HDL-C and baPWV, whose point was 5.6. The effect sizes and the confidence intervals on the left and right sides of inflection point were 12.7 (1.9 to 23.5) and - 16.7 (- 36.8 to 3.3), respectively. Subgroup analysis showed, in participants with excessive alcohol consumption (more than 280 g/week), that TG/HDL-C had a negative correlation with BAPWV (β = - 30.7, 95%CI (- 53.1, - 8.4)), and the P for interaction was less than 0.05, CONCLUSION: The relationship between TG/HDL-C and baPWV is non-linear. TG/HDL-C was positively

  7. Triglyceride Treatment in the Age of Cholesterol Reduction

    PubMed Central

    Agrawal, Nidhi; Corradi, Patricia Freitas; Gumaste, Namrata; Goldberg, Ira J.

    2017-01-01

    Cholesterol reduction has markedly reduced major cardiovascular disease (CVD) events and shown regression of atherosclerosis in some studies. However, CVD has for decades also been associated with increased levels of circulating triglyceride (TG)-rich lipoproteins. Whether this is due to a direct toxic effect of these lipoproteins on arteries or whether this is merely an association is unresolved. More recent genetic analyses have linked genes that modulate TG metabolism with CVD. Moreover, analyses of subgroups of hypertriglyceridemic (HTG) subjects in clinical trials using fibric acid drugs have been interpreted as evidence that TG reduction reduces CVD events. This review will focus on how HTG might cause CVD, whether TG reduction makes a difference, what pathophysiological defects cause HTG, and what options are available for treatment. PMID:27544319

  8. Causes of the triglyceride-lowering effect of exercise training in rats

    NASA Technical Reports Server (NTRS)

    Mondon, C. E.; Dolkas, C. B.; Tobey, T.; Reaven, G. M.

    1984-01-01

    Studies conducted with human subjects and laboratory animals have consistently shown a reduction in serum triglyceride (TG) in exercise-trained subjects. The obtained data have suggested that this decrease was due to a reduction in hepatic TG secretion. The present investigation, which was conducted with rats trained to attain a high level of spontaneous running activity, provides support for the earlier results. In addition, insights are obtained regarding the mechanism by which exercise lowers TG levels. Since the liver accounts for the vast majority of endogenous very low density lipoprotein (VLDL)-TG secretion, the fall in TG secretion rate seen in exercise-trained (ET) rats must be due to a reduction in hepatic TG secretion.

  9. Association of the TG/HDL-C and Non-HDL-C/HDL-C Ratios with Chronic Kidney Disease in an Adult Chinese Population.

    PubMed

    Wen, Jia; Chen, Yiyin; Huang, Yun; Lu, Yao; Liu, Xing; Zhou, Honghao; Yuan, Hong

    2017-01-01

    Evidence indicates a role for dyslipidemia in the development of chronic kidney disease (CKD). However, the association of lipid abnormalities and their ratios with kidney disease using the new CKD Epidemiology Collaboration (CKD-EPI) equation is not well understood. This cross-sectional study included 48,054 adult subjects. CKD was defined as an estimated glomerular filtration rate <60 ml/min/1.73 m2 or dipstick-positive proteinuria. Logistic regression models were used to examine the relationship between lipid variables and CKD. The prevalence of CKD in this study was 3.7%. When the participants exhibited higher serum triglyceride (TG), a higher TG/high-density lipoprotein cholesterol (TG/HDL-c) ratio or a higher non-HDL-c/HDL-c ratio or HDL-c in a lower quartile, the prevalence of CKD tended to be higher. The multivariate adjusted odds ratios for CKD per 1 standard deviation increase in lipid level were 1.17 (1.10-1.23) for TG, 0.86 (0.79-0.93) for HDL-c, 1.21 (1.13-1.31) for the TG/HDL-c ratio, and 1.14 (1.06-1.22) for the non-HDL-c/HDL-c ratio. No significant association was detected between CKD and total cholesterol (TC), non-HDL-c or the low-density lipoprotein cholesterol/HDL-c (LDL-c/HDL-c) ratio. In this relatively healthy adult Chinese population, the CKD-EPI equation determined that the TG/HDL-c and non-HDL-c/HDL-c ratios as well as TG and HDL-c correlate with the prevalence of CKD. © 2017 The Author(s). Published by S. Karger AG, Basel.

  10. Lipolysis, and not hepatic lipogenesis, is the primary modulator of triglyceride levels in streptozotocin-induced diabetic mice

    PubMed Central

    Willecke, Florian; Scerbo, Diego; Nagareddy, Prabhakara; Obunike, Joseph C; Barrett, Tessa J; Abdillahi, Mariane L.; Trent, Chad M.; Huggins, Lesley Ann; Fisher, Edward A; Drosatos, Konstantinos; Goldberg, Ira J.

    2014-01-01

    Objective Diabetic hypertriglyceridemia is thought to be primarily driven by increased hepatic de novo lipogenesis. However, experiments in animal models indicated that insulin deficiency should decrease hepatic de novo lipogenesis and reduce plasma triglyceride levels. Approach and Results To address the discrepancy between human data and genetically altered mouse models, we investigated whether insulin deficient diabetic mice had triglyceride changes that resemble those in diabetic humans. Streptozotocin (STZ)–induced insulin deficiency increased plasma triglyceride levels in mice. Contrary to the mouse models with impaired hepatic insulin receptor signalling, insulin deficiency did not reduce hepatic triglyceride secretion and de novo lipogenesis-related gene expression. Diabetic mice had a marked decrease in postprandial TG clearance, which was associated with decreased lipoprotein lipase (LpL) and PPARα mRNA levels in peripheral tissues and decreased LpL activity in skeletal muscle, heart and brown adipose tissue. Diabetic heterozygous LpL knockout mice had markedly elevated fasting plasma triglyceride levels and prolonged postprandial TG clearance. Conclusion Insulin deficiency causes hypertriglyceridemia by decreasing peripheral lipolysis and not by an increase in hepatic TG production and secretion. PMID:25395613

  11. The TG/HDL-C Ratio Might Be a Surrogate for Insulin Resistance in Chinese Nonobese Women.

    PubMed

    He, Jiyun; He, Sen; Liu, Kai; Wang, Yong; Shi, Di; Chen, Xiaoping

    2014-01-01

    Obejective. To examine the discriminatory power of triglyceride (TG) and triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) for insulin resistance (IR) in a normoglycaemic Chinese population. Methods. The data were collected from 711 individuals. The normoglycaemic individuals were eventually included in the study (n = 533, age: 62.8 ± 6.6 years, male: 56.8%), who were with a fasting plasma glucose < 6.1 mmol/L and without a history of diabetes. IR was defined as the upper quintile (≥1.6) of homeostasis model assessment of IR. Area under the receiver operating characteristic curve (AROC) was used to examine the discriminatory power. Results. The discriminatory power of TG/HDL-C for IR was acceptable in women with a BMI < 24 kg/m(2) or waist circumference < 80 cm (AROCs: 0.718 and 0.713, resp.); however, the discriminatory power was not acceptable in the obese women. TG/HDL-C was not an acceptable marker of IR in men. The discriminatory power of TG for IR was not acceptable in both men and women. Conclusions. The discriminatory power of TG/HDL-C for IR differs by gender and obesity index in the normoglycaemic Chinese population, and TG/HDL-C could discriminate IR in the nonobese and normoglycaemic women.

  12. Relationship between Triglyceride and HDL-C ratio with Acute Coronary Syndrome.

    PubMed

    Islam, M Z; Islam, M N; Bhowmik, T K; Saha, B; Hossain, M S; Ahmed, H; Ali, M S; Shakil, S S; Paul, P K

    2018-04-01

    Cardiovascular diseases (CVD) is the leading cause of death worldwide, responsible for one third of death, coronary artery disease (CAD) is the most common cause. Dyslipidaemiais one of the major contributors increased of CAD risk. This study was aimed to find out the relationship between triglyceride and HDL cholesterol ratio with acute coronary syndrome. This cross sectional study was conducted in the department of Cardiology, Mymensingh Medical College Hospital from August 2009 to May 2010. Smoking, hypertension, serum total cholesterol level, serum HDL-C, LDL-C, triglyceride (TG) level were important variable considered. A total number of 100 respondents consisted of 50 cases (patient) and 50 healthy persons (control). Investigations included ECG, Troponin-I, FBS and lipid profile. The data was analyzed by computer with the help of SPSS; Chi-square test, 't' test, ANOVA test used as test of significance. The mean level in cases of TG 168.2±88.0 vs. HDL 41.3±5.1 in control level TG 141.2±45.3 and HDL 34.2±3.4. TG/HDL ratio cases 4.2±1.7 and control 4.1±1.3. This ratio >4 is atherogenic for CAD. Unadjusted odds ratio TG/HDL ratio level high (>1). In multivariable regression analysis, TG/HDL ratio was strong relation with ACS. The study reflected that high TG/HDL ratio is associated with ACS. Categorization of patient with ACS on the basis of high TG/HDL ratio will be helpful for risk stratification and management.

  13. [Effects of adiponectin gene SNP45T/G on changes of serum lipid ratios induced by high-carbohydrate/low-fat diet in healthy Chinese youth].

    PubMed

    Li, Yu-jia; Fang, Ding-zhi; Gong, Ren-rong; Du, Juan; Huang, Xin

    2010-09-01

    To investigate the effects of adiponectin gene (APM1) SNP45T/G on serum lipid ratios and their responses to high-carbohydrate/low-fat (HC/LF) diet in healthy young Chinese. Fifty-six healthy young subjects were given two consecutive diets. The first was control diet (54% carbohydrate, 15% protein, and 31% fat) for 7 days, and the second was HC/LF diet (70% carbohydrate, 15% protein, and 15% fat) for 6 days. Before and after each diet, serum lipids and SNP45T/G were analyzed. The ratios of TG/HDL-C, log (TG/HDL-C), TC/HDL-C, and LDL-C/HDL-C were calculated. There was no significant difference of baseline lipid ratios between subjects with TT genotype and subjects carrying G allele (G carriers) in the whole population or in the males and females separately. The G allele was associated with significantly higher TC/HDL-C after HC/LF diet in the males (P < 0.05); and the males with TT genotype had significant decreases of LDL-C/HDL-C (P < 0.05) and TC/HDL-C (P < 0.05) after HC/LF diet compared with those before the diet, while G carriers only experienced significant decrease of TC/HDL-C (P < 0.01). In the females, TT genotype was associated with significantly higher TG/HDL-C (P < 0.05) and log (TG/HDL-C) (P < 0.05) both before and after the HC/LF diet. When compared with those before HC/LF diet, elevated TG/HDL-C (P < 0.05) and log (TG/ HDL-C) (P < 0.05) and declined TC/HDL-C (P < 0.01) were observed in the subjects with TT genotype after the diet. In the female subjects of G carriers, LDL-C/HDL-C (P < 0.05) and TC/HDL-C (P < 0.01) decreased significantly after the HC/LF diet. G allele of APM1 45T/G could inhibit increase of TG/HDL-C and log (TG/HDL-C) and promote the decrease of LDL-C/HDL-C induced by HC/LF diet in healthy young females. But in the healthy young males, it might eliminate the decline of LDL-C/HDL-C induced by HC/LF diet and increase TC/HDL-C.

  14. Dietary triglycerides as signaling molecules that influence reward and motivation

    PubMed Central

    Berland, Chloé; Cansell, Céline; Hnasko, Thomas S.; Magnan, Christophe; Luquet, Serge

    2017-01-01

    The reinforcing and motivational aspects of food are tied to the release of the dopamine in the mesolimbic system (ML). Free fatty acids from triglyceride (TG)-rich particles are released upon action of TG-lipases found at high levels in peripheral oxidative tissue (muscle, heart), but also in the ML. This suggests that local TG-hydrolysis in the ML might regulate food seeking and reward. Indeed, evidence now suggests that dietary TG directly target the ML to regulate amphetamine-induced locomotion and reward seeking behavior. Though the cellular mechanisms of TG action are unresolved, TG act in part through ML lipoprotein lipase, upstream of dopamine 2 receptor (D2R), and show desensitization in conditions of chronically elevated plasma TG as occur in obesity. TG sensing in the ML therefore represents a new mechanism by which chronic consumption of dietary fat might lead to adaptations in the ML and dysregulated feeding behaviors. PMID:28191490

  15. The Comparison of Gemfibrozil and Lovastatin Therapy in Patients with High LDL and Low HDL Cholesterol Levels

    DTIC Science & Technology

    1990-08-01

    cholesterol with same method as for TC; however, precision of the HDL measurements were (±SD) ±1.5 mg/dl. Triglycerides ( TG ) were...placebo lipid levels (TC and TG levels), lipoprotein cholesterol levels (LDL, VLDL, and HDL cholesterol levels), and the cholesterol ratios between... high density lipoprotein cholesterol in the serum and risk of mortality: evidence of a threshold effect. Br Med J. 1985; 290:1239-43. 7. Gordon

  16. Synthesis and evaluation of fluorogenic triglycerides as lipase assay substrates.

    PubMed

    Andersen, Rokhsana J; Brask, Jesper

    2016-06-01

    Three racemic fluorogenic triglycerides are synthesized and evaluated as lipase assay substrates. The presented synthesis route goes through a key triglyceride intermediate which can be chemoselectively functionalized with a wide range of different probes. Hence the substrate can be tailor-made for a specific assay, or focus can be on low cost in larger scale for applications in high-throughput screening (HTS) assays. In the specific examples, TG-ED, TG-FD and TG-F2 are assembled with the Edans-Dabcyl or the fluorescein-Dabcyl FRET pair, or relying on fluorescein self-quenching, respectively. Proof-of-concept assays allowed determination of 1st order kinetic parameters (kcat/KM) of 460s(-1)M(-1), 59s(-1)M(-1) and 346s(-1)M(-1), respectively, for the three substrates. Commercially available EnzChek lipase substrate provided 204s(-1)M(-1). Substrate concentration was identified as a critical parameter, with measured reaction rates decreasing at higher concentrations when intermolecular quenching becomes significant. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Detection of triglyceride using an iridium nano-particle catalyst based amperometric biosensor.

    PubMed

    Liao, Wei-Yin; Liu, Chung-Chiun; Chou, Tse-Chuan

    2008-12-01

    The detection and quantification of triglyceride (TG) using an iridium nano-particle modified carbon based biosensor was successfully carried out in this study. The detection procedures were based on the electrochemical detection of enzymatically produced NADH. TG was hydrolyzed by lipase and the glycerol produced was catalytically oxidized by NAD-dependent glycerol dehydrogenase producing NADH in a solution containing NAD(+). Glyceryl tributyrate, a short chain triglyceride, was chosen as the substrate for the evaluation of this TG biosensor in bovine serum and human serum. A linear response to glyceryl tributyrate in the concentration range of 0 to 10 mM and a sensitivity of 7.5 nA mM(-1) in bovine serum and 7.0 nA mM(-1) in human serum were observed experimentally. The potential interference of species such as uric acid (UA) and ascorbic acid (AA) was assessed. The incorporation of a selected surfactant and an increase in the incubation temperature appeared to enhance the performance of this biosensor. The conditions for the determination of TG levels in bovine serum using this biosensor were optimized, with sunflower seed oil being used as an analyte to simulate the detection of TG in blood. The experimental results demonstrated that this iridium nano-particle modified working electrode based biosensor provided a relatively simple means for the accurate determination of TG in serum.

  18. The TG/HDL-C Ratio Might Be a Surrogate for Insulin Resistance in Chinese Nonobese Women

    PubMed Central

    He, Jiyun; He, Sen; Liu, Kai; Wang, Yong; Shi, Di

    2014-01-01

    Obejective. To examine the discriminatory power of triglyceride (TG) and triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) for insulin resistance (IR) in a normoglycaemic Chinese population. Methods. The data were collected from 711 individuals. The normoglycaemic individuals were eventually included in the study (n = 533, age: 62.8 ± 6.6 years, male: 56.8%), who were with a fasting plasma glucose < 6.1 mmol/L and without a history of diabetes. IR was defined as the upper quintile (≥1.6) of homeostasis model assessment of IR. Area under the receiver operating characteristic curve (AROC) was used to examine the discriminatory power. Results. The discriminatory power of TG/HDL-C for IR was acceptable in women with a BMI < 24 kg/m2 or waist circumference < 80 cm (AROCs: 0.718 and 0.713, resp.); however, the discriminatory power was not acceptable in the obese women. TG/HDL-C was not an acceptable marker of IR in men. The discriminatory power of TG for IR was not acceptable in both men and women. Conclusions. The discriminatory power of TG/HDL-C for IR differs by gender and obesity index in the normoglycaemic Chinese population, and TG/HDL-C could discriminate IR in the nonobese and normoglycaemic women. PMID:25136362

  19. [Triglycerides/HDL-cholesterol ratio: in adolescents without cardiovascular risk factors].

    PubMed

    Soutelo, Jimena; Graffigna, Mabel; Honfi, Margarita; Migliano, Marta; Aranguren, Marcela; Proietti, Adrian; Musso, Carla; Berg, Gabriela

    2012-06-01

    Triglycerides/HDL-cholesterol ratio (TG/HDL) is an easy resource determination and it has good correlation with the HOMA index in adults. Due to physiological insulin resistance (IR) in adolescence it is necessary to find markers of IR independent of age, sex and pubertal stage. The objective was to identify reference values of TG/HDL ratio in a population of adolescents without cardiovascular risk factors. We evaluated 943 adolescents, 429 females and 514 males between 11 and 14. Anthropometric measures were determined and body mass index was calculated (BMI). Blood was extracted after 12 hours of fasting to determine glucose, triglycerides, HDL. The metabolic syndrome (MS) was diagnosed according to criteria of NCEP/ATP III modified by Cook. We excluded adolescents with MS or any component of it. We evaluated 562 adolescents (289 women and 273 men) with a weight of 48.91 +/- 6.51kg, BMI: 18.95 +/- 1.78, systolic blood pressure of 108.12 +/- 13.60 mmHg, diastolic blood pressure: 63.82 +/- 9.43 and waist circumference: 65.09 +/- 4.54 cm. TG/HDL ratio was 1.25 +/- 0.43, with a 95 percentile of 2.05. In adults, TG/HDL ratio greater than 3 is a marker of insulin resistance. We believe that a higher value to 2.05 might be a good index of insulin resistance in adolescence. TG/HDL ratio has the advantage of being methodologically simpler, more economical and independent of pubertal stage.

  20. Pleiotropic QTL on chromosome 19q13 for triglycerides and adiposity: the HERITAGE Family Study.

    PubMed

    Feitosa, Mary F; Rice, Treva; North, Kari E; Kraja, Aldi; Rankinen, Tuomo; Leon, Arthur S; Skinner, James S; Blangero, John; Bouchard, Claude; Rao, D C

    2006-04-01

    Motivated by strong correlations between plasma levels of triglycerides (TG) and adiposity traits, we conducted a series of bivariate genome-wide linkage analyses of TG with body mass index (BMI), total fat mass (FAT), percentage of body fat (FATPC), and abdominal subcutaneous fat (ASF). Maximum lod scores of 3.3, 3.0, 2.2 and 2.4, respectively, were found on chromosome 19q13. This linkage region includes the APOE gene, a predictor of variation in lipid-lipoprotein levels, and the hormone-sensitive lipase (LIPE) gene, a key enzyme in the mobilization of fatty acids from triglyceride stores. In addition, the adiposity measures together with the APOE marker showed significant association with TG levels (p = 0.02 to p = 0.03). In summary, these results suggest that one or more QTLs in the 19q13 region jointly influence TG levels and adiposity. Polymorphisms in the APOE gene, and possibly LIPE gene, appear to be strong candidates for the source of this pleiotropic QTL.

  1. Deviant early pregnancy maternal triglyceride levels and increased risk of congenital anomalies: a prospective community-based cohort study.

    PubMed

    Nederlof, M; de Walle, H E K; van Poppel, M N M; Vrijkotte, T G M; Gademan, M G J

    2015-08-01

    The maternal lipid profile could be of importance in congenital anomaly development. This study therefore investigates whether the maternal lipid profile during early pregnancy is associated with major nonsyndromic congenital anomalies (MNCA). Prospective community-based cohort study. Amsterdam Born Children and their Development (ABCD) study. A cohort of 3074 pregnant women recruited in 2003-2004 and their offspring. Non-fasting blood samples from pregnant women participating in the ABCD-study (median 12.9 weeks of gestation) were analysed for triglycerides (TG), cholesterol (TC), free fatty acids (FFA), apolipoprotein B (ApoB), and apolipoprotein A1 (ApoA) (n = 3074). The perinatal outcome (MNCA) was obtained from the Youth Health Care Registration and two questionnaires. Adjustment was made for ethnicity. MNCA prevalence. The prevalence of MNCA was 2.2% (n = 68: 20 cardiovascular, 25 bone and muscle, and 23 other single anomalies). A nonlinear association was found between maternal TG levels and MNCA prevalence. With a lower or higher level of maternal TG, the estimated probability increased: a TG level of 0.73 mmol/l (5th percentile), of 1.28 mmol/l (50th percentile), and of 2.35 mmol/l (95th percentile) corresponded with an estimated probability of 3.6, 2.1, and 2.9%, respectively. Unadjusted subgroup analyses showed that the U-shaped association was most prominent for cardiovascular congenital anomalies. Other lipids were not associated with MNCA. Both low and high maternal TG levels during early pregnancy were associated with an increased risk of MNCA in offspring. This suggests that an attempt should be made to normalise TG levels before or during early pregnancy; however, replication of our results is necessary before clinical practice recommendations can be made. © 2015 Royal College of Obstetricians and Gynaecologists.

  2. Clinical usefulness of lipid ratios, visceral adiposity indicators, and the triglycerides and glucose index as risk markers of insulin resistance.

    PubMed

    Du, Tingting; Yuan, Gang; Zhang, Muxun; Zhou, Xinrong; Sun, Xingxing; Yu, Xuefeng

    2014-10-20

    To directly compare traditional lipid ratios (total cholesterol [TC]/high density lipoprotein cholesterol [HDL-C], non-HDL-C/HDL-C, low density lipoprotein cholesterol [LDL-C]/HDL-C, and triglycerides [TG]/HDL-C), apolipoprotein B (apoB)/apolipoprotein A-I (apoA-I) ratio, visceral adiposity index (VAI), lipid accumulation product (LAP), and the product of TG and fasting glucose (TyG) for strength and independence as risk factors for insulin resistance (IR). We conducted a cross-sectional analysis of 7629 Chinese adults using data from the China Health and Nutrition Survey 2009. For all lipid ratios (traditional lipid ratios and apoB/apoA-I), among both sexes, TG/HDL-C explained the most additional percentage of variation in HOMA-IR (2.9% in men, and 2.3% in women); for all variables of interest, the variability in HOMA-IR explained by VAI and TG/HDL-C were comparable; TyG had the most significant association with HOMA-IR, which explained 9.1% for men and 7.8% for women of the variability in HOMA-IR. Logistic regression analysis showed the similar patterns. Receiver operating characteristic (ROC) curve analysis showed that, among both sexes, TG/HDL-C was a better discriminator of IR than apoB/apoA-I; the area under the ROC curve (AUC) for VAI (0.695 in men and 0.682 in women) was greater than that for TG/HDL-C (AUC 0.665 in men and 0.664 in women); TyG presented the greatest value of AUC (0.709 in men and 0.711 in women). The apoB/apoA-I performs no better than any of the traditional lipid ratios in correlating with IR. The TG/HDL-C, VAI and TyG are better markers for early identification of IR individuals.

  3. Triglycerides/glucose index is a useful surrogate marker of insulin resistance among adolescents.

    PubMed

    Kang, B; Yang, Y; Lee, E Y; Yang, H K; Kim, H-S; Lim, S-Y; Lee, J-H; Lee, S-S; Suh, B-K; Yoon, K-H

    2017-05-01

    Our aim was to investigate the association between the triglycerides/glucose index (TyG index) and the homeostasis model assessment-estimated insulin resistance (HOMA-IR) in the prediction of insulin resistance (IR) among adolescents. We conducted a cross-sectional study among 221 Korean adolescents (168 males and 53 females aged 9-13 years) from May to June 2014 in Chung-ju city. The TyG index was calculated as ln [triglycerides (mg dl -1 ) × fasting glucose (mg dl -1 )/2]. IR was defined using HOMA-IR >95th percentile for age and sex. In the IR group, weight, body mass index (BMI), waist circumference, body fat, fasting insulin, fasting plasma glucose, triglyceride levels and triglycerides/high-density lipoprotein cholesterol (TG/HDL-C) were significantly higher than that in the non-IR group. The TG index was significantly different between the IR group (n=22) and non-IR group (n=199), at 8.43±0.45 and 8.05±0.41, respectively (P<0.001). The TyG index was well correlated with HOMA-IR (r=0.41; P<0.001) and showed a strong positive association with TG/HDL-C (r=0.84; P<0.001). The cut-off of the TyG index for diagnosis of insulin resistance was 8.18. The TyG index is a simple, cost-effective surrogate marker of insulin resistance among adolescents compared with HOMA-IR.

  4. Ethnic differences in the ability of triglyceride levels to identify insulin resistance.

    PubMed

    Sumner, Anne E; Cowie, Catherine C

    2008-02-01

    The Metabolic Syndrome is used to predict the onset of coronary artery disease and Type 2 diabetes. As the predictive value of the Metabolic Syndrome has been challenged, alternative syndromes have been developed. All of these syndromes were developed in populations that were predominantly non-Hispanic white (NHW). They include the Enlarged Waist Elevated Triglyceride Syndrome, the Overweight-Lipid Syndrome and the Hypertriglyceridemic Waist Syndrome. The first applies to postmenopausal women, the second to overweight individuals (BMI> or =25 kg/m(2)), and the third to men. Each syndrome uses hypertriglyceridemia as a criterion. However, the definition of hypertriglyceridemia varies by syndrome i.e. TG> or =128 mg/dL for the Enlarged Waist Elevated Triglyceride Syndrome, TG> or =130 mg/dL for the Overweight-Lipid Syndrome, > or =150 mg/dL for the Metabolic Syndrome, and TG> or =176 mg/dL for the Hypertriglyceridemic Waist Syndrome. Insulin resistance and hypertriglyceridemia are highly correlated. But as insulin resistant non-Hispanic blacks (NHB) often have triglyceride (TG) levels below the thresholds set by these syndromes, the ability of either TG or these syndromes to identify high risk NHB is unknown. Using the National Health and Nutrition Examination Survey (NHANES) 1999-2002, our goals were to determine by ethnicity: (1) the prevalence of each of these syndromes; (2) the ability of fasting TG concentrations to identify insulin resistance at cut-off levels established by these syndromes, specifically 130, 150 and 176 mg/dL. Participants were 2804 adults from NHANES 1999-2002. The cohort was divided into tertiles of homeostasis model assessment. Insulin resistance was defined as the upper tertile (> or =2.73). The prevalence of each syndrome was lower in NHB than NHW or Mexican Americans (MA) (all P<0.05). Mean TG levels in NHB, non-Hispanic Whites (NHW) and Mexican Americans (MA) were: 99, 140 and 144mg/dL, respectively. The mean percents of insulin

  5. Comparative effectiveness of fish oil versus fenofibrate, gemfibrozil, and atorvastatin on lowering triglyceride levels among HIV-infected patients in routine clinical care

    PubMed Central

    Muñoz, Monica A; Liu, Wei; Delaney, Joseph AC; Brown, Elizabeth; Mugavero, Michael J; Mathews, W Chris; Napravnik, Sonia; Willig, James H; Eron, Joseph J; Hunt, Peter W; Kahn, James O; Saag, Michael S; Kitahata, Mari M; Crane, Heidi M

    2014-01-01

    Objective The goal of this study was to compare the effectiveness of fish oil, fenofibrate, gemfibrozil, and atorvastatin on reducing triglyceride (TG) levels among a large cohort of HIV-infected patients in clinical care. Design Retrospective observational cohort study Methods The primary endpoint was absolute change in TG levels measured using the last TG value pre-treatment and the first TG value post-treatment. A pre-post quasi-experimental design was used to estimate the change in TG due to initiating fish oil. Linear regression models examined the comparative effectiveness of treatment with fish oil versus gemfibrozil, fenofibrate, or atorvastatin for TG reduction. Models were adjusted for baseline differences in age, sex, race, CD4+ cell count, diabetes, body mass index, protease inhibitor use, and time between TG measures. Results A total of 493 patients (mean age 46 years; 95% male) were included (46 receiving gemfibrozil, 80 fenofibrate, 291 atorvastatin, 76 fish oil) with a mean baseline TG of 347 mg/dL. New use of fish oil decreased TGTG -45 mg/dL 95% Confidence interval (CI):-80 to -11) in the pre-post study. Compared with fish oil (reference), fibrates were more effective (ΔTG -66; 95% CI:-120 to -12) in reducing TG levels, whereas atorvastatin was not (ΔTG -39; 95% CI:-86 to 9). Conclusion In HIV-infected patients in routine clinical care, fish oil is less effective than fibrates (but not atorvastatin) at lowering triglyceride values. Fish oil may still represent an attractive alternative for patients with moderately elevated triglycerides particularly among patients who may not want or tolerate fibrates. PMID:23892238

  6. De novo synthesis of milk triglycerides in humans

    USDA-ARS?s Scientific Manuscript database

    Mammary gland (MG) de novo lipogenesis contributes significantly to milk fat in animals but little is known in humans. Objective: To test the hypothesis that the incorporation of 13C carbons from [U-13C]glucose into fatty acids (FA) and glycerol in triglycerides (TG) will be greater: 1) in milk tha...

  7. Alcoholic Extract of Lotus Leaves Improves Lipid Profile in Rats with HIV Protease Inhibitor-induced Dyslipidaemia

    PubMed Central

    Su, QJ; Lu, ZZ; Deng, QY; Wei, BM

    2015-01-01

    ABSTRACT Objective: To examine the effect of the alcoholic extract of lotus leaves (AELL) on antiretroviral treatment-induced dyslipidaemia in a rat model. Methods: Lotus leaves were extracted by 95% ethanol. Seventy male Sprague-Dawley rats were given lopinavir/ritonavir for six weeks. At weeks 0 and 6, sera were collected for measurement of total cholesterol (TC) and triglyceride (TG). Rats meeting the criteria for dyslipidaemia were assigned to four groups and received once daily for another four weeks lopinavir/ritonavir (group A), lopinavir/ritonavir plus 0.52 g/kg AELL (group B), lopinavir/ritonavir plus 0.26 g/kg AELL (group C), or lopinavir/ritonavir plus 0.13 g/kg AELL (group D), respectively. At weeks 8 and 10, blood samples were collected again for measurement of TC and TG. Results: Both TC and TG increased over time in group A during the observation period (weeks 6 to 10), however, TC and TG decreased in group B, and TG declined in group C. Neither TC nor TG could be reduced to a level near baseline. Conclusion: Alcoholic extract of lotus leaves may have the potential to treat dyslipidaemia related to highly active antiretroviral treatment, but may not be potent enough to reduce TC or TG concentrations to goal levels when used alone. PMID:26426169

  8. Application of Fourier-transform infrared (FT-IR) spectroscopy for simple and easy determination of chylomicron-triglyceride and very low density lipoprotein-triglyceride.

    PubMed

    Sato, Kenichi; Seimiya, Masanori; Kodera, Yoshio; Kitamura, Akihide; Nomura, Fumio

    2010-02-01

    Fourier-transform infrared (FT-IR) spectroscopy is a simple and reagent-free physicochemical analysis method, and is a potential alternative to more time-consuming and labor-intensive procedures. In this study, we aimed to use FT-IR spectroscopy to determine serum concentrations of chylomicron-triglyceride (TG) and very low density lipoprotein (VLDL)-TG. We analyzed a chylomicron fraction and VLDL fraction, which had been obtained by ultracentrifugation, to search for wavelengths to designate to each fraction. Then, partial least square (PLS) calibrations were developed using a training set of samples, for which TG concentrations had been determined by conventional procedures. Validation was conducted with another set of samples using the PLS model to predict serum TG concentrations on the basis of the samples' IR spectra. We analyzed a total of 150 samples. Serum concentrations of chylomicron-TG and VLDL-TG estimated by FT-IR spectroscopy agreed well with those obtained by the reference method (r=0.97 for both lipoprotein fractions). FT-IR spectrometric analysis required 15mul of serum and was completed within 1min. Serum chylomicron-TG and VLDL-TG concentrations can be determined with FT-IR spectroscopy. This rapid and simple test may have a great impact on the management of patients with dyslipidemia. Copyright 2009. Published by Elsevier B.V.

  9. Adipose Triglyceride Lipase Is Implicated in Fuel- and Non-fuel-stimulated Insulin Secretion*

    PubMed Central

    Peyot, Marie-Line; Guay, Claudiane; Latour, Martin G.; Lamontagne, Julien; Lussier, Roxane; Pineda, Marco; Ruderman, Neil B.; Haemmerle, Guenter; Zechner, Rudolf; Joly, Érik; Madiraju, S. R. Murthy; Poitout, Vincent; Prentki, Marc

    2009-01-01

    Reduced lipolysis in hormone-sensitive lipase-deficient mice is associated with impaired glucose-stimulated insulin secretion (GSIS), suggesting that endogenous β-cell lipid stores provide signaling molecules for insulin release. Measurements of lipolysis and triglyceride (TG) lipase activity in islets from HSL−/− mice indicated the presence of other TG lipase(s) in the β-cell. Using real time-quantitative PCR, adipose triglyceride lipase (ATGL) was found to be the most abundant TG lipase in rat islets and INS832/13 cells. To assess its role in insulin secretion, ATGL expression was decreased in INS832/13 cells (ATGL-knockdown (KD)) by small hairpin RNA. ATGL-KD increased the esterification of free fatty acid (FFA) into TG. ATGL-KD cells showed decreased glucose- or Gln + Leu-induced insulin release, as well as reduced response to KCl or palmitate at high, but not low, glucose. The KATP-independent/amplification pathway of GSIS was considerably reduced in ATGL-KD cells. ATGL−/− mice were hypoinsulinemic and hypoglycemic and showed decreased plasma TG and FFAs. A hyperglycemic clamp revealed increased insulin sensitivity and decreased GSIS and arginine-induced insulin secretion in ATGL−/− mice. Accordingly, isolated islets from ATGL−/− mice showed reduced insulin secretion in response to glucose, glucose + palmitate, and KCl. Islet TG content and FFA esterification into TG were increased by 2-fold in ATGL−/− islets, but glucose usage and oxidation were unaltered. The results demonstrate the importance of ATGL and intracellular lipid signaling for fuel- and non-fuel-induced insulin secretion. PMID:19389712

  10. Triglycerides and glucose index: a useful indicator of insulin resistance.

    PubMed

    Unger, Gisela; Benozzi, Silvia Fabiana; Perruzza, Fernando; Pennacchiotti, Graciela Laura

    2014-12-01

    Insulin resistance assessment requires sophisticated methodology of difficult application. Therefore, different estimators for this condition have been suggested. The aim of this study was to evaluate the triglycerides and glucose (TyG) index as a marker of insulin resistance and to compare it to the triglycerides/HDL cholesterol ratio (TG/HDL-C), in subjects with and without metabolic syndrome (MS). An observational, cross-sectional study was conducted on 525 adults of a population from Bahia Blanca, Argentina, who were divided into two groups: with MS (n=89) and without MS (n=436). The discriminating capacities for MS of the TyG index, calculated as Ln (TG [mg/dL] x glucose [mg/dL]/2), and the TG/HDL-C ratio were evaluated. Pre-test probability for MS was 30%. The mean value of the TyG index was higher in the group with MS as compared to the group without MS and its correlation with the TG/HDL-C ratio was good. The cut-off values for MS in the overall population were 8.8 for the TyG index (sensitivity=79%, specificity=86%), and 2.4 for the TG/HDL-C ratio (sensitivity=88%, specificity=72%). The positive likelihood ratios and post-test probabilities for these parameters were 5.8 vs 3.1 and 72% vs 58% respectively. The cut-off point for the TyG index was 8.8 in men and 8.7 in women; the respective values for TG/C-HDL were 3.1 in men and 2.2 in women. The TyG index was a good discriminant of MS. Its simple calculation warrants its further study as an alternative marker of insulin resistance. Copyright © 2014 SEEN. Published by Elsevier Espana. All rights reserved.

  11. The Triglyceride-to-HDL Cholesterol Ratio

    PubMed Central

    Giannini, Cosimo; Santoro, Nicola; Caprio, Sonia; Kim, Grace; Lartaud, Derek; Shaw, Melissa; Pierpont, Bridget; Weiss, Ram

    2011-01-01

    OBJECTIVE We evaluated whether the triglyceride-to-HDL cholesterol (TG/HDL-C) ratio is associated with insulin resistance (IR) in a large multiethnic cohort of obese youths. RESEARCH DESIGN AND METHODS Obese youths (1,452) had an oral glucose tolerance test and a fasting lipid profile. Insulin sensitivity was estimated using the whole body insulin sensitivity index (WBISI) and homeostasis model assessment (HOMA)-IR and evaluated, in a subgroup of 146 obese youths, by the hyperinsulinemic-euglycemic clamp. The cohort was divided by ethnicity (612 whites, 357 Hispanics, and 483 African Americans) and then stratified into ethnicity-specific tertiles of TG/HDL-C ratio. Differences across tertiles were evaluated, and the association between the TG/HDL-C ratio and insulin sensitivity (WBISI) was defined by a multiple stepwise linear regression analysis. The area under the receiver operating characteristic (ROC) curve (AUC) was determined to calculate the TG/HDL-C ratio cutoff to identify insulin-resistant subjects by ethnicity. RESULTS In each ethnic group and across rising tertiles of TG/HDL-C ratio, insulin sensitivity (WBISI) progressively decreased, whereas 2-h glucose and the AUC-glucose progressively increased. The cutoff for TG/HDL-C ratio was 2.27, and the odds of presenting with IR, in youths with TG/HDL-C ratio higher than the cutoff, was 6.023 (95% CI 2.798–12.964; P < 0.001) in white girls and boys, whereas for both Hispanics and African Americans the AUC-ROCs were not significant, thus not allowing the calculation of an optimal cutoff TG/HDL-C value. CONCLUSIONS The TG/HDL-C ratio is associated with IR mainly in white obese boys and girls and thus may be used with other risk factors to identify subjects at increased risk of IR-driven morbidity. PMID:21730284

  12. Influence of plasma cholesterol and triglyceride concentrations and eritoran (E5564) micelle size on its plasma pharmacokinetics and ex vivo activity following single intravenous bolus dose into healthy female rabbits.

    PubMed

    Wasan, Kishor M; Risovic, Verica; Sivak, Olena; Lee, Stephen D; Mason, Douglas X; Chiklis, Gregory R; McShane, Jim; Lynn, Melvyn; Wong, Nancy; Rossignol, Daniel P

    2008-01-01

    Eritoran (E5564) is a glycophospholipid that acts as a toll-like receptor 4 (TLR4) antagonist that is being tested as a treatment for severe sepsis and septic shock. In the blood, eritoran binds to plasma lipoproteins altering its pharmacokinetic and pharmacodynamic (PD) effects in vivo. The purpose of this study was to determine the influence of changes in plasma cholesterol and triglyceride concentrations on the plasma pharmacokinetics and ex vivo activity of eritoran following single intravenous bolus dosing of eritoran to healthy female rabbits fed either a regular chow diet or a cholesterol-enriched diet. This was done with eritoran administered as stable micelle formulations of mean hydrodynamic diameters of 8 or 27 nm). Female New Zealand White rabbits were fed a standard diet for 7 days and then randomly assigned either a regular chow diet [regular-diet (n = 9)] or a cholesterol-enriched diet [cholesterol-diet (n = 12)] for an additional 7 days. Following feeding of these diets a single intravenous bolus dose of eritoran (0.5 mg/kg) formulated into either "small micelles" (8 nm in diameter) or "large micelles" (27 nm in diameter) was administered to regular-fed and cholesterol-fed rabbits. Serial blood samples were obtained prior to eritoran administration and at the following times post injection: 0.083 (5 min), 1, 2, 4, 8, 10, 24, 48 and 72 h. Plasma was analyzed for eritoran concentrations using LC/MS/MS. Total plasma cholesterol (TC) and triglyceride (TG) levels were quantified using enzymatic kits. Plasma eritoran pharmacokinetic (PK) parameters were estimated by non-compartmental analysis using the WinNonlin nonlinear estimation program. To analyze PD activity, whole blood obtained at 0.083 (5 min), 2, 24, 48 and 72 h following eritoran administration was assessed for ex vivo activity by measuring the ability of 1 and 10 ng/ml LPS to elicit TNF-alpha release. Total plasma cholesterol and triglyceride levels were significantly higher in cholesterol

  13. Fatty acid compositions of triglycerides and free fatty acids in sebum depend on amount of triglycerides, and do not differ in presence or absence of acne vulgaris.

    PubMed

    Akaza, Narifumi; Akamatsu, Hirohiko; Numata, Shigeki; Matsusue, Miyuki; Mashima, Yasuo; Miyawaki, Masaaki; Yamada, Shunji; Yagami, Akiko; Nakata, Satoru; Matsunaga, Kayoko

    2014-12-01

    To clarify the influence of the fatty acid composition of sebum in acne vulgaris, we investigated the amounts and fatty acid compositions of triglycerides (TG) and free fatty acids (FFA), and the amounts of cutaneous superficial Propionibacterium acnes in acne patients and healthy subjects. The foreheads of 18 female patients, 10 male patients, 10 healthy females and 10 healthy males were studied in a Japanese population. There were significant differences in the amounts of sebum, TG and cutaneous superficial P. acnes, as well as the fatty acid compositions of TG and FFA between acne patients and healthy subjects in females. Their fatty acid compositions were correlated with the amount of TG with or without acne. It was clarified that the fatty acid compositions of TG and FFA depended on the amount of TG, and there were no differences in the fatty acid composition in the presence and absence of acne. © 2014 Japanese Dermatological Association.

  14. Central Nervous System Neuropeptide Y Signaling Modulates VLDL Triglyceride Secretion

    PubMed Central

    Stafford, John M.; Yu, Fang; Printz, Richard; Hasty, Alyssa H.; Swift, Larry L.; Niswender, Kevin D.

    2014-01-01

    OBJECTIVE Elevated triglyceride (TG) is the major plasma lipid abnormality in obese and diabetic patients and contributes to cardiovascular morbidity in these disorders. We sought to identify novel mechanisms leading to hypertriglyceridemia. Resistance to negative feedback signals from adipose tissue in key central nervous system (CNS) energy homeostatic circuits contributes to the development of obesity. Because triglycerides both represent the largest energy depot in the body and are elevated in both the plasma and adipose in obesity and diabetes, we hypothesized that the same neural circuits that regulate energy balance also regulate the secretion of TGs into plasma. RESEARCH DESIGN AND METHODS In normal fasting rats, the TG secretion rate was estimated by serial blood sampling after intravascular tyloxapol pretreatment. Neuropeptide Y (NPY) signaling in the CNS was modulated by intracerebroventricular injection of NPY, receptor antagonist, and receptor agonist. RESULTS A single intracerebroventricular injection of NPY increased TG secretion by 2.5-fold in the absence of food intake, and this was determined to be VLDL by fast performance liquid chromatography (FPLC). This effect was recapitulated by activating NPY signaling in downstream neurons with an NPY-Y5 receptor agonist. An NPY-Y1 receptor antagonist decreased the elevated TGs in the form of VLDL secretion rate by 50% compared with vehicle. Increased TG secretion was due to increased secretion of VLDL particles, rather than secretion of larger particles, because apolipoprotein B100 was elevated in FPLC fractions corresponding to VLDL. CONCLUSIONS We find that a key neuropeptide system involved in energy homeostasis in the CNS exerts control over VLDL-TG secretion into the bloodstream. PMID:18332095

  15. Triglyceride-to-high-density-lipoprotein-cholesterol ratio is an index of heart disease mortality and of incidence of type 2 diabetes mellitus in men.

    PubMed

    Vega, Gloria Lena; Barlow, Carolyn E; Grundy, Scott M; Leonard, David; DeFina, Laura F

    2014-02-01

    High triglyceride (TG) and low high-density lipoprotein cholesterol (HDL-C) impart risk for heart disease. This study examines the relationships of TG/HDL-C ratio to mortality from all causes, coronary heart disease (CHD), or cardiovascular disease (CVD). Survival analysis was done in 39,447 men grouped by TG/HDL-C ratio cut point of 3.5 and for metabolic syndrome. National Death Index International Classification of Diseases (ICD-9 and ICD-10) codes were used for CVD and CHD deaths occurring from 1970 to 2008. Incidence of type 2 diabetes mellitus (DM) according to ratio was estimated in 22,215 men. Triglyceride/HDL-C ratio and cross-product of TG and fasting blood glucose (TyG index) were used in analysis. Men were followed up for 581,194 person-years. Triglyceride/HDL-C ratio predicted CHD, CVD, and all-cause mortality after adjustment for established risk factors and non-HDL-C. Mortality rates were higher in individuals with a high ratio than in those with a low ratio. Fifty-five percent of men had metabolic syndrome that was also predictive of CHD, CVD, and all-cause mortality. Annual incidence of DM was 2 times higher in men with high TG/HDL-C ratio than in those with a low ratio. Individuals with high TG/HDL-C ratio had a higher incidence of DM than those with a low ratio. The TyG index was not equally predictive of causes of mortality to TG/HDL-C, but both were equally predictive of diabetes incidence. Triglyceride/HDL-C ratio predicts CHD and CVD mortality as well as or better than do metabolic syndrome in men. Also, a high ratio predisposes to DM. The TyG index does not predict CHD, CVD, or all-cause mortality equally well, but like TG/HDL-C ratio, it predicts DM incidence.

  16. Visceral adiposity index and triglyceride/high-density lipoprotein cholesterol ratio in hypogonadism.

    PubMed

    Haymana, Cem; Sonmez, Alper; Aydogdu, Aydogan; Tapan, Serkan; Basaran, Yalcin; Meric, Coskun; Baskoy, Kamil; Dinc, Mustafa; Yazici, Mahmut; Taslipinar, Abdullah; Barcin, Cem; Yilmaz, Mahmut Ilker; Bolu, Erol; Azal, Omer

    2017-01-01

    Cardiometabolic risk is high in patients with hypogonadism. Visceral adiposity index (VAI) and triglyceride/high-density lipoprotein cholesterol (TG/HDL-C) ratio are the practical markers of atherosclerosis and insulin resistance and independent predictors of cardiaovascular risk. To date, no study has evaluated VAI levels and TG/HDL-C ratio in hypogonadism. A total of 112 patients with congenital hypogonadotrophic hypogonadism (CHH) (mean age, 21.7 ± 2.06 years) and 124 healthy subjects (mean age, 21.5 ± 1.27 years) were enrolled. The demographic parameters, VAI, TG/HDL-C ratio, asymmetric dimethylarginine (ADMA), high-sensitivity C-reactive protein (hs-CRP), and homeostatic model assessment of insulin resistance (HOMA-IR) levels were measured for all participants. The patients had higher total cholesterol (p = 0.04), waist circumference, triglycerides, insulin, and HOMA-IR levels (p = 0.001 for all) than the healthy subjects. VAI and ADMA and TG/HDL-C levels were also higher in patients than in healthy subjects (p < 0.001 for all). VAI was weakly correlated with ADMA (r = 0.27, p = 0.015), HOMA-IR (r = 0.22, p = 0.006), hs-CRP (r = 0.19, p = 0.04), and total testosterone (r = -0.21, p = 0.009) levels, whereas TG/HDL-C ratio was weakly correlated weakly with ADMA (r = 0.30, p = 0.003), HOMA-IR (r = 0.22, p = 0.006), and total testosterone (r = -0.16, p = 0.03) levels. Neither VAI nor TG/HDL-C ratio determined ADMA, HOMA-IR, and hs-CRP levels. The results of this study demonstrate that patients with hypogonadism have elevated VAI and TG/HDL-C ratio. These values are significantly correlated with the surrogate markers of endothelial dysfunction, inflammation, and insulin resistance. However, the predictive roles of VAI and TG/HDL-C ratio are not significant. Prospective follow-up studies are warranted to clarify the role of VAI and TG/HDL-C ratio in predicting cardiometabolic risk in patients with hypogonadism.

  17. Polymorphisms in genes involved in the triglyceride synthesis pathway and marine omega-3 polyunsaturated fatty acid supplementation modulate plasma triglyceride levels.

    PubMed

    Ouellette, Catherine; Cormier, Hubert; Rudkowska, Iwona; Guénard, Frédéric; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

    2013-01-01

    Marine omega-3 (n-3) polyunsaturated fatty acids (PUFA) reduce plasma triglyceride (TG) levels. Genetic factors such as single nucleotide polymorphisms (SNPs) could be responsible for the variability of the plasma TG response to n-3 PUFA supplementation. Previous studies have demonstrated that n-3 PUFA supplementation using fish oil modified the expression levels of three genes involved in the TG synthesis pathway (GPAM, AGPAT3 and AGPAT4) in peripheral blood mononuclear cells. A total of 210 subjects consumed 5 g/day of a fish oil supplement for 6 weeks. Plasma lipids were measured before and after the supplementation period. Three SNPs in GPAM, 13 SNPs in AGPAT3 and 35 SNPs in AGPAT4 were genotyped. In an ANOVA for repeated measures adjusted for age, sex and BMI, genotype effects on plasma TG levels were observed for rs1838452 in AGPAT3 as well as for rs746731 and rs2293286 in AGPAT4. Genotype × supplementation interaction effects on plasma TG levels were observed for rs2792751 and rs17129561 in GPAM as well as for rs3798943 and rs9458172 in AGPAT4 (p < 0.05). These results suggest that SNPs in genes involved in the TG synthesis pathway may influence plasma TG levels after n-3 PUFA supplementation. © 2014 S. Karger AG, Basel.

  18. Correlation of CRP, fasting serum triglycerides and obesity as cardiovascular risk factors.

    PubMed

    Firdous, Samar

    2014-05-01

    To determine the correlation of C-reactive protein (CRP) with fasting triglycerides (TG) among pre-obese and obese patients without established diagnosis of coronary artery disease (CAD). A comparative cross-sectional study. Mayo Hospital, Lahore, from January to June 2010. Patients with BMI > 23 kg/m2 aged between 18 - 65 years were inducted and above variables were studied. Patients with signs of fluid retention, collagen vascular disease, CAD, patients on corticosteroids, immunomodulators or lipid lowering medications and febrile patients were not recruited. Body mass index was also determined. Independent sample t-test was applied to see the mean difference of age, CRP level and triglycerides level in relation to gender. Chi-square test was used to see the association between qualitative variables. ANOVA was applied to see CRP and fasting serum TG level in relation to BMI categories. Pearson correlation and simple linear regression was applied to see the dependency of CRP and triglycerides with BMI. P-value ² 0.05 was taken as significant. Raised CRP was major finding among all groups of BMI. Most of obese and pre-obese patients were young and middle aged and belonged to pre-obese group followed by class-1 and class-2 obesity. CRP level increased with body mass index. No such trend was observed for triglycerides. There was an intermediate positive correlation between CRP and BMI and triglycerides and BMI showed a weak negative correlation. If BMI increases by 1 unit on the average, CRP rises by 0.239 times and this unit rise was significant. Whereas 1 unit rise increase in triglycerides on the average cause CRP to decrease -0.006 times but this value was insignificant. Raised CRP and high fasting TG were major findings in all age groups especially among young and middle aged people. Obesity, hypertriglyceridemia and raised CRP are interrelated suggesting that obesity is not only linked to hypertriglyceridemia but vascular inflammation among pre-obese and obese

  19. Gender differences in the lipid profile of dyslipidemic subjects.

    PubMed

    Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Damaskos, Dimitris S; Bilianou, Helen I; Mihas, Constantinos; Milionis, Haralampos J; Kostakou, Peggy M; Cokkinos, Dennis V

    2009-03-01

    We evaluated the gender-associated differences in lipid profile of subjects intended to receive lipid-lowering therapy with emphasis on the associations between triglycerides (TG) and other plasma lipid variables. Lipid profiles of 1385 patients [aged 55+/-11 years, 549 women (40%)] were evaluated. Eligible subjects fulfilled one or more of the following criteria: total cholesterol (TC)>or=6.2 mmol/l, TG>or=1.7 mmol/l, and high-density lipoprotein cholesterol (HDL-C)<1.0 mmol/l. Patients were divided into subgroups according to TG and HDL-C levels. Women aged on average 3.5 years older, had higher TC and HDL-C, lower TG and a correspondingly lower TC/HDL-C ratio than men. High TG and low HDL-C in tandem appeared twice more frequently in men. Inverse correlations between HDL-C and TG levels were found to exist in the entire cohort (r=-0.354, p<0.001) and in all various subgroups. In the subgroup with TG<1.7 mmol/l, women had higher TC and HDL-C, lower TG levels and lower TC/HDL-C ratio compared with men. In the subgroup with TG>or=1.7 mmol/l, women had higher TC and HDL-C levels and lower TC/HDL ratio compared with men. In the subgroup with HDL-C>or=1.0 mmol/l women had higher HDL-C, lower TG levels and lower TC/HDL-C ratio compared with men. Elevated TG levels and low HDL-C in tandem are common lipid abnormalities in the clinical setting of primary and secondary preventions. Gender-associated differences in the lipid profile are evident in subjects presenting with dyslipidemia and might be of potential relevance for diagnostics and therapy for the prevention of atherosclerosis.

  20. Thyroglobulin (Tg) Testing Revisited: Tg Assays, TgAb Assays, and Correlation of Results With Clinical Outcomes.

    PubMed

    Netzel, Brian C; Grebe, Stefan K G; Carranza Leon, B Gisella; Castro, M Regina; Clark, Penelope M; Hoofnagle, Andrew N; Spencer, Carole A; Turcu, Adina F; Algeciras-Schimnich, Alicia

    2015-08-01

    Measurement of thyroglobulin (Tg) by mass spectrometry (Tg-MS) is emerging as a tool for accurate Tg quantification in patients with anti-Tg autoantibodies (TgAbs). The objective of the study was to perform analytical and clinical evaluations of two Tg-MS assays in comparison with immunometric Tg assays (Tg-IAs) and Tg RIAs (Tg-RIAs) in a cohort of thyroid cancer patients. A total of 589 samples from 495 patients, 243 TgAb-/252 TgAb+, were tested by Beckman, Roche, Siemens-Immulite, and Thermo-Brahms Tg and TgAb assays, two Tg-RIAs, and two Tg-MS assays. The frequency of TgAb+ was 58%, 41%, 27%, and 39% for Roche, Beckman, Siemens-Immulite, and Thermo-Brahms, respectively. In TgAb- samples, clinical sensitivities and specificities of 100% and 74%-100%, respectively, were observed across all assays. In TgAb+ samples, all Tg-IAs demonstrated assay-dependent Tg underestimation, ranging from 41% to 86%. In TgAb+ samples, the use of a common cutoff (0.5 ng/mL) for the Tg-MS, three Tg-IAs, and the USC-RIA improved the sensitivity for the Tg-MSs and Tg-RIAs when compared with the Tg-IAs. In up to 20% of TgAb+ cases, Tg-IAs failed to detect Tg that was detectable by Tg-MS. In Tg-RIAs false-high biases were observed in TgAb+ samples containing low Tg concentrations. Tg-IAs remain the method of choice for Tg quantitation in TgAb- patients. In TgAb+ patients with undetectable Tg by immunometric assay, the Tg-MS will detect Tg in up to 20% additional cases. The Tg-RIA will detect Tg in approximately 35% cases, but a significant proportion of these will be clinical false-positive results. The undetectable Tg-MS seen in approximately 40% of TgAb+ cases in patients with disease need further evaluation.

  1. Association between triglyceride levels and cardiovascular disease in patients with acute pancreatitis.

    PubMed

    Copeland, Laurel A; Swendsen, C Scott; Sears, Dawn M; MacCarthy, Andrea A; McNeal, Catherine J

    2018-01-01

    Conventional wisdom supports prescribing "fibrates before statins", that is, prioritizing treatment of hypertriglyceridemia (hTG) to prevent pancreatitis ahead of low-density lipoprotein cholesterol to prevent coronary heart disease. The relationship between hTG and acute pancreatitis, however, may not support this approach to clinical management. This study analyzed administrative data from the Veterans Health Administration for evidence of (1) temporal association between assessed triglycerides level and days to acute pancreatitis admission; (2) association between hTG and outcomes in the year after hospitalization for acute pancreatitis; (3) relative rates of prescription of fibrates vs statins in patients with acute pancreatitis; (4) association of prescription of fibrates alone versus fibrates with statins or statins alone with rates of adverse outcomes after hospitalization for acute pancreatitis. Only modest association was found between above-normal or extremely high triglycerides and time until acute pancreatitis. CHD/MI/stroke occurred in 23% in the year following AP, supporting cardiovascular risk management. Fibrates were prescribed less often than statins, defying conventional wisdom, but the high rates of cardiovascular events in the year following AP support a clinical focus on reducing cardiovascular risk factors.

  2. Association of first-trimester maternal lipid profiles and triglyceride-glucose index with the risk of gestational diabetes mellitus and large for gestational age newborn.

    PubMed

    Pazhohan, Azar; Rezaee Moradali, Monireh; Pazhohan, Nahideh

    2017-11-20

    To evaluate the association of maternal first-trimester plasma lipid profiles, fasting plasma glucose (FPG), and triglyceride (TyG) index with the risk of gestational diabetes mellitus (GDM) and large for gestational age (LGA) infant in Iranian mothers. Nine hundred and fifty-four healthy pregnant women were prospectively followed till after delivery. Maternal fasting lipids and glucose concentration were measured at nine-week gestation on average. We used generalized linear models to calculate the relative risks and 95% confidence intervals. The incidence of GDM and LGA infants among our participants was 18.4% and 26.1%, respectively. There was a significant correlation between the increase in FPG, triglyceride, TG/HDL-C ratio, as well as TyG index with the risk of GDM and LGA infant. After adjusting for potential confounders, the relative risk of GDM in women in the top tertile of FPG, triglyceride (TG), triglyceride/high-density lipoprotein-cholesterol (TG/HDL-C) and TyG index was 4.2-, 4.2-, 3.9-, and 4.9-folds of its risk in women in the bottom tertile, respectively. Also after adjusting for GDM, the relative risk of LGA infants in women in the top tertile of FPG, TG, TG/HDL-C ratio and TyG index was 3.9-, 4.3-, 4.8-, and 5.3-folds of its risk in women in the bottom tertile, respectively. Based on our findings, TyG index is more robust early predictors of GDM and LGA in Iranian women.

  3. Systemic delivery of estradiol, but not testosterone or progesterone, alters very low density lipoprotein-triglyceride kinetics in postmenopausal women.

    PubMed

    Smith, Gordon I; Reeds, Dominic N; Okunade, Adewole L; Patterson, Bruce W; Mittendorfer, Bettina

    2014-07-01

    Sexual dimorphism in plasma triglyceride (TG) metabolism is well established but it is unclear to what extent it is driven by differences in the sex hormone milieu. RESULTS from previous studies evaluating the effects of sex steroids on plasma TG homeostasis are inconclusive because they relied on orally administered synthetic hormone preparations or evaluated only plasma lipid concentrations but not kinetics. The purpose of this study was to evaluate the effects of systemically delivered 17β-estradiol, progesterone, and T on very low density lipoprotein-triglyceride (VLDL-TG) concentration and kinetics in postmenopausal women. VLDL-TG concentration and kinetics were evaluated by using stable isotope-labeled tracer techniques in four groups of postmenopausal women (n = 27 total) who were studied before and after treatment with either 17β-estradiol (0.1 mg/d via continuous delivery skin patch), progesterone (100 mg/d via vaginal insert) and T (12.5 mg/d via skin gel), or no intervention (control group). VLDL-TG concentration and kinetics were unchanged in the control group and not altered by T and progesterone administration. Estradiol treatment, in contrast, reduced VLDL-TG concentration by approximately 30% due to accelerated VLDL-TG plasma clearance (25.1 ± 2.5 vs. 17.4 ± 2.7 mL/min; P < .01). Estradiol, but not progesterone or T, is a major regulator of VLDL-TG metabolism.

  4. In vivo determination of triglyceride (TG) secretion in rats fed different dietary saturated fats using (2- sup 3 H)-glycerol

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lai, H.C.; Yang, H.; Lasekan, J.

    1990-02-26

    Male, Sprague-Dawley rats (154{plus minus}1 g) were fed diets containing 2% corn oil (CO) + 14% butterfat (BF), beef tallow (BT), olive oil (OO) or coconut oil (CN) vs a 16% CO control diet for 5 weeks. Changes in plasma TG specific activity (dpm/mg TG) were determined in individual unanesthetized rats after injection of 100 {mu}Ci (2-{sup 3}H)-glycerol via a carotid cannula. Fractional rate constants were obtained using a 2-compartment model and nonlinear regression analysis. Results demonstrated no difference in the fractional rate constants among dietary groups; but, differences in the rates of hepatic TG secretion were noted. Rats fedmore » BT showed a higher rate of hepatic TG secretion than rats fed CO. Rats fed BF, OO or CN showed somewhat higher rates of hepatic TG secretion than CO. VLDL TG, phospholipid, and apolipoprotein B and E levels were higher with saturated fats vs CO. The data suggest that the higher plasma TG levels noted in response to feeding saturated fats vs corn oil can be explained, in part, by an increased flux of hepatic TG secretion.« less

  5. Lipid accumulation product and triglycerides/glucose index are useful predictors of insulin resistance.

    PubMed

    Mazidi, Mohsen; Kengne, Andre-Pascal; Katsiki, Niki; Mikhailidis, Dimitri P; Banach, Maciej

    2018-03-01

    To investigate the association of triglycerides/glucose index (TyG index), anthropometrically predicted visceral adipose tissue (apVAT), lipid accumulation product (LAP), visceral adiposity index (VAI) and triglycerides (TG):high density lipoprotein-cholesterol (HDL-C) ratio with insulin resistance (IR) in adult Americans. This study was based on data from three NHANES cycles (2005 to 2010). The TyG index was calculated as ln [TG×fasting glucose/2]. VAI was calculated using gender-specific formulas: men [waist circumference (WC)/39.68+(1.88×body mass index (BMI)]×(TG/1.03)×(1.31/HDL-C); women: [WC/36.58+(1.89×BMI)]×(TG/0.81)×(1.52/HDL-C). LAP index was calculated as [WC-65]×[TG] in men, and [WC-58]×[TG] in women. Correlation and regression analyses accounted for the complex sampling of database. A total of 18,318 subjects was included in this analysis [mean age 47.6Years]; 48.7% (n=8918) men]. The homeostatic model assessment of insulin resistance (HOMA-IR) had a significant positive correlation with the TyG index (r=0.502), LAP (r=0.551), apVAT (r=0.454), TG:HDL-C ratio (r=0.441) and VAI (r=451) (p<0.001 for all comparisons). Bland-Altman plots showed no systematic errors. The optimal cut-off to predict HOMA-diagnosed IR was 0.473 (sensitivity=74.5% and specificity=72.7%) for LAP, 0.478 (75.9%, 71.9%) for TyG, 0.391 (70.4%, 67.1%) for VAI, 0.392 (77.1% and 62.0%) for TG:HDL-C ratio and 0.381 (63.8%, 74.8%) for apVAT. The LAP index is a simple, cheap and accurate although not perfect, surrogate marker of HOMA-diagnosed IR among adult Americans. Moreover, it has higher predictability than other screening tools which traditionally applied. Among the markers, apVAT had the highest specificity and the TG:HDL-C ratio had the highest sensitivity. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Relationship between Plasma Triglyceride Level and Severity of Hypertriglyceridemic Pancreatitis.

    PubMed

    Wang, Sheng-Huei; Chou, Yu-Ching; Shangkuan, Wei-Chuan; Wei, Kuang-Yu; Pan, Yu-Han; Lin, Hung-Che

    2016-01-01

    Hypertriglyceridemia is the third most common cause of acute pancreatitis, but whether the level of triglyceride (TG) is related to severity of pancreatitis is unclear. To evaluate the effect of TG level on the severity of hypertriglyceridemic pancreatitis (HTGP). Retrospective cohort study. We reviewed the records of 144 patients with HTGP from 1999 to 2013 at Tri-Service General Hospital. Patients with possible etiology of pancreatitis, such as gallstones, those consuming alcohol or drugs, or those with infections were excluded. The classification of severity of pancreatitis was based on the revised Atlanta classification. We allocated the patients into high-TG and low-TG groups based on the optimal cut-off value (2648 mg/dL), which was derived from the receiver operating characteristic (ROC) curve between TG level and severity of HTGP. We then compared the clinical characteristics, pancreatitis severity, and mortality rates of the groups. There were 66 patients in the low-TG group and 78 patients in the high-TG group. There was no significant difference in the age, sex ratio, body mass index, and comorbidity between the 2 groups. The high-TG group had significantly higher levels of glucose (P = 0.022), total cholesterol (P = 0.002), and blood urea nitrogen (P = 0.037), and lower levels of sodium (P = 0.003) and bicarbonate (P = 0.002) than the low-TG group. The incidences of local complication (P = 0.002) and severe and moderate form of pancreatitis (P = 0.004) were significantly higher in the high-TG group than in the low-TG group. The mortality rate was higher in the high-TG group than in the low-TG group (P = 0.07). Higher TG level in patients with HTGP may be associated with adverse prognosis, but randomized and prospective studies are needed in the future verify this relationship.

  7. The suprachiasmatic nucleus drives day-night variations in postprandial triglyceride uptake into skeletal muscle and brown adipose tissue.

    PubMed

    Moran-Ramos, Sofía; Guerrero-Vargas, Natali N; Mendez-Hernandez, Rebeca; Basualdo, Maria Del Carmen; Escobar, Carolina; Buijs, Ruud M

    2017-12-01

    What is the central question of this study? What are the factors influencing day-night variations in postprandial triglycerides? What is the main finding and its importance? Rats show low postprandial plasma triglyceride concentrations early in the active period that are attributable to a higher uptake by skeletal muscle and brown adipose tissue. We show that these day-night variations in uptake are driven by the suprachiasmatic nucleus, probably via a Rev-erbα-mediated mechanism and independent of locomotor activity. These findings highlight that the suprachiasmatic nucleus has a major role in day-night variations in plasma triglycerides and that disturbances in our biological clock might be an important risk factor contributing to development of postprandial hyperlipidaemia. Energy metabolism follows a diurnal pattern, mainly driven by the suprachiasmatic nucleus (SCN), and disruption of circadian regulation has been linked to metabolic abnormalities. Indeed, epidemiological evidence shows that night work is a risk factor for cardiovascular disease, and postprandial hyperlipidaemia is an important contributor. Therefore, the aim of this work was to investigate the factors that drive day-night variations in postprandial triglycerides (TGs). Intact and SCN-lesioned male Wistar rats were subjected to an oral fat challenge during the beginning of the rest phase (day) or the beginning of the active phase (night). The plasma TG profile was evaluated and tissue TG uptake assayed. After the fat challenge, intact rats showed lower postprandial plasma TG concentrations early in the night when compared with the day. However, no differences were observed in the rate of intestinal TG secretion between day and night. Instead, there was a higher uptake of TG by skeletal muscle and brown adipose tissue early in the active phase (night) when compared with the rest phase (day), and these variations were abolished in rats bearing bilateral SCN lesions. Rev-erbα gene expression

  8. A single nucleotide polymorphism in APOA5 determines triglyceride levels in Hong Kong and Guangzhou Chinese

    PubMed Central

    Jiang, Chao Qiang; Liu, Bin; Cheung, Bernard MY; Lam, Tai Hing; Lin, Jie Ming; Li Jin, Ya; Yue, Xiao Jun; Ong, Kwok Leung; Tam, Sidney; Wong, Ka Sing; Tomlinson, Brian; Lam, Karen SL; Thomas, G Neil

    2010-01-01

    Single nucleotide polymorphisms (SNPs) in the apolipoprotein A5 (APOA5) gene have been associated with hypertriglyceridaemia. We investigated which SNPs in the APOA5 gene were associated with triglyceride levels in two independent Chinese populations. In all, 1375 subjects in the Hong Kong Cardiovascular Risk Factor Prevalence Study were genotyped for five tagging SNPs chosen from HapMap. Replication was sought in 1996 subjects from the Guangzhou Biobank Cohort Study. Among the five SNPs, rs662799 (-1131T>C) was strongly related to log-transformed triglyceride levels among Hong Kong subjects (β=0.192, P=2.6 × 10−13). Plasma triglyceride level was 36.1% higher in CC compared to TT genotype. This association was confirmed in Guangzhou subjects (β=0.159, P=1.3 × 10−12), and was significantly irrespective of sex, age group, obesity, metabolic syndrome, hypertension, diabetes, smoking and alcohol drinking. The odds ratios and 95% confidence interval for plasma triglycerides ≥1.7 mmol/l associated with TC and CC genotypes were, respectively, 1.81 (1.37–2.39) and 2.22 (1.44–3.43) in Hong Kong and 1.27 (1.05–1.54) and 1.97 (1.42–2.73) in Guangzhou. Haplotype analysis suggested the association was due to rs662799 only. The corroborative findings in two independent populations indicate that the APOA5-1131T>C polymorphism is an important and clinically relevant determinant of plasma triglyceride levels in the Chinese population. PMID:20571505

  9. The hypertriglyceridemic clamp technique. Studies using long-chain and structured triglyceride emulsions in healthy subjects.

    PubMed

    Nordenström, Jörgen; Thörne, Anders; Aberg, Wiveca; Carneheim, Claes; Olivecrona, Thomas

    2006-11-01

    In a randomized crossover study, plasma kinetics of 2 different types of fat emulsions were studied in 8 healthy volunteers by using a hypertriglyceridemic clamp technique. The method involves the stabilization of serum triglyceride (TG) concentration during 180 minutes at a predetermined level (4 mmol/L) by adjustment of TG infusion rate by repeated online measurements of serum TG concentration. The fat emulsions under study were a long-chain fatty acid triglyceride (LCT) emulsion (Intralipid 20%, Fresenius Kabi, Sweden) and a structured triglyceride (STG) emulsion (Structolipid 20%, Fresenius Kabi) where medium- and long-chain fatty acids have been interesterified within a TG molecule. The hypertriglyceridemic clamp was found to have acceptable reproducibility when tested in 3 healthy individuals on 2 different occasions, as similar steady-state TG levels were obtained by infusing similar amounts of fat. The average (+/-SEM) TG concentration during the 180-minute clamp was similar for STGs and LCTs (4.0 +/- 0.1 vs 3.9 +/- 0.1 mmol/L; not significant), but the amount of fat that had to be infused was significantly higher during STG than during LCT clamping (0.31 +/- 0.04 vs 0.21 +/- 0.02 g TG per minute; P < .05). Higher serum levels of free fatty acids (1.80 +/- 0.13 vs 0.96 +/- 0.09 mmol/L; P < .05), free glycerol (1.30 +/- 0.07 vs 0.76 +/- 0.08 mmol/L; P < .001), and beta-OH butyrate (1.61 +/- 0.44 vs 1.17 +/- 0.23 mmol/L; not significant) were obtained at the end of the clamp during infusion of STGs compared with LCTs. During infusion of STGs the medium-chain fatty acids octanoic (C:8) and decanoic acid (C:10) constituted approximately half of circulating fatty acids that correspond to the compositional ratio of the emulsion. Plasma lipoprotein lipase (LPL) concentration was higher during STG than during LCT clamping (6.06 +/- 0.62 vs 3.15 +/- 0.40 mU/mL; P < .05), and there was a positive correlation between the mean LPL concentration and the amount of

  10. [Applied studies of structured triglycerides for parenteral nutrition in severe hemorrhagic shock patients after resuscitation].

    PubMed

    Su, Mao-sheng; He, Lei; Liu, Zhi-wei; Ma, Huan-xian; Zhao, Qing-hua; Zhang, Wen-zhi

    2012-03-27

    To evaluate the effects of structured triglycerides in parenteral nutrition versus a physical medium-chain triglycerides (MCT)/long-chain triglycerides (LCT) mixture on severe hemorrhagic shock patients after resuscitation. In a randomized trial, we studied 20 critical patients with a total blood loss of over 3000 ml perioperatively and/or intraoperatively. The use of triglycerides started from Day 3 postoperation and parenteral nutrition lasted for no less than 5 days. They were allocated to receive one of two nutrition regiments: structured triglycerides in Group A (n = 10) and MCT/LCT in Group B (n = 10). There were no significant differences of general conditions in two groups. Before the start of parenteral nutrition (d0), d1 d3 and d5 after start of infusion, the following parameters were measured: hemoglobin (Hb), platelet count (Plt), alanine aminotransferase (ALT), total bilirubin (TB), direct bilirubin (DB), serum triglycerides (TG), prealbumin (PA) and transferrin (TF). And mean artery pressure (MAP), heart rate (HR) and central vein pressure (CVP) were also recorded at the same time-points. Then the post-TG changes of the above data were compared in both groups. After the use of triglycerides, there were no significant differences of MAP, HR, CVP, Hb and Plt in both groups (P > 0.05). At D3 and D5, the serum levels of TG ((2.1 ± 0.4) vs (1.6 ± 0.6) mg/L, (2.3 ± 0.7) vs (1.5 ± 0.3) mg/L) and alanine aminotransferase ((133 ± 58) vs (97 ± 26) U/L; (116 ± 48) vs (77 ± 31) U/L) were significantly higher in Group B versus those receiving structured triglycerides in Group A (P < 0.05). TB ((18 ± 15) vs (18 ± 11) µmol/L) and DB ((8.9 ± 3.2) vs (8.8 ± 2.5) µmol/L) had no significant differences in two groups (P > 0.05). The serum levels of such nutrition markers as PA ((195 ± 55) vs (166 ± 55) mg/L,(245 ± 53) vs (195 ± 58) mg/L) and TF ((2.6 ± 0.5) vs (2.5 ± 0.6) g/L, (3.3 ± 0.8) vs (2.9 ± 0.6) g/L)were significantly higher in Group A than

  11. Inverse association between triglycerides-to-HDL-cholesterol ratio and alcohol drinking in middle-aged Japanese men.

    PubMed

    Wakabayashi, Ichiro

    2012-11-01

    Triglycerides-to-high-density-lipoprotein (HDL)-cholesterol ratio (TG/HDL-C ratio) has been proposed to be a useful predictor of cardiovascular disease. Habitual alcohol drinking causes elevation of triglycerides and HDL cholesterol levels. The purpose of this study was to determine how the TG/HDL-C ratio is influenced by alcohol intake. Subjects were 21,572 Japanese men (age range: 35-60 years) who were divided into non-, light (<22 g ethanol/day), heavy (≥22 but <44 g ethanol/day), and very heavy (≥44 g ethanol/day) drinkers. The relationship between alcohol intake and TG/HDL-C ratio was investigated by using analysis of covariance and logistic regression analysis. Log-transformed TG/HDL-C ratio was significantly lower in light, heavy, and very heavy drinkers than in nondrinkers and was lowest in light drinkers. Odds ratios for high TG/HDL-C ratios in light and heavy drinkers versus nondrinkers were significantly lower than a reference level of 1.00 (light drinkers: 0.63, 95% CI [0.57, 0.71],p < .01); heavy drinkers: 0.75, 95% CI [0.69, 0.81],p < .01]). Odds ratios for high waist-to-height ratio of subjects with versus subjects without high TG/HDL-C ratios were significantly higher than the reference level in non-, light, heavy, and very heavy drinkers and were significantly lower in heavy and very heavy drinkers than in nondrinkers (nondrinkers: 3.84 [3.42,4.31]; light drinkers: 3.65 [2.97,4.48]; heavy drinkers: 3.17 [2.84, 3.54],p < .05 compared with nondrinkers; very heavy drinkers: 2.61 [2.29, 2.97],p < .01 compared with nondrinkers). Alcohol drinking is inversely associated with TG/ HDL-C ratio and confounds the relationship between TG/HDL-C ratio and obesity.

  12. Influence of age and gender on triglycerides-to-HDL-cholesterol ratio (TG/HDL ratio) and its association with adiposity index.

    PubMed

    Wakabayashi, Ichiro

    2012-01-01

    TG/HDL ratio has been proposed to be a good predictor of cardiovascular disease. The aim of this study was to determine whether TG/HDL ratio and its association with adiposity index are modified by age and gender. Subjects were younger (35-40 years) and older (60-70 years) Japanese men and women (n=16,825) receiving health checkup examinations. TG/HDL ratio and its relationship with adiposity index such as waist-to-height ratio (WHtR) were compared between the age pair and between the gender pair. Log-transformed TG/HDL ratio was significantly higher in older women than in younger women, while log-transformed TG/HDL ratio was comparable in younger and older men. The odds ratio (OR) for high TG/HDL ratio in subjects with vs. subjects without high WHtR was significantly lower in older men and women than in younger men and women, respectively. The OR was significantly lower in younger men than in younger women [4.08 (3.63-4.58) (younger men) vs. 8.42 (5.55-12.78) (younger women), p<0.01], whereas the OR was significantly lower in older women than in older men [3.36 (2.87-3.93) (older men) vs. 1.93 (1.31-2.85) (older women), p<0.01]. The results suggest that TG/HDL ratio is comparable in younger and older men but that TG/HDL ratio is higher in older women than in younger women and that the association between obesity and high TG/HDL ratio declines with age and is stronger in younger women than in younger men, while the association is weaker in older women than in older men. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  13. Systemic Free Fatty Acid Disposal Into Very Low-Density Lipoprotein Triglycerides

    PubMed Central

    Koutsari, Christina; Mundi, Manpreet S.; Ali, Asem H.; Patterson, Bruce W.; Jensen, Michael D.

    2013-01-01

    We measured the incorporation of systemic free fatty acids (FFA) into circulating very low-density lipoprotein triglycerides (VLDL-TGs) under postabsorptive, postprandial, and walking conditions in humans. Fifty-five men and 85 premenopausal women with BMI 18–24 (lean) and 27–36 kg/m2 (overweight/obese) received an intravenous bolus injection of [1,1,2,3,3-2H5]glycerol (to measure VLDL-TG kinetics) and either [1-14C]palmitate or [9,10-3H]palmitate to determine the proportion of systemic FFA that is converted to VLDL-TG. Experiments started at 0630 h after a 12-h overnight fast. In the postabsorptive protocol, participants rested and remained fasted until 1330 h. In the postprandial protocol, volunteers ingested frequent portions of a fat-free smoothie. In the walking protocol, participants walked on a treadmill for 5.5 h at ∼3× resting energy expenditure. Approximately 7% of circulating FFA was converted into VLDL-TG. VLDL-TG secretion rates (SRs) were not statistically different among protocols. Visceral fat mass was the only independent predictor of VLDL-TG secretion, explaining 33–57% of the variance. The small proportion of systemic FFA that is converted to VLDL-TG can confound the expected relationship between plasma FFA concentration and VLDL-TG SRs. Regulation of VLDL-TG secretion is complex in that, despite a broad spectrum of physiological FFA concentrations, VLDL-TG SRs did not vary based on different acute substrate availability. PMID:23434937

  14. How Do Elevated Triglycerides and Low HDL-Cholesterol Affect Inflammation and Atherothrombosis?

    PubMed Central

    Welty, Francine K.

    2015-01-01

    This review article summarizes recent research into the mechanisms as to how elevated levels of triglyceride (TG) and low levels of high- density- lipoprotein cholesterol (HDL-C) contribute to inflammation and atherosclerosis. Evidence supports the role of TG-rich lipoproteins in signaling mechanisms via apolipoproteins C-III and free fatty acids leading to activation of NFKβ, VCAM-1 and other inflammatory mediators which lead to fatty streak formation and advanced atherosclerosis. Moreover, the cholesterol content in TG-rich lipoproteins has been shown to predict CAD risk better than LDL-C. In addition to reverse cholesterol transport, HDL has many other cardioprotective effects which include regulating immune function. The “functionality” of HDL appears more important than the level of HDL-C. Insulin resistance and central obesity underlie the pathophysiology of elevated TG and low HDL-C in metabolic syndrome and type 2 diabetes. Lifestyle recommendations including exercise and weight loss remain first line therapy in ameliorating insulin resistance and the adverse signaling processes from elevated levels of TG-rich lipoproteins and low HDL-C. PMID:23881582

  15. Values of (99m)Tc-methoxyisobutylisonitrile imaging after first-time large-dose (131)I therapy in treating differentiated thyroid cancer.

    PubMed

    Pan, Xiaomei; Duan, Dong; Zhu, Yuquan; Pang, Hua; Guan, Lili; Lv, Zhixiang

    2016-01-01

    The aim of this study is to investigate the use of (99m)Tc-methoxyisobutylisonitrile (MIBI) imaging for evaluating the treatment response of differentiated thyroid cancer (DTC) after the first administration of a high dose of (131)I. Patients with DTC who received (131)I therapy underwent (99m)Tc-MIBI imaging after successive increases in the therapeutic dose of (131)I, and the serum levels of thyroglobulin (Tg) were measured. A total of 191 patients were enrolled in the final analysis, including 65 metastases and/or thyroid remnant-positive patients (22 patients with metastases and 43 patients with thyroid remnants). The sensitivity of (99m)Tc-MIBI imaging for detecting positive cases and thyroid remnants was 56.9% and 39.5%, respectively, which was significantly lower than that of (131)I imaging (92.3% and 100%, respectively, P<0.01 for both). The sensitivity of (99m)Tc-MIBI imaging for detecting metastases was 90.9%, which was slightly higher than that of (131)I imaging (77.3%, P>0.05). The Tg levels in the positive group were significantly higher than that in the negative group (P<0.01). In addition, the Tg levels in the (99m)Tc-MIBI(+)/(131)I(-) group were significantly higher than that in the (131)I(+)/(99m)Tc-MIBI group (P<0.05). After the first (131)I therapy, although (99m)Tc-MIBI imaging was able to detect the existence of metastatic lesions in patients with DTC better, its assessment for the removal efficiency of thyroid remnants was unsatisfactory. The results of (99m)Tc-MIBI imaging showed good correlations with the Tg level.

  16. Association of lipoprotein lipase S447X, apolipoprotein E exon 4, and apoC3 -455T>C polymorphisms on the susceptibility to diabetic nephropathy.

    PubMed

    Ng, M C Y; Baum, L; So, W-Y; Lam, V K L; Wang, Y; Poon, E; Tomlinson, B; Cheng, S; Lindpaintner, K; Chan, J C N

    2006-07-01

    Diabetic nephropathy (DN) is the leading cause of end-stage renal disease. In DN patients, triglyceride (TG) level is elevated and lipoprotein lipase (LPL) activity, which hydrolyzes TG, is decreased. The LPL S447X and apolipoprotein E (APOE) exon 4 polymorphisms affect TG levels, and the APOC3 -455T>C polymorphism affects LPL activity. Our aim was to examine the association of these polymorphisms with nephropathy in type 2 diabetes. We examined these polymorphisms in a case-control study of type 2 diabetic patients including 374 with DN and 392 without DN. LPL 447X-containing genotypes (447X+) were significantly decreased in DN patients [18.6 vs 25.6%, odds ratio (OR) = 0.66, p = 0.02], as were APOE epsilon3/epsilon3 genotypes (64.8 vs 73.1%, OR = 0.68, p = 0.01). In addition, combinations of genotypes [APOE epsilon3/epsilon3 and LPL 447X+ (OR = 0.56), APOC3 CC and LPL 447X+ (OR = 0.31), APOE epsilon3/epsilon3 and APOC3 CC (OR = 0.61] were protective for DN compared with the most common combination of the respective polymorphisms. Our findings suggest the importance of interactions among lipid genes in modulating the risk of DN.

  17. Association of SNP3 polymorphism in the apolipoprotein A-V gene with plasma triglyceride level in Tunisian type 2 diabetes

    PubMed Central

    Chaaba, Raja; Attia, Nebil; Hammami, Sonia; Smaoui, Maha; Mahjoub, Sylvia; Hammami, Mohamed; Masmoudi, Ahmed Slaheddine

    2005-01-01

    Background Apolipoprotein A-V (Apo A-V) gene has recently been identified as a new apolipoprotein involved in triglyceride metabolism. A single nucleotide polymorphism (SNP3) located in the gene promoter (-1131) was associated with triglyceride variation in healthy subjects. In type 2 diabetes the triglyceride level increased compared to healthy subjects. Hypertriglyceridemia is a risk factor for coronary artery disease. We aimed to examine the interaction between SNP3 and lipid profile and coronary artery disease (CAD) in Tunisian type 2 diabetic patients. Results The genotype frequencies of T/T, T/C and C/C were 0.74, 0.23 and 0.03 respectively in non diabetic subjects, 0.71, 0.25 and 0.04 respectively in type 2 diabetic patients. Triglyceride level was higher in heterozygous genotype (-1131 T/C) of apo A-V (p = 0.024). Heterozygous genotype is more frequent in high triglyceride group (40.9%) than in low triglyceride group (18.8%) ; p = 0.011. Despite the relation between CAD and hypertriglyceridemia the SNP 3 was not associated with CAD. Conclusion In type 2 diabetic patients SNP3 is associated with triglyceride level, however there was no association between SNP3 and coronary artery disease. PMID:15636639

  18. [Relationship between the triglyceride/high-density lipoprotein-cholesterol ratio, insulin resistance index and cardiometabolic risk factors in women with polycystic ovary syndrome].

    PubMed

    Roa Barrios, Marlene; Arata-Bellabarba, Gabriela; Valeri, Lenin; Velázquez-Maldonado, Elsy

    2009-02-01

    To evaluate the relationship between the triglyceride/high density lipoprotein cholesterol (TG/HDL-c) ratio, insulin resistance index and cardiometabolic risk factors in women with polycystic ovary syndrome (PCOS). The present crosssectional study analyzed 62 women with PCOS and 48 healthy women (control group) aged 17- 35 years old. Body mass index (BMI), waist circumference (WC) and blood pressure were registered. Plasma concentrations of glucose, insulin, triglycerides, total cholesterol and HDL-c were measured. TheTG/HDL-c ratio, homeostasis model assessment for insulin resistance (HOMA(IR)) and quantitative insulin sensitivity check index (QUICKI) were calculated. Women with PCOS showed significantly higher values of the TG/HDL-c ratio and HOMA(IR), and a significantly lower QUICKI value. These differences were related to BMI and WC, with the highest values being observed in obese patients. The 50th percentile for the TG/HDL-c ratio was 3.64; the TG/cHDL ratio was positively correlated with BMI, WC and HOMA(IR) (r=0.48, p<0.001; r=0.58, p<0.001; r=0.43, p<0.001 respectively) and was negatively correlated with the QUICKI (r=-0.51; p<0.001). Women with PCOS showed a higher frequency of fasting glucose > 100 mg/dl (10% vs 3%; p<0.05), triglycerides>150 mg/dl (55% vs 20%; p<0.05) and WC>80 cm (82.3% vs 43.8%; p<0.001). Metabolic syndrome was also more frequent in women with PCOS than in controls (31% vs 10%). The independent variable with the strongest influence on TG/HDL-c was WC (p<0.001). This cross-sectional study demonstrates that women with PCOS show significantly higher values of the TG/HDL-c ratio, which is closely related to WC and insulin resistance and sensitivity indexes (HOMA(IR), QUICKI). The TG/HDL-c ratio could be considered as a useful and practical method to identify an increased risk of cardiovascular disease in patients with PCOS.

  19. Dietary triglycerides act on mesolimbic structures to regulate the rewarding and motivational aspects of feeding

    PubMed Central

    Cansell, Céline; Castel, Julien; Denis, Raphaël G. P.; Rouch, Claude; Delbes, Anne-Sophie; Martinez, Sarah; Mestivier, Denis; Finan, Brian; Maldonado-Aviles, Jaime G.; Rijnsburger, Merel; Tschöp, Matthias H.; DiLeone, Ralph J.; Eckel, Robert H.; la Fleur, Susanne E.; Magnan, Christophe; Hnasko, Thomas S.; Luquet, Serge

    2014-01-01

    Circulating triglycerides (TG) normally increase after a meal but are altered in pathophysiological conditions such as obesity. Although TG metabolism in the brain remains poorly understood, several brain structures express enzymes that process TG-enriched particles, including mesolimbic structures. For this reason, and because consumption of high fat diet alters dopamine signaling, we tested the hypothesis that TG might directly target mesolimbic reward circuits to control reward-seeking behaviors. We found that the delivery of small amounts of TG to the brain through the carotid artery rapidly reduced both spontaneous and amphetamine-induced locomotion, abolished preference for palatable food, and reduced the motivation to engage in food-seeking behavior. Conversely, targeted disruption of the TG-hydrolyzing enzyme lipoprotein lipase specifically in the nucleus accumbens increased palatable food preference and food seeking behavior. Finally, prolonged TG perfusion resulted in a return to normal palatable food preference despite continued locomotor suppression, suggesting that adaptive mechanisms occur. These findings reveal new mechanisms by which dietary fat may alter mesolimbic circuit function and reward seeking. PMID:24732670

  20. Overexpression of Rad in muscle worsens diet-induced insulin resistance and glucose intolerance and lowers plasma triglyceride level

    NASA Astrophysics Data System (ADS)

    Ilany, Jacob; Bilan, Philip J.; Kapur, Sonia; Caldwell, James S.; Patti, Mary-Elizabeth; Marette, Andre; Kahn, C. Ronald

    2006-03-01

    Rad is a low molecular weight GTPase that is overexpressed in skeletal muscle of some patients with type 2 diabetes mellitus and/or obesity. Overexpression of Rad in adipocytes and muscle cells in culture results in diminished insulin-stimulated glucose uptake. To further elucidate the potential role of Rad in vivo, we have generated transgenic (tg) mice that overexpress Rad in muscle using the muscle creatine kinase (MCK) promoter-enhancer. Rad tg mice have a 6- to 12-fold increase in Rad expression in muscle as compared to wild-type littermates. Rad tg mice grow normally and have normal glucose tolerance and insulin sensitivity, but have reduced plasma triglyceride levels. On a high-fat diet, Rad tg mice develop more severe glucose intolerance than the wild-type mice; this is due to increased insulin resistance in muscle, as exemplified by a rightward shift in the dose-response curve for insulin stimulated 2-deoxyglucose uptake. There is also a unexpected further reduction of the plasma triglyceride levels that is associated with increased levels of lipoprotein lipase in the Rad tg mice. These results demonstrate a potential synergistic interaction between increased expression of Rad and high-fat diet in creation of insulin resistance and altered lipid metabolism present in type 2 diabetes. diabetes mellitus | glucose transport | RGK GTPase | transgenic mouse

  1. [Relationship between serum lipids and status of vitamin C and E as antioxidants in Venezuelan elderly people].

    PubMed

    Meertens, Lesbia; Ruido, Tathiana; Díaz, Nayka; Naddaf, Gloria; Rodríguez, Adelmo; Solano, Liseti

    2008-12-01

    During aging there is a tendency towards hyperlipidemia and changes in the distribution of lipoproteins. A decline in the functioning of the body's antioxidant defense system is also observed at this time. The objective of this study was to establish the relationship between serum concentrations of total cholesterol and fractions, triglycerides, and Vitamins C and E. 61 adults over 60 years of age were evaluated from January to March, 2006. Nutritional status was diagnosed by BMI (WHO); serum levels of triglycerides (TG), total cholesterol (TC) and fractions (HDL-c and LDL-c) were determined by enzyme method; Vitamin C (colorimetric method) and Vitamin E by HPLC. ATPIII values were used as a reference for risk of TG, TC, HDL, LDL-c, vitamin C: > 0.9 mg/dL (normal), < 0.9 mg/dL (deficit); vitamin E: = 1300 microg/dL (normal), 1300 = microg /dL (deficit). Consumption of vitamins C and E were estimated by the direct weighing method 3 days per week. According to BMI, 19.7% had nutritional deficit, 39.3% overweight, and 11.5% obesity. TG, TC, LDL-c levels were at risk in females, and HDL-c in both genders. Prevalence of risk for heart disease was: TG (45.2%), HDL-c (51.1%), and LDL-c (52.5%). Consumption and serum levels of vitamin E were low in both genders. There was no association between variables. A significant and positive correlation between TG, TC, LDL-C, serum vitamin E, and BMI was observed. The female group showed overweight, hypertriglyceridemia and hypercholesterolemia, HDL-c and LDL-c at risk, and vitamin E deficiency, all of which are important risk factors for cardiovascular disease in this age group.

  2. Lipoprotein lipase variants associated with an endophenotype of hypertension: hypertension combined with elevated triglycerides.

    PubMed

    Chen, Pei; Jou, Yuh-Shan; Fann, Cathy S J; Chen, Jaw-Wen; Chung, Chia-Min; Lin, Chin-Yu; Wu, Sheng-Yeu; Kang, Mei-Jyh; Chen, Ying-Chuang; Jong, Yuh-Shiun; Lo, Huey-Ming; Kang, Chih-Sen; Chen, Chien-Chung; Chang, Huan-Cheng; Huang, Nai-Kuei; Wu, Yi-Lin; Pan, Wen-Harn

    2009-01-01

    Previously, we observed that young-onset hypertension was independently associated with elevated plasma triglyceride(s) (TG) levels to a greater extent than other metabolic risk factors. Thus, focusing on the endophenotype--hypertension combined with elevated TG--we designed a family-based haplotype association study to explore its genetic connection with novel genetic variants of lipoprotein lipase gene (LPL), which encodes a major lipid metabolizing enzyme. Young-onset hypertension probands and their families were recruited, numbering 1,002 individuals from 345 families. Single-nucleotide polymorphism discovery for LPL, linkage disequilibrium (LD) analysis, transmission disequilibrium tests (TDT), bin construction, haplotype TDT association and logistic regression analysis were performed. We found that the CC- haplotype (i) spanning from intron 2 to intron 4 and the ACATT haplotype (ii) spanning from intron 5 to intron 6 were significantly associated with hypertension-related phenotypes: hypertension (ii, P=0.05), elevated TG (i, P=0.01), and hypertension combined with elevated TG (i, P=0.001; ii, P<0.0001), according to TDT. The risk of this hypertension subtype increased with the number of risk haplotypes in the two loci, using logistic regression model after adjusting within-family correlation. The relationships between LPL variants and hypertension-related disorders were also confirmed by an independent association study. Finally, we showed a trend that individuals with homozygous risk haplotypes had decreased LPL expression after a fatty meal, as opposed to those with protective haplotypes. In conclusion, this study strongly suggests that two LPL intronic variants may be associated with development of the hypertension endophenotype with elevated TG. Copyright 2008 Wiley-Liss, Inc.

  3. Predictors of Subclinical Cardiovascular Disease in Women with Polycystic Ovary Syndrome: Interrelationship of Dyslipidemia and Arterial Blood Pressure

    PubMed Central

    Macut, Djuro; Bačević, Marina; Božić-Antić, Ivana; Bjekić-Macut, Jelica; Čivčić, Milorad; Erceg, Snježana; Vojnović Milutinović, Danijela; Stanojlović, Olivera; Andrić, Zoran; Kastratović-Kotlica, Biljana; Šukilović, Tijana

    2015-01-01

    Background. Women with polycystic ovary syndrome (PCOS) could develop subclinical atherosclerosis during life. Purpose. To analyze cardiovascular risk (CVR) factors and their relation to clinical markers of cardiovascular disease (CVD) in respect to their age. Material and Methods. One hundred women with PCOS (26.32 ± 5.26 years, BMI: 24.98 ± 6.38 kg/m2) were compared to 50 respective controls. In all subjects, total cholesterol (TC), HDL-C, LDL-C, triglycerides, TC/HDL-C and TG/HDL-C ratios, glucose, insulin and HOMA index, waist-to-hip ratio (WHR), systolic and diastolic blood pressure (SBP and DBP, resp.), and carotid intima-media thickness (CIMT) were analyzed in respect to their age and level of androgens. Results. PCOS over 30 years had higher WHR (P = 0.008), SBP (P < 0.001), DBP (P < 0.001), TC (P = 0.028), HDL-C (P = 0.028), LDL-C (P = 0.045), triglycerides (P < 0.001), TC/HDL-C (P < 0.001), and triglycerides/HDL-C (P < 0.001) and had more prevalent hypertension and pronounced CIMT on common carotid arteries even after adjustment for BMI (P = 0.005 and 0.036, resp.). TC/HDL-C and TG/HDL-C were higher in PCOS with the highest quintile of FAI in comparison to those with lower FAI (P = 0.045 and 0.034, resp.). Conclusions. PCOS women older than 30 years irrespective of BMI have the potential for early atherosclerosis mirrored through the elevated lipids/lipid ratios and through changes in blood pressure. PMID:25878664

  4. Effects of blood triglycerides on cardiovascular and all-cause mortality: a systematic review and meta-analysis of 61 prospective studies

    PubMed Central

    2013-01-01

    The relationship of triglycerides (TG) to the risk of death remains uncertain. The aim of this study was to determine the associations between blood triglyceride levels and cardiovascular diseases (CVDs) mortality and all-cause mortality. Four databases were searched without language restriction for relevant studies: PubMed, ScienceDirect, EMBASE, and Google Scholar. All prospective cohort studies reporting an association between TG and CVDs or all-cause mortality published before July 2013 were included. Risk ratios (RRs) with 95% confidence intervals (CIs) were extracted and pooled according to TG categories, unit TG, and logarithm of TG using a random-effects model with inverse-variance weighting. We identified 61 eligible studies, containing 17,018 CVDs deaths in 726,030 participants and 58,419 all-cause deaths in 330,566 participants. Twelve and fourteen studies, respectively, reported the effects estimates of CVDs and total mortality by TG categories. Compared to the referent (90–149 mg/dL), the pooled RRs (95% CI) of CVDs mortality for the lowest (< 90 mg/dL), borderline-high (150–199 mg/dL), and high TG (≥ 200 mg/dL) groups were 0.83 (0.75 to 0.93), 1.15 (1.03 to 1.29), and 1.25 (1.05 to 1.50); for total mortality they were 0.94 (0.85 to 1.03), 1.09 (1.02 to 1.17), and 1.20 (1.04 to 1.38), respectively. The risks of CVDs and all-cause deaths were increased by 13% and 12% (p < 0.001) per 1-mmol/L TG increment in twenty-two and twenty-two studies reported RRs per unit TG, respectively. In conclusion, elevated blood TG levels were dose-dependently associated with higher risks of CVDs and all-cause mortality. PMID:24164719

  5. [Mutations of APOC3 gene, metabolism of triglycerides and reduction of ischemic cardiovascular events].

    PubMed

    Pirillo, Angela; Catapano, Alberico Luigi

    2015-05-01

    A direct relationship between high plasma triglyceride (TG) levels and increased risk of cardiovascular disease has been shown in several studies. TG are present in the blood associated with different lipoprotein classes, including hepatically-derived very low density lipoproteins (VLDL) and intestinally-derived chylomicrons. Lipoprotein lipase (LPL) is a key enzyme that hydrolyzes TG, releasing free fatty acids that accumulate in peripheral tissues and remnant lipoproteins, that are then cleared by the liver. LPL activity is finely modulated by several cofactors, including apolipoprotein C-III (apoC-III) which acts as a LPL inhibitor. The key role of apoCIII has been established in several studies: animal models lacking APOC3 gene exhibit reduced plasma TG levels, whereas the overexpression of APOC3 gene led to increased TG levels. In humans, several mutations in APOC3 gene have been identified, leading to lower apoC-III levels and associated with reduced plasma TG levels. Recently, these mutations were found to be associated with a reduced risk for cardiovascular ischemia and coronary heart disease, thus confirming the negative role of apoC-III in TG metabolism and suggesting apoC-III as possible therapeutic target for the management of hypertriglyceridemia.

  6. Risk of type 2 diabetes mellitus associated with plasma lipid levels: The rural Chinese cohort study.

    PubMed

    Zhang, Ming; Zhou, Junmei; Liu, Yu; Sun, Xizhuo; Luo, Xinping; Han, Chengyi; Zhang, Lu; Wang, Bingyuan; Ren, Yongcheng; Zhao, Yang; Zhang, Dongdong; Liu, Xuejiao; Hu, Dongsheng

    2018-01-01

    To investigate the association of type 2 diabetes mellitus (T2DM) risk and plasma lipid levels in rural Chinese. Each lipid variable was divided into quartiles and dichotomized by clinical cutoff points. Cox proportional-hazards model was used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the association of T2DM risk and plasma lipid levels and explore the interaction between plasma lipid levels and other risk factors. 11,929 participants were included in the analysis. We documented 720 incident cases of T2DM over 70,720.84 person-years of follow-up, for an incidence of 10.18/1,000 person-years. In the multivariable-adjusted model, risk of T2DM was increased with the highest versus lowest quartiles of total cholesterol (TC) and triglycerides (TG) levels and TC/high-density lipoprotein-cholesterol (HDL-C) and TG/HDL-C ratios. The HRs (95% CIs) for the fourth quartiles, for example, were 1.34 (1.03-1.74), 2.32 (1.73-3.13), 1.66 (1.23-2.25), and 1.84 (1.38-2.45), respectively. In addition, risk of T2DM was increased with high TG level and TC/HDL-C and TG/HDL-C ratios by clinical cutoffs. The HRs (95% CIs) were 1.50 (1.25-1.80), 1.24 (1.03-1.48), and 1.44 (1.18-1.75), respectively. Risk of T2DM was associated with interactions between all lipid variables and age and BMI. TG level and TG/HDL-C ratio additionally interacted with gender (all P interaction  < 0.0001). Risk of T2DM was increased with elevated serum levels of TC and TG and TC/HDL-C and TG/HDL-C ratios and also with interactions between high TC and TG levels and TC/HDL-C and TG/HDL-C ratios and age and BMI in a rural Chinese population. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation

    PubMed Central

    Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

    2013-01-01

    Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption. PMID:23886516

  8. Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation.

    PubMed

    Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

    2013-10-01

    Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9-2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption.

  9. Utility of serum lipid ratios for predicting incident type 2 diabetes: the Isfahan Diabetes Prevention Study.

    PubMed

    Janghorbani, Mohsen; Amini, Masoud

    2016-09-01

    In this study, we evaluate the association between triglyceride to high-density lipoprotein cholesterol (TG/HDL) ratio and total cholesterol (TC) to HDL (TC/HDL) ratio and the risks of type 2 diabetes (T2D) in an Iranian high-risk population. We analysed 7-year follow-up data (n = 1771) in non-diabetic first-degree relatives of consecutive patients with T2D 30-70 years old. The primary outcome was the diagnosis of T2D based on repeated oral glucose tolerance tests. We used Cox proportional hazard models to estimate hazard ratio for incident T2D across tertiles of TG/HDL and TC/HDL ratios and plotted a receiver operating characteristic (ROC) curve to assess discrimination. The highest tertile of TG/HDL and TC/HDL ratios compared with the lowest tertile was not associated with T2D in age- and gender-adjusted models (HR 0.99, 95% CI: 0.88, 1.11 for TG/HDL ratio and 1.10, 95% CI: 0.97, 1.23 for TC/HDL ratio). Further adjustment for waist circumference or body mass index, fasting plasma glucose, and low-density lipoprotein cholesterol did not appreciably alter the hazard ratio compared with the age- and gender-adjusted model. The area under the ROC curve for TG/HDL ratio was 57.7% (95% CI: 54.0, 61.5) and for TC/HDL ratio was 55.1% (95% CI: 51.2, 59.0). TG/HDL and TC/HDL ratios were not robust predictors of T2D in high-risk individuals in Iran. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  10. Genomic and transcriptomic predictors of triglyceride response to regular exercise

    PubMed Central

    Sarzynski, Mark A; Davidsen, Peter K; Sung, Yun Ju; Hesselink, Matthijs K C; Schrauwen, Patrick; Rice, Treva K; Rao, D C; Falciani, Francesco; Bouchard, Claude

    2015-01-01

    Aim We performed genome-wide and transcriptome-wide profiling to identify genes and single nucleotide polymorphisms (SNPs) associated with the response of triglycerides (TG) to exercise training. Methods Plasma TG levels were measured before and after a 20-week endurance training programme in 478 white participants from the HERITAGE Family Study. Illumina HumanCNV370-Quad v3.0 BeadChips were genotyped using the Illumina BeadStation 500GX platform. Affymetrix HG-U133+2 arrays were used to quantitate gene expression levels from baseline muscle biopsies of a subset of participants (N=52). Genome-wide association study (GWAS) analysis was performed using MERLIN, while transcriptomic predictor models were developed using the R-package GALGO. Results The GWAS results showed that eight SNPs were associated with TG training-response (ΔTG) at p<9.9×10−6, while another 31 SNPs showed p values <1×10−4. In multivariate regression models, the top 10 SNPs explained 32.0% of the variance in ΔTG, while conditional heritability analysis showed that four SNPs statistically accounted for all of the heritability of ΔTG. A molecular signature based on the baseline expression of 11 genes predicted 27% of ΔTG in HERITAGE, which was validated in an independent study. A composite SNP score based on the top four SNPs, each from the genomic and transcriptomic analyses, was the strongest predictor of ΔTG (R2=0.14, p=3.0×10−68). Conclusions Our results indicate that skeletal muscle transcript abundance at 11 genes and SNPs at a number of loci contribute to TG response to exercise training. Combining data from genomics and transcriptomics analyses identified a SNP-based gene signature that should be further tested in independent samples. PMID:26491034

  11. Docosahexaenoic acid triglyceride-based microemulsions with an added dendrimer - Structural considerations.

    PubMed

    Lidich, Nina; Francesca Ottaviani, M; Hoffman, Roy E; Aserin, Abraham; Garti, Nissim

    2016-12-01

    Omega fatty acids, mainly the triglyceride of docosahexaenoic acid (TG-DHA), are considered important nutraceuticals. These compounds are water-insoluble and their transport across membranes depends on their carriers. Dendrimers are known as drug carriers across cell membranes and also as permeation enhancers. The solubilization of TG-DHA and dendrimer into a microemulsion (ME) system serving as a carrier could be used for a targeted delivery in the future. The interactions between TG-DHA and second generation poly(propyleneimine) dendrimers (PPI-G2) and their effect on structural transitions of ME were explored along the water dilution line using electron paramagnetic resonance and pulsed-gradient spin-echo NMR along with other analytical techniques. The microviscosity, order parameter, and micropolarity of all studied systems decrease upon water dilution. Incorporation of TG-DHA reduces the microviscosity, order, and micropolarity, whereas PPI-G2 leads to an increase in these parameters. The effect of PPI-G2 is more pronounced at relative high contents (1 and 5wt%) where PPI-G2 interacts with the hydrophilic headgroups of the surfactants. In the macroscale, the effects of TG-DHA and PPI-G2 differ mostly in the bicontinuous region, where macroviscosity increases upon TG-DHA incorporation and decreases upon solubilization of 5wt% PPI-G2. From DSC measurements it was concluded that in the presence of TG-DHA the PPI-G2 is intercalated easily at the interface. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. A high-carbohydrate diet enhances the adverse effect of the S2 allele of APOC3 SstI polymorphism on the TG/HDL-C ratio only in young Chinese females.

    PubMed

    Song, Yong Yan; Gong, Ren Rong; Zhang, Zhen; Li, Yuan Hao; Xiao, Li Ying; Zhou, Xue Dong; Fang, Ding Zhi

    2011-06-01

    Both genetic background and diet have profound effects on plasma lipid profiles. We hypothesized that a high-carbohydrate (high-CHO) diet may affect the ratios of serum lipids and apolipoproteins (apo) differently in subjects with different genotypes of the SstI polymorphism in the apoCIII gene (APOC3). Fifty-six healthy university students (27 males and 29 females, 22.89 ± 1.80 years) were given a washout diet of 54% carbohydrate for 7 days, followed by a high-CHO diet of 70% carbohydrate for 6 days without total energy restriction. Serum triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), apoB100, apoAI, and the APOC3 SstI polymorphism were analyzed. The ratios of serum lipids and apoB100/apoAI were calculated. At baseline, the TG/HDL-C ratio was significantly higher in females, but not in males, with the S2 allele. The differences in the TG/HDL-C ratio between genotypes remained the same after the washout and the high-CHO diet in females. When compared with those before the high-CHO diet, the TC/HDL-C (male S2 carriers: 3.13 ± 1.00 vs 2.36 ± 0.65, P = 0.000; male subjects with the S1S1 genotype: 2.97 ± 0.74 vs 2.09 ± 0.55, P = 0.000; female S2 carriers: 2.68 ± 0.36 vs 2.24 ± 0.37, P = 0.004; female subjects with the S1S1 genotype: 2.69 ± 0.41 vs 2.09 ± 0.31, P = 0.000) and LDL-C/HDL-C (male S2 carriers: 1.44 ± 0.71 vs 1.06 ± 0.26, P = 0.012; male subjects with the S1S1 genotype: 1.35 ± 0.61 vs 1.01 ± 0.29, P = 0.005; female S2 carriers: 1.18 ± 0.33 vs 1.00 ± 0.18, P = 0.049; female subjects with the S1S1 genotype: 1.18 ± 0.35 vs 1.04 ± 0.19, P = 0.026) ratios were significantly decreased after the high-CHO diet regardless of gender and of genotype of the APOC3 SstI polymorphism. However, in female S2 carriers, the TG/HDL-C (1.38 ± 0.46 vs 1.63 ± 0.70, P = 0.039) ratio was significantly increased after the high-CHO diet. In conclusion, the high-CHO diet has

  13. Genome-wide association study of triglyceride response to a high-fat meal among participants of the NHLBI genetics of lipid lowering drugs and diet network (GOLDN)

    USDA-ARS?s Scientific Manuscript database

    Objective: The triglyceride (TG) response to a high-fat meal (postprandial lipemia, PPL) affects cardiovascular disease risk and is influenced by genes and environment. Genes involved in lipid metabolism have dominated genetic studies of PPL TG response. We sought to elucidate common genetic variant...

  14. Genome-wide association study of triglyceride response to a high-fat meal among participants of the NHLBI Genetics of Lipid Lowering Drugs and Diet Network (GOLDN)

    USDA-ARS?s Scientific Manuscript database

    The triglyceride (TG) response to a high-fat meal (postprandial lipemia, PPL) affects cardiovascular disease risk and is influenced by genes and environment. Genes involved in lipid metabolism have dominated genetic studies of PPL TG response. We sought to elucidate common genetic variants through a...

  15. The Effect of 10 Weeks Resistance Training on Cholesterol and Blood Triglyceride Levels of Patients with Fatty Liver Disease.

    PubMed

    Valizadeh, Rohollah; Hosseini Askarabadi, Siroos; Karampour, Sedigheh; Abdolhamid Tehrani, Mona

    2014-01-01

    The present study aims to consider the effect of 10 weeks resistance trainings on cholesterol and blood triglyceride (TG) levels of patients with having fatty liver, aged 50 to 60 in National Iranian South Oil Company (NISOC). This research is practical and its plan has been done experimentally with pretest and post-test on experimental and control groups. In this study, 20 samples from 100 patients who referred to sonography clinic in NISOC with distinction of fatty liver were selected randomly and divided into two groups of control (n = 10) and experimental (n = 10). Cholesterol and blood trigly-ceride were measured as pretest. Test of normality for TG was (p = 0/200) by Kolmogorov-Smirnov and (p = 0/070) for cholesterol by Shapiro-Wilk test. After 10 weeks resistance trainings, the analysis and resolution of data were done by computer and SPSS (16) software as well as the descriptive and statistical methods (t-test). Comparison between these two groups showed that 8 weeks resistance trainings with a ≤ 0.05 causes significant decrease in the amount of TG but did not any significant effect on cholesterol of fatty liver patients. How to cite this article: Valizadeh R, Askarabadi SH, Karampour S, Tehrani MA. The Effect of 10 Weeks Resistance Training on Cholesterol and Blood Triglyceride Levels of Patients with Fatty Liver Disease. Euroasian J Hepato-Gastroenterol 2014;4(1):64-65.

  16. Waist circumference: a better index of fat location than WHR for predicting lipid profile in overweight/obese Iranian women.

    PubMed

    Shahraki, T; Shahraki, M; Roudbari, M

    2009-01-01

    We carried out a clinical cross-sectional study on 728 overweight and obese women aged 20-60 years during July 2005-May 2006 in Sistan and Baluchestan, Islamic Republic of Iran. Body mass index (BMI) and waist circumference (WC) showed significant correlation with total cholesterol (TC), triglycerides (TG) and low-density lipoprotein cholesterol. After adjustment for age and BMI, this was also true for WC with TC and TG. There was no such correlation between waist-to-hip ratio (WHR) and lipid profile. Hence, WC was a better anthropometric index of fat location than WHR to estimate lipid profile in overweight and obese adult women.

  17. Fasting Lipoprotein Lipase Protein Levels Can Predict a Postmeal Increment of Triglyceride Levels in Fasting Normohypertriglyceridemic Subjects.

    PubMed

    Tsuzaki, Kokoro; Kotani, Kazuhiko; Yamada, Kazunori; Sakane, Naoki

    2016-09-01

    Although a postprandial increment in triglyceride (TG) levels is considered to be a risk factor for atherogenesis, tests (e.g., fat load) to assess postprandial changes in TG levels cannot be easily applied to clinical practice. Therefore, fasting markers that predict postprandial TG states are needed to be developed. One current candidate is lipoprotein lipase (LPL) protein, a molecule that hydrides TGs. This study investigated whether fasting LPL levels could predict postprandial TG levels. A total of 17 subjects (11 men, 6 women, mean age 52 ± 11 years) with normotriglyceridemia during fasting underwent the meal test. Several fasting parameters, including LPL, were measured for the area under the curve of postprandial TGs (AUC-TG). The subjects' mean fasting TG level was 1.30 mmol/l, and their mean LPL level was 41.6 ng/ml. The subjects' TG levels increased after loading (they peaked after two postprandial hours). Stepwise multiple regression analysis demonstrated that fasting TG levels were a predictor of the AUC-TG. In addition, fasting LPL mass levels were found to be a predictor of the AUC-TG (β = 0.65, P < 0.01), and this relationship was independent of fasting TG levels. Fasting LPL levels may be useful to predict postprandial TG increment in this population. © 2015 Wiley Periodicals, Inc.

  18. Effect of functional sympathetic nervous system impairment of the liver and abdominal visceral adipose tissue on circulating triglyceride-rich lipoproteins

    PubMed Central

    Cirnigliaro, Christopher M.; Kirshblum, Steven C.; McKenna, Cristin

    2017-01-01

    Background Interruption of sympathetic innervation to the liver and visceral adipose tissue (VAT) in animal models has been reported to reduce VAT lipolysis and hepatic secretion of very low density lipoprotein (VLDL) and concentrations of triglyceride-rich lipoprotein particles. Whether functional impairment of sympathetic nervous system (SNS) innervation to tissues of the abdominal cavity reduce circulating concentrations of triglyceride (TG) and VLDL particles (VLDL-P) was tested in men with spinal cord injury (SCI). Methods One hundred-three non-ambulatory men with SCI [55 subjects with neurologic injury at or proximal to the 4th thoracic vertebrae (↑T4); 48 subjects with SCI at or distal to the 5th thoracic vertebrae (↓T5)] and 53 able-bodied (AB) subjects were studied. Fasting blood samples were obtained for determination of TG, VLDL-P concentration by NMR spectroscopy, serum glucose by autoanalyzer, and plasma insulin by radioimmunoassay. VAT volume was determined by dual energy x-ray absorptiometry imaging with calculation by a validated proprietary software package. Results Significant group main effects for TG and VLDL-P were present; post-hoc tests revealed that serum TG concentrations were significantly higher in ↓T5 group compared to AB and ↑T4 groups [150±9 vs. 101±8 (p<0.01) and 112±8 mg/dl (p<0.05), respectively]. VLDL-P concentration was significantly elevated in ↓T5 group compared to AB and ↑T4 groups [74±4 vs. 58±4 (p<0.05) and 55±4 μmol/l (p<0.05)]. VAT volume was significantly higher in both SCI groups than in the AB group, and HOMA-IR was higher and approached significance in the SCI groups compared to the AB group. A linear relationship between triglyceride rich lipoproteins (i.e., TG or Large VLDL-P) and VAT volume or HOMA-IR was significant only in the ↓T5 group. Conclusions Despite a similar VAT volume and insulin resistance in both SCI groups, the ↓T5 group had significantly higher serum TG and VLDL-P values than

  19. Impaired Insulin Suppression of VLDL-Triglyceride Kinetics in Nonalcoholic Fatty Liver Disease.

    PubMed

    Poulsen, Marianne K; Nellemann, Birgitte; Stødkilde-Jørgensen, Hans; Pedersen, Steen B; Grønbæk, Henning; Nielsen, Søren

    2016-04-01

    Nonalcoholic fatty liver disease (NAFLD) is associated with glucose and lipid metabolic abnormalities. However, insulin suppression of very low-density lipoprotein-triglyceride (VLDL-TG) kinetics is not fully understood. The objective of the study was to determine VLDL-TG, glucose, and palmitate kinetics during fasting and hyperinsulinemia in men with (NAFLD+) and without NAFLD (NAFLD−). Twenty-seven nondiabetic, upper-body obese (waist to hip ratio > 0.9, body mass index > 28 kg/m2) men, 18 NAFLD+, and nine NAFLD− determined by magnetic resonance spectroscopy were enrolled.14C-labeled VLDL-TG and 3H-labeled glucose and palmitate tracers were applied in combination with indirect calorimetry and breath samples to assess kinetics and substrate oxidations postabsorptively and during a hyperinsulinemic-euglycemic clamp. Dual-X-ray absorptiometry and magnetic resonance imaging assessed body composition. Liver fat content was greater in NAFLD+ than NAFLD− men (21.0% vs 3.7%), even though body composition, metabolites (except triglycerides), and insulin were similar in the groups. Insulin suppression of VLDL-TG secretion (P = .0001), oxidation (P = .0003), and concentration (P= .008) as well as percentage decreases were lower in NAFLD+ than NAFLD− men (secretion: 31.9% ± 17.2% vs 64.7% ± 19.9%; oxidation: −9.0% ± 24.7% vs 46.5% ± 36.6%; concentration: 11.9% ± 20.7% vs 56.2% ± 22.9%, all P < .001). Likewise, lower insulin suppression of very low-density lipoprotein particle size was present in NAFLD+ than NAFLD− men (P = .0002). Conversely, insulin suppression of endogenous glucose production was similar in the groups. Compared with endogenous glucose production, the inability of NAFLD+ men to suppress VLDL-TG kinetics to compensate for the increased liver fat content seems to be an early pathophysiological manifestation of male NAFLD+. These data suggest therapeutic targets reducing liver fat content may ameliorate metabolic abnormalities associated with

  20. Early gene-diet interaction between glucokinase regulatory protein (GCKR) polymorphism, vegetable and fish intakes in modulating triglyceride levels in healthy adolescents.

    PubMed

    Tam, C H T; Wang, Y; Lee, H M; Luk, A O Y; Tong, P C Y; Chan, M H M; Ozaki, R; Kong, A P S; So, W Y; Chan, J C N; Ma, R C W

    2015-10-01

    The benefits of dietary vegetable and fish consumptions on improving glucose and lipid metabolism have been well established. Recently, the T-allele of a common genetic variant rs780094 at glucokinase regulatory protein (GCKR) was reported to be associated with elevated triglyceride (TG) levels but reduced fasting plasma glucose (FPG) and type 2 diabetes risk. However, the dietary modulation on genetic risk is not clearly understood. A cohort of 2095 Chinese adolescents (mean age 15.6 ± 2.0 years, 45.3% male) recruited from a population-based school survey for cardiovascular risk factor assessment, with dietary data including weekly vegetable and fish consumptions as well as clinical data were genotyped for the GCKR rs780094 polymorphism. In the linear regression analysis with adjustment for sex, age, body mass index, and socioeconomic status (school banding, paternal and maternal education levels), the frequency of vegetable intake per week was inversely associated with FPG (P = 0.044). Individuals with low fish intake generally had elevated TG levels but reduced TC, HDL-C and LDL-C (0.006 < P < 0.029). We also observed significant associations of the minor T-allele of GCKR rs780094 with decreased FPG (P = 0.013) and increased TG levels (P = 2.7 × 10(-8)). There were significant gene-diet interactions between rs780094 and vegetable consumption (P(interaction) = 0.009), and between rs780094 and fish consumption (P(interaction) = 0.031) in modulating TG levels. The T-allele of GCKR locus was associated with higher TG levels amongst individuals with ≥7 vegetable meals per week (P = 6.4 × 10(-9)), and among individuals with <7 fish meals per week (P = 0.020 and 7.0 × 10(-7) for 4-6 and ≤3 meals per week, respectively). High intake of vegetable exerted a reduction in TG levels only among CC genotype carriers (Ptrend = 0.020), while high intake of fish was associated with reduced TG levels only among TT genotype carriers (Ptrend = 0.026). In summary, our data

  1. The Relationship between the Triglyceride to High-Density Lipoprotein Cholesterol Ratio and Metabolic Syndrome.

    PubMed

    Shin, Hyun-Gyu; Kim, Young-Kwang; Kim, Yong-Hwan; Jung, Yo-Han; Kang, Hee-Cheol

    2017-11-01

    Metabolic syndrome is associated with cardiovascular diseases and is characterized by insulin resistance. Recent studies suggest that the triglyceride/high-density lipoprotein cholesterol (TG/HDLC) ratio predicts insulin resistance better than individual lipid levels, including TG, total cholesterol, low-density lipoprotein cholesterol (LDLC), or HDLC. We aimed to elucidate the relationship between the TG/HDLC ratio and metabolic syndrome in the general Korean population. We evaluated the data of adults ≥20 years old who were enrolled in the Korean National Health and Nutrition Examination Survey in 2013 and 2014. Subjects with angina pectoris, myocardial infarction, stroke, or cancer were excluded. Metabolic syndrome was defined by the harmonized definition. We examined the odds ratios (ORs) of metabolic syndrome according to TG/HDLC ratio quartiles using logistic regression analysis (SAS ver. 9.4; SAS Institute Inc., Cary, NC, USA). Weighted complex sample analysis was also conducted. We found a significant association between the TG/HDLC ratio and metabolic syndrome. The cutoff value of the TG/HDLC ratio for the fourth quartile was ≥3.52. After adjustment, the OR for metabolic syndrome in the fourth quartile compared with that of the first quartile was 29.65 in men and 20.60 in women (P<0.001). The TG/HDLC ratio is significantly associated with metabolic syndrome.

  2. Association between Lipid Ratios and Insulin Resistance in a Chinese Population

    PubMed Central

    Zhang, Liying; Chen, Shanying; Deng, Aiwen; Liu, Xinyu; Liang, Yan; Shao, Xiaofei; Sun, Mingxia; Zou, Hequn

    2015-01-01

    Aim To explore the association of lipid ratios and triglyceride (TG) with insulin resistance (IR) in a Chinese population. We also provide the clinical utility of lipid ratios to identify men and women with IR. Methods This cross-sectional study included 614 men and 1055 women without diabetes. Insulin resistance was defined by homeostatic model assessment of IR > 2.69. Lipid ratios included the TG/ high density lipoprotein cholesterol (HDL-C), the total cholesterol (TC)/HDL-C and the low density lipoprotein cholesterol (LDL-C)/HDL –C. Logistic regression models and accurate estimates of the area under the receiver operating characteristic (AUROC) curves were obtained. Results In normal-weight men, none of lipid ratios nor TG was associated with IR. In overweight/obese men, normal-weight women and overweight/obese women, the TG/HDL-C, the TC/HDL-C and TG were significantly associated with IR, and the associations were independent of waist circumference. All of the AUROCs for the TG/HDL-C and TG were > 0.7. The AUROCs for TC/HDL-C ratio were 0.69–0.77. The optimal cut-offs for TG/HDL-C were 1.51 in men and 0.84 in women. The optimal cut-offs for TG were 1.78 mmol/L in men and 1.49 mmol/L in women, respectively. In men, the optimal cut-off for LDL-C/HDL-C is 3.80. In women, the optimal cut-off for LDL-C/HDL-C is 3.82. Conclusion The TG/HDL-C, the TC/HDL-C and TG are associated with IR in overweight/obese men, normal-weight and overweight/obese women. The LDL-C/HDL-C is only associated with IR in normal-weight women. The TG/HDL-C and TG might be used as surrogate markers for assessing IR. PMID:25635876

  3. Plasma triglyceride/HDL-cholesterol ratio, insulin resistance, and cardiometabolic risk in young adults

    PubMed Central

    Murguía-Romero, Miguel; Jiménez-Flores, J. Rafael; Sigrist-Flores, Santiago C.; Espinoza-Camacho, Miguel A.; Jiménez-Morales, Mayra; Piña, Enrique; Méndez-Cruz, A. René; Villalobos-Molina, Rafael; Reaven, Gerald M.

    2013-01-01

    Studies in mature adults suggest that the plasma concentration ratio of triglyceride (TG)/HDL-cholesterol (HDL-C) provides a simple way to identify apparently healthy individuals who are insulin resistant (IR) and at increased cardiometabolic risk. This study extends these observations by examining the clinical utility of the TG/HDL-C ratio and the metabolic syndrome (MetS) in 2,244 healthy college students (17–24 years old) of Mexican Mestizo ancestry. The TG/HDL-C ratio separating the 25% with the highest value was used to identify IR and increased cardiometabolic risk. Cardiometabolic risk factors were more adverse in men and women whose TG/HDL-C ratios exceeded 3.5 and 2.5, respectively, and approximately one third were identified as being IR. The MetS identified fewer individuals as being IR, but their risk profile was accentuated. In conclusion, both a higher TG/HDL-C ratio and a diagnosis of the MetS identify young IR individuals with an increased cardiometabolic risk profile. The TG/HDL-C ratio identified a somewhat greater number of “high risk” subjects, whereas the MetS found a group whose risk profile was somewhat magnified. These findings suggest that the TG/HDL-C ratio may serve as a simple and clinically useful approach to identify apparently healthy, young individuals who are IR and at increased cardiometabolic risk. PMID:23863983

  4. Association of fasting triglyceride concentration and postprandial triglyceride response with the carotid intima-media thickness in the middle aged: The Netherlands Epidemiology of Obesity study.

    PubMed

    Christen, Tim; de Mutsert, Renée; Gast, Karin B; Rensen, Patrick C N; de Koning, Eelco; Rosendaal, Frits R; Trompet, Stella; Jukema, J Wouter

    People are in a postprandial state for the majority of the day, postprandial triglyceride (TG) response may be more important in the etiology of atherosclerosis than fasting TGs. The objective of the study was to investigate the associations of fasting TG concentration (TGc) and postprandial TG response after a meal challenge with subclinical atherosclerosis, measured by intima-media thickness (IMT) in a middle-aged population. A total of 5574 participants (57% women) with a mean (standard deviation [SD]) age of 56 (6) years were included in this cross-sectional analysis of baseline measurements of The Netherlands Epidemiology of Obesity study. Serum TGc was measured fasting and 30 and 150 minutes after a liquid mixed meal, and the incremental area under the curve (TGiAUC) was calculated. With linear regression analyses, we calculated the differences in IMT with 95% confidence intervals, adjusted for confounding factors, and additionally for TGc or TGiAUC. Per SD of TGc (0.82 mmol/L), IMT was 8.5 μm (2.1, 14.9) greater after adjustment for TGiAUC and confounding factors. Per SD of TGiAUC (24.0 mmol/L × min), the difference in IMT was -1.7 μm (-8.5, 5.0) after adjustment for fasting TG and confounding factors. The association between TG response after a mixed meal and IMT disappeared after adjusting for TGc. The association between fasting TG concentration and IMT persisted after adjustment for postprandial TG response. These findings imply that it is not useful to perform a meal challenge in cardiovascular risk stratification. Our results support use of fasting TGc instead of postprandial TG responses for cardiovascular risk stratification in clinical practice. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  5. The polymorphism -1131T>C in apolipoprotein A5 gene is associated with dyslipidemia in Brazilian subjects.

    PubMed

    Ferreira, Cláudia N; Carvalho, Maria G; Fernandes, Ana P; Santos, Izabela R; Rodrigues, Kathryna F; Lana, Angela M Q; Almeida, Cristina R; Loures-Vale, Andréia A; Gomes, Karina B; Sousa, Marinez O

    2013-03-01

    Polymorphisms in apolipoprotein A5 gene (APOA5) have been associated with higher triglyceride levels in many populations. The aim of the study was to determine the allelic and genotypic distribution of the APOA5 -1131T>C polymorphism and to identify the association of the genetic variant and the risk for dyslipidemia. We genotyped 109 dyslipidemic subjects and 107 controls. The total cholesterol, triglycerides and HDL-c were determined enzymatically. Comparison of means among groups was calculated by ANOVA. Significant differences among groups were evaluated by Student-Newman-Keuls test. The minor allele C was more frequent in dyslipidemic subjects than controls (p=0.019) and confers an increased individual risk for dyslipidemia (OR=1.726, CI 95%=1.095-2.721). The genotype analysis by gender showed that this allele was more frequent in dyslipidemic males (p=0.037; OR=2.050, CI 95%=1.042-4.023). When participants were analyzed according to genotypes TT and TC/CC, C-carriers presented higher cholesterol and triglycerides levels than TT homozygous (p=0.046 and 0.049, respectively). The allele C confers higher total cholesterol and triglycerides levels in dyslipidemic adults. The APOA5 -1131T>C polymorphism is associated with dyslipidemia in male subjects. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Excess S-adenosylmethionine reroutes phosphatidylethanolamine towards phosphatidylcholine and triglyceride synthesis

    PubMed Central

    Martínez-Uña, Maite; Varela-Rey, Marta; Cano, Ainara; Fernández-Ares, Larraitz; Beraza, Naiara; Aurrekoetxea, Igor; Martínez-Arranz, Ibon; García-Rodríguez, Juan L; Buqué, Xabier; Mestre, Daniela; Luka, Zigmund; Wagner, Conrad; Alonso, Cristina; Finnell, Richard H; Lu, Shelly C; Martínez-Chantar, M Luz; Aspichueta, Patricia; Mato, José M

    2013-01-01

    Methionine adenosyltransferase 1A (MAT1A) and glycine N-methyltransferase (GNMT) are the primary genes involved in hepatic S-adenosylmethionine (SAMe) synthesis and degradation, respectively. Mat1a ablation in mice induces a decrease in hepatic SAMe, activation of lipogenesis, inhibition of triglyceride (TG) release, and steatosis. Gnmt deficient mice, despite showing a large increase in hepatic SAMe, also develop steatosis. We hypothesized that as an adaptive response to hepatic SAMe accumulation, phosphatidylcholine (PC) synthesis via the phosphatidylethanolamine (PE) N-methyltransferase (PEMT) pathway is stimulated in Gnmt−/− mice. We also propose that the excess PC thus generated is catabolized leading to TG synthesis and steatosis via diglyceride (DG) generation. We observed that Gnmt−/− mice present with normal hepatic lipogenesis and increased TG release. We also observed that the flux from PE to PC is stimulated in the liver of Gnmt−/− mice and that this results in a reduction in PE content and a marked increase in DG and TG. Conversely, reduction of hepatic SAMe following the administration of a methionine deficient diet reverted the flux from PE to PC of Gnmt−/− mice to that of wild type animals and normalized DG and TG content preventing the development of steatosis. Gnmt−/− mice with an additional deletion of perilipin2, the predominant lipid droplet protein, maintain high SAMe levels, with a concurrent increased flux from PE to PC, but do not develop liver steatosis. Conclusion These findings indicate that excess SAMe reroutes PE towards PC and TG synthesis, and lipid sequestration. PMID:23505042

  7. Identification of cardiometabolic risk: visceral adiposity index versus triglyceride/HDL cholesterol ratio.

    PubMed

    Salazar, Martin R; Carbajal, Horacio A; Espeche, Walter G; Aizpurúa, Marcelo; Maciel, Pablo M; Reaven, Gerald M

    2014-02-01

    The plasma concentration ratio of triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) can identify cardiometabolic risk and cardiovascular disease. The visceral adiposity index is a sex-specific index, in which measurements of body mass index and waist circumference are combined with TG and HDL-C concentrations. The current analysis was initiated to see if the visceral adiposity index would improve the ability of the TG/HDL-C to identify increased cardiometabolic risk and outcome. Cardiometabolic data were obtained in 2003 from 926 apparently healthy individuals, 796 of whom were evaluated in 2012 for evidence of incident cardiovascular disease. The relationship between TG/HDL-C and values for visceral adiposity index was evaluated by Pearson's correlation coefficient. The relative risks for first cardiovascular event between individuals above and below the TG/HDL-C sex-specific cut points, and in the top quartile of visceral adiposity index versus the remaining 3 quartiles, were estimated using Cox proportional hazard models. TG/HDL-C concentration and visceral adiposity index were highly correlated (r = 0.99) in both men and women. Although more men (133 vs121) and women (73 vs 59) were identified as being at "high risk" by an elevated TG/HDL-C ratio, the individual cardiometabolic risk factors were essentially identical with either index used. However, the hazard ratio of developing cardiovascular disease was significantly increased in individuals with an elevated TG/HDL-C, whereas it was not the case when the visceral adiposity index was used to define "high risk." The visceral adiposity index does not identify individuals with an adverse cardiometabolic profile any better than the TG/HDL-C. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Assessment of postprandial triglycerides in clinical practice: validation in a general population and coronary heart disease patients

    USDA-ARS?s Scientific Manuscript database

    BACKGROUND: Previous studies have suggested that for clinical purposes, subjects with fasting triglycerides (TGs) between 89-180 mg/dl (1-2 mmol/l) would benefit from postprandial TGs testing. OBJECTIVE: To determine the postprandial TG response in 2 independent studies and validate who should benef...

  9. Influence of triglycerides on other plasma lipids in middle-aged men intended for hypolipidaemic treatment.

    PubMed

    Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Salpea, Klelia D; Hoursalas, Ioannis S; Petropoulos, Ilias; Bilianou, Helen I; Damaskos, Dimitris S; Giannakopoulou, Vasiliki N; Cokkinos, Dennis V

    2006-01-01

    The present investigation aimed to evaluate the influence of serum triglycerides (TG) on other plasma lipids in male patients less than 65 years of age intended for hypolipidaemic treatment. Lipid profiles of a cohort of 412 dyslipidaemic male patients aged 53.4 +/- 7.7 years (mean +/- standard deviation) were evaluated. Patients were stratified in accordance with their fasting plasma lipid levels. They were divided into multiple groups on the basis of serum TG (> or = 150 or < 150 mg/dl) and high-density lipoprotein cholesterol (HDL-C > or = 40 or < 40 mg/dl). Patients with TG > or = 150 mg/dl had higher total cholesterol and lower HDL-C levels compared with those with TG < 150 mg/dl (p = 0.005 and p < 0.001, respectively). Patients with HDL-C < 40 mg/dl had similar total cholesterol levels and higher TG levels compared to those with HDL-C > or = 40 mg/dl (p < 0.001). In all patients, an inverse correlation between TG and HDL-C was found (r = -0.286, p < 0.001). Additionally, HDL-C levels were inversely correlated with the TG concentration in patients with TG < 150 mg/dl (r = -0.135, p = 0.042) and TG > or = 150 mg/dl (r = -0.188, p = 0.002). An inverse correlation between TG and HDL-C levels seems to exist in the sampled population, revealing a close link between the metabolic pathways for TG and HDL-C. This inverse correlation appears to persist even in patients with low fasting TG levels.

  10. Triglyceride-rich lipoproteins as a causal factor for cardiovascular disease

    PubMed Central

    Toth, Peter P

    2016-01-01

    Approximately 25% of US adults are estimated to have hypertriglyceridemia (triglyceride [TG] level ≥150 mg/dL [≥1.7 mmol/L]). Elevated TG levels are associated with increased cardiovascular disease (CVD) risk, and severe hypertriglyceridemia (TG levels ≥500 mg/dL [≥5.6 mmol/L]) is a well-established risk factor for acute pancreatitis. Plasma TG levels correspond to the sum of the TG content in TG-rich lipoproteins (TRLs; ie, very low-density lipoproteins plus chylomicrons) and their remnants. There remains some uncertainty regarding the direct causal role of TRLs in the progression of atherosclerosis and CVD, with cardiovascular outcome studies of TG-lowering agents, to date, having produced inconsistent results. Although low-density lipoprotein cholesterol (LDL-C) remains the primary treatment target to reduce CVD risk, a number of large-scale epidemiological studies have shown that elevated TG levels are independently associated with increased incidence of cardiovascular events, even in patients treated effectively with statins. Genetic studies have further clarified the causal association between TRLs and CVD. Variants in several key genes involved in TRL metabolism are strongly associated with CVD risk, with the strength of a variant’s effect on TG levels correlating with the magnitude of the variant’s effect on CVD. TRLs are thought to contribute to the progression of atherosclerosis and CVD via a number of direct and indirect mechanisms. They directly contribute to intimal cholesterol deposition and are also involved in the activation and enhancement of several proinflammatory, proapoptotic, and procoagulant pathways. Evidence suggests that non-high-density lipoprotein cholesterol, the sum of the total cholesterol carried by atherogenic lipoproteins (including LDL, TRL, and TRL remnants), provides a better indication of CVD risk than LDL-C, particularly in patients with hypertriglyceridemia. This article aims to provide an overview of the

  11. [Influence of diet and behavior related factors on the peripheral blood triglyceride levels in adults: a cross-sectional study].

    PubMed

    Liang, M B; Wang, H; Zhang, J; He, Q F; Fang, L; Wang, L X; Su, D T; Zhao, M; Zhang, X W; Hu, R Y; Cong, L M; Ding, G G; Ye, Z; Yu, M

    2017-12-10

    Objective: To study the influence of diet and behavior related factors on the peripheral blood triglyceride levels in adults, through a cross-sectional survey. Methods: The current study included 13 434 subjects without histories of major chronic diseases from a population-based cross-sectional survey: the 2010 Metabolic Syndrome Survey in Zhejiang Province. A generalized linear model was used to investigate the influence of diet/behavior-related factors on the peripheral blood triglyceride levels. Results: Mean TG of the sample population appeared as (1.36±1.18) mmol/L. The proportions of elevated TG and marginally elevated TG were 10.3% and 11.0% respectively, with statistically significant difference seen between males and females ( χ (2)=44.135, P <0.001). In this sampled population, the daily intake of cooking oil was exceeding the recommendation levels by over 50% while the intake of fruit, milk, nuts and physical exercise were much below the recommendation. There were statistically significant differences between smoking, alcohol-intake, meat, fruit and water intake in male population from this study. However, in females, the intake of aquatic product and physical exercise showed statistically significant differences. After controlling for other variables, factors as age, drinking, staple food and aquatic products showed positive influence on TG, while milk presented negative influence on TG. Through interaction analysis, fruit and meat intake in males and staple food in females showed positive influence on TG, when compared to the reference group. Conclusion: Hyperglyceridemia appeared as one of the major metabolic abnormities in Zhejiang province. Programs on monitoring the alcohol, staple food and meat intake should be priority on intervention, in the communities.

  12. PNPLA3 is regulated by glucose in human hepatocytes, and its I148M mutant slows down triglyceride hydrolysis.

    PubMed

    Perttilä, Julia; Huaman-Samanez, Carolina; Caron, Sandrine; Tanhuanpää, Kimmo; Staels, Bart; Yki-Järvinen, Hannele; Olkkonen, Vesa M

    2012-05-15

    Liver fat is increased in carriers of the minor G allele in rs738409 (I148M amino acid substitution) in patatin-like phospholipase domain-containing 3 (PNPLA3)/adiponutrin. We studied transcriptional regulation of PNPLA3 in immortalized human hepatocytes (IHH) and human hepatoma cells (HuH7) and the impact of PNPLA3 I148M mutant on hepatocyte triglyceride metabolism. Studies in IHH showed that silencing of the carbohydrate response element-binding protein (ChREBP) abolished induction of PNPLA3 mRNA by glucose. Glucose-dependent binding of ChREBP to a newly identified carbohydrate response element in the PNPLA3 promoter was demonstrated by chromatin immunoprecipitation. Adenoviral overexpression of mouse ChREBP in IHH failed to induce PNPLA3 mRNA. [(3)H]acetate or [(3)H]oleate incorporation with 1-h pulse labeling or 18-h [(3)H]oleate labeling in HuH7 cells showed no effect of PNPLA3 I148M on triglyceride (TG) synthesis in the absence of free fatty acid (FFA) loading. Increased [(3)H]oleate accumulation into triglycerides in I148M-expressing cells was observed after 18 h of labeling in the presence of 200 μM FFA-albumin complexes. This was accompanied by increased PNPLA3 protein levels. The rate of hydrolysis of [(3)H]TG during lipid depletion was decreased significantly by PNPLA3 I148M. Our results suggest that PNPLA3 is regulated in human hepatocytes by glucose via ChREBP. PNPLA3 I148M enhances cellular accumulation of [(3)H]TG in the presence of excess FFA, which is known to stabilize PNPLA3 protein. These data do not exclude an effect of PNPLA3 I148M on hepatocyte lipogenesis but show that the mutant increases the stability of triglycerides.

  13. The role of the daily feeding rhythm in the regulation of the day/night rhythm in triglyceride secretion in rats.

    PubMed

    Su, Yan; Foppen, Ewout; Mansur Machado, Frederico Sander; Fliers, Eric; Kalsbeek, Andries

    2018-02-15

    Plasma triglyceride (TG) levels show a clear daily rhythm, however, thus far it is still unknown whether this rhythm results from a daily rhythm in TG production, TG uptake or both. Previous studies have shown that feeding activity affects plasma TG concentrations, but it is not clear how the daily rhythm in feeding activity affects plasma TG concentrations. In the present study, we measured plasma TG concentrations and TG secretion rates in rats at 6 Zeitgeber times to investigate whether plasma TG concentrations and TG secretion show a daily rhythm. We found that plasma TG concentrations and TG secretion show a significant day/night rhythm. Next, we removed the daily rhythm in feeding behavior by introducing a 6-meals-a-day (6M) feeding schedule to investigate whether the daily rhythm in feeding behavior is necessary to maintain the daily rhythm in TG secretion. We found that the day/night rhythm in TG secretion was abolished under 6M feeding conditions. Hepatic apolipoprotein B (ApoB) and microsomal TG transfer protein (Mttp), which are both involved in TG secretion, also lost their daily rhythmicity under 6M feeding conditions. Together, these results indicate that: (1) the daily rhythm in TG secretion contributes to the formation of a day/night rhythm in plasma TG levels and (2) a daily feeding rhythm is essential for maintaining the daily rhythm in TG secretion.

  14. Triglyceride to HDL-C ratio and increased arterial stiffness in children, adolescents, and young adults.

    PubMed

    Urbina, Elaine M; Khoury, Philip R; McCoy, Connie E; Dolan, Lawrence M; Daniels, Stephen R; Kimball, Thomas R

    2013-04-01

    Lipid levels are linked to early atherosclerosis. Risk stratification may be improved by using triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C), which relates to arterial stiffness in adults. We tested whether TG/HDL-C was an independent predictor of arterial stiffness in youth. Subjects 10 to 26 years old (mean 18.9 years, 39% male, 56% non-Caucasian, n = 893) had laboratory, anthropometric, blood pressure, and arterial stiffness data collected (brachial distensibility, augmentation index, carotid-femoral pulse-wave velocity). Subjects were stratified into tertiles of TG/HDL-C (low, n = 227; mid, n = 288; high, n = 379). There was a progressive rise in cardiovascular (CV) risk factors and arterial stiffness across TG/HDL-C ratio. The high TG/HDL-C ratio group had the stiffest vessels (all P < .03 by analysis of variance). TG/HDL-C as a continuous variable was an independent determinant of brachial distensibility in CV risk factor adjusted model and for carotid-femoral pulse-wave velocity in obese subjects, with trend for higher augmentation index. TG/HDL-C, an estimate of small, dense low-density lipoprotein cholesterol, is an independent determinant of arterial stiffness in adolescents and young adults, especially in obese youth. These data suggest that use of TG/HDL-C may be helpful in identifying young adults requiring aggressive intervention to prevent atherosclerotic CV diseases.

  15. Beyond LDL: What Role for PCSK9 in Triglyceride-Rich Lipoprotein Metabolism?

    PubMed

    Dijk, Wieneke; Le May, Cédric; Cariou, Bertrand

    2018-06-01

    Elevated plasma triglyceride (TG) levels are an independent risk factor for cardiovascular disease (CVD). Proprotein convertase subtilisin-kexin 9 (PCSK9) - a protein therapeutically targeted to lower plasma cholesterol levels - might regulate plasma TG-rich lipoprotein (TRL) levels. We provide a timely and critical review of the current evidence for a role of PCSK9 in TRL metabolism by assessing the impact of PCSK9 gene variants, by reviewing recent clinical data with PCSK9 inhibitors, and by describing the potential mechanisms by which PCSK9 might regulate TRL metabolism. We conclude that the impact of PCSK9 on TRL metabolism is relatively modest, especially compared to its impact on cholesterol metabolism. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Longitudinal Associations between Triglycerides and Metabolic Syndrome Components in a Beijing Adult Population, 2007-2012.

    PubMed

    Tao, Li-Xin; Yang, Kun; Liu, Xiang-Tong; Cao, Kai; Zhu, Hui-Ping; Luo, Yan-Xia; Guo, Jin; Wu, Li-Juan; Li, Xia; Guo, Xiu-Hua

    2016-01-01

    Longitudinal associations between triglycerides (TG) and other metabolic syndrome (MetS) components have rarely been reported. The purpose was to investigate the longitudinal association between TG and other MetS components with time. The longitudinal study was established in 2007 on individuals who attended health check-ups at Beijing Tongren Hospital and Beijing Xiaotangshan Hospital. Data used in this study was based on 7489 participants who had at least three health check-ups over a period of 5-year follow up. Joint model was used to explore longitudinal associations between TG and other MetS components after adjusted for age. There were positive correlations between TG and other MetS components except for high density lipoprotein (HDL), and the correlations increased with time. A negative correlation was displayed between TG and HDL, and the correlation also increased with time. Among all five pairs of TG and other MetS components, the marginal correlation between TG and body mass index (BMI) was the largest for both men and women. The marginal correlation between TG and fasting plasma glucose was the smallest for men, while the marginal correlation between TG and diastolic blood pressure was the smallest for women. The longitudinal association between TG and other MetS components increased with time. Among five pairs of TG and other MetS components, the longitudinal correlation between TG and BMI was the largest. It is important to closely monitor subjects with high levels of TG and BMI in health check-up population especially for women, because these two components are closely associated with development of hypertension, diabetes, cardiovascular disease and other metabolic diseases.

  17. Association of triglyceride-to-high density lipoprotein cholesterol ratio to cardiorespiratory fitness in men.

    PubMed

    Vega, Gloria Lena; Grundy, Scott M; Barlow, Carolyn E; Leonard, David; Willis, Benjamin L; DeFina, Laura F; Farrell, Stephen W

    Both triglyceride-to-high density lipoprotein cholesterol (TG/HDL-C) and cardiorespiratory fitness (CRF) impart risk for all-cause morbidity and mortality independently of conventional risk factors. To determine prevalence and/or incidence of high TG/HDL-C ratio in men with low CRF. Clinical characteristics and CRF were used to determine prevalence of a TG/HDL-C ratio ≥ 3.5 (high ratio) in 13,954 men of the Cooper Center Longitudinal Study. High-ratio conversion was determined in 10,424 men with normal baseline TG/HDL-C ratio. Hazard ratio (HR) of incident high TG/HDL-C was adjusted for age and waist girth. Men with low CRF had the highest prevalence of a high TG/HDL-C ratio. In the population with normal TG/HDL-C, age-adjusted HR of incident high TG/HDL-C ratio was 2.77 times higher in men with lowest CRF than in those with highest CRF. Incidence of conversion of normal to high ratio was 5.5% per year in low CRF population, compared with 1.7% in high CRF subjects. Incidence HR was independent of waist girth. Men who converted from normal to high TG/HDL-C ratio during the follow-up period had increased number of metabolic risk factors and a higher prevalence of metabolic syndrome. Men who did not convert to a high TG/HDL-C ratio retained a low prevalence of metabolic syndrome risk factors. A high TG/HDL-C ratio is common in men with low CRF. Metabolic syndrome also is common among those with a high ratio. Copyright © 2016 National Lipid Association. All rights reserved.

  18. Assessment of the ability of the triglyceride to high density lipoprotein cholesterol ratio to discriminate insulin resistance among Caribbean-born black persons with and without Hispanic ethnicity.

    PubMed

    Tull, E S

    2013-02-01

    The objective of this research was to determine if the triglyceride (TG) to high density lipoprotein (HDL) cholesterol (TG/HDL) ratio has similar utility for discriminating insulin resistance in Caribbean-born black persons with and without Hispanic ethnicity. Serum lipids, glucose and insulin were determined and compared for 144 Hispanic blacks and 655 non-Hispanic blacks living in the US Virgin Islands. Area under the receiver operating characteristics (AUROC) curve statistics were used to evaluate the ability of the TG/HDL ratio to discriminate insulin resistance in the two ethnic groups. Hispanic blacks had significantly higher levels of triglycerides and insulin resistance and a lower level of HDL cholesterol than non-Hispanic blacks. The AUROC curve for the ability of the TG/HDL to discriminate insulin resistance was 0.71 (95% CI = 0.62, 0.79) for Hispanic blacks and 0.64 (95% CI = 0.59, 0.69) for non-Hispanic blacks. Among Caribbean-born black persons living in the US Virgin Islands, the TG/HDL ratio is a useful screening measure for discriminating insulin resistance in those with Hispanic ethnicity but not in those without Hispanic ethnicity.

  19. Inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) prevents dietary cholesterol-associated steatosis by enhancing hepatic triglyceride mobilization.

    PubMed

    Alger, Heather M; Brown, J Mark; Sawyer, Janet K; Kelley, Kathryn L; Shah, Ramesh; Wilson, Martha D; Willingham, Mark C; Rudel, Lawrence L

    2010-05-07

    Acyl-CoA:cholesterol O-acyl transferase 2 (ACAT2) promotes cholesterol absorption by the intestine and the secretion of cholesteryl ester-enriched very low density lipoproteins by the liver. Paradoxically, mice lacking ACAT2 also exhibit mild hypertriglyceridemia. The present study addresses the unexpected role of ACAT2 in regulation of hepatic triglyceride (TG) metabolism. Mouse models of either complete genetic deficiency or pharmacological inhibition of ACAT2 were fed low fat diets containing various amounts of cholesterol to induce hepatic steatosis. Mice genetically lacking ACAT2 in both the intestine and the liver were dramatically protected against hepatic neutral lipid (TG and cholesteryl ester) accumulation, with the greatest differences occurring in situations where dietary cholesterol was elevated. Further studies demonstrated that liver-specific depletion of ACAT2 with antisense oligonucleotides prevents dietary cholesterol-associated hepatic steatosis both in an inbred mouse model of non-alcoholic fatty liver disease (SJL/J) and in a humanized hyperlipidemic mouse model (LDLr(-/-), apoB(100/100)). All mouse models of diminished ACAT2 function showed lowered hepatic triglyceride concentrations and higher plasma triglycerides secondary to increased hepatic secretion of TG into nascent very low density lipoproteins. This work demonstrates that inhibition of hepatic ACAT2 can prevent dietary cholesterol-driven hepatic steatosis in mice. These data provide the first evidence to suggest that ACAT2-specific inhibitors may hold unexpected therapeutic potential to treat both atherosclerosis and non-alcoholic fatty liver disease.

  20. Different Patterns of Walking and Postprandial Triglycerides in Older Women

    PubMed Central

    KASHIWABARA, KYOKO; KIDOKORO, TETSUHIRO; YANAOKA, TAKUMA; BURNS, STEPHEN F.; STENSEL, DAVID J.; MIYASHITA, MASASHI

    2018-01-01

    ABSTRACT Purpose Although a single bout of continuous exercise (≥30 min) reduces postprandial triglyceride (TG), little evidence is available regarding the effect of multiple short (≤10 min) bouts of exercise on postprandial TG in individuals at increased risk for cardiovascular diseases. This study compared the effects of different patterns of walking on postprandial TG in postmenopausal, older women with hypertriglyceridemia. Methods Twelve inactive women (mean age ± SD, 71 ± 5 yr) with hypertriglyceridemia (fasting TG ≥1.70 mmol·L−1) completed three, 1-d laboratory-based trials in a random order: 1) control, 2) continuous walking, and 3) multiple short bouts of walking. On the control trial, participants sat in a chair for 8 h. For the walking trials, participants walked briskly in either one 30-min bout in the morning (0900–0930 h) or twenty 90-s bouts over 8 h. Except for walking, both exercise trials mimicked the control trial. In each trial, participants consumed a standardized breakfast (0800 h) and lunch (1100 h). Venous blood samples were collected in the fasted state and at 2, 4, 6, and 8 h after breakfast. Results The serum TG incremental area under the curve was 35% and 33% lower on the continuous and multiple short bouts of walking trials than that on the control trial (8.2 ± 3.1 vs 8.5 ± 5.4 vs 12.7 ± 5.8 mmol per 8 h·L−1, respectively; main effect of trial: effect size = 0.459, P = 0.001). Conclusions Accumulating walking in short bouts limits postprandial TG in at-risk, inactive older women with fasting hypertriglyceridemia. PMID:28857839

  1. Antihyperlipidemic activity of Ichnocarpus frutescens in triton WR-1339-induced and high-fat diet animals.

    PubMed

    Saravanan, M; Pandikumar, P; Prakash Babu, N; Ignacimuthu, S

    2011-10-01

    Ichnocarpus frutescens (L.) R.Br. (Apocynaceae) is used to treat diabetes and hyperlipidemia in folk medicine. The crude methanol extract and fractions of I. frutescens were investigated for antihyperlipidemic effect. Fresh leaves of I. frutescens were extracted with methanol and fractionated with hexane, benzene, ethyl acetate, acetone, and methanol. The active acetone fraction was subfractionated, which resulted in active fraction 3. The antihyperlipidemic effects of the methanol extract and fractions of I. frutescens were studied in triton WR-1339-induced and high-fat diet (HFD) obese animals. Further, lipid absorption and excretion were studied. The methanol extract significantly reduced total cholesterol (TC) by 29.63% and triglyceride (Tg) by 51.10% at 400 mg/kg in triton WR-1339-induced animals and significantly reduced TC (27.81%) and Tg (37.03%) at 400 mg/kg in HFD animals. Fraction 3 showed significant reduction in TC (25.03%) and Tg (58.05%) at 200 mg/kg. Feeding of HFD consisting 3% of fraction 3 increased feces weight and Tg level in mice. Fraction 3, showed significant decrease in plasma Tg level at the second hour, after oral administration of the lipid emulsion to rats. The observed properties apparently validate the folk medicinal use of this plant in amelioration of hyperlipidemia.

  2. Efficient lowering of triglyceride levels in mice by human apoAV protein variants associated with hypertriglyceridemia.

    PubMed

    Vaessen, Stefan F C; Sierts, Jeroen A; Kuivenhoven, Jan Albert; Schaap, Frank G

    2009-02-06

    Variation in the apolipoprotein A5 (APOA5) gene has consistently been associated with increased plasma triglyceride (TG) levels in epidemiological studies. In vivo functionality of these variations, however, has thus far not been tested. Using adenoviral over-expression, we evaluated plasma expression levels and TG-lowering efficacies of wild-type human apoAV, two human apoAV variants associated with increased TG (S19W, G185C) and one variant (Q341H) that is predicted to have altered protein function. Injection of mice with adenovirus encoding wild-type or mutant apoAV resulted in an identical dose-dependent elevation of human apoAV levels in plasma. The increase in apoAV levels resulted in pronounced lowering of plasma TG levels at two viral dosages. Unexpectedly, the TG-lowering efficacy of all three apoAV variants was similar to wild-type apoAV. In addition, no effect on TG-hydrolysis-related plasma parameters (free fatty acids, glycerol and post-heparin lipoprotein lipase activity) was apparent upon expression of all apoAV variants. In conclusion, our data indicate that despite their association with hypertriglyceridemia and/or predicted protein dysfunction, the 19W, 185C and 341H apoAV variants are equally effective in reducing plasma TG levels in mice.

  3. Self-monitoring of plasma triglyceride levels to evaluate postprandial response to different nutrients.

    PubMed

    Iovine, C; Gentile, A; Hattemer, A; Pacioni, D; Riccardi, G; Rivellese, A A

    2004-05-01

    Self-monitoring of plasma triglycerides (TG) may be a very useful tool to monitor, on a daily basis, the TG responses to different nutrients, particularly carbohydrates (CHO) and fat, whose influence on postprandial TG levels is not very well known. Therefore, the aim of the present study was to evaluate the TG response of hypertriglyceridemic patients to a similar amount of calories deriving from different sources of CHO and fat. Thirty-nine hypertriglyceridemic patients were randomly assigned to 1 of 2 experimental groups. In 1 group (the fat group), patients were given a standard meal plus a fat supplement of 300 kcal derived from different types of fat (butter, sunflower margarine, olive oil) for dinner, once a week for 3 weeks. In the other group (the CHO group), patients consumed the same standard meal plus a supplement of 300 kcal derived from different types of CHO (bread, coke, fruit). In both groups, patients measured their plasma TG before and 3 hours after each meal by Accutrend GCT (ROCHE, Mannheim, Germany). A subgroup of patients (n = 18) also performed TG determinations 2 hours after the test meals. The 3-hour TG increments were not significantly different between the different test meals (f = 0.671; P =.52); instead, the TG increments induced by fat supplements were significantly higher than those induced by the CHO supplements (f = 14.31; P =.0001). Similar results were also obtained 2 hours after the test meals. In conclusion, this study shows that the 2- and 3-hour TG responses to fat are higher compared with that induced by carbohydrate. This point, especially if confirmed by experiments with more frequent after meal measurements and of longer duration, should be taken into account in defining the best dietary approach to lower plasma TG levels throughout the whole day.

  4. Acute effects of exercise and calorie restriction on triglyceride metabolism in women

    PubMed Central

    Bellou, Elena; Siopi, Aikaterina; Galani, Maria; Maraki, Maria; Tsekouras, Yiannis E.; Panagiotakos, Demosthenes B.; Kavouras, Stavros A.; Magkos, Faidon; Sidossis, Labros S.

    2013-01-01

    The mechanisms by which exercise reduces fasting plasma triglyceride (TG) concentrations in women and the effect of negative energy balance independent of muscular contraction are not known. Purpose The aim of this study was to evaluate the effects of equivalent energy deficits induced by exercise or calorie restriction on basal very low-density lipoprotein (VLDL) TG metabolism in women. Methods Eleven healthy women (age: 23.5±2.7 years, BMI: 21.6±1.4 kg/m2) underwent a stable isotopically labeled tracer infusion study to determine basal VLDL-TG kinetics after performing, in random order, three experimental trials on the previous day: i) a single exercise bout (brisk walking at 60% of peak oxygen consumption for 123±18 min, with a net energy expenditure of 2.06±0.39 MJ (~500 kcal)), ii) dietary energy restriction of 2.10±0.41 MJ, and iii) a control day of isocaloric feeding and rest (zero energy balance). Results Fasting plasma VLDL-TG concentration was ~30% lower after the exercise trial compared to the control trial (P<0.001), whereas no significant change was detected after the calorie restriction trial (P=0.297 vs control). Relative to the control condition, exercise increased the plasma clearance rate of VLDL-TG by 22% (P=0.001) and reduced hepatic VLDL-TG secretion rate by ~17% (P=0.042), whereas hypocaloric diet had no effect on VLDL-TG kinetics (P>0.2). Conclusion (i) Exercise-induced hypotriglyceridemia in women manifests through a different mechanism (increased clearance and decreased secretion of VLDL-TG) than that previously described in men (increased clearance of VLDL-TG only), and (ii) exercise affects TG homeostasis by eliciting changes in VLDL-TG kinetics that cannot be reproduced by an equivalent diet-induced energy deficit, indicating that these changes are independent of the exercise-induced negative energy balance but instead are specific to muscular contraction. PMID:23073216

  5. Acute effects of exercise and calorie restriction on triglyceride metabolism in women.

    PubMed

    Bellou, Elena; Siopi, Aikaterina; Galani, Maria; Maraki, Maria; Tsekouras, Yiannis E; Panagiotakos, Demosthenes B; Kavouras, Stavros A; Magkos, Faidon; Sidossis, Labros S

    2013-03-01

    The mechanisms by which exercise reduces fasting plasma triglyceride (TG) concentrations in women and the effect of negative energy balance independent of muscular contraction are not known.The aim of this study was to evaluate the effects of equivalent energy deficits induced by exercise or calorie restriction on basal VLDL-TG metabolism in women. Eleven healthy women (age = 23.5 ± 2.7 yr, body mass index = 21.6 ± 1.4 kg·m-2; mean ± SD) underwent a stable isotopically labeled tracer infusion study to determine basal VLDL-TG kinetics after performing, in random order, three experimental trials on the previous day: (i) a single exercise bout (brisk walking at 60% of peak oxygen consumption for 123 ± 18 min, with a net energy expenditure of 2.06 ± 0.39 MJ, ∼500 kcal), (ii) dietary energy restriction of 2.10 ± 0.41 MJ, and (iii) a control day of isocaloric feeding and rest (zero energy balance). Fasting plasma VLDL-TG concentration was approximately 30% lower after the exercise trial compared with the control trial (P < 0.001), whereas no significant change was detected after the calorie restriction trial (P = 0.297 vs control). Relative to the control condition, exercise increased the plasma clearance rate of VLDL-TG by 22% (P = 0.001) and reduced hepatic VLDL-TG secretion rate by approximately 17% (P = 0.042), whereas hypocaloric diet had no effect on VLDL-TG kinetics (P > 0.2). (i) Exercise-induced hypotriglyceridemia in women manifests through a different mechanism (increased clearance and decreased secretion of VLDL-TG) than that previously described in men (increased clearance of VLDL-TG only), and (ii) exercise affects TG homeostasis by eliciting changes in VLDL-TG kinetics that cannot be reproduced by an equivalent diet-induced energy deficit, indicating that these changes are independent of the exercise-induced negative energy balance but instead are specific to muscular contraction.

  6. Icosapent ethyl: Eicosapentaenoic acid concentration and triglyceride-lowering effects across clinical studies.

    PubMed

    Bays, Harold E; Ballantyne, Christie M; Doyle, Ralph T; Juliano, Rebecca A; Philip, Sephy

    2016-09-01

    Icosapent ethyl is a high-purity prescription form of eicosapentaenoic acid (EPA) ethyl ester approved at a dose of 4g/day as an adjunct to diet to reduce triglyceride (TG) levels in adult patients with severe (≥500mg/dL) hypertriglyceridemia. This post-hoc exploratory analysis examined the relationship of icosapent ethyl dose with EPA concentrations in plasma and red blood cells (RBCs) across 3 clinical studies-a phase 1 pharmacokinetic study in healthy adult volunteers and 2 pivotal phase 3 studies (MARINE and ANCHOR) in adult patients with hypertriglyceridemia-and examined the relationship between EPA levels and TG-lowering effects in MARINE and ANCHOR. In all 3 studies, icosapent ethyl produced dose-dependent increases in the concentrations of EPA in plasma and RBCs. In both MARINE and ANCHOR, these dose-dependent EPA increases correlated with the degree of TG level lowering (all P<0.01). In patients with high TG levels (≥200mg/dL) and treated with icosapent ethyl 4g/day, the end-of-treatment plasma and RBC EPA concentrations were >170μg/mL and>70μg/mL, respectively. These studies support icosapent ethyl as producing predictable dose-dependent pharmacokinetics/pharmacodynamics, with TG level lowering dependent upon icosapent ethyl dose and EPA concentrations in plasma and RBCs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Atypical Antipsychotic Medications Increase Postprandial Triglyceride and Glucose Levels in Male Rats: Relationship with Stearoyl-CoA Desaturase Activity

    PubMed Central

    McNamara, Robert K.; Jandacek, Ronald; Rider, Therese; Tso, Patrick; Cole-Strauss, Allyson; Lipton, Jack W.

    2011-01-01

    Recent preclinical and clinical evidence suggests that the stearoyl-CoA desaturase-1 (Scd1) enzyme plays a key role in the regulation of triglyceride (TG) biosynthesis and insulin sensitivity, and in vitro studies have found that antipsychotic medications up-regulate Scd1 mRNA expression. To investigate these effects in vivo, rats were treated with risperidone (1.5, 3, 6 mg/kg/d), paliperidone (1.5, 3, 6 mg/kg/d), olanzapine (2.5, 5, 10 mg/kg/d), quetiapine (5, 10, 20 mg/kg/d), haloperidol (1, 3 mg/kg/d) or vehicle through their drinking water for 40 d. Effects on liver Scd1 mRNA expression and an index of Scd1 activity (the plasma 18:1/18:0 ratio, ‘deaturation index’) were determined, as were postprandial plasma triglyceride (TG), glucose, insulin, and polyunsaturated fatty acid (PUFA) levels. All atypical antipsychotics increased the plasma 18:1/18:0 ratio, but not liver Scd1 mRNA expression, at doses found to also increase plasma TG levels. Among all rats (n=122), the plasma 18:1/18:0 ratio accounted for 56% of the variance in TG concentrations. The plasma 18:1/18:0 ratio was also positively associated with erythrocyte and heart membrane phospholipid 18:1n-9 composition. All antipsychotics except risperidone increased glucose levels at specific doses, and none of the antipsychotics significantly altered insulin levels. The plasma 18:1/18:0 ratio accounted for 20% of the variance in glucose levels. Plasma omega-3 and omega-6 PUFA levels were inversely correlated with the plasma 18:1/18:0 ratio and TG and glucose levels. These in vivo data demonstrate that different atypical antipsychotic medications increase the plasma 18:1/18:0 ratio in association with elevations in postprandial TG levels, and that concomitant elevations in PUFA biosynthesis oppose these effects. PMID:21474290

  8. Assessment of the relationship between lipid parameters and obesity indices in non-diabetic obese patients: a preliminary report.

    PubMed

    Stępień, Anna; Stępień, Mariusz; Wlazeł, Rafał N; Paradowski, Marek; Banach, Maciej; Rysz, Jacek

    2014-12-16

    The aim of this cross-sectional study was to examine the relationship between obesity and lipid markers. We divided 66 non-diabetic adult obese patients (mean age: 55.8±11.6 years) into 3 groups according to body mass index (BMI). All patients were measured for waist circumference (WC), hip circumference (HC), body mass index (BMI), waist-to-hip ratio (WHR), waist-to-height ratio (WHtR), body adiposity index (BAI), and visceral adiposity index (VAI). Serum levels of total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG) were determined, and lipid indices TC/HDL, LDL/HDL, and TG/HDL were also estimated. TC and LDL-C in Group III were lower than in Group I (5.0±1.0 vs. 6.0±1.0 mmol/L, and 2.9±0.9 vs. 3.8±1.2 mmol/L; p<0.05 for both). Negative correlations were found between: BMI and TC, LDL, and HDL (r=-0.291; r=-0.310, r=-0.240, respectively); and WC, WHR, VAI, and HDL (r=-0.371, r=-0.296, r=-0.376, respectively). Positive correlations were found between WC, WHR, and TG/HDL (r=0.279, r=0.244, respectively) and between VAI and: TC (r=0.327), TG (r=0.885), TC/HDL (r=0.618), LDL/HDL (r=0.480), and TG/HDL (r=0.927). Obesity is associated with lipid disturbances, especially with HDL-C reduction, in obese non-diabetic patients. VAI is strongly related to lipid profile and thus may be the most valuable obesity index in obese patients with dyslipidemias.

  9. The Paradox of ApoA5 Modulation of Triglycerides: Evidences from Clinical and Basic Research

    PubMed Central

    Garelnabi, Mahdi; Lor, Kenton; Jin, Jun; Chai, Fei; Santanam, Nalini

    2012-01-01

    Apolipoprotein A5 (ApoA5) is a key regulator of plasma triglycerides (TG), although its plasma concentration is very low compared to other known apoproteins. Over the years, researchers have attempted to elucidate the molecular mechanisms by which ApoA5 regulates plasma TG in vivo. Though still under debate, two theories broadly describe how ApoA5 modulates TG levels: (i) ApoA5 enhances the catabolism of TG-rich lipoproteins and (ii) it inhibits the rate of production of very low-density lipoprotein (VLDL), the major carrier of TGs. This review will summarize the basic and clinical studies that have attempted to describe the importance of ApoA5 in TG metabolism. Population studies conducted in various countries have demonstrated an association between single nucleotide polymorphisms (SNPs) in ApoA5 and the increased risk to cardiovascular disease and metabolic syndrome (including diabetes and obesity). ApoA5 is also highly expressed during liver regeneration and is an acute phase protein associated with HDL which was independent of its effects on TG metabolism. Conclusion Despite considerable evidences available from clinical and basic research studies, on the role of ApoA5 in TG metabolism and its indirect link to metabolic diseases, additional investigations are needed to understand the paradoxical role of this important apoprotein shown modulated by diet and from it polymorphism variants. PMID:23000317

  10. [Effects of fructose on triglycerides in individuals with diabetes: a Meta-analysis of experimental trials].

    PubMed

    Xiang, Xuesong; Zhao, Jia; Zhu, Jing; Zhang, Peng; Wang, Zhu; Yang, Yuexin

    2015-05-01

    To assess the effects of fructose on the blood triglycerides, particularly examining treatment dose, duration, and control of food in individuals with diabetes. A systematic review and Meta-analysis of experimental clinical trials were conducted to investigate the effect of isocaloric fructose exchange for carbohydrate on triglycerides, total cholesterol. MedLine, EMBASE, The Cochrane Library, CMBdisc, CNKI (1970-2014), and some related journals were searched. Heterogeneity was assessed by 2 tests and quantified by I2. Meta-analysis was conducted by RevMan 5.3. 15 reports (21 trials) met the eligibility criteria. Isocaloric fructose exchange for carbohydrate raised triglycerides under specific conditions in individuals with type 2 diabetes. A triglyceride-raising effect without heterogeneity was seen only in type 2 diabetes when the dose was ≥ 100 g fructose/d (WMD 0.17, 95% CI0.08 - 0.25, P < 0.0001). A triglyceride-raising effect with heterogeneity was seen in type 2 diabetes when the reference carbohydrate was starch (WMD 0.13, 95% CI 0.02 - 0.23 , P = 0.02). Effect of fructose on the level of TG in type 2 diabetes patients is more sensitive than that in type 1 diabetes. The effect on triglycerides is dose dependent and depends on what kinds of carbohydrate is being exchanged with fructose.

  11. Alteration of Lipid Parameters in Patients With Subclinical Hypothyroidism

    PubMed Central

    Laway, Bashir Ahmad; War, Fayaz Ahmad; Shah, Sonaullah; Misgar, Raiz Ahmad; Kumar Kotwal, Suman

    2014-01-01

    Background: Overt hypothyroidism is associated with abnormalities of lipid metabolism, but conflicting results regarding the degree of lipid changes in subclinical hypothyroidism (SCH) exist. Objectives: The aim of this study was to assess differences in lipid profile parameters between subjects with and without SCH in a north Indian population. Patients and Methods: Serum lipid parameters of 70 patients with subclinical hypothyroidism and 100 age and sex matched euthyroid controls were evaluated in a cross-sectional study. Results: Mean serum total cholesterol (TC), triglycerides (TG) and very low-density cholesterol (VLDL) were significantly higher in patients with SCH than controls (P < 0.05). Mean TC, TG and low-density cholesterol (LDL) concentrations were higher in patients with serum thyroid stimulating hormone (TSH) greater than 10 mU/L than those with serum TSH equal to or less than 10 mU/L, but this difference was not statistically significant. No association was found between serum high-density cholesterol (HDL-C) concentration and serum TSH level. Conclusions: High TC, TG and VLDL were observed in our patients with SCH. PMID:25237326

  12. Triglyceride to HDL-C Ratio and Increased Arterial Stiffness in Children, Adolescents, and Young Adults

    PubMed Central

    Khoury, Philip R.; McCoy, Connie E.; Dolan, Lawrence M.; Daniels, Stephen R.; Kimball, Thomas R.

    2013-01-01

    BACKGROUND AND OBJECTIVE: Lipid levels are linked to early atherosclerosis. Risk stratification may be improved by using triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C), which relates to arterial stiffness in adults. We tested whether TG/HDL-C was an independent predictor of arterial stiffness in youth. METHODS: Subjects 10 to 26 years old (mean 18.9 years, 39% male, 56% non-Caucasian, n = 893) had laboratory, anthropometric, blood pressure, and arterial stiffness data collected (brachial distensibility, augmentation index, carotid-femoral pulse-wave velocity). Subjects were stratified into tertiles of TG/HDL-C (low, n = 227; mid, n = 288; high, n = 379). RESULTS: There was a progressive rise in cardiovascular (CV) risk factors and arterial stiffness across TG/HDL-C ratio. The high TG/HDL-C ratio group had the stiffest vessels (all P < .03 by analysis of variance). TG/HDL-C as a continuous variable was an independent determinant of brachial distensibility in CV risk factor adjusted model and for carotid-femoral pulse-wave velocity in obese subjects, with trend for higher augmentation index. CONCLUSIONS: TG/HDL-C, an estimate of small, dense low-density lipoprotein cholesterol, is an independent determinant of arterial stiffness in adolescents and young adults, especially in obese youth. These data suggest that use of TG/HDL-C may be helpful in identifying young adults requiring aggressive intervention to prevent atherosclerotic CV diseases. PMID:23460684

  13. Genetically elevated levels of circulating triglycerides and brachial-ankle pulse wave velocity in a Chinese population.

    PubMed

    Yao, W-M; Zhang, H-F; Zhu, Z-Y; Zhou, Y-L; Liang, N-X; Xu, D-J; Zhou, F; Sheng, Y-H; Yang, R; Gong, L; Yin, Z-J; Chen, F-K; Cao, K-J; Li, X-L

    2013-04-01

    Elevated levels of circulating triglycerides and increased arterial stiffness are associated with cardiovascular disease. Numerous studies have reported an association between levels of circulating triglycerides and arterial stiffness. We used Mendelian randomization to test whether this association is causal. We investigated the association between circulating triglyceride levels, the apolipoprotein A-V (ApoA5) -1131T>C single nucleotide polymorphism and brachial-ankle pulse wave velocity (baPWV) by examining data from 4421 subjects aged 18-74 years who were recruited from the Chinese population. baPWV was significantly associated with the levels of circulating triglycerides after adjusting for age, sex, body mass index (BMI), systolic blood pressure, heart rate, waist-to-hip ratio, antihypertensive treatment and diabetes mellitus status. The -1131C allele was associated with a 5% (95% confidence interval 3-8%) increase in circulating triglycerides (adjusted for age, sex, BMI, waist-to-hip ratio, diabetes mellitus and antihypertensive treatment). Instrumental variable analysis showed that genetically elevated levels of circulating triglycerides were not associated with increased baPWV. These results do not support the hypothesis that levels of circulating triglycerides have a causal role in the development of arterial stiffness.

  14. Independent association of TG/HDL-C with urinary albumin excretion in normotensive subjects in a rural Korean population.

    PubMed

    Kang, Hee-Taik; Kim, Jong-Koo; Kim, Jang-Young; Linton, John A; Yoon, Jin-Ha; Koh, Sang-Baek

    2012-01-18

    The ratio of triglycerides (TG, mg/dl) to high-density lipoprotein cholesterol (HDL-C, mg/dl) is a reliable indicator of insulin resistance and atherosclerotic diseases in some ethnic groups. This study is performed to examine the association between TG/HDL-C and albuminuria. This cross-sectional study included 9094 adult subjects (4091 men, 5003 women) who were enrolled in the Korean Genomic Rural Cohort (KGRC) and aged 40 years or more. Albuminuria was defined as a urine albumin/creatinine ratio ≥ 30 mg/g. Participants were categorized into TG/HDL-C quartile. Compared to the lowest TG/HDL-C quartile (<1.94 in men, <1.71 in women), the odds ratios (ORs) for albuminuria in participants who were categorized in the highest TG/HDL-C quartile (≥ 4.98 in men, ≥ 4.20 in women) were 1.30 (95% CI: 0.97-1.75) and 1.36 (1.03-1.79) in men and women, respectively, when adjusted for blood pressure and other covariates. In normotensive men and women, the ORs for albuminuria in the highest TG/HDL-C quartile were 1.58 (1.04-2.39) and 1.68 (1.15-2.45), respectively, even after fully adjusted. In contrast, TG/HDL-C was not associated with albuminuria in hypertensive subjects. TG/HDL-C was independently associated with increased prevalence of albuminuria in normotensive rural Korean subjects aged 40 years or more in KGRC. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Activation of farnesoid X receptor promotes triglycerides lowering by suppressing phospholipase A2 G12B expression.

    PubMed

    Liu, Qingli; Yang, Meng; Fu, Xuekun; Liu, Renzhong; Sun, Caijun; Pan, Haobo; Wong, Chi-Wai; Guan, Min

    2016-11-15

    As a novel mediator of hepatic very low-density lipoproteins (VLDL) secretion, phospholipase A2 G12B (PLA2G12B) is transcriptionally regulated by hepatocyte nuclear factor-4 alpha (HNF-4α). Farnesoid X receptor (FXR) plays a critical role in maintaining bile acids and triglycerides (TG) homeostasis. Here we report that FXR regulates serum TG level in part through PLA2G12B. Activation of FXR by chenodeoxycholic acid (CDCA) or GW4064 significantly decreased PLA2G12B expression in HepG2 cells. PLA2G12B expression was transcriptionally repressed due to an FXR-mediated up-regulation of small heterodimer partner (SHP) which functionally suppresses HNF-4α activity. We found that hepatic PLA2G12B expression was suppressed and serum TG level reduced in high fat diet mice treated with CDCA. Concurrently, CDCA treatment lowered hepatic VLDL-TG secretion. Our data demonstrate that activation of FXR promotes TG lowering, not only by decreasing de novo lipogenesis but also reducing hepatic secretion of TG-rich VLDL particles in part through suppressing PLA2G12B expression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  16. Polyunsaturated fatty acids effect on serum triglycerides concentration in presence of metabolic syndrome components. The Alaska-Siberia Project

    PubMed Central

    Lopez-Alvarenga, Juan C.; Ebbesson, Sven O E; Ebbesson, Lars O E; Tejero, M Elizabeth; Voruganti, V. Saroja; Comuzzie, Anthony G

    2009-01-01

    Serum fatty acids (FA) have wide effects on metabolism: Serum saturated fatty acids (SFA) increase triglyceride (TG) levels in plasma while polyunsaturated fatty acids (PUFA) reduce them. Traditionally, Eskimos have a high consumption of omega -3 fatty acids (ω–3 FA), but the westernization of their food habits have increased their dietary SFAs, partly reflected in their serum concentrations. We studied the joint effect of serum SFAs and PUFAs on circulating levels of TG in the presence of metabolic syndrome components. We included 212 men and 240 women (age 47.9±15.7 y, BMI 26.9±5.3) from four villages located in Alaska for a cross sectional study. Generalized linear models were employed to build surface responses of TG as in functions of SFAs and PUFAs measured in blood samples adjusting by sex, BMI and village. The effects of individual FAs were assessed by multiple linear regression analysis and partial correlations (r) were calculated. The most important predictors for TG levels were glucose tolerance (r = 0.116, p = 0.018) and BMI (r = 0.42, p<0.001). TG concentration showed negative associations with 20:3ω-6 (r =− 0.16, p = 0.001), 20:4ω-6 (r = −0.14, p=0.005), 20:5ω-3 (r = −0.17, p<0.001) and 22:5ω-3 (r = −0.26, p<0.001), and positive associations with palmitic acid (r = 0.16, p<0.001) and 18:3ω-3 (r = 0.15, p<0.001). The surface response analysis suggested that the effect of palmitic acid on TG is blunted in different degrees according to the PUFA chemical structure. The long chain ω-3, even in presence of high levels of SF, was associated with lower triglyceride levels. Eicosapentanoic acid (20:5ω3) had the strongest effect against palmitic acid on TG. The total FA showed moderate association with levels of TG, while SFA was positively associated, and large chain PUFA negatively. The westernized dietary habits among Eskimos are likely to change their metabolic profile and increase comorbidities related to metabolic disease. PMID

  17. The triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio as a predictor of β-cell function in African American women.

    PubMed

    Maturu, Amita; DeWitt, Peter; Kern, Philip A; Rasouli, Neda

    2015-05-01

    The TG/HDL-C ratio is used as a marker of insulin resistance (IR) in Caucasians. However, there are conflicting data on TG/HDL-C ratio as a predictor of IR in African Americans. Compared to Caucasians, African Americans have lower TG levels and increased insulin levels despite a greater risk for diabetes. We hypothesized that the TG/HDL-C ratio is predictive of IR and/or β-cell function in African American (AA) women. Non-diabetic AA women (n = 41) with a BMI > 25 kg/m(2) underwent frequently sampled intravenous glucose tolerance test (FSIGTT). Insulin sensitivity (SI) and the acute insulin response to glucose (AIRg) were measured using minimal model and β-cell function was determined by disposition index (DI = S I*AIRg). IR was defined as the lowest tertile of SI (<1.8 × 10(-4)min(-1)/μU/ml) and inadequate β cell compensation was defined as the lowest tertile of DI (< 900). Data were analyzed using logistic regression models and area under the receiver operating characteristic curve (AUC-ROC). An AUC-ROC > 0.70 was defined as significant discrimination. The mean (± SD) age was 38.5 ± 11.3 years, with BMI of 33.5 ± 6.7 kg/m(2) and fasting glucose of 86.5 ± 10.5 mg/dL. The AUC-ROC for the prediction of DI < 900 was 0.74 indicating that a higher TG/HDL-C ratio was associated with decreased DI. However, the AUC-ROC for prediction of IR or low AIRg (<335 μU/ml) was not significant. This study confirmed that the TG/HDL-C ratio is a poor predictor of IR in AA women. However, we did show an inverse association between the TG/HDL-C ratio and β-cell function, suggesting that this simple tool may effectively identify AA women at risk for DM2. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. High-dose ascorbic acid decreases cholesterolemic factors of an atherogenic diet in guinea pigs.

    PubMed

    Filis, Konstantinos; Anastassopoulou, Aikaterini; Sigala, Fragiska; Theodorou, Dimitrios; Manouras, Andreas; Leandros, Emanouel; Sigalas, Panagiotis; Hepp, Wolfgang; Bramis, John

    2007-03-01

    The study evaluates the effect of a high supplemental dose of ascorbic acid (AA) on plasma concentrations of total cholesterol (TC), triglycerides (TG), total lipids (TL), and lipoprotein fractions high-density, very-low-density-, and low-density lipoprotein (HDL, VLDL, LDL) in guinea pigs fed with atherogenic diet. Group I consisted of 5 normally fed guinea pigs plus a low dose of AA (1 mg/100 g/day), group II consisted of 7 guinea pigs fed with food enriched with 2% cholesterol plus a low dose of AA (1 mg/100 g/day), and group III consisted of 7 guinea pigs fed with food enriched with 2% cholesterol plus a high dose of AA (30 mg/100 g/day). Cholesterolemic factors concentrations were determined after nine weeks. Concentrations of TC, TG, TL, LDL, and VLDL were increased in group II compared to group I (p < 0.01 for all differences). Supplementation with a high dose of AA resulted in decreased concentrations of TC (p < 0.01), TG (p < 0.01), TL (p < 0.01), and LDL (p < 0.01) in group III compared to group II. Additionally, concentration of HDL was increased in group III compared to group II (p < 0.01). High-dose AA supplementation to an atherogenic diet decreases concentrations of TC, TG, TL, and LDL and increases concentration of HDL compared to low-dose AA.

  19. Association between early pregnancy vitamin D status and changes in serum lipid profiles throughout pregnancy.

    PubMed

    Lepsch, Jaqueline; Eshriqui, Ilana; Farias, Dayana Rodrigues; Vaz, Juliana S; Cunha Figueiredo, Amanda C; Adegboye, Amanda Rodrigues Amorim; Brito, Alex; Mokhtar, Rana; Allen, Lindsay H; Holick, Michael F; Kac, Gilberto

    2017-05-01

    To evaluate the associations between first trimester 25-hydroxyvitamin D [25(OH)D] status and changes in high-density lipoprotein cholesterol (HDL-c), low-density lipoprotein cholesterol (LDL-c), total cholesterol (TC), triglyceride (TG) concentrations, TG/HDL-c, and TC/HDL-c ratios throughout pregnancy. We hypothesized that first trimester 25(OH)D inadequacy is associated with lower concentrations of HDL-c and higher LDL-c, TC, TG, TG/HDL-c, and TC/HDL-c ratios throughout pregnancy. A prospective cohort study with 3 visits at 5-13 (baseline), 20-26, and 30-36 gestational weeks, recruited 194 pregnant women attending a public health care center in Rio de Janeiro, Brazil. Plasma 25(OH)D concentrations were measured in the first trimester using liquid chromatography-tandem mass spectrometry. 25(OH)D concentrations were classified as adequate (≥75nmol/L) or inadequate (<75nmol/L). Serum TC, HDL-c, and TG concentrations were measured enzymatically. Crude and adjusted longitudinal linear mixed-effects models were employed to evaluate the association between the first trimester 25(OH)D status and changes in serum lipid concentrations throughout pregnancy. Confounders adjusted for in the multiple analysis were age, homeostatic model assessment (HOMA), early pregnancy BMI, leisure time physical activity before pregnancy, energy intake, and gestational age. At baseline, 69% of the women had inadequate concentrations of 25(OH)D. Women with 25(OH)D inadequacy had higher mean LDL-c than those with adequate concentrations (91.3 vs. 97.5mg/dL; P=0.064) at baseline. TC, HDL-c, LDL-c TG, TG/HDL-c ratios, and TC/HDL-c ratios, increased throughout pregnancy independently of 25(OH)D concentrations (ANOVA for repeated measures P<0.001). The adjusted models showed direct associations between the first trimester 25(OH)D status and changes in TC (β=9.53; 95%CI=1.12-17.94), LDL-c (β=9.99; 95% CI=3.62-16.36) concentrations, and TC/HDL-c ratios (β=0.16; 95% CI=0.01-0.31) throughout

  20. Rare loss-of-function mutations in ANGPTL family members contribute to plasma triglyceride levels in humans

    PubMed Central

    Romeo, Stefano; Yin, Wu; Kozlitina, Julia; Pennacchio, Len A.; Boerwinkle, Eric; Hobbs, Helen H.; Cohen, Jonathan C.

    2008-01-01

    The relative activity of lipoprotein lipase (LPL) in different tissues controls the partitioning of lipoprotein-derived fatty acids between sites of fat storage (adipose tissue) and oxidation (heart and skeletal muscle). Here we used a reverse genetic strategy to test the hypothesis that 4 angiopoietin-like proteins (ANGPTL3, -4, -5, and -6) play key roles in triglyceride (TG) metabolism in humans. We re-sequenced the coding regions of the genes encoding these proteins and identified multiple rare nonsynonymous (NS) sequence variations that were associated with low plasma TG levels but not with other metabolic phenotypes. Functional studies revealed that all mutant alleles of ANGPTL3 and ANGPTL4 that were associated with low plasma TG levels interfered either with the synthesis or secretion of the protein or with the ability of the ANGPTL protein to inhibit LPL. A total of 1% of the Dallas Heart Study population and 4% of those participants with a plasma TG in the lowest quartile had a rare loss-of-function mutation in ANGPTL3, ANGPTL4, or ANGPTL5. Thus, ANGPTL3, ANGPTL4, and ANGPTL5, but not ANGPTL6, play nonredundant roles in TG metabolism, and multiple alleles at these loci cumulatively contribute to variability in plasma TG levels in humans. PMID:19075393

  1. The paradox of ApoA5 modulation of triglycerides: evidence from clinical and basic research.

    PubMed

    Garelnabi, Mahdi; Lor, Kenton; Jin, Jun; Chai, Fei; Santanam, Nalini

    2013-01-01

    Apolipoprotein A5 (ApoA5) is a key regulator of plasma triglycerides (TG), even though its plasma concentration is very low compared to other known apoproteins. Over the years, researchers have attempted to elucidate the molecular mechanisms by which ApoA5 regulates plasma TG in vivo. Though still under debate, two theories broadly describe how ApoA5 modulates TG levels: (i) ApoA5 enhances the catabolism of TG-rich lipoproteins and (ii) it inhibits the rate of production of very low-density lipoprotein (VLDL), the major carrier of TGs. This review will summarize the basic and clinical studies that describe the importance of ApoA5 in TG metabolism. Population studies conducted in various countries have demonstrated an association between single nucleotide polymorphisms (SNPs) in ApoA5 and the increased risk to cardiovascular disease and metabolic syndrome (including diabetes and obesity). ApoA5 is also highly expressed during liver regeneration and is an acute phase protein associated with HDL, which is independent of its effects on TG metabolism. Despite considerable evidences available from clinical and basic research studies on the role of ApoA5 in TG metabolism and its indirect link to metabolic diseases, additional investigations are needed to understand the paradoxical role of this important apoprotein is modulated by both diet and its polymorphism variants. Copyright © 2012 The Canadian Society of Clinical Chemists. All rights reserved.

  2. Progesterone-specific stimulation of triglyceride biosynthesis in a breast cancer cell line (T-47D)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Judge, S.M.; Chatterton, R.T. Jr.

    1983-09-01

    The purpose of this study was to examine the lactogenic response of human mammary cancer cell lines to hormones in vitro. Progesterone was found to stimulate the incorporation of 14C from (14C)acetate into triglycerides (TG) and to promote accumulation of TG with a fatty acid composition similar to that of human milk fat in T-47D cells. Lipid droplets were observed in larger numbers without concomitant accumulation of casein granules in cells incubated with progesterone, but secretion of lipid into the medium did not occur. An effect of progesterone on TG accumulation was detectable after 12 hr and was maximal atmore » 72 hr. Increasing doses of progesterone (10(-9) to 10(-5) M) caused a progressive increase in TG accumulation. The presence of cortisol and/or prolactin did not alter TG formation nor the dose response of the cells to progesterone. The growth rate of T-47D cells was not altered by the presence of progesterone in the medium. Neither of the human mammary cancer cell lines, MCF-7 and HBL-100, nor the human fibroblast cell lines, 28 and 857, responded to progesterone. The data indicate that, while the normally lactogenic hormones do not stimulate milk product biosynthesis in the cell lines tested, progesterone specifically stimulated synthesis and accumulation of TG in the T-47D cells.« less

  3. Triglyceride to HDL-C Ratio is Associated with Insulin Resistance in Overweight and Obese Children

    PubMed Central

    Iwani, Nur Ahmad Kamil Zati; Jalaludin, Muhammad Yazid; Zin, Ruziana Mona Wan Mohd; Fuziah, Md Zain; Hong, Janet Yeow Hua; Abqariyah, Yahya; Mokhtar, Abdul Halim; Wan Nazaimoon, Wan Mohamud

    2017-01-01

    The purpose of this study was to investigate the usefulness of triglyceride to hdl-c ratio (TG:HDL-C) as an insulin resistance (IR) marker for overweight and obese children. A total of 271 blood samples of obese and overweight children aged 9–16 years were analysed for fasting glucose, lipids and insulin. Children were divided into IR and non-insulin resistance, using homeostasis model assessment (HOMA). The children were then stratified by tertiles of TG: HDL-C ratio. The strength between TG:HDL-C ratio and other parameters of IR were quantified using Pearson correlation coefficient (r). Odds ratio was estimated using multiple logistic regression adjusted for age, gender, pubertal stages and IR potential risk factors. Children with IR had significantly higher TG:HDL-C ratio (2.48) (p = 0.01). TG:HDL-C ratio was significantly correlated with HOMA-IR (r = 0.104, p < 0.005) and waist circumference (r = 0.134, p < 0.001). Increasing tertiles of TG:HDL-C ratio showed significant increase in mean insulin level (p = 0.03), HOMA-IR (p = 0.04) and significantly higher number of children with acanthosis nigricans and metabolic syndrome. The odds of having IR was about 2.5 times higher (OR = 2.47; 95% CI 1.23, 4.95; p = 0.01) for those in the highest tertiles of TG:HDL-C ratio. Hence, TG:HDL-C may be a useful tool to identify high risk individuals. PMID:28059134

  4. Triglyceride-to-HDL cholesterol ratio. Predictive value for CHD severity and new-onset heart failure.

    PubMed

    Yunke, Z; Guoping, L; Zhenyue, C

    2014-02-01

    This study aimed to explore the association between the triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio and the severity of coronary heart disease (CHD). It also evaluated the clinical role of the TG/HDL-C ratio in predicting in-hospital CHD events and the long-term prognosis of CHD patients. According to the results of coronary angiography examinations, 317 patients were enrolled in the study and classified into a CHD group (n=233) and a control group (n=84). The TG/HDL-C ratio was calculated at baseline. The CHD group was then further classified into cases of single-branch stenosis (n=79), double-branch stenosis (n=73), and multi-branch stenosis (n=81). The Gensini score was calculated for each group to analyze the relationship between the TG/HDL-C ratio and the severity of CHD. The TG/HDL-C ratio in the CHD group was significantly higher than in the normal group (P < 0.001). The TG/HDL-C ratio was positively correlated with the Gensini score. The ratio was significantly higher in patients with new-onset heart failure than in those without heart failure events (P < 0.05). An average 3-year follow-up showed that the serum TG/HDL-C ratios of patients with adverse events were significantly higher than other patients (P <  0.01). The TG/HDL-C ratio is predictive of the severity of CHD. It could also help predict in-hospital new-onset heart failure incidents of CHD patients.

  5. Alcohol intake and triglycerides/high-density lipoprotein cholesterol ratio in men with hypertension.

    PubMed

    Wakabayashi, Ichiro

    2013-07-01

    The triglycerides/high-density lipoprotein cholesterol (TG/HDL-C) ratio has been proposed to be a good predictor of cardiovascular disease. The relationship between alcohol consumption and TG/HDL-C ratio in patients with hypertension is unknown. Subjects were normotensive and hypertensive men aged 35-60 years who were divided by daily ethanol intake into non-, light (<22g/day), heavy (≥22 but <44g/day), and very heavy (≥44g/day) drinkers. The TG/HDL-C ratio was significantly higher in the hypertensive group than in the normotensive group. Both in the normotensive and hypertensive groups, TG/HDL-C ratio was significantly lower in light, heavy, and very heavy drinkers than in nondrinkers and was lowest in light drinkers. In the hypertensive group, odds ratios (ORs) for high TG/HDL-C ratio (≥3.75) in light, heavy, and very heavy drinkers vs. nondrinkers were significantly lower (P < 0.01) than a reference level of 1.00 (light drinkers: OR = 0.49, 95% confidence interval (CI) = 0.40-0.59; heavy drinkers: OR = 0.59, 95% CI = 0.52-0.67; very heavy drinkers: OR = 0.70, 95% CI = 0.61-0.80) and were significantly lower than the corresponding ORs in the normotensive group. The ORs for hypertension in subjects with vs. subjects without high TG/HDL-C ratio were significantly higher than the reference level in all the alcohol groups and were significantly lower in light, heavy, and very heavy drinkers than in nondrinkers. The results suggest that there is an inverted J-shaped relationship between alcohol and TG/HDL-C ratio in individuals with hypertension and that alcohol weakens the positive association between TG/HDL-C ratio and hypertension.

  6. OSBPL10, a novel candidate gene for high triglyceride trait in dyslipidemic Finnish subjects, regulates cellular lipid metabolism.

    PubMed

    Perttilä, Julia; Merikanto, Krista; Naukkarinen, Jussi; Surakka, Ida; Martin, Nicolas W; Tanhuanpää, Kimmo; Grimard, Vinciane; Taskinen, Marja-Riitta; Thiele, Christoph; Salomaa, Veikko; Jula, Antti; Perola, Markus; Virtanen, Ismo; Peltonen, Leena; Olkkonen, Vesa M

    2009-08-01

    Analysis of variants in three genes encoding oxysterol-binding protein (OSBP) homologues (OSBPL2, OSBPL9, OSBPL10) in Finnish families with familial low high-density lipoprotein (HDL) levels (N = 426) or familial combined hyperlipidemia (N = 684) revealed suggestive linkage of OSBPL10 single-nucleotide polymorphisms (SNPs) with extreme end high triglyceride (TG; >90th percentile) trait. Prompted by this initial finding, we carried out association analysis in a metabolic syndrome subcohort (Genmets) of Health2000 examination survey (N = 2,138), revealing association of multiple OSBPL10 SNPs with high serum TG levels (>95th percentile). To investigate whether OSBPL10 could be the gene underlying the observed linkage and association, we carried out functional experiments in the human hepatoma cell line Huh7. Silencing of OSBPL10 increased the incorporation of [(3)H]acetate into cholesterol and both [(3)H]acetate and [(3)H]oleate into triglycerides and enhanced the accumulation of secreted apolipoprotein B100 in growth medium, suggesting that the encoded protein ORP10 suppresses hepatic lipogenesis and very-low-density lipoprotein production. ORP10 was shown to associate dynamically with microtubules, consistent with its involvement in intracellular transport or organelle positioning. The data introduces OSBPL10 as a gene whose variation may contribute to high triglyceride levels in dyslipidemic Finnish subjects and provides evidence for ORP10 as a regulator of cellular lipid metabolism.

  7. Natural Docosahexaenoic Acid in the Triglyceride Form Attenuates In Vitro Microglial Activation and Ameliorates Autoimmune Encephalomyelitis in Mice.

    PubMed

    Mancera, Pilar; Wappenhans, Blanca; Cordobilla, Begoña; Virgili, Noemí; Pugliese, Marco; Rueda, Fèlix; Espinosa-Parrilla, Juan F; Domingo, Joan C

    2017-06-30

    Many neurodegenerative diseases are associated, at least in part, to an inflammatory process in which microglia plays a major role. The effect of the triglyceride form of the omega-3 polyunsaturated fatty acid docosahexaenoic acid (TG-DHA) was assayed in vitro and in vivo to assess the protective and anti-inflammatory activity of this compound. In the in vitro study, BV-2 microglia cells were previously treated with TG-DHA and then activated with Lipopolysaccharide (LPS) and Interferon-gamma (IFN-γ). TG-DHA treatment protected BV-2 microglia cells from oxidative stress toxicity attenuating NO production and suppressing the induction of inflammatory cytokines. When compared with DHA in the ethyl-ester form, a significant difference in the ability to inhibit NO production in favor of TG-DHA was observed. TG-DHA inhibited significantly splenocyte proliferation but isolated CD4+ lymphocyte proliferation was unaffected. In a mice model of autoimmune encephalomyelitis (EAE), 250 mg/kg/day oral TG-DHA treatment was associated with a significant amelioration of the course and severity of the disease as compared to untreated animals. TG-DHA-treated EAE mice showed a better weight profile, which is a symptom related to a better course of encephalomyelitis. TG-DHA may be a promising therapeutic agent in neuroinflammatory processes and merit to be more extensively studied in human neurodegenerative disorders.

  8. Inhibitory activity of diacylglycerol acyltransferase (DGAT) and microsomal triglyceride transfer protein (MTP) by the flavonoid, taxifolin, in HepG2 cells: potential role in the regulation of apolipoprotein B secretion.

    PubMed

    Casaschi, Adele; Rubio, Brent K; Maiyoh, Geoffrey K; Theriault, Andre G

    2004-10-01

    The purpose of the present study was to examine the role of taxifolin, a plant flavonoid, on several aspects involving apolipoprotein B (apoB) secretion and triglyceride (TG) availability in HepG2 cells. Taxifolin was shown by ELISA to markedly reduce apoB secretion under basal and lipid-rich conditions up to 63% at 200 micromol/L. As to the mechanism underlying this effect, we examined whether taxifolin exerted its effect by limiting TG availability in the microsomal lumen essential for lipoprotein assembly. Taxifolin was shown to inhibit microsomal TG synthesis by 37% and its subsequent transfer into the lumen (-26%). The reduction in synthesis was due to a decrease in diacylglycerol acyltransferase (DGAT) activity (-35%). The effect on DGAT activity was found to be non-competitive and non-transcriptional in nature. Both DGAT-1 and DGAT-2 mRNA expression remained essentially unchanged suggesting the point of regulation may be at the post-transcriptional level. Evidence is accumulating that microsomal triglyceride transfer protein (MTP) is also involved in determining the amount of lumenal TG available for lipoprotein assembly and secretion. Taxifolin was shown to inhibit this enzyme by 41%. Whether the reduction in TG accumulation in the microsomal lumen is predominantly due to DGAT and/or MTP activity remains to be addressed. In summary, taxifolin reduced apoB secretion by limiting TG availability via DGAT and MTP activity.

  9. Is In-Stent Restenosis After a Successful Coronary Stent Implantation Due to Stable Angina Associated With TG/HDL-C Ratio?

    PubMed

    Kundi, Harun; Korkmaz, Ahmet; Balun, Ahmet; Cicekcioglu, Hulya; Kiziltunc, Emrullah; Gursel, Koray; Cetin, Mustafa; Ornek, Ender; Ileri, Mehmet

    2017-10-01

    We examined the impact of the preprocedural triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) ratio on risk of in-stent restenosis (ISR). Patients with typical anginal symptoms and/or positive treadmill or myocardial perfusion scintigraphy test results who underwent successful coronary stent implantation due to stable angina were examined; 1341 patients were enrolled. The hospital files of the patients were used to gather data. Cox regression analysis showed that the TG/HDL-C ratio was independently associated with the presence of ISR ( P < .001). Moreover, diabetes mellitus ( P = .007), smaller stent diameter ( P = .046), and smoking status ( P = .001) were also independently associated with the presence of ISR. Using a cutoff of 3.8, the TG/HDL-C ratio predicted the presence of ISR with a sensitivity of 71% and a specificity of 68%. Also, the highest quartile of TG/HDL-C ratio had the highest rate of ISR ( P < .001). Measuring preprocedural TG/HDL-C ratio, in fasting or nonfasting samples, could be beneficial for the risk assessment of ISR. However, further large-scale prospective studies are required to establish the exact role of this simple, easily calculated, and reproducible parameter in the pathogenesis of ISR.

  10. Association between the triglyceride to high-density lipoprotein cholesterol ratio and insulin resistance in Korean adolescents: a nationwide population-based study.

    PubMed

    Park, Jae-Min; Lee, Jee-Yon; Dong, Jae June; Lee, Duk-Chul; Lee, Yong-Jae

    2016-11-01

    Studies have suggested the triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) as a surrogate marker of insulin resistance. However, few studies have examined the association between TG/HDL-C and insulin resistance in the general adolescent population. This study aimed to examine the association between TG/HDL-C and insulin resistance in a nationally representative sample of Korean adolescents. A total of 2649 participants aged 12-18 years were selected from the 2007 to 2010 Korean National Health and Nutrition Examination Survey (KNHANES). Insulin resistance was defined as the homeostatic model assessment of insulin resistance (HOMA-IR) values greater than the 80th percentile. The mean values of most cardiometabolic variables increased proportionally with TG/HDL-C quartiles. Compared to individuals in the lowest TG/HDL-C quartile, the odds ratio for insulin resistance for individuals in the highest quartile was 2.91 in boys and 2.38 in girls after adjusting for confounding variables. This study suggests that TG/HDL-C could be a convenient marker for identifying Korean adolescents with insulin resistance.

  11. Atypical antipsychotic medications increase postprandial triglyceride and glucose levels in male rats: relationship with stearoyl-CoA desaturase activity.

    PubMed

    McNamara, Robert K; Jandacek, Ronald; Rider, Therese; Tso, Patrick; Cole-Strauss, Allyson; Lipton, Jack W

    2011-06-01

    Recent preclinical and clinical evidence suggests that the stearoyl-CoA desaturase-1 (Scd1) enzyme plays a key role in the regulation of triglyceride (TG) biosynthesis and insulin sensitivity, and in vitro studies have found that antipsychotic medications up-regulate Scd1 mRNA expression. To investigate these effects in vivo, rats were treated with risperidone (1.5, 3, and 6mg/kg/d), paliperidone (1.5, 3, and 6mg/kg/d), olanzapine (2.5, 5, and 10mg/kg/d), quetiapine (5, 10, and 20mg/kg/d), haloperidol (1, and 3mg/kg/d) or vehicle through their drinking water for 40days. Effects on liver Scd1 mRNA expression and an index of Scd1 activity (the plasma 18:1/18:0 ratio, 'desaturation index') were determined, as were postprandial plasma triglyceride (TG), glucose, insulin, and polyunsaturated fatty acid (PUFA) levels. All atypical antipsychotics increased the plasma 18:1/18:0 ratio, but not liver Scd1 mRNA expression, at doses found to also increase plasma TG levels. Among all rats (n=122), the plasma 18:1/18:0 ratio accounted for 56% of the variance in TG concentrations. The plasma 18:1/18:0 ratio was also positively associated with erythrocyte and heart membrane phospholipid 18:1n-9 composition. All antipsychotics except risperidone increased glucose levels at specific doses, and none of the antipsychotics significantly altered insulin levels. The plasma 18:1/18:0 ratio accounted for 20% of the variance in glucose levels. Plasma omega-3 and omega-6 PUFA levels were inversely correlated with the plasma 18:1/18:0 ratio and TG and glucose levels. These in vivo data demonstrate that different atypical antipsychotic medications increase the plasma 18:1/18:0 ratio in association with elevations in postprandial TG and glucose levels, and that concomitant elevations in PUFA biosynthesis oppose these effects. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Inhibitory effect of trans-caryophyllene (TC) on leukocyte-endothelial attachment.

    PubMed

    Zhang, Zhen; Yang, Chunfeng; Dai, Xinlun; Ao, Yu; Li, Yumei

    2017-08-15

    trans-Caryophyllene (TC) is a major component found in the essential oils of many spices and foods/medicinal plants. It is a natural sesquiterpene and has been the subject of numerous studies. However, the effects of TC on vascular inflammation remain unknown. In this study, we reported that TC treatment in human umbilical vein endothelial cells (HUVECs) prevented attachment of monocytic leukemia cell line THP-1 cells to endothelial cells. In addition, in vivo results indicate that TC inhibited macrophage infiltration to the aortic surface and reduced total serum levels of cholesterol and triglycerides. Importantly, administration of TC could inhibit the induction of vascular cell adhesion molecule-1 (VCAM-1) both in vitro and in vivo. Notably, our data indicate that the inhibitory effects of TC on the expression of VCAM-1 are mediated by the JAK2/STAT1/IRF-1 pathway. TC is a specific agonist of the type 2 cannabinoid receptor (CB2R). Importantly, we further verified that the inhibitory effects of TC on the expression of IRF-1 and VCAM-1 are dependent on activation of CB2R. Inhibition of CB2R by either specific inhibitors or RNA interference abolished the inhibitory effects of TC on the expression of IRF-1 and VCAM-1. Our results suggest that TC might have a capacity to suppress the development of atherosclerosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Negative interferences by calcium dobesilate in the detection of five serum analytes involving Trinder reaction-based assays

    PubMed Central

    Wu, Jie; Zhao, Fang; Xia, Liangyu; Cheng, Xinqi; Liu, Qian; Liu, Li; Xu, Ermu; Qiu, Ling

    2018-01-01

    Previously, we reported the strong negative interference of calcium dobesilate, a vasoprotective agent, in creatinine assays involving the Trinder reaction. It is hypothesized that a similar effect occurs in the detection of uric acid (UA), total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C). The interferences of calcium dobesilate during the detection of the five serum analytes were investigated on automated systems/analysers, and the effects were compared among eight different assay systems for each analyte. A calcium dobesilate standard was added into two sets of the blank serum pools of each analyte at final concentrations of 0, 2, 4, 8, 16, 32, and 64 μg/mL. The percentage deviation of each analyte value was calculated between each drug concentration and the drug-free samples. The clinically acceptable error levels for UA, TC, TG, HDL-C, and LDL-C were defined as ±4.87%, ±4.1%, ±9.57%, ±5.61%, and ±5.46%, respectively. The observed interference was concentration dependent for each analyte. In the presence of 16 μg/mL calcium dobesilate, which was within the therapeutic range, all seven Trinder reaction-based UA assay systems, two TG assay systems, two HDL-C assay systems and one TC assay system exhibited negative drug interferences. Calcium dobesilate negatively interferes with the detection of UA, TG, TC, and HDL-C in assay systems based on the Trinder reaction. The effect was most significant in UA and TG detection. PMID:29432460

  14. Effects of soybean lipid infusion on triglyceride and unbound free fatty acid levels in preterm infants.

    PubMed

    Hegyi, Thomas; Kleinfeld, Alan; Huber, Andrew; Weinberger, Barry; Memon, Naureen; Joe Shih, Weichung; Carayannopoulos, Mary; Oh, William

    2018-04-18

    To determine the plasma triglyceride (TG) and unbound free fatty acid (FFAu) levels in infants treated with increasing dosages of soybean lipid, intralipid (IL), infusion. TG and FFAu levels were measured in 78 preterm infants (BW 500-2000 g; GA 23-34 weeks) using the fluorescent probe ADIFAB2 and enzymatic method. The infants' BW was 1266.2 ± 440.7 g and GA 28.8 ± 3.1 weeks. TG levels were 77.4 ± 50 mg/dL, 140.2 ± 188 mg/dL (p < .04 compared to levels during low dose IL infusion) and 135.6 ± 118 mg/dL (p < .004), respectively during increased IL rates. FFAu levels were 17.7 ± 13 nM, 47.3 ± 102.8 nM (p = .07) and 98 ± 234 nM (p = .03). TG levels correlated with IL dose, the rate of IL administration, and FFAu levels. TG and FFAu levels were higher in infants below 28 weeks' gestation Conclusions: Increasing dosage of IL is associated with increasing levels of TG and FFAu, especially in infants below 29 weeks of gestation. The increased level of FFAu suggests inefficient cellular utilization.

  15. Plasma triglyceride determination can identify increased risk of statin-induced type 2 diabetes: a hypothesis.

    PubMed

    Armato, J; Ruby, R; Reaven, G

    2015-04-01

    To evaluate the ability of plasma triglyceride (TG) measurements to identify statin-treated persons at accentuated risk of statin-induced type 2 diabetes (T2DM). The experimental population consisted of nondiabetic, statin-treated patients (n = 469), classified as being at high risk for T2DM, subdivided on the basis of a plasma TG concentration of 1.7 mmol/L. Comparisons were made of demographic characteristics, concentrations of fasting glucose, insulin, HbA1c, and hs-CRP, oral glucose tolerance tests, estimates of insulin action and secretion, and lipid/lipoprotein profiles. Despite similar fasting glucose and HbA1c concentrations, patients with elevated TG concentrations displayed markers of increased risk of T2DM (insulin resistance and compensatory hyperinsulinemia), more adverse lipid/lipoprotein profiles, and increased prevalence of abnormal hs-CRP values. These findings demonstrate that plasma TG concentrations ≥ 1.7 mmol/L identified a subset of individuals at enhanced risk of developing statin-induced diabetes within a population classified prior to statin treatment as being at high risk of T2DM. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Recent trends and perspectives in enzyme based biosensor development for the screening of triglycerides: a comprehensive review.

    PubMed

    Hooda, Vinita; Gahlaut, Anjum; Gothwal, Ashish; Hooda, Vikas

    2018-04-27

    Clinical manifestations of the elevated plasma triacylglycerol (TG) include a greater prevalence of atherosclerotic heart disease, acute pancreatitis, diabetes mellitus, hypertension, and ischemic vascular disease. Hence, these significant health troubles have attracted scientific attention for the precise detection of TG in biological samples. Numerous techniques have been employed to quantify TG over many decades, but biosensors hold the leading position owing to their superior traits such as highly specific recognition for target molecules, accuracy, minituarization, small sample requirement and rapid response. Enzyme-based electrochemical biosensors represent an instantaneous resolution for the foremost bottlenecks constraining laboratory prototypes to reach real time bedside applications. We highlight the choice of transducers and constructive strategies to design high-performance biosensor for the quantification of triglycerides in sera and early diagnosis of health problems related to it. In the present review, a small effort has been made to emphasize the significant role of enzymes, nanostructured metal oxides, graphene, conducting polypyrrole, nanoparticles, porous silicon, EISCAP and ENFET in enabling TG biosensors more proficient and taking a revolutionary step forward.

  17. Comparison of FTIR-ATR and Raman spectroscopy in determination of VLDL triglycerides in blood serum with PLS regression

    NASA Astrophysics Data System (ADS)

    Oleszko, Adam; Hartwich, Jadwiga; Wójtowicz, Anna; Gąsior-Głogowska, Marlena; Huras, Hubert; Komorowska, Małgorzata

    2017-08-01

    Hypertriglyceridemia, related with triglyceride (TG) in plasma above 1.7 mmol/L is one of the cardiovascular risk factors. Very low density lipoproteins (VLDL) are the main TG carriers. Despite being time consuming, demanding well-qualified staff and expensive instrumentation, ultracentrifugation technique still remains the gold standard for the VLDL isolation. Therefore faster and simpler method of VLDL-TG determination is needed. Vibrational spectroscopy, including FT-IR and Raman, is widely used technique in lipid and protein research. The aim of this study was assessment of Raman and FT-IR spectroscopy in determination of VLDL-TG directly in serum with the isolation step omitted. TG concentration in serum and in ultracentrifugated VLDL fractions from 32 patients were measured with reference colorimetric method. FT-IR and Raman spectra of VLDL and serum samples were acquired. Partial least square (PLS) regression was used for calibration and leave-one-out cross validation. Our results confirmed possibility of reagent-free determination of VLDL-TG directly in serum with both Raman and FT-IR spectroscopy. Quantitative VLDL testing by FT-IR and/or Raman spectroscopy applied directly to maternal serum seems to be promising screening test to identify women with increased risk of adverse pregnancy outcomes and patient friendly method of choice based on ease of performance, accuracy and efficiency.

  18. Acute administration of n-3 rich triglyceride emulsions provides cardioprotection in murine models after ischemia-reperfusion.

    PubMed

    Zirpoli, Hylde; Abdillahi, Mariane; Quadri, Nosirudeen; Ananthakrishnan, Radha; Wang, Lingjie; Rosario, Rosa; Zhu, Zhengbin; Deckelbaum, Richard J; Ramasamy, Ravichandran

    2015-01-01

    Dietary n-3 fatty acids (FAs) may reduce cardiovascular disease risk. We questioned whether acute administration of n-3 rich triglyceride (TG) emulsions could preserve cardiac function and decrease injury after ischemia/reperfusion (I/R) insult. We used two different experimental models: in vivo, C57BL/6 mice were exposed to acute occlusion of the left anterior descending coronary artery (LAD), and ex-vivo, C57BL/6 murine hearts were perfused using Langendorff technique (LT). In the LAD model, mice treated with n-3 TG emulsion (1.5 g/kg body weight), immediately after ischemia and 1 h later during reperfusion, significantly reduced infarct size and maintained cardiac function (p<0.05). In the LT model, administration of n-3 TG emulsion (300 mg TG/100 ml) during reperfusion significantly improved functional recovery (p<0.05). In both models, lactate dehydrogenase (LDH) levels, as a marker of injury, were significantly reduced by n-3 TG emulsion. To investigate the mechanisms by which n-3 FAs protects hearts from I/R injury, we investigated changes in key pathways linked to cardioprotection. In the ex-vivo model, we showed that n-3 FAs increased phosphorylation of AKT and GSK3β proteins (p<0.05). Acute n-3 TG emulsion treatment also increased Bcl-2 protein level and reduced an autophagy marker, Beclin-1 (p<0.05). Additionally, cardioprotection by n-3 TG emulsion was linked to changes in PPARγ protein expression (p<0.05). Rosiglitazone and p-AKT inhibitor counteracted the positive effect of n-3 TG; GSK3β inhibitor plus n-3 TG significantly inhibited LDH release. We conclude that acute n-3 TG injection during reperfusion provides cardioprotection. This may prove to be a novel acute adjunctive reperfusion therapy after treating patients with myocardial infarction.

  19. Acute Administration of n-3 Rich Triglyceride Emulsions Provides Cardioprotection in Murine Models after Ischemia-Reperfusion

    PubMed Central

    Zirpoli, Hylde; Abdillahi, Mariane; Quadri, Nosirudeen; Ananthakrishnan, Radha; Wang, Lingjie; Rosario, Rosa; Zhu, Zhengbin; Deckelbaum, Richard J.; Ramasamy, Ravichandran

    2015-01-01

    Dietary n-3 fatty acids (FAs) may reduce cardiovascular disease risk. We questioned whether acute administration of n-3 rich triglyceride (TG) emulsions could preserve cardiac function and decrease injury after ischemia/reperfusion (I/R) insult. We used two different experimental models: in vivo, C57BL/6 mice were exposed to acute occlusion of the left anterior descending coronary artery (LAD), and ex-vivo, C57BL/6 murine hearts were perfused using Langendorff technique (LT). In the LAD model, mice treated with n-3 TG emulsion (1.5g/kg body weight), immediately after ischemia and 1h later during reperfusion, significantly reduced infarct size and maintained cardiac function (p<0.05). In the LT model, administration of n-3 TG emulsion (300mgTG/100ml) during reperfusion significantly improved functional recovery (p<0.05). In both models, lactate dehydrogenase (LDH) levels, as a marker of injury, were significantly reduced by n-3 TG emulsion. To investigate the mechanisms by which n-3 FAs protects hearts from I/R injury, we investigated changes in key pathways linked to cardioprotection. In the ex-vivo model, we showed that n-3 FAs increased phosphorylation of AKT and GSK3β proteins (p<0.05). Acute n-3 TG emulsion treatment also increased Bcl-2 protein level and reduced an autophagy marker, Beclin-1 (p<0.05). Additionally, cardioprotection by n-3 TG emulsion was linked to changes in PPARγ protein expression (p<0.05). Rosiglitazone and p-AKT inhibitor counteracted the positive effect of n-3 TG; GSK3β inhibitor plus n-3 TG significantly inhibited LDH release. We conclude that acute n-3 TG injection during reperfusion provides cardioprotection. This may prove to be a novel acute adjunctive reperfusion therapy after treating patients with myocardial infarction. PMID:25559887

  20. [Effects of vegetal oil supplementation on the lipid profile of Wistar rats ].

    PubMed

    Poveda, Elpidia; Ayala, Paola; Milena, Rodríguez; Ordóñez, Edgar; Baracaldo, Cesar; Delgado, Willman; Guerra, Martha

    2005-03-01

    Dietary tocopherols, tocotrienols and saturated, mono and polyunsaturated fatty acids have been reported to have an effect on blood lipid profiles. In Colombia, vegetable oils (palm, soy, corn, sunflower, and canola) are a common dietary constituent and consumed in high quantities. In the current study, the effects of vegetable oil consumption was examined by measuring blood concentrations of triglycerides (TG), total cholesterol (TC) and HDL cholesterol (HDL-C) in male Wistar rats. The concentrations of tocopherols, tocotrienols, and fatty acids in each oil was quantified by High Performance Liquid Chromatography (HPLC). Each rat diet was supplemented with 0.2 ml/day with one oil type. Over a 4-week period, groups of animals were sacrificed weekly and blood samples were obtained to quantify TC, TG and HDL-C for each oil class. Statistical analyses included mean, standard deviation, ANOVA and Bonferroni comparisons tests. Triglyceride content was not affected except in the control and the soy group in the third treatment week, although a tendency for decreased TG was noted in the palm oil group and for increased TG in the sunflower oil and canola oil groups. No significant differences in total cholesterol were observed. In HDL-C, significant differences were present for every treatment week (p = 0.005); this represented a decreasing trend in palm oil group and an increasing trend in the sunflower and corn oil groups. The oils effected changes in the blood lipid profile. A small amount of saturated fatty acids (tocopherol and tocotrienol) were favourable for the HDL-C increase. The presenct of tocorienols tended to decrease the TG and probably helped attenuate the unfavorable effects of the saturated fatty acids.

  1. Elevated resting heart rate is associated with dyslipidemia in middle-aged and elderly Chinese.

    PubMed

    Sun, Ji Chao; Huang, Xiao Lin; Deng, Xin Ru; Lv, Xiao Fei; Lu, Jie Li; Chen, Yu Hong; Bi, Yu Fang; Wang, Wei Qing; Xu, Min; Ning, Guang

    2014-08-01

    To study the relationship between resting heart rate and blood lipid level. A total of 9 415 subjects aged ⋝ 40 years were included in the present study. Their resting heart rate was monitored and their serum levels of triglyceride (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C) and high density lipoprotein cholesterol (HDL-C) were measured to define dyslipidemia according to the 2007 Chinese Guidelines on Prevention and Treatment of Dyslipidemia in Adults. The subjects were divided into group A with their resting heart rate <70 beats/min, group B with their resting heart rate =70-79 beats/min, group C with their resting heart rate =80-89 beats/min, and group D with their resting heart rate ⋝ 90 beats/min. High TG, TC, and LDL-C were presented across the resting heart rate (Ptrend <0.01). Multiple logistic regression analysis revealed that the risk of high TG and TC was higher in subjects with their resting heart rate ⋝ 90 beats/min than in those with their resting heart rate <70 beats/min (OR=1.42; 95% CI: 1.16-1.74 and OR=1.33; 95% CI: 1.09-1.64, respectively). Elevated resting heart rate is associated with high TG and TC in middle-aged and elderly Chinese subjects. Copyright © 2014 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  2. Echium Oil Reduces Plasma Triglycerides by Increasing Intravascular Lipolysis in apoB100-Only Low Density Lipoprotein (LDL) Receptor Knockout Mice

    PubMed Central

    Forrest, Lolita M.; Lough, Christopher M.; Chung, Soonkyu; Boudyguina, Elena Y.; Gebre, Abraham K.; Smith, Thomas L.; Colvin, Perry L.; Parks, John S.

    2013-01-01

    Echium oil (EO), which is enriched in SDA (18:4 n-3), reduces plasma triglyceride (TG) concentrations in humans and mice. We compared mechanisms by which EO and fish oil (FO) reduce plasma TG concentrations in mildly hypertriglyceridemic male apoB100-only LDLrKO mice. Mice were fed one of three atherogenic diets containing 0.2% cholesterol and palm oil (PO; 20%), EO (10% EO + 10% PO), or FO (10% FO + 10% PO). Livers from PO- and EO-fed mice had similar TG and cholesteryl ester (CE) content, which was significantly higher than in FO-fed mice. Plasma TG secretion was reduced in FO vs. EO-fed mice. Plasma very low density lipoprotein (VLDL) particle size was ordered: PO (63 ± 4 nm) > EO (55 ± 3 nm) > FO (40 ± 2 nm). Post-heparin lipolytic activity was similar among groups, but TG hydrolysis by purified lipoprotein lipase was significantly greater for EO and FO VLDL compared to PO VLDL. Removal of VLDL tracer from plasma was marginally faster in EO vs. PO fed mice. Our results suggest that EO reduces plasma TG primarily through increased intravascular lipolysis of TG and VLDL clearance. Finally, EO may substitute for FO to reduce plasma TG concentrations, but not hepatic steatosis in this mouse model. PMID:23857172

  3. Echium oil reduces plasma triglycerides by increasing intravascular lipolysis in apoB100-only low density lipoprotein (LDL) receptor knockout mice.

    PubMed

    Forrest, Lolita M; Lough, Christopher M; Chung, Soonkyu; Boudyguina, Elena Y; Gebre, Abraham K; Smith, Thomas L; Colvin, Perry L; Parks, John S

    2013-07-12

    Echium oil (EO), which is enriched in SDA (18:4 n-3), reduces plasma triglyceride (TG) concentrations in humans and mice. We compared mechanisms by which EO and fish oil (FO) reduce plasma TG concentrations in mildly hypertriglyceridemic male apoB100-only LDLrKO mice. Mice were fed one of three atherogenic diets containing 0.2% cholesterol and palm oil (PO; 20%), EO (10% EO + 10% PO), or FO (10% FO + 10% PO). Livers from PO- and EO-fed mice had similar TG and cholesteryl ester (CE) content, which was significantly higher than in FO-fed mice. Plasma TG secretion was reduced in FO vs. EO-fed mice. Plasma very low density lipoprotein (VLDL) particle size was ordered: PO (63 ± 4 nm) > EO (55 ± 3 nm) > FO (40 ± 2 nm). Post-heparin lipolytic activity was similar among groups, but TG hydrolysis by purified lipoprotein lipase was significantly greater for EO and FO VLDL compared to PO VLDL. Removal of VLDL tracer from plasma was marginally faster in EO vs. PO fed mice. Our results suggest that EO reduces plasma TG primarily through increased intravascular lipolysis of TG and VLDL clearance. Finally, EO may substitute for FO to reduce plasma TG concentrations, but not hepatic steatosis in this mouse model.

  4. Stepwise positive association between APOA5 minor allele frequencies and increasing plasma triglyceride quartiles in random patients with hypertriglyceridemia of unclarified origin.

    PubMed

    Hadarits, Ferenc; Kisfali, Péter; Mohás, Márton; Maász, Anita; Sümegi, Katalin; Szabó, Melinda; Hetyésy, Katalin; Valasek, Andrea; Janicsek, Ingrid; Wittmann, István; Melegh, Béla

    2011-03-01

    Apolipoprotein A5 (ApoA5) gene and its protein product play a central role in the complex regulation of circulating triglyceride levels in humans. Naturally occurring variants of the apolipoprotein A5 gene have been associated with increased triglyceride levels and have been found to confer risk for cardiovascular diseases. In our study, four polymorphisms, the T-1131C, IVS3+G476A, T1259C, and C56G alleles of APOA5 were analyzed in a total of 436 patients by polymerase chain reaction-restriction fragment length polymorphism methods. The randomly selected patients were classified into four quartile (q) groups based on triglyceride levels (q1: TG<1.31 mmol/l; q2: 1.31-2.90 mmol/l; q3: 2.91-4.85 mmol/l; q4: TG>4.85 mmol/l). We observed significant stepwise increasing association between the four APOA5 minor allele carrier frequencies and plasma triglyceride quartiles: -1131C (q1: 4.44%; q2: 8.95%; q3: 12.9%; q4: 20.6%), IVS3 + 476A (q1: 4.44%; q2: 5.79%; q3: 11.1%; q4: 19.7%), 1259C (q1: 4.44%; q2: 6.84%; q3: 11.1%; q4: 20.6%) and 56G (q1: 5.64%; q2: 6.31%; q3: 11.16%; q4: 11.9%). The serum total cholesterol and high density lipoprotein-cholesterol levels also showed allele-dependent differences in the quartiles. The findings presented here revealed a special arrangement of APOA5 minor alleles in patients with different serum triglyceride ranges in Hungarians.

  5. Differences in the triglyceride to HDL-cholesterol ratio between Palestinian and Israeli adults.

    PubMed

    Weiss, Ram; Nassar, Hisham; Sinnreich, Ronit; Kark, Jeremy D

    2015-01-01

    To evaluate differences in the triglyceride to HDL-cholesterol ratio (TG/HDL), thought to be a proxy measure of insulin resistance, between Palestinian and Israeli adults in view of the greater incidence of coronary heart disease and high prevalence of diabetes in Palestinian Arabs. A population-based observational prevalence study of cardiovascular and diabetes risk factors in Jerusalem. Participants (968 Palestinians, 707 Israelis, sampled at ages 25-74 years) underwent fasting and 2 h post-75 g oral challenge plasma glucose determinations. Metabolic risk was assessed using the surrogate index TG/HDL. Sex-specific comparisons were stratified by categories of body mass index and sex-specific waist circumference quartiles, adjusted by regression for age, glucose tolerance status and use of statins. Prevalence of overweight and obesity was substantially larger in Palestinians (p = 0.005). Prevalence of diabetes was 2.4 and 4 fold higher among Palestinian men and women, respectively (p<0.001). Adjusted TG/HDL was higher in Palestinians than Israelis across BMI and waist circumference categories (p<0.001 for both). Higher TG/HDL in Palestinians persisted in analyses restricted to participants with normal glucose tolerance and off statins. Notably, higher TG/HDL among Palestinians prevailed at a young age (25-44 years) and in normal weight individuals of both sexes. Palestinians have a higher TG/HDL ratio than Israelis. Notably, this is evident also in young, healthy and normal weight participants. These findings indicate the need to study the determinants of this biomarker and other measures of insulin resistance in urban Arab populations and to focus research attention on earlier ages: childhood and prenatal stages of development.

  6. Differences in the Triglyceride to HDL-Cholesterol Ratio between Palestinian and Israeli Adults

    PubMed Central

    Weiss, Ram; Nassar, Hisham; Sinnreich, Ronit; Kark, Jeremy D.

    2015-01-01

    Aims To evaluate differences in the triglyceride to HDL-cholesterol ratio (TG/HDL), thought to be a proxy measure of insulin resistance, between Palestinian and Israeli adults in view of the greater incidence of coronary heart disease and high prevalence of diabetes in Palestinian Arabs. Research Methods A population-based observational prevalence study of cardiovascular and diabetes risk factors in Jerusalem. Participants (968 Palestinians, 707 Israelis, sampled at ages 25-74 years) underwent fasting and 2h post-75g oral challenge plasma glucose determinations. Metabolic risk was assessed using the surrogate index TG/HDL. Sex-specific comparisons were stratified by categories of body mass index and sex-specific waist circumference quartiles, adjusted by regression for age, glucose tolerance status and use of statins. Results Prevalence of overweight and obesity was substantially larger in Palestinians (p = 0.005). Prevalence of diabetes was 2.4 and 4 fold higher among Palestinian men and women, respectively (p<0.001). Adjusted TG/HDL was higher in Palestinians than Israelis across BMI and waist circumference categories (p<0.001 for both). Higher TG/HDL in Palestinians persisted in analyses restricted to participants with normal glucose tolerance and off statins. Notably, higher TG/HDL among Palestinians prevailed at a young age (25-44 years) and in normal weight individuals of both sexes. Conclusions Palestinians have a higher TG/HDL ratio than Israelis. Notably, this is evident also in young, healthy and normal weight participants. These findings indicate the need to study the determinants of this biomarker and other measures of insulin resistance in urban Arab populations and to focus research attention on earlier ages: childhood and prenatal stages of development. PMID:25635396

  7. Influences of APOA5 Variants on Plasma Triglyceride Levels in Uyghur Population

    PubMed Central

    Wang, Yi; Wu, Di; Jin, Li; Wang, Xiaofeng

    2014-01-01

    Objective Single nucleotide polymorphisms (SNPs) in apolipoprotein A5 (APOA5) gene are associated with triglyceride (TG) levels. However, the minor allele frequencies and linkage disequilibriums (LDs) of the SNPs in addition to their effects on TG levels vary greatly between Caucasians and East Asians. The distributions of the SNPs/haplotypes and their associations with TG levels in Uyghur population, an admixture population of Caucasians and East Asians, have not been reported to date. Here, we performed a cross-sectional study to address these. Methods Genotyping of four SNPs in APOA5 (rs662799, rs3135506, rs2075291, and rs2266788) was performed in 1174 unrelated Uyghur subjects. SNP/haplotype and TG association analyses were conducted. Results The frequencies of the SNPs in Uyghurs were in between those in Caucasians and East Asians. The LD between rs662799 and rs2266788 in Uyghurs was stronger than that in East Asians but weaker than that in Caucasians, and the four SNPs resulted in four haplotypes (TGGT, CGGC, TCGT, and CGTT arranged in the order of rs662799, rs3135506, rs2075291, and rs2266788) representing 99.2% of the population. All the four SNPs were significantly associated with TG levels. Compared with non-carriers, carriers of rs662799-C, rs3135506-C, rs2075291-T, and rs2266788-C alleles had 16.0%, 15.1%, 17.1%, and 12.4% higher TG levels, respectively. When haplotype TGGT was defined as the reference, the haplotypes CGGC, TCGT, and CGTT resulted in 16.1%, 19.0%, and 19.8% higher TG levels, respectively. The proportions of variance in TG explained by APOA5 locus were 2.5%, 0.3%, 0.4%, and 1.9% for single SNP rs662799, rs3135506, rs2075291, and rs2266788, respectively, and 3.0% for the haplotypes constructed by them. Conclusions The association profiles between the SNPs and haplotypes at APOA5 locus and TG levels in this admixture population differed from those in Caucasians and East Asians. The functions of these SNPs and haplotypes need to be

  8. Consumption of sugar-sweetened beverages, but not 100% fruit juice, is associated with fasting high-density lipoprotein and triglyceride concentrations in U.S. adults

    USDA-ARS?s Scientific Manuscript database

    Introduction: Dyslipidemia, characterized by high triglyceride (TG) and low HDL concentrations, is a risk factor for cardiovascular disease (CVD). Decreasing dietary sugar consumption is one dietary modification that may influence dyslipidemia risk to reduce the risk for CVD. Two major sources of di...

  9. Use of the plasma triglyceride/high-density lipoprotein cholesterol ratio to identify cardiovascular disease in hypertensive subjects.

    PubMed

    Salazar, Martin R; Carbajal, Horacio A; Espeche, Walter G; Aizpurúa, Marcelo; Leiva Sisnieguez, Carlos E; Leiva Sisnieguez, Betty C; March, Carlos E; Stavile, Rodolfo N; Balbín, Eduardo; Reaven, Gerald M

    2014-10-01

    This analysis evaluated the hypothesis that the plasma triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) concentration ratio can help identify patients with essential hypertension who are insulin-resistant, with the cardiovascular disease (CVD) risk profile associated with that defect. Data from a community-based study developed between 2003 and 2012 were used to compare CVD risk factors and outcome. Plasma TG/HDL-C cut-points of 2.5 (women) and 3.5 (men) subdivided normotensive (n = 574) and hypertensive (n = 373) subjects into "high" and "low" risk groups. Metabolic syndrome criteria (MetS) were also used to identify "high" and "low" risk groups. The baseline cardio-metabolic profile was significantly more adverse in 2003 in "high" risk subgroups, irrespective of BP classification or definition of risk (TG/HDL-C ratio vs. MetS criteria). Crude incidence of combined CVD events increased across risk groups, ranging from 1.9 in normotensive-low TG/HDL-C subjects to 19.9 in hypertensive-high TG/HDL-C ratio individuals (P for trends <.001). Adjusted hazard ratios for CVD events also increased with both hypertension and TG/HDL-C. Comparable findings were seen when CVD outcome was predicted by MetS criteria. The TG/HDL-C concentration ratio and the MetS criteria identify to a comparable degree hypertensive subjects who are at greatest cardio-metabolic risk and develop significantly more CVD.

  10. [Risk factors analysis of nonalcoholic fatty liver disease in Chinese men].

    PubMed

    Zheng, Rui-Dan; Zhuang, Qun-Ying; Chen, Jian-Neng; Chen, Jie; Lu, Yan-Hui

    2013-01-01

    To explore risk factors of nonalcoholic fatty liver disease (NAFLD) in men in order to provide a theoretical basis for developing more effective NAFLD prevention and control strategies. One-hundred-and-two male patients (37.3+/-11.4 years old) hospitalized with NAFLD at the Dongnan Affiliated Hospital of Xiamen University between January 2009 and December 2010 were enrolled in the study, along with 23 age-matched healthy men (34.4+/-16.7 years old) to serve as the control group. The correlation(s) of body mass index (BMI; overweight defined as more than or equal to 22.717 kg/m2), waist circumference (WC), waist-to-hip ratio (WHR; central obesity defined as more than or equal to 0.866), fasting plasma glucose (FPG), triglyceride (TG), and total cholesterol (TC) with NAFLD was analyzed by univariate and multivariate logistic regression analyses. Receiver operating characteristic (ROC) curves were used to select proper thresholds for classification. BMI, WC, WHR, FPG, TG, and TC were significantly different between the cases and controls (P less than 0.01). BMI, WC, WHR, TG and TC were identified as risk factors of NAFLD in these male cases (P less than 0.01). Relative to WC, TG and TC, both BMI and WHR had significant predictive value for NAFLD (odds ratio (OR) = 10.819 and 10.588, respectively). In addition, BMI had the highest diagnostic value for the prediction of NAFLD (area under the curve (AUC) = 0.931) followed by WHR (AUC = 0.879). BMI, WC, WHR, TG, and TC are risk factors of NAFLD in Chinese men. BMI and WHR are effective anthroposomatology indices of NAFLD and may be useful factors on which to base future prevention and early diagnosis strategies for NAFLD in males.

  11. Non-HDL Cholesterol and Triglycerides: Implications for Coronary Atheroma Progression and Clinical Events.

    PubMed

    Puri, Rishi; Nissen, Steven E; Shao, Mingyuan; Elshazly, Mohamed B; Kataoka, Yu; Kapadia, Samir R; Tuzcu, E Murat; Nicholls, Stephen J

    2016-11-01

    Non-high-density lipoprotein cholesterol (non-HDLC) levels reflect the full burden of cholesterol transported in atherogenic lipoproteins. Genetic studies suggest a causal association between elevated triglycerides (TGs)-rich lipoproteins and atherosclerosis. We evaluated associations between achieved non-HDLC and TG levels on changes in coronary atheroma volume. Data were analyzed from 9 clinical trials involving 4957 patients with coronary disease undergoing serial intravascular ultrasonography to assess changes in percent atheroma volume (ΔPAV) and were evaluated against on-treatment non-HDLC and TG levels. The effects of lower (<100 mg/dL) versus higher (≥100 mg/dL) achieved non-HDLC levels and lower (<200 mg/dL) versus higher (≥200 mg/dL) achieved TG levels were evaluated in populations with variable on-treatment low-density lipoprotein cholesterol (LDLC) 0) was associated with achieved TG levels >200 mg/dL, respectively. Lower on-treatment non-HDLC and TG levels associated with significant PAV regression compared with higher non-HDLC and TG levels across all levels of LDLC and C-reactive protein and irrespective of diabetic status (P<0.001 across all comparisons). ΔPAV were more strongly influenced by changes in non-HDLC (β=0.62; P<0.001) compared with changes in LDLC (β=0.51; P<0.001). Kaplan-Meier sensitivity analyses demonstrated significantly greater major adverse cardiovascular event rates in those with higher versus lower non-HDLC and TG levels, with an earlier separation of the non-HDLC compared with the LDLC curve. Achieved non-HDLC levels seem more closely associated with coronary atheroma progression than LDLC. Plaque progression associates with achieved TGs, but only above levels of 200 mg/dL. These observations support a more prominent role for non

  12. Longitudinal analysis of haplotypes and polymorphisms of the APOA5 and APOC3 genes associated with variation in serum triglyceride levels: the Bogalusa Heart Study.

    PubMed

    Hallman, D Michael; Srinivasan, Sathanur R; Chen, Wei; Boerwinkle, Eric; Berenson, Gerald S

    2006-12-01

    Polymorphisms in the APOC3 and APOA5 genes, from the APOA1/APOC3/APOA4/APOA5 gene cluster on chromosome 11q23, have been associated with interindividual variation in plasma triglycerides. APOA5 polymorphisms implicated include 2 in the promoter region (-1131 T/C and -3 A/G) and 1 in exon 2 (+56 C/G). APOC3 polymorphisms implicated include 1 (SstI) in the 3' untranslated region and 1 (-2854 G/T) in the APOC3-APOA4 intergenic region. We analyzed the associations of haplotypes and multilocus genotypes of these polymorphisms on longitudinal serum triglyceride profiles in 360 African American and 823 white subjects from the Bogalusa Heart Study. Subjects were examined from 2 to 8 times (mean +/- SD, 5.4 +/- 1.3) between 1973 and 1996, at ages ranging from 4 to 38 years, with 1978 observations in African Americans and 4465 in whites. Serum triglycerides were significantly higher among whites across all ages. Allele frequencies differed significantly between African Americans and whites at all but the APOA5 +56 C/G locus. Linkage disequilibrium among the loci was higher in whites and haplotype diversity lower: 6 haplotypes had estimated frequencies of more than 1% in African Americans, 5 in whites. Individually, all polymorphisms except APOC3 -2854 G/T showed significant associations with triglyceride levels in the full sample. However, genotype models including all 5 loci showed significant triglyceride associations for only 3 (APOC3 SstI, APOA5 -1131 T/C, and APOA5 +56 C/G); significant interactions among them indicated their effects were not independent. Neither APOC3 -2854 G/T nor APOA5 -3 A/G had significant effects when the other 3 loci were in the models. The EM algorithm was used to estimate haplotype frequencies and assign haplotype probabilities to individuals, which is conditional on their genotypes; individuals' haplotype probability vectors were then used as predictors in multilevel mixed models of longitudinal triglyceride profiles. Of haplotypes comprising

  13. HIV treatment is associated with a two-fold higher probability of raised triglycerides: Pooled Analyses in 21 023 individuals in sub-Saharan Africa.

    PubMed

    Ekoru, Kenneth; Young, Elizabeth H; Dillon, David G; Gurdasani, Deepti; Stehouwer, Nathan; Faurholt-Jepsen, Daniel; Levitt, Naomi S; Crowther, Nigel J; Nyirenda, Moffat; Njelekela, Marina A; Ramaiya, Kaushik; Nyan, Ousman; Adewole, Olanisun O; Anastos, Kathryn; Compostella, Caterina; Dave, Joel A; Fourie, Carla M; Friis, Henrik; Kruger, Iolanthe M; Longenecker, Chris T; Maher, Dermot P; Mutimura, Eugene; Ndhlovu, Chiratidzo E; Praygod, George; Pefura Yone, Eric W; Pujades-Rodriguez, Mar; Range, Nyagosya; Sani, Mahmoud U; Sanusi, Muhammad; Schutte, Aletta E; Sliwa, Karen; Tien, Phyllis C; Vorster, Este H; Walsh, Corinna; Gareta, Dickman; Mashili, Fredirick; Sobngwi, Eugene; Adebamowo, Clement; Kamali, Anatoli; Seeley, Janet; Smeeth, Liam; Pillay, Deenan; Motala, Ayesha A; Kaleebu, Pontiano; Sandhu, Manjinder S

    2018-01-01

    Anti-retroviral therapy (ART) regimes for HIV are associated with raised levels of circulating triglycerides (TG) in western populations. However, there are limited data on the impact of ART on cardiometabolic risk in sub-Saharan African (SSA) populations. Pooled analyses of 14 studies comprising 21 023 individuals, on whom relevant cardiometabolic risk factors (including TG), HIV and ART status were assessed between 2003 and 2014, in SSA. The association between ART and raised TG (>2.3 mmol/L) was analysed using regression models. Among 10 615 individuals, ART was associated with a two-fold higher probability of raised TG (RR 2.05, 95% CI 1.51-2.77, I 2 =45.2%). The associations between ART and raised blood pressure, glucose, HbA1c, and other lipids were inconsistent across studies. Evidence from this study confirms the association of ART with raised TG in SSA populations. Given the possible causal effect of raised TG on cardiovascular disease (CVD), the evidence highlights the need for prospective studies to clarify the impact of long term ART on CVD outcomes in SSA.

  14. The Role of Plasma Triglyceride/High-Density Lipoprotein Cholesterol Ratio to Predict New Cardiovascular Events in Essential Hypertensive Patients.

    PubMed

    Turak, Osman; Afşar, Barış; Ozcan, Fırat; Öksüz, Fatih; Mendi, Mehmet Ali; Yayla, Çagrı; Covic, Adrian; Bertelsen, Nathan; Kanbay, Mehmet

    2016-08-01

    Triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) has been suggested as a simple method to identify unfavorable cardiovascular outcomes in the general population. The effect of the TG/HDL-C ratio on essential hypertensive patients is unclear. About 900 consecutive essential hypertensive patients (mean age 52.9±12.6 years, 54.2% male) who visited our outpatient hypertension clinic were analyzed. Participants were divided into quartiles based on baseline TG/HDL-C ratio and medical records were obtained periodically for the occurrence of fatal events and composite major adverse cardiovascular events (MACEs) including transient ischemic attack, stroke, aortic dissection, acute coronary syndrome, and death. Participants were followed for a median of 40 months (interquartile range, 35-44 months). Overall, a higher quartile of TG/HDL-C ratio at baseline was significantly linked with higher incidence of fatal and nonfatal cardiovascular events. Using multivariate Cox regression analysis, plasma TG/HDL-C ratio was independently associated with increased risk of fatal events (hazard ratio [HR], 1.25; 95% confidence interval [CI], 1.13-1.37; P≤.001] and MACEs (HR, 1.13; 95% CI, 1.06-1.21; P≤.001). Increased plasma TG/HDL-C ratio was associated with more fatal events and MACEs in essential hypertensive patients. © 2015 Wiley Periodicals, Inc.

  15. Epigenome-wide association study of triglyceride postprandial responses to high-fat dietary challenge in the Genetics of Lipid Lowering Drugs and Diet Network study

    USDA-ARS?s Scientific Manuscript database

    Postprandial lipemia (PPL), the increased plasma triglyceride (TG) concentration after consuming a high-fat meal, is an independent risk factor for cardiovascular disease (CVD). Individual responses to a meal high in fat vary greatly, depending on genetic and lifestyle factors. However, only a few ...

  16. Comparison of triglycerides and phospholipids as supplemental sources of dietary long-chain polyunsaturated fatty acids in piglets.

    PubMed

    Mathews, Susan A; Oliver, William T; Phillips, Oulayvanh T; Odle, Jack; Diersen-Schade, Deborah A; Harrell, Robert J

    2002-10-01

    Addition of arachidonic acid (AA) and docosahexaenoic acid (DHA) to infant formula promotes visual and neural development. This study was designed to determine whether the source of dietary long-chain polyunsaturated fatty acids (LCPUFA) affected overall animal health and safety. Piglets consumed ad libitum from 1 to 16 d of age a skim milk-based formula with different fat sources added to provide 50% of the metabolizable energy. Treatment groups were as follows: control (CNTL; no added LCPUFA), egg phospholipid (PL), algal/fungal triglyceride (TG) oils, TG plus PL (soy lecithin source) added to match phospholipid treatment (TG + PL) and essential fatty acid deficient (EFAD). Formulas with LCPUFA provided 0.6 and 0.3 g/100 g total fatty acids as AA and DHA, respectively. CNTL piglets had 40% longer ileal villi than PL piglets (P < 0.03), but the TG group was not different from the CNTL group. Gross liver histology did not differ among any of the formula-fed groups (P > 0.1). Apparent dry matter digestibility was 10% greater in CNTL, TG and TG + PL groups compared with PL piglets (P < 0.002). No differences in alanine aminotransferase were detected among treatments, but aspartate aminotransferase was elevated (P < 0.03) in PL piglets compared with TG + PL piglets. Total plasma AA concentration was greater in the TG group compared with CNTL piglets (P < 0.05). Total plasma DHA concentrations were greater in TG piglets compared with PL (P < 0.06) or CNTL (P < 0.02) piglets. These data demonstrate that the algal/fungal TG sources of DHA and AA may be a more appropriate supplement for infant formulas than the egg PL source based on piglet plasma fatty acid profiles and apparent dry matter digestibilities.

  17. Triglyceride enrichment of HDL enhances in vivo metabolic clearance of HDL apo A-I in healthy men

    PubMed Central

    Lamarche, Benoît; Uffelman, Kristine D.; Carpentier, André; Cohn, Jeffrey S.; Steiner, George; Barrett, P. Hugh; Lewis, Gary F.

    1999-01-01

    Triglyceride (TG) enrichment of HDL resulting from cholesteryl ester transfer protein–mediated exchange with TG-rich lipoproteins may enhance the lipolytic transformation and subsequent metabolic clearance of HDL particles in hypertriglyceridemic states. The present study investigates the effect of TG enrichment of HDL on the clearance of HDL-associated apo A-I in humans. HDL was isolated from plasma of six normolipidemic men (mean age: 29.7 ± 2.7 years) in the fasting state and after a five-hour intravenous infusion with a synthetic TG emulsion, Intralipid. Intralipid infusion resulted in a 2.1-fold increase in the TG content of HDL. Each tracer was then whole-labeled with 125I or 131I and injected intravenously into the subject. Apo A-I in TG-enriched HDL was cleared 26% more rapidly than apo A-I in fasting HDL. A strong correlation between the Intralipid-induced increase in the TG content of HDL and the increase in HDL apo A-I fractional catabolic rate reinforced the importance of TG enrichment of HDL in enhancing its metabolic clearance. HDL was separated further into lipoproteins containing apo A-II (LpAI:AII) and those without apo A-II (LpAI). Results revealed that the enhanced clearance of apo A-I from TG-enriched HDL could be largely attributed to differences in the clearance of LpAI but not LpAI:AII. This is, to our knowledge, the first direct demonstration in humans that TG enrichment of HDL enhances the clearance of HDL apo A-I from the circulation. This phenomenon could provide an important mechanism explaining how HDL apo A-I and HDL cholesterol are lowered in hypertriglyceridemic states. PMID:10207171

  18. Evidence for a gene influencing the TG/HDL-C ratio on chromosome 7q32.3-qter: a genome-wide scan in the Framingham study.

    PubMed

    Shearman, A M; Ordovas, J M; Cupples, L A; Schaefer, E J; Harmon, M D; Shao, Y; Keen, J D; DeStefano, A L; Joost, O; Wilson, P W; Housman, D E; Myers, R H

    2000-05-22

    Some studies show that plasma triglyceride (TG) levels are a significant independent risk factor for cardiovascular disease (CVD). TG levels are inversely correlated with high density lipoprotein cholesterol (HDL-C) levels, and their metabolism may be closely interrelated. Therefore, the TG/HDL-C ratio may be a relevant CVD risk factor. Our analysis of families in the Framingham Heart Study gave a genetic heritability estimate for log(TG) of 0.40 and for log(TG/HDL-C) of 0.49, demonstrating an important genetic component for both. A 10 cM genome-wide scan for log(TG) level and log(TG/HDL-C) was carried out for the largest 332 extended families of the Framingham Heart Study (1702 genotyped individuals). The highest multipoint variance component LOD scores obtained for both log(TG) and log(TG/HDL-C) were on chromosome 7 (at 155 cM), where the results for the two phenotypes were 1.8 and 2.5, respectively. The 7q32.3-qter region contains several candidate genes. Four other regions with multipoint LOD scores greater than one were identified on chromosome 3 [LOD score for log(TG/HDL-C) = 1.8 at 140 cM], chromosome 11 [LOD score for log(TG/HDL-C) = 1.1 at 125 cM], chromosome 16 [LOD score for log(TG) = 1.5 at 70 cM, LOD score for log(TG/HDL-C) = 1.1 at 75 cM] and chromosome 20 [LOD score for log(TG/HDL-C) = 1.7 at 35 cM, LOD score for log(TG) = 1.3 at 40 cM]. These results identify loci worthy of further study.

  19. Effect of Acute Negative and Positive Energy Balance on Basal Very-Low Density Lipoprotein Triglyceride Metabolism in Women

    PubMed Central

    Bellou, Elena; Maraki, Maria; Magkos, Faidon; Botonaki, Helena; Panagiotakos, Demosthenes B.; Kavouras, Stavros A.; Sidossis, Labros S.

    2013-01-01

    Background Acute reduction in dietary energy intake reduces very low-density lipoprotein triglyceride (VLDL-TG) concentration. Although chronic dietary energy surplus and obesity are associated with hypertriglyceridemia, the effect of acute overfeeding on VLDL-TG metabolism is not known. Objective The aim of the present study was to investigate the effects of acute negative and positive energy balance on VLDL-TG metabolism in healthy women. Design Ten healthy women (age: 22.0±2.9 years, BMI: 21.2±1.3 kg/m2) underwent a stable isotopically labeled tracer infusion study to determine basal VLDL-TG kinetics after performing, in random order, three experimental trials on the previous day: i) isocaloric feeding (control) ii) hypocaloric feeding with a dietary energy restriction of 2.89±0.42 MJ and iii) hypercaloric feeding with a dietary energy surplus of 2.91±0.32 MJ. The three diets had the same macronutrient composition. Results Fasting plasma VLDL-TG concentrations decreased by ∼26% after hypocaloric feeding relative to the control trial (P = 0.037), owing to decreased hepatic VLDL-TG secretion rate (by 21%, P = 0.023) and increased VLDL-TG plasma clearance rate (by ∼12%, P = 0.016). Hypercaloric feeding increased plasma glucose concentration (P = 0.042) but had no effect on VLDL-TG concentration and kinetics compared to the control trial. Conclusion Acute dietary energy deficit (∼3MJ) leads to hypotriglyceridemia via a combination of decreased hepatic VLDL-TG secretion and increased VLDL-TG clearance. On the other hand, acute dietary energy surplus (∼3MJ) does not affect basal VLDL-TG metabolism but disrupts glucose homeostasis in healthy women. PMID:23533676

  20. Quercetin Lowers Plasma Triglycerides Accompanied by White Adipose Tissue Browning in Diet-Induced Obese Mice.

    PubMed

    Kuipers, Eline N; Dam, Andrea D van; Held, Ntsiki M; Mol, Isabel M; Houtkooper, Riekelt H; Rensen, Patrick C N; Boon, Mariëtte R

    2018-06-16

    Obesity and dyslipidemia are major risk factors for the development of cardiovascular diseases (CVD). Quercetin, a natural flavonoid, lowers plasma triglycerides (TG) in human intervention studies, and its intake is associated with lower CVD risk. The aim of this study was to elucidate the mechanism by which quercetin lowers plasma TG levels in diet-induced obesity. C57Bl/6J mice received a high-fat diet (45% of calories derived from fat) with or without quercetin (0.1% w / w ) for 12 weeks. Quercetin decreased plasma TG levels from nine weeks onwards (−19%, p < 0.05), without affecting food intake, body composition, or energy expenditure. Mechanistically, quercetin did not reduce intestinal fatty acid (FA) absorption. Rather, quercetin induced a slight reduction in liver Apob expression (−13%, p < 0.05), which suggests decreased very-low density lipoprotein-TG production. Interestingly, quercetin also markedly increased the uptake of [³H]oleate, which was derived from glycerol tri[³H]oleate-labeled lipoprotein-like particles by subcutaneous white adipose tissue (sWAT, +60%, p < 0.05). Furthermore, quercetin also markedly increased mRNA expression of Ucp1 (+229%, p < 0.05) and Elovl3 (+138%, p < 0.05), specifically in sWAT. Accordingly, only quercetin-treated animals showed uncoupling protein-1 protein-positive cells in sWAT, which is fully compatible with increased browning. Taken together, the TG-lowering effect of quercetin may, at least in part, be due to increased TG-derived FA uptake by sWAT as a consequence of browning.

  1. The association between lipid parameters and obesity in university students.

    PubMed

    Hertelyova, Z; Salaj, R; Chmelarova, A; Dombrovsky, P; Dvorakova, M C; Kruzliak, P

    2016-07-01

    Abdominal obesity is associated with high plasma triglyceride and with low plasma high-density lipoprotein cholesterol levels. Objective of the study was to find an association between plasma lipid and lipoprotein levels and anthropometric parameters in abdominal obesity in Slovakian university students. Lipid profile and anthropometric parameters of obesity were studied in a sample of 419 probands, including 137 men and 282 women. Males had higher values of non-high-density lipoprotein cholesterol (non-HDL-C), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG) and very low-density lipoprotein cholesterol (VLDL-C) than females, but these differences were not significant. Females had significantly (P < 0.05) higher TC and HDL-C (P < 0.001) than males. In comparison, all anthropometric parameters in the males were significantly (P < 0.001) higher than in the females. A positive correlation between non-HDL-C, TG, VLDL-C and anthropometric parameters (BMI, WC, WHR, WHtR) was found at P < 0.001. LDL was positively correlated with BMI, WCF, WHtR and TC with BMI, WHtR at P < 0.001. We also observed a correlation between TC-WCF and LDL-WHR at P < 0.01. A negative correlation was found between HDL and all monitored anthropometric parameters at P < 0.001. On the other hand, no correlation between TC and WHR was detected. This study shows an association between plasma lipid and lipoprotein levels and anthropometric parameters in abdominal obesity in young people, predominantly university students.

  2. SULF2 Strongly Prediposes to Fasting and Postprandial Triglycerides in Patients with Obesity and Type 2 Diabetes Mellitus

    PubMed Central

    Hassing, H. Carlijne; Surendran, R. Preethi; Derudas, Bruno; Verrijken, An; Francque, Sven M.; Mooij, Hans L.; Bernelot Moens, Sophie J.; ’t Hart, Leen M.; Nijpels, Giel; Dekker, Jacqueline M.; Williams, Kevin Jon; Stroes, Erik S. G.; Van Gaal, Luc F.; Staels, Bart; Nieuwdorp, Max; Dallinga-Thie, Geesje M.

    2014-01-01

    Objective Hepatic overexpression of sulfatase-2 (SULF2), a heparan sulfate remodelling enzyme, strongly contributes to high triglyceride (TG) levels in obese, type 2 diabetic (T2DM) db/db mice. Nevertheless, data in humans are lacking. Here we sought to investigate the association of human hepatic SULF2 expression and SULF2 gene variants with TG metabolism in patients with obesity and/or T2DM. Design and Methods Liver biopsies from 121 obese subjects were analyzed for relations between hepatic SULF2 mRNA levels and plasma TG. Associations between seven SULF2 tagSNPs and TG levels were assessed in 210 obese T2DM subjects with dyslipidemia. Replication of positive findings was performed in 1316 independent obese T2DM patients. Postprandial TRL clearance was evaluated in 29 obese T2DM subjects stratified by SULF2 genotype. Results Liver SULF2 expression was significantly associated with fasting plasma TG (r = 0.271; p=0.003) in obese subjects. The SULF2 rs2281279(A>G) SNP was reproducibly associated with lower fasting plasma TG levels in obese T2DM subjects (p<0.05). Carriership of the minor G allele was associated with lower levels of postprandial plasma TG (P<0.05) and retinyl esters (RE) levels (P<0.001). Conclusions These findings implicate SULF2 as potential therapeutic target in the atherogenic dyslipidemia of obesity and T2DM. PMID:24339435

  3. SULF2 strongly prediposes to fasting and postprandial triglycerides in patients with obesity and type 2 diabetes mellitus.

    PubMed

    Hassing, H Carlijne; Surendran, R Preethi; Derudas, Bruno; Verrijken, An; Francque, Sven M; Mooij, Hans L; Bernelot Moens, Sophie J; Hart, Leen M 't; Nijpels, Giel; Dekker, Jacqueline M; Williams, Kevin Jon; Stroes, Erik S G; Van Gaal, Luc F; Staels, Bart; Nieuwdorp, Max; Dallinga-Thie, Geesje M

    2014-05-01

    Hepatic overexpression of sulfatase-2 (SULF2), a heparan sulfate remodeling enzyme, strongly contributes to high triglyceride (TG) levels in obese, type 2 diabetic (T2DM) db/db mice. Nevertheless, data in humans are lacking. Here, the association of human hepatic SULF2 expression and SULF2 gene variants with TG metabolism in patients with obesity and/or T2DM was investigated. Liver biopsies from 121 obese subjects were analyzed for relations between hepatic SULF2 mRNA levels and plasma TG. Associations between seven SULF2 tagSNPs and TG levels were assessed in 210 obese T2DM subjects with dyslipidemia. Replication of positive findings was performed in 1,316 independent obese T2DM patients. Postprandial TRL clearance was evaluated in 29 obese T2DM subjects stratified by SULF2 genotype. Liver SULF2 expression was significantly associated with fasting plasma TG (r = 0.271; P = 0.003) in obese subjects. The SULF2 rs2281279(A>G) SNP was reproducibly associated with lower fasting plasma TG levels in obese T2DM subjects (P < 0.05). Carriership of the minor G allele was associated with lower levels of postprandial plasma TG (P < 0.05) and retinyl esters levels (P < 0.001). These findings implicate SULF2 as potential therapeutic target in the atherogenic dyslipidemia of obesity and T2DM. Copyright © 2013 The Obesity Society.

  4. Triglyceride to high-density lipoprotein cholesterol ratio predicts cardiovascular outcomes in prevalent dialysis patients.

    PubMed

    Chen, Hung-Yuan; Tsai, Wan-Chuan; Chiu, Yen-Ling; Hsu, Shih-Ping; Pai, Mei-Fen; Yang, Ju-Yeh; Peng, Yu-Sen

    2015-03-01

    Triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio, an indicator of atherogenic dyslipidemia, is a predictor of cardiovascular (CV) outcomes in the general population and has been correlated with atherosclerotic events. Whether the TG/HDL-C ratio can predict CV outcomes and survival in dialysis patients is unknown. We performed this prospective, observational cohort study and enrolled 602 dialysis patients (539 hemodialysis and 63 peritoneal dialysis) from a single center in Taiwan followed up for a median of 3.9 years. The outcomes were the occurrence of CV events, CV death, and all-cause mortality during follow-up. The association of baseline TG/HDL-C ratio with outcomes was explored with Cox regression models, which were adjusted for demographic parameters and inflammatory/nutritional markers. Overall, 203 of the patients experienced CV events and 169 patients died, of whom 104 died due to CV events. Two hundred fifty-four patients reached the composite CV outcome. Patients with higher TG/HDL-C levels (quintile 5) had a higher incidence of CV events (adjusted hazard ratio [HR] 2.03, 95% confidence interval [CI] 1.19-3.47), CV mortality (adjusted HR 1.91, 95% CI 1.07-3.99), composite CV outcome (adjusted HR 2.2, 95% CI 1.37-3.55), and all-cause mortality (adjusted HR 1.94, 95% CI 1.1-3.39) compared with the patients in quintile 1. However, in diabetic dialysis patients, the TG/HDL-C ratio did not predict the outcomes. The TG/HDL-C ratio is a reliable and easily accessible predictor to evaluate CV outcomes and survival in prevalent nondiabetic dialysis patients. ClinicalTrials.gov: NCT01457625.

  5. Triglycerides to High-Density Lipoprotein Cholesterol Ratio Can Predict Impaired Glucose Tolerance in Young Women with Polycystic Ovary Syndrome.

    PubMed

    Song, Do Kyeong; Lee, Hyejin; Sung, Yeon Ah; Oh, Jee Young

    2016-11-01

    The triglycerides to high-density lipoprotein cholesterol (TG/HDL-C) ratio could be related to insulin resistance (IR). We previously reported that Korean women with polycystic ovary syndrome (PCOS) had a high prevalence of impaired glucose tolerance (IGT). We aimed to determine the cutoff value of the TG/HDL-C ratio for predicting IR and to examine whether the TG/HDL-C ratio is useful for identifying individuals at risk of IGT in young Korean women with PCOS. We recruited 450 women with PCOS (24±5 yrs) and performed a 75-g oral glucose tolerance test (OGTT). IR was assessed by a homeostasis model assessment index over that of the 95th percentile of regular-cycling women who served as the controls (n=450, 24±4 yrs). The cutoff value of the TG/HDL-C ratio for predicting IR was 2.5 in women with PCOS. Among the women with PCOS who had normal fasting glucose (NFG), the prevalence of IGT was significantly higher in the women with PCOS who had a high TG/HDL-C ratio compared with those with a low TG/HDL-C ratio (15.6% vs. 5.6%, p<0.05). The cutoff value of the TG/HDL-C ratio for predicting IR was 2.5 in young Korean women with PCOS, and women with NFG and a high TG/HDL-C ratio had a higher prevalence of IGT. Therefore, Korean women with PCOS with a TG/HDL-C ratio >2.5 are recommended to be administered an OGTT to detect IGT even if they have NFG.

  6. Triglycerides: A reappraisal.

    PubMed

    Wiesner, Philipp; Watson, Karol E

    2017-08-01

    Elevated cholesterol levels are clearly independently associated with adverse cardiovascular events. Another class of lipid particles, triglycerides, is also abundant in the human body and has been found in atherosclerotic plaques. Recent observational studies have demonstrated an association between elevated triglyceride levels and increased risk for future cardiovascular events. With this knowledge and the discovery of effective agents to lower triglyceride levels, the management of triglycerides is currently undergoing a renaissance. Unfortunately, no randomized, controlled clinical trials have been completed to date, proving that lowering triglycerides will reduce cardiovascular events. In this review we highlight some of the evidence that led to this stage and discuss the current data on pharmacologic intervention of triglyceride levels and the effect on clinical outcomes. Lastly, we want to give the reader insight on what the most recent lipid guidelines state about clinical triglyceride management, mention new pharmacological agents, and highlight the clinical evidence for safe and effective lowering of triglycerides levels with life style modification. Copyright © 2017. Published by Elsevier Inc.

  7. Serum fetuin-A levels are associated with serum triglycerides before and 6 months after bariatric surgery.

    PubMed

    Verras, Christos G; Christou, Georgios A; Simos, Yannis V; Ayiomamitis, George D; Melidonis, Andreas J; Kiortsis, Dimitrios N

    2017-07-01

    The elucidation of the changes of fetuin-A in the context of bariatric surgery. Twenty obese patients (8 males, 12 females; body mass index = 42.5±3.4 kg/m2) were studied at baseline and 6 months after bariatric surgery. Serum fetuin-A levels did not differ with regard to the presence of each individual component of the Metabolic Syndrome (MetS) at baseline, except for hypertriglyceridaemia [increased serum fetuin-A levels (p=0.011)]. Circulating fetuin-A was positively correlated with serum triglycerides (TG) (r=0.461, p=0.047) and negatively correlated with serum globulins (r=-0.477, p=0.033) and C-reactive protein (CRP) (r=-0.604, p=0.010), while it independently predicted TG at baseline. Circulating fetuin-A did not change during the 6 months either in the whole population or in the subgroups of patients who were positive for each individual component of MetS at baseline and negative for this component at 6 months of follow-up, except for hypertriglyceridaemia [reduction of serum fetuin-A levels (p=0.046)]. The subgroup of patients with a decrease in circulating fetuin-A during the 6 months was characterized by a smaller reduction of serum globulins (p=0.003) and CRP (p=0.049). The change in serum fetuin-A levels over the 6 months was positively correlated with the change in TG (r=0.592, p=0.006) and negatively correlated with the change in serum globulins (r=-0.523, p=0.018) and CRP (r=-.494, p=0.037). Circulating fetuin-A predicted serum triglycerides before as well as 6 months after bariatric surgery.

  8. Triglycerides are a predictive factor for arterial stiffness: a community-based 4.8-year prospective study.

    PubMed

    Wang, Xiaona; Ye, Ping; Cao, Ruihua; Yang, Xu; Xiao, Wenkai; Zhang, Yun; Bai, Yongyi; Wu, Hongmei

    2016-05-18

    Epidemiological studies have disclosed an independent effect of triglycerides on coronary heart disease despite achievement of low-density lipoprotein cholesterol goals with statin therapy. Arterial stiffness has been increasingly recognized as a strong predictor of cardiovascular disease and atherosclerotic disease. The association between triglycerides and arterial stiffness is not well characterized. We aimed to determine the relationship between triglycerides and arterial stiffness in a community-based longitudinal sample from Beijing, China. We related levels of plasma TGs to measures of arterial stiffness (carotid-femoral pulse wave velocity [PWV] and carotid-radial PWV) in 1447 subjects (mean age, 61.3 years) from a community-based population in Beijing, China. After a median follow-up interval of 4.8 years, multiple linear regression analysis revealed that TGs were independently associated with carotid-femoral PWV (β = 0.747, P < 0.001) and carotid-radial PWV (β = 0.367, P = 0.001). In the group older than 65 years, the association between baseline TG levels and follow-up carotid-femoral PWV (β = 1.094, P = 0.001) and carotid-radial PWV (β = 0.524, P = 0.002) were strengthened. In forward stepwise multivariate logistic regression analysis, every SD increase in TGδ was associated with a 1.296-increased likelihood of the presence of carotid-femoral PWVδII (OR [per SD increase in TGδ]: 1.296; 95% CI: 1.064 ~ 1.580; P = 0.010) in Model 2, whereas the relationship between TGδ and carotid-radial PWVδII disappeared. In addition, the relationship was strengthened between TGδ and the presence of carotid-femoral PWVδII (OR 1.526, 95% CI: 1.088-2.141, P = 0.014) in the group older than 65 years but not carotid-radial PWVδII. No association was noted in subjects younger than 65 years. Lower triglyceride levels were significantly associated with decreases in carotid-femoral PWV, indicating that achieving low TG levels may be an additional therapeutic

  9. Exome-wide association study of plasma lipids in >300,000 individuals.

    PubMed

    Liu, Dajiang J; Peloso, Gina M; Yu, Haojie; Butterworth, Adam S; Wang, Xiao; Mahajan, Anubha; Saleheen, Danish; Emdin, Connor; Alam, Dewan; Alves, Alexessander Couto; Amouyel, Philippe; Di Angelantonio, Emanuele; Arveiler, Dominique; Assimes, Themistocles L; Auer, Paul L; Baber, Usman; Ballantyne, Christie M; Bang, Lia E; Benn, Marianne; Bis, Joshua C; Boehnke, Michael; Boerwinkle, Eric; Bork-Jensen, Jette; Bottinger, Erwin P; Brandslund, Ivan; Brown, Morris; Busonero, Fabio; Caulfield, Mark J; Chambers, John C; Chasman, Daniel I; Chen, Y Eugene; Chen, Yii-Der Ida; Chowdhury, Rajiv; Christensen, Cramer; Chu, Audrey Y; Connell, John M; Cucca, Francesco; Cupples, L Adrienne; Damrauer, Scott M; Davies, Gail; Deary, Ian J; Dedoussis, George; Denny, Joshua C; Dominiczak, Anna; Dubé, Marie-Pierre; Ebeling, Tapani; Eiriksdottir, Gudny; Esko, Tõnu; Farmaki, Aliki-Eleni; Feitosa, Mary F; Ferrario, Marco; Ferrieres, Jean; Ford, Ian; Fornage, Myriam; Franks, Paul W; Frayling, Timothy M; Frikke-Schmidt, Ruth; Fritsche, Lars G; Frossard, Philippe; Fuster, Valentin; Ganesh, Santhi K; Gao, Wei; Garcia, Melissa E; Gieger, Christian; Giulianini, Franco; Goodarzi, Mark O; Grallert, Harald; Grarup, Niels; Groop, Leif; Grove, Megan L; Gudnason, Vilmundur; Hansen, Torben; Harris, Tamara B; Hayward, Caroline; Hirschhorn, Joel N; Holmen, Oddgeir L; Huffman, Jennifer; Huo, Yong; Hveem, Kristian; Jabeen, Sehrish; Jackson, Anne U; Jakobsdottir, Johanna; Jarvelin, Marjo-Riitta; Jensen, Gorm B; Jørgensen, Marit E; Jukema, J Wouter; Justesen, Johanne M; Kamstrup, Pia R; Kanoni, Stavroula; Karpe, Fredrik; Kee, Frank; Khera, Amit V; Klarin, Derek; Koistinen, Heikki A; Kooner, Jaspal S; Kooperberg, Charles; Kuulasmaa, Kari; Kuusisto, Johanna; Laakso, Markku; Lakka, Timo; Langenberg, Claudia; Langsted, Anne; Launer, Lenore J; Lauritzen, Torsten; Liewald, David C M; Lin, Li An; Linneberg, Allan; Loos, Ruth J F; Lu, Yingchang; Lu, Xiangfeng; Mägi, Reedik; Malarstig, Anders; Manichaikul, Ani; Manning, Alisa K; Mäntyselkä, Pekka; Marouli, Eirini; Masca, Nicholas G D; Maschio, Andrea; Meigs, James B; Melander, Olle; Metspalu, Andres; Morris, Andrew P; Morrison, Alanna C; Mulas, Antonella; Müller-Nurasyid, Martina; Munroe, Patricia B; Neville, Matt J; Nielsen, Jonas B; Nielsen, Sune F; Nordestgaard, Børge G; Ordovas, Jose M; Mehran, Roxana; O'Donnell, Christoper J; Orho-Melander, Marju; Molony, Cliona M; Muntendam, Pieter; Padmanabhan, Sandosh; Palmer, Colin N A; Pasko, Dorota; Patel, Aniruddh P; Pedersen, Oluf; Perola, Markus; Peters, Annette; Pisinger, Charlotta; Pistis, Giorgio; Polasek, Ozren; Poulter, Neil; Psaty, Bruce M; Rader, Daniel J; Rasheed, Asif; Rauramaa, Rainer; Reilly, Dermot F; Reiner, Alex P; Renström, Frida; Rich, Stephen S; Ridker, Paul M; Rioux, John D; Robertson, Neil R; Roden, Dan M; Rotter, Jerome I; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J; Sanna, Serena; Sattar, Naveed; Schmidt, Ellen M; Scott, Robert A; Sever, Peter; Sevilla, Raquel S; Shaffer, Christian M; Sim, Xueling; Sivapalaratnam, Suthesh; Small, Kerrin S; Smith, Albert V; Smith, Blair H; Somayajula, Sangeetha; Southam, Lorraine; Spector, Timothy D; Speliotes, Elizabeth K; Starr, John M; Stirrups, Kathleen E; Stitziel, Nathan; Strauch, Konstantin; Stringham, Heather M; Surendran, Praveen; Tada, Hayato; Tall, Alan R; Tang, Hua; Tardif, Jean-Claude; Taylor, Kent D; Trompet, Stella; Tsao, Philip S; Tuomilehto, Jaakko; Tybjaerg-Hansen, Anne; van Zuydam, Natalie R; Varbo, Anette; Varga, Tibor V; Virtamo, Jarmo; Waldenberger, Melanie; Wang, Nan; Wareham, Nick J; Warren, Helen R; Weeke, Peter E; Weinstock, Joshua; Wessel, Jennifer; Wilson, James G; Wilson, Peter W F; Xu, Ming; Yaghootkar, Hanieh; Young, Robin; Zeggini, Eleftheria; Zhang, He; Zheng, Neil S; Zhang, Weihua; Zhang, Yan; Zhou, Wei; Zhou, Yanhua; Zoledziewska, Magdalena; Howson, Joanna M M; Danesh, John; McCarthy, Mark I; Cowan, Chad A; Abecasis, Goncalo; Deloukas, Panos; Musunuru, Kiran; Willer, Cristen J; Kathiresan, Sekar

    2017-12-01

    We screened variants on an exome-focused genotyping array in >300,000 participants (replication in >280,000 participants) and identified 444 independent variants in 250 loci significantly associated with total cholesterol (TC), high-density-lipoprotein cholesterol (HDL-C), low-density-lipoprotein cholesterol (LDL-C), and/or triglycerides (TG). At two loci (JAK2 and A1CF), experimental analysis in mice showed lipid changes consistent with the human data. We also found that: (i) beta-thalassemia trait carriers displayed lower TC and were protected from coronary artery disease (CAD); (ii) excluding the CETP locus, there was not a predictable relationship between plasma HDL-C and risk for age-related macular degeneration; (iii) only some mechanisms of lowering LDL-C appeared to increase risk for type 2 diabetes (T2D); and (iv) TG-lowering alleles involved in hepatic production of TG-rich lipoproteins (TM6SF2 and PNPLA3) tracked with higher liver fat, higher risk for T2D, and lower risk for CAD, whereas TG-lowering alleles involved in peripheral lipolysis (LPL and ANGPTL4) had no effect on liver fat but decreased risks for both T2D and CAD.

  10. Effects of acute exercise on postprandial triglyceride response after a high fat meal in overweight black and white adolescents

    PubMed Central

    Lee, SoJung; Burns, Stephen F.; White, David; Kuk, Jennifer L.; Arslanian, Silva

    2014-01-01

    Objective We examined the effects of acute exercise on postprandial triglyceride (TG) metabolism following a high fat meal in overweight black vs. white adolescents. Design and Subjects Twenty-one black and 17 white adolescents (12-18 yrs, BMI >85th percentile) were evaluated twice, during control versus exercise trials, 1-4 weeks apart, in a counterbalanced randomized design. In the control trial, participants performed no exercise on day 1. In the exercise trial, participants performed a single bout of 60 min exercise (50% VO2peak) on a cycle ergometer on day 1. On day 2 of both trials, participants consumed a high-fat breakfast (70% calories from fat) and blood was sampled for TG concentration in the fasted state and for 6 hrs postprandially. Results There was a significant main effect of condition on postprandial peak TG concentration (P=0.01) and TG-area under the curve (AUC) (P=0.003), suggesting that independent of race, peak TG and TG-AUC was lower in the exercise trial vs. control trial. Including Tanner stage, gender, total fat (kg) and VAT as independent variables, stepwise multiple regression analyses revealed that in whites, VAT was the strongest (P<0.05) predictor of postprandial TG-AUC explaining 56% and 25% of the variances in TG-AUC in the control and exercise trials, respectively. In blacks, VAT was not associated with postprandial TG-AUC independent of trial. Conclusion A single bout of aerobic exercise preceding a high fat meal is beneficial to reduce postprandial TG concentrations in overweight white adolescents to a greater extent than black adolescents, particularly those with increased visceral adiposity. PMID:23507997

  11. Effects of acute exercise on postprandial triglyceride response after a high-fat meal in overweight black and white adolescents.

    PubMed

    Lee, S; Burns, S F; White, D; Kuk, J L; Arslanian, S

    2013-07-01

    We examined the effects of acute exercise on postprandial triglyceride (TG) metabolism following a high-fat meal in overweight black vs white adolescents. Twenty-one black and 17 white adolescents (12-18 yrs, body mass index 85th percentile) were evaluated twice, during control versus exercise trials, 1-4 weeks apart, in a counterbalanced randomized design. In the control trial, participants performed no exercise on day 1. In the exercise trial, participants performed a single bout of 60-min exercise (50% VO2 peak) on a cycle ergometer on day 1. On day 2 of both trials, participants consumed a high-fat breakfast (70% calories from fat) and blood was sampled for TG concentration in the fasted state and for 6 h postprandially. There was a significant main effect of condition on postprandial peak TG concentration (P=0.01) and TG area under the curve (AUC) (P=0.003), suggesting that independent of race, peak TG and TG-AUC was lower in the exercise trial vs control trial. Including Tanner stage, gender, total fat (kg) and visceral adipose tissue (VAT) as independent variables, stepwise multiple regression analyses revealed that in whites, VAT was the strongest (P<0.05) predictor of postprandial TG-AUC, explaining 56 and 25% of the variances in TG-AUC in the control and exercise trials, respectively. In blacks, VAT was not associated with postprandial TG-AUC, independent of trial. A single bout of aerobic exercise preceding a high-fat meal is beneficial to reduce postprandial TG concentrations in overweight white adolescents to a greater extent than black adolescents, particularly those with increased visceral adiposity.

  12. The triglyceride-to-HDL cholesterol ratio: association with insulin resistance in obese youths of different ethnic backgrounds.

    PubMed

    Giannini, Cosimo; Santoro, Nicola; Caprio, Sonia; Kim, Grace; Lartaud, Derek; Shaw, Melissa; Pierpont, Bridget; Weiss, Ram

    2011-08-01

    We evaluated whether the triglyceride-to-HDL cholesterol (TG/HDL-C) ratio is associated with insulin resistance (IR) in a large multiethnic cohort of obese youths. Obese youths (1,452) had an oral glucose tolerance test and a fasting lipid profile. Insulin sensitivity was estimated using the whole body insulin sensitivity index (WBISI) and homeostasis model assessment (HOMA)-IR and evaluated, in a subgroup of 146 obese youths, by the hyperinsulinemic-euglycemic clamp. The cohort was divided by ethnicity (612 whites, 357 Hispanics, and 483 African Americans) and then stratified into ethnicity-specific tertiles of TG/HDL-C ratio. Differences across tertiles were evaluated, and the association between the TG/HDL-C ratio and insulin sensitivity (WBISI) was defined by a multiple stepwise linear regression analysis. The area under the receiver operating characteristic (ROC) curve (AUC) was determined to calculate the TG/HDL-C ratio cutoff to identify insulin-resistant subjects by ethnicity. In each ethnic group and across rising tertiles of TG/HDL-C ratio, insulin sensitivity (WBISI) progressively decreased, whereas 2-h glucose and the AUC-glucose progressively increased. The cutoff for TG/HDL-C ratio was 2.27, and the odds of presenting with IR, in youths with TG/HDL-C ratio higher than the cutoff, was 6.023 (95% CI 2.798-12.964; P < 0.001) in white girls and boys, whereas for both Hispanics and African Americans the AUC-ROCs were not significant, thus not allowing the calculation of an optimal cutoff TG/HDL-C value. The TG/HDL-C ratio is associated with IR mainly in white obese boys and girls and thus may be used with other risk factors to identify subjects at increased risk of IR-driven morbidity.

  13. Association between triglyceride to HDL-C ratio and insulin resistance in indigenous Argentinean children.

    PubMed

    Hirschler, V; Maccallini, G; Sanchez, M; Gonzalez, C; Molinari, C

    2015-12-01

    Insulin resistance is considered one of the major risk factors for the development of type 2 diabetes mellitus (T2DM). Thus, early identification, preferably by using simple and inexpensive diagnostic tools, is essential for preventing T2DM. Triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) has been proposed as an inexpensive tool to identify individuals at high risk of T2DM. The objective of this study was to determine the relationship between insulin resistance and TG/HDL-C in indigenous Argentinean children. A cross-sectional study of 501 (243 boys) indigenous school children aged 10.0 ± 2.4 yr were assessed for anthropometry, lipids, glucose, and insulin levels from November 2011 to November 2013. Insulin resistance was defined as the upper third quartile of homeostasis model assessment (HOMA-IR). The prevalence of overweight/obesity was 11.4% per Centers for Disease Control. Mean levels of various characteristics were: body mass index (BMI) 17.2 ± 2.6, HDL-C 39 ± 9 mg/dL, TGs 121 ± 58 mg/dL, TG/HDL-C 2.9 ± 1.8, glucose 77 ± 8 mg/dL, HOMA-IR 1.0 ± 0.8, and insulin 44 ± 9 mUI/L. Children in the higher quartiles of TG/HDL-C had significantly higher HOMA-IR values than children in the lower quartiles. Multiple linear regression analysis showed that TG/HDL-C was significantly associated with HOMA-IR (r² = 0.19) adjusted for age, gender, and BMI. Furthermore, for a 1-unit increase in log TG/HDL-C, the odds of being insulin resistant (HOMA-IR>III quartile) increased by 2.58 times [odds ratio (OR), 2.58 (1.63-4.05); p < 0.01], adjusted for age, gender, and BMI. This study suggests that TG/HDL-C may be a good marker to identify insulin resistant indigenous Argentinean children. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Comparative effectiveness of fish oil versus fenofibrate, gemfibrozil, and atorvastatin on lowering triglyceride levels among HIV-infected patients in routine clinical care.

    PubMed

    Muñoz, Monica A; Liu, Wei; Delaney, Joseph A C; Brown, Elizabeth; Mugavero, Michael J; Mathews, W Chris; Napravnik, Sonia; Willig, James H; Eron, Joseph J; Hunt, Peter W; Kahn, James O; Saag, Michael S; Kitahata, Mari M; Crane, Heidi M

    2013-11-01

    The goal of this study was to compare the effectiveness of fish oil, fenofibrate, gemfibrozil, and atorvastatin on reducing triglyceride (TG) levels among a large cohort of HIV-infected patients in clinical care. Retrospective observational cohort study. The primary endpoint was absolute change in TG levels measured using the last TG value pretreatment and the first TG value posttreatment. A pre-post quasi-experimental design was used to estimate the change in TG because of initiating fish oil. Linear regression models examined the comparative effectiveness of treatment with fish oil versus gemfibrozil, fenofibrate, or atorvastatin for TG reduction. Models were adjusted for baseline differences in age, sex, race, CD4⁺ cell count, diabetes, body mass index, protease inhibitor use, and time between TG measures. A total of 493 patients (mean age, 46 years; 95% male) were included (46 patients receiving gemfibrozil; 80, fenofibrate; 291, atorvastatin; and 76, fish oil) with a mean baseline TG of 347 mg/dL. New use of fish oil decreased TGTG, -45 mg/dL; 95% confidence interval (CI): -80 to -11] in the pre-post study. Compared with fish oil (reference), fibrates were more effective (ΔTG, -66; 95% CI: -120 to -12) in reducing TG levels, whereas atorvastatin was not (ΔTG, -39; 95% CI: -86 to 9). In HIV-infected patients in routine clinical care, fish oil is less effective than fibrates (but not atorvastatin) at lowering TG values. Fish oil may still represent an attractive alternative for patients with moderately elevated TGs, particularly among patients who may not want or tolerate fibrates.

  15. Imaging of Cerebral Amyloid Angiopathy with Bivalent 99mTc-Hydroxamamide Complexes

    NASA Astrophysics Data System (ADS)

    Iikuni, Shimpei; Ono, Masahiro; Watanabe, Hiroyuki; Matsumura, Kenji; Yoshimura, Masashi; Kimura, Hiroyuki; Ishibashi-Ueda, Hatsue; Okamoto, Yoko; Ihara, Masafumi; Saji, Hideo

    2016-05-01

    Cerebral amyloid angiopathy (CAA), characterized by the deposition of amyloid aggregates in the walls of cerebral vasculature, is a major factor in intracerebral hemorrhage and vascular cognitive impairment and is also associated closely with Alzheimer’s disease (AD). We previously reported 99mTc-hydroxamamide (99mTc-Ham) complexes with a bivalent amyloid ligand showing high binding affinity for β-amyloid peptide (Aβ(1-42)) aggregates present frequently in the form in AD. In this article, we applied them to CAA-specific imaging probes, and evaluated their utility for CAA-specific imaging. In vitro inhibition assay using Aβ(1-40) aggregates deposited mainly in CAA and a brain uptake study were performed for 99mTc-Ham complexes, and all 99mTc-Ham complexes with an amyloid ligand showed binding affinity for Aβ(1-40) aggregates and very low brain uptake. In vitro autoradiography of human CAA brain sections and ex vivo autoradiography of Tg2576 mice were carried out for bivalent 99mTc-Ham complexes ([99mTc]SB2A and [99mTc]BT2B), and they displayed excellent labeling of Aβ depositions in human CAA brain sections and high affinity and selectivity to CAA in transgenic mice. These results may offer new possibilities for the development of clinically useful CAA-specific imaging probes based on the 99mTc-Ham complex.

  16. Imaging of Cerebral Amyloid Angiopathy with Bivalent (99m)Tc-Hydroxamamide Complexes.

    PubMed

    Iikuni, Shimpei; Ono, Masahiro; Watanabe, Hiroyuki; Matsumura, Kenji; Yoshimura, Masashi; Kimura, Hiroyuki; Ishibashi-Ueda, Hatsue; Okamoto, Yoko; Ihara, Masafumi; Saji, Hideo

    2016-05-16

    Cerebral amyloid angiopathy (CAA), characterized by the deposition of amyloid aggregates in the walls of cerebral vasculature, is a major factor in intracerebral hemorrhage and vascular cognitive impairment and is also associated closely with Alzheimer's disease (AD). We previously reported (99m)Tc-hydroxamamide ((99m)Tc-Ham) complexes with a bivalent amyloid ligand showing high binding affinity for β-amyloid peptide (Aβ(1-42)) aggregates present frequently in the form in AD. In this article, we applied them to CAA-specific imaging probes, and evaluated their utility for CAA-specific imaging. In vitro inhibition assay using Aβ(1-40) aggregates deposited mainly in CAA and a brain uptake study were performed for (99m)Tc-Ham complexes, and all (99m)Tc-Ham complexes with an amyloid ligand showed binding affinity for Aβ(1-40) aggregates and very low brain uptake. In vitro autoradiography of human CAA brain sections and ex vivo autoradiography of Tg2576 mice were carried out for bivalent (99m)Tc-Ham complexes ([(99m)Tc]SB2A and [(99m)Tc]BT2B), and they displayed excellent labeling of Aβ depositions in human CAA brain sections and high affinity and selectivity to CAA in transgenic mice. These results may offer new possibilities for the development of clinically useful CAA-specific imaging probes based on the (99m)Tc-Ham complex.

  17. Intraduodenal infusion of cyanidin-3-glucoside transiently promotes triglyceride excretion into bile in rats.

    PubMed

    Hashimoto, Naoto; Han, Kyu-Ho; Fukushima, Michihiro

    2017-02-01

    Flavonoids purportedly have a role in improving lipid metabolism. In our preliminary study, highly concentrated flavonoid metabolites appeared in bile juice in rats, which also contains various lipids. Biliary flavonoid metabolites generally have amphiphilic properties, may influence lipid solubility, and possibly contribute to the improvement of dyslipidemia. However, the influence of biliary flavonoid metabolites on the biliary lipid profile is not well known. Therefore, we hypothesized that the amphiphilic property of biliary flavonoid metabolites alters biliary lipid profiles. To estimate the influence of flavonoids on the biliary lipid profile, we laparotomized rats under anesthesia, intraduodenally injected them with cyanidin-3-glucoside chloride (C3G) or quercetin, and analyzed their biliary metabolite concentrations for 2 hours. Concentrations of C3G and quercetin metabolites peaked at 30 minutes after the injection; those of quercetin were 6 to 10 times higher than those of C3G throughout the sampling period up to 2 hours. Biliary triglyceride (TG) concentrations were higher in the C3G group at 30 and 45 minutes; biliary cholesterol and phospholipid concentrations were lower in the quercetin group at 30 minutes than those in the control group. Hepatic TG content after the 2-hour sampling was lower in the C3G group than in the control group. These results suggest that C3G, but not quercetin, may transiently promote TG excretion into bile, with a reduction in hepatic TG content. This C3G effect may be involved in improvement of TG metabolism. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. APOA5 and APOA1 polymorphisms are associated with triglyceride levels in Mexican children.

    PubMed

    Suárez-Sánchez, F; Klunder-Klunder, M; Valladares-Salgado, A; Gómez-Zamudio, J; Peralta-Romero, J; Meyre, D; Burguete-García, A; Cruz, M

    2017-08-01

    Dyslipidemia is an important risk factor for the development of several diseases. The genetic component of hypertriglyceridemia has been studied in adults, but little is known in children. The objective is to evaluate the association of two variants in APOA5 (rs662799) and APOA1 (rs5072) with triglyceride (TG) levels in Mexican children. Anthropometric parameters were measured in 1559 Mexican children 5-14 years of age. DNA was isolated from blood samples. Lipid profiles and glucose concentrations were determined from serum and genotyping of rs662799, and rs5072 was performed using TaqMan® technology. Additive and dominant models adjusted for age, gender and body mass index were used to evaluate the association of these single nucleotide polymorphisms with TG levels. Children with high TG levels were found to have a higher body mass index and waist circumference as well as a worse lipids profile and glucose levels (p < 0.001). Additive and dominant models demonstrated a significant association between the rs662799 and rs5072 with TG. The dominant model showed the strongest significant association (OR = 1.81; 95% CI 1.46-2.24; p = 5.40 × 10 -08 for rs662799 and OR = 1.54; 95% CI 1.05-2.25; p = 2.60 × 10 -02 for rs5072). The minor alleles of rs662799 (APOA5) and rs5072 (APOA1) modulate TG levels in Mexican children. © 2016 World Obesity Federation.

  19. The Triglyceride to HDL Ratio and Its Relationship to Insulin Resistance in Pre- and Postpubertal Children: Observation from the Wausau SCHOOL Project

    PubMed Central

    Olson, Karen; Hendricks, Bryan; Murdock, David K.

    2012-01-01

    Insulin resistance (IR) is a risk factor for ischemic heart disease and diabetes and raises the triglyceride/high-density lipoprotein (TG/HDL) ratio in adults, but is not well defined in children. Purpose. To investigate the TG/HDL ratios in children as an IR marker. Methods. Wausau SCHOOL Project assessed 99 prepubertal and 118 postpubertal children. The TG/HDL ratio was correlated with numerous risk factors. Results. TG/HDL ratio was significantly correlated with QUICKI, HOMA-IR, zBMI, waist-to hip ratio, systolic and diastolic BP, LDL size and LDL number. A group of 32 IR children (HOMA-IR > 1 SD from the mean, i.e., >2.45) had significantly higher TG/HDL (3.11 ± 1.77) compared to non-IR children (1.86 ± 0.75). A TG/HDL ratio of ≥2.0 identified 32 of the 40 children deemed IR by HOMA-IR (>2.45) with a sensitivity of 0.80 and a specificity of 0.66. Children with TG/HDL ratio ≥3 were heavier and had higher BP, glucose, HOMA-IR, LDL number, and lower HDL level, QUICKI, and LDL size, regardless of pubertal status. Conclusion. The TG/HDL ratio is strongly associated with IR in children, and with higher BMI, waist hip ratio, BP, and more athrogenic lipid profile. PMID:22811895

  20. The Triglyceride to HDL Ratio and Its Relationship to Insulin Resistance in Pre- and Postpubertal Children: Observation from the Wausau SCHOOL Project.

    PubMed

    Olson, Karen; Hendricks, Bryan; Murdock, David K

    2012-01-01

    Insulin resistance (IR) is a risk factor for ischemic heart disease and diabetes and raises the triglyceride/high-density lipoprotein (TG/HDL) ratio in adults, but is not well defined in children. Purpose. To investigate the TG/HDL ratios in children as an IR marker. Methods. Wausau SCHOOL Project assessed 99 prepubertal and 118 postpubertal children. The TG/HDL ratio was correlated with numerous risk factors. Results. TG/HDL ratio was significantly correlated with QUICKI, HOMA-IR, zBMI, waist-to hip ratio, systolic and diastolic BP, LDL size and LDL number. A group of 32 IR children (HOMA-IR > 1 SD from the mean, i.e., >2.45) had significantly higher TG/HDL (3.11 ± 1.77) compared to non-IR children (1.86 ± 0.75). A TG/HDL ratio of ≥2.0 identified 32 of the 40 children deemed IR by HOMA-IR (>2.45) with a sensitivity of 0.80 and a specificity of 0.66. Children with TG/HDL ratio ≥3 were heavier and had higher BP, glucose, HOMA-IR, LDL number, and lower HDL level, QUICKI, and LDL size, regardless of pubertal status. Conclusion. The TG/HDL ratio is strongly associated with IR in children, and with higher BMI, waist hip ratio, BP, and more athrogenic lipid profile.

  1. Triglycerides-to-HDL cholesterol ratio as screening tool for impaired glucose tolerance in obese children and adolescents.

    PubMed

    Manco, Melania; Grugni, Graziano; Di Pietro, Mario; Balsamo, Antonio; Di Candia, Stefania; Morino, Giuseppe Stefano; Franzese, Adriana; Di Bonito, Procolo; Maffeis, Claudio; Valerio, Giuliana

    2016-06-01

    To identify metabolic phenotypes at increased risk of impaired glucose tolerance (IGT) in Italian overweight/obese children (n = 148, age 5-10 years) and adolescents (n = 531, age 10-17.9 year). Phenotypes were defined as follows: obesity by the 95th cut-points of the Center for Disease Control body mass index reference standards, impaired fasting glucose (fasting plasma glucose ≥100 mg/dl), high circulating triglycerides (TG), TG/HDL cholesterol ≥2.2, waist-to-height ratio (WTHR) >0.6, and combination of the latter with high TG or TG/HDL cholesterol ≥2.2. In the 148 obese children, TG/HDL-C ≥ 2.2 (OR 20.19; 95 % CI 2.50-163.28, p = 0.005) and the combination of TG/HDL-C ≥ 2.2 and WTHR > 0.60 (OR 14.97; 95 % CI 2.18-102.76, p = 0.006) were significantly associated with IGT. In the 531 adolescents, TG/HDL-C ≥ 2.2 (OR 1.991; 95 % CI 1.243-3.191, p = 0.004) and the combination with WTHR > 0.60 (OR 2.24; 95 % CI 1.29-3.87, p = 0.004) were associated with significantly increased risk of IGT. In the whole sample, having high TG levels according to the NIH National Heart, Lung and Blood Institute Expert Panel was not associated with an increased risk of presenting IGT. TG/HDL-C ratio can be useful, particularly in children, to identify obese young patients at risk of IGT. Its accuracy as screening tool in a general population needs to be verified. The combination of TG/HDL-C ratio and WTHR > 0.6 did not improve prediction. Having high TG according to the NIH definition was not associated with increased risk of developing IGT.

  2. Reduced Triglyceride Secretion in Response to an Acute Dietary Fat Challenge in Obese Compared to Lean Mice

    PubMed Central

    Uchida, Aki; Whitsitt, Mary C.; Eustaquio, Trisha; Slipchenko, Mikhail N.; Leary, James F.; Cheng, Ji-Xin; Buhman, Kimberly K.

    2012-01-01

    Obesity results in abnormally high levels of triglyceride (TG) storage in tissues such as liver, heart, and muscle, which disrupts their normal functions. Recently, we found that lean mice challenged with high levels of dietary fat store TGs in cytoplasmic lipid droplets in the absorptive cells of the intestine, enterocytes, and that this storage increases and then decreases over time after an acute dietary fat challenge. The goal of this study was to investigate the effects of obesity on intestinal TG metabolism. More specifically we asked whether TG storage in and secretion from the intestine are altered in obesity. We investigated these questions in diet-induced obese (DIO) and leptin-deficient (ob/ob) mice. We found greater levels of TG storage in the intestine of DIO mice compared to lean mice in the fed state, but similar levels of TG storage after a 6-h fast. In addition, we found similar TG storage in the intestine of lean and DIO mice at multiple time points after an acute dietary fat challenge. Surprisingly, we found remarkably lower TG secretion from both DIO and ob/ob mice compared to lean controls in response to an acute dietary fat challenge. Furthermore, we found altered mRNA levels for genes involved in regulation of intestinal TG metabolism in lean and DIO mice at 6 h fasting and in response to an acute dietary fat challenge. More specifically, we found that many of the genes related to TG synthesis, chylomicron synthesis, TG storage, and lipolysis were induced in response to an acute dietary fat challenge in lean mice, but this induction was not observed in DIO mice. In fact, we found a significant decrease in intestinal mRNA levels of genes related to lipolysis and fatty acid oxidation in DIO mice in response to an acute dietary fat challenge. Our findings demonstrate altered TG handling by the small intestine of obese compared to lean mice. PMID:22375122

  3. Triglycerides Revisited to the Serial.

    PubMed

    Viecili, Paulo Ricardo Nazário; da Silva, Brenda; Hirsch, Gabriela E; Porto, Fernando G; Parisi, Mariana M; Castanho, Alison R; Wender, Michele; Klafke, Jonatas Z

    This review discusses the role of triglycerides (TGs) in the normal cardiovascular system as well as in the development and clinical manifestation of cardiovascular diseases. Regulation of TGs at the enzymatic and genetic level, in addition to their possible relevance as preclinical and clinical biomarkers, is discussed, culminating with a description of available and emerging treatments. Due to the high complexity of the subject and the vast amount of material in the literature, the objective of this review was not to exhaust the subject, but rather to compile the information to facilitate and improve the understanding of those interested in this topic. The main publications on the topic were sought out, especially those from the last 5 years. The data in the literature still give reason to believe that there is room for doubt regarding the use of TG as disease biomarkers; however, there is increasing evidence for the role of hypertriglyceridemia on the atherosclerotic inflammatory process, cardiovascular outcomes, and mortality. © 2017 Elsevier Inc. All rights reserved.

  4. Triglyceride associated polymorphisms of the APOA5 gene have very different allele frequencies in Pune, India compared to Europeans

    PubMed Central

    Chandak, Giriraj R; Ward, Kirsten J; Yajnik, Chittaranjan S; Pandit, Anand N; Bavdekar, Ashish; Joglekar, Charu V; Fall, Caroline HD; Mohankrishna, P; Wilkin, Terence J; Metcalf, Bradley S; Weedon, Michael N; Frayling, Timothy M; Hattersley, Andrew T

    2006-01-01

    Background The APOA5 gene variants, -1131T>C and S19W, are associated with altered triglyceride concentrations in studies of subjects of Caucasian and East Asian descent. There are few studies of these variants in South Asians. We investigated whether the two APOA5 variants also show similar association with various lipid parameters in Indian population as in the UK white subjects. Methods We genotyped 557 Indian adults from Pune, India, and 237 UK white adults for -1131T>C and S19W variants in the APOA5 gene, compared their allelic and genotype frequency and determined their association with fasting serum triglycerides, total cholesterol, HDL and LDL cholesterol levels using univariate general linear analysis. APOC3 SstI polymorphism was also analyzed in 175 Pune Indian subjects for analysis of linkage disequilibrium with the APOA5 variants. Results The APOA5 -1131C allele was more prevalent in Indians from Pune (Pune Indians) compared to UK white subjects (allele frequency 20% vs. 4%, p = 0.00001), whereas the 19W allele was less prevalent (3% vs. 6% p = 0.0015). Patterns of linkage disequilibrium between the two variants were similar between the two populations and confirmed that they occur on two different haplotypes. In Pune Indians, the presence of -1131C allele and the 19W allele was associated with a 19% and 15% increase respectively in triglyceride concentrations although only -1131C was significant (p = 0.0003). This effect size was similar to that seen in the UK white subjects. Analysis of the APOC3 SstI polymorphism in 175 Pune Indian subjects showed that this variant is not in appreciable linkage disequilibrium with the APOA5 -1131T>C variant (r2 = 0.07). Conclusion This is the first study to look at the role of APOA5 in Asian Indian subjects that reside in India. The -1131C allele is more prevalent and the 19W allele is less prevalent in Pune Indians compared to UK Caucasians. We confirm that the APOA5 variants are associated with triglyceride levels

  5. Triglycerides to High-Density Lipoprotein Cholesterol Ratio Can Predict Impaired Glucose Tolerance in Young Women with Polycystic Ovary Syndrome

    PubMed Central

    Song, Do Kyeong; Lee, Hyejin; Sung, Yeon-Ah

    2016-01-01

    Purpose The triglycerides to high-density lipoprotein cholesterol (TG/HDL-C) ratio could be related to insulin resistance (IR). We previously reported that Korean women with polycystic ovary syndrome (PCOS) had a high prevalence of impaired glucose tolerance (IGT). We aimed to determine the cutoff value of the TG/HDL-C ratio for predicting IR and to examine whether the TG/HDL-C ratio is useful for identifying individuals at risk of IGT in young Korean women with PCOS. Materials and Methods We recruited 450 women with PCOS (24±5 yrs) and performed a 75-g oral glucose tolerance test (OGTT). IR was assessed by a homeostasis model assessment index over that of the 95th percentile of regular-cycling women who served as the controls (n=450, 24±4 yrs). Results The cutoff value of the TG/HDL-C ratio for predicting IR was 2.5 in women with PCOS. Among the women with PCOS who had normal fasting glucose (NFG), the prevalence of IGT was significantly higher in the women with PCOS who had a high TG/HDL-C ratio compared with those with a low TG/HDL-C ratio (15.6% vs. 5.6%, p<0.05). Conclusion The cutoff value of the TG/HDL-C ratio for predicting IR was 2.5 in young Korean women with PCOS, and women with NFG and a high TG/HDL-C ratio had a higher prevalence of IGT. Therefore, Korean women with PCOS with a TG/HDL-C ratio >2.5 are recommended to be administered an OGTT to detect IGT even if they have NFG. PMID:27593868

  6. Triglyceride to High-Density Lipoprotein Cholesterol Ratio Predicts Cardiovascular Outcomes in Prevalent Dialysis Patients

    PubMed Central

    Chen, Hung-Yuan; Tsai, Wan-Chuan; Chiu, Yen-Ling; Hsu, Shih-Ping; Pai, Mei-Fen; Yang, Ju-Yeh; Peng, Yu-Sen

    2015-01-01

    Abstract Triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio, an indicator of atherogenic dyslipidemia, is a predictor of cardiovascular (CV) outcomes in the general population and has been correlated with atherosclerotic events. Whether the TG/HDL-C ratio can predict CV outcomes and survival in dialysis patients is unknown. We performed this prospective, observational cohort study and enrolled 602 dialysis patients (539 hemodialysis and 63 peritoneal dialysis) from a single center in Taiwan followed up for a median of 3.9 years. The outcomes were the occurrence of CV events, CV death, and all-cause mortality during follow-up. The association of baseline TG/HDL-C ratio with outcomes was explored with Cox regression models, which were adjusted for demographic parameters and inflammatory/nutritional markers. Overall, 203 of the patients experienced CV events and 169 patients died, of whom 104 died due to CV events. Two hundred fifty-four patients reached the composite CV outcome. Patients with higher TG/HDL-C levels (quintile 5) had a higher incidence of CV events (adjusted hazard ratio [HR] 2.03, 95% confidence interval [CI] 1.19–3.47), CV mortality (adjusted HR 1.91, 95% CI 1.07–3.99), composite CV outcome (adjusted HR 2.2, 95% CI 1.37–3.55), and all-cause mortality (adjusted HR 1.94, 95% CI 1.1–3.39) compared with the patients in quintile 1. However, in diabetic dialysis patients, the TG/HDL-C ratio did not predict the outcomes. The TG/HDL-C ratio is a reliable and easily accessible predictor to evaluate CV outcomes and survival in prevalent nondiabetic dialysis patients. ClinicalTrials.gov: NCT01457625 PMID:25761189

  7. TriGlycerides and high-density lipoprotein cholesterol ratio compared with homeostasis model assessment insulin resistance indexes in screening for metabolic syndrome in the chinese obese children: a cross section study.

    PubMed

    Liang, Jianfeng; Fu, Junfen; Jiang, Youyun; Dong, Guanping; Wang, Xiumin; Wu, Wei

    2015-09-28

    Metabolic Syndrome (MS) is prevalant in China, especially according to the pediatric obesity group. Based on the MS-CHN2012 definition for Chinese children and adolescents the need to explore and establish a convienent MS screening become imminent. This study aims to investigate the optimal cut-off values, compare the accuracy for the (TriGlycerides (TG) to High-Density Lipoprotein Cholesterol (HDL-C)) (TG/HDL-C) ratio and Homeostasis Model Assessment Insulin Resistance (HOMA-IR) indexs to identify Metabolic Syndrome in obese pediatric population in China. A total sample of 976 children (female 286 male 690, BMI > = 95 percentile) aged from 6-16 years underwent a medical assessment including a physical examination and investigations of total cholesterol, high-density lipoprotein, low-density lipoprotein, triglycerides, insulin, glucose, and oral glucose tolerance test to identify the components of Metabolic Syndrome. The validity and accuracy between TG/HDL-C ratio and HOMA-IR were compared by Receiver Operating Characteristics analysis (ROC). TG/HDL-C ratio achieved a larger ROC Area under Curve (AUC = 0.843) than HOMA-IR indexes (0.640, 0.625 for HOMA1-IR, HOMA2-IR respectively) to screen for Metabolic Syndrome. The cut-off values for MS were: TG/HDL-C ratio > 1.25 (sensitivity: 80%; specificity: 75%), HOMA1-IR > 4.59 (sensitivity: 58.7%; specificity: 65.5%) and HOMA2-IR > 2.76 (sensitivity: 53.2%; specificity: 69.5%). The results kept robust after stratified by gender, age group and pubertal stage. TG/HDL-C ratio was a better indicator than the HOMA-IR to screen for a positive diagnosis for MS. Furthermore, the TG/HDL-C ratio was superior to the HOMA-IR indexes even after the control of possible confusions from the gender, age group and puberty stage. TG/HDL-C ratio proved a better index than HOMA-IR in screening for MS in obese children and adolescents. TG/HDL-C ratio has a discriminatory power in detecting potential MS in the Chinese obese pediatric

  8. Triglyceride level

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003493.htm Triglyceride level To use the sharing features on this page, please enable JavaScript. The triglyceride level is a blood test to measure the amount ...

  9. A genome-wide association and gene-environment interaction study for serum triglycerides levels in a healthy Chinese male population.

    PubMed

    Tan, Aihua; Sun, Jielin; Xia, Ning; Qin, Xue; Hu, Yanling; Zhang, Shijun; Tao, Sha; Gao, Yong; Yang, Xiaobo; Zhang, Haiying; Kim, Seong-Tae; Peng, Tao; Lin, Xiaoling; Li, Li; Mo, Linjian; Liang, Zhengjia; Shi, Deyi; Huang, Zhang; Huang, Xianghua; Liu, Ming; Ding, Qiang; Trent, Jeffrey M; Zheng, S Lilly; Mo, Zengnan; Xu, Jianfeng

    2012-04-01

    Triglyceride (TG) is a complex phenotype influenced by both genetic and environmental factors. Recent genome-wide association studies (GWAS) have identified genes or loci affecting lipid levels; however, such studies in Chinese populations are limited. A two-stage GWAS were conducted to identify genetic variants that were associated with TG in a Chinese population of 3495 men. Gene-environment interactions on serum TG levels were further investigated for the seven single nucleotide polymorphisms (SNPs) that were studied in both stages. Two previously reported SNPs (rs651821 in APOA5, rs328 in LPL) were replicated in the second stage, and the combined P-values were 9.19 × 10(-26) and 1.41 × 10(-9) for rs651821 and rs328, respectively. More importantly, a significant interaction between aldehyde dehydrogenase 2 (ALDH2) rs671 and alcohol consumption on serum TG levels were observed (P = 3.34 × 10(-5)). Rs671 was significantly associated with serum TG levels in drinkers (P = 1.90 × 10(-10)), while no association was observed in non-drinkers (P > 0.05). For drinkers, men carrying the AA/AG genotype have significantly lower serum TG levels, compared with men carrying the GG genotype. For men with the GG genotype, the serum TG levels increased with the quantity of alcohol intake (P = 1.28 × 10(-8) for trend test). We identified a novel, significant interaction effect between alcohol consumption and the ALDH2 rs671 polymorphism on TG levels, which suggests that the effect of alcohol intake on TG occurs in a two-faceted manner. Just one drink can increase TG level in susceptible individuals who carry the GG genotype, while individuals carrying AA/AG genotypes may actually benefit from moderate drinking.

  10. The triglyceride to high-density lipoprotein ratio identifies children who may be at risk of developing cardiometabolic disease.

    PubMed

    Bailey, Daniel P; Savory, Louise A; Denton, Sarah J; Davies, Ben R; Kerr, Catherine J

    2014-08-01

    It is important to develop simple, reliable methods to identify high-risk individuals who may benefit from intervention. This study investigated the association between the triglyceride to high-density lipoprotein cholesterol (TG/HDL) ratio and cardiometabolic risk, cardiorespiratory fitness and physical activity in children. Anthropometric, biochemical parameters, cardiorespiratory fitness and accelerometry determined physical activity were assessed in 155 children (80 girls) from 10 to 14 years of age from Bedfordshire, UK. Participants were grouped into high and low TG/HDL ratio groups, according to published thresholds. MANCOVA and logistic regression were used in the analysis. Cardiometabolic risk factor levels were significantly higher in participants with a high TG/HDL ratio (p < 0.05). The odds of having high waist circumference (OR = 13.99; 95% CI 2.93, 69.25), elevated systolic blood pressure (5.27; 1.39, 20.01), high non-HDL cholesterol (19.47; 4.42, 85.81) and ≥2 cardiometabolic risk factors (15.32; 3.10, 75.79) were higher in participants with a high TG/HDL ratio. The TG/HDL ratio values were significantly lower in those with high cardiorespiratory fitness (p = 0.01), but there was no association with physical activity. These findings support the use of the TG/HDL ratio to identify children with cardiometabolic risk factors who may be at risk of developing cardiometabolic disease. ©2014 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  11. Triglyceride-based screening tests fail to recognize cardiometabolic disease in African immigrant and African-American men.

    PubMed

    Yu, Sophia S K; Ramsey, Natalie L M; Castillo, Darleen C; Ricks, Madia; Sumner, Anne E

    2013-02-01

    The prevalence of cardiometabolic disease in Africa now rivals that of Western nations. Therefore, screening programs that lead to effective prevention of cardiometabolic disease in Africans is imperative. Most screening tests for cardiometabolic disease use triglyceride (TG) levels as a criterion. However, the failure rate of TG-based screening tests in African Americans is high. In Africans, the efficacy of TG-based screening tests is unknown. Our goal was to determine the association between hypertriglyceridemia (TG ≥150 mg/dL) and cardiometabolic disease in African and African-American men. This was a cross-sectional study of 155 men (80 African immigrants, 75 African Americans) [age, 35±9 years, mean±standard deviation (SD), body mass index (BMI) 28.5±5.2 kg/m(2)] who self-identified as healthy. Lipid profiles were performed. Glucose tolerance and insulin resistance was determined by oral glucose tolerance tests (OGTT) and the insulin sensitivity index (S(I)), respectively. Cardiometabolic disease was defined by four possible subtypes--prediabetes, diabetes, insulin resistance, or metabolic triad [hyperinsulinemia, hyperapolipoprotein B, small low-density lipoprotein (LDL) particles]. TG levels were higher in men with cardiometabolic disease than without (88±43 versus 61±26 mg/dL, P<0.01). However, <10% of men with cardiometabolic disease had TG ≥150 mg/dL. Even within each cardiometabolic disease subtype, the prevalence of TG ≥150 mg/dL was <10%. Furthermore, TG levels in the 5% of men identified by OGTT as diabetic were ≤100 mg/dL (mean 71±24, range 45-100 mg/dL). Hypertriglyceridemia is a poor marker of cardiometabolic disease in men of African descent. Therefore TG-based screening tests fail to identify both African immigrants and African-American men with cardiometabolic disease. As a consequence, the opportunity for early intervention and prevention is lost.

  12. SCD1 activity in muscle increases triglyceride PUFA content, exercise capacity, and PPARδ expression in mice[S

    PubMed Central

    Rogowski, Michael P.; Flowers, Matthew T.; Stamatikos, Alexis D.; Ntambi, James M.; Paton, Chad M.

    2013-01-01

    Stearoyl-CoA desaturase (SCD)1 converts saturated fatty acids into monounsaturated fatty acids. Using muscle overexpression, we sought to determine the role of SCD1 expression in glucose and lipid metabolism and its effects on exercise capacity in mice. Wild-type C57Bl/6 (WT) and SCD1 muscle transgenic (SCD1-Tg) mice were generated, and expression of the SCD1 transgene was restricted to skeletal muscle. SCD1 overexpression was associated with increased triglyceride (TG) content. The fatty acid composition of the muscle revealed a significant increase in polyunsaturated fatty acid (PUFA) content of TG, including linoleate (18:2n6). Untrained SCD1-Tg mice also displayed significantly increased treadmill exercise capacity (WT = 6.6 ± 3 min, Tg = 71.9 ± 9.5 min; P = 0.0009). SCD1-Tg mice had decreased fasting plasma glucose, glucose transporter (GLUT)1 mRNA, fatty acid oxidation, mitochondrial content, and increased peroxisome proliferator-activated receptor (PPAR)δ and Pgc-1 protein expression in skeletal muscle. In vitro studies in C2C12 myocytes revealed that linoleate (18:2n6) and not oleate (18:1n9) caused a 3-fold increase in PPARδ and a 9-fold increase in CPT-1b with a subsequent increase in fat oxidation. The present model suggests that increasing delta-9 desaturase activity of muscle increases metabolic function, exercise capacity, and lipid oxidation likely through increased PUFA content, which increases PPARδ expression and activity. However, the mechanism of action that results in increased PUFA content of SCD1-Tg mice remains to be elucidated. PMID:23918045

  13. The effect of plant sterols on serum triglyceride concentrations is dependent on baseline concentrations: a pooled analysis of 12 randomised controlled trials.

    PubMed

    Demonty, Isabelle; Ras, Rouyanne T; van der Knaap, Henk C M; Meijer, Linsie; Zock, Peter L; Geleijnse, Johanna M; Trautwein, Elke A

    2013-02-01

    Plant sterols (PS) are well known for their low-density lipoprotein cholesterol-lowering effect. Until recently, they were believed to have little or no impact on blood triglycerides (TG). However, studies taken individually were possibly lacking statistical power to detect modest TG decreases. This study was performed to quantify the TG-lowering effect of PS by pooling individual subject data from 12 randomised controlled trials that investigated the effects of PS on blood lipids. The main outcome variable was the control-adjusted PS effect on relative (%) and absolute (mmol/L) changes in TG. The relative and absolute changes in high-density lipoprotein cholesterol (HDL-C) were also assessed. Differences in changes of serum lipid concentrations between PS and control treatments were estimated by an ANCOVA using a random effect model which included PS intake (active or control), study and predefined subject characteristics. The twelve randomised controlled trials included in total 935 hypercholesterolaemic subjects not preselected based on their baseline TG concentrations. In most studies, the PS dose ranged between 1.6 and 2.5 g/day. PS intake significantly lowered serum TG by 6.0% (95% CI: -10.7, -1.2) or 0.12 mmol/L (95% CI: -0.20, -0.04). No significant interaction was observed between PS intake and baseline TG concentrations on relative changes, but, on absolute changes, interaction was significant with larger TG decreases observed with higher TG concentrations at baseline. No effects were observed on HDL-C concentrations. These results show that PS exert a modest TG-lowering effect which is dependent on baseline concentrations.

  14. Induction of triglyceride accumulation and mitochondrial maintenance in muscle cells by lactate

    PubMed Central

    Sun, Jingquan; Ye, Xin; Xie, Minhao; Ye, Jianping

    2016-01-01

    Muscle exercise induces intramuscular triglyceride (TG) accumulation and promotes mitochondrial maintenance in myotubes. However, the mechanism underlying exercise effects remains unknown. In this study, lactic acid was tested as a signaling molecule in C2C12 myotubes to understand the mechanism. Intracellular TG storage was induced in the cells by sodium lactate. The lactate activity was observed with an inhibition of the cAMP-PKA pathway as indicated by a reduction in the phosphorylation status of CREB (pCREB). Induction of pCREB signal by forskolin was blocked by pretreatment of cells with lactate. The impact of lactate on mitochondrial function was examined with a focus on the activities of two enzymes, MCAT (malonylCoA:ACP transferase) and PDH (pyruvate dehydrogenase). The enzyme activities were induced in the cells by lactate. Expression of the lactate receptor (GPR81) and lactate transporters (MCT1/4) were induced as well by lactate. The lactate activities were observed at concentrations between 4–64 mM, and were not dependent on the increase in intracellular pyruvate. Pyruvate treatment did not generate the same effects in the cells. Those results suggest that lactate may induce intramuscular TG storage and mitochondrial maintenance in myotubes through inhibition of the cAMP pathway by activation of GPR81 in a positive feedback manner. PMID:27645401

  15. [Association of Insulin Resistance and β Cell Function with Lipid Metabolism in Middle-aged and Elderly Hui and Han Populations].

    PubMed

    Li, Shu-ya; Jiang, Min; Yao, Tian-yu; Cheng, Yu-xuan; Fan, Ya-jie; Liu, Xu-ying; Zhang, Jin-ling; Liu, Lan; Wang, Zhi-zhong; Ma, Yu-ying; Hu, Xue-qin; Wang, Pan-pan; Yu, Jing-jing; Ma, Rong; Huang, Qi

    2016-04-01

    To explore the association of insulin resistance and β cell function with lipid metabolism in middle-aged and elderly Hui and Han populations. A total of 1000 subjects age over 40 years were recruited from five urban communities in Yinchuan and Wuzhong cities of Ningxia. The composition ratio between Hui and Han nationality was 1:2. A questionnaire-based survey was performed. Physical examinations were carried out to measure the height, body mass, waistline, and hipline. The levels of triglyceride (TG), total cholesterol (TC), blood uric acid (BUA), fasting blood glucose and insulin were measured. The boby mass index (BMI), waist-hip ratio (WHR), and secretion related index including insulin resistance index (IR), insulin sensitivity index (IAI), and beta cell function index (HBCI) were calculated. The BMI, WHR, IAI, HBCI, and the prevalence rate of diabetes in Hui nationality were significantly higher than those in Han nationality (P<0.01). The levels of BUA, fasting blood glucose, TC, and IR in Han nationality were significantly lower than those in Hui nationality (P<0.01). In Hui populations, TG, BMI, WHR, and BUA were positively correlated with IR (r=0.234, r=0.193, r=0.143, and r=0.129, respectively; P<0.01) and were negatively correlated with IAI (r=-0.234, r=-0.193, r=-0.143, r=-0.129, respectively; P<0.01), whereas TC was negatively correlated with HBCI (r=-0.169, P<0.01). In Han populations, TC, TG, BMI, WHR, and BUA were positively correlated with IR (r=0.140, r=0.257, r=0.288, r=0.163, r=0.104, P<0.01) and negatively correlated with IAI (r=-0.140, r=-0.257, r=-0.288, r=-0.163, and r=-0.104, P<0.01), whereas BMI was negatively correlated with HBCI (r=-0.111, P<0.01). After the influential factors such as gender, nationality, and age were adjusted, the TC, TG, BMI, WHR, BUA levels were positively correlated with IR (r=0.109, r=0.256, r=0.253, r=0.139, and r=0.142, P<0.01) and negatively correlated with IAI (r=-0.109, r=-0.256, r=-0.253, r=-0.139, and r=-0

  16. The effect of defatted cocoa powder on cholesterol-induced changes of serum lipids in rats

    PubMed

    Ahmad, Mousa Numan; Amr, Amira Mohammad

    2017-06-05

    Cocoa has been known for many health benefits, but its lipid-lowering activity still remains unresolved. To investigate effects of varying amounts of defatted cocoa on serum lipids in cholesterol-fed rats. Forty-eight male Sprague-Dawley rats were randomly assigned into four cholesterol-free (control) and four cholesterol-supplemented (experimental) diets containing 0, 1, 2 or 3% defatted cocoa (DC) and given ad libitumto the rats for ten weeks. Serum total cholesterol (TC), low- and very low-density lipoprotein cholesterol (LDL-C and VLDL-C), high-density lipoprotein cholesterol (HDL-C) and triglycerides (TG) were quantified, atherogenic index (AI) was calculated, and other biological parameters were assessed. Food intake and body weight did not respond to DC. Compared to 0% DC, 3% DC had the most prominent effect on serum lipids inducing significant fall in LDL-C and TG, and rise in TC/TG in cholesterol-deprived rats, and increase in VLDL-C and AI, and decrease in HDL-C in cholesterol-fed rats. Compared to cholesterol-deprived rats, 3% DC caused significant rise in VLDL-C, AI and TC/TG, and fall in TG in cholesterol-fed rats. This lipid-modifying effect was markedly substantiated by corresponding linear trend responses to DC. Differences in lipid variables of rats fed on DC diets were less evident. Results suggest that, in contrast to cholesterol-free situations, defatted cocoa is seemingly incapable of counteracting the atherogenic effect of cholesterol in rats, perhaps in an interaction that is likely to have clinical implications in cardiometabolic conditions.

  17. Positive relationship between dietary fat, ethanol intake, triglycerides and hypothalamic peptides: Counteraction by lipid-lowering drugs

    PubMed Central

    Barson, Jessica R.; Karatayev, Olga; Chang, Guo-Qing; Johnson, Deanne F.; Bocarsly, Miriam E.; Hoebel, Bartley G.; Leibowitz, Sarah F.

    2009-01-01

    Studies in both humans and animals suggest a positive relationship between the intake of ethanol and intake of fat, which may contribute to alcohol abuse. This relationship may be mediated, in part, by hypothalamic orexigenic peptides such as orexin (OX), which stimulate both consumption of ethanol and fat, and circulating triglycerides (TG), which stimulate these peptides and promote consummatory behavior. The present study investigated this vicious cycle between ethanol and fat, to further characterize its relation to TG and to test the effects of lowering TG levels. In Experiment 1, the behavioral relationship between fat intake and ethanol was confirmed. Adult male Sprague-Dawley rats, chronically injected with ethanol (1 g/kg i.p.) and tested in terms of their preference for a high-fat compared to low-fat diet, showed a significant increase in their fat preference, compared to rats injected with saline, in measures of 2 h and 24 h intake. Experiment 2 tested the relationship of circulating TG in this positive association between ethanol and fat, in rats chronically consuming 9% ethanol vs. water and given acute meal tests (25 kcal) of a high-fat vs. low-fat diet. Levels of TG were elevated in response to both chronic drinking of ethanol vs. water and acute eating of a high-fat vs. low-fat meal. Most importantly, ethanol and a high-fat diet showed an interaction effect, whereby their combination produced a considerably larger increase in TG levels (+172%) compared to ethanol with a low-fat diet (+111%). In Experiment 3, a direct manipulation of TG levels was found to affect ethanol intake. After administration of gemfibrozil (50 mg/kg i.g.) compared to vehicle, TG levels were lowered by 37%, and ethanol intake was significantly reduced. In Experiment 4, the TG-lowering drug gemfibrozil also caused a significant reduction in the expression of the orexigenic peptide OX, in the perifornical lateral hypothalamus. These results support the existence of a vicious

  18. Impact of fatty acyl composition and quantity of triglycerides on bioaccessibility of dietary carotenoids.

    PubMed

    Huo, Tianyao; Ferruzzi, Mario G; Schwartz, Steven J; Failla, Mark L

    2007-10-31

    A carotenoid-rich salad meal with varying amounts and types of triglycerides (TG) was digested using simulated gastric and small intestinal conditions. Xanthophylls (lutein and zeaxanthin) and carotenes (alpha-carotene, beta-carotene, and lycopene) in chyme and micelle fraction were quantified to determine digestive stability and efficiency of micellarization (bioaccessibility). Micellarization of lutein (+zeaxanthin) exceeded that of alpha- and beta-carotenes, which was greater than that of lycopene for all test conditions. Micellarization of carotenes, but not lutein (+zeaxanthin), was enhanced (P < 0.05) by addition of TG (2.5% v/w) to the meal and was dependent on fatty acyl chain length in structured TG (c18:1 > c8:0 > c4:0). The degree of unsaturation of c18 fatty acyl chains in TG added to the salad purée did not significantly alter the efficiency of micellarization of carotenoids. Relatively low amounts of triolein and canola oil (0.5-1%) were required for maximum micellarization of carotenes, but more oil (approximately 2.5%) was required when TG with medium chain saturated fatty acyl groups (e.g., trioctanoin and coconut oil) was added to the salad. Uptake of lutein and beta-carotene by Caco-2 cells also was examined by exposing cells to micelles generated during the simulated digestion of salad purée with either triolein or trioctanoin. Cell accumulation of beta-carotene was independent of fatty acyl composition of micelles, whereas lutein uptake was slightly, but significantly, increased from samples with digested triolein compared to trioctanoin. The results show that the in vitro transfer of alpha-carotene, beta-carotene, and lycopene from chyme to mixed micelles during digestion requires minimal (0.5-1%) lipid content in the meal and is affected by the length of fatty acyl chains but not the degree of unsaturation in TG. In contrast, fatty acyl chain length has limited if any impact on carotenoid uptake by small intestinal epithelial cells. These

  19. Basal-bolus insulin therapy reduces maternal triglycerides in gestational diabetes without modifying cholesteryl ester transfer protein activity.

    PubMed

    Olmos, Pablo R; Borzone, Gisella R

    2017-09-01

    Macrosomia in the offspring of overweight/obese mothers with glucose-controlled gestational diabetes mellitus (GDM) is due to excessive rise of maternal triglycerides (TG). We aimed to ascertain whether basal-bolus insulin therapy (BBIT), or other components of the treatment, could reduce TG in GDM. We studied the records of 131 singleton pregnancies with GDM, using stepwise multiple linear regression, Mann-Whitney, χ 2 , and Jonckheere-Terpstra tests. As maternal TG increased steadily during normal pregnancy, these were transformed as z-scores. The atherogenic index of plasma (AIP) was calculated as a measure of cholesteryl ester transfer protein activity. Multiple regression showed that only BBIT (but neither limitation of weight gain nor metformin) reduced maternal TG z-scores (P = 0.011). When the 131 pregnancies were split into two groups - without BBIT (n = 58; HbA1c = 5.3 ± 0.3%) and with BBIT (n = 73; HbA1c = 5.4 ± 0.6; P = 0.2005) - we observed that BBIT (n = 73) reduced maternal TG z-scores in a dose-related fashion (Jonckheere-Terpstra P = 0.03817). The atherogenic index of plasma remained within normal range in both groups. BBIT (but not weight gain control nor metformin) reduced maternal TG in mothers with glucose-controlled GDM. This beneficial effect of BBIT was not related to changes in the cholesteryl ester transfer protein activity. © 2017 Japan Society of Obstetrics and Gynecology.

  20. Genetic determinants of cardiometabolic risk factors in rural families in Brazil.

    PubMed

    Pena, Geórgia G; Martinez-Perez, Angel; Dutra, Míriam Santos; Gazzinelli, Andrea; Corrêa-Oliveira, Rodrigo; Soria, José M; Velasquez-Melendez, Gustavo

    2016-09-10

    The purpose of this study was to estimate the heritability of genetic and environmental correlations between cardiometabolic risk factors in extended pedigrees. The Jequitinhonha Community Family Study Cohort (JCFSC) consists of individuals aged ≥18 years living in rural villages. Family pedigrees were constructed of the cohort. The following data were collected: demographic and socioeconomic status, lifestyle variables, anthropometrics, and lipid traits. The JCFSC consists of 931 individuals distributed into 69 pedigrees with 4,907 members in total. The heritabilities were 0.47 for total cholesterol (TC), 0.44 for triglycerides (TG) and 0.42 for high-density lipoprotein cholesterol (HDLc), 0.49 for metabolic syndrome, approximately 0.60 for anthropometric traits and 0.30 for blood pressure/hypertension. Significant genetic correlations (ρg ) were found mainly between TG and TC (ρg  = 0.58) and hypertension and TG (ρg  = 0.52). Systolic blood pressure (SBP) was correlated with TG (ρg  = 0.39) and HDLc (ρg  = -0.30). Diastolic blood pressures correlated with TG (ρg =0.56) and TC (ρg =0.30). Genetic correlations were also found between anthropometric traits, including: body mass index (BMI) and TG (ρg =0.34), waist circumference (WC) and TG (ρg =0.42), and WC and HDLc (ρg =-0.33). Household effects were found for HDLc (c(2) = 0.19), SBP (c(2)  = 0.14) and Hypertension (c(2) = 0.14). To some phenotypes, including lipids, hypertension, blood pressure, and anthropometric traits, genetic contribution is important in the determination of cardiometabolic risk factors. This study provides a foundation for future studies. These will mainly focus on rare variants that could describe the genetic mechanisms influencing cardiometabolic risk. Am. J. Hum. Biol. 28:619-626, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. A novel mutation in the TG gene (G2322S) causing congenital hypothyroidism in a Sudanese family: a case report.

    PubMed

    Watanabe, Y; Sharwood, E; Goodwin, B; Creech, M K; Hassan, H Y; Netea, M G; Jaeger, M; Dumitrescu, A; Refetoff, S; Huynh, T; Weiss, R E

    2018-05-02

    Congenital hypothyroidism (CH) has an incidence of approximately 1:3000, but only 15% have mutations in the thyroid hormone synthesis pathways. Genetic analysis allows for the precise diagnosis. A 3-week old girl presented with a large goiter, serum TSH > 100 mIU/L (reference range: 0.7-5.9 mIU/L); free T 4  < 3.2 pmol/L (reference range: 8.7-16 pmol/L); thyroglobulin (TG) 101 μg/L. Thyroid Tc-99 m scan showed increased radiotracer uptake. One brother had CH and both affected siblings have been clinically and biochemically euthyroid on levothyroxine replacement. Another sibling had normal thyroid function. Both Sudanese parents reported non-consanguinity. Peripheral blood DNA from the proposita was subjected to whole exome sequencing (WES). WES identified a novel homozygous missense mutation of the TG gene: c.7021G > A, p.Gly2322Ser, which was subsequently confirmed by Sanger sequencing and present in one allele of both parents. DNA samples from 354 alleles in four Sudanese ethnic groups (Nilotes, Darfurians, Nuba, and Halfawien) failed to demonstrate the presence of the mutant allele. Haplotyping showed a 1.71 centiMorgans stretch of homozygosity in the TG locus suggesting that this mutation occurred identical by descent and the possibility of common ancestry of the parents. The mutation is located in the cholinesterase-like (ChEL) domain of TG. A novel rare missense mutation in the TG gene was identified. The ChEL domain is critical for protein folding and patients with CH due to misfolded TG may present without low serum TG despite the TG gene mutations.

  2. Association between serum triglyceride to high-density lipoprotein cholesterol ratio and sarcopenia in elderly Korean males: The Korean National Health and Nutrition Examination Survey.

    PubMed

    Chung, Tae-Ha; Kwon, Yu-Jin; Shim, Jae-Yong; Lee, Yong-Jae

    2016-12-01

    We investigated the association between the triglycerides to high-density lipoprotein cholesterol (TG/HDL) ratio and sarcopenia in elderly Korean males. We examined the relationship between the TG/HDL ratio and sarcopenia in 879 elderly males ≥60years who participated in the 2010-2011 KNHANES. Sarcopenia was defined as an appendicular skeletal muscle mass (ASM) divided by the weight (%), which is >1 SD below the mean for young adults. The odds ratios (ORs) for sarcopenia were calculated using multiple logistic regression across the TG/HDL ratio quartiles (Q1: ≤1.4, Q2: 1.5-2.4, Q3: 2.5-3.8 and Q4: ≥3.9) after adjusting for confounding variables. The prevalence of sarcopenia significantly increased in accordance with TG/HDL ratio quartiles. Compared with the lowest quartile of the TG/HDL ratio, the corresponding OR (95% CI) of the highest quartile of the TG/HDL ratio for sarcopenia was 2.10 (1.12-3.91) after adjusting for age, body mass index (BMI), cigarette smoking, alcohol intake and physical activity. TG/HDL ratio was positively related with a higher risk of sarcopenia in elderly Korean males. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Reduced Expression of Adipose Triglyceride Lipase Enhances Tumor Necrosis Factor α-induced Intercellular Adhesion Molecule-1 Expression in Human Aortic Endothelial Cells via Protein Kinase C-dependent Activation of Nuclear Factor-κB*

    PubMed Central

    Inoue, Tomoaki; Kobayashi, Kunihisa; Inoguchi, Toyoshi; Sonoda, Noriyuki; Fujii, Masakazu; Maeda, Yasutaka; Fujimura, Yoshinori; Miura, Daisuke; Hirano, Ken-ichi; Takayanagi, Ryoichi

    2011-01-01

    We examined the effects of adipose triglyceride lipase (ATGL) on the initiation of atherosclerosis. ATGL was recently identified as a rate-limiting triglyceride (TG) lipase. Mutations in the human ATGL gene are associated with neutral lipid storage disease with myopathy, a rare genetic disease characterized by excessive accumulation of TG in multiple tissues. The cardiac phenotype, known as triglyceride deposit cardiomyovasculopathy, shows massive TG accumulation in both coronary atherosclerotic lesions and the myocardium. Recent reports show that myocardial triglyceride content is significantly higher in patients with prediabetes or diabetes and that ATGL expression is decreased in the obese insulin-resistant state. Therefore, we investigated the effect of decreased ATGL activity on the development of atherosclerosis using human aortic endothelial cells. We found that ATGL knockdown enhanced monocyte adhesion via increased expression of TNFα-induced intercellular adhesion molecule-1 (ICAM-1). Next, we determined the pathways (MAPK, PKC, or NFκB) involved in ICAM-1 up-regulation induced by ATGL knockdown. Both phosphorylation of PKC and degradation of IκBα were increased in ATGL knockdown human aortic endothelial cells. In addition, intracellular diacylglycerol levels and free fatty acid uptake via CD36 were significantly increased in these cells. Inhibition of the PKC pathway using calphostin C and GF109203X suppressed TNFα-induced ICAM-1 expression. In conclusion, we showed that ATGL knockdown increased monocyte adhesion to the endothelium through enhanced TNFα-induced ICAM-1 expression via activation of NFκB and PKC. These results suggest that reduced ATGL expression may influence the atherogenic process in neutral lipid storage diseases and in the insulin-resistant state. PMID:21828047

  4. The Association between Triglyceride/High-Density Lipoprotein Cholesterol Ratio and All-Cause Mortality in Acute Coronary Syndrome after Coronary Revascularization

    PubMed Central

    Wan, Ke; Zhao, Jianxun; Huang, Hao; Zhang, Qing; Chen, Xi; Zeng, Zhi; Zhang, Li; Chen, Yucheng

    2015-01-01

    Aims High triglycerides (TG) and low high-density lipoprotein cholesterol (HDL-C) are cardiovascular risk factors. A positive correlation between elevated TG/HDL-C ratio and all-cause mortality and cardiovascular events exists in women. However, utility of TG to HDL-C ratio for prediction is unknown among acute coronary syndrome (ACS). Methods Fasting lipid profiles, detailed demographic data, and clinical data were obtained at baseline from 416 patients with ACS after coronary revascularization. Subjects were stratified into three levels of TG/HDL-C. We constructed multivariate Cox-proportional hazard models for all-cause mortality over a median follow-up of 3 years using log TG to HDL-C ratio as a predictor variable and analyzing traditional cardiovascular risk factors. We constructed a logistic regression model for major adverse cardiovascular events (MACEs) to prove that the TG/HDL-C ratio is a risk factor. Results The subject’s mean age was 64 ± 11 years; 54.5% were hypertensive, 21.8% diabetic, and 61.0% current or prior smokers. TG/HDL-C ratio ranged from 0.27 to 14.33. During the follow-up period, there were 43 deaths. In multivariate Cox models after adjusting for age, smoking, hypertension, diabetes, and severity of angiographic coronary disease, patients in the highest tertile of ACS had a 5.32-fold increased risk of mortality compared with the lowest tertile. After adjusting for conventional coronary heart disease risk factors by the logistic regression model, the TG/HDL-C ratio was associated with MACEs. Conclusion The TG to HDL-C ratio is a powerful independent predictor of all-cause mortality and is a risk factor of cardiovascular events. PMID:25880982

  5. Use of plasma triglyceride/high-density lipoprotein cholesterol ratio to identify increased cardio-metabolic risk in young, healthy South Asians.

    PubMed

    Flowers, Elena; Molina, César; Mathur, Ashish; Reaven, Gerald M

    2015-01-01

    Prevalence of insulin resistance and associated dyslipidaemia [high triglyceride (TG) and low high-density lipoprotein cholesterol (HDL-C) concentrations] are increased in South Asian individuals; likely contributing to their increased risk of type-2 diabetes and cardiovascular disease. The plasma concentration ratio of TG/HDL-C has been proposed as a simple way to identify apparently healthy individuals at high cardio-metabolic risk. This study was carried out to compare the cardio-metabolic risk profiles of high-risk South Asian individuals identified by an elevated TG/HDL-C ratio versus those with a diagnosis of the metabolic syndrome. Body mass index, waist circumference, blood pressure, and fasting plasma glucose, insulin, TG, and HDL-C concentrations were determined in apparently healthy men (n=498) and women (n=526). The cardio-metabolic risk profile of "high risk" individuals identified by TG/HDL-C ratios in men (≥ 3.5) and women (≥2.5) was compared to those identified by a diagnosis of the metabolic syndrome. More concentrations of all cardio-metabolic risk factors were significantly higher in "high risk" groups, identified by either the TG/HDL-C ratio or a diagnosis of the metabolic syndrome. TG, HDL-C, and insulin concentrations were not significantly different in "high risk" groups identified by either criterion, whereas plasma glucose and blood pressure were higher in those with the metabolic syndrome. Apparently healthy South Asian individuals at high cardio-metabolic risk can be identified using either the TG/HDL-C ratio or the metabolic syndrome criteria. The TG/HDL-C ratio may be used as a simple marker to identify such individuals.

  6. Longitudinal Trend in Lipid Profile of Incident Peritoneal Dialysis Patients is Not Influenced by the Use of Biocompatible Solutions

    PubMed Central

    Cho, Yeoungjee; Büchel, Janine; Steppan, Sonja; Passlick-Deetjen, Jutta; Hawley, Carmel M.; Dimeski, Goce; Clarke, Margaret; Johnson, David W.

    2016-01-01

    ♦ Background: The longitudinal trends of lipid parameters and the impact of biocompatible peritoneal dialysis (PD) solutions on these levels remain to be fully defined. The present study aimed to a) evaluate the influence of neutral pH, low glucose degradation product (GDP) PD solutions on serum lipid parameters, and b) explore the capacity of lipid parameters (total cholesterol [TC], triglyceride [TG], high density lipoprotein [HDL], TC/HDL, low density lipoprotein [LDL], very low density lipoprotein [VLDL]) to predict cardiovascular events (CVE) and mortality in PD patients. ♦ Methods: The study included 175 incident participants from the balANZ trial with at least 1 stored serum sample. A composite CVE score was used as a primary clinical outcome measure. Multilevel linear regression and Poisson regression models were fitted to describe the trend of lipid parameters over time and its ability to predict composite CVE, respectively. ♦ Results: Small but statistically significant increases in serum TG (coefficient 0.006, p < 0.001), TC/HDL (coefficient 0.004, p = 0.001), and VLDL cholesterol (coefficient 0.005, p = 0.001) levels and a decrease in the serum HDL cholesterol levels (coefficient −0.004, p = 0.009) were observed with longer time on PD, whilst the type of PD solution (biocompatible vs standard) received had no significant effect on these levels. Peritoneal dialysis glucose exposure was significantly associated with trends in TG, TC/HDL, HDL and VLDL levels. Baseline lipid parameter levels were not predictive of composite CVEs or all-cause mortality. ♦ Conclusion: Serum TG, TC/HDL, and VLDL levels increased and the serum HDL levels decreased with increasing PD duration. None of the lipid parameters were significantly modified by biocompatible PD solution use over the time period studied or predictive of composite CVE or mortality. PMID:26429421

  7. Low serum free thyroxine level is correlated with lipid profile in depressive patients with suicide attempt.

    PubMed

    Peng, Rui; Dai, Wen; Li, Yan

    2018-05-24

    The present research was carried out to observe the relationships between serum free triiothyronine (FT3), free thyroxine (FT4), thyroid-stimulating hormone (TSH) levels and lipid profile and suicide risk in depressive subjects. Serum concentrations of albumin, total bilrubin, uric acid, total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL), low-density lipoprotein cholesterol (LDL), high-sensitivity C-reactive protein (hs-CRP), FT3, FT4 and TSH were measured in 271 patients meeting the DSM-IV criteria for major depressive disorder (202 subjects without suicidal behavior and 69 suicide attempters). A significant decrease in serum TC, TG and FT4 levels was found in suicide attempters with major depressive disorder compared with non-suicide attempters (all p < 0.0025). For the other biochemical factors levels (albumin, total bilrubin, uric acid, HDL, LDL, hs-CRP, FT3, and TSH), there were no significant differences between suicide attempters and non-suicide attempters. Relativity analysis suggested that FT4 is positively and significantly correlated with TC (p < 0.0025); TSH is positively associated with HDL (p < 0.0025). Univariate analysis showed that serum TC and FT4 abundances are correlated with the suicide attempts in major depressive subjects. This research demonstrated that the levels of serum TC, TG, and FT4 levels in suicidal patients were greatly decreased compared with patients without suicidal behavior. These findings support the hypothesis that low serum FT4 level affects lipid profile in major depressive patients with suicidal attempt. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Serotonin (5-HT) receptor 5A sequence variants affect human plasma triglyceride levels

    PubMed Central

    Zhang, Y.; Smith, E. M.; Baye, T. M.; Eckert, J. V.; Abraham, L. J.; Moses, E. K.; Kissebah, A. H.; Martin, L. J.

    2010-01-01

    Neurotransmitters such as serotonin (5-hydroxytryptamine, 5-HT) work closely with leptin and insulin to fine-tune the metabolic and neuroendocrine responses to dietary intake. Losing the sensitivity to excess food intake can lead to obesity, diabetes, and a multitude of behavioral disorders. It is largely unclear how different serotonin receptor subtypes respond to and integrate metabolic signals and which genetic variations in these receptor genes lead to individual differences in susceptibility to metabolic disorders. In an obese cohort of families of Northern European descent (n = 2,209), the serotonin type 5A receptor gene, HTR5A, was identified as a prominent factor affecting plasma levels of triglycerides (TG), supported by our data from both genome-wide linkage and targeted association analyses using 28 publicly available and 12 newly discovered single nucleotide polymorphisms (SNPs), of which 3 were strongly associated with plasma TG levels (P < 0.00125). Bayesian quantitative trait nucleotide (BQTN) analysis identified a putative causal promoter SNP (rs3734967) with substantial posterior probability (P = 0.59). Functional analysis of rs3734967 by electrophoretic mobility shift assay (EMSA) showed distinct binding patterns of the two alleles of this SNP with nuclear proteins from glioma cell lines. In conclusion, sequence variants in HTR5A are strongly associated with high plasma levels of TG in a Northern European population, suggesting a novel role of the serotonin receptor system in humans. This suggests a potential brain-specific regulation of plasma TG levels, possibly by alteration of the expression of HTR5A. PMID:20388841

  9. Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels.

    PubMed

    Spracklen, Cassandra N; Chen, Peng; Kim, Young Jin; Wang, Xu; Cai, Hui; Li, Shengxu; Long, Jirong; Wu, Ying; Wang, Ya Xing; Takeuchi, Fumihiko; Wu, Jer-Yuarn; Jung, Keum-Ji; Hu, Cheng; Akiyama, Koichi; Zhang, Yonghong; Moon, Sanghoon; Johnson, Todd A; Li, Huaixing; Dorajoo, Rajkumar; He, Meian; Cannon, Maren E; Roman, Tamara S; Salfati, Elias; Lin, Keng-Hung; Guo, Xiuqing; Sheu, Wayne H H; Absher, Devin; Adair, Linda S; Assimes, Themistocles L; Aung, Tin; Cai, Qiuyin; Chang, Li-Ching; Chen, Chien-Hsiun; Chien, Li-Hsin; Chuang, Lee-Ming; Chuang, Shu-Chun; Du, Shufa; Fan, Qiao; Fann, Cathy S J; Feranil, Alan B; Friedlander, Yechiel; Gordon-Larsen, Penny; Gu, Dongfeng; Gui, Lixuan; Guo, Zhirong; Heng, Chew-Kiat; Hixson, James; Hou, Xuhong; Hsiung, Chao Agnes; Hu, Yao; Hwang, Mi Yeong; Hwu, Chii-Min; Isono, Masato; Juang, Jyh-Ming Jimmy; Khor, Chiea-Chuen; Kim, Yun Kyoung; Koh, Woon-Puay; Kubo, Michiaki; Lee, I-Te; Lee, Sun-Ju; Lee, Wen-Jane; Liang, Kae-Woei; Lim, Blanche; Lim, Sing-Hui; Liu, Jianjun; Nabika, Toru; Pan, Wen-Harn; Peng, Hao; Quertermous, Thomas; Sabanayagam, Charumathi; Sandow, Kevin; Shi, Jinxiu; Sun, Liang; Tan, Pok Chien; Tan, Shu-Pei; Taylor, Kent D; Teo, Yik-Ying; Toh, Sue-Anne; Tsunoda, Tatsuhiko; van Dam, Rob M; Wang, Aili; Wang, Feijie; Wang, Jie; Wei, Wen Bin; Xiang, Yong-Bing; Yao, Jie; Yuan, Jian-Min; Zhang, Rong; Zhao, Wanting; Chen, Yii-Der Ida; Rich, Stephen S; Rotter, Jerome I; Wang, Tzung-Dau; Wu, Tangchun; Lin, Xu; Han, Bok-Ghee; Tanaka, Toshihiro; Cho, Yoon Shin; Katsuya, Tomohiro; Jia, Weiping; Jee, Sun-Ha; Chen, Yuan-Tsong; Kato, Norihiro; Jonas, Jost B; Cheng, Ching-Yu; Shu, Xiao-Ou; He, Jiang; Zheng, Wei; Wong, Tien-Yin; Huang, Wei; Kim, Bong-Jo; Tai, E-Shyong; Mohlke, Karen L; Sim, Xueling

    2017-05-01

    Large-scale meta-analyses of genome-wide association studies (GWAS) have identified >175 loci associated with fasting cholesterol levels, including total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG). With differences in linkage disequilibrium (LD) structure and allele frequencies between ancestry groups, studies in additional large samples may detect new associations. We conducted staged GWAS meta-analyses in up to 69,414 East Asian individuals from 24 studies with participants from Japan, the Philippines, Korea, China, Singapore, and Taiwan. These meta-analyses identified (P < 5 × 10-8) three novel loci associated with HDL-C near CD163-APOBEC1 (P = 7.4 × 10-9), NCOA2 (P = 1.6 × 10-8), and NID2-PTGDR (P = 4.2 × 10-8), and one novel locus associated with TG near WDR11-FGFR2 (P = 2.7 × 10-10). Conditional analyses identified a second signal near CD163-APOBEC1. We then combined results from the East Asian meta-analysis with association results from up to 187,365 European individuals from the Global Lipids Genetics Consortium in a trans-ancestry meta-analysis. This analysis identified (log10Bayes Factor ≥6.1) eight additional novel lipid loci. Among the twelve total loci identified, the index variants at eight loci have demonstrated at least nominal significance with other metabolic traits in prior studies, and two loci exhibited coincident eQTLs (P < 1 × 10-5) in subcutaneous adipose tissue for BPTF and PDGFC. Taken together, these analyses identified multiple novel lipid loci, providing new potential therapeutic targets. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Triglycerides to high-density lipoprotein cholesterol ratio is an independent predictor of incident fatty liver; a population-based cohort study.

    PubMed

    Fukuda, Yukiko; Hashimoto, Yoshitaka; Hamaguchi, Masahide; Fukuda, Takuya; Nakamura, Naoto; Ohbora, Akihiro; Kato, Takahiro; Kojima, Takao; Fukui, Michiaki

    2016-05-01

    Triglycerides (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) has been recommended for surrogates of insulin resistance. However, it remains to be elucidated the association between TG/HDL-C and incident fatty liver. To investigate the association between TG/HDL-C and incident fatty liver. We performed population-based historical cohort study consisted with 4518 healthy Japanese who received yearly health-checkup programmes over decade. Fatty liver was diagnosed using ultrasonography. During the observation periods, 38.8% (case/N = 1023/2637) of men and 17.2% (case/N = 324/1881) of women developed fatty liver. Adjusting odds ratio of TG/HDL-C for incident fatty liver were 1.59 (95% confidence interval (CI) 1.42-1.79, P < 0.0001) in men and 2.50 (95% CI 1.80-3.51, P < 0.0001) in women. In addition, adjusting odds ratio of TG/HDL-C for incident non-alcoholic fatty liver disease were 1.55 (95% CI 1.35-1.77, P < 0.0001) in men and 2.72 (95% CI 1.88-3.95, P < 0.0001) in women. According to the receiver operator characteristic (ROC) analysis, the optimal cut-off point of TG/HDL-C for incident fatty liver was 0.88 (area under the ROC curve (AUC) 0.67 [95% CI 0.65-0.69], sensitivity = 0.64, specificity = 0.60, P < 0.0001) in men and 0.64 (AUC 0.69 [95% CI 0.66-0.72], sensitivity = 0.50, specificity = 0.78, P < 0.0001) in women. The TG/HDL-C could predict the incident fatty liver. Thus, it is important to check TG/HDL-C and lifestyles modification is needed for preventing future fatty liver disease in patients with high TG/HDL-C. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. The rs2516839 Polymorphism of the USF1 Gene May Modulate Serum Triglyceride Levels in Response to Cigarette Smoking

    PubMed Central

    Niemiec, Pawel; Nowak, Tomasz; Iwanicki, Tomasz; Gorczynska-Kosiorz, Sylwia; Balcerzyk, Anna; Krauze, Jolanta; Grzeszczak, Wladyslaw; Wiecha, Maria; Zak, Iwona

    2015-01-01

    Single nucleotide polymorphisms (SNPs) of the USF1 gene (upstream stimulatory factor 1) influence plasma lipid levels. This study aims to determine whether USF1 SNPs interact with traditional risk factors of atherosclerosis to increase coronary artery disease (CAD) risk. In the present study serum lipid levels and USF1 gene polymorphisms (rs2516839 and rs3737787) were determined in 470 subjects: 235 patients with premature CAD and 235 controls. A trend of increasing triglycerides (TG) levels in relation to the C allele dose of rs2516839 SNP was observed. The synergistic effect of cigarette smoking and C allele carrier state on CAD risk was also found (SIM = 2.69, p = 0.015). TG levels differentiated significantly particular genotypes in smokers (1.53 mmol/L for TT, 1.80 mmol/L for CT and 2.27 mmol/L for CC subjects). In contrast, these differences were not observed in the non-smokers subgroup (1.57 mmol/L for TT, 1.46 mmol/L for CT and 1.49 mmol/L for CC subjects). In conclusion, the rs2516839 polymorphism may modulate serum triglyceride levels in response to cigarette smoking. Carriers of the C allele seem to be particularly at risk of CAD, when exposed to cigarette smoking. PMID:26068452

  12. Synergistic association of changes in serum uric acid and triglycerides with changes in insulin resistance after walking exercise in community-dwelling older women.

    PubMed

    Kawamoto, Ryuichi; Katoh, Takeaki; Ninomiya, Daisuke; Kumagi, Teru; Abe, Masanori; Kohara, Katsuhiko

    2016-05-01

    Serum uric acid (SUA) and triglyceride (TG) levels are strongly correlated with insulin resistance; however, the association after a walking exercise program in community-dwelling older women has not been investigated. The present study included 100 postmenopausal women (mean ± standard deviation, 68 ± 7 years) from a rural village in Japan. The Nordic walking program of 120 min per week was performed for 12 weeks. Before and after the intervention, SUA, TG, various relevant factors and homeostasis model assessment of insulin resistance (HOMA-IR) were measured. Multivariate linear regression analysis showed that baseline TG and γ-glutamyltransferase (GGT) were significantly associated with baseline HOMA-IR. After the 12-week training program, changes in TG, SUA and GGT were significantly associated with changes in HOMA-IR. In addition to their direct associations, we observed a synergistic association between changes in TG and SUA and changes in HOMA-IR. Participants were divided into three groups (tertiles) according to changes in TG and SUA. The tertiles of changes in SUA correlated significantly with changes in HOMA-IR in participants in the tertile with the greatest decrease in TG (r = 0.525, p = 0.001), but not in the other two tertiles of change in TG (r = 0.049, p = 0.699). There was a significant interaction between SUA and TG for changes in HOMA-IR (β = 0.281, p = 0.005). These results suggest that changes in TG and SUA are synergistic factors associated with changes in insulin resistance after a 12-week walking exercise program in community-dwelling older women.

  13. Dietary oxidized linoleic acid lowers triglycerides via APOA5/APOClll dependent mechanisms

    PubMed Central

    Garelnabi, Mahdi; Selvarajan, Krithika; Litvinov, Dmitry; Santanam, Nalini; Parthasarathy, Sampath

    2008-01-01

    Previously we have shown that intestinal cells efficiently take up oxidized fatty acids (OxFAs) and that atherosclerosis is increased when animals are fed a high cholesterol diet in the presence of oxidized linoleic acid. Interestingly, we found that in the absence of dietary cholesterol, the oxidized fatty acid fed low-density lipoprotein (LDL) receptor negative mice appeared to have lower plasma triglyceride (TG) levels as compared to animals fed oleic acid. In the present study, we fed C57BL6 mice a normal mice diet supplemented with oleic acid or oxidized linoleic acid (at 18 mg/animal/day) for 2 weeks. After the mice were sacrificed, we measured the plasma lipids and collected livers for the isolation of RNA. The results showed that while there were no significant changes in the levels of total cholesterol and high-density lipoprotein cholesterol (HDLc), there was a significant decrease (41.14%) in the levels of plasma TG in the mice that were fed oxidized fatty acids. The decreases in plasma TG levels were accompanied by significant increases (P < 0.001) in the expressions of APOA5 and acetyl-CoA oxidase genes as well as a significant (P < 0.04) decrease in APOClll gene expression. Oxidized lipids have been suggested to be ligands for peroxisome proliferator-activated receptor (PPARα). However, there were no increases in the mRNA or protein levels of PPARα in the oxidized linoleic acid fed animals. These results suggest that oxidized fatty acids may act through an APOA5/APOClll mechanism that contributes to lowering of TG levels other than PPARα induction. PMID:18243209

  14. Association Between Thyroid Dysfunction and Lipid Profiles Differs According to Age and Sex: Results from the Korean National Health and Nutrition Examination Survey.

    PubMed

    Oh, Hye-Seon; Kwon, Hyemi; Ahn, Jonghwa; Song, Eyun; Park, Suyeon; Kim, Mijin; Han, Minkyu; Jeon, Min Ji; Kim, Won Gu; Kim, Won Bae; Shong, Young Kee; Rhee, Eun-Jung; Kim, Tae Yong

    2018-06-15

    Lipid profiles of men and women change differently during the aging process. Guidelines recommend that dyslipidemia patients should consider screening for hypothyroidism without consideration of age or sex. Data from the sixth Korean National Health and Nutrition Examination Survey were used. A total of 4275 participants without thyroid disease and without a past history of dyslipidemia or dyslipidemia medication were evaluated. The association between thyroid dysfunction and lipid profiles (total cholesterol [TC], low-density lipoprotein cholesterol [LDLC], and triglycerides [TG]) was analyzed by age and sex. The prevalence of thyroid dysfunction was significantly different according to TC and LDLC levels (p = 0.003 and p = 0.021, respectively). In women, the weighted prevalence of thyroid dysfunction was significantly different according to levels of TC, LDLC, and TG (p = 0.007, p = 0.016, and p = 0.044, respectively). However, in men, no association was found in any of the lipid profiles. Female participants were divided into two groups using a cutoff age of 55 years. In younger women, the weighted prevalence of thyroid dysfunction was different according to the levels of TC, LDLC, and TG (p = 0.013, p = 0.007, and p = 0.007, respectively). However, in older women, no association was found for any of the lipid profiles. The prevalence of thyroid dysfunction was significantly different according to lipid profiles, and this association differed by age and sex.

  15. High Triglycerides Predicts Arteriogenic Erectile Dysfunction and Major Adverse Cardiovascular Events in Subjects With Sexual Dysfunction.

    PubMed

    Corona, Giovanni; Cipriani, Sarah; Rastrelli, Giulia; Sforza, Alessandra; Mannucci, Edoardo; Maggi, Mario

    2016-09-01

    The atherogenic role of triglycerides (TG) remains controversial. The aim of the present study is to analyze the contribution of TG in the pathogenesis of erectile dysfunction (ED) and to verify the value of elevated TG in predicting major adverse cardiovascular events (MACE). An unselected series of 3,990 men attending our outpatient clinic for sexual dysfunction was retrospectively studied. A subset of this sample (n = 1,687) was enrolled in a longitudinal study. Several clinical, biochemical, and instrumental (penile color Doppler ultrasound; PCDU) factors were evaluated. Among the patients studied, after adjustment for confounders, higher TG levels were associated with arteriogenic ED and a higher risk of clinical and biochemical hypogonadism. Conversely, no association between TG and other sexual dysfunctions was observed. When pathological PCDU parameters-including flaccid acceleration (<1.17 m/sec(2)) or dynamic peak systolic velocity (PSV <35 cm/sec)-were considered, the negative association between impaired penile flow and higher TG levels was confirmed, even when subjects taking lipid-lowering drugs or those with diabetes were excluded from the analysis (OR = 6.343 [1.243;32.362], P = .026 and 3.576 [1.104;11.578]; P = .34 for impaired acceleration and PSV, respectively). Similarly, when the same adjusted models were applied, TG levels were associated with a higher risk of hypogonadism, independently of the definition criteria (OR = 2.892 [1.643;5.410], P < .0001 and 4.853 [1.965;11.990]; P = .001 for total T <12 and 8 nM, respectively). In the longitudinal study, after adjusting for confounders, elevated TG levels (upper quartile: 162-1686 mg/dL) were independently associated with a higher incidence of MACE (HR = 2.469 [1.019;5.981]; P = .045), when compared to the rest of the sample. Our data suggest an association between elevated TG and arteriogenic ED and its cardiovascular (CV) risk stratification. Whether the use of TG lowering drugs

  16. The Short-term Prognostic Value of the Triglyceride-to-high-density Lipoprotein Cholesterol Ratio in Acute Ischemic Stroke

    PubMed Central

    Wang, Huan; Lei, Leix; Zhang, Han-Qing; Gu, Zheng-Tian; Xing, Fang-Lan; Yan, Fu-Ling

    2018-01-01

    The triglyceride (TG)-to-high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) is a simple approach to predicting unfavorable outcomes in cardiovascular disease. The influence of TG/HDL-C on acute ischemic stroke remains elusive. The purpose of this study was to investigate the precise effect of TG/HDL-C on 3-month mortality after acute ischemic stroke (AIS). Patients with AIS were enrolled in the present study from 2011 to 2017. A total of 1459 participants from a single city in China were divided into retrospective training and prospective test cohorts. Medical records were collected periodically to determine the incidence of fatal events. All participants were followed for 3 months. Optimal cutoff values were determined using X-tile software to separate the training cohort patients into higher and lower survival groups based on their lipid levels. A survival analysis was conducted using Kaplan-Meier curves and a Cox proportional hazards regression model. A total of 1459 patients with AIS (median age 68.5 years, 58.5% male) were analyzed. Univariate Cox regression analysis confirmed that TG/HDL-C was a significant prognostic factor for 3-month survival. X-tile identified 0.9 as an optimal cutoff for TG/HDL-C. In the univariate analysis, the prognosis of the TG/HDL-C >0.9 group was markedly superior to that of TG/HDL-C ≤0.9 group (P<0.001). A multivariate Cox regression analysis showed that TG/HDL-C was independently correlated with a reduced risk of mortality (hazard ratio [HR], 0.39; 95% confidence interval [CI], 0.24-0.62; P<0.001). These results were confirmed in the 453 patients in the test cohort. A nomogram was constructed to predict 3-month case-fatality, and the c-indexes of predictive accuracy were 0.684 and 0.670 in the training and test cohorts, respectively (P<0.01). The serum TG/HDL-C ratio may be useful for predicting short-term mortality after AIS. PMID:29896437

  17. The Short-term Prognostic Value of the Triglyceride-to-high-density Lipoprotein Cholesterol Ratio in Acute Ischemic Stroke.

    PubMed

    Deng, Qi-Wen; Li, Shuo; Wang, Huan; Lei, Leix; Zhang, Han-Qing; Gu, Zheng-Tian; Xing, Fang-Lan; Yan, Fu-Ling

    2018-06-01

    The triglyceride (TG)-to-high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) is a simple approach to predicting unfavorable outcomes in cardiovascular disease. The influence of TG/HDL-C on acute ischemic stroke remains elusive. The purpose of this study was to investigate the precise effect of TG/HDL-C on 3-month mortality after acute ischemic stroke (AIS). Patients with AIS were enrolled in the present study from 2011 to 2017. A total of 1459 participants from a single city in China were divided into retrospective training and prospective test cohorts. Medical records were collected periodically to determine the incidence of fatal events. All participants were followed for 3 months. Optimal cutoff values were determined using X-tile software to separate the training cohort patients into higher and lower survival groups based on their lipid levels. A survival analysis was conducted using Kaplan-Meier curves and a Cox proportional hazards regression model. A total of 1459 patients with AIS (median age 68.5 years, 58.5% male) were analyzed. Univariate Cox regression analysis confirmed that TG/HDL-C was a significant prognostic factor for 3-month survival. X-tile identified 0.9 as an optimal cutoff for TG/HDL-C. In the univariate analysis, the prognosis of the TG/HDL-C >0.9 group was markedly superior to that of TG/HDL-C ≤0.9 group (P<0.001). A multivariate Cox regression analysis showed that TG/HDL-C was independently correlated with a reduced risk of mortality (hazard ratio [HR], 0.39; 95% confidence interval [CI], 0.24-0.62; P<0.001). These results were confirmed in the 453 patients in the test cohort. A nomogram was constructed to predict 3-month case-fatality, and the c-indexes of predictive accuracy were 0.684 and 0.670 in the training and test cohorts, respectively (P<0.01). The serum TG/HDL-C ratio may be useful for predicting short-term mortality after AIS.

  18. Comparison of the abilities of the plasma triglyceride/high-density lipoprotein cholesterol ratio and the metabolic syndrome to identify insulin resistance.

    PubMed

    Salazar, Martin R; Carbajal, Horacio A; Espeche, Walter G; Leiva Sisnieguez, Carlos E; March, Carlos E; Balbín, Eduardo; Dulbecco, Carlos A; Aizpurúa, Marcelo; Marillet, Alberto G; Reaven, Gerald M

    2013-07-01

    This study compares the ability of an elevated triglyceride/high-density lipoprotein cholesterol (TG/HDL-C) ratio, using sex-specific cut-points, to identify insulin-resistant individuals within a population without known cardiac disease or diabetes with that obtained using the diagnostic criteria of the metabolic syndrome (MetS). Measurements were made of waist circumference (WC), systolic and diastolic blood pressure, fasting plasma glucose, fasting plasma insulin (FPI), plasma TG and plasma HDL-C concentrations in 1102 women and 464 men. These data were used to classify subjects as being insulin resistant (FPI concentration in the upper quartile) and having the MetS or an elevated TG/HDL-C ratio (>2.5 and >3.5 for women and men, respectively). The sensitivity and specificity with which the two indices identified insulin-resistant subjects were similar (43% and 81% for TG/HDL-C ratio and 45% and 82% for MetS), as the number of individuals was found with either an elevated TG/HDL-C ratio (n = 386) or the MetS (n = 384). Eighty-one per cent of the individuals were identified concordantly. Cardio-metabolic risk profiles in 'low-risk' individuals identified by a low TG/HDL-C ratio were comparable to those who did not have the MetS, and this was also the case when comparing 'high-risk' groups identified by having the MetS or an elevated TG/HDL-C ratio. These findings suggest that TG/HDL-C concentration ratio is as adequate as MetS diagnosis to identify insulin-resistant subjects.

  19. The association between triglyceride high density lipoprotein cholesterol ratio and benign prostate hyperplasia in non-diabetic patients:a cross-sectional study.

    PubMed

    Besiroglu, Huseyin; Dursun, Murat; Otunctemur, Alper; Ozbek, Emin

    2017-09-01

    To assess the association between triglyceride (TG)/high density lipoprotein (HDL) ratio and benign prostate hyperplasia/lower urinary tract symptoms (BPH/LUTS). Four hundred patients who were admitted to the Urology Clinic between January and December 2014 with complaints of BPH/LUTS were enrolled in this cross-sectional study. Patients were divided into two groups according to their International Prostate Symptom Score and prostate volume (PV). They were compared in terms of age, body mass index (BMI), PV, PSA, post micturional residual volume, uroflowmetry Q max value, fasting blood sugar, TG and high density lipoprotein-cholesterol (HDL-C) level and TG/HDL ratio. Although univariate analyses reveal that age, BMI, waist circumference (WC), FBS, TG, HDL-C level, and TG/HDL ratio were correlated with PV, only age [1.125 OR (1.088-1.164), p = .00001], BMI [1.119 OR (1.040-1.204), p = .003], TG [(1.043 OR (1.016-1.071), p = .002], HDL-C [(0.923 OR (0.860-0.990), p = .025], and TG/HDL ratio [(1.224 OR (1.130-1.315), p = .014] were statistically significant in multivariate analysis. The calculated area under the curve (AUC) for PV of 30 ml, 40 ml, and 50 ml was 0.668 (0.608-0.727), 0.617 (0.561-0.673), and 0.592 (0.530-0.654), respectively. Our results indicate that the TG/HDL ratio correlates with enhancement in PV. Further studies are warranted to better evaluate this relationship.

  20. The triglyceride to high-density lipoprotein-cholesterol ratio in adolescence and subsequent weight gain predict nuclear magnetic resonance-measured lipoprotein subclasses in adulthood.

    PubMed

    Weiss, Ram; Otvos, James D; Sinnreich, Ronit; Miserez, Andre R; Kark, Jeremy D

    2011-01-01

    To assess whether the fasting triglyceride-to-high-density lipoprotein (HDL)-cholesterol (TG/HDL) ratio in adolescence is predictive of a proatherogenic lipid profile in adulthood. A longitudinal follow-up of 770 Israeli adolescents 16 to 17 years of age who participated in the Jerusalem Lipid Research Clinic study and were reevaluated 13 years later. Lipoprotein particle size was assessed at the follow-up with proton nuclear magnetic resonance. The TG/HDL ratio measured in adolescence was strongly associated with low-density lipoprotein, very low-density lipoprotein (VLDL), and HDL mean particle size in young adulthood in both sexes, even after adjustment for baseline body mass index and body mass index change. The TG/HDL ratio measured in adolescence and subsequent weight gain independently predicted atherogenic small low-density lipoprotein and large VLDL particle concentrations (P < .001 in both sexes). Baseline TG/HDL and weight gain interacted to increase large VLDL concentration in men (P < .001). Adolescents with an elevated TG/HDL ratio are prone to express a proatherogenic lipid profile in adulthood. This profile is additionally worsened by weight gain. Copyright © 2011 Mosby, Inc. All rights reserved.

  1. Diagnostic value of Tg and TgAb for metastasis following ablation in patients with differentiated thyroid carcinoma coexistent with Hashimoto thyroiditis.

    PubMed

    Chai, Hong; Zhu, Zhao-Jin; Chen, Ze-Quan; Yu, Yong-Li

    2016-08-01

    This study was designed to investigate the clinical value of serum thyroglobulin (Tg) and antithyroglobulin antibody (TgAb) measurements and the cutoff value after ablation in differentiated thyroid carcinoma (DTC) complicated by Hashimoto thyroiditis (HT) with metastasis. We measured serum Tg and TgAb levels and evaluated the disease status in 164 cases of DTC coexistent with HT in pathologically confirmed patients after surgery and post-remnant ablation during a 3-year follow-up. All Tg and TgAb levels were assessed by chemiluminescent immunoassay (IMA). Receiver operating characteristic (ROC) curve analysis was used to evaluate the prognostic value of Tg and TgAb for disease metastasis. The relationship between Tg and TgAb was analyzed using the scatter diagram distribution method. We found that the cutoff values of Tg and TgAb were 1.48 µg/L and 45 kIU/L, respectively. The area under the ROC curve (AUC) of Tg and TgAb was 0.907 and 0.650, respectively. In DTC coexistent with HT patients, the optimal cutoff value correlated with metastasis in Tg and TgAb was 1.48 µg/L and 45 kIU/L, respectively.

  2. Effect of Hydrogenated, Liquid and Ghee Oils on Serum Lipids Profile

    PubMed Central

    Mohammadifard, Noushin; Nazem, Masoud; Naderi, Gholam-Ali; Saghafian, Faezeh; Sajjadi, Firoozeh; Maghroon, Maryam; Bahonar, Ahmad; Alikhasi, Hasan; Nouri, Fatemeh

    2010-01-01

    BACKGROUND Trans fatty acids are known as the most harmful type of dietary fats, so this study was done to compare the effects of hydrogenated, liquid and ghee oils on serum lipids profile of healthy adults. METHODS This study was a randomized clinical trial conducted on 129 healthy participants aged from 20 to 60 years old who were beneficiaries of Imam-e-Zaman charitable organization. Subjects were randomly divided into 3 groups and each group was treated with a diet containing cooking and frying liquid, ghee, or hydrogenated for 40 days. Fasting serum lipids, including total cholesterol (TC), triglyceride (TG), LDL-cholesterol (LDL-C), HDL-cholesterol (HDL-C), apoprotein A (Apo A), and apoprotein B (Apo B) were measured before and after the study. RESULTS TC, TG and Apo B had a significant reduction in the liquid oil group compared to the hydrogenated oil group. In the ghee group TG declined and Apo A increased significantly (P < 0.01). Liquid oil group had a significant reduction in HDL-C, compared to the ghee oil group (P < 0.05). CONCLUSION It was concluded that consuming liquid oil along with frying oil caused to reduce all serum lipid levels. However, ghee oil only reduced TG and increased HDL-C levels. PMID:22577408

  3. Exome-wide association study of plasma lipids in >300,000 individuals

    PubMed Central

    Liu, Dajiang J.; Peloso, Gina M.; Yu, Haojie; Butterworth, Adam S.; Wang, Xiao; Mahajan, Anubha; Saleheen, Danish; Emdin, Connor; Alam, Dewan; Alves, Alexessander Couto; Amouyel, Philippe; di Angelantonio, Emanuele; Arveiler, Dominique; Assimes, Themistocles L.; Auer, Paul L.; Baber, Usman; Ballantyne, Christie M.; Bang, Lia E.; Benn, Marianne; Bis, Joshua C.; Boehnke, Michael; Boerwinkle, Eric; Bork-Jensen, Jette; Bottinger, Erwin P.; Brandslund, Ivan; Brown, Morris; Busonero, Fabio; Caulfield, Mark J; Chambers, John C; Chasman, Daniel I.; Chen, Y. Eugene; Chen, Yii-Der Ida; Chowdhury, Rajiv; Christensen, Cramer; Chu, Audrey Y.; Connell, John M; Cucca, Francesco; Cupples, L. Adrienne; Damrauer, Scott M.; Davies, Gail; Deary, Ian J; Dedoussis, George; Denny, Joshua C.; Dominiczak, Anna; Dubé, Marie-Pierre; Ebeling, Tapani; Eiriksdottir, Gudny; Esko, Tõnu; Farmaki, Aliki-Eleni; Feitosa, Mary F; Ferrario, Marco; Ferrieres, Jean; Ford, Ian; Fornage, Myriam; Franks, Paul W.; Frayling, Timothy M.; Frikke-Schmidt, Ruth; Fritsche, Lars; Frossard, Philippe; Fuster, Valentin; Ganesh, Santhi K.; Gao, Wei; Garcia, Melissa E.; Gieger, Christian; Giulianini, Franco; Goodarzi, Mark O.; Grallert, Harald; Grarup, Niels; Groop, Leif; Grove, Megan L.; Gudnason, Vilmundur; Hansen, Torben; Harris, Tamara B.; Hayward, Caroline; Hirschhorn, Joel N.; Holmen, Oddgeir L.; Huffman, Jennifer; Huo, Yong; Hveem, Kristian; Jabeen, Sehrish; Jackson, Anne U; Jakobsdottir, Johanna; Jarvelin, Marjo-Riitta; Jensen, Gorm B; Jørgensen, Marit E.; Jukema, J. Wouter; Justesen, Johanne M.; Kamstrup, Pia R.; Kanoni, Stavroula; Karpe, Fredrik; Kee, Frank; Khera, Amit V.; Klarin, Derek; Koistinen, Heikki A.; Kooner, Jaspal S; Kooperberg, Charles; Kuulasmaa, Kari; Kuusisto, Johanna; Laakso, Markku; Lakka, Timo; Langenberg, Claudia; Langsted, Anne; Launer, Lenore J.; Lauritzen, Torsten; Liewald, David CM; Lin, Li An; Linneberg, Allan; Loos, Ruth J.F.; Lu, Yingchang; Lu, Xiangfeng; Mägi, Reedik; Malarstig, Anders; Manichaikul, Ani; Manning, Alisa K.; Mäntyselkä, Pekka; Marouli, Eirini; Masca, Nicholas GD; Maschio, Andrea; Meigs, James B.; Melander, Olle; Metspalu, Andres; Morris, Andrew P; Morrison, Alanna C.; Mulas, Antonella; Müller-Nurasyid, Martina; Munroe, Patricia B.; Neville, Matt J; Nielsen, Jonas B.; Nielsen, Sune F; Nordestgaard, Børge G; Ordovas, Jose M.; Mehran, Roxana; O’Donnell, Christoper J.; Orho-Melander, Marju; Molony, Cliona M.; Muntendam, Pieter; Padmanabhan, Sandosh; Palmer, Colin NA; Pasko, Dorota; Patel, Aniruddh P.; Pedersen, Oluf; Perola, Markus; Peters, Annette; Pisinger, Charlotta; Pistis, Giorgio; Polasek, Ozren; Poulter, Neil; Psaty, Bruce M.; Rader, Daniel J.; Rasheed, Asif; Rauramaa, Rainer; Reilly, Dermot; Reiner, Alex P.; Renström, Frida; Rich, Stephen S; Ridker, Paul M; Rioux, John D.; Robertson, Neil R; Roden, Dan M.; Rotter, Jerome I.; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J; Sanna, Serena; Sattar, Naveed; Schmidt, Ellen M.; Scott, Robert A.; Sever, Peter; Sevilla, Raquel S.; Shaffer, Christian M.; Sim, Xueling; Sivapalaratnam, Suthesh; Small, Kerrin S; Smith, Albert V.; Smith, Blair H; Somayajula, Sangeetha; Southam, Lorraine; Spector, Timothy D; Speliotes, Elizabeth K.; Starr, John M; Stirrups, Kathleen E; Stitziel, Nathan; Strauch, Konstantin; Stringham, Heather M; Surendran, Praveen; Tada, Hayato; Tall, Alan R.; Tang, Hua; Tardif, Jean-Claude; Taylor, Kent D; Trompet, Stella; Tsao, Philip S.; Tuomilehto, Jaakko; Tybjaerg-Hansen, Anne; van Zuydam, Natalie R; Varbo, Anette; Varga, Tibor V; Virtamo, Jarmo; Waldenberger, Melanie; Wang, Nan; Wareham, Nick J.; Warren, Helen R; Weeke, Peter E.; Weinstock, Joshua; Wessel, Jennifer; Wilson, James G.; Wilson, Peter W. F.; Xu, Ming; Yaghootkar, Hanieh; Young, Robin; Zeggini, Eleftheria; Zhang, He; Zheng, Neil S.; Zhang, Weihua; Zhang, Yan; Zhou, Wei; Zhou, Yanhua; Zoledziewska, Magdalena; Howson, Joanna MM; Danesh, John; McCarthy, Mark I; Cowan, Chad; Abecasis, Goncalo; Deloukas, Panos; Musunuru, Kiran; Willer, Cristen J.; Kathiresan, Sekar

    2017-01-01

    We screened DNA sequence variants on an exome-focused genotyping array in >300,000 participants with replication in >280,000 participants and identified 444 independent variants in 250 loci significantly associated with total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and/or triglycerides (TG). At two loci (JAK2 and A1CF), experimental analysis in mice revealed lipid changes consistent with the human data. We utilized mapped variants to address four clinically relevant questions and found the following: (1) beta-thalassemia trait carriers displayed lower TC and were protected from coronary artery disease; (2) outside of the CETP locus, there was not a predictable relationship between plasma HDL-C and risk for age-related macular degeneration; (3) only some mechanisms of lowering LDL-C seemed to increase risk for type 2 diabetes; and (4) TG-lowering alleles involved in hepatic production of TG-rich lipoproteins (e.g., TM6SF2, PNPLA3) tracked with higher liver fat, higher risk for type 2 diabetes, and lower risk for coronary artery disease whereas TG-lowering alleles involved in peripheral lipolysis (e.g., LPL, ANGPTL4) had no effect on liver fat but lowered risks for both type 2 diabetes and coronary artery disease. PMID:29083408

  4. The characteristics of impaired fasting glucose associated with obesity and dyslipidaemia in a Chinese population.

    PubMed

    Qian, Yun; Lin, Yudi; Zhang, Tiemei; Bai, Jianling; Chen, Feng; Zhang, Yi; Luo, Senlin; Shen, Hongbing

    2010-03-17

    Different populations have diverse patterns of relationships between Impaired Fasting Glucose (IFG) and obesity and lipid markers, it is important to investigate the characteristics of associations between IFG and other related risk factors including body mass index (BMI), waist circumstance (WC), serum lipids and blood pressure (BP) in a Chinese population. This was a case-control study of 648 IFG subjects and 1,296 controls derived from a large-scale, community-based, cross-sectional survey of 10,867 participants. Each subject received a face-to-face interview, physical examination, and blood tests, including fasting blood glucose and lipids. Student's t-test, Chi-square test, Spearman correlation and multiple logistic regressions were used for the statistical analyses. Fasting plasma glucose (FPG) was positively correlated with BMI, WC, systolic blood pressure (SBP), diastolic blood pressure (DBP), triglyceride (TG), and total cholesterol (TC), and was negatively correlated with high density lipoprotein-cholesterol (HDL-C) (all p < 0.05). BMI was more strongly correlated with IFG than with WC. The correlation coefficient of FPG was remarkably higher with TG (0.244) than with TC (0.134) and HDL-C (-0.192). TG was an important predictor of IFG, with odds ratios of 1.76 (95%CI: 1.31-2.36) for subjects with borderline high TG level (1.70 mmol/l < or = TG < 2.26 mmol/l) and 3.13 (95% CI: 2.50-3.91) for those with higher TG level (TG > or = 2.26 mmol/l), when comparing to subjects with TG < 1.70 mmol/l. There was a significant dose-response relationship between the number of abnormal variables and increased risk of IFG. In this Chinese population, both BMI and WC were important predictors of IFG. Abnormal TG as a lipid marker was more strongly associated with IFG than were TC and HDL-C. These factors should be taken into consideration simultaneously for prevention of IFG.

  5. Genetic variation in Tanis was associated with elevating plasma triglyceride level in Chinese nondiabetic subjects

    PubMed Central

    2013-01-01

    Background The association of genetic polymorphisms of Tanis with triglyceride concentration in human has not been thoroughly examined. We aimed to investigate the relationship between triglyceride concentrations and Tanis genetic polymorphisms. Methods All participants (n=1497) selected from subjects participating in the Cardiovascular Risk Survey (CRS) study were divided into two groups according to ethnicity (Han: n=1059; Uygur: n= 438). Four tagging SNPs (rs12910524, rs1384565, rs2101171, rs4965814) of Tanis gene were genotyped using TaqMan® assays from Applied Biosystems following the manufacturer’s suggestions and analyzed in an ABI 7900HT Fast Real-Time PCR System. Results We found that the SNP rs12910524 was associated with triglyceride levels by analyses of a dominant model (P<0.001), recessive model (P <0.001) and additive model (P < 0.001) not only in Han ethnic but also in Uygur ethnic group, and the difference remained significant after the adjustment of sex, age, alcohol intake, smoking, BMI and plasma glucose (GLU) level (All P < 0.001). However, this relationship was not observed in rs1384565, rs2101171, and rs4965814 before and after multivariate adjustment (All P > 0.05). Furthermore, there were significant interactions between rs12910524 and GLU on TG both in Han (P=0.001) and Uygur population (P=2.60×10-4). Conclusion Our results indicated that the rs12910524 in the Tanis gene was associated with triglyceride concentrations in subjects without diabetes in China. PMID:23829426

  6. PAH/Aromatic Tar and Coke Precursor Formation in the Early Stages of Triglyceride (Triolein) Pyrolysis.

    PubMed

    Alhroub, Ibrahim; Kozliak, Evguenii; Kubátová, Alena; Sulkes, Mark

    2018-03-29

    There has been a limited understanding of high MW polycyclic aromatic hydrocarbon (PAH) product chemistry in the pyrolysis of triglycerides (TGs), though the subject has important implications for both fuel production from TGs and food science. Previous TG pyrolysis studies have been able to identify only relatively low MW GC-elutable aromatics occurring in the bulk liquid phase; products occurring in the solid phase have remained inaccessible to chemical analysis. In contrast, cold gas expansion molecular beam methods, where pyrolysis products are analyzed in real time as they are entrained in gas expansions, remove product collection difficulties, thereby allowing for analysis of coke/tar PAH precursors. In this study, the model TG triolein was heated and the ensuing products in the molecular beam were soft photoionized, enabling time-of-flight mass detection. Use of 266 nm pulses enabled selective photoionization of aromatic products. Unlike previous work on analysis of the liquid phase TG cracking products, a different and distinct pattern of rather large PAHs, up to 444 amu, was observed, at nontrivial relative product fractions. With an increase of temperature to ∼350 °C, a small number of PAHs with MW ≥ 276 amu increasingly dominated the aromatic product distribution. Surprisingly, PAH product detection ensued at rather low temperatures, as low as ∼260 °C. For tentative PAH product identification and product chemistry rationalization, we observed the product homology pattern and applied a stoichiometric analysis. The latter, combined with the known homology profiles of TG cracking products, indicated specific patterns of intermediate fragment association that facilitated large-MW PAH formation as a result of TG cracking.

  7. Isolation, structural elucidation, MS profiling, and evaluation of triglyceride accumulation inhibitory effects of benzophenone C-glucosides from leaves of Mangifera indica L.

    PubMed

    Zhang, Yi; Han, Lifeng; Ge, Dandan; Liu, Xuefeng; Liu, Erwei; Wu, Chunhua; Gao, Xiumei; Wang, Tao

    2013-02-27

    Seventy percent ethanol-water extract from the leaves of Mangifera indica L. (Anacardiaceae) was found to show an inhibitory effect on triglyceride (TG) accumulation in 3T3-L1 cells. From the active fraction, six new benzophenone C-glucosides, foliamangiferosides A(3) (1), A(4) (2), C(4) (3), C(5) (4), C(6) (5), and C(7) (6) together with 11 known benzophenone C-glucosides (7-17) were obtained. In this paper, isolation, structure elucidation (1-6), and MS fragment cleavage pathways of all 17 isolates were studied. 1-6 showed inhibitory effects on TG and free fatty acid accumulation in 3T3-L1 cells at 10 μM.

  8. Hypolipidemic effect of arborium plus in experimentally induced hypercholestermic rabbits.

    PubMed

    Murty, Devarakonda; Rajesh, Enjamoori; Raghava, Doonaboina; Raghavan, Tangaraj Vijaya; Surulivel, Mukanthan Karupiah Munirajan

    2010-06-01

    Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of the ayurvedic herbal formulation Arborium Plus [Hyppophae ramnoides L. fruit juice (S) and Rhododendron arboreum Sm. Linn flower juice (R) in a 1:4 ratio] on triglycerides (TG), total cholesterol (TC), low-density lipoprotein (LDL), atherogenic index (AI), high-density lipoprotein (HDL), and high-sensitivity c-reactive protein (hs CRP) in experimentally induced hypercholesterolemic rabbits. Four groups of rabbits were subjected to different treatments for 8 weeks: control group, CHOL group (1% w/w cholesterol for 8 weeks), S+R group (1% w/w cholesterol and Arborium Plus for 8 weeks), and A group (1% w/w cholesterol and atorvastatin for 8 weeks). The results showed significant increases in TG, TC, LDL, AI, and hs CRP in hypercholesterolemic rabbits which was significantly reduced in Arborium Plus-treated hypercholesterolemic rabbits. The data demonstrated that the Arborium Plus formulation was associated with hypolipidemic effects in experimentally induced hypercholesterolemic rabbits.

  9. Triglyceride-to-HDL-cholesterol ratio and metabolic syndrome as contributors to cardiovascular risk in overweight patients.

    PubMed

    Marotta, Teodoro; Russo, Barbara F; Ferrara, L Aldo

    2010-08-01

    Insulin resistance increases cardiovascular risk of obese patients. Triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL) >or=3.0 (in mg/dl) is a marker of insulin resistance in overweight persons. We aimed at assessing cardiovascular risk profile in 301 overweight elderly Neapolitan outpatients, according to TG/HDL ratio and metabolic syndrome (MS), diagnosed by National Cholesterol Education Program (NCEP) and International Diabetes Federation (IDF) criteria. TG/HDL ratio was >or=3.0 in 97 patients (group A) and <3.0 in 204 (group B). Overall, 93-97% of group A patients and 38-51% of group B patients had MS, depending on the diagnostic criterion. Group A patients with MS had significantly higher waist-to-hip ratio, total and non-HDL cholesterol than group B patients with MS. In group B, MS and non-MS patients had similar waist-to-hip ratio, blood pressure, total and non-HDL cholesterol. Ten year coronary risk, calculated by the Framingham equations (n = 243), was 10.3 +/- 5% in group B, non-MS patients; 13.1 +/- 6% in group B, MS patients; 19.9 +/- 8% in group A (F = 32.8; P < 0.001). At the multiple regression analysis, TG/HDL ratio was associated with coronary risk (r(2) = 0.227) more closely than gender, blood pressure, waist-to-hip ratio, non HDL cholesterol, and MS considered as a whole. A separate regression analysis showed that the logarithmically transformed TG/HDL ratio, an index of the HDL cholesterol esterification rate, is also associated with coronary risk (r(2) = 0.252). Thus, TG/HDL ratio could help to characterize high-risk overweight patients deserving a special therapeutic effort. Cardiovascular risk profile of insulin-sensitive patients, identified by lower values of this parameter, is only moderately affected by MS.

  10. Elevated Serum Triglyceride and Retinol-Binding Protein 4 Levels Associated with Fructose-Sweetened Beverages in Adolescents

    PubMed Central

    Chan, Te-Fu; Lin, Wei-Ting; Chen, Yi-Ling; Huang, Hsiao-Ling; Yang, Wei-Zeng; Lee, Chun-Ying; Chen, Meng-Hsueh; Wang, Tsu-Nai; Huang, Meng-Chuan; Chiu, Yu-Wen; Huang, Chun-Chi; Tsai, Sharon; Lin, Chih-Lung; Lee, Chien-Hung

    2014-01-01

    Background The metabolic effect of fructose in sugar-sweetened beverages (SSB) has been linked to de novo lipogenesis and uric acid (UA) production. Objectives This study investigated the biological effects of SSB consumption on serum lipid profiles and retinol-binding protein 4 (RBP4) among Taiwanese adolescents. Methods We evaluated the anthropometric parameters and biochemical outcomes of 200 representative adolescents (98 boys and 102 girls) who were randomly selected from a large-scale cross-sectional study. Data were analyzed using multiple regression models adjusted for covariates. Results Increased SSB consumption was associated with increased waist and hip circumferences, body mass index (BMI) values and serum UA, triglyceride (TG) and RBP4 levels. Adolescents who consumed >500 ml/day of beverages half-to-heavily sweetened with high-fructose corn syrup (HFCS) exhibited TG and RBP4 levels 22.7 mg/dl and 13.92 ng/ml higher than non-drinkers, respectively. HFCS drinkers with hyperuricemia had higher TG levels than HFCS drinkers with normal UA levels (98.6 vs. 81.6 mg/dl). The intake of HFCS-rich SSBs and high value of BMI (≥24) interactively reinforced RBP4 levels among overweight/obese adolescents. Circulating RBP4 levels were significantly correlated with weight-related outcomes and TG and UA concentration among HFCS drinkers (r = 0.253 to 0.404), but not among non-drinkers. Conclusions High-quantity HFCS-rich beverage consumption is associated with higher TG and RBP4 levels. Hyperuricemia is likely to intensify the influence of HFCS-rich SSB intake on elevated TG levels, and in overweight and obese adolescents, high BMI may modify the action of fructose on higher circulating levels of RBP4. PMID:24475021

  11. Clinical characteristics and beta cell function in Chinese patients with newly diagnosed type 2 diabetes mellitus with different levels of serum triglyceride.

    PubMed

    Zheng, Shuang; Zhou, Huan; Han, Tingting; Li, Yangxue; Zhang, Yao; Liu, Wei; Hu, Yaomin

    2015-04-29

    To explore clinical characteristics and beta cell function in Chinese patients with newly diagnosed drug naive type 2 diabetes mellitus (T2DM) with different levels of serum triglyceride (TG). Patients with newly diagnosed T2DM (n = 624) were enrolled and divided into different groups according to levels of serum TG. All patients underwent oral glucose tolerance tests and insulin releasing tests. Demographic data, lipid profiles, glucose levels, and insulin profiles were compared between different groups. Basic insulin secretion function index (homeostasis model assessment for beta cell function index, HOMA-β), modified beta cell function index (MBCI), glucose disposition indices (DI), and early insulin secretion function index (insulinogenic index, IGI) were used to evaluate the beta cell function. Patients of newly diagnosed T2DM with hypertriglyceridemia were younger, fatter and had worse lipid profiles, glucose profiles, and high insulin levels than those with normal TG. There is no difference in early phase insulin secretion among groups of newly diagnosed T2DM patients with different TG levels. The basal beta cell function (HOMA-β and MBCI) initially increased along rising TG levels and then decreased as the TG levels rose further. The insulin sensitivity was relatively high in patients with a low level of TG and low with a high level of TG. Hypertriglyceridemia influences clinical characteristics and β cell function of Chinese patients with newly diagnosed T2DM. A better management of dyslipidemia may, to some extent, reduce the effect of lipotoxicity, thereby improving glucose homeostasis in patients with newly diagnosed T2DM.

  12. Is triglyceride/HDL ratio a reliable screening test for assessment of atherosclerotic risk in patients with chronic inflammatory disease?

    PubMed

    Keles, Nursen; Aksu, Feyza; Aciksari, Gonul; Yilmaz, Yusuf; Demircioglu, Kenan; Kostek, Osman; Cekin, Muhammed Esad; Kalcik, Macit; Caliskan, Mustafa

    2016-01-01

    The term chronic inflammatory disease (CID) refers to a category of inflammatory diseases that includes Ankylosing spondylitis (AS) and familial Mediterranean fever (FMF). The incidence of adverse cardiovascular events is greater among patients with CID, though they may not have conventional atherosclerotic risk factors. Endothelial dysfunction is one of the underlying fundamental mechanisms that trigger development of atherosclerotic alterations in arteries, and flow-mediated dilatation (FMD) is a noninvasive method to determine endothelial dysfunction. Recent studies have shown a relationship between high triglyceride high-density lipoprotein cholesterol (TG/HDL-C) ratio and coronary atherosclerosis. Many studies have demonstrated that patients with CID have lower FMD values compared to healthy population, indicating endothelial dysfunction. However TG/HDL ratio and its relationship to FMD in patients with CID has not been investigated. The present study investigated whether TG/HDL ratio in CID patients differs from that of healthy population, and its relationship to FMD in patients with CID. A total of 58 patients with CID and a group of 58 healthy volunteer individuals were enrolled in the study. FMD measurements were taken with high resolution ultrasound (US), and TG/HDL ratios were calculated. Patients with CID had significantly higher TG/HDL-C ratio (2.5 [2.2-2.8] vs 2.3 [2.1-2.5]; p=0.03) and lower FMD values (5.2 [4.2-6.3] vs 6.7 [6.3-9.7]; p<0.001), compared to healthy group, and a negative correlation was found between FMD levels and TG/HDL ratio of the study population. Higher TG/HDL ratio and lower FMD values found in CID patients may reflect increased atherosclerotic risk.

  13. Relationship between TG/HDL-C ratio and metabolic syndrome risk factors with chronic kidney disease in healthy adult population.

    PubMed

    Ho, Chih-I; Chen, Jau-Yuan; Chen, Shou-Yen; Tsai, Yi-Wen; Weng, Yi-Ming; Tsao, Yu-Chung; Li, Wen-Cheng

    2015-10-01

    The triglycerides-to-high-density lipoprotein-cholesterol (TG/HDL-C) ratio has been identified as a biomarker of insulin resistance and a predictor for atherosclerosis. The objectives of this study were to investigate which the TG/HDL-C ratio is useful to detect metabolic syndrome (MS) risk factors and subclinical chronic kidney disease (CKD) in general population without known CKD or renal impairment and to compare predictive accuracy of MS risk factors. This was a cross-sectional study. A total 46,255 subjects aged ≥18 years undergoing health examination during 2010-2011 in Taiwan. The independent associations between TG/HDL-C ratio quartiles, waist circumstance (WC) waist-to-height ratio (WHtR), mean atrial pressure (MAP), and CKD prevalence was analyzed by using logistic regression models. Analyses of the areas under receiver operating characteristic (ROC) were performed to determine the accuracy of MS risk factors in predicting CKD. A dose-response manner was observed for the prevalence of CKD and measurements of MS risk factors, showing increases from the lowest to the highest quartile of the TG/HDL-C ratio. Males and females in the highest TG/HDL-C ratio quartile (>2.76) had a 1.4-fold and 1.74-fold greater risk of CKD than those in the lowest quartile (≤1.04), independent of confounding factors. Mean arterial pressure (MAP) had the highest AUC for predicting CKD among MS risk factors. The TG/HDL-C ratio was an independent risk factor for CKD, but it showed no superiority over MAP in predicting CKD. A TG/HDL-C ratio ≥2.76 may be useful in clinical practice to detect subjects with worsened cardiometabolic profile who need monitoring to prevent CKD. TG/HDL-C ratio is an independent risk factor for CKD in adults aged 18-50 years. MAP was the most powerful predictor over other MS risk factors in predicting CKD. However, longitudinal and comparative studies are required to demonstrate the predictive value of TG/HDL-C on the onset and progression of CKD over

  14. 99mTc-EDDA/HYNIC-TOC and (18)F-FDG in thyroid cancer patients with negative (131)I whole-body scans.

    PubMed

    Gabriel, Michael; Froehlich, Franz; Decristoforo, Clemens; Ensinger, Christian; Donnemiller, Eveline; von Guggenberg, Elisabeth; Heute, Dirk; Moncayo, Roy

    2004-03-01

    Several studies have reported on the expression of somatostatin receptors in patients with differentiated thyroid cancer (DTC). The aim of this study was to evaluate the imaging abilities of a recently developed technetium-99m labelled somatostatin analogue, (99m)Tc-EDDA/HYNIC-TOC ((99m)Tc-TOC), in terms of precise localisation of disease. The study population comprised 54 patients (24 men, 30 women; age range 22-90 years) with histologically confirmed DTC who presented with recurrent or persistent disease as indicated by elevated Tg levels after initial treatment. All patients were negative on the iodine-131 post-therapy whole-body scans. Fluorine-18 fluorodeoxyglucose positron emission tomography ((18)F-FDG PET) was performed in a subgroup of 36 patients. The study population consisted of two groups: Group A ( n=22) comprised patients with disease recurrence as shown by elevated Tg levels but without detectable pathology. In group B ( n=32), pre-existing lesions were known. Among the 54 cases, SSTR scintigraphy was true positive in 33 (61.1%), true negative in 4 (7.4%) and false negative in 17 (31.5%) cases, which resulted in a sensitivity of 66%. A total of 138 tumour foci were localised in 33 patients. The fraction of true positive (99m)Tc-TOC findings was positively correlated ( P<0.01) with elevated Tg levels (higher than 30 ng/ml). Despite two false positive findings, analysis on a lesion basis demonstrated better diagnostic efficacy with (18)F-FDG PET ( P<0.001); however, it also revealed substantial agreement between the imaging techniques [Cohen's kappa of 0.62 (0.47-0.78)]. In conclusion, scintigraphy with (99m)Tc-TOC might be a promising tool for treatment planning; it is easy to perform and showed sufficient accuracy for localisation diagnostics in thyroid cancer patients with recurrent or metastatic disease.

  15. [Study on protective effect of Tianji soft capsule on blood lipids, internal antioxidant system and vascular endothelial system in hyperlipidemia rats].

    PubMed

    Ma, Hai-ying; Chen, Jin-yao; Zhang, Li-shi

    2011-11-01

    To study the protective effects of Tianji soft capsule (TJSC) on blood lipids, internal antioxidant system and vascular endothelial system in hyperlipidemia rats. Seventy two healthy male rats were divided into six groups. The rats in control group were administered with ordinary diet. The rats in model group were fed with high cholesterol/lipid diet to induce hyperlipidemia. The rats in TJSC and CoQ10 groups were fed with high cholesterol/lipid diet, and treated with TJSC at different doses of 83 (low-dose group, L), 250 (middle-dose group, M), 750 (high-dose group, H) mg/kg, and CoQ10 at the dose of 83 mg/kg, respectively. All animals were put to death after four weeks, effects on lipid level; antioxidant system and endothelial system were evaluated through detection of total cholesterol (TC), triglyceride (TG), very low density lipoprotein (VLDL), atherogenic index (AI), malondidehyde (MDA) and plasma endothelin (ET), HDL/TC ratio, activities of superoxide dismutase (SOD) and nitric oxide (NO). Compared with model group, serum TC, TG, VLDL, AI, MDA and ET reduced and the HDL/TC ratio increased, meanwhile activities of SOD and NO were enhanced. TJSC can regulate the lipid metabolism, enhance antioxidant system and protect the vascular endothelia system in hyperlipiemic rats.

  16. Effects of Apple Consumption on Lipid Profile of Hyperlipidemic and Overweight Men

    PubMed Central

    Vafa, Mohammad Reza; Haghighatjoo, Elham; Shidfar, Farzad; Afshari, Shirin; Gohari, Mahmood Reza; Ziaee, Amir

    2011-01-01

    Objectives: Fruits and vegetables may be beneficial on lipid profile of hyperlipidemic subjects. The present study was aimed to verify the effect of golden delicious apple on Lipid Profile in hyperlipidemic and overweight men. Methods: Forty six hyperlipidemic and overweight men were randomly divided into two groups. Intervention group received 300g golden delicious apple per day for 8 weeks. Control group had the regular dietary regimen for the same period of time. Blood samples were analyzed for serum triglycerides (TG), total cholesterol (TC), low density lipoprotein-cholesterol (LDL-C), high density lipoprotein-cholesterol (HDL-C), very low density lipoprotein-cholesterol (VLDL), apolipoprotein B (Apo B), lipoprotein a (Lp a) and LDL/HDL ratio at baseline and after intervention. Results: Total polyphenols and fibers were 485 mg/kg and 4.03 g/100g in fresh apple respectively. After 8 weeks, significant statistical differences were observed considering the TG and VLDL levels between two groups, but no significant differences were observed regarding TC, LDL-C, HDL-C, Apo (B), Lp (a) and LDL/HDL ratio. Conclusions: Consumption of Golden delicious apple may be increased serum TG and VLDL in hyperlipidemic and overweight men. We need more studies to assay the effect of apple consumption on serum TC, LDL-C, HDL-C, Apo (B), Lp (a) and LDL/HDL ratio. PMID:21603015

  17. Griffiths-like phase in high TC perovskite La2FeReO6 prepared in a controlled reducing atmosphere

    NASA Astrophysics Data System (ADS)

    Kaipamagalath, Aswathi; Palakkal, Jasnamol P.; Varma, Manoj R.

    2018-05-01

    The perovskite La2FeReO6 is prepared by solid-state reaction method. Calcination was done in a controlled reducing atmosphere. The structure of the compound is found to be orthorhombic with Pbnm space group. From the DC magnetic studies, the transition temperature (TC) of La2FeReO6 is found to be at 729 K. A Griffiths-like phase is present in the material with ferromagnetic short-range correlations above TC up to the Griffiths temperature TG = 863 K.

  18. α-Tocopherol Attenuates the Triglyceride- and Cholesterol-Lowering Effects of Rice Bran Tocotrienol in Rats Fed a Western Diet.

    PubMed

    Shibata, Akira; Kawakami, Yuki; Kimura, Toshiyuki; Miyazawa, Teruo; Nakagawa, Kiyotaka

    2016-07-06

    Previous studies demonstrated the ability of tocotrienol (T3) to lower levels of lipids, including cholesterol (Cho) and triglycerides (TG). Although α-tocopherol (α-Toc) reportedly inhibits the hypocholesterolemic effect of T3, there is no information about whether α-Toc influences the TG-lowering effect of T3 in vivo. In this study, we investigated the influence of α-Toc on the antihyperlipidemic effects (Cho- and TG-lowering) of rice bran tocotrienols (RBT3) in F344 rats fed a western diet. α-Toc attenuated both the Cho- and TG-lowering effects of RBT3 in vivo, whereas α-Toc alone exhibited no hypolipidemic effects. RBT3-induced Cpt-1a and Cyp7a1 gene expression was reduced by α-Toc. Furthermore, coadministration of α-Toc decreased liver and adipose tissue concentrations of tocotrienols in F344 rats. These results indicate that α-Toc has almost no antihyperlipidemic effect in vivo, but abrogates the antihyperlipidemic effect of RBT3 by reducing tissue concentrations of tocotrienols and regulating expression of genes involved in lipid metabolism. Understanding the underlying mechanism of the beneficial effects of T3 on lipid metabolism and the interaction with α-Toc will be important for developing T3-based therapeutics.

  19. Association of APOA5 -1131T>C polymorphism and serum lipid levels in patients with type 2 diabetes.

    PubMed

    Celap, Ivana; Simundic, Ana-Maria; Nikolac, Nora; Kackov, Sanja; Katalinic, Darko

    2013-10-01

    Significant abnormalities in lipid metabolism are frequently present in patients with type 2 diabetes mellitus (T2DM). Hypertriglyceridemia, a highly proatherogenic state, is associated with increased risk of coronary artery disease. Genetic polymorphism APOA5 -1131T>C has been recognized as a significant contributor to hypertriglyceridemia in both healthy and diabetic populations. The aim of the study was to investigate the association of APOA5 -1131T>C polymorphism with the serum levels of triglycerides, total cholesterol, high-density lipoprotein (HDL) cholesterol, and low-density lipoprotein (LDL) cholesterol in patients with T2DM. In total, 234 DNA samples from patients with T2DM were genotyped using the PCR-RFLP method. Serum lipid levels were measured using standard laboratory methods. Obtained APOA5 -1131T>C genotype frequencies were 89% (T/T) and 11% (T/C+C/C). There was no significant association between APOA5 -1131T>C genotypes and triglyceride levels (1.90 mM [1.32-2.74] vs. 1.78 mM [1.54-3.05] for T/T vs. T/C+C/C genotype; p=0.553), HDL cholesterol levels (1.30 mM [1.10-1.40] vs. 1.30 mM [1.05-1.40] for T/T vs. T/C+C/C; p=0.534), and LDL cholesterol levels (3.1 mM [2.3-3.8] vs. 3.0 mM [2.2-3.5] for T/T vs. T/C+C/C; p=0.313). Our results suggest that hypertriglyceridemia in patients with T2DM is not likely to be associated with the APOA5 -1131T>C polymorphism.

  20. Selenium Level and Dyslipidemia in Rural Elderly Chinese

    PubMed Central

    Su, Liqin; Gao, Sujuan; Unverzagt, Frederick W.; Cheng, Yibin; Hake, Ann M.; Xin, Pengju; Chen, Chen; Liu, Jingyi; Ma, Feng; Bian, Jianchao; Li, Ping; Jin, Yinlong

    2015-01-01

    Objective Higher selenium level has been hypothesized to have the potential to reduce the risk of cardiovascular diseases including dyslipidemia. However, results from previous studies are inconsistent. This study aims to determine the association between selenium level and dyslipidemia in elderly Chinese with relatively low selenium status. Methods A cross-sectional study of 1859 participants aged 65 or older from four rural counties in China was conducted. Serum total cholesterol (TC), triglycerides (TG), high density lipoprotein-cholesterol (HDLC) and low-density lipoprotein-cholesterol (LDLC), nail selenium concentration and APOE genotype were measured in all subjects. The four types of dyslipidemia were defined as >5.17mmol/L for High-TC, >1.69 mmol/L for High-TG, >3.36 mmol/L for High-LDLC, and <1.04 mmol/L for Low-HDLC according to Chinese Guidelines on Prevention and Treatment of Dyslipidemia in Adults. Logistic models adjusting for age, gender, APOE genotype, body mass index, alcohol consumption, smoking, physical activity, medication use for cardiovascular diseases were used to examine the relationship between selenium levels and the risk of dyslipidemia. Results Mean nail selenium concentration was 0.465μg/gin this sample. Rates for High-TC, High-LDLC, High-TG, Low-HDLC were 18.13%, 13.23%, 12.21% and 32.76% respectively. Results from logistic models indicated that higher selenium levels were significantly associated with higher risk of High-TC, High-LDLC and lower risk of Low-HDLC adjusting for covariates (p < 0.0001). Compared with the lowest selenium quartile group, participants in selenium quartile groups 2, 3 and 4 had significantly higher rates of High-TC, High-LDLC, High-TG, and lower rate of Low-HDLC adjusting for covariates. No significant association was observed between selenium level and the risk of High-TG. APOEε4 carriers had higher rates of High-TC and High-LDLC. There was no interaction between selenium level and APOE with the rates of

  1. A human APOC3 missense variant and monoclonal antibody accelerate apoC-III clearance and lower triglyceride-rich lipoprotein levels.

    PubMed

    Khetarpal, Sumeet A; Zeng, Xuemei; Millar, John S; Vitali, Cecilia; Somasundara, Amritha Varshini Hanasoge; Zanoni, Paolo; Landro, James A; Barucci, Nicole; Zavadoski, William J; Sun, Zhiyuan; de Haard, Hans; Toth, Ildikó V; Peloso, Gina M; Natarajan, Pradeep; Cuchel, Marina; Lund-Katz, Sissel; Phillips, Michael C; Tall, Alan R; Kathiresan, Sekar; DaSilva-Jardine, Paul; Yates, Nathan A; Rader, Daniel J

    2017-09-01

    Recent large-scale genetic sequencing efforts have identified rare coding variants in genes in the triglyceride-rich lipoprotein (TRL) clearance pathway that are protective against coronary heart disease (CHD), independently of LDL cholesterol (LDL-C) levels. Insight into the mechanisms of protection of these variants may facilitate the development of new therapies for lowering TRL levels. The gene APOC3 encodes apoC-III, a critical inhibitor of triglyceride (TG) lipolysis and remnant TRL clearance. Here we report a detailed interrogation of the mechanism of TRL lowering by the APOC3 Ala43Thr (A43T) variant, the only missense (rather than protein-truncating) variant in APOC3 reported to be TG lowering and protective against CHD. We found that both human APOC3 A43T heterozygotes and mice expressing human APOC3 A43T display markedly reduced circulating apoC-III levels. In mice, this reduction is due to impaired binding of A43T apoC-III to lipoproteins and accelerated renal catabolism of free apoC-III. Moreover, the reduced content of apoC-III in TRLs resulted in accelerated clearance of circulating TRLs. On the basis of this protective mechanism, we developed a monoclonal antibody targeting lipoprotein-bound human apoC-III that promotes circulating apoC-III clearance in mice expressing human APOC3 and enhances TRL catabolism in vivo. These data reveal the molecular mechanism by which a missense variant in APOC3 causes reduced circulating TG levels and, hence, protects from CHD. This protective mechanism has the potential to be exploited as a new therapeutic approach to reduce apoC-III levels and circulating TRL burden.

  2. [The role of CD14 promoter - 159 C-> T polymorphism on changes of serum lipid ratios induced by high-carbohydrate/low-fat diets in healthy Chinese Han youth].

    PubMed

    Jiang, Zhe; Gong, Ren-rong; Li, Yuan-hao; Fan, Mei; Fang, Ding-zhi

    2012-05-01

    To investigate the role of CD14 promoter - 159 C-> T polymorphism on ratios of serum lipids and its interaction on the ratios with a high-carbohydrate/low-fat (HC/LF) diet in a young and healthy Chinese Han population. After a washout diet for seven days, fifty six healthy young subjects (22.89 +/- 1.80 years) were given the HC/LF diet for six days. Twelve-hour fasting venous blood samples were collected in the mornings of the first, the eighth and the fourteenth days. The serum lipid profiles and the CD14 -159 C->T polymorphism were analyzed. The ratios of triglyceride/high density lipoprotein-cholesterol (TG/HDL-c), log (TG/HDL-c), total cholesterol/high density lipoprotein-cholesterol (TC/HDL-c) and low density lipoprotein-cholesterol/high density lipoprotein-cholesterol (LDL-c/HDL-c) were calculated. The male carriers of the C allele had significantly higher TG/HDL-c and log (TG/HDL-c) than the female carriers at baseline, after the washout diet and after the HC/LF diet, higher TC/HDL-c at baseline and after the washout diet, and higher LDL-c/HDL-c only after the washout diet. The female subjects with the TT genotype had higher TG/HDL-c and log (TG/HDL-c) than the female carriers of the C allele at baseline, after the washout diet and after the HC/LF diet, higher LDL-c/HDL-c at baseline and after the HC/LF diet, and higher TC/HDL-c only after the washout diet. Compared with that before the HC/LF diet, TC/HDL-c was significantly decreased after the HC/LF diet regardless of gender and the genotype of the CD14 -159 polymorphism. LDL-c/HDL-c was significantly decreased in both the male and female carriers of the C allele. TG/HDL-c and log (TG/HDL-c) were significantly increased only in the female carriers of the C allele. In the subjects with C allele, the HC/LF diet is a minor factor and its effects on the lipid ratios can be masked by the effects of the C allele at CD14 -159. The interaction between the HC/LF diet and the C allele at CD14 -159 can decrease LDL

  3. Increased VLDL-triglyceride secretion precedes impaired control of endogenous glucose production in obese, normoglycemic men.

    PubMed

    Sørensen, Lars P; Søndergaard, Esben; Nellemann, Birgitte; Christiansen, Jens S; Gormsen, Lars C; Nielsen, Søren

    2011-09-01

    To assess basal and insulin-mediated VLDL-triglyceride (TG) kinetics and the relationship between VLDL-TG secretion and hepatic insulin resistance assessed by endogenous glucose production (EGP) in obese and lean men. A total of 12 normoglycemic, obese (waist-to-hip ratio >0.9, BMI >30 kg/m(2)) and 12 lean (BMI 20-25 kg/m(2)) age-matched men were included. Ex vivo-labeled [1-(14)C]VLDL-TGs and [3-(3)H]glucose were infused postabsorptively and during a hyperinsulinemic-euglycemic clamp to determine VLDL-TG kinetics and EGP. Body composition was determined by dual X-ray absorptiometry and computed tomography scanning. Energy expenditure and substrate oxidation rates were measured by indirect calorimetry. Basal VLDL-TG secretion rates were increased in obese compared with lean men (1.25 ± 0.34 vs. 0.86 ± 0.34 μmol/kg fat-free mass [FFM]/min; P = 0.011), whereas there was no difference in clearance rates (150 ± 56 vs. 162 ± 77 mL/min; P = NS), resulting in greater VLDL-TG concentrations (0.74 ± 0.40 vs. 0.38 ± 0.20 mmol/L; P = 0.011). The absolute insulin-mediated suppression of VLDL-TG secretion was similar in the groups. However, the percentage reduction (-36 ± 18 vs. -54 ± 10%; P = 0.008) and achieved VLDL-TG secretion rates (0.76 ± 0.20 vs. 0.41 ± 0.19 μmol/kg FFM/min; P < 0.001) were impaired in obese men. Furthermore, clearance rates decreased significantly in obese men, but there was no significant change in lean men (-17 ± 18 vs. 7 ± 20%; P = 0.007), resulting in less percentage reduction of VLDL-TG concentrations in obese men (-22 ± 20 vs. -56 ± 11%; P < 0.001). Insulin-suppressed EGP was similar (0.4 [0.0-0.8] vs. 0.1 [0.0-1.2] mg/kg FFM/min (median [range]); P = NS), and the percentage reduction was equivalent (-80% [57-98] vs. -98% [49-100], P = NS). Insulin-mediated glucose disposal was significantly reduced in obese men. Basal VLDL-TG secretion rates are increased in normoglycemic but insulin-resistant, obese men, resulting in

  4. Impact of apolipoprotein A5 (APOA5) polymorphisms on serum triglyceride levels in schizophrenic patients under long-term atypical antipsychotic treatment.

    PubMed

    Hong, Chen-Jee; Chen, Tzu-Ting; Bai, Ya Mei; Liou, Ying-Jay; Tsai, Shih-Jen

    2012-01-01

    Schizophrenic patients treated with clozapine or olanzapine often develop hypertriglyceridemia. The apolipoprotein A5 gene (APOA5), which affects VLDL production and lipolysis, has been implicated in the triglyceride (TG) metabolism. This study examined the association of common APOA5 genetic variants and TG levels in chronically institutionalized schizophrenic patients, on a stable dose of atypical antipsychotic (clozapine, olanzapine or risperidone. The TG levels in 466 schizophrenic patients treated with clozapine (n = 182), olanzapine (n = 89) or risperidone (n = 195) were measured. Patients were genotyped for the three APOA5 single nucleotide polymorphisms (SNPs) rs662799 (-1131T > C), rs651821 (3A > G) and rs2266788 (1891T > C). A gene × drug interaction with TG levels was observed. In single-marker-based analysis, the minor alleles of the two polymorphisms (-1131C and -3G) were observed to be associated with increased TGs in patients treated with risperidone, but not with clozapine or olanzapine. Haplotype analysis further revealed that carriers of the haplotype constructed with the three minor alleles had higher TG levels than those who did not carry this haplotype in patients taking risperidone (CGC((+/+)) vs. = 125.4 ± 59.1 vs. 82.2 ± 65.8, P = 0.015; CGC((-/+ )) vs. CGC((-/-)) = 113.7 ± 80.4 vs. 82.2 ± 65.8, P = 0.012). Our findings extend and add new information to the existing data regarding the association between APOA5 and TG regulation during long-term atypical antipsychotic treatment.

  5. Comparison between TG-51 and TG-21: Calibration of photon and electron beams in water using cylindrical chambers.

    PubMed

    Cho, S H; Lowenstein, J R; Balter, P A; Wells, N H; Hanson, W F

    2000-01-01

    A new calibration protocol, developed by the AAPM Task Group 51 (TG-51) to replace the TG-21 protocol, is based on an absorbed-dose to water standard and calibration factor (N(D,w)), while the TG-21 protocol is based on an exposure (or air-kerma) standard and calibration factor (N(x)). Because of differences between these standards and the two protocols, the results of clinical reference dosimetry based on TG-51 may be somewhat different from those based on TG-21. The Radiological Physics Center has conducted a systematic comparison between the two protocols, in which photon and electron beam outputs following both protocols were compared under identical conditions. Cylindrical chambers used in this study were selected from the list given in the TG-51 report, covering the majority of current manufacturers. Measured ratios between absorbed-dose and air-kerma calibration factors, derived from the standards traceable to the NIST, were compared with calculated values using the TG-21 protocol. The comparison suggests that there is roughly a 1% discrepancy between measured and calculated ratios. This discrepancy may provide a reasonable measure of possible changes between the absorbed-dose to water determined by TG-51 and that determined by TG-21 for photon beam calibrations. The typical change in a 6 MV photon beam calibration following the implementation of the TG-51 protocol was about 1%, regardless of the chamber used, and the change was somewhat smaller for an 18 MV photon beam. On the other hand, the results for 9 and 16 MeV electron beams show larger changes up to 2%, perhaps because of the updated electron stopping power data used for the TG-51 protocol, in addition to the inherent 1% discrepancy presented in the calibration factors. The results also indicate that the changes may be dependent on the electron energy.

  6. Ultrasound assisted production of fatty acid methyl esters from transesterification of triglycerides with methanol in the presence of KOH catalyst: optimization, mechanism and kinetics.

    PubMed

    Thanh, Le Tu; Okitsu, Kenji; Maeda, Yasuaki; Bandow, Hiroshi

    2014-03-01

    Ultrasound assisted transesterification of triglycerides (TG) with methanol in the presence of KOH catalyst was investigated, where the changes in the reactants and products (diglycerides (DG), monoglycerides (MG), fatty acid methyl esters (FAME) and glycerin (GL)) concentrations were discussed to understand the reaction mechanism and kinetics under ultrasound irradiation. The optimum reaction condition for the FAME production was the concentration of KOH 1.0 wt.%, molar ratio of TG to methanol of 1:6, and irradiation time of 25 min. The rate constants during the TG transesterification with methanol into GL and FAME were estimated by a curve fitting method with simulated curves to the obtained experimental results. The rate constants of [Formula: see text] were estimated to be 0.21, 0.008, 0.23, 0.005, 0.14 and 0.001 L mol(-1)min(-1), respectively. The rate determining step for the TG transesterification with methanol into GL and FAME was the reaction of MG with methanol into GL and FAME. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Novel Genetic Loci Associated with the Plasma Triglyceride Response to an Omega-3 Fatty Acid Supplementation.

    PubMed

    Vallée Marcotte, Bastien; Cormier, Hubert; Guénard, Frédéric; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

    2016-01-01

    A recent genome-wide association study (GWAS) by our group identified 13 loci associated with the plasma triglyceride (TG) response to omega-3 (n-3) fatty acid (FA) supplementation. This study aimed to test whether single-nucleotide polymorphisms (SNPs) within the IQCJ, NXPH1, PHF17 and MYB genes are associated with the plasma TG response to an n-3 FA supplementation. A total of 208 subjects followed a 6-week n-3 FA supplementation of 5 g/day of fish oil (1.9-2.2 g of eicosapentaenoic acid and 1.1 g of docosahexaenoic acid). Measurements of plasma lipids were made before and after the supplementation. Sixty-seven tagged SNPs were selected to increase the density of markers near GWAS hits. In a repeated model, independent effects of the genotype and the gene-supplementation interaction were associated with plasma TG. Genotype effects were observed with two SNPs of NXPH1, and gene-diet interactions were observed with ten SNPs of IQCJ, four SNPs of NXPH1 and three SNPs of MYB. Positive and negative responders showed different genotype frequencies with nine SNPs of IQCJ, two SNPs of NXPH1 and two SNPs of MYB. Fine mapping in GWAS-associated loci allowed the identification of SNPs partly explaining the large interindividual variability observed in plasma TG levels in response to an n-3 FA supplementation. © 2016 S. Karger AG, Basel.

  8. DGAT2 Inhibition Alters Aspects of Triglyceride Metabolism in Rodents but Not in Non-human Primates.

    PubMed

    McLaren, David G; Han, Seongah; Murphy, Beth Ann; Wilsie, Larissa; Stout, Steven J; Zhou, Haihong; Roddy, Thomas P; Gorski, Judith N; Metzger, Daniel E; Shin, Myung K; Reilly, Dermot F; Zhou, Heather H; Tadin-Strapps, Marija; Bartz, Steven R; Cumiskey, Anne-Marie; Graham, Thomas H; Shen, Dong-Ming; Akinsanya, Karen O; Previs, Stephen F; Imbriglio, Jason E; Pinto, Shirly

    2018-06-05

    Diacylglycerol acyltransferase 2 (DGAT2) catalyzes the final step in triglyceride (TG) synthesis and has been shown to play a role in regulating hepatic very-low-density lipoprotein (VLDL) production in rodents. To explore the potential of DGAT2 as a therapeutic target for the treatment of dyslipidemia, we tested the effects of small-molecule inhibitors and gene silencing both in vitro and in vivo. Consistent with prior reports, chronic inhibition of DGAT2 in a murine model of obesity led to correction of multiple lipid parameters. In contrast, experiments in primary human, rhesus, and cynomolgus hepatocytes demonstrated that selective inhibition of DGAT2 has only a modest effect. Acute and chronic inhibition of DGAT2 in rhesus primates recapitulated the in vitro data yielding no significant effects on production of plasma TG or VLDL apolipoprotein B. These results call into question whether selective inhibition of DGAT2 is sufficient for remediation of dyslipidemia. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Comparison of cardiovascular protective effects of tropical seaweeds, Kappaphycus alvarezii, Caulerpa lentillifera, and Sargassum polycystum, on high-cholesterol/high-fat diet in rats.

    PubMed

    Matanjun, Patricia; Mohamed, Suhaila; Muhammad, Kharidah; Mustapha, Noordin Mohamed

    2010-08-01

    This study was designed to investigate the comparative in vivo cardiovascular protective effects of red, green, and brown tropical seaweeds, namely, Kappaphycus alvarezii (or Eucheuma cottonii), Caulerpa lentillifera, and Sargassum polycystum, in rats fed on high-cholesterol/high-fat (HCF) diets. Male Sprague-Dawley rats (weighing 260-300 g) on the HCF diet had significantly increased body weight, plasma total cholesterol (TC), plasma low-density lipoprotein cholesterol (LDL-C), plasma triglycerides (TG), lipid peroxidation, and erythrocyte glutathione peroxidase (GSH-Px) and superoxide dismutase levels after 16 weeks. Supplementing 5% seaweeds to HCF diet significantly reduced plasma TC (-11.4% to -18.5%), LDL-C (-22% to -49.3%), and TG (-33.7% to -36.1%) levels and significantly increased HDL-C levels (16.3-55%). Among the seaweeds, S. polycystum showed the best anti-obesity and blood GSH-Px properties, K. alvarezii showed the best antihyperlipemic and in vivo antioxidation effects, and C. lentillifera was most effective at reducing plasma TC. All seaweeds significantly reduced body weight gain, erythrocyte GSH-Px, and plasma lipid peroxidation of HCF diet rats towards the values of normal rats.

  10. Age Dependency of Myocardial Triglyceride Content: A 3T High-Field 1H-MR Spectroscopy Study.

    PubMed

    Petritsch, B; Gassenmaier, T; Kunz, A S; Donhauser, J; Goltz, J P; Bley, T A; Horn, M

    2015-11-01

    The role of myocardial triglyceride (mTG) content in the aging human heart is not entirely understood. The aim of this study was to measure concentrations of mTG content from healthy volunteers and to determine the association between age, mTG content and systolic heart function. Furthermore, the technical stability of the (1)H-magnetic resonance spectroscopy ((1)H-MRS) and the reliability of peak evaluation at 3 T were evaluated. The total study population of 47 healthy volunteers was divided into 4 age classes, according to the age of the subjects (1(st) cohort 20 - 29 years (yrs.), n = 20; 2(nd) cohort 30 - 39 yrs., n = 10; 3(rd) cohort 40 - 49 yrs., n = 9; 4(th) cohort 50 - 60 yrs., n = 8). Cardiac MRI and double triggered (1)H-MRS of the myocardium were consecutively performed using a 3 T scanner. Each participant underwent spectroscopic measurements twice in the same investigation. mTG content increases with age. The correlation of age and mTG is minimal (r = 0.48; p < 0.001). The following age-averaged mTG content values expressed as % of mTG signal compared to the water signal were determined for each cohort: 1(st) cohort 0.25 % (± 0.17); 2(nd) cohort 0.48 % (± 0.30); 3(rd) cohort 0.48 % (± 0.18); 4(th) cohort 0.77 % (± 0.70). There was no significant correlation (r = 0.04; p = n.s.) between LV mass and mTG content in healthy volunteers. Within our cohorts, no effects of age or mTG content on systolic heart function were seen (r = - 0.01; p = n.s.). The intraclass correlation coefficient of spectroscopic measurements was high (r = 0.965; p < 0.001). Myocardial TG content increases with age. The normal age-dependent concentration ranges of myocardial lipid metabolites reported in this study may be helpful for the correction of acquired (1)H-MRS data in patients when evaluating metabolic and cardiovascular diseases in future magnetic resonance spectroscopy studies.

  11. Dyslipidemia patterns are differentially associated with dietary factors.

    PubMed

    Song, SuJin; Paik, Hee Young; Park, Minseon; Song, YoonJu

    2016-08-01

    Dyslipidemia, a strong predictor of cardiovascular diseases, is prevalent among Korean adults, but little is known about the associations between overall lipid profiles and dietary factors. We identified dyslipidemia patterns among lipid indicators and examined dietary factors associated with dyslipidemia patterns in Korean adults. Subjects in this cross-sectional study were recruited from the Family Medicine Division or the Health Examination Center of the general hospital in Seoul between 2010 and 2012. Measurements of biochemical and dietary variables repeated three times were collected from a total of 138 subjects at 3- to 4-month intervals when the subjects visited the hospital. Dietary intake data were obtained using 24-h recalls. In order to estimate typical values for biochemical and dietary variables, the averages of repeated measures for each subject were calculated. To identify dyslipidemia patterns, factor analysis was used based on total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), triglycerides (TG), and high-density lipoprotein cholesterol (HDLC). Two dyslipidemia patterns, (1) TC & LDLC and (2) TG & HDLC, were identified. Dietary fat and cholesterol intakes were positively associated with the TC & LDLC pattern score, but not associated with the TG & HDLC pattern score. The TG & HDLC pattern was significantly associated with low intakes of calcium, potassium, milk and dairy products. Two dyslipidemia patterns were associated with dietary factors in Korean adults. Further studies should investigate specific dietary recommendations according to lipid profiles in the prevention and management of dyslipidemia in Korea. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  12. Usefulness of triglycerides-to-high-density lipoprotein cholesterol ratio for predicting the first coronary event in men.

    PubMed

    Cordero, Alberto; Andrés, Eva; Ordoñez, Beatriz; León, Montserrat; Laclaustra, Martín; Grima, Alberto; Luengo, Emilio; Moreno, José; Bes, María; Pascual, Isaac; Civeira, Fernando; Pocoví, Miguel; Alegría, Eduardo; Casasnovas, José A

    2009-11-15

    Overweight and obesity potentiate the development of cardiovascular risk factors but many doubts have arisen recently regarding their role in coronary events. We evaluated the predictive value of a surrogate maker of insulin resistance, the ratio of triglyceride (TG) to high-density lipoprotein (HDL), for the incidence of a first coronary event in men workers according to body mass index (BMI). We designed a case-control study of active subjects collected from a single factory through their annual health examination and medical reports. Case subjects included those with myocardial infarction, unstable angina pectoris, or subclinical myocardial ischemia detected through electrocardiographic abnormalities. The sample was constituted by 208 case and 2,080 control subjects (mean age 49.9 years, 49.6 to 50.2). General characteristics of case and control subjects were well matched. The TG/HDL ratio was significantly higher in case subjects compared to controls. Stratification of the sample revealed an increasing prevalence of case subjects and mean TG/HDL in each category of BMI. Multivariable analysis, adjusted by smoking, demonstrated that TG/HDL increased 50% the risk of a first coronary event (odds ratio [OR] 1.47, 95% confidence interval [CI] 1.26 to 1.71), whereas low-density lipoprotein cholesterol values indicated a more moderate increased risk (OR 1.01, 95% CI 1.005 to 1.012); metabolic syndrome (OR 1.76, 95% CI 0.94 to 3.30) and hypertension (OR 1.50, 95% CI 0.81 to 2.79) did not reach statistical significance. The TG/HDL ratio was associated with a first coronary event in all categories of BMI. In conclusion, the TG/HDL ratio has a high predictive value of a first coronary event regardless of BMI.

  13. Mediation analysis reveals a sex-dependent association between ABO gene variants and TG/HDL-C ratio that is suppressed by sE-selectin level.

    PubMed

    Teng, Ming-Sheng; Hsu, Lung-An; Wu, Semon; Chou, Hsin-Hua; Chang, Chi-Jen; Sun, Yu-Zen; Juan, Shu-Hui; Ko, Yu-Lin

    2013-06-01

    Previous investigations have revealed an association between the ABO locus/blood group and total cholesterol and inflammatory biomarker levels. We aimed to test the statistical association of ABO locus variants with lipid profiles and levels of thirteen inflammatory markers in a Taiwanese population. A sample population of 617 Taiwanese subjects was enrolled. Five ABO gene region polymorphisms were selected and genotyped. After adjusting for clinical covariates and inflammatory marker levels, the genetic-inferred ABO blood group genotypes were associated with sE-selectin level (P = 3.5 × 10(-36)). Significantly higher total and low-density lipoprotein cholesterol (LDL-C) levels were noted in individuals with blood group A (P = 7.2 × 10(-4) and P = 7.3 × 10(-4), respectively). Interestingly, after adjusting for sE-selectin level, significantly lower high-density lipoprotein cholesterol (HDL-C) level as well as higher triglyceride (TG) level and ratio of triglyceride to HDL-C (TG/HDL-C ratio) were noted in individuals with blood group A comparing to non-A individuals (P = 0.009, P = 0.004 and P = 0.001, respectively); these associations were also observed in the group A male subjects (P = 0.027, P = 0.001, and P = 0.002, respectively). Mediation analysis further revealed a suppression effect of sE-selectin level on the association between genetic-inferred ABO blood group genotypes and TG/HDL-C ratio in total participants (P = 1.18 × 10(-6)) and in males (P = 5.99 × 10(-5)). Genetic variants at the ABO locus independently affect sE-selectin level in Taiwanese subjects, while the association of ABO locus variants with TG/HDL-C ratio is suppressed by sE-selectin level in Taiwanese males. These results provided further evidence for the mechanism in the association of ABO blood groups with atherosclerotic cardiovascular diseases. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  14. The effect of preoperative serum triglycerides and high-density lipoprotein-cholesterol levels on the prognosis of breast cancer.

    PubMed

    Li, Xing; Tang, Hailin; Wang, Jin; Xie, Xinhua; Liu, Peng; Kong, Yanan; Ye, Feng; Shuang, Zeyu; Xie, Zeming; Xie, Xiaoming

    2017-04-01

    Although dyslipidemia has been documented to be associated with several types of cancer including breast cancer, it remains uncertainty the prognostic value of serum lipid in breast cancer. The purpose of this study is to evaluate the association between the preoperative plasma lipid profile and the prognostic of breast cancer patients. The levels of preoperative serum lipid profile (including cholesterol [CHO], Triglycerides [TG], high-density lipoprotein-cholesterol [HDL-C], low-density lipoprotein-cholesterol [LDL-C], apolipoprotein A-I [ApoAI], and apolipoprotein B [ApoB]) and the clinical data were retrospectively collected and reviewed in 1044 breast cancer patients undergoing operation. Kaplan-Meier method and the Cox proportional hazards regression model were used in analyzing the overall survival [OS] and disease-free survival [DFS]. Combining the receiver-operating characteristic and Kaplan-Meier analysis, we found that preoperative lower TG and HDL-C level were risk factors of breast cancer patients. In multivariate analyses, a decreased HDL-C level showed significant association with worse OS (HR: 0.528; 95% CI: 0.302-0.923; P = 0.025), whereas a decreased TG level showed significant association with worse DFS (HR: 0.569; 95% CI: 0.370-0.873; P = 0.010). Preoperative serum levels of TG and HDL-C may be independent factor to predict outcome in breast cancer patient. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. N-3 Fatty Acid Rich Triglyceride Emulsions Are Neuroprotective after Cerebral Hypoxic-Ischemic Injury in Neonatal Mice

    PubMed Central

    Vannucci, Susan J.; Mastropietro, Christopher; Bazan, Nicolas G.; Ten, Vadim S.; Deckelbaum, Richard J.

    2013-01-01

    We questioned if acute administration of n-3 fatty acids (FA) carried in n-3 rich triglyceride (TG) emulsions provides neuroprotection in neonatal mice subjected to hypoxic-ischemic (H/I) brain injury. We examined specificity of FA, optimal doses, and therapeutic windows for neuroprotection after H/I. H/I insult was induced in C57BL/6J 10-day-old mice by right carotid artery ligation followed by exposure to 8% O2 for 15 minutes at 37°C. Intraperitoneal injection with n-3-rich TG emulsions, n-6 rich TG emulsions or saline for control was administered at different time points before and/or after H/I. In separate experiments, dose responses were determined with TG containing only docosahexaenoic acid (Tri-DHA) or eicosapentaenoic acid (Tri-EPA) with a range of 0.1–0.375 g n-3 TG/kg, administered immediately after H/I insult. Infarct volume and cerebral blood flow (CBF) were measured. Treatment with n-3 TG emulsions both before- and after- H/I significantly reduced total infarct volume by a mean of 43% when administered 90 min prior to H/I and by 47% when administered immediately after H/I. In post-H/I experiments Tri-DHA, but not Tri-EPA exhibited neuroprotective effects with both low and high doses (p<0.05). Moreover, delayed post-H/I treatment with Tri-DHA significantly decreased total infarct volume by a mean of 51% when administered at 0 hr, by 46% at 1 hr, and by 51% at 2 hr after H/I insult. No protective effect occurred with Tri-DHA injection at 4 hr after H/I. There were no n-3 TG related differences in CBF. A significant reduction in brain tissue death was maintained after Tri-DHA injection at 8 wk after the initial brain injury. Thus, n-3 TG, specifically containing DHA, is protective against H/I induced brain infarction when administered up to 2 hr after H/I injury. Acute administration of TG-rich DHA may prove effective for treatment of stroke in humans. PMID:23437099

  16. PROMETHEUS: an observational, cross-sectional, retrospective study of hypertriglyceridemia in Russia.

    PubMed

    Karpov, Yuri; Khomitskaya, Yunona

    2015-08-25

    Data regarding the prevalence of hypertriglyceridemia in the Russian population are lacking, despite triglyceride (TG)-mediated pathways being causal in cardiovascular disease. The prevalence of mixed dyslipidemia and severe hypertriglyceridemia in the Russian population (PROMETHEUS) was undertaken to address this gap. This was an observational, cross-sectional retrospective study. Data from adults with a full/partial lipoprotein record who had blood analyses done at an INVITRO laboratory in Russia between January 1, 2011 and December 31, 2013 were analyzed. The primary endpoint was the prevalence of hypertriglyceridemia (TG ≥ 1.7 mmol/L); secondary endpoints included prevalence of borderline high, high, and very high TG and severe hypertriglyceridemia, defined as a TG level of 1.7 to <2.3, 2.3 to <5.6, ≥5.6, and ≥10.0 mmol/L, respectively. Statistical analyses involved the Wilcoxon and the Chi square tests. Correlations between log-transformed TG and low- and high-density lipoprotein cholesterol (LDL-C and HDL-C) and total cholesterol (TC) were assessed. The correlation between glycated hemoglobin (HbA1c) and TG levels in a nested sample of subjects with HbA1c and TG data was also assessed using a log-linear model. The full dataset and nested sample comprised 357,072 and 54,602 individuals, respectively. Prevalence of hypertriglyceridemia, borderline high TG, high TG, very high TG, and severe hypertriglyceridemia in the full dataset was 29.2, 16.2, 12.9, 0.11, and 0.011%, respectively; corresponding rates in the nested sample were 19.0, 17.2, 0.25, and 0.016%, respectively. TG levels were 16.4% higher in males versus females; males had a greater risk of hypertriglyceridemia (risk ratio 1.25; 95% CI 1.24, 1.26; P < 0.0001). Prevalence of hypertriglyceridemia increased with age, peaking at 40-49 years in males (42.8%) and 60-69 years in females (34.4%); a 0.61% increase in TG levels for each year of life was predicted. Hypertriglyceridemia prevalence increased

  17. Is triglyceride/HDL ratio a reliable screening test for assessment of atherosclerotic risk in patients with chronic inflammatory disease?

    PubMed Central

    Keles, Nursen; Aksu, Feyza; Aciksari, Gonul; Yilmaz, Yusuf; Demircioglu, Kenan; Kostek, Osman; Cekin, Muhammed Esad; Kalcik, Macit; Caliskan, Mustafa

    2016-01-01

    OBJECTIVE: The term chronic inflammatory disease (CID) refers to a category of inflammatory diseases that includes Ankylosing spondylitis (AS) and familial Mediterranean fever (FMF). The incidence of adverse cardiovascular events is greater among patients with CID, though they may not have conventional atherosclerotic risk factors. Endothelial dysfunction is one of the underlying fundamental mechanisms that trigger development of atherosclerotic alterations in arteries, and flow-mediated dilatation (FMD) is a noninvasive method to determine endothelial dysfunction. Recent studies have shown a relationship between high triglyceride high-density lipoprotein cholesterol (TG/HDL-C) ratio and coronary atherosclerosis. Many studies have demonstrated that patients with CID have lower FMD values compared to healthy population, indicating endothelial dysfunction. However TG/HDL ratio and its relationship to FMD in patients with CID has not been investigated. The present study investigated whether TG/HDL ratio in CID patients differs from that of healthy population, and its relationship to FMD in patients with CID. METHODS: A total of 58 patients with CID and a group of 58 healthy volunteer individuals were enrolled in the study. FMD measurements were taken with high resolution ultrasound (US), and TG/HDL ratios were calculated. RESULTS: Patients with CID had significantly higher TG/HDL-C ratio (2.5 [2.2–2.8] vs 2.3 [2.1–2.5]; p=0.03) and lower FMD values (5.2 [4.2–6.3] vs 6.7 [6.3–9.7]; p<0.001), compared to healthy group, and a negative correlation was found between FMD levels and TG/HDL ratio of the study population. CONCLUSION: Higher TG/HDL ratio and lower FMD values found in CID patients may reflect increased atherosclerotic risk. PMID:28058384

  18. Effect of the APOC3 Sst I SNP on fasting triglyceride levels in men heterozygous for the LPL P207L deficiency.

    PubMed

    Garenc, Christophe; Couillard, Charles; Laflamme, Nathalie; Cadelis, François; Gagné, Claude; Couture, Patrick; Julien, Pierre; Bergeron, Jean

    2005-10-01

    Lipoprotein lipase (LPL) plays a major role in triglyceride (TG)-rich lipoprotein catabolism. A mutation at codon 207 (P207L) in the exon 5 of the LPL gene has been associated with 50% reduction in postheparin plasma LPL activity and significant increase in plasma TG levels in heterozygous individuals with low HDL. However, heterogeneity in fasting TG concentrations among these carriers suggests that other factors may be involved in the expression of this hypertriglyceridemic state. Indeed, previous studies have shown that the rare S2 allele of the APOC3 Sst I polymorphism was associated with higher concentrations of TG levels in noncarriers of LPL defect. Therefore, we investigated the association of the APOC3 Sst I variant on fasting lipoprotein-lipid levels in a sample of 35 heterozygous men bearing the LPL P207L mutation. Genetic association analyses were performed using the two-genotype groups S1/S1 and S1/S2. The genotype S1/S2 group was characterized by greater plasma cholesterol (plasma-C, P=0.02), plasma-TG (P=0.04), very low-density lipoproteins (VLDL)-C (P=0.004), VLDL-TG (P=0.01), VLDL-apolipoprotein B (apoB) (P=0.001) levels and cholesterol/HDL-C ratio (P=0.008), as well as lower VLDL-TG/VLDL-apoB ratio compared to the S1/S1 genotype group. These results support an exacerbating effect of the APOC3 Sst I single-nucleotide polymorphism on fasting TG levels since a large number of smaller VLDL particles are observed in LPL-deficient men bearing the APOC3 S2 allele.

  19. Impact of the Use of Different Diagnostic Criteria in the Prevalence of Dyslipidemia in Pregnant Women

    PubMed Central

    Feitosa, Alina Coutinho Rodrigues; Barreto, Luciana Tedgue; da Silva, Isabela Matos; da Silva, Felipe Freire; Feitosa Filho, Gilson Soares

    2017-01-01

    Background There is a physiologic elevation of total cholesterol (TC) and triglycerides (TG) during pregnancy. Some authors define dyslipidemia (DLP) in pregnant women when TC, LDL and TG concentrations are above the 95th percentile (p95%) and HDL concentration is below the 5th percentile (P5%) for gestational age (GA). Objective To compare the prevalence of DLP in pregnant women using percentiles criteria with the V Brazilian Guidelines on Dyslipidemia and the association with maternal and fetal outcomes. Results Pregnant women with high-risk conditions, aged 18-50 years, and at least one lipid profile during pregnancy was classified as the presence of DLP by two diagnostic criteria. Clinical and laboratorial data of mothers and newborns were evaluated. Conclusion 433 pregnant women aged 32.9 ± 6.5 years were studied. Most (54.6%) had lipid profile collected during third trimester. The prevalence of any lipid abnormalities according to the criteria of the National Guidelines was 83.8%: TC ≥ 200 mg/dL was found in 49.9%; LDL ≥ 160 mg/dL, in 14.3%, HDL ≤ 50 mg/dL in 44.4% and TG ≥ 150 mg/dL in 65.3%. Any changes of lipid according to percentiles criteria was found in 19.6%: elevation above the P95% for TC was found in 0.7%; for LDL, 1.7%; for TG 6.4% and HDL lower than the P5% in 13%. The frequency of comorbidity: hypertension, diabetes, smoking, obesity and preeclampsia was similar among pregnant women when DLP was compared by both criteria. Conclusion The prevalence of DLP during pregnancy varies significantly depending on the criteria used, however none demonstrated superiority in association with comorbidities. PMID:28591252

  20. Clinical usefulness of metabolic risk factors to identify young asymptomatic women adults with subclinical atherosclerosis: A cross-sectional study.

    PubMed

    Qin, Guangming; Chen, Zhihao; Su, Weiwei; Geng, Xiaoge; Chen, Xiaojun; Xu, Xiang; Pan, Wensheng

    2017-03-01

    Interventions of cardiovascular disease should be implemented in early ages. But most studies were performed in middle aged or elderly adults because of the low prevalence in young, especially for women. We investigate the association between metabolic risk factors and subclinical atherosclerosis in young asymptomatic women adults, using carotid intima-media thickness (CIMT) as a marker of the atherosclerotic process.We performed a cross-sectional study of 950 Chinese young asymptomatic women adults (37.28 ± 5.16 years) who underwent a routine health screening examination. Triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), total cholesterol (TC), fasting blood glucose (FBG), homocysteine (HCY), gamma glutamyltransferase (GGT), uric acid, and CIMT were measured.Out of 950 subjects, 16 (1.7%) were detected with increased CIMT. Significant differences existed in the indicators including age, body mass index (BMI), TC, TG, LDL-C, LDL-C/HDL-C, non-HDL-C, and TC/HDL-C. Although TG, LDL-C, non-HDL-C, TC/HDL-C, and TG/HDL-C were the significant indicators when adjusted for age only, age, LDL-C/HDL-C, FBG, and GGT were the only independent relative indicators of increased CMIT that entered the multivariate model. The area under receiver operating characteristic curve for a linear combination of age, LDL-C/HDL-C, FBG, and GGT was 0.809 (95% confidence interval = 0.712-0.906), superior to any of the variables taken alone (age, AUC = 0.707; FBG, AUC = 0.710; LDL-C/HDL-C, AUC = 0.695; GGT, AUC = 0.648).The combined assessment of age, LDL-C/HDL-C, FBG, and GGT contributes to an early detection for subclinical atherosclerosis, providing guidance to clinicians for women's early interventions of latent cardiovascular disease. Neither of the above four individual indicators is qualified alone.

  1. Aerobic Exercise and Lipids and Lipoproteins in Women: A Meta-Analysis of Randomized Controlled Trials

    PubMed Central

    Kelley, George A.; Kelley, Kristi S.; Tran, Zung VU

    2007-01-01

    Background Cardiovascular disease (CVD) in women is the leading cause of mortality in the United States, and less than optimal lipid and lipoprotein levels are major risk factors for CVD. The purpose of this study was to use the meta-analytic approach to examine the effects of aerobic exercise on lipids and lipoproteins in women. Methods Studies were retrieved via computerized literature searches, review of reference lists, hand searching selected journals, and expert review of our reference list. The inclusion of studies was limited to randomized controlled trials published in the English language literature between January 1955 and January 2003 in which aerobic exercise was used as the primary intervention in adult women aged ≥18 years. One or more of the following lipids and lipoproteins were assessed: total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG). Results Using a random effects model, statistically significant improvements were observed for all lipids and lipoproteins (TC, X̄ ± SEM, −4.3 ± 1.3 mg/dl, 95% CI −6.9 to −1.7 mg/dl; HDL-C, X̄± SEM, 1.8 ± 0.9 mg/dl, 95% CI 0.1 to 3.5 mg/dl; LDL-C, X̄ ± SEM, −4.4 ± 1.1 mg/dl, 95% CI −6.5 to −2.2 mg/dl; TG, X̄ ± SEM, −4.2 ± 2.1 mg/dl, 95% CI −8.4 to −0.1 mg/dl). Reductions of approximately 2%, 3%, and 5%, respectively, were observed for TC, LDL-C, and TG, whereas an increase of 3% was observed for HDL-C. Conclusions Aerobic exercise is efficacious for increasing HDL-C and decreasing TC, LDL-C, and TG in women. PMID:15650348

  2. Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans.

    PubMed

    Cha, Seongwon; Yu, Hyunjoo; Park, Ah Yeon; Song, Kwang Hoon

    2014-03-12

    Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C-G-A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS.

  3. Polymorphisms in genes involved in fatty acid β-oxidation interact with dietary fat intakes to modulate the plasma TG response to a fish oil supplementation.

    PubMed

    Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

    2014-03-18

    A large inter-individual variability in the plasma triglyceride (TG) response to an omega-3 polyunsaturated fatty acid (n-3 PUFA) supplementation has been observed. The objective was to examine gene-diet interaction effects on the plasma TG response after a fish oil supplementation, between single-nucleotide polymorphisms (SNPs) within genes involved in fatty acid β-oxidation and dietary fat intakes. Two hundred and eight (208) participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9-2.2 g EPA and 1.1 g DHA). Dietary fat intakes were measured using three-day food records. SNPs within RXRA, CPT1A, ACADVL, ACAA2, ABCD2, ACOX1 and ACAA1 genes were genotyped using TAQMAN methodology. Gene-diet interaction effects on the plasma TG response were observed for SNPs within RXRA (rs11185660, rs10881576 and rs12339187) and ACOX1 (rs17583163) genes. For rs11185660, fold changes in RXRA gene expression levels were different depending on SFA intakes for homozygotes T/T. Gene-diet interaction effects of SNPs within genes involved in fatty acid β-oxidation and dietary fat intakes may be important in understanding the inter-individual variability in plasma TG levels and in the plasma TG response to a fish oil supplementation.

  4. Polymorphisms in Genes Involved in Fatty Acid β-Oxidation Interact with Dietary Fat Intakes to Modulate the Plasma TG Response to a Fish Oil Supplementation

    PubMed Central

    Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

    2014-01-01

    A large inter-individual variability in the plasma triglyceride (TG) response to an omega-3 polyunsaturated fatty acid (n-3 PUFA) supplementation has been observed. The objective was to examine gene-diet interaction effects on the plasma TG response after a fish oil supplementation, between single-nucleotide polymorphisms (SNPs) within genes involved in fatty acid β-oxidation and dietary fat intakes. Two hundred and eight (208) participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g EPA and 1.1 g DHA). Dietary fat intakes were measured using three-day food records. SNPs within RXRA, CPT1A, ACADVL, ACAA2, ABCD2, ACOX1 and ACAA1 genes were genotyped using TAQMAN methodology. Gene-diet interaction effects on the plasma TG response were observed for SNPs within RXRA (rs11185660, rs10881576 and rs12339187) and ACOX1 (rs17583163) genes. For rs11185660, fold changes in RXRA gene expression levels were different depending on SFA intakes for homozygotes T/T. Gene-diet interaction effects of SNPs within genes involved in fatty acid β-oxidation and dietary fat intakes may be important in understanding the inter-individual variability in plasma TG levels and in the plasma TG response to a fish oil supplementation. PMID:24647074

  5. Evaluation of the effect of shift work on serum cholesterol and triglyceride levels.

    PubMed

    Akbari, Hamed; Mirzaei, Ramazan; Nasrabadi, Tahereh; Gholami-Fesharaki, Mohammad

    2015-01-01

    Working outside daylight hours (7 am to 7 pm) is called shift work. Shift work is a common practice in many industries and factories such as steel industries, petroleum industries, power plants, and in some services such as medicine and nursing and police forces, in which professionals provide services during day and night. Considering the contradictory reports of different studies, we decided to evaluate the effect of shift work on cholesterol and triglyceride (TG) levels through a historical cohort on steel industry workers. This retrospective cohort study was performed on all the staff of Isfahan's Mobarakeh Steel Company between years 2002 and 2011. There were 5773 participants in this study. Data were collected from the medical records of the staff using the census method. For analysis of data, generalized estimating equation (GEE) regression was used. The results showed a significant difference in cholesterol levels between shift workers and day workers on the first observation (P < 0.001), yet no such difference was observed for TG (P = 0.853). Moreover, the results showed that the variables of age, work experience and BMI were not similar between shift workers and day workers. Therefore, to remove the effect of such variables, we used GEE regression. Despite the borderline difference of cholesterol between regular shift workers and day workers, this correlation was not statistically significant (P = 0.051). The results for TG also showed no correlation with shift work. According to the findings of this study, there is no relationship between shift work and changes in serum TG and cholesterol. The lack of relationship can be due to shift plans for shift workers, nutrition, or the "Healthy Heart project" at Isfahan Mobarakeh Steel Company.

  6. Assessment of postprandial triglycerides in clinical practice: Validation in a general population and coronary heart disease patients.

    PubMed

    Perez-Martinez, Pablo; Alcala-Diaz, Juan F; Kabagambe, Edmon K; Garcia-Rios, Antonio; Tsai, Michael Y; Delgado-Lista, Javier; Kolovou, Genovefa; Straka, Robert J; Gomez-Delgado, Francisco; Hopkins, Paul N; Marin, Carmen; Borecki, Ingrid; Yubero-Serrano, Elena M; Hixson, James E; Camargo, Antonio; Province, Michael A; Lopez-Moreno, Javier; Rodriguez-Cantalejo, Fernando; Tinahones, Francisco J; Mikhailidis, Dimitri P; Perez-Jimenez, Francisco; Arnett, Donna K; Ordovas, Jose M; Lopez-Miranda, Jose

    2016-01-01

    Previous studies have suggested that for clinical purposes, subjects with fasting triglycerides (TGs) between 89-180 mg/dl (1-2 mmol/l) would benefit from postprandial TGs testing. To determine the postprandial TG response in 2 independent studies and validate who should benefit diagnostically from an oral-fat tolerance test (OFTT) in clinical practice. A population of 1002 patients with coronary heart disease (CHD) from the CORDIOPREV clinical trial and 1115 white US subjects from the GOLDN study underwent OFTTs. Subjects were classified into 3 groups according to fasting cut points of TGs to predict the usefulness of OFTT: (1) TG < 89 mg/dl (<1 mmol/l); (2) TG, 89-180 mg/dl (1-2 mmol/l); and (3) TG > 180 mg/dl (>2 mmol/l). Postprandial TG concentration at any point > 220 mg/dl (>2.5 mmol/l) has been pre-established as an undesirable postprandial response. Of the total, 49% patients with CHD and 42% from the general population showed an undesirable response after the OFTT. The prevalence of undesirable postprandial TG in the CORDIOPREV clinical trial was 12.8, 50.3, and 89.7%, in group 1, 2, and 3, respectively (P < .001) and 11.2, 58.1, and 97.5% in group 1, 2, and 3, respectively (P < .001) in the GOLDN study. These two studies validate the predictive values reported in a previous consensus. Moreover, the findings of the CORDIOPREV and GOLDN studies show that an OFTT is useful to identify postprandial hyperlipidemia in subjects with fasting TG between 1-2 mmol/l (89-180 mg/dL), because approximately half of them have hidden postprandial hyperlipidemia, which may influence treatment. An OFTT does not provide additional information regarding postprandial hyperlipidemia in subjects with low TG (<1 mmol/l, <89 mg/dL) or increased TG (>2 mmol/l, >180 mg/dl). Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  7. SU-F-T-488: Comparison of the TG-51 and TG-51 Addendum Calibration Protocols

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCaw, T; Hwang, M; Jang, S

    Purpose: To quantify differences between the TG51 and TG51 addendum calibration protocols. Methods: Beam energies of 6X, 6XSRS, 10X, 15X, 23X, 6XFFF, and 10XFFF were calibrated following both the TG51 and TG51 addendum protocols using both a Farmer and a scanning ionization chamber with traceable absorbed dose-to-water calibrations. For the TG51 addendum procedure, the collimating jaws were positioned to define a 10×10cm{sup 2} radiation field, a lead foil was only used for kQ measurements of FFF energies, and a volume-averaging correction was applied based on crossline and inline dose profiles. For the TG51 procedure, the collimating jaws were set tomore » 10×10cm{sup 2} according to the digital readout, and a lead foil was used for kQ measurements of energies greater than 10MV. Results: For beam energies with a flattening filter, absorbed dose-to-water determined by the two protocols differed by 0.1%–0.3%. For FFF beam energies, differences between the protocols were up to 0.2% and 0.8% for the scanning and Farmer ionization chambers, respectively. Differences between the protocols were due to kQ determination, volume-averaging correction, and measurement of raw ionization. Differences in kQ values between the two protocols were up to 0.4% and 0.2% for the scanning and Farmer ionization chambers, respectively. Volume-averaging corrections were less than 0.1% for the scanning ionization chamber, and up to 0.4% and 0.6% for the Farmer ionization chamber in beams with a flattening filter and FFF beams, respectively. Raw ionization measurements differed up to 0.3%±0.07% due to differences in jaw settings. Conclusion: The TG51 and TG51 addendum calibration protocols differed less than 0.3% for the scanning ionization chamber. For the Farmer chamber in FFF energies, volume-averaging corrections of up to 0.6% contributed to calibration differences of up to 0.8%. Failure to verify the radiation field size can produce calibration differences of up to 0.3%.« less

  8. Triglyceride:high-density lipoprotein cholesterol effects in healthy subjects administered a peroxisome proliferator activated receptor delta agonist.

    PubMed

    Sprecher, Dennis L; Massien, Christine; Pearce, Greg; Billin, Andrew N; Perlstein, Itay; Willson, Timothy M; Hassall, David G; Ancellin, Nicolas; Patterson, Scott D; Lobe, David C; Johnson, Tony G

    2007-02-01

    Exercise increases fatty acid oxidation (FAO), improves serum high density lipoprotein cholesterol (HDLc) and triglycerides (TG), and upregulates skeletal muscle peroxisome proliferator activated receptor (PPAR)delta expression. In parallel, PPARdelta agonist-upregulated FAO would induce fatty-acid uptake (via peripheral lipolysis), and influence HDLc and TG-rich lipoprotein particle metabolism, as suggested in preclinical models. Healthy volunteers were allocated placebo (n=6) or PPARdelta agonist (GW501516) at 2.5 mg (n=9) or 10 mg (n=9), orally, once-daily for 2 weeks while hospitalized and sedentary. Standard lipid/lipoproteins were measured and in vivo fat feeding studies were conducted. Human skeletal muscle cells were treated with GW501516 in vitro and evaluated for lipid-related gene expression and FAO. Serum TG trended downwards (P=0.08, 10 mg), whereas TG clearance post fat-feeding improved with drug (P=0.02). HDLc was enhanced in both treatment groups (2.5 mg P=0.004, 10 mg P<0.001) when compared with the decrease in the placebo group (-11.5+/-1.6%, P=0.002). These findings complimented in vitro cell culture results whereby GW501516 induced FAO and upregulated CPT1 and CD36 expression, in addition to a 2-fold increase in ABCA1 (P=0.002). However, LpL expression remained unchanged. This is the first report of a PPARdelta agonist administered to man. In this small study, GW501516 significantly influenced HDLc and TGs in healthy volunteers. Enhanced in vivo serum fat clearance, and the first demonstrated in vitro upregulation in human skeletal muscle fat utilization and ABCA1 expression, suggests peripheral fat utilization and lipidation as potential mechanisms toward these HDL:TG effects.

  9. A human APOC3 missense variant and monoclonal antibody accelerate apoC-III clearance and lower triglyceride-rich lipoprotein levels

    PubMed Central

    Khetarpal, Sumeet A; Zeng, Xuemei; Millar, John S; Vitali, Cecilia; Somasundara, Amritha Varshini Hanasoge; Zanoni, Paolo; Landro, James A; Barucci, Nicole; Zavadoski, William J; Sun, Zhiyuan; de Haard, Hans; Toth, Ildikó V; Peloso, Gina M; Natarajan, Pradeep; Cuchel, Marina; Lund-Katz, Sissel; Phillips, Michael C; Tall, Alan R; Kathiresan, Sekar; DaSilva-Jardine, Paul; Yates, Nathan A; Rader, Daniel J

    2017-01-01

    Recent large-scale genetic sequencing efforts have identified rare coding variants in genes in the triglyceride-rich lipoprotein (TRL) clearance pathway that are protective against coronary heart disease (CHD), independently of LDL cholesterol (LDL-C) levels1. Insight into the mechanisms of protection of these variants may facilitate the development of new therapies for lowering TRL levels. The gene APOC3 encodes apoC-III, a critical inhibitor of triglyceride (TG) lipolysis and remnant TRL clearance2. Here we report a detailed interrogation of the mechanism of TRL lowering by the APOC3 Ala43Thr (A43T) variant, the only missense (rather than protein-truncating) variant in APOC3 reported to be TG lowering and protective against CHD3–5. We found that both human APOC3 A43T heterozygotes and mice expressing human APOC3 A43T display markedly reduced circulating apoC-III levels. In mice, this reduction is due to impaired binding of A43T apoC-III to lipoproteins and accelerated renal catabolism of free apoC-III. Moreover, the reduced content of apoC-III in TRLs resulted in accelerated clearance of circulating TRLs. On the basis of this protective mechanism, we developed a monoclonal antibody targeting lipoprotein-bound human apoC-III that promotes circulating apoC-III clearance in mice expressing human APOC3 and enhances TRL catabolism in vivo. These data reveal the molecular mechanism by which a missense variant in APOC3 causes reduced circulating TG levels and, hence, protects from CHD. This protective mechanism has the potential to be exploited as a new therapeutic approach to reduce apoC-III levels and circulating TRL burden. PMID:28825717

  10. Ability of the plasma concentration ratio of triglyceride/high-density lipoprotein cholesterol to identify increased cardio-metabolic risk in an east Asian population.

    PubMed

    Sung, Ki-Chul; Reaven, Gerald; Kim, Sun

    2014-07-01

    The plasma concentration ratio of triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) has identified increased cardio-metabolic risk and outcome in European populations. The goal of this study was to see if this ratio would also have clinical utility in identifying cardio-metabolic risk in an East Asian population. Measurements of various cardio-metabolic risk factors, including coronary calcium scores, were available on 12,166 apparently healthy Korean adults. Approximately 25% of men and women with the highest TG/HDL-C ratios were classified as being at high cardio-metabolic risk, and their risk factor profiles compared to the remainder of the population, as well as to individuals with the metabolic syndrome (MetS). High cardio-metabolic risk (upper 25%) was defined as a TG/HDL-C ratio ≥3.5 (men) or ≥2.0 (women), and all cardio-metabolic risk factors measured, including coronary calcium scores, were significantly more adverse when compared to individuals beneath these cut-points. Although cardio-metabolic risk profiles appeared reasonably comparable in subjects identified by either a high TG/HDL-C or a diagnosis of MetS, use of the TG/HDL-C increased the numbers at high risk. Evidence that determination of the plasma TG/HDL-C concentration ratio provides a simple way to identify individual at increased cardio-metabolic risk has been extended to an East Asian population. The ability of an elevated TG/HDL-C ratio to accomplish this goal is comparable to that achieved using the more complicated MetS criteria. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Plasma Triglyceride Levels May Be Modulated by Gene Expression of IQCJ, NXPH1, PHF17 and MYB in Humans.

    PubMed

    Vallée Marcotte, Bastien; Guénard, Frédéric; Cormier, Hubert; Lemieux, Simone; Couture, Patrick; Rudkowska, Iwona; Vohl, Marie-Claude

    2017-01-26

    A genome-wide association study (GWAS) by our group identified loci associated with the plasma triglyceride (TG) response to ω-3 fatty acid (FA) supplementation in IQCJ , NXPH1 , PHF17 and MYB . Our aim is to investigate potential mechanisms underlying the associations between single nucleotide polymorphisms (SNPs) in the four genes and TG levels following ω-3 FA supplementation. 208 subjects received 3 g/day of ω-3 FA (1.9-2.2 g of EPA and 1.1 g of docosahexaenoic acid (DHA)) for six weeks. Plasma TG were measured before and after the intervention. 67 SNPs were selected to increase the density of markers near GWAS hits. Genome-wide expression and methylation analyses were conducted on respectively 30 and 35 participants' blood sample together with in silico analyses. Two SNPs of IQCJ showed different affinities to splice sites depending on alleles. Expression levels were influenced by genotype for one SNP in NXPH1 and one in MYB . Associations between 12 tagged SNPs of IQCJ , 26 of NXPH1 , seven of PHF17 and four of MYB and gene-specific CpG site methylation levels were found. The response of plasma TG to ω-3 FA supplementation may be modulated by the effect of DNA methylation on expression levels of genes revealed by GWAS.

  12. Plasma Triglyceride Levels May Be Modulated by Gene Expression of IQCJ, NXPH1, PHF17 and MYB in Humans

    PubMed Central

    Vallée Marcotte, Bastien; Guénard, Frédéric; Cormier, Hubert; Lemieux, Simone; Couture, Patrick; Rudkowska, Iwona; Vohl, Marie-Claude

    2017-01-01

    A genome-wide association study (GWAS) by our group identified loci associated with the plasma triglyceride (TG) response to ω-3 fatty acid (FA) supplementation in IQCJ, NXPH1, PHF17 and MYB. Our aim is to investigate potential mechanisms underlying the associations between single nucleotide polymorphisms (SNPs) in the four genes and TG levels following ω-3 FA supplementation. 208 subjects received 3 g/day of ω-3 FA (1.9–2.2 g of EPA and 1.1 g of docosahexaenoic acid (DHA)) for six weeks. Plasma TG were measured before and after the intervention. 67 SNPs were selected to increase the density of markers near GWAS hits. Genome-wide expression and methylation analyses were conducted on respectively 30 and 35 participants’ blood sample together with in silico analyses. Two SNPs of IQCJ showed different affinities to splice sites depending on alleles. Expression levels were influenced by genotype for one SNP in NXPH1 and one in MYB. Associations between 12 tagged SNPs of IQCJ, 26 of NXPH1, seven of PHF17 and four of MYB and gene-specific CpG site methylation levels were found. The response of plasma TG to ω-3 FA supplementation may be modulated by the effect of DNA methylation on expression levels of genes revealed by GWAS. PMID:28134766

  13. The role of plasma triglyceride/high-density lipoprotein cholesterol ratio to predict cardiovascular outcomes in chronic kidney disease.

    PubMed

    Sonmez, Alper; Yilmaz, Mahmut Ilker; Saglam, Mutlu; Unal, Hilmi Umut; Gok, Mahmut; Cetinkaya, Hakki; Karaman, Murat; Haymana, Cem; Eyileten, Tayfun; Oguz, Yusuf; Vural, Abdulgaffar; Rizzo, Manfredi; Toth, Peter P

    2015-04-16

    Cardiovascular disease (CVD) risk is substantially increased in subjects with chronic kidney disease (CKD). The Triglycerides (TG) to High-Density Lipoprotein Cholesterol (HDL-C) ratio is an indirect measure of insulin resistance and an independent predictor of cardiovascular risk. No study to date has been performed to evaluate whether the TG/HDL-C ratio predicts CVD risk in patients with CKD. A total of 197 patients (age 53±12 years) with CKD Stages 1 to 5, were enrolled in this longitudinal, observational, retrospective study. TG/HDL-C ratio, HOMA-IR indexes, serum asymmetric dimethyl arginine (ADMA), high sensitivity C-reactive protein (CRP), parathyroid hormone (PTH), calcium, phosphorous, estimated glomerular filtration rate (eGFR), and albumin levels were measured. Flow mediated vasodilatation (FMD) of the brachial artery was assessed by using high-resolution ultrasonography. A total of 11 cardiovascular (CV) deaths and 43 nonfatal CV events were registered in a mean follow-up period of 30 (range 9 to 35) months. Subjects with TG/HDL-C ratios above the median values (>3.29) had significantly higher plasma ADMA, PTH, and phosphorous levels (p=0.04, p=0.02, p=0.01 respectively) and lower eGFR and FMD values (p=0.03, p<0.001 respectively). The TG/HDL-C ratio was an independent determinant of FMD (β=-0.25 p=0.02) along with TG, HDL-C, hsCRP, serum albumin, phosphate levels, systolic blood pressure, PTH, eGFR and the presence of diabetes mellitus. The TG/HDL-C ratio was also a significant independent determinant of cardiovascular outcomes [HR: 1.36 (1.11-1.67) (p=0.003)] along with plasma ADMA levels [HR: 1.31 (1.13-1.52) (p<0.001)] and a history of diabetes mellitus [HR: 4.82 (2.80-8.37) (p<0.001)]. This study demonstrates that the elevated TG/HDL-C ratio predicts poor CVD outcome in subjects with CKD. Being a simple, inexpensive, and reproducible marker of CVD risk, the TG/HDL-C ratio may emerge as a novel and reliable indicator among the many well

  14. Hypoglycemic and hypolipidemic effects of Coriandrum sativum L. in Meriones shawi rats.

    PubMed

    Aissaoui, Abderrahmane; Zizi, Soumia; Israili, Zafar H; Lyoussi, Badiâa

    2011-09-01

    The use of an aqueous extract of coriander (Coriandrum sativum L.; Apiaceae, Umbelliferae) seeds (CS-extract) in Moroccan traditional treatment of diabetes remains to be experimentally validated. The study aim was to investigate potential hypoglycemic (and hypolipidemic) activity of CS-extract after a single oral dose and after daily dosing for 30 days (sub-chronic study) in normal and obese-hyperglycemic-hyperlipidemic (OHH) Meriones shawi rats. After a single oral dose of CS-extract (20mg/kg; predetermined as optimum), plasma glucose, insulin, total cholesterol (TC), and triglycerides (TG) were measured in normal and OHH rats (hypercaloric diet and forced limited physical activity); glibenclamide (GLB; 2.5mg/kg) was used as reference. In the sub-chronic study, the effect of CS-extract and GLB (at the above doses) on body weight (BW), plasma glucose, insulin, TC, LDL-cholesterol, HDL-cholesterol, TG, urea and creatinine was determined in normal and OHH rats; insulin resistance (IR as HOMA-IR), atherosclerotic and cardioprotective indices were calculated. A single dose of CS-extract or GLB suppressed hyperglycemia in OHH rats, and normo-glycemia was achieved at 6-h post-dose; there was no effect on lipids, TG or insulin, but IR decreased significantly. The hypoglycemic effect was lower in normal rats. In the sub-chronic study in OHH rats, the test substances (CS-extract>GLB) reduced plasma glucose (normoglycemia on Day 21), insulin and IR, TC, LDL-cholesterol, and TG. Atherosclerotic index decreased while cardioprotective indices increased only by CS-extract, with no effect on BW, urea or creatinine. Sub-chronic administration of CS-extract in OHH Meriones shawi rats normalized glycemia and decreased the elevated levels of insulin, IR, TC, LDL-cholesterol and TG. Since, the CS-extract decreased several components of the metabolic syndrome and decreased atherosclerotic and increased cardioprotective indices, CS-extract may have cardiovascular protective effect. The

  15. The Associations Between Smoking Habits and Serum Triglyceride or Hemoglobin A1c Levels Differ According to Visceral Fat Accumulation.

    PubMed

    Koda, Michiko; Kitamura, Itsuko; Okura, Tomohiro; Otsuka, Rei; Ando, Fujiko; Shimokata, Hiroshi

    2016-01-01

    Whether smokers and former smokers have worse lipid profiles or glucose levels than non-smokers remains unclear. The subjects were 1152 Japanese males aged 42 to 81 years. The subjects were divided according to their smoking habits (nonsmokers, former smokers, and current smokers) and their visceral fat area (VFA) (<100 cm(2) and ≥100 cm(2)). The serum triglyceride (TG) levels of 835 males were assessed. In the VFA ≥100 cm(2) group, a significantly greater proportion of current smokers (47.3%) exhibited TG levels of ≥150 mg/dL compared with former smokers (36.4%) and non-smokers (18.8%). The difference in TG level distribution between former smokers and non-smokers was also significant. However, among the subjects with VFA of <100 cm(2), the TG levels of the three smoking habit groups did not differ. The serum hemoglobin A1c (HbA1c) levels of 877 males were also assessed. In the VFA <100 cm(2) group, significantly higher proportions of current smokers (17.9%) and former smokers (14.9%) demonstrated HbA1c levels of ≥5.6% compared with non-smokers (6.3%). In contrast, in the VFA ≥100 cm(2) group, significantly fewer former smokers displayed HbA1c levels of ≥5.6% compared with non-smokers and current smokers. Furthermore, the interaction between smoking habits and VFA was associated with the subjects' TG and HbA1c concentrations, and the associations of TG and HbA1c concentrations and smoking habits varied according to VFA. Both smoking habits and VFA exhibited associations with TG and HbA1c concentrations. The associations between smoking habits and these parameters differed according to VFA.

  16. Triglycerides/High density lipoprotein cholesterol ratio as a cardiometabolic risk marker in children and adolescents from Mérida city, Venezuela.

    PubMed

    Aguirre, Miguel; Briceño, Yajaira; Gómez-Pérez, Roald; Zerpa, Yajaira; Camacho, Nolis; Paoli, Mariela

    2018-02-01

    To determine the behavior of the triglycerides/HDL-cholesterol ratio (TG/HDL) as a cardiometabolic risk marker in children and adolescents from Mérida, Venezuela. A total of 1292 children and adolescents aged 7-18 years who attended educational institutions in the Libertador Municipality were enrolled into this study. Anthropometric measurements and blood pressure values were recorded. Fasting blood glucose, insulin and lipid levels were measured. The TG/HDL ratio, HOMA-IR, and QUICKI indexes were calculated. Subjects were categorized as with and without cardiometabolic risk based on the presence or absence of 2or more risk factors. Cut-off points for the TG/HDL ratio were determined by constructing ROC curves. Significantly higher mean TG/HDL ratios were found in pubertal (2.2 ± 1.7) as compared to prepubertal subjects (1.8 ± 1.5; P=.001), with no sex differences. Two or more risk factors were found in 14.7% (n=192) of the participants, in whom TG/HDL ratios were significantly higher as compared to those with no risk (3.5±2.9 versus 1.6±0.8 in prepubertal and 4.1 ± 3.5 versus 1.8 ± 0.9 in pubertal subjects; P=.0001). According to cardiometabolic risk, cut-off points for the TG/HDL ratio of 1.8 and 2.5 were found for prepubertal and pubertal children respectively. These cut-off points showed risks (odds ratio) higher than 2.5 for conditions such as metabolic syndrome, elevated non-HDL-C, abdominal obesity, and elevated HOMA-IR. In this sample of children and adolescents, an elevated TG/HDLc ratio was found to be a good marker for predicting cardiometabolic risk. Copyright © 2017 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. The Associations Between Smoking Habits and Serum Triglyceride or Hemoglobin A1c Levels Differ According to Visceral Fat Accumulation

    PubMed Central

    Koda, Michiko; Kitamura, Itsuko; Okura, Tomohiro; Otsuka, Rei; Ando, Fujiko; Shimokata, Hiroshi

    2016-01-01

    Background Whether smokers and former smokers have worse lipid profiles or glucose levels than non-smokers remains unclear. Methods The subjects were 1152 Japanese males aged 42 to 81 years. The subjects were divided according to their smoking habits (nonsmokers, former smokers, and current smokers) and their visceral fat area (VFA) (<100 cm2 and ≥100 cm2). Results The serum triglyceride (TG) levels of 835 males were assessed. In the VFA ≥100 cm2 group, a significantly greater proportion of current smokers (47.3%) exhibited TG levels of ≥150 mg/dL compared with former smokers (36.4%) and non-smokers (18.8%). The difference in TG level distribution between former smokers and non-smokers was also significant. However, among the subjects with VFA of <100 cm2, the TG levels of the three smoking habit groups did not differ. The serum hemoglobin A1c (HbA1c) levels of 877 males were also assessed. In the VFA <100 cm2 group, significantly higher proportions of current smokers (17.9%) and former smokers (14.9%) demonstrated HbA1c levels of ≥5.6% compared with non-smokers (6.3%). In contrast, in the VFA ≥100 cm2 group, significantly fewer former smokers displayed HbA1c levels of ≥5.6% compared with non-smokers and current smokers. Furthermore, the interaction between smoking habits and VFA was associated with the subjects’ TG and HbA1c concentrations, and the associations of TG and HbA1c concentrations and smoking habits varied according to VFA. Conclusions Both smoking habits and VFA exhibited associations with TG and HbA1c concentrations. The associations between smoking habits and these parameters differed according to VFA. PMID:26616395

  18. Impact of night sleep duration on glycemic and triglyceride levels in Chinese with different glycemic status.

    PubMed

    Zheng, Yu; Wang, Anping; Pan, Changyu; Lu, Juming; Dou, Jingtao; Lu, Zhaohui; Ba, Jianming; Wang, Baoan; Mu, Yiming

    2015-01-01

    The aim of the present study was to assess the relationship between night sleep duration and glycemic and triglyceride (TG) levels among people with different glycemic status. In all, 18,121 subjects aged ≥40 years were enrolled in this cross-sectional study, including 4318 with impaired glucose regulation (IGR), 4225 with diabetes, and 9578 with normal glucose regulation (NGR). The IGR + diabetes and NGR groups were divided into three subgroups according to self-reported night sleep duration as follows: (i) <6 h; (ii) 6-9 h; and (iii) >9 h. The associations of sleep duration with HbA1c, fasting plasma glucose (FPG), 2-h post-load plasma glucose (PPG), and TG levels were examined. Long night sleep duration (>9 h) was associated with higher HbA1c, FPG, PPG, and TG levels compared with sleep duration of 6-9 h (P < 0.01 for all) in the IGR + diabetes group, but not in the NGR group. This association was adjusted for potential confounders, including body mass index and depressive symptoms, and remained significant even after adjusting for snoring. A significant interaction between sleep duration and TG or snoring was observed for HbA1c levels, which attenuated the sleep-HbA1c association in the IGR + diabetes group. However, no significant association was observed between short night sleep duration and HbA1c levels. Long night sleep duration is associated with higher HbA1c, FPG, PPG, and TG levels in IGR and diabetes patients, independent of potential confounders. This may be important in clinical management of IGR and diabetes patients. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

  19. Antihyperlipidemic activity of adenosine triphosphate in rabbits fed a high-fat diet and hyperlipidemic patients.

    PubMed

    Zhang, Lianshan; Liang, Libin; Tong, Tong; Qin, Yuguo; Xu, Yanping; Tong, Xinglong

    2016-10-01

    Context Recently, adenosine triphosphate (ATP) was occasionally found to decrease the triglyceride (TG) levels in several hyperlipidemic patients in our clinical practice. Objective The study investigates the anti-hyperlipidemic effects of ATP in a high-fat fed rabbit model and hyperlipidemic patients. Materials and methods Twenty-four rabbits were randomly divided into three groups of eight animals each as follows: normal diet, high-fat diet and high-fat diet + ATP group. ATP supplementation (40 mg/day) was started at the 20th day and lasted for 10 days. Serum concentrations of total cholesterol (TC), TG, LDL-C, HDL-C were measured on the 20th day and 30th day. Heart, liver and aorta were subjected histopathological examination. Twenty outpatients diagnosed primary hyperlipidemia took ATP at a dose of 60 mg twice a day for 1 week. Results Feeding rabbits with a high-fat diet resulted in a significant elevation of lipid parameters including TC, TG, LDL-C, VLDL-C compared to the normal diet group (p < 0.01). ATP treatment significantly decreased serum TG level (p < 0.01), whilst other parameters remained statistically unaltered. Meanwhile, ATP significantly reduced the thickness of fat layer in cardiac epicardium (p < 0.05) and pathological gradation of ballooning degeneration in hepatocytes (p < 0.05). After taking ATP for 1 week, hyperlipidemia patients exhibited a significant decrease of TG (p < 0.01), but other lipid parameters had no significant change. Discussion and conclusion The study indicates that ATP selectively decreases serum TG levels in high-fat diet rabbits and hyperlipidemic patients. Therefore, ATP supplementation may provide an effective approach to control TG level.

  20. Quantitative proteomic analysis of cultured skin fibroblast cells derived from patients with triglyceride deposit cardiomyovasculopathy

    PubMed Central

    2013-01-01

    Background Triglyceride deposit cardiomyovasculopathy (TGCV) is a rare disease, characterized by the massive accumulation of triglyceride (TG) in multiple tissues, especially skeletal muscle, heart muscle and the coronary artery. TGCV is caused by mutation of adipose triglyceride lipase, which is an essential molecule for the hydrolysis of TG. TGCV is at high risk for skeletal myopathy and heart dysfunction, and therefore premature death. Development of therapeutic methods for TGCV is highly desirable. This study aims to discover specific molecules responsible for TGCV pathogenesis. Methods To identify differentially expressed proteins in TGCV patient cells, the stable isotope labeling with amino acids in cell culture (SILAC) method coupled with LC-MS/MS was performed using skin fibroblast cells derived from two TGCV patients and three healthy volunteers. Altered protein expression in TGCV cells was confirmed using the selected reaction monitoring (SRM) method. Microarray-based transcriptome analysis was simultaneously performed to identify changes in gene expression in TGCV cells. Results Using SILAC proteomics, 4033 proteins were quantified, 53 of which showed significantly altered expression in both TGCV patient cells. Twenty altered proteins were chosen and confirmed using SRM. SRM analysis successfully quantified 14 proteins, 13 of which showed the same trend as SILAC proteomics. The altered protein expression data set was used in Ingenuity Pathway Analysis (IPA), and significant networks were identified. Several of these proteins have been previously implicated in lipid metabolism, while others represent new therapeutic targets or markers for TGCV. Microarray analysis quantified 20743 transcripts, and 252 genes showed significantly altered expression in both TGCV patient cells. Ten altered genes were chosen, 9 of which were successfully confirmed using quantitative RT-PCR. Biological networks of altered genes were analyzed using an IPA search. Conclusions We

  1. Prevalence of Dyslipidemia Among Antiretroviral-Naive HIV-Infected Individuals in China

    PubMed Central

    Shen, Yinzhong; Wang, Jiangrong; Wang, Zhenyan; Qi, Tangkai; Song, Wei; Tang, Yang; Liu, Li; Zhang, Renfang; Lu, Hongzhou

    2015-01-01

    Abstract Little is known about the epidemiological features of dyslipidemia among antiretroviral-naive HIV-infected individuals in China. We used a cross-sectional study design to estimate the prevalence of dyslipidemia in this population, and to identify risk factors associated with the presence of dyslipidemia. One thousand five hundred and eighteen antiretroviral-naive HIV-infected individuals and 347 HIV-negative subjects in China were enrolled during 2009 to 2010. Demographics and medical histories were recorded. After an overnight fast, serum samples were collected to measure lipid levels. Factors associated with the presence of dyslipidemia were analyzed by logistic regression. Mean total cholesterol (TC), low-density lipoprotein cholesterol (LDL), high-density lipoprotein cholesterol (HDL) levels were lower in HIV-positive than HIV-negative subjects, but mean triglyceride (TG) was higher in HIV-positive subjects. The overall prevalence of dyslipidemia in HIV-positive and HIV-negative groups did not differ (75.6% vs. 73.7%, P = 0.580). However, the prevalence of high TC (8.4% vs. 28.2%, P < 0.001) and high LDL (8.5% vs. 62.6%, P < 0.001) was lower in HIV-positive than HIV-negative subjects, and the prevalence of high TG (33.9% vs. 17.0%, P < 0.001) and low HDL (59.6% vs. 11.2%, P < 0.001) was higher in HIV-positive than HIV-negative subjects. Logistic analysis showed that HIV positivity was significantly associated with both an increased risk of high TG and low HDL and a decreased risk of high TC and high LDL. The mean levels of TC, of LDL and of HDL showed an increasing trend with increasing CD4 count in HIV-positive subjects. Multivariable logistic regression found that lower CD4 count was significantly associated with both an increased risk of high TG and low HDL and a decreased risk of high TC in HIV-positive subjects. Among antiretroviral-naive HIV-infected Chinese adults, there was a high prevalence of dyslipidemia characterized by

  2. Profile of Free Fatty Acids and Fractions of Phospholipids, Cholesterol Esters and Triglycerides in Serum of Obese Youth with and without Metabolic Syndrome.

    PubMed

    Bermúdez-Cardona, Juliana; Velásquez-Rodríguez, Claudia

    2016-02-15

    The study evaluated the profile of circulating fatty acids (FA) in obese youth with and without metabolic syndrome (MetS) to determine its association with nutritional status, lifestyle and metabolic variables. A cross-sectional study was conducted in 96 young people, divided into three groups: obese with MetS (OBMS), obese (OB) and appropriate weight (AW). FA profiles were quantified by gas chromatography; waist circumference (WC), fat folds, lipid profile, high-sensitivity C-reactive protein, glucose, insulin, the homeostasis model assessment (HOMA index), food intake and physical activity (PA) were assessed. The OBMS group had significantly greater total free fatty acids (FFAs), palmitic-16:0 in triglyceride (TG), palmitoleic-16:1n-7 in TG and phospholipid (PL); in the OB group, these FAs were higher than in the AW group. Dihomo-gamma-linolenic (DHGL-20:3n-6) was higher in the OBMS than the AW in PL and FFAs. Linoleic-18:2n-6 in TG and PL had the lowest proportion in the OBMS group. WC, PA, total FFA, linoleic-18:2n-6 in TG and DHGL-20:3n-6 in FFAs explained 62% of the HOMA value. The OB group presented some higher proportions of FA and biochemical values than the AW group. The OBMS had proportions of some FA in the TG, PL and FFA fractions that correlated with disturbances of MetS.

  3. Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans

    PubMed Central

    2014-01-01

    Background Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. Methods The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). Results The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C–G–A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. Conclusions We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS. PMID:24618354

  4. Positive relationship between dietary fat, ethanol intake, triglycerides, and hypothalamic peptides: counteraction by lipid-lowering drugs.

    PubMed

    Barson, Jessica R; Karatayev, Olga; Chang, Guo-Qing; Johnson, Deanne F; Bocarsly, Miriam E; Hoebel, Bartley G; Leibowitz, Sarah F

    2009-09-01

    Studies in both humans and animals suggest a positive relationship between the intake of ethanol and intake of fat, which may contribute to alcohol abuse. This relationship may be mediated, in part, by hypothalamic orexigenic peptides such as orexin (OX), which stimulate both consumption of ethanol and fat, and circulating triglycerides (TGs), which stimulate these peptides and promote consummatory behavior. The present study investigated this vicious cycle between ethanol and fat, to further characterize its relation to TGs and to test the effects of lowering TG levels. In Experiment 1, the behavioral relationship between fat intake and ethanol was confirmed. Adult male Sprague-Dawley rats, chronically injected intraperitoneally with ethanol (1g/kg) and tested in terms of their preference for a high-fat diet (HFD) compared with low-fat diet (LFD), showed a significant increase in their fat preference, compared with rats injected with saline, in measures of 2h and 24h intake. Experiment 2 tested the relationship of circulating TGs in this positive association between ethanol and fat, in rats chronically consuming 9% ethanol versus water and given acute meal tests (25kcal) of a HFD versus LFD. Levels of TGs were elevated in response to both chronic drinking of ethanol versus water and acute eating of a high-fat versus low-fat meal. Most importantly, ethanol and a HFD showed an interaction effect, whereby their combination produced a considerably larger increase in TG levels (+172%) compared to ethanol with a LFD (+111%). In Experiment 3, a direct manipulation of TG levels was found to affect ethanol intake. After intragastric administration of gemfibrozil (50mg/kg) compared with vehicle, TG levels were lowered by 37%, and ethanol intake was significantly reduced. In Experiment 4, the TG-lowering drug gemfibrozil also caused a significant reduction in the expression of the orexigenic peptide, OX, in the perifornical lateral hypothalamus. These results support the

  5. TU-B-304-01: The Aftermath of TG-142

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Klein, E.

    2015-06-15

    Although published in 2009, the AAPM TG-142 report on accelerator quality assurance still proves a challenge for full clinical implementation. The choice of methodologies to satisfy TG-142 requirements is critical to a successful application. Understanding the philosophy of TG-142 can help in creating an institution-specific QA practice that is both efficient and effective. The concept of maintaining commissioned beam profiles is still found confusing. The physicist must also consider technologies not covered by TG-142 (i.e. arc therapy techniques). On the horizon is TG-198 report on implementing TG-142. Although the community still lacks a final TG-100 report, performing a failure-mode -and-effectsmore » analysis and statistical process control analysis to determine the institution-specific clinical impact of each TG-142 test may be useful for identifying trends for pro-active surveillance. Learning Objectives: To better understand the confusing and controversial aspects of TG-142. To understand what is still missing from TG-142 and how to account for these tests in clinical practice To describe which QA tests in TG-142 yield the largest potential clinical result if not discovered.« less

  6. TU-B-304-02: Quantitative FMEA of TG-142

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O’Daniel, J.

    2015-06-15

    Although published in 2009, the AAPM TG-142 report on accelerator quality assurance still proves a challenge for full clinical implementation. The choice of methodologies to satisfy TG-142 requirements is critical to a successful application. Understanding the philosophy of TG-142 can help in creating an institution-specific QA practice that is both efficient and effective. The concept of maintaining commissioned beam profiles is still found confusing. The physicist must also consider technologies not covered by TG-142 (i.e. arc therapy techniques). On the horizon is TG-198 report on implementing TG-142. Although the community still lacks a final TG-100 report, performing a failure-mode -and-effectsmore » analysis and statistical process control analysis to determine the institution-specific clinical impact of each TG-142 test may be useful for identifying trends for pro-active surveillance. Learning Objectives: To better understand the confusing and controversial aspects of TG-142. To understand what is still missing from TG-142 and how to account for these tests in clinical practice To describe which QA tests in TG-142 yield the largest potential clinical result if not discovered.« less

  7. TU-B-304-00: The Aftermath of TG-142

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    2015-06-15

    Although published in 2009, the AAPM TG-142 report on accelerator quality assurance still proves a challenge for full clinical implementation. The choice of methodologies to satisfy TG-142 requirements is critical to a successful application. Understanding the philosophy of TG-142 can help in creating an institution-specific QA practice that is both efficient and effective. The concept of maintaining commissioned beam profiles is still found confusing. The physicist must also consider technologies not covered by TG-142 (i.e. arc therapy techniques). On the horizon is TG-198 report on implementing TG-142. Although the community still lacks a final TG-100 report, performing a failure-mode -and-effectsmore » analysis and statistical process control analysis to determine the institution-specific clinical impact of each TG-142 test may be useful for identifying trends for pro-active surveillance. Learning Objectives: To better understand the confusing and controversial aspects of TG-142. To understand what is still missing from TG-142 and how to account for these tests in clinical practice To describe which QA tests in TG-142 yield the largest potential clinical result if not discovered.« less

  8. Lipid profile of women qualifying for hypolipidaemic treatment.

    PubMed

    Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Salpea, Klelia D; Damaskos, Dimitris S; Hoursalas, Ioannis S; Petropoulos, Ilias; Bilianou, Helen I; Cokkinos, Dennis V

    2006-08-01

    Death rates from coronary heart disease continue to rise in women despite a marked decrease in men for the past two decades. Our study aimed to evaluate essential risk factors in high-risk adult women. Lipid profiles of 547 dyslipidaemic adult women aged 57.5 +/- 10.6 years (mean +/- standard deviation) were evaluated and stratified according to fasting plasma lipid levels. Classification of the cohort was performed based on triglycerides (TG) and high-density lipoprotein cholesterol (HDL-C) levels and correlations between TG and HDL-C were estimated. Patients with TG > or =150 mg/dl had lower HDL-C levels compared to those with TG <150 mg/dl (p < 0.001). Patients with HDL-C <40 mg/dl had lower TC levels and higher TG levels compared to those with HDL-C > or =40 mg/dl (p = 0.012 and p < 0.001, respectively). In the cohort and the subgroups an inverse correlation between TG and HDL-C was observed (r = -0.428, slope = -0.048, p < 0.001). The expected inverse correlation between fasting high TG and low HDL levels was confirmed. The novelty of the study is that this correlation persists even in the case of low fasting TG levels.

  9. The predictive ability of triglycerides and waist (hypertriglyceridemic waist) in assessing metabolic triad change in obese children and adolescents.

    PubMed

    Hobkirk, James P; King, Roderick F; Gately, Paul; Pemberton, Philip; Smith, Alexander; Barth, Julian H; Harman, Nicola; Davies, Ian; Carroll, Sean

    2013-10-01

    The metabolic triad [fasting insulin, apolipoprotein B, and low-density lipoporotein (LDL) peak particle density] is characteristic of increased intra-abdominal adipose tissue and insulin resistance and can be predicted by the simple and adoptable screening tool, the hypertriglyceridemic waist. The associations between hypertriglyceridemic waist components [fasting triglycerides (TG) and waist circumference cut-points derived from a child-specific metabolic syndrome definition] with the metabolic triad were examined in obese youth before and after weight loss. A continuous metabolic triad score (MTS) was calculated as a cumulative and standardized residual score of fasting insulin, apolipoprotein B, and LDL peak particle density (z-scores of the metabolic triad variables regressed onto age and sex). The predictive ability of TG and waist in assessing metabolic triad change was undertaken in 75 clinically obese boys and girls, aged 8-18, body mass index (BMI) 34.2±6.4 kg/m(2) before and after weight loss. Fasting TG concentrations (r(2)=0.216, P<0.0001) and waist circumference (r(2)=0.049, P=0.019) were both significant independent predictors of the cumulative MTS, together accounting for 26.5% of its total variance. All cardiometabolic risk factors [except a reduction in high-density lipoprotein cholesterol (HDL-C)] were favorably modified following weight loss. Fasting TG change was the only significant predictor of the MTS change (r(2)=0.177, P<0.0001). Waist circumference was not a significant predictor of MTS change. The reduction in fasting TG concentration (but not waist circumference) was the only significant predictor of MTS change. Fasting TG may be the most important metabolic syndrome component to best characterize the metabolic heterogeneity in obese cohorts and the changes in metabolic risk in clinically obese youth.

  10. Assessment of the correlation between the atherogenic index of plasma and cardiometabolic risk factors in children and adolescents: might it be superior to the TG/HDL-C ratio?

    PubMed

    Nogay, Nalan Hakime

    2017-08-28

    Most of the studies investigating the correlation between the atherogenic index of plasma (AIP) and cardiometabolic risk factors have been conducted with adults, while only a limited number of related studies that involved children and adolescents has been conducted. The purpose of this study is to assess the correlation between the AIP and other cardiometabolic risk factors in adolescents. This study was conducted with 310 girls and 90 boys who were between the ages of 6 and 18 years. After a 10-h fasting period, the biochemical values of the participants were measured in the morning. The anthropometric measurements of the participants were also taken. The AIP was calculated as Log10 (triglycerides/high density lipoprotein-cholesterol; TG/HDL-C). In adolescents between the ages of 12 and 18, the mean AIP of the group with TG ≥130 mg/dL was significantly higher than that of the groups with TG of 90-129 mg/dL and <90 mg/dL. There was a strong correlation between TG and AIP for both boys and girls among the children and adolescents, while there was a strong correlation between the TG/HDL-C ratio and TG only in the boys who were within the 6-11-year-old age group. An increase in AIP is associated with cardiovascular risk factors in children and adolescents other than those seen in adults. Based on the TG/HDL-C ratio, the AIP may be superior as a complementary index in the assessment of cardiometabolic risks in children and adolescents.

  11. Relationship between insulin sensitivity and the triglyceride-HDL-C ratio in overweight and obese postmenopausal women: a MONET study.

    PubMed

    Karelis, Antony D; Pasternyk, Stephanie M; Messier, Lyne; St-Pierre, David H; Lavoie, Jean-Marc; Garrel, Dominique; Rabasa-Lhoret, Rémi

    2007-12-01

    The objective of this cross-sectional study was to examine the relationship between the triglyceride-HDL-cholesterol ratio (TG:HDL-C) and insulin sensitivity in overweight and obese sedentary postmenopausal women. The study population consisted of 131 non-diabetic overweight and obese sedentary postmenopausal women (age; 57.7+/-5.0 y; body mass index (BMI), 32.2+/-4.3 kg/m2). Subjects were characterized by dividing the entire cohort into tertiles based on the TG:HDL-C (T1<0.86 vs. T2=0.86 to 1.35 vs. T3>1.35, respectively). We measured (i) insulin sensitivity (using the hyperinsulinenic-euglycemic clamp and homeostasis model assessment (HOMA)), (ii) body composition (using dual-energy X-ray absorptiometry), (iii) visceral fat (using computed tomography), (iv) plasma lipids, C-reactive protein, 2 h glucose concentration during an oral glucose tolerance test (2 h glucose), as well as fasting glucose and insulin, (v) peak oxygen consumption, and (vi) lower-body muscle strength (using weight training equipment). Significant correlations were observed between the TG:HDL-C and the hyperinsulinemic-euglycemic clamp (r=-0.45; p<0.0001), as well as with HOMA (r=0.42; p<0.0001). Moreover, the TG:HDL-C significantly correlated with lean body mass, visceral fat, 2 h glucose, C-reactive protein, and muscle strength. Stepwise regression analysis showed that the TG:HDL-C explained 16.4% of the variation in glucose disposal in our cohort, which accounted for the greatest source of unique variance. Other independent predictors of glucose disposal were 2 h glucose (10.1%), C-reactive protein (CRP; 7.6%), and peak oxygen consumption (5.8%), collectively (including the TG:HDL-C) explaining 39.9% of the unique variance. In addition, the TG:HDL-C was the second predictor for HOMA, accounting for 11.7% of the variation. High levels of insulin sensitivity were associated with low levels of the TG:HDL-C. In addition, the TG:HDL-C was a predictor for glucose disposal rates and HOMA values

  12. Birth weight and blood lipid levels in Spanish adolescents: influence of selected APOE, APOC3 and PPARgamma2 gene polymorphisms. The AVENA Study.

    PubMed

    Ruiz, Jonatan R; Labayen, Idoia; Ortega, Francisco B; Moreno, Luis A; González-Lamuño, Domingo; Martí, Amelia; Nova, Esther; Fuentes, Miguel García; Redondo-Figuero, Carlos; Martínez, J Alfredo; Sjöström, Michael; Castillo, Manuel J

    2008-11-10

    There is increasing evidence indicating that genes involved in certain metabolic processes of cardiovascular diseases may be of particular influence in people with low body weight at birth. We examined whether the apolipoprotein (APO) E, APOC3 and the peroxisome proliferator-activated receptor-gamma-2 (PPARgamma2) polymorphisms influence the association between low birth weight and blood lipid levels in healthy adolescents aged 13-18.5 years. A cross-sectional study of 502 Spanish adolescents born at term was conducted. Total (TC) and high density lipoprotein cholesterol (HDLc), triglycerides (TG), apolipoprotein (apo) A and B, and lipoprotein(a) [Lp(a)] were measured. Low density lipoprotein cholesterol (LDLc), TC-HDLc, TC/HDLc and apoB/apoA were calculated. Low birth weight was associated with higher levels of TC, LDLc, apoB, Lp(a), TC-HDLc, TC/HDLc and apoB/apoA in males with the APOE epsilon3epsilon4 genotype, whereas in females, it was associated with lower HDLc and higher TG levels. In males with the APOC3 S1/S2 genotype, low birth weight was associated with lower apoA and higher Lp(a), yet this association was not observed in females. There were no associations between low birth weight and blood lipids in any of the PPARgamma2 genotypes. The results indicate that low birth weight has a deleterious influence on lipid profile particularly in adolescents with the APOE epsilon3/epsilon4 genotype. These findings suggest that intrauterine environment interact with the genetic background affecting the lipid profile in later life.

  13. Triglycerides

    MedlinePlus

    ... physical activity Not smoking Limiting sugar and refined foods Limiting alcohol Switching from saturated fats to healthier fats Some people will also need to take cholesterol medicines to lower their triglycerides.

  14. Efficacy and safety of eicosapentaenoic acid ethyl ester (AMR101) therapy in statin-treated patients with persistent high triglycerides (from the ANCHOR study).

    PubMed

    Ballantyne, Christie M; Bays, Harold E; Kastelein, John J; Stein, Evan; Isaacsohn, Jonathan L; Braeckman, Rene A; Soni, Paresh N

    2012-10-01

    AMR101 is an ω-3 fatty acid agent containing ≥96% pure icosapent-ethyl, the ethyl ester of eicosapentaenoic acid. The efficacy and safety of AMR101 were evaluated in this phase 3, multicenter, placebo-controlled, randomized, double-blinded, 12-week clinical trial (ANCHOR) in high-risk statin-treated patients with residually high triglyceride (TG) levels (≥200 and <500 mg/dl) despite low-density lipoprotein (LDL) cholesterol control (≥40 and <100 mg/dl). Patients (n = 702) on a stable diet were randomized to AMR101 4 or 2 g/day or placebo. The primary end point was median percent change in TG levels from baseline versus placebo at 12 weeks. AMR101 4 and 2 g/day significantly decreased TG levels by 21.5% (p <0.0001) and 10.1% (p = 0.0005), respectively, and non-high-density lipoprotein (non-HDL) cholesterol by 13.6% (p <0.0001) and 5.5% (p = 0.0054), respectively. AMR101 4 g/day produced greater TG and non-HDL cholesterol decreases in patients with higher-efficacy statin regimens and greater TG decreases in patients with higher baseline TG levels. AMR101 4 g/day decreased LDL cholesterol by 6.2% (p = 0.0067) and decreased apolipoprotein B (9.3%), total cholesterol (12.0%), very-low-density lipoprotein cholesterol (24.4%), lipoprotein-associated phospholipase A(2) (19.0%), and high-sensitivity C-reactive protein (22.0%) versus placebo (p <0.001 for all comparisons). AMR101 was generally well tolerated, with safety profiles similar to placebo. In conclusion, AMR101 4 g/day significantly decreased median placebo-adjusted TG, non-HDL cholesterol, LDL cholesterol, apolipoprotein B, total cholesterol, very-low-density lipoprotein cholesterol, lipoprotein-associated phospholipase A(2), and high-sensitivity C-reactive protein in statin-treated patients with residual TG elevations. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Association of the triglycerides to high-density lipoprotein cholesterol ratio with the risk of chronic kidney disease: analysis in a large Japanese population.

    PubMed

    Tsuruya, Kazuhiko; Yoshida, Hisako; Nagata, Masaharu; Kitazono, Takanari; Hirakata, Hideki; Iseki, Kunitoshi; Moriyama, Toshiki; Yamagata, Kunihiro; Yoshida, Hideaki; Fujimoto, Shouichi; Asahi, Koichi; Kurahashi, Issei; Ohashi, Yasuo; Watanabe, Tsuyoshi

    2014-03-01

    To investigate the relationship between triglycerides to high-density lipoprotein cholesterol ratio (TG/HDL-C) and chronic kidney disease (CKD). We used data from 216,007 Japanese adults who participated in a nationwide health checkup program. Men (n = 88,516) and women (n = 127,491) were grouped into quartiles based on their TG/HDL-C levels (<1.26, 1.26-1.98, 1.99-3.18, and >3.18 in men; <0.96, 0.96-1.44, 1.45-2.22, and >2.22 in women). We cross-sectionally assessed the association of TG/HDL-C levels with CKD [defined as an estimated glomerular filtration rate (eGFR) of <60 mL/min/1.73 m(2) (low eGFR) and/or proteinuria (defined as urinary protein ≥ 1+ on dipstick testing)], low eGFR, and proteinuria. The prevalence of CKD, low eGFR, and proteinuria increased significantly with elevating quartiles of TG/HDL-C in both genders (all P for trend <0.001). Participants in the highest quartile of TG/HDL-C had a significantly greater risk of CKD than those in the lowest quartile after adjustment for the relevant confounding factors (odds ratio: 1.57, 95% confidence interval: 1.49-1.65 in men; 1.41, 1.34-1.48 in women, respectively). Furthermore, there were significant associations with low eGFR and proteinuria. In stratified analysis, the risk of CKD increased linearly with greater TG/HDL-C levels in participants with and without hypertension, diabetes, and obesity. Moreover, higher TG/HDL-C levels were relevant for CKD, especially in participants with hypertension and diabetes (P for interaction <0.001, respectively). An elevated TG/HDL-C is associated with the risk of CKD in the Japanese population. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Metabolism of defined structured triglyceride particles compared to mixtures of medium and long chain triglycerides intravenously infused in dogs.

    PubMed

    Simoens, Ch; Deckelbaum, R J; Carpentier, Y A

    2004-08-01

    The present study aimed to determine whether including medium-chain fatty acids (MCFA) in specifically designed structured triglycerides (STG) with a MCFA in sn-1 and sn-3 positions and a long-chain (LC) FA in sn-2 position (MLM) would lead to different effects on plasma lipids and FA distribution into plasma and tissue lipids by comparison to a mixture of separate MCT and LCT molecules (MMM/LLL). The fatty acid (FA) composition was comparable in both lipid emulsions. Lipids were infused over 9h daily, in 2 groups of dogs (n = 6 each), for 28 days as a major component (55% of the non-protein energy intake) of total parenteral nutrition (TPN). Blood samples were obtained on specific days, before starting and just before stopping TPN. The concentration of plasma lipids was measured before starting and before stopping TPN on days 1, 2, 3, 4, 5, 8, 10, 12, 16 and 28. Biopsies were obtained from liver, muscle and adipose tissue 15 days before starting, and again on the day following cessation of TPN. In addition, the spleen was removed after the TPN period. FA composition in plasma and tissue lipids was analysed by gas liquid chromatography in different lipid components of plasma and tissues. No differences in either safety or tolerance parameters were detected between both lipid preparations. A lower rise of plasma TG (P < 0.05) was observed during MLM infusion, indicating a faster elimination rate of MLM vs MMM/LLL emulsion. In spite of the differences of TG molecules which would be assumed to affect the site of FA delivery and metabolic fate, FA distribution in phospholipids (PL) of hepatic and extrahepatic tissues did not substantially differ between both emulsions. Copyright 2003 Elsevier Ltd.

  17. Comparison of TG-43 and TG-186 in breast irradiation using a low energy electronic brachytherapy source.

    PubMed

    White, Shane A; Landry, Guillaume; Fonseca, Gabriel Paiva; Holt, Randy; Rusch, Thomas; Beaulieu, Luc; Verhaegen, Frank; Reniers, Brigitte

    2014-06-01

    The recently updated guidelines for dosimetry in brachytherapy in TG-186 have recommended the use of model-based dosimetry calculations as a replacement for TG-43. TG-186 highlights shortcomings in the water-based approach in TG-43, particularly for low energy brachytherapy sources. The Xoft Axxent is a low energy (<50 kV) brachytherapy system used in accelerated partial breast irradiation (APBI). Breast tissue is a heterogeneous tissue in terms of density and composition. Dosimetric calculations of seven APBI patients treated with Axxent were made using a model-based Monte Carlo platform for a number of tissue models and dose reporting methods and compared to TG-43 based plans. A model of the Axxent source, the S700, was created and validated against experimental data. CT scans of the patients were used to create realistic multi-tissue/heterogeneous models with breast tissue segmented using a published technique. Alternative water models were used to isolate the influence of tissue heterogeneity and backscatter on the dose distribution. Dose calculations were performed using Geant4 according to the original treatment parameters. The effect of the Axxent balloon applicator used in APBI which could not be modeled in the CT-based model, was modeled using a novel technique that utilizes CAD-based geometries. These techniques were validated experimentally. Results were calculated using two dose reporting methods, dose to water (Dw,m) and dose to medium (Dm,m), for the heterogeneous simulations. All results were compared against TG-43-based dose distributions and evaluated using dose ratio maps and DVH metrics. Changes in skin and PTV dose were highlighted. All simulated heterogeneous models showed a reduced dose to the DVH metrics that is dependent on the method of dose reporting and patient geometry. Based on a prescription dose of 34 Gy, the average D90 to PTV was reduced by between ~4% and ~40%, depending on the scoring method, compared to the TG-43 result. Peak

  18. Identification of Type 2 Diabetes Risk Factors Using Phenotypes Consisting of Anthropometry and Triglycerides based on Machine Learning.

    PubMed

    Lee, Bum Ju; Kim, Jong Yeol

    2016-01-01

    The hypertriglyceridemic waist (HW) phenotype is strongly associated with type 2 diabetes; however, to date, no study has assessed the predictive power of phenotypes based on individual anthropometric measurements and triglyceride (TG) levels. The aims of the present study were to assess the association between the HW phenotype and type 2 diabetes in Korean adults and to evaluate the predictive power of various phenotypes consisting of combinations of individual anthropometric measurements and TG levels. Between November 2006 and August 2013, 11,937 subjects participated in this retrospective cross-sectional study. We measured fasting plasma glucose and TG levels and performed anthropometric measurements. We employed binary logistic regression (LR) to examine statistically significant differences between normal subjects and those with type 2 diabetes using HW and individual anthropometric measurements. For more reliable prediction results, two machine learning algorithms, naive Bayes (NB) and LR, were used to evaluate the predictive power of various phenotypes. All prediction experiments were performed using a tenfold cross validation method. Among all of the variables, the presence of HW was most strongly associated with type 2 diabetes (p < 0.001, adjusted odds ratio (OR) = 2.07 [95% CI, 1.72-2.49] in men; p < 0.001, adjusted OR = 2.09 [1.79-2.45] in women). When comparing waist circumference (WC) and TG levels as components of the HW phenotype, the association between WC and type 2 diabetes was greater than the association between TG and type 2 diabetes. The phenotypes tended to have higher predictive power in women than in men. Among the phenotypes, the best predictors of type 2 diabetes were waist-to-hip ratio + TG in men (AUC by NB = 0.653, AUC by LR = 0.661) and rib-to-hip ratio + TG in women (AUC by NB = 0.73, AUC by LR = 0.735). Although the presence of HW demonstrated the strongest association with type 2 diabetes, the predictive power of the combined

  19. The TG/HDL Cholesterol Ratio Predicts All Cause Mortality in Women With Suspected Myocardial Ischemia A Report from the Women’s Ischemia Syndrome Evaluation (WISE)

    PubMed Central

    Bittner, Vera; Johnson, B. Delia; Zineh, Issam; Rogers, William J.; Vido, Diane; Marroquin, Oscar C.; Bairey-Merz, C. Noel; Sopko, George

    2009-01-01

    High triglycerides (TG) and low high density lipoprotein cholesterol (HDL-C) are important cardiovascular risk factors in women. The prognostic utility of the TG/HDL-C ratio, a marker for insulin resistance and small dense low density lipoprotein particles, is unknown among high risk women. Methods We studied 544 women without prior myocardial infarction or coronary revascularization, referred for clinically indicated coronary angiography and enrolled in the Women’s Ischemia Syndrome Evaluation (WISE). Fasting lipid profiles and detailed demographic and clinical data were obtained at baseline. Multi-variate Cox-proportional hazards models for all cause mortality and cardiovascular events (death, myocardial infarction, heart failure, stroke) over a median follow-up of 6 years were constructed using log TG/HDL-C ratio as a predictor variable and accounting for traditional cardiovascular risk factors. Results Mean age was 57±11 years, 84% were white, 55% hypertensive, 20% diabetic, 50% current or prior smokers. TG/HDL-C ranged from 0.3 to 18.4 (median 2.2, first quartile 0.35 to <1.4, fourth quartile 3.66–18.4). Deaths (n=33) and CV events (n=83) increased across TG/HDL-C quartiles (both p<0.05 for trend). TG/HDL-C was a strong independent predictor of mortality in models adjusted for age, race, smoking, hypertension, diabetes, and angiographic coronary disease severity (HR 1.95, 95% CI 1.05, 3.64, p=0.04). For cardiovascular events, the multivariate HR was 1.54 (95% CI 1.05, 2.22, p=0.03) when adjusted for demographic and clinical variables, but became non-significant when angiographic results were included. Conclusion Among women with suspected ischemia, the TG/HDL-C ratio is a powerful independent predictor of all cause mortality and cardiovascular events. PMID:19249427

  20. Thyroid function modifies the association between ratio of triglyceride to high-density lipoprotein cholesterol and renal function: a multicenter cross-sectional study

    PubMed Central

    Yuan, Zhongshang; Zhao, Meng; Zhang, Bingchang; Zhang, Haiqing; Zhang, Xu; Guan, Qingbo; Ning, Guang; Gao, Ling; Xue, Fuzhong; Zhao, Jiajun

    2015-01-01

    Hypothyroidism was confirmed to be associated with both dyslipidemia and renal dysfunction. However, the impact of thyroid function on the relationship between serum lipid levels and renal function has never been given sufficient attention. In this large-scale multicenter cross-sectional study, the ratio of triglyceride to high-density lipoprotein cholesterol (TG/HDL) and the prevalence of hypothyroidism in CKD subjects were significantly higher than those in non-CKD ones (P < 0.001). After adjustment for potential confounding factors, TG/HDL was shown to be significantly associated with serum Cr levels (β = 0.551; 95%CI, 0.394–0.708), and eGFR (β = −0.481; 95%CI, −0.731–−0.230). The risk for CKD was significantly increased as TG/HDL ratio was elevated (adjusted odds ratio = 1.20; 95%CI, 1.11–1.27). These significant associations were found among subjects with euthyroidism and hypothyroidism rather than hyperthyroidism. Furthermore, the associations between TG/HDL and Cr or CKD status were significantly greater in hypothyroidism than those in euthyroidism (P < 0.05). These results suggested that elevated TG/HDL ratio was associated with renal dysfunction; it exhibited a significantly stronger association with Cr and CKD in hypothyroidism than in euthyroidism. Therefore, more attention should be paid on lipid profile to prevent or delay the occurrence and progression of renal dysfunction, especially for those with hypothyroidism. PMID:26179571

  1. Thyroid function modifies the association between ratio of triglyceride to high-density lipoprotein cholesterol and renal function: a multicenter cross-sectional study.

    PubMed

    Yuan, Zhongshang; Zhao, Meng; Zhang, Bingchang; Zhang, Haiqing; Zhang, Xu; Guan, Qingbo; Ning, Guang; Gao, Ling; Xue, Fuzhong; Zhao, Jiajun

    2015-07-16

    Hypothyroidism was confirmed to be associated with both dyslipidemia and renal dysfunction. However, the impact of thyroid function on the relationship between serum lipid levels and renal function has never been given sufficient attention. In this large-scale multicenter cross-sectional study, the ratio of triglyceride to high-density lipoprotein cholesterol (TG/HDL) and the prevalence of hypothyroidism in CKD subjects were significantly higher than those in non-CKD ones (P < 0.001). After adjustment for potential confounding factors, TG/HDL was shown to be significantly associated with serum Cr levels (β = 0.551; 95%CI, 0.394-0.708), and eGFR (β = -0.481; 95%CI, -0.731--0.230). The risk for CKD was significantly increased as TG/HDL ratio was elevated (adjusted odds ratio = 1.20; 95%CI, 1.11-1.27). These significant associations were found among subjects with euthyroidism and hypothyroidism rather than hyperthyroidism. Furthermore, the associations between TG/HDL and Cr or CKD status were significantly greater in hypothyroidism than those in euthyroidism (P < 0.05). These results suggested that elevated TG/HDL ratio was associated with renal dysfunction; it exhibited a significantly stronger association with Cr and CKD in hypothyroidism than in euthyroidism. Therefore, more attention should be paid on lipid profile to prevent or delay the occurrence and progression of renal dysfunction, especially for those with hypothyroidism.

  2. Metabolic effects of protease inhibitor-sparing antiretroviral regimens given as initial treatment of HIV-1 Infection (AIDS Clinical Trials Group Study A5095).

    PubMed

    Shikuma, Cecilia M; Yang, Yang; Glesby, Marshall J; Meyer, William A; Tashima, Karen T; Ribaudo, Heather J; Webb, Nancy; Bastow, Barbara; Kuritzkes, Daniel R; Gulick, Roy M

    2007-04-15

    To assess metabolic changes after initiation of protease inhibitor (PI)-sparing regimens in antiretroviral-naive patients. Metabolic changes were analyzed within the triple-nucleoside (zidovudine [ZDV]/lamivudine [3TC]/abacavir [ABC])-containing, 3-drug efavirenz (EFV) [ZDV/3TC + EFV]-containing, and 4-drug EFV [ZDV/3TC/ABC + EFV]-containing arms of the AIDS Clinical Trials Group multicenter trial A5095. Metabolic values were compared with published US general population norms. From week 0 to week 24, all arms exhibited similar mild median increases in glucose and decreases in insulin sensitivity, whereas changes in lipids were greater in the ZDV/3TC + EFV and ZDV/3TC/ABC + EFV arms than in the ZDV/3TC/ABC arm: triglyceride (TG; 7, 18, and -1 mg/dL, respectively), total cholesterol (TC; 23, 28, and 5 mg/dL, respectively), low-density lipoprotein cholesterol (LDL-C; 9, 14, and 1 mg/dL, respectively), and high-density lipoprotein cholesterol (HDL-C; 10, 10, and 5 mg/dL, respectively). Adjusted mean study lipid values of all study participants at week 0 and week 96 compared with those of the National Health and Nutrition Examination Survey (NHANES) 1999 through 2002 values were: TG (148, 187, and 123 mg/dL, respectively), TC (164, 195, and 203 mg/dL, respectively), HDL-C (35, 47, and 51 mg/dL, respectively), and LDL-C (101, 117, and 123 mg/dL, respectively) (P < or = 0.005 for each value vs. NHANES values). Similar mild increases in glucose and decreases in insulin sensitivity were observed in all regimens, whereas lipids were modestly higher in the EFV-containing arms. Compared with general population norms, the metabolic dysfunctions of concern after these PI-sparing therapies were increasingly abnormal TC and lower (but improved relative to baseline) HDL-C levels.

  3. Cardiometabolic risk in US Army recruits and the effects of basic combat training.

    PubMed

    Pasiakos, Stefan M; Karl, J Philip; Lutz, Laura J; Murphy, Nancy E; Margolis, Lee M; Rood, Jennifer C; Cable, Sonya J; Williams, Kelly W; Young, Andrew J; McClung, James P

    2012-01-01

    Cardiometabolic disease risk in US military recruits and the effects of military training have not been determined. This study examined lifestyle factors and biomarkers associated with cardiometabolic risk in US Army recruits (209; 118 male, 91 female, 23 ± 5 yr) before, during, and after basic combat training (BCT). Anthropometrics; fasting total (TC), high-density lipoprotein (HDL) and low-density lipoprotein (LDL) cholesterol; triglycerides (TG); glucose; and insulin were measured at baseline and every 3 wks during the 10 wk BCT course. At baseline, 14% of recruits were obese (BMI>30 kg/m(2)), 27% were cigarette smokers, 37% were sedentary, and 34% reported a family history of cardiometabolic disease. TC was above recommended levels in 8%, LDL in 39%, TG in 5%, and glucose in 8% of recruits, and HDL was below recommended levels in 33% of recruits at baseline. By week 9, TC decreased 8%, LDL 10%, TG 13%, glucose 6% and homeostasis model assessment of insulin resistance (HOMA-IR) 40% in men (P<0.05). In women, TC, LDL, glucose and HOMA-IR were decreased from baseline at weeks 3 and 6 (P<0.05), but were not different from baseline levels at week 9. During BCT, body weight declined in men but not women, while body fat percentage declined in both men and women (P<0.05). At the start of military service, the prevalence of cardiometabolic risk in US military recruits is comparable to that reported in similar, college-aged populations. Military training appears to be an effective strategy that may mitigate risk in young people through improvements in lipid profiles and glycemic control.

  4. Cardiometabolic Risk in US Army Recruits and the Effects of Basic Combat Training

    PubMed Central

    Lutz, Laura J.; Murphy, Nancy E.; Margolis, Lee M.; Rood, Jennifer C.; Cable, Sonya J.; Williams, Kelly W.; Young, Andrew J.; McClung, James P.

    2012-01-01

    Background Cardiometabolic disease risk in US military recruits and the effects of military training have not been determined. This study examined lifestyle factors and biomarkers associated with cardiometabolic risk in US Army recruits (209; 118 male, 91 female, 23±5 yr) before, during, and after basic combat training (BCT). Methodology/Principal Findings Anthropometrics; fasting total (TC), high-density lipoprotein (HDL) and low-density lipoprotein (LDL) cholesterol; triglycerides (TG); glucose; and insulin were measured at baseline and every 3 wks during the 10 wk BCT course. At baseline, 14% of recruits were obese (BMI>30 kg/m2), 27% were cigarette smokers, 37% were sedentary, and 34% reported a family history of cardiometabolic disease. TC was above recommended levels in 8%, LDL in 39%, TG in 5%, and glucose in 8% of recruits, and HDL was below recommended levels in 33% of recruits at baseline. By week 9, TC decreased 8%, LDL 10%, TG 13%, glucose 6% and homeostasis model assessment of insulin resistance (HOMA-IR) 40% in men (P<0.05). In women, TC, LDL, glucose and HOMA-IR were decreased from baseline at weeks 3 and 6 (P<0.05), but were not different from baseline levels at week 9. During BCT, body weight declined in men but not women, while body fat percentage declined in both men and women (P<0.05). Conclusions/Significance At the start of military service, the prevalence of cardiometabolic risk in US military recruits is comparable to that reported in similar, college-aged populations. Military training appears to be an effective strategy that may mitigate risk in young people through improvements in lipid profiles and glycemic control. PMID:22384004

  5. The product of fasting plasma glucose and triglycerides improves risk prediction of type 2 diabetes in middle-aged Koreans.

    PubMed

    Lee, Joung-Won; Lim, Nam-Kyoo; Park, Hyun-Young

    2018-05-30

    Screening for risk of type 2 diabetes mellitus (T2DM) is an important public health issue. Previous studies report that fasting plasma glucose (FPG) and triglyceride (TG)-related indices, such as lipid accumulation product (LAP) and the product of fasting glucose and triglyceride (TyG index), are associated with incident T2DM. We aimed to evaluate whether FPG or TG-related indices can improve the predictive ability of a diabetes risk model for middle-aged Koreans. 7708 Koreans aged 40-69 years without diabetes at baseline were eligible from the Korean Genome and Epidemiology Study. The overall cumulative incidence of T2DM was 21.1% (766 cases) in men and 19.6% (797 cases) in women. Therefore, the overall cumulative incidence of T2DM was 20.3% (1563 cases). Multiple logistic regression analysis was conducted to compare the odds ratios (ORs) for incident T2DM for each index. The area under the receiver operating characteristic curve (AROC), continuous net reclassification improvement (cNRI), and integrated discrimination improvement (IDI) were calculated when each measure was added to the basic risk model for diabetes. All the TG-related indices and FPG were more strongly associated with incident T2DM than WC in our study population. The adjusted ORs for the highest quartiles of WC, TG, FPG, LAP, and TyG index compared to the lowest, were 1.64 (95% CI, 1.13-2.38), 2.03 (1.59-2.61), 3.85 (2.99-4.97), 2.47 (1.82-3.34), and 2.79 (2.16-3.60) in men, and 1.17 (0.83-1.65), 2.42 (1.90-3.08), 2.15 (1.71-2.71), 2.44 (1.82-3.26), and 2.85 (2.22-3.66) in women, respectively. The addition of TG-related parameters or FPG, but not WC, to the basic risk model for T2DM (including age, body mass index, family history of diabetes, hypertension, current smoking, current drinking, and regular exercise) significantly increased cNRI, IDI, and AROC in both sexes. Adding either TyG index or FPG into the basic risk model for T2DM increases its prediction and reclassification ability

  6. Triglyceride Synthesis in Epididymal Adipose Tissue

    PubMed Central

    Bederman, Ilya R.; Foy, Steven; Chandramouli, Visvanathan; Alexander, James C.; Previs, Stephen F.

    2009-01-01

    The obesity epidemic has generated interest in determining the contribution of various pathways to triglyceride synthesis, including an elucidation of the origin of triglyceride fatty acids and triglyceride glycerol. We hypothesized that a dietary intervention would demonstrate the importance of using glucose versus non-glucose carbon sources to synthesize triglycerides in white adipose tissue. C57BL/6J mice were fed either a low fat, high carbohydrate (HC) diet or a high fat, carbohydrate-free (CF) diet and maintained on 2H2O (to determine total triglyceride dynamics) or infused with [6,6-2H]glucose (to quantify the contribution of glucose to triglyceride glycerol). The 2H2O labeling data demonstrate that although de novo lipogenesis contributed ∼80% versus ∼5% to the pool of triglyceride palmitate in HC- versus CF-fed mice, the epididymal adipose tissue synthesized ∼1.5-fold more triglyceride in CF- versus HC-fed mice, i.e. 37 ± 5 versus 25 ± 3 μmol × day–1. The [6,6-2H]glucose labeling data demonstrate that ∼69 and ∼28% of triglyceride glycerol is synthesized from glucose in HC- versus CF-fed mice, respectively. Although these data are consistent with the notion that non-glucose carbon sources (e.g. glyceroneogenesis) can make substantial contributions to the synthesis of triglyceride glycerol (i.e. the absolute synthesis of triglyceride glycerol from non-glucose substrates increased from ∼8 to ∼26 μmol × day–1 in HC- versus CF-fed mice), these observations suggest (i) the importance of nutritional status in affecting flux rates and (ii) the operation of a glycerol-glucose cycle. PMID:19114707

  7. On-Site Classification of Pansteatitis in Mozambique Tilapia (Oreochromis mossambicus) using a Portable Lipid-Based Analyzer

    PubMed Central

    Somerville, Stephen E.; Cantu, Theresa M.; Guillette, Matthew P.; Botha, Hannes; Boggs, Ashley S. P.; Luus-Powell, Wilmien; Guillette, Louis J.

    2017-01-01

    While no pansteatitis-related large-scale mortality events have occurred since 2008, the current status of pansteatitis (presence and pervasiveness) in the Olifants River system and other regions of South Africa remain largely unknown. In part, this is due to both a lack of known biological markers of pansteatitis and a lack of suitable non-invasive assays capable of rapidly classifying the disease. Here, we propose the application of a point-of-care (POC) device using lipid-based test strips (total cholesterol (TC) and total triglyceride (TG)), for classifying pansteatitis status in the whole blood of pre-spawning Mozambique tilapia (Oreochromis mossambicus). Using the TC strips, the POC device was able to non-lethally classify the tilapia as either healthy or pansteatitis-affected; the sexes were examined independently because sexual dimorphism was observed for TC (males p = 0.0364, females χ2 = 0.0007). No significant difference between diseased and pansteatitis-affected tilapia was observed using the TG strips. This is one of the first described applications of using POC devices for on-site environmental disease state testing. A discussion on the merits of using portable lipid-based analyzers as an in-field disease-state diagnostic tool is provided. PMID:28729886

  8. Metabolic profile of serum and follicular fluid from postpartum dairy cows during summer and winter.

    PubMed

    Alves, Benner G; Alves, Kele A; Martins, Muller C; Braga, Lucas S; Silva, Thiago H; Alves, Bruna G; Santos, Ricarda M; Silva, Thiago V; Viu, Marco A O; Beletti, Marcello E; Jacomini, José O; Gambarini, Maria L

    2014-01-01

    This study was designed to monitor the biochemical profiles of serum and follicular fluid (FF) of postpartum dairy cows during the summer (n=30) and winter (n=30). Blood and FF (follicles ≥ 9 mm) were obtained from Girolando cows at 30, 45, 60, 75 and 90 days postpartum. The samples were collected and analysed to determine glucose, total cholesterol (TC), triglyceride (TG), urea, sodium (Na), potassium (K) and calcium (Ca) levels. Throughout the study, the following clinical variables were measured: rectal temperature (RT), respiratory rate (RR) and body condition score (BCS). In addition, the temperature humidity index (THI) was calculated for each season. During the summer season, THI was higher, BCS decreased, there was an increase in RT, and glucose, urea, Na and K serum levels were decreased (P<0.05). The levels of TC, TG, urea, K and Ca in follicular fluid increased (P<0.05). Positive correlations (P<0.05) were observed between the serum and FF levels for glucose (r=0.29), TC (r=0.24) and Ca (r=0.30). Therefore, the biochemical profile of serum and FF of dairy cows under summer heat-stress conditions demonstrates marked changes that may impair fertility during lactation.

  9. The effect of exemestane, anastrozole, and tamoxifen on lipid profiles in Japanese postmenopausal early breast cancer patients: final results of National Surgical Adjuvant Study BC 04, the TEAM Japan sub-study.

    PubMed

    Hozumi, Y; Suemasu, K; Takei, H; Aihara, T; Takehara, M; Saito, T; Ohsumi, S; Masuda, N; Ohashi, Y

    2011-08-01

    In this Tamoxifen Exemestane Adjuvant Multinational Japan sub-study, we evaluated the time course of changes in serum lipids in postmenopausal women with hormone-sensitive early breast cancer treated with exemestane, anastrozole, or tamoxifen for postoperative adjuvant therapy. A total of 154 breast cancer patients were assigned to receive exemestane, anastrozole, or tamoxifen in this randomized open-label study. Serum lipid parameters including triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were measured during 1 year of treatment. TC and LDL-C rapidly decreased in patients treated with tamoxifen at 3 months. Compared with anastrozole and exemestane patients, TC and LDL-C were significantly lower at all assessment time points in tamoxifen patients (P < 0.05). TG increased in tamoxifen patients; it was significantly higher compared with exemestane patients at all assessment time points (P < 0.05). HDL-C slightly decreased in exemestane patients; it was significantly lower compared with anastrozole patients at 3 months and 1 year (P = 0.0179 and 0.0013, respectively). Changes of lipid profiles in Japanese postmenopausal women treated with tamoxifen were relatively favorable, while exemestane and anastrozole had no clinically significant effect on the serum lipids.

  10. Triglycerides and Heart Disease, Still a Hypothesis?

    PubMed Central

    Goldberg, Ira J.; Eckel, Robert H.; McPherson, Ruth

    2011-01-01

    The purpose of this article is to review the basic and clinical science relating plasma triglycerides and cardiovascular disease. Although many aspects of the basic physiology of triglyceride production, its plasma transport and tissue uptake have been known for several decades, the relationship of plasma triglyceride levels to vascular disease is uncertain. Are triglyceride rich lipoproteins, their influence on HDL and LDL, or the underlying diseases leading to defects in triglyceride metabolism the culprit? Animal models have failed to confirm that anything other than early fatty lesions can be produced by triglyceride-rich lipoproteins. Metabolic products of triglyceride metabolism can be toxic to arterial cells; however, these studies are primarily in vitro. Correlative studies of fasting and postprandial triglycerides and genetic diseases implicate VLDL and their remnants, and chylomicron remnants in atherosclerosis development; but the concomitant alterations in other lipoproteins and other risk factors obscure any conclusions about direct relationships between disease and triglycerides. Genes that regulate triglyceride levels also correlate with vascular disease. Human intervention trials, however, have lacked an appropriately defined population, and have produced outcomes without definitive conclusions. The time is more than ripe for new and creative approaches to understanding the relationship of triglycerides and heart disease. PMID:21527746

  11. Knockdown of Triglyceride Synthesis Does Not Enhance Palmitate Lipotoxicity or Prevent Oleate-Mediated Rescue in Rat Hepatocytes

    PubMed Central

    Leamy, Alexandra K.; Hasenour, Clinton M.; Egnatchik, Robert A.; Trenary, Irina A.; Yao, Conghui; Patti, Gary J.; Shiota, Masakazu; Young, Jamey D.

    2016-01-01

    Experiments in a variety of cell types, including hepatocytes, consistently demonstrate the acutely lipotoxic effects of saturated fatty acids, such as palmitate (PA), but not unsaturated fatty acids, such as oleate (OA). PA+OA co-treatment fully prevents PA lipotoxicity through mechanisms that are not well defined but which have been previously attributed to more efficient esterification and sequestration of PA into triglycerides (TGs) when OA is abundant. However, this hypothesis has never been directly tested by experimentally modulating the relative partitioning of PA/OA between TGs and other lipid fates in hepatocytes. In this study, we found that addition of OA to PA-treated hepatocytes enhanced TG synthesis, reduced total PA uptake and PA lipid incorporation, decreased phospholipid saturation and rescued PA-induced ER stress and lipoapotosis. Knockdown of diacylglycerol acyltransferase (DGAT), the rate-limiting step in TG synthesis, significantly reduced TG accumulation without impairing OAmediated rescue of PA lipotoxicity. In both wild-type and DGAT-knockdown hepatocytes, OA cotreatment significantly reduced PA lipid incorporation and overall phospholipid saturation compared to PA-treated hepatocytes. These data indicate that OA’s protective effects do not require increased conversion of PA into inert TGs, but instead may be due to OA’s ability to compete against PA for cellular uptake and/or esterification and, thereby, normalize the composition of cellular lipids in the presence of a toxic PA load. PMID:27249207

  12. The Joint Effects of Smoking and Alcohol Drinking on Lipid-Related Indices among Chinese Males-Comparing Exercise and Non-Exercise Groups.

    PubMed

    Yang, Jian; Ye, Jun; Guo, Qiao; Sun, Yining; Zheng, Yansong; Zhang, Yongliang

    2018-06-11

    Smoking and drinking are two predisposing factors for dyslipidemia. Exercise has been proposed as a strategy to improve the blood lipids. However, it remains unclear how smoking and drinking jointly affect blood lipids and whether exercise influences their effects. To evaluate the effects of smoking and drinking, either alone or in combination, on lipid-related indices in both exercise and non-exercise groups among Chinese men. This study was conducted in a health examination center between 2015 and 2016. A sample of 6,179 male subjects was divided into exercise and non-exercise groups. Logistic and linear regression analyses were used to calculate the odds ratios for abnormal lipid-related indices and correlation coefficients between smoking/drinking and lipid-related indices. In the study population, the percentage of stable smokers and stable drinkers was 46.3% (2,860/6,179) and 77.6% (4,795/6,179), respectively. An increased smoking amount was significantly associated with an elevated triglyceride (TG) level and a decreased high-density lipoprotein cholesterol (HDL-C) level. Heavier smokers had higher odds ratios for high TG and low HDL-C. Heavier drinkers had higher levels of total cholesterol (TC), TG, and HDL-C and higher odds ratios for high TC and high TG but lower odds ratio for low HDL-C. The exercise group had lower TG levels and higher HDL-C levels than did the non-exercise group. Both heavier smoking and heavier drinking were associated with poorer TG levels, and the results suggest that drinking may be helpful for HDL-C. Exercise may relieve the negative effects of smoking and drinking.

  13. Correlation of Serum Lipoprotein Ratios with Insulin Resistance in Infertile Women with Polycystic Ovarian Syndrome: A Case Control Study.

    PubMed

    Ghaffarzad, Aisa; Amani, Reza; Mehrzad Sadaghiani, Mahzad; Darabi, Masoud; Cheraghian, Bahman

    2016-01-01

    Dyslipidemia and insulin resistance (IR), occurring in most infertile women with polycystic ovarian syndrome (PCOS), increase the risk of cardiovascular disease (CVD) and type 2 diabetes. This study aimed to assess the relationships between lipoprotein ratios and IR in PCOS women. Thirty six infertile women with PCOS selected based on Androgen Excess Society (AES) criteria and 29 healthy women matched for age were recruited to this case-control study. After physical measurements, fasting serum glucose (Glu), insulin and lipid profile levels [triglycerides (TGs), total cholesterol (TC), low-density lipoproteincholesterol (LDL-C) and high-density lipoprotein-cholesterol (HDL-C)] were measured, while lipoprotein ratios (TC/HDL-C, LDL-C/HDL-C, TG/HDL-C) were calculated. IR was also calculated using homeostasis model assessment (HOMA)-IR. The optimal cutoffs of lipoprotein ratios in relation to HOMA-IR were calculated based on the Receiver Operating Characteristics (ROC) curve analysis using the area under curve (AUC). Waist circumference (WC), insulin levels, HOMA-IR, TG levels, and all lipoprotein ratios were significantly higher, while HDL-C was lower in PCOS group as compared to healthy controls. All lipoprotein ratios, TG levels, and WC are significantly correlated with insulin levels and HOMA-IR. Among lipoprotein ratios, the highest AUC of the ROC belonged to TG/HDL-C ratio with sensitivity of 63.6% and specificity of 84.4% (TG/HDL-C>3.19) as a marker of IR in infertile PCOS women. Lipoprotein ratios, particularly TG/HDL-C, are directly correlated with insulin levels and can be used as a marker of IR (HOMA-IR) in infertile PCOS patients.

  14. ANGPTL4 E40K and T266M: effects on plasma triglyceride and HDL levels, postprandial responses, and CHD risk.

    PubMed

    Talmud, Philippa J; Smart, Melissa; Presswood, Edward; Cooper, Jackie A; Nicaud, Viviane; Drenos, Fotios; Palmen, Jutta; Marmot, Michael G; Boekholdt, S Matthijs; Wareham, Nicholas J; Khaw, Kay-Tee; Kumari, Meena; Humphries, Steve E

    2008-12-01

    Angiopoietin-like 4 is a dual-function protein: an inhibitor of LPL, influencing plasma triglycerides (TGs), with angiogenic properties. We examined the association of common ANGPTL4 variants with CHD traits and risk in 5 studies (13,527 individuals). The effects on plasma lipids of 6 tagging SNPs and the recently identified E40K were examined in a study of 2772 men. Only T266M (rs1044250, MAF=30%) and E40K (MAF=2%) were significantly associated with TG-lowering (-10.4%, P<0.004 and -20.4%, P<0.0001), respectively. T266M no longer showed significant associations when K40 carriers (K40+) were excluded (P=0.2). Combining data from 5 studies confirmed the TG-lowering effect of K40+ (weighted mean difference: -0.12 [95% CI -0.18, -0.05] mmol/L TG P=0.0001). Surprisingly, in the 3 prospective studies, the combined OR for CHD was 1.48 (1.11 to 1.96, P=0.007), independent of TG. In individuals with a paternal history of MI (n=332) T266M, but not E40K, showed effects on postprandial AUC TG and glucose (P=0.009 and P=0.017, respectively) compared to controls (n=370). Although associated with an atheroprotective lipid profile, E40K was associated with increased CHD risk, suggesting Angptl4 influences parameters beyond lipid levels. T266M showed effects only under conditions of postprandial stress. The functionality of these potential "loss-of-function" variants needs validation.

  15. CE: Triglycerides: Do They Matter?

    PubMed

    Scordo, Kristine; Pickett, Kim Anne

    2017-01-01

    : Since the introduction of HMG-CoA reductase inhibitors, also known as statins, as an adjunct to diet in the treatment of hyperlipidemia and the greater emphasis placed on reducing low-density lipoprotein (LDL) cholesterol levels in the prevention of atherosclerosis and cardiovascular disease (CVD), there has been less focus on the value of lowering serum triglyceride levels. Many patients are aware of their "good" and "bad" cholesterol levels, but they may not be aware of their triglyceride level or of the association between high triglycerides and the development of CVD. In recent years, however, in light of the increasing incidences of obesity, insulin resistance, and type 2 diabetes, lowering triglyceride levels has gained renewed interest. In addition to the focus on lowering LDL cholesterol levels in CVD prevention, clinicians need to be aware of the role of triglycerides-their contribution to CVD, and the causes and treatment of hypertriglyceridemia.

  16. Triglycerides produced in the livers of fasting rabbits are predominantly stored as opposed to secreted into the plasma

    PubMed Central

    Tuvdendorj, Demidmaa; Zhang, Xiao-jun; Chinkes, David L.; Wang, Lijian; Wu, Zhanpin; Rodriguez, Noe A.; Herndon, David N.; Wolfe, Robert R.

    2015-01-01

    Objective The liver plays a central role in regulating fat metabolism; however, it is not clear how the liver distributes the synthesized triglycerides (TGs) to storage and to the plasma. Materials and Methods We have measured the relative distribution of TGs produced in the liver to storage and the plasma by means of U-13C16-palmitate infusion in anesthetized rabbits after an overnight fast. Results The fractional synthesis rates of TGs stored in the liver and secreted into the plasma were not significantly different (Stored vs. Secreted: 31.9 ± 0.8 vs. 27.7 ± 2.6 %•h−1, p > 0.05. However, the absolute synthesis rates of hepatic stored and secreted TGs were 543 ± 158 and 27 ± 7 nmol·kg−1·min−1 respectively, indicating that in fasting rabbits the TGs produced in the liver were predominately stored (92±3%) rather than secreted (8±3%) into the plasma. This large difference was mainly due to the larger pool size of the hepatic TGs which was 21±9-fold that of plasma TGs. Plasma free fatty acids (FFAs) contributed 47±1% of the FA precursor for hepatic TG synthesis, and the remaining 53±1% was derived from hepatic lipid breakdown and possibly plasma TGs depending on the activity of hepatic lipase. Plasma palmitate concentration significantly correlated with hepatic palmitoyl-CoA and TG synthesis. Conclusion In rabbits, after an overnight fast, the absolute synthesis rate of hepatic stored TGs was significantly higher than that of secreted due to the larger pool size of hepatic TGs. The net synthesis rate of TG was approximately half the absolute rate. Plasma FFA is a major determinant of hepatic TG synthesis, and therefore hepatic TG storage. PMID:25682063

  17. Common functional variants of APOA5 and GCKR accumulate gradually in association with triglyceride increase in metabolic syndrome patients.

    PubMed

    Hadarits, Ferenc; Kisfali, Péter; Mohás, Márton; Maász, Anita; Duga, Balázs; Janicsek, Ingrid; Wittmann, István; Melegh, Béla

    2012-02-01

    The common functional variants of the apolipoprotein A5 (APOA5) and the glucokinase regulatory protein genes (GCKR) have been shown to associate with increased fasting triglyceride (TG) levels. Albeit the basic association has been extensively investigated in several populations of different origin, less is known about quantitative traits of them. In our study accumulation rates of four APOA5 (T-1131, IVS3 + G476A, T1259C and C56G) and two GCKR (C1337T and rs780094) functional SNPs were analyzed in patients stratified into four TG quartile groups. Randomly selected 325 metabolic syndrome patients were separated into four quartile (q) groups based on the TG levels as follows q1: TG <1.38 mmol/l; q2: 1.38-1.93 mmol/l; q3: 1.94-2.83 mmol/l; and q4: TG >2.83 mmol/l. We observed significant stepwise increase of prevalence rates of minor allele frequencies in the four plasma TG quartiles for three APOA5 SNPs: -1131C (q1: 4.94%; q2: 8.64%; q3: 11.6%; q4: 12.3%), IVS3 + 476A (q1: 4.32%; q2: 7.4%; q3: 10.36%; q4: 11.1%), and 1259C (q1: 4.94%; q2: 7.41%; q3: 10.4%; q4: 11.7%). The haplotype analysis revealed, that the frequency of APOA5*2 haplotype gradually increased in q2, q3 and q4 (q1: 9.87%; q2: 14.8%; q3: 18.3%; q4: 21%). The distribution of the homozygotes of the two analyzed GCKR variants resembled to the APOA5 pattern. Contrary to the hypothetically predictable linear association coming from the current knowledge about the APOA5 and GCKR functions, the findings presented here revealed a unique, TG raise dependent gradual accumulation of the functional variants of in MS patients. Thus, the findings of the current study serve indirect evidence for the existence of rare APOA5 and GCKR haplotypes in metabolic syndrome patients with higher TG levels, which contribute to the complex lipid metabolism alteration in this disease.

  18. Overexpression of porcine lipoprotein-associated phospholipase A2 in swine.

    PubMed

    Tang, Xiaochun; Wang, Gangqi; Liu, Xingxing; Han, Xiaolei; Li, Zhuang; Ran, Guangyao; Li, Zhanjun; Song, Qi; Ji, Yuan; Wang, Haijun; Wang, Yuhui; Ouyang, Hongsheng; Pang, Daxin

    2015-09-25

    Lipoprotein-associated phospholipase A 2 (Lp-PLA2) is associated with the risk of vascular disease. It circulates in human blood predominantly in association with low-density lipoprotein cholesterol (LDL-C) and hydrolyses oxidized phospholipids into pro-inflammatory products. However, in the mouse circulation, it predominantly binds to high-density lipoprotein cholesterol (HDL-C) and exhibits anti-inflammatory properties. To further investigate the effects of Lp-PLA2 in the circulation, we generated over-expressed Lp-PLA2 transgenic swine. The eukaryotic expression plasmid of porcine Lp-PLA2 which driven by EF1α promoter was constructed and generate transgenic swine via SCNT. The expression and activity of Lp-PLA2 in transgenic swine were evaluated, and the total cholesterol (TC), HDL-C, LDL-C and triglyceride (TG) levels in the fasting and fed states were also assessed. Compared with wild-type swine controls, the transgenic swine exhibited elevated Lp-PLA2 mRNA levels and activities, and the activity did not depend on the feeding state. The TC, HDL-C and LDL-C levels were not significantly increased. There was no change in the TG levels in the fasting state between transgenic and control pigs. However, in the fed state, the TG levels of transgenic swine were slightly increased compared with the control pigs and were significantly elevated compared with the fasting state. In addition, inflammatory gene (interleukin [IL]-6, monocyte chemotactic protein [MCP]-1 and tumor necrosis factor [TNF]-α) mRNA levels in peripheral blood mononuclear cells (PBMCs) were significantly increased. The results demonstrated that Lp-PLA2 is associated with triglycerides which may be helpful for understanding the relationship of this protein with cardiovascular disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Niemann-Pick C1 modulates hepatic triglyceride metabolism and its genetic variation contributes to serum triglyceride levels.

    PubMed

    Uronen, Riikka-Liisa; Lundmark, Per; Orho-Melander, Marju; Jauhiainen, Matti; Larsson, Kristina; Siegbahn, Agneta; Wallentin, Lars; Zethelius, Björn; Melander, Olle; Syvänen, Ann-Christine; Ikonen, Elina

    2010-08-01

    To study how Niemann-Pick disease type C1 (NPC1) influences hepatic triacylglycerol (TG) metabolism and to determine whether this is reflected in circulating lipid levels. In Npc1(-/-) mice, the hepatic cholesterol content is increased but the TG content is decreased. We investigated lipid metabolism in Npc1(-/-) mouse hepatocytes and the association of NPC1 single-nucleotide polymorphisms with circulating TGs in humans. TGs were reduced in Npc1(-/-) mouse serum and hepatocytes. In Npc1(-/-) hepatocytes, the incorporation of [3H]oleic acid and [3H]acetate into TG was decreased, but shunting of oleic acid- or acetate-derived [3H]carbons into cholesterol was increased. Inhibition of cholesterol synthesis normalized TG synthesis, content, and secretion in Npc1(-/-) hepatocytes, suggesting increased hepatic cholesterol neogenesis as a cause for the reduced TG content and secretion. We found a significant association between serum TG levels and 5 common NPC1 single-nucleotide polymorphisms in a cohort of 1053 men, with the lowest P=8.7 x 10(-4) for the single-nucleotide polymorphism rs1429934. The association between the rs1429934 A allele and higher TG levels was replicated in 2 additional cohorts, which included 8041 individuals. This study provides evidence of the following: (1) in mice, loss of NPC1 function reduces hepatocyte TG content and secretion by increasing the metabolic flux of carbons into cholesterol synthesis; and (2) common variation in NPC1 contributes to serum TG levels in humans.

  20. Identification of Quantitative Trait Loci That Determine Plasma Total-Cholesterol and Triglyceride Concentrations in DDD/Sgn and C57BL/6J Inbred Mice.

    PubMed

    Suto, Jun-Ichi; Kojima, Misaki

    2017-01-01

    DDD/Sgn mice have significantly higher plasma lipid concentrations than C57BL/6J mice. In the present study, we performed quantitative trait loci (QTL) mapping for plasma total-cholesterol (CHO) and triglyceride (TG) concentrations in reciprocal F 2 male intercross populations between the two strains. By single-QTL scans, we identified four significant QTL on chromosomes (Chrs) 1, 5, 17, and 19 for CHO and two significant QTL on Chrs 1 and 12 for TG. By including cross direction as an interactive covariate, we identified separate significant QTL on Chr 17 for CHO but none for TG. When the large phenotypic effect of QTL on Chr 1 was controlled by composite interval mapping, we identified three additional significant QTL on Chrs 3, 4, and 9 for CHO but none for TG. QTL on Chr 19 was a novel QTL for CHO and the allelic effect of this QTL significantly differed between males and females. Whole-exome sequence analysis in DDD/Sgn mice suggested that Apoa2 and Acads were the plausible candidate genes underlying CHO QTL on Chrs 1 and 5, respectively. Thus, we identified a multifactorial basis for plasma lipid concentrations in male mice. These findings will provide insight into the genetic mechanisms of plasma lipid metabolism.

  1. Identification of Quantitative Trait Loci That Determine Plasma Total-Cholesterol and Triglyceride Concentrations in DDD/Sgn and C57BL/6J Inbred Mice

    PubMed Central

    Kojima, Misaki

    2017-01-01

    DDD/Sgn mice have significantly higher plasma lipid concentrations than C57BL/6J mice. In the present study, we performed quantitative trait loci (QTL) mapping for plasma total-cholesterol (CHO) and triglyceride (TG) concentrations in reciprocal F2 male intercross populations between the two strains. By single-QTL scans, we identified four significant QTL on chromosomes (Chrs) 1, 5, 17, and 19 for CHO and two significant QTL on Chrs 1 and 12 for TG. By including cross direction as an interactive covariate, we identified separate significant QTL on Chr 17 for CHO but none for TG. When the large phenotypic effect of QTL on Chr 1 was controlled by composite interval mapping, we identified three additional significant QTL on Chrs 3, 4, and 9 for CHO but none for TG. QTL on Chr 19 was a novel QTL for CHO and the allelic effect of this QTL significantly differed between males and females. Whole-exome sequence analysis in DDD/Sgn mice suggested that Apoa2 and Acads were the plausible candidate genes underlying CHO QTL on Chrs 1 and 5, respectively. Thus, we identified a multifactorial basis for plasma lipid concentrations in male mice. These findings will provide insight into the genetic mechanisms of plasma lipid metabolism. PMID:28642824

  2. The polymorphism -863C/A in tumour necrosis factor-alpha gene contributes an independent association to gout.

    PubMed

    Chang, S-J; Tsai, P-C; Chen, C-J; Lai, H-M; Ko, Y-C

    2007-11-01

    To investigate the associations between polymorphisms in the promoter of the tumour necrosis factor-alpha (TNF-alpha) gene and gout. The polymorphisms -308G/A and -863C/A in the TNF-alpha gene were determined in 106 gout patients and 159 healthy controls among male Taiwanese using the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method. The biochemical markers, including Glutamic-oxaloacetic transaminase (GOT), Glutamic-pyruvic transaminase (GPT), uric acid, creatinine, total cholesterol (TC), triglycerides (TG), body mass index (BMI) and hypertension, as well as alcohol consumption were measured. The gout patients had 9.43% (10/106) with genotype AA at polymorphism -863C/A showing a significantly higher fraction than controls (0.63%; 1/159, P < 0.001). The crude results also showed that the gout patients had significantly higher portions of abnormal GOT, GPT, creatinine, TC, TG, alcohol consumption, hypertension and hyperuricaemia than controls (P < 0.05), but the -308G/A, BMI and genotype CA at -863C/A did not show the same significant difference (P > 0.05). After adjustment by a stepwise logistic regression method, the hyperuricaemia, creatinine, GPT, TG and alcohol consumption as well as genotype AA at polymorphism -863C/A were found to be significantly associated with gout. The genotype AA at polymorphism -863C/A in a recessive model showed a significant association with developing gout independent of hyperuricaemia, abnormal creatinine, higher TG, GPT and alcohol consumption.

  3. The associations between triglyceride to high-density lipoprotein cholesterol ratios and the risks of gestational diabetes mellitus and large-for-gestational-age infant.

    PubMed

    Wang, Dongyu; Xu, Shuqia; Chen, Haitian; Zhong, Lieqiang; Wang, Zilian

    2015-10-01

    To evaluate the associations between triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratios and the risks of gestational diabetes mellitus (GDM) and delivering large-for-gestational-age (LGA) infant. This was a single-centre prospective observational study. Six hundred and thirty-six women with a singleton pregnancy were recruited. Lipids profile, HbA1c and glucose were measured at the time of oral glucose tolerance test (OGTT) during 24-28 gestational weeks. TG/HDL-C ratios were calculated and clinical data including perinatal parameters were analysed. The prevalence of GDM was 17·30% (n = 110) and LGA was 3·93% (n = 25) in this study. TG/HDL-C ratios were found to be significantly higher in GDM group (P < 0·01) and LGA group (P = 0·045) compared with those in non-GDM group and non-LGA group, respectively. TG/HDL-C ratios were independently associated with the risks of GDM (OR = 1·64, P = 0·02) and LGA (OR = 2·87, P < 0·01). The area under the combined ROC curve of TG/HDL-C ratio and HbA1c to detect GDM was 0·705 (95% CI, 0·637-0·772). Furthermore, the area under the ROC curve of TG/HDL-C ratio combined with HbA1c and prepregnancy BMI to detect LGA was 0·806 (95% CI, 0·719-0·893). TG/HDL-C ratios in combination with HbA1c and prepregnancy BMI can be good markers to predict the risks of GDM and delivering LGA infant. © 2015 John Wiley & Sons Ltd.

  4. Lymphatic Transport and Lymphocyte Targeting of a Triglyceride Mimetic Prodrug Is Enhanced in a Large Animal Model: Studies in Greyhound Dogs.

    PubMed

    Han, Sifei; Hu, Luojuan; Gracia; Quach, Tim; Simpson, Jamie S; Edwards, Glenn A; Trevaskis, Natalie L; Porter, Christopher J H

    2016-10-03

    In previous studies, a triglyceride (TG) mimetic prodrug of the model immunomodulator mycophenolic acid (MPA) was shown to significantly enhance lymphatic transport of MPA-related species in the rat. The rat gastrointestinal tract, however, is somewhat different from that in higher order species such as dogs and humans and may underestimate lymphatic transport. Here the effectiveness of the prodrug strategy has been examined in conscious greyhound dogs, the GI physiology of which is more representative of that in humans. The bioavailability and lymphatic transport of free MPA and total MPA related materials were examined following oral administration of the parent drug (MPA) and the prodrug (2-MPA-TG) to both thoracic lymph duct cannulated and intact (noncannulated) greyhound dogs. The enrichment of free MPA in lymph nodes and lymph-derived lymphocytes was also determined to examine the efficiency of drug targeting to potential sites of action within the lymph. Via biochemical integration into a series of site-specific metabolic processes, the prodrug markedly increased (288-fold) lymphatic transport of total MPA related material (present as re-esterified 2-MPA-TG) when compared to the parent MPA and the extent of lymphatic transport was significantly greater in the dog (36.4% of the dose recovered in lymph) when compared to the previous data in the rat (13.4% of the dose). Conversion from 2-MPA-TG derivatives to parent MPA occurred in vivo, resulting in a marked increase in MPA concentrations in lymph nodes (5-6-fold) and lymph lymphocytes (21-fold), when compared to animals administered the parent drug. In conclusion, the data demonstrate that the TG prodrug of MPA facilitates efficient delivery of MPA to the lymphatic system in dogs and suggest that the TG prodrug strategy may more effectively facilitate targeted delivery in large animals than in rats.

  5. Higher serum triglyceride to high-density lipoprotein cholesterol ratio was associated with increased cardiovascular mortality in female patients on peritoneal dialysis.

    PubMed

    Wu, H; Xiong, L; Xu, Q; Wu, J; Huang, R; Guo, Q; Mao, H; Yu, X; Yang, X

    2015-08-01

    High serum triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio has been found to be an independent predictor for cardiovascular events in the general population. We aimed to evaluate whether a high TG/HDL-C ratio was associated with an increased risk of mortality in patients on continuous ambulatory peritoneal dialysis (CAPD). In this single-center retrospective cohort study, 1170 incident patients on peritoneal dialysis (PD) from 1 January 2007 to 31 December 2011 were recruited and followed up until 31 December 31 2013. The mean age was 47.4 ± 15.2 years, and 24.7% were diabetic. During a median of the 34.5-month follow-up period, 213 (18.2%) deaths occurred, 121 of which (56.8%) were caused by cardiovascular disease (CVD). The serum median TG/HDL-C ratio at baseline was 2.57 (range: 0.06-39.39). On multivariate Cox regression analysis, the highest quartile of the TG/HDL-C ratio (≥4.19) was associated with increased risk of all-cause mortality (hazard ratio (HR) 1.98, 95% confidence interval (CI), 1.17-3.36; P = 0.011) and CVD mortality (HR 2.28, 95% CI, 1.16-4.47; P = 0.017). For female patients, each one-unit higher baseline TG/HDL-C was associated with 13% (95% CI 1.06-1.22; P = 0.001) increased risk of CVD mortality, whereas such an association was not observed for male patients, (HR 1.00, 95% CI 0.92-1.08; P = 0.977). A higher serum TG/HDL-C ratio was associated with an increased risk of all-cause and CVD mortality in PD patients. Moreover, the increased risk of CVD mortality was significantly higher in female than male PD patients. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. NASH resolution is associated with improvements in HDL and triglyceride levels but not improvement in LDL or non-HDL-C levels.

    PubMed

    Corey, K E; Vuppalanchi, R; Wilson, L A; Cummings, O W; Chalasani, N

    2015-02-01

    Nonalcoholic steatohepatitis (NASH) is associated with dyslipidemia and cardiovascular disease (CVD). To determine the relationship between resolution of NASH and dyslipidemia. Individuals in the Pioglitazone vs. Vitamin E vs. Placebo for the Treatment of Nondiabetic Patients with Nonalcoholic Steatohepatitis (PIVENS) trial with paired liver biopsies and fasting lipid levels were included (N = 222). In the PIVENS trial individuals were randomised to pioglitazone 30 mg, vitamin E 800 IU or placebo for 96 weeks. Change in lipid levels at 96 weeks was compared between those with and without NASH resolution. Dyslipidemia at baseline was frequent, with low high-density lipoprotein (HDL) (<40 mg/dL in men or <50 mg/dL in women) in 63%, hypertriglyceridaemia (≥150 mg/dL) in 46%, hypercholesterolaemia (≥200 mg/dL) in 47% and triglycerides (TG)/HDL >5.0 in 25%. Low-density lipoprotein (LD) ≥160 mg/dL was found in 16% and elevated non-HDL cholesterol (non-HDL-C) (≥130 mg/dL) in 73%. HDL increased with NASH resolution but decreased in those without resolution (2.9 mg/dL vs. -2.5 mg/dL, P < 0.001). NASH resolution was associated with significant decreases in TG and TG/HDL ratio compared to those without resolution (TG: -21.1 vs. -2.3 mg/dL, P = 0.03 and TG/HDL: -0.7 vs. 0.1, P = 0.003). Non-HDL-C, LDL and cholesterol decreased over 96 weeks in both groups, but there was no significant difference between groups. Treatment group did not impact lipids. NASH resolution is associated with improvements in TG and HDL but not in other cardiovascular disease risk factors including LDL and non-HDL-C levels. Individuals with resolution of NASH may still be at increased risk of cardiovascular disease. ClinicalTrials.gov identifier: NCT00063622. © 2014 John Wiley & Sons Ltd.

  7. De novo synthesis of milk triglycerides in humans

    PubMed Central

    Mohammad, Mahmoud A.; Sunehag, Agneta L.

    2014-01-01

    Mammary gland (MG) de novo lipogenesis contributes significantly to milk fat in animals but little is known in humans. Objective: To test the hypothesis that the incorporation of 13C carbons from [U-13C]glucose into fatty acids (FA) and glycerol in triglycerides (TG) will be greater: 1) in milk than plasma TG, 2) during a high-carbohydrate (H-CHO) diet than high-fat (H-FAT) diet, and 3) during feeding than fasting. Seven healthy, lactating women were studied on two isocaloric, isonitrogenous diets. On one occasion, subjects received diets containing H-FAT or H-CHO diet for 1 wk. Incorporation of 13C from infused [U-13C]glucose into FA and glycerol was measured using GC-MS and gene expression in RNA isolated from milk fat globule using microarrays. Incorporation of 13C2 into milk FA increased with increased FA chain length from C2:0 to C12:0 but progressively declined in C14:0 and C16:0 and was not detected in FA>C16. During feeding, regardless of diets, enrichment of 13C2 in milk FA and 13C3 in milk glycerol were ∼3- and ∼7-fold higher compared with plasma FA and glycerol, respectively. Following an overnight fast during H-CHO and H-FAT diets, 25 and 6%, respectively, of medium-chain FA (MCFA, C6–C12) in milk were derived from glucose but increased to 75 and 25% with feeding. Expression of genes involved in FA or glycerol synthesis was unchanged regardless of diet or fast/fed conditions. The human MG is capable of de novo lipogenesis of primarily MCFA and glycerol, which is influenced by the macronutrient composition of the maternal diet. PMID:24496312

  8. 21 CFR 862.1705 - Triglyceride test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Triglyceride test system. 862.1705 Section 862....1705 Triglyceride test system. (a) Identification. A triglyceride test system is a device intended to measure triglyceride (neutral fat) in serum and plasma. Measurements obtained by this device are used in...

  9. Insulin resistance and lipid profile during an oral glucose tolerance test in women with and without gestational diabetes mellitus.

    PubMed

    Liang, Zx; Wu, Y; Zhu, Xy; Fang, Q; Chen, Dq

    2016-01-01

    We aimed to compare changes in insulin levels during an oral glucose tolerance test (OGTT) between women with normal glucose tolerance (NGT) during pregnancy and those with gestational diabetes mellitus (GDM). Overall, 105 pregnant women between 24 and 28 weeks' gestation, 50 with NGT and 55 with GDM according to NDDG standard, were enrolled into the study. The levels of fasting blood glucose, insulin, triglyceride (TG) and total cholesterol (TC) and the insulin levels, blood glucose levels at 1, 2 and 3 hours post oral glucose administration during an OGTT (5.8, 10.6, 9.2 and 8.1 mmol/L, respectively) were measured. Then, insulin resistance (IR) index was calculated. There was no significant difference in fasting, 3-h insulin levels and 3-h blood glucose levels between those with NGT and those with GDM (P > 0.05). However, 1-h and 2-h insulin levels, fasting and 1-h and 2-h blood glucose levels in women with GDM were significantly higher than those in the NGT group (P < 0.05). Fasting TC and TG levels in the GDM group were significantly higher than those with NGT (P = 0.031 and P = 0.025, respectively). Correlation analysis showed that TG and TC levels were positively correlated with homoeostasis model assessment-IR (HOMA-IR) (r = 0.67 and r = 0.78, respectively; P < 0.05). Our findings suggest that insulin sensitivity in women with GDM was significantly lower than that observed in those with NGT. Reducing IR and blood lipids in women with GDM could potentially improve maternal and foetal outcomes.

  10. Comparison of the recommendations of the AAPM TG-51 and TG-51 addendum reference dosimetry protocols.

    PubMed

    McCaw, Travis J; Hwang, Min-Sig; Jang, Si Young; Huq, M Saiful

    2017-07-01

    This work quantified differences between recommendations of the TG-51 and TG-51 addendum reference dosimetry protocols. Reference dosimetry was performed for flattened photon beams with nominal energies of 6, 10, 15, and 23 MV, as well as flattening-filter free (FFF) beam energies of 6 and 10 MV, following the recommendations of both the TG-51 and TG-51 addendum protocols using both a Farmer ® ionization chamber and a scanning ionization chamber with calibration coefficients traceable to absorbed dose-to-water (D w ) standards. Differences in D w determined by the two protocols were 0.1%-0.3% for beam energies with a flattening filter, and up to 0.2% and 0.8% for FFF beams measured with the scanning and Farmer ® ionization chambers, respectively, due to k Q determination, volume-averaging correction, and collimator jaw setting. Combined uncertainty was between 0.91% and 1.2% (k = 1), varying by protocol and detector. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  11. Cardiac Expression of Microsomal Triglyceride Transfer Protein Is Increased in Obesity and Serves to Attenuate Cardiac Triglyceride Accumulation

    PubMed Central

    Bartels, Emil D.; Nielsen, Jan M.; Hellgren, Lars I.; Ploug, Thorkil; Nielsen, Lars B.

    2009-01-01

    Obesity causes lipid accumulation in the heart and may lead to lipotoxic heart disease. Traditionally, the size of the cardiac triglyceride pool is thought to reflect the balance between uptake and β-oxidation of fatty acids. However, triglycerides can also be exported from cardiomyocytes via secretion of apolipoproteinB-containing (apoB) lipoproteins. Lipoprotein formation depends on expression of microsomal triglyceride transfer protein (MTP); the mouse expresses two isoforms of MTP, A and B. Since many aspects of the link between obesity-induced cardiac disease and cardiac lipid metabolism remain unknown, we investigated how cardiac lipoprotein synthesis affects cardiac expression of triglyceride metabolism-controlling genes, insulin sensitivity, and function in obese mice. Heart-specific ablation of MTP-A in mice using Cre-loxP technology impaired upregulation of MTP expression in response to increased fatty acid availability during fasting and fat feeding. This resulted in cardiac triglyceride accumulation but unaffected cardiac insulin-stimulated glucose uptake. Long-term fat-feeding of male C57Bl/6 mice increased cardiac triglycerides, induced cardiac expression of triglyceride metabolism-controlling genes and attenuated heart function. Abolishing cardiac triglyceride accumulation in fat-fed mice by overexpression of an apoB transgene in the heart prevented the induction of triglyceride metabolism-controlling genes and improved heart function. The results suggest that in obesity, the physiological increase of cardiac MTP expression serves to attenuate cardiac triglyceride accumulation albeit without major effects on cardiac insulin sensitivity. Nevertheless, the data suggest that genetically increased lipoprotein secretion prevents development of obesity-induced lipotoxic heart disease. PMID:19390571

  12. Biomechanism of chlorogenic acid complex mediated plasma free fatty acid metabolism in rat liver.

    PubMed

    H V, Sudeep; K, Venkatakrishna; Patel, Dipak; K, Shyamprasad

    2016-08-05

    Plasma free fatty acids (FFA) are involved in blood lipid metabolism as well as many health complications. The present study was conducted to evaluate the potential role of chlorogenic acid complex from green coffee bean (CGA7) on FFA metabolism in high fat diet fed rats. Hyperlipidemia was induced in Wistar rats using high-fat diet. The animals were given CGA7/orlistat concurrently for 42 days. The parameters analysed during the study include plasma and liver total cholesterol (TC), Triglycerides (TG) and FFA. AMPK activation in the liver was analysed through ELISA. The multiple factors involved in AMPK mediated FFA metabolism were analysed using western blotting. CGA7 (50, 100, 150 mg/kg BW) decreased triglycerides (TG) and FFA levels in plasma and liver. CGA7 administration led to the activation of AMP-activated protein kinase (AMPK) and a subsequent increase in the levels of carnitine palmitoyltransferase 1 (CPT-1). There was a decrease in acetyl-CoA carboxylase (ACC) activity as evident by the increase in its phosphorylation level. Chlorogenic acids improved the blood lipid metabolism in rats by alleviating the levels of FFA and TG, modulating the multiple factors in liver through AMPK pathway. The study concludes that CGA7 complex can be promoted as an active ingredient in nutrition for obesity management.

  13. Replacement of Refined Starches and Added Sugars with Egg Protein and Unsaturated Fats Increases Insulin Sensitivity and Lowers Triglycerides in Overweight or Obese Adults with Elevated Triglycerides.

    PubMed

    Maki, Kevin C; Palacios, Orsolya M; Lindner, Emily; Nieman, Kristin M; Bell, Marjorie; Sorce, Jennifer

    2017-07-01

    Background: Hypertriglyceridemia is a common condition in the United States and is often associated with other metabolic disturbances, including insulin resistance, metabolic syndrome, and a predominance of small dense LDL particles. Objective: The objective of this trial was to evaluate the effects of a combination of egg protein (Epro) and unsaturated fatty acids (UFAs) substituted for refined starches and added sugars on insulin sensitivity (primary outcome) and other cardiometabolic health markers in overweight or obese adults with elevated triglyceride (TG) concentrations. Methods: Subjects with elevated TG concentrations were given test foods prepared by using Epro powder (∼8% of energy) and vegetable oil (∼8% of energy; Epro and UFA condition) or test foods prepared by using refined starch and sugar (∼16% of energy; carbohydrate condition) in a randomized, double-blind, controlled-feeding, crossover trial (3 wk/condition, 2-wk washout). The Matsuda insulin sensitivity index (MISI), fasting lipids, and other cardiometabolic health markers were assessed at baseline and the end of each diet condition. Responses were compared by using repeated-measures ANCOVA. Results: Twenty-five participants [11 men, 14 women; mean ± SEM: age, 46.3 ± 2.4 y; body mass index (in kg/m 2 ), 31.8 ± 1.0] with a median (interquartile range limits) fasting serum TG concentration of 173 mg/dL (159, 228 mg/dL) completed the trial. The MISI value increased 18.1% ± 8.7% from baseline during the Epro and UFA condition and decreased 5.7% ± 6.2% from baseline during the carbohydrate condition ( P < 0.001). The disposition index increased 23.8% ± 20.8% during the Epro and UFA condition compared with a decrease of 16.3% ± 18.8% during carbohydrate ( P = 0.042) and LDL peak particle size increased 0.12 nm (-0.12, 0.28 nm) with Epro and UFA compared with a decrease of 0.15 nm (-0.33, 0.12 nm) with carbohydrate ( P = 0.019). TG and VLDL cholesterol concentrations were lowered by 18

  14. [Treatment of hyperlipoidemia by xiaozhi capsule: a clinical efficacy research].

    PubMed

    Wang, Jian-Ping; Fan, Rui-Hong; Wang, Yan; Mei, Yan

    2013-06-01

    To observe the clinical effect and efficacy of Xiaozhi Capsule (XZC), a Chinese medicine preparation for tonifying Gan-Shen, invigorating Pi to dissipate dampness (TGSIPDD) on total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and endothelin (ET) in treating patients with hyperlipidemia. Totally 120 primary hyperlipidemia patients were randomly assigned to the treatment group (80 cases) and the control group (40 cases). Those in the treatment group took XZC, while those in the control group took Xuezhikang Capsule (XZKC). The serum TC, TG, HDL-C, LDL-C, and ET were detected and evaluated after 8 weeks of treatment. In the treatment group TC was reduced by 25.60%, TG by 33.70%, LDL-C by 32.90%, and ET by 11.02%, while HDL-C was elevated by 24.20%. In the control group, TC was reduced by 24.80%, TG by 33.50%, LDL-C by 31.30%, and ET by 12.05%, while HDL-C was elevated by 20.90%. There was statistical difference in the two groups when compared with before treatment (P < 0.01). But there was no statistical difference in the aforesaid indices between the two groups after treatment (P > 0.05). The integrals for main symptoms after treatment obviously decreased in the two groups, showing statistical difference when compared with before treatment in the same group (P < 0.01). But there was no statistical difference in the aforesaid indices between the two groups (P > 0.05). After 8 weeks of treatment, symptoms such as vertigo, heavy sensation of head, palpitation, chest distress, dry mouth and thirsty were obviously improved after treatment. There was statistical difference in the improvement of tinnitus after treatment in the treatment group (P < 0.01). The total effective rate was 86.25% in the treatment group and 82.50% in the control group, showing no statistical difference (P > 0.05). XZC showed certain effects on each blood lipid index and ET of hyperlipidemia patients. It had better

  15. Effects of Polymorphisms in APOA4-APOA5-ZNF259-BUD13 Gene Cluster on Plasma Levels of Triglycerides and Risk of Coronary Heart Disease in a Chinese Han Population

    PubMed Central

    Su, Li; Zhang, Mingjun; Wang, Long; Jing, Jinjin; Zhou, Li

    2015-01-01

    Background/Aim Recent genome-wide association studies have identified several loci influencing lipid levels. The present study focused on the triglycerides (TG)-associated locus, the APOA4-APOA5-ZNF259-BUD13 gene cluster on chromosome 11, to explore the role of genetic variants in this gene cluster in the development of increasing TG levels and coronary heart disease (CHD). Methodology/Principal Findings Six single nucleotide polymorphisms (SNPs), rs4417316, rs651821, rs6589566, rs7396835, rs964184 and rs17119975, in the APOA4-APOA5-ZNF259-BUD13 gene cluster were selected and genotyped in 5374 healthy Chinese subjects. There were strong significant associations between the six SNPs and TG levels (P<1.0×10−8). Moreover, a weighted genotype score was found to be associated with TG levels (P = 3.28×10−13). The frequencies of three common haplotypes were observed to be significantly different between the high TG group and the low TG group (P<0.05). However, no significant effects were found for the SNPs regarding susceptibility to CHD in the Chinese case-control populations. Conclusions/Significance This study highlights the genotypes, genotype scores and haplotypes of the APOA4-APOA5-ZNF259-BUD13 gene cluster that were associated with TG levels in a Chinese population; however, the genetic variants in this gene cluster did not increase the risk of CHD in the Chinese population. PMID:26397108

  16. Identifying cardiovascular disease risk and outcome: use of the plasma triglyceride/high-density lipoprotein cholesterol concentration ratio versus metabolic syndrome criteria.

    PubMed

    Salazar, M R; Carbajal, H A; Espeche, W G; Aizpurúa, M; Leiva Sisnieguez, C E; March, C E; Balbín, E; Stavile, R N; Reaven, G M

    2013-06-01

    Metabolic syndrome (MetS) has been shown to predict both risk and CVD events. We have identified sex-specific values for the triglyceride/high-density lipoprotein cholesterol (TG/HDL-C) ratio associated with an unfavourable cardio-metabolic risk profile, but it is not known whether it also predicts CVD outcome. To quantify risk for CVD outcomes associated with a high TG/HDL-C ratio and to compare this risk with that predicted using MetS, a population longitudinal prospective observational study was performed in Rauch City, Buenos Aires, Argentina. In 2003 surveys were performed on a population random sample of 926 inhabitants. In 2012, 527 women and 269 men were surveyed again in search of new CVD events. The first CVD event was the primary endpoint. Relative risks for CVD events between individuals above and below the TG/HDL-C cut-points, and with or without MetS, were estimated using Cox proportional hazard. The first CVD event was the primary endpoint. Relative risks for CVD events between individuals above and below the TG/HDL-C cut-points, and with or without MetS, were estimated using Cox proportional hazard. The number of subjects deemed at 'high' CVD risk on the basis of an elevated TG/HDL-C ratio (30%) or having the MetS (35%) was relatively comparable. The unadjusted hazard risk was significantly increased when comparing 'high' versus 'low' risk groups no matter which criteria was used, although it was somewhat higher in those with the MetS (HR = 3.17, 95% CI:1.79-5.60 vs. 2.16, 95% CI:1.24-3.75). However, this difference essentially disappeared when adjusted for sex and age (HR = 2.09, 95% CI:1.18-3.72 vs. 2.01, 95% CI:1.14-3.50 for MetS and TG/HDL-C respectively). An elevated TG/HDL-C ratio appears to be just as effective as the MetS diagnosis in predicting the development of CVD. © 2013 The Association for the Publication of the Journal of Internal Medicine.

  17. Effects of a 3-year dietary intervention on age-related changes in triglyceride and apolipoprotein A-V levels in patients with impaired fasting glucose or new-onset type 2 diabetes as a function of the APOA5 -1131 T > C polymorphism.

    PubMed

    Kim, Minjoo; Chae, Jey Sook; Kim, Miri; Lee, Sang-Hyun; Lee, Jong Ho

    2014-04-28

    The purpose of this study was to estimate the effects of a 3-year dietary intervention on age-related changes in triglyceride and apolipoprotein (apo A-V) levels in patients with impaired fasting glucose (IFG) or new-onset type 2 diabetes as a function of the APOA5 -1131 T > C polymorphism. We genotyped the APOA5 -1131 T > C polymorphism in 203 Korean individuals with IFG or new-onset type 2 diabetes for the TT (n = 91), TC (n = 98), and CC (n = 14) alleles. Plasma apo A-V and triglyceride levels were evaluated at baseline and after a 3-year dietary intervention. Our results showed that HDL, glucose, insulin, HOMA-IR index, free fatty acids, and apo A-V decreased and brachial-ankle pulse wave velocity (ba-PWV) and malondialdehyde (MDA) increased at the 3-year follow-up visit compared with baseline. Plasma apo A-V levels were reduced in subjects with the C allele (TC or CC) (P = 0.036) and triglyceride levels were reduced in subjects with the TT allele (P = 0.047). Subjects with the C allele showed lower post-treatment apo A-V and higher post-treatment fasting triglyceride levels than subjects with the TT allele. Changes in apo A-V and triglyceride levels were negatively correlated in subjects with the TT allele and positively correlated in subjects with the C allele. This study showed that the dietary intervention prevented an age-related increase in triglyceride levels in individuals with IFG or new-onset type 2 diabetes who possess the TT allele, but not the CT or CC allele, of the APOA5 -1131 T > C polymorphism.

  18. Increasing insulin resistance accentuates the effect of triglyceride-associated loci on serum triglycerides during 5 years.

    PubMed

    Justesen, Johanne M; Andersson, Ehm A; Allin, Kristine H; Sandholt, Camilla H; Jørgensen, Torben; Linneberg, Allan; Jørgensen, Marit E; Hansen, Torben; Pedersen, Oluf; Grarup, Niels

    2016-12-01

    Blood concentrations of triglycerides are influenced by genetic factors as well as a number of environmental factors, including adiposity and glucose homeostasis. The aim was to investigate the association between a serum triglyceride weighted genetic risk score (wGRS) and changes in fasting serum triglyceride level over 5 years and to test whether the effect of the wGRS was modified by 5 year changes of adiposity, insulin resistance, and lifestyle factors. A total of 3,474 nondiabetic individuals from the Danish Inter99 cohort participated in both the baseline and 5 year follow-up physical examinations and had information on the wGRS comprising 39 genetic variants. In a linear regression model adjusted for age, sex, and baseline serum triglyceride, the wGRS was associated with increased serum triglyceride levels over 5 years [per allele effect = 1.3% (1.0-1.6%); P = 1.0 × 10 -17 ]. This triglyceride-increasing effect of the wGRS interacted with changes in insulin resistance (P interaction = 1.5 × 10 -6 ). This interaction indicated that the effect of the wGRS was stronger in individuals who became more insulin resistant over 5 years. In conclusion, our findings suggest that increased genetic risk load is associated with a larger increase in fasting serum triglyceride levels in nondiabetic individuals during 5 years of follow-up. This effect of the wGRS is accentuated by increasing insulin resistance. Copyright © 2016 by the American Society for Biochemistry and Molecular Biology, Inc.

  19. The association between high-sensitivity C-reactive protein and metabolic risk factors in black and white South African women: a cross-sectional study.

    PubMed

    George, Cindy; Evans, Juliet; Micklesfield, Lisa K; Olsson, Tommy; Goedecke, Julia H

    2018-01-01

    High-sensitivity C-reactive protein (hsCRP) is associated with metabolic risk, however it is unclear whether the relationship is confounded by racial/ethnic differences in socioeconomic status (SES), lifestyle factors or central adiposity. The aims of the study was, (1) to investigate whether hsCRP levels differ by race/ethnicity; (2) to examine the race/ethnic-specific associations between hsCRP, HOMA-IR and serum lipids [total cholesterol (TC), triglycerides (TG), high-density lipoproteins (HDL-C) and low-density lipoproteins (LDL-C)]; and (3) to determine whether race/ethnic-specific associations are explained by SES, lifestyle factors or waist circumference (WC). The convenience sample comprised 195 black and 153 white apparently health women, aged 18-45 years. SES (education, assets and housing density) and lifestyle factors (alcohol use, physical activity and contraceptive use) were collected by questionnaire. Weight, height and WC were measured, and fasting blood samples collected for hsCRP, glucose, insulin, and lipids. Black women had higher age- and BMI-adjusted hsCRP levels than white women ( p  = 0.047). hsCRP was associated with HOMA-IR ( p  < 0.001), TG (p < 0.001), TC ( p  < 0.05), HDL-C (p < 0.05), and LDL-C ( p  < 0.05), independent of age and race/ethnicity. The association between hsCRP and lipids differed by race/ethnicity, such that hsCRP was positively associated with TG and LDL-C in white women, and inversely associated with HDL-C in black women. Higher hsCRP was also associated with higher TC in white women and lower TC in black women. Furthermore, when adjusting for SES and lifestyle factors, the associations between hsCRP, and TC and TG, remained, however the associations between hsCRP, and HDL-C and LDL-C, were no longer significant. Although circulating hsCRP may identify individuals at increased metabolic risk, the heterogeneity in these associations between racial/ethnic groups highlights the need for

  20. Thermal Expansion Behavior in TcO2. Toward Breaking the Tc-Tc Bond.

    PubMed

    Reynolds, Emily; Zhang, Zhaoming; Avdeev, Maxim; Thorogood, Gordon J; Poineau, Frederic; Czerwinski, Kenneth R; Kimpton, Justin A; Kennedy, Brendan J

    2017-08-07

    The structure of TcO 2 between 25 and 1000 °C has been determined in situ using X-ray powder diffraction methods and is found to remain monoclinic in space group P2 1 /c. Thermal expansion in TcO 2 is highly anisotropic, with negative thermal expansion of the b axis observed above 700 °C. This is the result of an anomalous expansion along the a axis that is a consequence of weakening of the Tc-Tc bonds.

  1. Structured triglyceride emulsions in parenteral nutrition.

    PubMed

    Chambrier, C; Lauverjat, M; Bouletreau, P

    2006-08-01

    Over the past 3 decades, various concepts for IV fat emulsions (IVFE) have been developed. A randomized, structured-lipid emulsion based on an old technology has recently become available. This structured-lipid emulsion is produced by mixing medium-chain triglycerides and long-chain triglycerides, then allowing hydrolysis to form free fatty acids, followed by random transesterification of the fatty acids into mixed triglyceride molecules. Studies in animals have shown an improvement in nitrogen balance with the use of these lipid emulsions. Only 8 human clinical studies with these products have been performed. The results of these human clinical studies have been less promising than the animal studies; however, an improvement in nitrogen balance and lipid metabolism exceeds results associated with infusion of long-chain triglycerides (LCT) or a physical mixture of long-chain triglycerides and medium-chain triglycerides (LCT-MCT). Structured-lipid emulsion seems to induce less elevation in serum liver function values compared with standard IVFEs. In addition, structured-lipid emulsions have no detrimental effect on the reticuloendothelial system. Further studies are necessary in order to recommend the use of structured-lipid emulsions. The clinical community hopes that chemically defined structured triglycerides will make it possible to determine the distribution of specific fatty acids on a specific position on the glycerol core and therefore obtain specific activity for a specific clinical situation.

  2. Comparison of serum triglyceride levels with propofol in long chain triglyceride and propofol in medium and long chain triglyceride after short term anesthesia in pediatric patients.

    PubMed

    Bhukal, Ishwar; Thimmarayan, Gokul; Bala, Indu; Solanki, Sohan Lal; Samra, Tanvir

    2014-11-01

    Significant increase in serum triglyceride (ST) concentration have been described in adult population after prolonged administration of propofol formulation containing long chain triglyceride (LCT). Though, medium chain triglyceride-LCT (MCT-LCT) propofol when compared with LCT propofol for long-term sedation in adults resulted in identical triglyceride levels, the elimination of triglyceride was faster in patients administered MCT-LCT propofol. A total of 40 children were randomized into two groups of 20 each; Group I were induced with 1% LCT propofol (3 mg/kg) and Group II with 1% medium and LCT propofol and maintained with descalating dose of 20.15 and 10 mg/kg/h at 10 min intervals. Blood samples for ST concentration were obtained before induction of anesthesia, at the end of propofol infusion and 4 h after terminating propofol infusion. ST levels were raised significantly above the basal values in both the groups but the rise was significantly higher in Group I (P < 0.05). Four hours after stopping propofol infusion the triglyceride levels were similar to the basal values in Group II, whereas in Group I the values were significantly greater than the baseline (P < 0.05) as well as those of Group II (P < 0.05). No clinically significant adverse effect of hypertriglyceridemia was observed. Even short term anesthesia with LCT and MCT-LCT propofol (1%) leads to elevated ST levels. The increase in ST levels is less with MCT-LCT propofol and elimination of triglyceride is also rapid after terminating MCT-LCT propofol infusion.

  3. Association of dietary pattern and physical activity level with triglyceride to high-density lipoprotein cholesterol ratio among adults in Jiangsu, China: a cross-sectional study with sex-specific differences.

    PubMed

    Lyu, Shurong; Su, Jian; Xiang, Quanyong; Wu, Ming

    2014-08-01

    Our study aims to explore the association between dietary patterns and physical activity levels (PAL) with a triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio, and to examine whether the association is sex dependent among Chinese adults. In this cross-sectional study, data were collected through questionnaires, anthropometric measurement, and biochemical tests. Four food patterns ("meat," "healthy," "high-energy," and "traditional Chinese") were established through factor analysis. Physical activity level was categorized as "active," "moderate," and "inactive." Logistic regression models were used to determine the associations between food patterns and PAL with TG/HDL-C ratio. Compared with quartile 1, quartiles 2 and 3 of meat pattern among men were found to be associated with lower risk of high TG/HDL-C ratio (the highest quartile of TG/HDL-C ratio). Similar decreased risk of high TG/HDL-C ratio was also observed in the highest quartile 4 of healthy pattern among women. Active PAL was protective against high TG/HDL-C ratio among both men (odds ratio [OR], 0.69; 95% confidence interval [CI], 0.55-0.86) and women (OR, 0.77; 95% CI, 0.62-0.96). Although no statistically significant interaction was observed, we found that individuals with active PAL and low healthy diet had a similar OR with those with inactive PAL and high healthy diet (0.62 vs 0.68). In conclusion, dietary patterns were associated with TG/HDL-C ratio in a sex-specific way, and active PAL was consistently related to decreased risk of high TG/HDL-C ratio across genders. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Association between polymorphisms in phospholipase A2 genes and the plasma triglyceride response to an n-3 PUFA supplementation: a clinical trial.

    PubMed

    Tremblay, Bénédicte L; Cormier, Hubert; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

    2015-02-21

    Fish oil-derived long-chain omega-3 (n-3) polyunsaturated fatty acids (PUFAs), including eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), reduce plasma triglyceride (TG) levels. Genetic factors such as single-nucleotide polymorphisms (SNPs) found in genes involved in metabolic pathways of n-3 PUFA could be responsible for well-recognized heterogeneity in plasma TG response to n-3 PUFA supplementation. Previous studies have shown that genes in the glycerophospholipid metabolism such as phospholipase A2 (PLA2) group II, IV, and VI, demonstrate changes in their expression levels in peripheral blood mononuclear cells (PBMCs) after n-3 PUFA supplementation. A total of 208 subjects consumed 3 g/day of n-3 PUFA for 6 weeks. Plasma lipids were measured before and after the supplementation period. Five SNPs in PLA2G2A, six in PLA2G2C, eight in PLA2G2D, six in PLA2G2F, 22 in PLA2G4A, five in PLA2G6, and nine in PLA2G7 were genotyped. The MIXED Procedure for repeated measures adjusted for age, sex, BMI, and energy intake was used in order to test whether the genotype, supplementation or interaction (genotype by supplementation) were associated with plasma TG levels. The n-3 PUFA supplementation had an independent effect on plasma TG levels. Genotype effects on plasma TG levels were observed for rs2301475 in PLA2G2C, rs818571 in PLA2G2F, and rs1569480 in PLA2G4A. Genotype x supplementation interaction effects on plasma TG levels were observed for rs1805018 in PLA2G7 as well as for rs10752979, rs10737277, rs7540602, and rs3820185 in PLA2G4A. These results suggest that, SNPs in PLA2 genes may influence plasma TG levels during a supplementation with n-3 PUFA. This trial was registered at clinicaltrials.gov as NCT01343342.

  5. Triglyceride to high density lipoprotein cholesterol ratio and its association with periodontal disease in Korean adults: findings based on the 2012-2014 Korean national health and nutrition examination survey.

    PubMed

    Kwon, Yu-Jin; Park, Jeong-Won; Lim, Hyoung-Ji; Lee, Yong-Jae; Lee, Hye-Sun; Shim, Jae-Yong

    2018-01-01

    The aim of this study is to evaluate whether the triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio is associated with periodontal disease in Korean adults. This cross-sectional study included 12,249 individuals (4,941 men and 7,308 women) who took part in the 2012-2014 Korean National Health and Nutrition Examination Survey. We categorized the TG/HDL-C ratio into three groups. Periodontal disease was defined as a community pocket index score ≥3 with at least one affected site. Multiple logistic analyses were used to analyze the association between TG/HDL-C ratio and periodontal disease. In the study population, prevalence of periodontal disease was 31.6% in men and 21% in women. Compared to the lowest tertile group, OR (95% CI) of the highest tertile group for periodontal disease was 1.474 (1.220-1.780) in men and 1.259 (1.041-1.522) in women after adjusting for age, waist circumference, systolic blood pressure, fasting glucose, current smoking, alcohol drinking, physical activity, household income, oral health behavior, and use of anti-dyslipidemia medication. Our study suggests that the TG/HDL-C ratio is associated with periodontal disease in Korean adults. TG/HDL-C ratio is a simple and useful marker to reflect insulin resistance. And periodontal disease is also known to be related with insulin resistance. This study indicates that TG/HDL-C ratio was associated with periodontal disease in Korean adults.

  6. Experimental study of osthole on treatment of hyperlipidemic and alcoholic fatty liver in animals

    PubMed Central

    Song, Fang; Xie, Mei-Lin; Zhu, Lu-Jia; Zhang, Ke-Ping; Xue, Jie; Gu, Zhen-Lun

    2006-01-01

    AIM: To evaluate the effects of osthole on fatty liver, and investigate the possible mechanism. METHODS: A quail model with hyperlipidemic fatty liver and rat model with alcoholic fatty liver were set up by feeding high fat diet and alcohol, respectively. These experimental animals were then treated with osthole 5-20 mg/kg for 6 wk, respectively. Whereafter, the lipid in serum and hepatic tissue, and coefficient of hepatic weight were measured. RESULTS: After treatment with osthole the levels of serum total cholesterol (TC), triglyceride (TG), lower density lipoprotein-cholesterol (LDL-C), coefficient of hepatic weight, and the hepatic tissue contents of TC and TG were significantly decreased. The activity of superoxide dismutase (SOD) in liver was improved. In alcohol-induced fatty liver rats, the level of malondialdehyde (MDA) in liver was decreased. In high fat-induced fatty liver quails, glutathione peroxidase (GSH-PX) in liver was significantly improved. The histological evaluation of liver specimens demonstrated that the osthole dramatically decreased lipid accumulation. CONCLUSION: These results suggested that osthole had therapeutic effects on both alcohol and high fat-induced fatty liver. The mechanism might be associated with its antioxidation. PMID:16865778

  7. Changes in the lipid profile of elite basketball and soccer players after a match.

    PubMed

    Apostolidis, N; Bogdanis, G C; Kostopoulos, N; Souglis, A; Papadopoulos, Ch

    2014-01-01

    The lipid profile of elite basketball and soccer athletes was evaluated and compared with that of inactive individuals. Total cholesterol (T-C), low and high density lipoprotein cholesterol (LDL-C and HDL-C), and triglyceride (TG) concentration were measured in the morning and after a soccer or a basketball match. All parameters of lipid profile measured at a fasted and resting state, except HDL-C, were lower in the athletes compared with the controls (p < 0.01). The soccer match resulted in a greater decrease in TG (78.3 ± 6.7 to 70.7 ± 6.3, p < 0.01), T-C (179.3 ± 10.7 to 171.6 ± 9.6, p < 0.01), LDL-C (110.9 ± 8.9 to 103.5 ± 7.5, p < 0.01) compared with the basketball match that resulted only in a decrease in LDL-C (126.8 ± 9.5 to 117.3 ± 9.1, p < 0.01) and an increase in HDL-C that was similar to that observed after the soccer match (9-12%). These findings support the beneficial effects of basketball and soccer on cardiovascular health.

  8. Association between berries intake and cardiovascular diseases risk factors: a systematic review with meta-analysis and trial sequential analysis of randomized controlled trials.

    PubMed

    Luís, Ângelo; Domingues, Fernanda; Pereira, Luísa

    2018-02-21

    The main goal of this work was to clarify the effects of the consumption of berries on cardiovascular disease (CVD) risk factors by performing a systematic review according to the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analysis) statement, followed by a meta-analysis and a trial sequential analysis (TSA) of randomized controlled trials (RCTs). The electronic search was conducted in PubMed, Scopus, SciELO, Web of Science and Cochrane Library between April and June 2016. To be included, RCTs had to report 1 or more of the following outcomes: total cholesterol (TC), HDL-cholesterol (HDL), LDL-cholesterol (LDL), triglycerides (TG), blood pressure (BP), C-reactive protein (CRP), tumour necrosis factor-α (TNF-α), interleukin-6 (IL-6), vascular cell adhesion molecule-1 (VCAM), intercellular adhesion molecule-1 (ICAM), glucose, insulin, apolipoprotein A-I (Apo A-I) or apolipoprotein B (Apo B). It was observed that the intake of berries reduces TC, LDL, TG, and BP while increasing the level of HDL, suggesting a beneficial effect on the control of CVDs' risk factors. Thus, the intake of berries as nutraceuticals or functional foods could be suggested for the prevention and control of CVDs.

  9. The Predictive Role of Serum Triglyceride to High-Density Lipoprotein Cholesterol Ratio According to Renal Function in Patients with Acute Myocardial Infarction

    PubMed Central

    Woo, Jong Shin; Lee, Tae Won; Ihm, Chun Gyoo; Kim, Yang Gyoon; Moon, Joo Young; Lee, Sang Ho; Jeong, Myung Ho; Jeong, Kyung Hwan

    2016-01-01

    Objective A high serum triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio has been reported as an independent predictor for cardiovascular events in the general population. However, the prognostic value of this ratio in patients with renal dysfunction is unclear. We examined the association of the TG/HDL-C ratio with major adverse cardiovascular events (MACEs) according to renal function in patients with acute myocardial infarction (AMI). Method This study was based on the Korea Acute Myocardial Infarction Registry database. Of 13,897 patients who were diagnosed with AMI, the study population included the 7,016 patients with available TG/HDL-C ratio data. Patients were stratified into three groups according to their estimated glomerular filtration rate (eGFR), and the TG/HDL-C ratio was categorized into tertiles. We investigated 12-month MACEs, which included cardiac death, myocardial infarction, and repeated percutaneous coronary intervention or coronary artery bypass grafting. Results During the 12-month follow up period, 593 patients experienced MACEs. There was a significant association between the TG/HDL-C ratio and MACEs (p<0.001) in the entire study cohort. Having a TG/HDL-C ratio value in the highest tertile of TG/HDL-C ratio was an independent factor associated with increased risk of MACEs (hazard ratio [HR], 1.56; 95% confidence interval [CI], 1.26–1.93; p<0.001). Then we performed subgroup analyses according to renal function. In patients with normal renal function (eGFR ≥ 90 ml/min/1.73m2) and mild renal dysfunction (eGFR ≥ 60 to < 90ml/min/1.73m2), a higher TG/HDL-C ratio was significantly associated with increased risk of MACEs (HR, 1.64; 95% CI, 1.04–2.60; p = 0.035; and HR, 1.56; 95% CI, 1.14–2.12; p = 0.005, respectively). However, in patients with moderate renal dysfunction (eGFR < 60 ml/min/1.73m2), TG/HDL-C ratio lost its predictive value on the risk of MACEs (HR, 1.23; 95% CI, 0.82–1.83; p = 0.317). Conclusions In

  10. The Predictive Role of Serum Triglyceride to High-Density Lipoprotein Cholesterol Ratio According to Renal Function in Patients with Acute Myocardial Infarction.

    PubMed

    Kim, Jin Sug; Kim, Weon; Woo, Jong Shin; Lee, Tae Won; Ihm, Chun Gyoo; Kim, Yang Gyoon; Moon, Joo Young; Lee, Sang Ho; Jeong, Myung Ho; Jeong, Kyung Hwan

    2016-01-01

    A high serum triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio has been reported as an independent predictor for cardiovascular events in the general population. However, the prognostic value of this ratio in patients with renal dysfunction is unclear. We examined the association of the TG/HDL-C ratio with major adverse cardiovascular events (MACEs) according to renal function in patients with acute myocardial infarction (AMI). This study was based on the Korea Acute Myocardial Infarction Registry database. Of 13,897 patients who were diagnosed with AMI, the study population included the 7,016 patients with available TG/HDL-C ratio data. Patients were stratified into three groups according to their estimated glomerular filtration rate (eGFR), and the TG/HDL-C ratio was categorized into tertiles. We investigated 12-month MACEs, which included cardiac death, myocardial infarction, and repeated percutaneous coronary intervention or coronary artery bypass grafting. During the 12-month follow up period, 593 patients experienced MACEs. There was a significant association between the TG/HDL-C ratio and MACEs (p<0.001) in the entire study cohort. Having a TG/HDL-C ratio value in the highest tertile of TG/HDL-C ratio was an independent factor associated with increased risk of MACEs (hazard ratio [HR], 1.56; 95% confidence interval [CI], 1.26-1.93; p<0.001). Then we performed subgroup analyses according to renal function. In patients with normal renal function (eGFR ≥ 90 ml/min/1.73m2) and mild renal dysfunction (eGFR ≥ 60 to < 90ml/min/1.73m2), a higher TG/HDL-C ratio was significantly associated with increased risk of MACEs (HR, 1.64; 95% CI, 1.04-2.60; p = 0.035; and HR, 1.56; 95% CI, 1.14-2.12; p = 0.005, respectively). However, in patients with moderate renal dysfunction (eGFR < 60 ml/min/1.73m2), TG/HDL-C ratio lost its predictive value on the risk of MACEs (HR, 1.23; 95% CI, 0.82-1.83; p = 0.317). In patients with AMI, TG/HDL-C ratio is a

  11. Association of Cytotoxic T-Lymphocyte Antigen 4 (CTLA4) and Thyroglobulin (TG) Genetic Variants with Autoimmune Hypothyroidism

    PubMed Central

    Patel, Hinal; Mansuri, Mohmmad Shoab; Singh, Mala; Begum, Rasheedunnisa; Shastri, Minal; Misra, Ambikanandan

    2016-01-01

    Autoimmune hypothyroidism is known to be caused by immune responses related to the thyroid gland and its immunological feature includes presence of autoimmune antibodies. Therefore the aim was to analyze presence of anti-TPO antibodies in hypothyroidism patients in Gujarat. Cytotoxic T-Lymphocyte Antigen 4 (CTLA4) is one of the susceptibility genes for various autoimmune diseases. Hence, exon1 +49A/G and 3’UTR CT60A/G single nucleotide polymorphisms (SNPs) in CTLA4 and its mRNA expression levels were investigated in autoimmune hypothyroidism patients. Thyroglobulin (TG) is known to be associated with autoimmune thyroid disorders and thus exon 33 (E33) SNP in TG was investigated. We analyzed the presence of anti-TPO antibodies in the plasma samples of 84 hypothyroidism patients and 62 controls by ELISA. PCR-RFLP technique was used for genotyping of polymorphisms. sCTLA4 and flCTLA4 mRNA expression levels were assessed by real time PCR. 59.52% of hypothyroid patients had anti-TPO antibodies in their circulation. The genotype and allele frequencies differed significantly for +49A/G (p = 0.0004 for +49AG, p = 0.0019 for +49GG & p = 0.0004 for allele), CT60 (p = 0.0110 for CT60AG, p = 0.0005 for CT60GG & p<0.0001 for allele) and TG E33 (p = 0.0003 for E33TC p<0.0001 for E33CC& p<0.0001 for allele) SNPs between patients and controls. Patients had significantly decreased mRNA levels of both sCTLA4 (p = 0.0017) and flCTLA4 (p<0.0001) compared to controls. +49A/G and CT60 polymorphisms of CTLA4 were in moderate linkage disequilibrium. Logistic regression analysis indicated significant association of CT49A/G, CT60A/G and TG exon 33 polymorphisms with susceptibility to autoimmune hypothyroidism when adjusted for age and gender. Our results suggest +49A/G and CT60 polymorphism of CTLA4 and E33 polymorphism of TG may be genetic risk factors for autoimmune hypothyroidism susceptibility and down regulation of both forms of CTLA4 advocates the crucial role of CTLA4 in

  12. The -1535 promoter variant of the visfatin gene is associated with serum triglyceride and HDL-cholesterol levels in Japanese subjects.

    PubMed

    Tokunaga, Ayumi; Miura, Atsuko; Okauchi, Yukiyoshi; Segawa, Katsumori; Fukuhara, Atsunori; Okita, Kohei; Takahashi, Masahiko; Funahashi, Tohru; Miyagawa, Jun-Ichiro; Shimomura, Iichiro; Yamagata, Kazuya

    2008-03-01

    Visfatin is a novel adipocytokine that is expressed by the visceral fat cells. We investigated the role of genetic variation in the visfatin gene in the pathophysiology of type 2 diabetes and clinical variables in Japanese subjects. The 11 exons, and the promoter region of the visfatin gene were screened for single nucleotide polymorphisms (SNPs) by PCR-direct sequencing. We found SNPs in the promoter region (SNP - 1535T>C), exon 2 (SNP + 131C>G, Thr44Arg), and exon 7 (SNP + 903G>A). The allele and genotype frequencies of these SNPs showed no significant differences between 200-448 diabetic and 200-333 control subjects. However, the -1535T/T genotype was associated with lower serum triglyceride levels (T/T vs. T/C + C/C (p = 0.015) and T/T vs. C/C (p = 0.043)) and higher HDL-cholesterol levels (T/T vs. C/C, p = 0.0496) in the nondiabetic subjects. Reporter gene assay of 3T3-L1 adipocytes revealed that the promoter activity of -1535T and -1535C was similar, suggesting that the observed association may reflect linkage disequilibrium between -1535T>C and causative variations of the visfatin gene.

  13. Endocrine and metabolic effects of consuming fructose- and glucose-sweetened beverages with meals in obese men and women: influence of insulin resistance on plasma triglyceride responses.

    PubMed

    Teff, Karen L; Grudziak, Joanne; Townsend, Raymond R; Dunn, Tamara N; Grant, Ryan W; Adams, Sean H; Keim, Nancy L; Cummings, Bethany P; Stanhope, Kimber L; Havel, Peter J

    2009-05-01

    Compared with glucose-sweetened beverages, consumption of fructose-sweetened beverages with meals elevates postprandial plasma triglycerides and lowers 24-h insulin and leptin profiles in normal-weight women. The effects of fructose, compared with glucose, ingestion on metabolic profiles in obese subjects has not been studied. The objective of the study was to compare the effects of fructose- and glucose-sweetened beverages consumed with meals on hormones and metabolic substrates in obese subjects. The study had a within-subject design conducted in the clinical and translational research center. Participants included 17 obese men (n = 9) and women (n = 8), with a body mass index greater than 30 kg/m(2). Subjects were studied under two conditions involving ingestion of mixed nutrient meals with either glucose-sweetened beverages or fructose-sweetened beverages. The beverages provided 30% of total kilocalories. Blood samples were collected over 24 h. Area under the curve (24 h AUC) for glucose, lactate, insulin, leptin, ghrelin, uric acid, triglycerides (TGs), and free fatty acids was measured. Compared with glucose-sweetened beverages, fructose consumption was associated with lower AUCs for insulin (1052.6 +/- 135.1 vs. 549.2 +/- 79.7 muU/ml per 23 h, P < 0.001) and leptin (151.9 +/- 22.7 vs. 107.0 +/- 15.0 ng/ml per 24 h, P < 0.03) and increased AUC for TG (242.3 +/- 96.8 vs. 704.3 +/- 124.4 mg/dl per 24 h, P < 0.0001). Insulin-resistant subjects exhibited larger 24-h TG profiles (P < 0.03). In obese subjects, consumption of fructose-sweetened beverages with meals was associated with less insulin secretion, blunted diurnal leptin profiles, and increased postprandial TG concentrations compared with glucose consumption. Increases of TGs were augmented in obese subjects with insulin resistance, suggesting that fructose consumption may exacerbate an already adverse metabolic profile present in many obese subjects.

  14. Association of Serum Triglyceride to HDL Cholesterol Ratio with All-Cause and Cardiovascular Mortality in Incident Hemodialysis Patients.

    PubMed

    Chang, Tae Ik; Streja, Elani; Soohoo, Melissa; Kim, Tae Woo; Rhee, Connie M; Kovesdy, Csaba P; Kashyap, Moti L; Vaziri, Nosratola D; Kalantar-Zadeh, Kamyar; Moradi, Hamid

    2017-04-03

    Elevated serum triglyceride/HDL cholesterol (TG/HDL-C) ratio has been identified as a risk factor for cardiovascular (CV) disease and mortality in the general population. However, the association of this important clinical index with mortality has not been fully evaluated in patients with ESRD on maintenance hemodialysis (MHD). We hypothesized that the association of serum TG/HDL-C ratio with all-cause and CV mortality in patients with ESRD on MHD is different from the general population. We studied the association of serum TG/HDL-C ratio with all-cause and CV mortality in a nationally representative cohort of 50,673 patients on incident hemodialysis between January 1, 2007 and December 31, 2011. Association of baseline and time-varying TG/HDL-C ratios with mortality was assessed using Cox proportional hazard regression models, with adjustment for multiple variables, including statin therapy. During the median follow-up of 19 months (interquartile range, 11-32 months), 12,778 all-cause deaths and 4541 CV deaths occurred, respectively. We found that the 10th decile group (reference: sixth deciles of TG/HDL-C ratios) had significantly lower risk of all-cause mortality (hazard ratio, 0.91 [95% confidence interval, 0.83 to 0.99] in baseline and 0.86 [95% confidence interval, 0.79 to 0.94] in time-varying models) and CV mortality (hazard ratio, 0.83 [95% confidence interval, 0.72 to 0.96] in baseline and 0.77 [95% confidence interval, 0.66 to 0.90] in time-varying models). These associations remained consistent and significant across various subgroups. Contrary to the general population, elevated TG/HDL-C ratio was associated with better CV and overall survival in patients on hemodialysis. Our findings provide further support that the nature of CV disease and mortality in patients with ESRD is unique and distinct from other patient populations. Hence, it is vital that future studies focus on identifying risk factors unique to patients on MHD and decipher the underlying

  15. Association of Serum Triglyceride to HDL Cholesterol Ratio with All-Cause and Cardiovascular Mortality in Incident Hemodialysis Patients

    PubMed Central

    Chang, Tae Ik; Streja, Elani; Soohoo, Melissa; Kim, Tae Woo; Rhee, Connie M.; Kovesdy, Csaba P.; Kashyap, Moti L.; Vaziri, Nosratola D.; Kalantar-Zadeh, Kamyar

    2017-01-01

    Background and objectives Elevated serum triglyceride/HDL cholesterol (TG/HDL-C) ratio has been identified as a risk factor for cardiovascular (CV) disease and mortality in the general population. However, the association of this important clinical index with mortality has not been fully evaluated in patients with ESRD on maintenance hemodialysis (MHD). We hypothesized that the association of serum TG/HDL-C ratio with all-cause and CV mortality in patients with ESRD on MHD is different from the general population. Design, setting, participants, & measurements We studied the association of serum TG/HDL-C ratio with all-cause and CV mortality in a nationally representative cohort of 50,673 patients on incident hemodialysis between January 1, 2007 and December 31, 2011. Association of baseline and time-varying TG/HDL-C ratios with mortality was assessed using Cox proportional hazard regression models, with adjustment for multiple variables, including statin therapy. Results During the median follow-up of 19 months (interquartile range, 11–32 months), 12,778 all-cause deaths and 4541 CV deaths occurred, respectively. We found that the 10th decile group (reference: sixth deciles of TG/HDL-C ratios) had significantly lower risk of all-cause mortality (hazard ratio, 0.91 [95% confidence interval, 0.83 to 0.99] in baseline and 0.86 [95% confidence interval, 0.79 to 0.94] in time-varying models) and CV mortality (hazard ratio, 0.83 [95% confidence interval, 0.72 to 0.96] in baseline and 0.77 [95% confidence interval, 0.66 to 0.90] in time-varying models). These associations remained consistent and significant across various subgroups. Conclusions Contrary to the general population, elevated TG/HDL-C ratio was associated with better CV and overall survival in patients on hemodialysis. Our findings provide further support that the nature of CV disease and mortality in patients with ESRD is unique and distinct from other patient populations. Hence, it is vital that future

  16. Variable (Tg, Ts) Measurements of Alkane Dissociative Sticking Coefficients

    NASA Astrophysics Data System (ADS)

    Valadez, Leticia; Dewitt, Kristy; Abbott, Heather; Kolasinski, Kurt; Harrision, Ian

    2006-03-01

    Dissociative sticking coefficients S(Tg, Ts) for CH4 and C2H6 on Pt(111) have been measured as a function of gas temperature (Tg) and surface temperature (Ts) using an effusive molecular beam. Microcanonical unimolecular rate theory (MURT) was employed to extract transition state characteristics [e.g., E0(CH4) = 52.5±3.5 kJ/mol-1 and E0(C2H6) = 26.5±3 kJ/mol-1]. MURT allows our S(Tg, Ts) values to be directly compared to other supersonic molecular beam and thermal equilibrium sticking measurements. The S(Tg, Ts) depend strongly on Ts, however, only for CH4 is a strong Tg dependence observed. The fairly weak Tg dependence for C2H6 suggests that vibrational mode specific behavior and/or molecular rotations play stronger roles in the dissociative chemisorption of C2H6 than they do for CH4. Interestingly, thermal S(Tg=Ts) predictions based on MURT modeling of our CH4/Pt(111) data are three orders of magnitude higher than recent thermal equilibrium measurements on supported Pt nanocrystallite catalysts [J. M. Wei, E. Iglesia, J. Phys. Chem. B 108, 4094 (2004)].

  17. Increasing insulin resistance accentuates the effect of triglyceride-associated loci on serum triglycerides during 5 years[S

    PubMed Central

    Justesen, Johanne M.; Andersson, Ehm A.; Allin, Kristine H.; Sandholt, Camilla H.; Jørgensen, Torben; Linneberg, Allan; Jørgensen, Marit E.; Hansen, Torben; Pedersen, Oluf; Grarup, Niels

    2016-01-01

    Blood concentrations of triglycerides are influenced by genetic factors as well as a number of environmental factors, including adiposity and glucose homeostasis. The aim was to investigate the association between a serum triglyceride weighted genetic risk score (wGRS) and changes in fasting serum triglyceride level over 5 years and to test whether the effect of the wGRS was modified by 5 year changes of adiposity, insulin resistance, and lifestyle factors. A total of 3,474 nondiabetic individuals from the Danish Inter99 cohort participated in both the baseline and 5 year follow-up physical examinations and had information on the wGRS comprising 39 genetic variants. In a linear regression model adjusted for age, sex, and baseline serum triglyceride, the wGRS was associated with increased serum triglyceride levels over 5 years [per allele effect = 1.3% (1.0–1.6%); P = 1.0 × 10−17]. This triglyceride-increasing effect of the wGRS interacted with changes in insulin resistance (Pinteraction = 1.5 × 10−6). This interaction indicated that the effect of the wGRS was stronger in individuals who became more insulin resistant over 5 years. In conclusion, our findings suggest that increased genetic risk load is associated with a larger increase in fasting serum triglyceride levels in nondiabetic individuals during 5 years of follow-up. This effect of the wGRS is accentuated by increasing insulin resistance. PMID:27777317

  18. Human plasma lipid modulation in schistosomiasis mansoni depends on apolipoprotein E polymorphism.

    PubMed

    Martins da Fonseca, Caíque Silveira; Pimenta Filho, Adenor Almeida; dos Santos, Bianka Santana; da Silva, César Augusto; Domingues, Ana Lúcia Coutinho; Owen, James Stuart; Lima, Vera Lúcia de Menezes

    2014-01-01

    Schistosomiasis mansoni is a parasitic liver disease, which causes several metabolic disturbances. Here, we evaluate the influence of Apolipoprotein E (APOE) gene polymorphism, a known modulator of lipid metabolism, on plasma lipid levels in patients with hepatosplenic schistosomiasis. Blood samples were used for APOE genotyping and to measure total cholesterol (TC), LDL-C, HDL-C and triglycerides. Schistosomiasis patients had reduced TC, LDL-C and triglycerides (25%, 38% and 32% lower, respectively; P<0.0001) compared to control individuals, whereas HDL-C was increased (10% higher; P = 0.0136). Frequency of the common alleles, ε2, ε3 and ε4, was similar (P = 0.3568) between controls (n = 108) and patients (n = 84), implying that APOE genotype did not affect susceptibility to the advanced stage of schistosomiasis. Nevertheless, while patient TC and LDL-C levels were significantly reduced for each allele (except TC in ε2 patients), changes in HDL-C and triglycerides were noted only for the less common ε2 and ε4 alleles. The most striking finding, however, was that accepted regulation of plasma lipid levels by APOE genotype was disrupted by schistosomiasis. Thus, while ε2 controls had higher TC and LDL-C than ε3 carriers, these parameters were lower in ε2 versus ε3 patients. Similarly, the inverse relationship of TG levels in controls (ε2>ε3>ε4) was absent in patients (ε2 or ε4>ε3), and the increase in HDL-C of ε2 or ε4 patients compared to ε3 patients was not seen in the control groups. We confirm that human schistosomiasis causes dyslipidemia and report for the first time that certain changes in plasma lipid and lipoprotein levels depend on APOE gene polymorphism. Importantly, we also concluded that S. mansoni disrupts the expected regulation of plasma lipids by the different ApoE isoforms. This finding suggests ways to identify new metabolic pathways affected by schistosomiasis and also potential molecular targets to treat

  19. Correlates of serum lipids and lipoproteins in Congolese patients with arterial hypertension.

    PubMed

    Lepira, F B; M'Buyamba-Kabangu, J R; Kayembe, K P; Nseka, M N

    2005-01-01

    The purpose of this study was to assess the prevalence of dyslipidaemia and the correlates of serum lipids and lipoproteins among Congolese subjects with and without arterial hypertension. One hundred hypertensive patients attending the outpatient clinics at the University of Kinshasa Hospital, and 100 age- and sex-matched controls recruited among hospital personnel or blood donors entered the case-control study. Their blood pressure (BP), heart rate (HR), body mass index (BMI), waist-to-hip ratio (WHR), serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglycerides (TG), plasma fibrinogen (only in patients) and fasting glucose, serum uric acid, creatinine and creatinine clearance (CrCl) were compared using the Student's t-test or Chi-square test as appropriate. Associations between continuous variables were assessed with Pearson correlation coefficients, and correlates of lipids and lipoproteins were determined using multiple linear-regression analysis. Compared to healthy controls, hypertensive patients had greater BMI (p TC (4.96 +/- 1.18 mmol/l for controls vs 5.01 +/- 1.49 mmol/l for hypertensives), LDL-C (3.46 +/- 1.16 mmol/l vs 3.36 +/- 1.32 mmol/l) and HDL-C (1.19 +/- 0.39 mmol/l vs 1.27 +/- 0.39 mmol/l) were similar and within the normal ranges, whereas TG in hypertensives (1.03 +/- 0.66 mmol/l) were significantly higher (p TC >or= 6.20 mmol/l. In hypertensive patients, TC (r = 0.24; p < 0.01) and LDL-C (r = 0.20; p < 0.05) were positively correlated to plasma fibrinogen. A positive correlation was also observed between TC and

  20. Usefulness of Icosapent Ethyl (Eicosapentaenoic Acid Ethyl Ester) in Women to Lower Triglyceride Levels (Results from the MARINE and ANCHOR Trials).

    PubMed

    Mosca, Lori; Ballantyne, Christie M; Bays, Harold E; Guyton, John R; Philip, Sephy; Doyle, Ralph T; Juliano, Rebecca A

    2017-02-01

    There are limited data on the efficacy and safety of triglyceride (TG)-lowering agents in women. We conducted subgroup analyses of the effects of icosapent ethyl (a high-purity prescription form of the ethyl ester of the omega-3 fatty acid, eicosapentaenoic acid) on TG levels (primary efficacy variable) and other atherogenic and inflammatory parameters in a total of 215 women with a broad range of TG levels (200-2000 mg/dl) enrolled in two 12-week placebo-controlled trials: MARINE (n = 18; placebo, n = 18) and ANCHOR (n = 91; placebo, n = 88). Icosapent ethyl 4 g/day significantly reduced TG levels from baseline to week 12 versus placebo in both MARINE (-22.7%; p = 0.0327) and ANCHOR (-21.5%; p <0.0001) without increasing low-density lipoprotein cholesterol levels. Significant improvements were also observed in non-high-density lipoprotein cholesterol levels in MARINE (-15.7%; p = 0.0082) and ANCHOR (-14.2%; p <0.0001) and total cholesterol levels in MARINE (-14.9%; p = 0.0023) and ANCHOR (-12.1%; p <0.0001), along with significant increases of >500% in eicosapentaenoic acid levels in plasma and red blood cells (all p <0.001). Icosapent ethyl was well tolerated, with adverse-event profiles comparable with findings in the overall studies. In conclusion, icosapent ethyl 4 g/day significantly reduced TG levels and other atherogenic parameters in women without increasing low-density lipoprotein cholesterol levels compared with placebo; the clinical implications of these findings are being evaluated in the REDUCtion of Cardiovascular Events With Eicosapentaenoic Acid [EPA]-Intervention Trial (REDUCE-IT) cardiovascular outcomes study. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Effects of the C161T polymorphism in the gene of peroxisome proliferators activated receptor γ on changes of plasma lipid and apolipoprotein ratios induced by a high carbohydrate diet in a healthy Chinese Han young population.

    PubMed

    Fan, Mei; Gong, Ren Rong; Lin, Jia; Jiang, Zhe; Li, Yuan Hao; Zhang, Rong Rong; Fang, Ding Zhi

    2014-01-01

    Changes in the ratios of plasma lipids and apolipoproteins may be associated with diets and the C161T polymorphism in the gene of peroxisome proliferators activated receptor gamma (PPARgamma). As a result, this study was to investigate the effects of this polymorphism on changes of the ratios induced by a high-carbohydrate (high-CHO) diet. After a washout diet of 54% carbohydrate for 7 days, 56 healthy young adults (22.89 +/- 1.80 years old) were given the high-CHO diet of 70% carbohydrate for 6 days. Height, weight, waist circumference (WC), glucose, triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), apolipoprotein (apo) AI, and apoB100 at baseline and before and after the high-CHO diet were measured. Body mass index (BMI), TG/HDL-C, log (TG/HDL-C), TC/HDL-C, LDL-C/HDL-C, and apoB100/apoAI were calculated. PPARgamma C161T was detected by a PCR-RFLP method. The relationship between the polymorphism and the ratios were analyzed. The female T carriers had higher BMI and WC than the female CC homozygotes at baseline and before and after the diet, higher glucose, TG/HDL-C and log (TG/HDL-C) before the diet. In males, when compared to the T carriers, the CC homozygotes had higher TG/HDL-C, log (TG/HDL-C) and apoB100/apoAI at baseline and before and after the diet, higher glucose at baseline, higher LDL-C/HDL-C and TC/HDL-C before and after the diet. Compared with those before the high-CHO diet, TC/HDL-C and LDL-C/HDL-C decreased after the diet regardless of gender and the genotypes. Decreased BMI and WC were observed in the male CC homozygotes but only decreased BMI in the female T carriers. Notably, decreased apoB100/apoAI was observed in the male T carriers, while elevated TG/HDL-C and log (TG/HDL-C) in the female CC homozygotes, and reduced glucose in the female T carriers. The results suggest that the interplay of gender, the PPARgamma C161T polymorphism and the high-CHO diet can

  2. High triglycerides and low high-density lipoprotein cholesterol lipid profile in rheumatoid arthritis: A potential link among inflammation, oxidative status, and dysfunctional high-density lipoprotein.

    PubMed

    Rodríguez-Carrio, Javier; Alperi-López, Mercedes; López, Patricia; López-Mejías, Raquel; Alonso-Castro, Sara; Abal, Francisco; Ballina-García, Francisco J; González-Gay, Miguel Á; Suárez, Ana

    The interactions between inflammation and lipid profile in rheumatoid arthritis (RA) are poorly understood. The lipid profile study in RA has been biased toward lipoprotein levels, whereas those of triglycerides (TGs) and lipoprotein functionality have been underestimated. Since recent findings suggest a role for TG and TG-rich lipoproteins (TRL) on inflammation, we aimed to evaluate a combined lipid profile characterized by high TG and low high-density lipoprotein cholesterol levels (TG high HDL low ) in RA. Lipid profiles were analyzed in 113 RA patients, 113 healthy controls, and 27 dyslipemic subjects. Levels of inflammatory mediators, paraoxonase-1 (PON1) activity, and total antioxidant capacity were quantified in serum. PON1-rs662 status was evaluated by real-time polymerase chain reaction. The TG high HDL low profile was detected in 29/113 RA patients. Although no differences in prevalence compared with healthy controls or dyslipemic subjects were observed, this profile was associated with increased tumor necrosis factor α (P = .004), monocyte chemotactic protein (P = .004), interferon-gamma-inducible protein-10 (P = .018), and leptin (P < .001) serum levels in RA, where decreased PON1 activity and total antioxidant capacity were found. TG high HDL low prevalence was lower among anti-TNFα-treated patients (P = .004). When RA patients were stratified by PON1-rs662 status, these associations remained in the low-activity genotype (QQ). Finally, a poor clinical response on TNFα blockade was related to an increasing prevalence of the TG high HDL low profile over treatment (P = .021) and higher TRL levels at baseline (P = .042). The TG high HDL low profile is associated with systemic inflammation, decreased PON1 activity, and poor clinical outcome on TNFα blockade in RA, suggesting a role of TRL and HDL dysfunction as the missing link between inflammation and lipid profile. Copyright © 2017 National Lipid Association. Published by Elsevier Inc

  3. Simultaneous Quantification of Free Cholesterol, Cholesteryl Esters, and Triglycerides without Ester Hydrolysis by UHPLC Separation and In-Source Collision Induced Dissociation Coupled MS/MS

    NASA Astrophysics Data System (ADS)

    Gardner, Michael S.; McWilliams, Lisa G.; Jones, Jeffrey I.; Kuklenyik, Zsuzsanna; Pirkle, James L.; Barr, John R.

    2017-08-01

    We demonstrate the application of in-source nitrogen collision-induced dissociation (CID) that eliminates the need for ester hydrolysis before simultaneous analysis of esterified cholesterol (EC) and triglycerides (TG) along with free cholesterol (FC) from human serum, using normal phase liquid chromatography (LC) coupled to atmospheric pressure chemical ionization (APCI) tandem mass spectrometry (MS/MS). The analysis requires only 50 μL of 1:100 dilute serum with a high-throughput, precipitation/evaporation/extraction protocol in one pot. Known representative mixtures of EC and TG species were used as calibrators with stable isotope labeled analogs as internal standards. The APCI MS source was operated with nitrogen source gas. Reproducible in-source CID was achieved with the use of optimal cone voltage (declustering potential), generating FC, EC, and TG lipid class-specific precursor fragment ions for multiple reaction monitoring (MRM). Using a representative mixture of purified FC, CE, and TG species as calibrators, the method accuracy was assessed with analysis of five inter-laboratory standardization materials, showing -10% bias for Total-C and -3% for Total-TG. Repeated duplicate analysis of a quality control pool showed intra-day and inter-day variation of 5% and 5.8% for FC, 5.2% and 8.5% for Total-C, and 4.1% and 7.7% for Total-TG. The applicability of the method was demonstrated on 32 serum samples and corresponding lipoprotein sub-fractions collected from normolipidemic, hypercholesterolemic, hypertriglyceridemic, and hyperlipidemic donors. The results show that in-source CID coupled with isotope dilution UHPLC-MS/MS is a viable high precision approach for translational research studies where samples are substantially diluted or the amounts of archived samples are limited. [Figure not available: see fulltext.

  4. The influence of the S19W SNP of the APOA5 gene on triglyceride levels in southern Brazil: interactions with the APOE gene, sex and menopause status.

    PubMed

    De Andrade, F M; Maluf, S W; Schuch, J B; Voigt, F; Barros, A C; Lucatelli, J F; Hutz, M H

    2011-08-01

    Hypertriglyceridemia is an important independent risk factor for coronary artery diseases and is determined by a wide range of factors, both genetic and exogenous. The A5 apolipoprotein, which is associated with the synthesis and removal of triglycerides (TG), is encoded by the APOA5 gene. One of the polymorphisms of this gene that has been the focus of a large number of studies, and which appears to be associated with increased TG, is S19W (rs 3135506). In this study, we examined the influence of this single nucleotide polymorphism (SNP) on TG levels of a sample of southern Brazilians. Samples obtained from 567 people of European descent were genotyped; interactions between this variant and anthropometric variables were analyzed, and the effects of lifestyle, sex, menopause, and variations of the APOE gene were evaluated. We found that the 19W allele is associated with increased TG (p = 0.025) and that this influence was modulated by sex (p = 0.003), menopause (p = 0.022) and the presence of the E*4 allele (p = 0.027). Our data showed, for the first time, the importance and magnitude of the influence of the S19W variant in a southern Brazilian population. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. 1914G variant of BCHE gene associated with enzyme activity, obesity and triglyceride levels.

    PubMed

    Lima, Jovana Karoline; Leite, Neiva; Turek, Luciane Viater; Souza, Ricardo Lehtonen Rodrigues; da Silva Timossi, Luciana; Osiecki, Ana Claudia Vecchi; Osiecki, Raul; Furtado-Alle, Lupe

    2013-12-10

    Polymorphisms of butyrylcholinesterase (BChE) have been reported to be associated to weight, BMI variance and hypertriglyceridemia in adults and adolescents. The aim of the present study was to investigate the association of -116A (SNP: G/A; rs1126680) and 1914G (SNP: A/G; rs3495) variants of BCHE gene with anthropometric and biochemical variables associated with obesity in population sample of 115 individuals, from Southern Brazil. Participants were grouped in two categories: obese (BMI≥30) and non-obese (BMI<30). The 1914G allele showed significantly higher frequency in the obese group, and carriers of 1914G allele showed lower mean BChE activity when compared to 1914A carriers (p=0.006). Higher means of BMI (p=0.02) and triglyceride (TG; p=0.01) were found in 1914G carriers (BMI=27.57 kg/m(2); TG=150.8 mg/dL) when compared to 1914A homozygotes (BMI=25.55 kg/m(2); TG=107.9 mg/dL). Carriers of the -116A allele showed lower mean BChE activity than usual homozygotes, and the -116A variant was found in cis with 1914G (p<0.0001; D'=1). The region of BCHE gene that contains the 1914G mutation site is target of microRNAs (miRs) and the response of BChE to glucocorticoids is especially influenced by these miRs. Therefore, it is possible that the 1914G allele can be interfering in gluconeogenesis, hyperglycemia, lipolysis and body fat distribution. This lower activity may cause an imbalance in lipid metabolism, which may lead to an increased predisposition to obesity and to a lower ability to maintain metabolic homeostasis. © 2013 Elsevier B.V. All rights reserved.

  6. Trends in lipid profiles and descriptive characteristics of U.S. adults with and without diabetes and cholesterol-lowering medication use-National Health and Nutrition Examination Survey, 2003-2012, United States.

    PubMed

    Mercado, Carla I; Gregg, Edward; Gillespie, Cathleen; Loustalot, Fleetwood

    2018-01-01

    With a cholesterol-lowering focus for diabetic adults and in the age of polypharmacy, it is important to understand how lipid profile levels differ among those with and without diabetes. Investigate the means, differences, and trends in lipid profile measures [TC, total cholesterol; LDL-c, low-density lipoprotein; HDL-c, high-density lipoprotein; and TG, triglycerides] among US adults by diabetes status and cholesterol-lowering medication. Population number and proportion of adults aged ≥21 years with diabetes and taking cholesterol-lowering medication were estimated using data on 10,384 participants from NHANES 2003-2012. Age-standardized means, trends, and differences in lipid profile measures were estimated by diabetes status and cholesterol medication use. For trends and differences, linear regression analysis were used adjusted for age, gender, and race/ethnicity. Among diabetic adults, 52% were taking cholesterol-lowering medication compared to the 14% taking cholesterol-lowering medication without diabetes. Although diabetic adults had significantly lower TC and LDL-c levels than non-diabetic adults [% difference (95% confidence interval): TC = -5.2% (-6.8 --3.5), LDL-c = -8.0% (-10.4 --5.5)], the percent difference was greater among adults taking cholesterol medication [TC = -8.0% (-10.3 --5.7); LDL-c = -13.7% (-17.1 --10.2)] than adults not taking cholesterol medication [TC = -3.5% (-5.2 --1.6); LDL-c = -4.3% (-7.1 --1.5)] (interaction p-value: TC = <0.001; LDL-c = <0.001). From 2003-2012, mean TC and HDL-c significantly decreased among diabetic adults taking cholesterol medication [% difference per survey cycle (p-value for linear trend): TC = -2.3% (0.003) and HDL-c = -2.3% (0.033)]. Mean TC, HDL-c, and LDL-c levels did not significantly change from 2003 to 2012 in non-diabetic adults taking cholesterol medication or for adults not taking cholesterol medications. Diabetic adults were more likely to have lower lipid levels, except for triglyceride

  7. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  8. Impact of the Triglycerides to High-Density Lipoprotein Cholesterol Ratio on the Incidence and Progression of CKD: A Longitudinal Study in a Large Japanese Population.

    PubMed

    Tsuruya, Kazuhiko; Yoshida, Hisako; Nagata, Masaharu; Kitazono, Takanari; Iseki, Kunitoshi; Iseki, Chiho; Fujimoto, Shouichi; Konta, Tsuneo; Moriyama, Toshiki; Yamagata, Kunihiro; Narita, Ichiei; Kimura, Kenjiro; Kondo, Masahide; Asahi, Koichi; Kurahashi, Issei; Ohashi, Yasuo; Watanabe, Tsuyoshi

    2015-12-01

    The impact of the triglycerides to high-density lipoprotein cholesterol (TG:HDL-C) ratio on chronic kidney disease (CKD) is unclear. Longitudinal cohort study. 124,700 participants aged 39 to 74 years in the Japanese Specific Health Check and Guidance System, including 50,392 men, 74,308 women, 102,900 without CKD, and 21,800 with CKD. Quartiles of TG:HDL-C ratio. Changes in estimated glomerular filtration rate (eGFR) and urinary protein excretion during the 2-year study period. Incident CKD in participants without CKD, and progression of CKD in participants with CKD. In the entire study population, higher quartile of TG:HDL-C ratio at baseline was significantly associated with greater decline in eGFR and increase in urinary protein excretion during the 2-year study period, even after adjustment for confounding factors. A higher ratio was associated with higher risk of incident CKD in participants without CKD and higher risk of rapid decline in eGFR and increase in urinary protein excretion in participants with CKD. Higher TG:HDL-C ratio was more strongly associated with decline in eGFR (P for interaction = 0.002) and with incident CKD (P for interaction = 0.05) in participants with diabetes than without diabetes. Short observation period and single measurement of all variables. A higher TG:HDL-C ratio affects the decline in eGFR and incidence and progression of CKD in the Japanese population. Copyright © 2015 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

  9. Isolation of the molecular species of monogalactosyldiacylglycerols from brown edible seaweed Sargassum horneri and their inhibitory effects on triglyceride accumulation in 3T3-L1 adipocytes.

    PubMed

    Ma, Ai-Cui; Chen, Zhen; Wang, Tao; Song, Ni; Yan, Qian; Fang, Yu-Chun; Guan, Hua-Shi; Liu, Hong-Bing

    2014-11-19

    The chemical composition of monogalactosyldiacylglycerols (MGDGs) from brown alga Sargassum horneri and their inhibitory effects on lipid accumulation were investigated in this study. A total of 10 molecular species of MGDGs were identified using nuclear magnetic resonance, alkaline hydrolysis, gas chromatography-flame ionization detector, and high-performance liquid chromatography-tandem mass spectrometry methods. Individual molecular species of MGDGs, including (2S)-1-O-myristoyl-2-O-palmitoleoyl-3-O-β-D-galactopyranosyl-sn-glycerol (1), (2S)-1-O-myristoyl-2-O-linoleyl-3-O-β-D-galactopyranosyl-sn-glycerol (3), (2S)-1-O-palmitoyl-2-O-linolenoyl-3-O-β-D-galactopyranosyl-sn-glycerol (5), (2S)-1-O-myristoyl-2-O-oleyl-3-O-β-D-galactopyranosyl-sn-glycerol (7), (2S)-1-O-palmitoyl-2-O-palmitoleoyl-3-O-β-D-galactopyranosyl-sn-glycerol (8), (2S)-1-O-palmitoyl-2-O-linoleyl-3-O-β-D-galactopyranosyl-sn-glycerol (9), and (2S)-1-O-palmitoyl-2-O-oleyl-3-O-β-D-galactopyranosyl-sn-glycerol (10), were then furnished using semi-preparative high-performance liquid chromatography, and their inhibitory effects on triglyceride (TG) accumulation and free fatty acid (FFA) levels in 3T3-L1 adipocytes were evaluated. Compounds 3 and 9 showed inhibitory effects on TG and FFA accumulation, with TG levels of 1.568 ± 0.2808 and 1.701 ± 0.1460 μmol/L and FFA levels of 0.149 ± 0.0258 and 0.198 ± 0.0229 mequiv/L, respectively, which were more effective than other compounds. The primary structure-activity relationship suggested that linoleyl [18:2(ω-6)] in the sn-2 position played an important role on triglyceride accumulation inhibition.

  10. Improvement in lipids after switch to boosted atazanavir or darunavir in children/adolescents with perinatally acquired HIV on older protease inhibitors: results from the Pediatric HIV/AIDS Cohort Study.

    PubMed

    Jao, J; Yu, W; Patel, K; Miller, T L; Karalius, B; Geffner, M E; DiMeglio, L A; Mirza, A; Chen, J S; Silio, M; McFarland, E J; Van Dyke, R B; Jacobson, D

    2018-03-01

    Dyslipidaemia is common in perinatally HIV-infected (PHIV) youth receiving protease inhibitors (PIs). Few studies have evaluated longitudinal lipid changes in PHIV youth after switch to newer PIs. We compared longitudinal changes in fasting lipids [total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and TC:HDL-C ratio] in PHIV youth enrolled in the Pediatric HIV/AIDS Cohort Study (PHACS) Adolescent Master Protocol (AMP) study who switched to atazanavir/ritonavir (ATV/r)- or darunavir/ritonavir (DRV/r)-based antiretroviral therapy (ART) from an older PI-based ART and those remaining on an older PI. Generalized estimating equation models were fitted to assess the association of a switch to ATV/r- or DRV/r-based ART with the rate of change in lipids, adjusted for potential confounders. From 2007 to 2014, 47 PHIV children/adolescents switched to ATV/r or DRV/r, while 120 remained on an older PI [primarily lopinavir/r (72%) and nelfinavir (24%)]. Baseline age ranged from 7 to 21 years. After adjustment for age, Tanner stage, race/ethnicity, and HIV RNA level, a switch to ATV/r or DRV/r was associated with a more rapid annual rate of decline in the ratio of TC:HDL-C. (β = -0.12; P = 0.039) than remaining on an older PI. On average, TC declined by 4.57 mg/dL/year (P = 0.057) more in the switch group. A switch to ATV/r or DRV/r was not associated with the rate of HDL-C, LDL-C, or TG change. A switch to ATV/r or DRV/r may result in more rapid reduction in TC and the TC:HDL-C ratio in PHIV youth, potentially impacting long-term cardiovascular disease risk. © 2017 British HIV Association.

  11. Cosmological applications of F (T ,TG) gravity

    NASA Astrophysics Data System (ADS)

    Kofinas, Georgios; Saridakis, Emmanuel N.

    2014-10-01

    We investigate the cosmological applications of F (T ,TG) gravity, which is a novel modified gravitational theory based on the torsion invariant T and the teleparallel equivalent of the Gauss-Bonnet term TG. F (T ,TG) gravity differs from both F (T ) theories as well as from F (R ,G ) class of curvature modified gravity, and thus its corresponding cosmology proves to be very interesting. In particular, it provides a unified description of the cosmological history from early-times inflation to late-times self-acceleration, without the inclusion of a cosmological constant. Moreover, the dark energy equation-of-state parameter can be quintessence or phantomlike, or experience the phantom-divide crossing, depending on the parameters of the model.

  12. Ramadan fasting ameliorates oxidative stress and improves glycemic control and lipid profile in diabetic patients.

    PubMed

    Al-Shafei, Ahmad I

    2014-10-01

    The effects of Ramadan fasting on public health are important. The present study characterized the metabolic effects of Ramadan fasting and evaluated its influence on oxidative stress in diabetic patients. The current study was carried out in the city of Benha, Egypt, during the period from July 12, 2012 to October 4, 2012. This corresponds to 22 Shaban 1433 to 18 Dhul Al-Qi'dah 1433 in the Islamic Calendar. Two equal, sex- and age-matched groups (n = 40 each; age 55 ± 5 years) of non-diabetic subjects (ND group) and diabetic patients (D group) were recruited for this study. Parameters of glycemic control, lipid profile, and oxidative stress were measured pre-, during and post-fasting. Ramadan fasting reduced fasting blood glucose (FBG) insignificantly by 5.8% and significantly by 23.0% in the (ND) and (D) groups, respectively. Serum triglycerides (TG) and malondialdehyde (MDA) were lowered significantly by: TG (22.8, 22.1%), MDA (54.3, 46.6%), and total cholesterol (TC) and low-density lipoproteins (LDL) insignificantly by: TC: (4.7, 6.1%), LDL: (4.0, 5.1%), whereas high-density lipoproteins (HDL) were raised significantly by 6.7% and insignificantly by 2.2%, and blood glutathione (GSH) significantly by 52.6 and 59.4%, in the (ND) and (D) groups, respectively. At 6 weeks post-fasting FBG, TG, TC, HDL, and LDL returned to levels indistinguishable from their baseline values in both groups, while MDA was maintained significantly lower by (25.7, 22.7%), and GSH significantly higher by (26.3, 31.3%), in the (ND) and (D) groups, respectively. Ramadan fasting improves glycemic control and lipids profile and alleviates oxidative stress in diabetics.

  13. Impact of avocado-enriched diets on plasma lipoproteins: A meta-analysis.

    PubMed

    Peou, Sokunthea; Milliard-Hasting, Brittany; Shah, Sachin A

    2016-01-01

    Optimizing plasma lipoproteins is the primary goal of pharmacotherapy and diet interventions in people at risk for cardiovascular diseases. Avocados offer a rich source of monounsaturated fat and may pose beneficial effects on the lipid profile. We aimed to perform a meta-analysis of randomized clinical trials assessing the impact of avocados on TC, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol, and/or triglycerides (TG). We searched PUBMED, Cumulative Index to Nursing and Allied Health Literature, Index to Nursing and Allied Health Literature, and the Cochrane Database of Systemic Reviews from their inception to February 2015. The weighted mean difference from baseline was calculated for all endpoints. Subgroup analyses were performed to assess heterogeneity, and funnel plots inspected to assess publication bias. Ten unique studies (n = 229) were included. Avocado consumption significantly reduced TC, LDL-C, and TG by -18.80 mg/dL (95% confidence interval [CI], -24.56 to -13.05; I(2), 46.9%), -16.50 mg/dL (95% CI, -22.91 to -10.10; I(2), 72.5%), -27.20 mg/dL (95% CI, -44.41 to -9.99; I(2), 91.1%) respectively. High-density lipoprotein cholesterol decreased nonsignificantly by -0.18 mg/dL (95% CI, -3.23 to 2.88; I(2), 84.8%). Avocado-substituted diets significantly decrease TC, LDL-C, and TG levels. Substituting dietary fats with avocados versus adding to the free diet should be the primary recommendation strategy. Larger trials looking at the impact of avocados on major adverse cardiovascular events are warranted. Copyright © 2016 National Lipid Association. All rights reserved.

  14. Alantolactone suppresses APOC3 expression and alters lipid homeostasis in L02 liver cells.

    PubMed

    Yang, Meiting; Zhao, Hanhan; Ai, Huihan; Zhu, Hongbin; Wang, Shuyue; Bao, Yongli; Li, Yuxin

    2018-06-05

    A high level of APOC3 expression is an independent risk factor for some lipid metabolism-related diseases, such as cardiovascular disease (CVD), nonalcoholic fatty liver disease (NAFLD) and atherosclerosis (AS). This suggests that down-regulating APOC3 expression is a potential way of regulating lipid levels. In this study, we used luciferase reporter screening to identify a natural compound, alantolactone (ALA), that can inhibit the promoter activity of APOC3. ALA decreased APOC3 expression at both mRNA and protein levels. Then we pretreated L02 liver cells with oxLDL to investigate the function of ALA in lipid homeostasis. Intriguingly, ALA attenuated oxLDL-induced foam cell formation by reducing total cholesterol (TC) and triglyceride (TG) contents. Furthermore, these results could be reversed by overexpressing APOC3 protein. ALA inhibited tyrosine phosphorylation (Tyr705pho) of STAT3 to down-regulate APOC3 expression. Intriguingly, overexpression of a wild-type STAT3 or a constitutively active form of STAT3 (STAT3-C) up-regulated APOC3 expression and partly reversed the effect of ALA in oxLDL-induced L02 cells. Overexpression of wild-type STAT3 also increased TC but not TG contents in L02 cells. However, overexpression of STAT3-C significantly increased TC and TG contents, and the effect of ALA was partly attenuated by STAT3-C, although this was not statistically significant. These results suggest that ALA attenuates lipid accumulation through down-regulation of APOC3 expression, at least in part by inhibiting STAT3 signaling. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. [Association between chronic periodontitis and hyperlipidemia: a Meta-analysis based on observational studies].

    PubMed

    Lianhui, Yang; Meifei, Lian; Zhongyue, Hu; Yunzhi, Feng

    2017-08-01

    Objective The aim of this study is to evaluate the relationship between periodontitis and hyperlipidemia risks through Meta-analysis. Methods Two researchers conducted an electronic search on PubMed, Cochrane Library, Embase, CBM, CNKI, Wanfang and VIP databases established until July 2016 for observational studies on the association between periodontitis and hyperlipidemia. The language used was limited to Chinese and English. After data extraction and quality evaluation of included trials, Meta-analysis was conducted using the RevMan 5.3 software. The GRADE 3.6 software was used to evaluate the quality level of the evidence. Results Six case-control studies and one cohort study were included. The results of Meta-analysis showed that serum triglyceride (TG) in patients with periodontitis was significantly higher than that of the periodontal health group (MD=50.50, 95% confidence interval=39.57-61.42, P<0.000 01), as well as serum total cholesterol (TC) (MD=17.54, 95% confidence interval=10.91-24.18, P<0.000 01). Furthermore, the risks of TG and TC in the serum of patients with chronic periodontitis were 4.73 times (OR=4.73, 95% confidence interval=2.74-8.17, P<0.000 01) and 3.62 times (OR=3.62, 95% confidence interval=2.18-6.03, P<0.000 01) of that of periodontal healthy patients. No significant difference was observed between the group with high-density lipoprotein cholesterol (HDL-C) and that with low density lipoprotein cholesterol (LDL-C). Conclusion Current evidence indicates that a correlation exists between chronic periodontitis and hyperlipidemia, and chronic periodontitis is an independent risk factor for hyperlipidemia, especially for TC and TG in serum.

  16. Hypolipidaemic Effect of Hericium erinaceum Grown in Artemisia capillaris on Obese Rats.

    PubMed

    Choi, Won-Sik; Kim, Young-Sun; Park, Byeoung-Soo; Kim, Jang-Eok; Lee, Sung-Eun

    2013-06-01

    In this study, ethanolic extracts from Hericium erinaceum cultivated with Artemisia capillaris (HEAC) were assessed for their ability to lower the cholesterol levels of male Sprague-Dawley rats fed a high-fat diet. Rats were randomly subdivided into seven test groups. Each group contained eight rats fed a high-fat diet during a growth period lasting 4 wk. Supplementation with the extracts was performed once a day for 2 wk after the high-fat diet. The control group (rats fed a high-fat diet) showed a high efficiency ratio (feed efficiency ratio) value compared to the normal group. Biochemical parameters, including total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-c), and triglyceride (TG) levels dramatically increased in the control group compared to the normal group. High-density lipoprotein-cholesterol (HDL-c) content in the control group was also significantly lower relative to the normal group. Two positive control groups, treated with simvastatin and atorvastatin, had lowered TC, LDL-c, and TG levels, and increased HDL-c content compared to the control group. Treatment with the tested extracts, including HEAC, ethanolic extracts from Hericium erinaceum, and ethanolic extracts from Artemisia capillaris reduced TC, LDL-c, and TG levels and elevated HDL-c content in the hyperlipidemia rats. The atherogenic index and cardiac risk factor values for the HEAC-treated group were 0.95 and 1.95, respectively. Simvastatin- and atorvastatin-treated groups showed atherogenic index values of 1.56 and 1.69, respectively, and cardiac risk factor values of 2.56 and 2.69, respectively. These results show HEAC possesses an ability to cure hyperlipidemia in rats and may serve as an effective natural medicine for treating hyperlipidemia in humans.

  17. Dietary intake of the short-chain triglyceride triacetin vs. long-chain triglycerides decreases adipocyte diameter and fat deposition in rats.

    PubMed

    Lynch, J W; Bailey, J W

    1995-05-01

    Diets containing either triacetin (the water-soluble triglyceride of acetate) or long-chain triglycerides (LCT) were fed to rats for 30 d to determine the effect on body weight gain and adipose tissue cellularity. Male Sprague-Dawley rats were allowed free access to one of three diets: a control diet containing 5% of energy as fat or one of two experimental diets that contained 30% triglyceride (by energy). The source of the triglyceride in the two experimental groups was either 100% LCT or 95% triacetin + 5% LCT. Within the experimental groups receiving 30% fat, the source of dietary triglyceride (LCT vs. triacetin) did not affect total energy consumption. There were no significant differences in body weight at the onset of the study; however, animals fed 100% LCT weighed significantly more than the other two groups at the end of the study. In all three fat pads studied, animals fed triacetin had significantly lower pad mass than did animals fed LCT. Mean fat cell size was smaller in fat depots of animals fed short-chain triglyceride. Provision of dietary energy as the short-chain triglyceride triacetin in lieu of LCT resulted in lower weight gain and fat deposition. These data demonstrate the impact of dietary triglyceride composition on body weight regulation.

  18. Medium chain triglycerides and hepatic encephalopathy

    PubMed Central

    Morgan, M. Hilary; Bolton, C. H.; Morris, J. S.; Read, A. E.

    1974-01-01

    The oral administration of short (C6) and medium (C8 and (C10) chain triglycerides produced no clinical or electroencephalographic changes in patients with cirrhosis of the liver. Arterial ammonia levels were also monitored in these patients and showed no significant change after medium chain triglycerides. It was concluded that medium chain triglycerides, known to be of potential value in the treatment of malabsorption in patients with cirrhosis, are not clinically contraindicated, even in patients with evidence of hepatic encephalopathy. PMID:4841275

  19. Comparison between European and Iranian cutoff points of triglyceride/high-density lipoprotein cholesterol concentrations in predicting cardiovascular disease outcomes.

    PubMed

    Gharipour, Mojgan; Sadeghi, Masoumeh; Dianatkhah, Minoo; Nezafati, Pouya; Talaie, Mohammad; Oveisgharan, Shahram; Golshahi, Jafar

    2016-01-01

    High triglyceride (TG) and low high-density lipoprotein cholesterol (HDL-C) are important cardiovascular risk factors. The exact prognostic value of the TG/HDL-C ratio, a marker for cardiovascular events, is currently unknown among Iranians so this study sought to determine the optimal cutoff point for the TG/HDL-C ratio in predicting cardiovascular disease events in the Iranian population. The Isfahan Cohort Study (ICS) is an ongoing, longitudinal, population-based study that was originally conducted on adults aged ≥ 35 years, living in urban and rural areas of three districts in central Iran. After 10 years of follow-up, 5431 participants were re-evaluated using a standard protocol similar to the one used for baseline. At both measurements, participants underwent medical interviews, physical examinations, and fasting blood measurements. "High-risk" subjects were defined by the discrimination power of indices, which were assessed using receiver operating characteristic (ROC) analysis; the optimal cutoff point value for each index was then derived. The mean age of the participants was 50.7 ± 11.6 years. The TG/HDL-C ratio, at a threshold of 3.68, was used to screen for cardiovascular events among the study population. Subjects were divided into two groups ("low" and "high" risk) according to the TG/HDL-C concentration ratio at baseline. A slightly higher number of high-risk individuals were identified using the European cutoff points of 63.7% in comparison with the ICS cutoff points of 49.5%. The unadjusted hazard ratio (HR) was greatest in high-risk individuals identified by the ICS cutoff points (HR = 1.54, 95% CI [1.33-1.79]) vs European cutoff points (HR = 1.38, 95% [1.17-1.63]). There were no remarkable changes after adjusting for differences in sex and age (HR = 1.58, 95% CI [1.36-1.84] vs HR = 1.44, 95% CI [1.22-1.71]) for the ICS and European cutoff points, respectively. The threshold of TG/HDL ≥ 3.68 is the optimal cutoff point for predicting

  20. Genome-wide association study of triglyceride response to a high-fat meal among participants of the NHLBI Genetics of Lipid Lowering Drugs and Diet Network (GOLDN).

    PubMed

    Wojczynski, Mary K; Parnell, Laurence D; Pollin, Toni I; Lai, Chao Q; Feitosa, Mary F; O'Connell, Jeff R; Frazier-Wood, Alexis C; Gibson, Quince; Aslibekyan, Stella; Ryan, Kathy A; Province, Michael A; Tiwari, Hemant K; Ordovas, Jose M; Shuldiner, Alan R; Arnett, Donna K; Borecki, Ingrid B

    2015-10-01

    The triglyceride (TG) response to a high-fat meal (postprandial lipemia, PPL) affects cardiovascular disease risk and is influenced by genes and environment. Genes involved in lipid metabolism have dominated genetic studies of PPL TG response. We sought to elucidate common genetic variants through a genome-wide association (GWA) study in the Genetics of Lipid Lowering Drugs and Diet Network (GOLDN). The GOLDN GWAS discovery sample consisted of 872 participants within families of European ancestry. Genotypes for 2,543,887 variants were measured or imputed from HapMap. Replication of our top results was performed in the Heredity and Phenotype Intervention (HAPI) Heart Study (n = 843). PPL TG response phenotypes were constructed from plasma TG measured at baseline (fasting, 0 hour), 3.5 and 6 hours after a high-fat meal, using a random coefficient regression model. Association analyses were adjusted for covariates and principal components, as necessary, in a linear mixed model using the kinship matrix; additional models further adjusted for fasting TG were also performed. Meta-analysis of the discovery and replication studies (n = 1715) was performed on the top SNPs from GOLDN. GOLDN revealed 111 suggestive (p < 1E-05) associations, with two SNPs meeting GWA significance level (p < 5E-08). Of the two significant SNPs, rs964184 demonstrated evidence of replication (p = 1.20E-03) in the HAPI Heart Study and in a joint analysis, was GWA significant (p = 1.26E-09). Rs964184 has been associated with fasting lipids (TG and HDL) and is near ZPR1 (formerly ZNF259), close to the APOA1/C3/A4/A5 cluster. This association was attenuated upon additional adjustment for fasting TG. This is the first report of a genome-wide significant association with replication for a novel phenotype, namely PPL TG response. Future investigation into response phenotypes is warranted using pathway analyses, or newer genetic technologies such as metabolomics. Copyright © 2015 Elsevier Inc. All

  1. GENOME-WIDE ASSOCIATION STUDY OF TRIGLYCERIDE RESPONSE TO A HIGH-FAT MEAL AMONG PARTICIPANTS OF THE NHLBI GENETICS OF LIPID LOWERING DRUGS AND DIET NETWORK (GOLDN)

    PubMed Central

    Wojczynski, M.K.; Parnel, L.D.; Pollin, T.I.; Lai, C.Q.; Feitosa, M.F.; O’Connell, J.R.; Frazier-Wood, A.C.; Gibson, Q.; Aslibekyan, S.; Ryan, K.A.; Province, M.A.; Tiwari, H.K.; Ordovas, J.M.; Shuldiner, A.R.; Arnett, D.K.; Borecki, I.B.

    2015-01-01

    Objective The triglyceride (TG) response to a high-fat meal (postprandial lipemia, PPL) affects cardiovascular disease risk and is influenced by genes and environment. Genes involved in lipid metabolism have dominated genetic studies of PPL TG response. We sought to elucidate common genetic variants through a genome-wide association (GWA) study in the Genetics of Lipid Lowering Drugs and Diet Network (GOLDN). Methods The GOLDN GWAS discovery sample consisted of 872 participants within families of European ancestry. Genotypes for 2,543,887 variants were measured or imputed from HapMap. Replication of our top results was performed in the Heredity and Phenotype Intervention (HAPI) Heart Study (n=843). PPL TG response phenotypes were constructed from plasma TG measured at baseline (fasting, 0 hour), 3.5 and 6 hours after a high-fat meal, using a random coefficient regression model. Association analyses were adjusted for covariates and principal components, as necessary, in a linear mixed model using the kinship matrix; additional models further adjusted for fasting TG were also performed. Meta-analysis of the discovery and replication studies (n=1,715) was performed on the top SNPs from GOLDN. Results GOLDN revealed 111 suggestive (p<1E-05) associations, with two SNPs meeting GWA significance level (p<5E-08). Of the two significant SNPs, rs964184 demonstrated evidence of replication (p=1.20E-03) in the HAPI Heart Study and in a joint analysis, was GWA significant (p=1.26E-09). Rs964184 has been associated with fasting lipids (TG and HDL) and is near ZPR1 (formerly ZNF259), close to the APOA1/C3/A4/A5 cluster. This association was attenuated upon additional adjustment for fasting TG. Conclusion This is the first report of a genome-wide significant association with replication for a novel phenotype, namely PPL TG response. Future investigation into response phenotypes is warranted using pathway analyses, or newer genetic technologies such as metabolomics. PMID:26256467

  2. Lipid profiles in the untreated patients with Hashimoto thyroiditis and the effects of thyroxine treatment on subclinical hypothyroidism with Hashimoto thyroiditis.

    PubMed

    Tagami, Tetsuya; Tamanaha, Tamiko; Shimazu, Satoko; Honda, Kyoko; Nanba, Kazutaka; Nomura, Hidenari; Yoriko, Sakane Ueda; Usui, Takeshi; Shimatsu, Akira; Naruse, Mitsuhide

    2010-01-01

    To evaluate the prevalence of dyslipidemia in the population of Hashimoto thyroiditis, we reviewed medical records on the consecutive 1181 cases with adult Hashimoto thyroiditis and 830 cases were adopted for the study. First, the serum TSH level increased and serum free T4 level decreased, slightly but significantly, with increasing age. There were significant positive correlations between serum TSH levels and lipid parameters such as total cholesterol (TC), triglyceride (TG), HDL-cholesterol (HDL-C), LDL-cholesterol (LDL-C), non-HDL-C and LDL-C/HDL-C ratio (L/H). In contrast, there were significant negative correlations between serum free T4 levels and all of these lipid parameters. According to the thyroid function, the cases were classified into 4 groups such as thyrotoxicosis (TT), euthyroidism (EU), subclinical hypothyroidism (SH) and overt hypothyroidism (OH). TC, HDL-C, non-HDL-C and LDL-C of TT were significantly lower than those in EU. In contrast, TC, TG, non-HDL-C, LDL-C, L/H and age of OH were significantly higher than those in EU. Interestingly, LDL-C and L/H of SH were significantly higher compared with EU. Thirty-two of SH patients were treated with small doses of levothyroxine and the effects on the lipid profile were examined. The TC, non-HDL-C, LDL-C and L/H were significantly decreased after treatment. In conclusion, the prevalence of dyslipidemia increases along with hypofunction of the thyroid and T4 replacement therapy may improve lipid profile in the cases of SH with Hashimoto thyroiditis.

  3. Enhanced 99 Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui

    Technetium (99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals. Two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 – 1,000 oC. After being cooled, the solid glass specimens prepared at different temperatures were analyzed for Tc oxidation state using Tc K-edge XANES. In most samples, Tc wasmore » partially oxidized from Tc(IV) to Tc(VII) as the melt temperature increased. However, Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were moderately higher than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  4. Utility of the triglyceride level for predicting incident diabetes mellitus according to the fasting status and body mass index category: the Ibaraki Prefectural Health Study.

    PubMed

    Fujihara, Kazuya; Sugawara, Ayumi; Heianza, Yoriko; Sairenchi, Toshimi; Irie, Fujiko; Iso, Hiroyasu; Doi, Mikio; Shimano, Hitoshi; Watanabe, Hiroshi; Sone, Hirohito; Ota, Hitoshi

    2014-01-01

    The levels of lipids, especially triglycerides (TG), and obesity are associated with diabetes mellitus (DM). Although typically measured in fasting individuals, non-fasting lipid measurements play an important role in predicting future DM. This study compared the predictive efficacy of lipid variables according to the fasting status and body mass index (BMI) category. Data were collected for 39,196 nondiabetic men and 87,980 nondiabetic women 40-79years of age who underwent health checkups in Ibaraki-Prefecture, Japan in 1993 and were followed through 2007. The hazard ratios (HRs) for DM in relation to sex, the fasting status and BMI were estimated using a Cox proportional hazards model. A total of 8,867 participants, 4,012 men and 4,855 women, developed DM during a mean follow-up of 5.5 years. TG was found to be an independent predictor of incident DM in both fasting and non-fasting men and non-fasting women. The multivariable-adjusted HR for DM according to the TG quartile (Q) 4 vs. Q1 was 1.18 (95% confidence interval (CI): 1.05, 1.34) in the non-fasting men with a normal BMI (18.5-24.9). This trend was also observed in the non-fasting women with a normal BMI. That is, the multivariable-adjusted HRs for DM for TG Q2, Q3 and Q4 compared with Q1 were 1.07 (95% CI: 0.94, 1.23), 1.17 (95%CI: 1.03, 1.34) and 1.48 (95%CI: 1.30, 1.69), respectively. The fasting and non-fasting TG levels in men and non-fasting TG levels in women are predictive of future DM among those with a normal BMI. Clinicians must pay attention to those individuals at high risk for DM.

  5. Effects of a 3-year dietary intervention on age-related changes in triglyceride and apolipoprotein A-V levels in patients with impaired fasting glucose or new-onset type 2 diabetes as a function of the APOA5 -1131 T > C polymorphism

    PubMed Central

    2014-01-01

    Background The purpose of this study was to estimate the effects of a 3-year dietary intervention on age-related changes in triglyceride and apolipoprotein (apo A-V) levels in patients with impaired fasting glucose (IFG) or new-onset type 2 diabetes as a function of the APOA5 -1131 T > C polymorphism. Methods We genotyped the APOA5 -1131 T > C polymorphism in 203 Korean individuals with IFG or new-onset type 2 diabetes for the TT (n = 91), TC (n = 98), and CC (n = 14) alleles. Plasma apo A-V and triglyceride levels were evaluated at baseline and after a 3-year dietary intervention. Results Our results showed that HDL, glucose, insulin, HOMA-IR index, free fatty acids, and apo A-V decreased and brachial-ankle pulse wave velocity (ba-PWV) and malondialdehyde (MDA) increased at the 3-year follow-up visit compared with baseline. Plasma apo A-V levels were reduced in subjects with the C allele (TC or CC) (P = 0.036) and triglyceride levels were reduced in subjects with the TT allele (P = 0.047). Subjects with the C allele showed lower post-treatment apo A-V and higher post-treatment fasting triglyceride levels than subjects with the TT allele. Changes in apo A-V and triglyceride levels were negatively correlated in subjects with the TT allele and positively correlated in subjects with the C allele. Conclusions This study showed that the dietary intervention prevented an age-related increase in triglyceride levels in individuals with IFG or new-onset type 2 diabetes who possess the TT allele, but not the CT or CC allele, of the APOA5 -1131 T > C polymorphism. PMID:24775272

  6. Effect of obstructive sleep apnea hypopnea syndrome on lipid profile: a meta-regression analysis.

    PubMed

    Nadeem, Rashid; Singh, Mukesh; Nida, Mahwish; Waheed, Irfan; Khan, Adnan; Ahmed, Saeed; Naseem, Jawed; Champeau, Daniel

    2014-05-15

    Obstructive sleep apnea (OSA) is associated with obesity, metabolic syndrome, and dyslipidemia, which may be related to decrease androgen levels found in OSA patients. Dyslipidemia may contribute to atherosclerosis leading to increasing risk of heart disease. Systematic review was conducted using PubMed and Cochrane library by utilizing different combinations of key words; sleep apnea, obstructive sleep apnea, serum lipids, dyslipidemia, cholesterol, total cholesterol, low density lipoprotein (LDL), high density lipoprotein (HDL), and triglyceride (TG). Inclusion criteria were: English articles, and studies with adult population in 2 groups of patients (patients with OSA and without OSA). A total 96 studies were reviewed for inclusion, with 25 studies pooled for analysis. Sixty-four studies were pooled for analysis; since some studies have more than one dataset, there were 107 datasets with 18,116 patients pooled for meta-analysis. All studies measured serum lipids. Total cholesterol pooled standardized difference in means was 0.267 (p = 0.001). LDL cholesterol pooled standardized difference in means was 0.296 (p = 0.001). HDL cholesterol pooled standardized difference in means was -0.433 (p = 0.001). Triglyceride pooled standardized difference in means was 0.603 (p = 0.001). Meta-regression for age, BMI, and AHI showed that age has significant effect for TC, LDL, and HDL. BMI had significant effect for LDL and HDL, while AHI had significant effect for LDL and TG. Patients with OSA appear to have increased dyslipidemia (high total cholesterol, LDL, TG, and low HDL).

  7. Usefulness of the LDL-C/apoB ratio in the overall evaluation of atherogenicity of lipid profile.

    PubMed

    Kaneva, Anastasiya M; Potolitsyna, Natalya N; Bojko, Evgeny R

    2017-02-01

    The ratio of low-density lipoprotein cholesterol to apolipoprotein-B (LDL-C/apoB) conventionally represents an alternative index of LDL particle size. This study was undertaken to determine the importance of LDL-C/apoB ratio in the overall evaluation of atherogenicity of lipid profile. The plasma levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), apolipoprotein (apo) A-I, apoB and apoE were measured in 186 apparently healthy men using enzymatic and immunoturbidimetric methods. The subjects with low values of the LDL-C/apoB ratio, indicating a predominance of small dense LDL (sd-LDL) particles in plasma, were characterized by higher TG levels and lower apoE levels. Low levels of apoE are most likely a cause of reduced clearance of TG-rich lipoproteins, which promotes the formation of sd-LDL. Determination of the LDL-C/apoB ratio can be used for monitoring qualitative changes in lipid profile, in addition to traditional lipid variables indicating quantitative changes.

  8. Blood Pressure Medications: Can They Raise My Triglycerides?

    MedlinePlus

    ... medications: Can they raise my triglycerides? Can some blood pressure medications cause an increase in triglycerides? Answers from Sheldon G. Sheps, M.D. Yes, some blood pressure medications can affect triglyceride and cholesterol levels. Hydrochlorothiazide ...

  9. Apolipoprotein C3 SstI polymorphism and triglyceride levels in Asian Indians

    PubMed Central

    Chhabra, S; Narang, R; Krishnan, LR; Vasisht, S; Agarwal, DP; Srivastava, LM; Manchanda, SC; Das, N

    2002-01-01

    Background A close association between Sst I polymorphism in the 3' untranslated region of the apolipoproteinC3 (APOC3) gene and levels of plasma triglycerides (TG) had been reported by different investigators. Hypertriglyceridemia(HTG) is a known risk factor for coronary artery disease (CAD) in the context of Asian Indians. We conducted a study on the relationship between APOC3 SstI polymorphism (S1S1, S1S2 and S2S2 genotypes) and plasma TG levels in a group of 139 male healthy volunteers from Northern India. Methods DNA samples were analyzed by polymerase chain reaction (PCR) followed by SstI digestion. Digested PCR products were run on 3% agarose gel and visualized by ethidium bromide staining. Results Rare S2 allele was highly prevalent in our study population (0.313) as compared to the Caucasians (0.00–0.11). The genotypic distribution was in agreement with Hardy-Weinberg equilibrium. S2 allele was almost two times more prevalent in the HTG group (N = 34) as compared to NTG group (N = 105) (p = 0.001). Multiple logistic regression revealed S1S2 individuals had age-adjusted odds ratio of 2.43 (95%CI = 0.99–6.01, p = 0.054) and S2S2 had 9.9 (95%CI = 2.66–37.29, p = 0.0006) for developing HTG in comparison to S1S1 genotype. Conclusions Our study shows a significant association between rare S2 allele and HTG in Asian Indians. PMID:12052247

  10. Enhanced 99Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE PAGES

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui; ...

    2017-09-07

    We present that technetium ( 99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Because reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals, two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 and 1000 °C. After being cooled, the solid glass specimens prepared at different temperatures at 600, 800, and 1000 °C were analyzed for Tcmore » oxidation state using Tc K-edge XANES. In most samples, Tc was partially (<60%) oxidized from Tc(IV) to Tc(VII) as the melt temperature increased up to 600 °C. However, most of Tc(IV) was completely (>95%) oxidized to Tc(VII) at temperature above 800 °C. Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were slightly higher (~10%) than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  11. Enhanced 99Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui

    We present that technetium ( 99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Because reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals, two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 and 1000 °C. After being cooled, the solid glass specimens prepared at different temperatures at 600, 800, and 1000 °C were analyzed for Tcmore » oxidation state using Tc K-edge XANES. In most samples, Tc was partially (<60%) oxidized from Tc(IV) to Tc(VII) as the melt temperature increased up to 600 °C. However, most of Tc(IV) was completely (>95%) oxidized to Tc(VII) at temperature above 800 °C. Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were slightly higher (~10%) than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  12. SWIFT: Prospective 48-Week Study to Evaluate Efficacy and Safety of Switching to Emtricitabine/Tenofovir From Lamivudine/Abacavir in Virologically Suppressed HIV-1 Infected Patients on a Boosted Protease Inhibitor Containing Antiretroviral Regimen

    PubMed Central

    Campo, R.; DeJesus, E.; Bredeek, U. F.; Henry, K.; Khanlou, H.; Logue, K.; Brinson, C.; Benson, P.; Dau, L.; Wang, H.; White, K.; Flaherty, J.; Fralich, T.; Guyer, B.; Piontkowsky, D.

    2013-01-01

    Background. In the United States, emtricitabine/tenofovir disoproxil fumarate (FTC/TDF) is a preferred nucleoside reverse transcriptase inhibitor (NRTI) backbone with lamivudine/abacavir (3TC/ABC) as a commonly used alternative. For patients infected with human immunodeficiency virus (HIV-1) virologically suppressed on a boosted protease inhibitor (PI) + 3TC/ABC regimen, the merits of switching to FTC/TDF as the NRTI backbone are unknown. Methods. SWIFT was a prospective, randomized, open-label 48-week study to evaluate efficacy and safety of switching to FTC/TDF. Subjects receiving 3TC/ABC + PI + ritonavir (RTV) with HIV-1 RNA < 200 c/mL ≥3 months were randomized to continue 3TC/ABC or switch to FTC/TDF. The primary endpoint was time to loss of virologic response (TLOVR) with noninferiority measured by delta of 12%. Virologic failure (VF) was defined as confirmed rebound or the last HIV-1 RNA measurement on study drug ≥200 c/mL. Results. In total, 311 subjects were treated in this study (155 to PI + RTV + FTC/TDF, 156 to PI + RTV + 3TC/ABC). Baseline characteristics were similar between the arms: 85% male, 28% black, median age, 46 years; and median CD4 532 cells/mm3. By TLOVR through week 48, switching to FTC/TDF was noninferior compared to continued 3TC/ABC (86.4% vs 83.3%, treatment difference 3.0% (95% confidence interval, −5.1% to 11.2%). Fewer subjects on FTC/TDF experienced VF (3 vs 11; P = .034). FTC/TDF showed greater declines in fasting low-density lipoproteins (LDL), total cholesterol (TC), and triglycerides (TG) with significant declines in LDL and TC beginning at week 12 with no TC/HDL ratio change. Switching to FTC/TDF showed improved NCEP thresholds for TC and TG and improved 10-year Framingham TC calculated scores. Decreased epidermal growth factor receptor (eGFR) was observed in both arms with a larger decrease in the FTC/TDF arm. Conclusions. Switching to FTC/TDF from 3TC/ABC maintained virologic suppression, had fewer VFs, improved

  13. The triglyceride/high-density lipoprotein cholesterol ratio fails to predict insulin resistance in African-American women: an analysis of Jackson Heart Study.

    PubMed

    Sumner, Anne E; Harman, Jane L; Buxbaum, Sarah G; Miller, Bernard V; Tambay, Anita V; Wyatt, Sharon B; Taylor, Herman A; Rotimi, Charles N; Sarpong, Daniel F

    2010-12-01

    Compared to whites, insulin-resistant African Americans have worse outcomes. Screening programs that could identify insulin resistance early enough for intervention to affect outcome often rely on triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C) levels. Racial differences in TG and HDL-C may compromise the efficacy of these programs in African Americans. A recommendation currently exists to use the TG/HDL-C ratio ≥2.0 to predict insulin resistance in African Americans. The validity of this recommendation needs examination. Therefore, our aim was to determine the ability of TG/HDL-C ratio to predict insulin resistance in African Americans. In 1,903 African Americans [895 men, 1,008 women, age 55 ± 12 years, mean ± standard deviation (SD), range 35-80 years, body mass index (BMI) 31.0 ± 6.4 kg/m(2), range 18.5-55 kg/m(2)] participating in the Jackson Heart Study, a population-based study of African Americans, Jackson, Mississippi tricounty region, insulin resistance was defined by the upper quartile (≥4.43) of homeostasis model assessment of insulin resistance (HOMA-IR). An area under the receiver operating characteristic curve (AUC-ROC) of >0.70 was required for prediction of insulin resistance by TG/HDL-C. The optimal test cutoff was determined by the Youden index. HOMA-IR was similar in men and women (3.40 ± 2.03 vs. 3.80 ± 2.46, P = 0.60). Women had lower TG (94 ± 49 vs. 109 ± 65 mg/dL P < 0.001) and TG/HDL-C (1.9 ± 1.4 vs. 2.7 ± 2.1, P < 0.001). For men, AUC-ROC for prediction of insulin resistance by TG/HDL-C was: 0.77 ± 0.01, mean ± standard error (SE), with an optimal cutoff of ≥2.5. For women, the AUC-ROC was 0.66 ± 0.01, rendering an optimal cutoff indefinable. When women were divided in two groups according to age, 35-50 years and 51-80 years, the results did not change. In African-American men, the recommended TG/HDL-C threshold of 2.0 should be adjusted

  14. Effects of berberine and cinnamic acid on palmitic acid-induced intracellular triglyceride accumulation in NIT-1 pancreatic β cells.

    PubMed

    Zhao, Li; Jiang, Shu-Jun; Lu, Fu-Er; Xu, Li-Jun; Zou, Xin; Wang, Kai-Fu; Dong, Hui

    2016-07-01

    To investigate the effects of berberine (BBR) and cinnamic acid (CA), the main active components in Jiaotai Pill (, JTP), on palmitic acid (PA)-induced intracellular triglyceride (TG) accumulation in NIT-1 pancreatic β cells. Cells were incubated in culture medium containing PA (0.25 mmol/L) for 24 h. Then treatments with BBR (10 μmol/L), CA (100 μmol/L) and the combination of BBR and CA (BBR+CA) were performed respectively. Intracellular lipid accumulation was assessed by Oil Red O staining and TG content was measured by colorimetric assay. The expression of adenosine monophosphate-activated protein kinase (AMPK) protein and its downstream lipogenic and fatty acid oxidation genes, including fatty acid synthase (FAS), acetyl-coA carboxylase (ACC), phosphorylation acetyl-coA carboxylase (pACC), carnitine acyl transferase 1 (CPT-1) and sterol regulating element binding protein 1c (SREBP-1c) were determined by Western blot or real time polymerase chain reaction. PA induced an obvious lipid accumulation and a significant increase in intracellular TG content in NIT-1 cells. PA also induced a remarkable decrease in AMPK protein expression and its downstream targets such as pACC and CPT-1. Meanwhile, AMPK downstream lipogenic genes including SREBP-1c mRNA, FAS and ACC protein expressions were increased. Treatments with BBR and BBR+CA, superior to CA, significantly reversed the above genes changes in NIT-1 pancreatic β cells. However, the synergistic effect of BBR and CA on intracellular TG content was not observed in the present study. It can be concluded that in vitro, BBR and BBR+CA could inhibit PA-induced lipid accumulation by decreasing lipogenesis and increasing lipid oxidation in NIT-1 pancreatic β cells.

  15. Semi-physiological model of postprandial triglyceride response in lean, obese and very obese individuals after a high-fat meal.

    PubMed

    Leohr, Jennifer; Heathman, Michael; Kjellsson, Maria C

    2018-03-01

    To quantify the postprandial triglyceride (TG) response of chylomicrons and very-low-density lipoprotein-V6 (VLDL-V6) after a high-fat meal in lean, obese and very obese healthy individuals, using a mechanistic population lipokinetic modelling approach. Healthy individuals from three body mass index population categories: lean (18.5-24.9 kg/m 2 ), obese (30-33 kg/m 2 ), and very obese (34-40 kg/m 2 ) were enrolled in a clinical study to assess the TG response after a high-fat meal, containing 60% fat. Non-linear mixed-effect modelling was used to analyse the TG concentrations of chylomicrons and large VLDL-V6 particles. The TGs in chylomicrons and VLDL-V6 particles had a prominent postprandial peak and represented the majority of the postprandial response; only the VLDL-V6 showed a difference across the populations. A turn-over model successfully described the TG concentration-time profiles of both chylomicrons and large VLDL-V6 particles after the high-fat meal. This model consisted of four compartments: two transit compartments for the lag between meal consumption and appearance of TGs in the blood, and one compartment each for the chylomicrons and large VLDL-V6 particles. The rate constants for the production of chylomicrons and elimination of large VLDL-V6 particles, along with the conversion rate of chylomicrons to large VLDL-V6 particles were well defined. This is the first lipokinetic model to describe the absorption of TGs from dietary fats into the blood stream and compares the dynamics of TGs in chylomicrons and large VLDL-V6 particles among lean, obese and very obese people. Such a model can be used to identify where pharmacological therapies act, thereby improving the determination of efficacy, and identifying complementary mechanisms for combinational drug therapies. © 2017 John Wiley & Sons Ltd.

  16. α-Eleostearic acid-containing triglycerides for a continuous assay to determine lipase sn-1 and sn-3 regio-preference.

    PubMed

    El Alaoui, Meddy; Soulère, Laurent; Noiriel, Alexandre; Queneau, Yves; Abousalham, Abdelkarim

    2017-08-01

    Lipases are essentially described as sn-1 and sn-3 regio-selective. Actually few methods are available to measure this lipase regio-selectivity, moreover they require chiral chromatography analysis or specific derivations which are discontinuous and time consuming. In this study we describe a new, convenient, sensitive and continuous spectrophotometric method to screen lipases regio-selectivity using synthetic triglycerides (TG) containing α-eleostearic acid (9Z, 11E, 13E-octadecatrienoic acid) either at the sn-1 position [1-α-eleostearoyl-2,3-octadecyl-sn-glycerol (sn-EOO)] or at the sn-3 position [1,2-octadecyl-3-α-eleostearoyl-sn-glycerol (sn-OOE)] and coated onto the wells of microtiter plates. A non-hydrolysable ether bond, with a non UV-absorbing alkyl chain, was introduced at the other sn positions to prevent acyl chain migration during TG synthesis or lipolysis. The synthesis of TG containing α-eleostearic acid was performed from S-glycidol in six steps to obtain sn-EOO and in five steps to sn-OOE. The α-eleostearic acid conjugated triene constitutes an intrinsic chromophore and, consequently, confers the strong UV absorption properties of this free fatty acid as well as of the TG harboring it. The lipase activity on coated sn-EOO or sn-OOE was measured by the increase in the absorbance at 272nm due to the transition of α-eleostearic acid from the adsorbed to the soluble state. Human and porcine pancreatic lipases, guinea pig pancreatic lipase related protein 2, Thermomyces lanuginosus lipase, Candida antarctica lipase A and Candida antarctica lipase B were all used to validate the assay. This continuous high-throughput screening method could determine directly without any processes after lipolysis the regio-selectivity of various lipases. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Triglyceride Glucose-Body Mass Index Is a Simple and Clinically Useful Surrogate Marker for Insulin Resistance in Nondiabetic Individuals.

    PubMed

    Er, Leay-Kiaw; Wu, Semon; Chou, Hsin-Hua; Hsu, Lung-An; Teng, Ming-Sheng; Sun, Yu-Chen; Ko, Yu-Lin

    2016-01-01

    Insulin resistance (IR) and the consequences of compensatory hyperinsulinemia are pathogenic factors for a set of metabolic abnormalities, which contribute to the development of diabetes mellitus and cardiovascular diseases. We compared traditional lipid levels and ratios and combined them with fasting plasma glucose (FPG) levels or adiposity status for determining their efficiency as independent risk factors for IR. We enrolled 511 Taiwanese individuals for the analysis. The clinical usefulness of various parameters--such as traditional lipid levels and ratios; visceral adiposity indicators, visceral adiposity index (VAI), and lipid accumulation product (LAP); the product of triglyceride (TG) and FPG (the TyG index); TyG with adiposity status (TyG-body mass index [BMI]) and TyG-waist circumference index [WC]); and adipokine levels and ratios--was analyzed to identify IR. For all lipid ratios, the TG/high-density lipoprotein cholesterol (HDL-C) ratio had the highest additional percentage of variation in the homeostasis model assessment of insulin resistance (HOMA-IR; 7.0% in total); for all variables of interest, TyG-BMI and leptin-adiponectin ratio (LAR) were strongly associated with HOMA-IR, with 16.6% and 23.2% of variability, respectively. A logistic regression analysis revealed similar patterns. A receiver operating characteristic (ROC) curve analysis indicated that TG/HDL-C was a more efficient IR discriminator than other lipid variables or ratios. The area under the ROC curve (AUC) for VAI (0.734) and TyG (0.708) was larger than that for TG/HDL-C (0.707). TyG-BMI and LAR had the largest AUC (0.801 and 0.801, respectively). TyG-BMI is a simple, powerful, and clinically useful surrogate marker for early identification of IR.

  18. Triglyceride Glucose-Body Mass Index Is a Simple and Clinically Useful Surrogate Marker for Insulin Resistance in Nondiabetic Individuals

    PubMed Central

    Er, Leay-Kiaw; Wu, Semon; Chou, Hsin-Hua; Hsu, Lung-An; Teng, Ming-Sheng; Sun, Yu-Chen; Ko, Yu-Lin

    2016-01-01

    Background Insulin resistance (IR) and the consequences of compensatory hyperinsulinemia are pathogenic factors for a set of metabolic abnormalities, which contribute to the development of diabetes mellitus and cardiovascular diseases. We compared traditional lipid levels and ratios and combined them with fasting plasma glucose (FPG) levels or adiposity status for determining their efficiency as independent risk factors for IR. Methods We enrolled 511 Taiwanese individuals for the analysis. The clinical usefulness of various parameters—such as traditional lipid levels and ratios; visceral adiposity indicators, visceral adiposity index (VAI), and lipid accumulation product (LAP); the product of triglyceride (TG) and FPG (the TyG index); TyG with adiposity status (TyG-body mass index [BMI]) and TyG-waist circumference index [WC]); and adipokine levels and ratios—was analyzed to identify IR. Results For all lipid ratios, the TG/high-density lipoprotein cholesterol (HDL-C) ratio had the highest additional percentage of variation in the homeostasis model assessment of insulin resistance (HOMA-IR; 7.0% in total); for all variables of interest, TyG-BMI and leptin-adiponectin ratio (LAR) were strongly associated with HOMA-IR, with 16.6% and 23.2% of variability, respectively. A logistic regression analysis revealed similar patterns. A receiver operating characteristic (ROC) curve analysis indicated that TG/HDL-C was a more efficient IR discriminator than other lipid variables or ratios. The area under the ROC curve (AUC) for VAI (0.734) and TyG (0.708) was larger than that for TG/HDL-C (0.707). TyG-BMI and LAR had the largest AUC (0.801 and 0.801, respectively). Conclusion TyG-BMI is a simple, powerful, and clinically useful surrogate marker for early identification of IR. PMID:26930652

  19. PROPERTY ANALYSIS OF TRIGLYCERIDE-BASED THERMOSETS. (R829576)

    EPA Science Inventory

    Triglycerides with acrylate functionality were prepared from various oils and
    model triglycerides. The triglyceride-acrylates were homopolymerized and copolymerized
    with styrene. The cross-link densities of the resulting polymer networks were
    predicted utilizing the F...

  20. Altered relationship of plasma triglycerides to HDL cholesterol in patients with HIV/HAART-associated dyslipidemia: further evidence for a unique form of metabolic syndrome in HIV patients.

    PubMed

    Vu, Catherine N; Ruiz-Esponda, Raul; Yang, Eric; Chang, Evelyn; Gillard, Baiba; Pownall, Henry J; Hoogeveen, Ron C; Coraza, Ivonne; Balasubramanyam, Ashok

    2013-07-01

    Plasma triglycerides (TG) and HDL-C are inversely related in Metabolic Syndrome (MetS), due to exchange of VLDL-TG for HDL-cholesteryl esters catalyzed by cholesteryl ester transfer protein (CETP). We investigated the relationship of TG to HDL-C in highly-active antiretroviral drug (HAART)-treated HIV patients. Fasting plasma TG and HDL-C levels were compared in 179 hypertriglyceridemic HIV/HAART patients and 71 HIV-negative persons (31 normotriglyceridemic (NL) and 40 hypertriglyceridemic due to type IV hyperlipidemia (HTG)). CETP mass and activity were compared in 19 NL and 87 HIV/HAART subjects. Among the three groups, a plot of HDL-C vs. TG gave similar slopes but significantly different y-intercepts (9.24±0.45, 8.16±0.54, 6.70±0.65, sqrt(HDL-C) for NL, HIV and HTG respectively; P<0.001); this difference persisted after adjusting HDL-C for TG, age, BMI, gender, glucose, CD4 count, viral load and HAART strata (7.18±0.20, 6.20±0.05 and 4.55±0.15 sqrt(HDL-C) for NL, HIV and HTG, respectively, P<0.001). CETP activity was not different between NL and HIV, but CETP mass was significantly higher in HIV (1.47±0.53 compared to 0.93±0.27μg/mL, P<0.0001), hence CETP specific activity was lower in HIV (22.67±13.46 compared to 28.46±8.24nmol/μg/h, P=0.001). Dyslipidemic HIV/HAART patients have a distinctive HDL-C plasma concentration adjusted for TG. The weak inverse relationship between HDL-C and TG is not explained by altered total CETP activity; it could result from a non-CETP-dependent mechanism or a decrease in CETP function due to inhibitors of CETP activity in HIV patients' plasma. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Increased hepatic mitochondrial FA oxidation reduces plasma and liver TG levels and is associated with regulation of UCPs and APOC-III in rats

    PubMed Central

    Lindquist, Carine; Bjørndal, Bodil; Rossmann, Christine Renate; Tusubira, Deusdedit; Svardal, Asbjørn; Røsland, Gro Vatne; Tronstad, Karl Johan; Hallström, Seth; Berge, Rolf Kristian

    2017-01-01

    Hepatic mitochondrial function, APOC-III, and LPL are potential targets for triglyceride (TG)-lowering drugs. After 3 weeks of dietary treatment with the compound 2-(tridec-12-yn-1-ylthio)acetic acid (1-triple TTA), the hepatic mitochondrial FA oxidation increased more than 5-fold in male Wistar rats. Gene expression analysis in liver showed significant downregulation of APOC-III and upregulation of LPL and the VLDL receptor. This led to lower hepatic (53%) and plasma (73%) TG levels. Concomitantly, liver-specific biomarkers related to mitochondrial biogenesis and function (mitochondrial DNA, citrate synthase activity, and cytochrome c and TFAM gene expression) were elevated. Interestingly, 1-triple TTA lowered plasma acetylcarnitine levels, whereas the concentration of β-hydroxybutyrate was increased. The hepatic energy state was reduced in 1-triple TTA-treated rats, as reflected by increased AMP/ATP and decreased ATP/ADP ratios, whereas the energy state remained unchanged in muscle and heart. The 1-triple TTA administration induced gene expression of uncoupling protein (UCP)2 and UCP3 in liver. In conclusion, the 1-triple TTA-mediated clearance of blood TG may result from lowered APOC-III production, increased hepatic LPL gene expression, mitochondrial FA oxidation, and (re)uptake of VLDL facilitating drainage of FAs to the liver for β-oxidation and production of ketone bodies as extrahepatic fuel. The possibility that UCP2 and UCP3 mediate a moderate degree of mitochondrial uncoupling should be considered. PMID:28473603

  2. Adipocyte Triglyceride Turnover Is Independently Associated With Atherogenic Dyslipidemia

    PubMed Central

    Frayn, Keith; Bernard, Samuel; Spalding, Kirsty; Arner, Peter

    2012-01-01

    Background Inappropriate storage of fatty acids as triglycerides in adipocytes and their removal from adipocytes through lipolysis and subsequent oxidation may cause the atherogenic dyslipidemia phenotype of elevated apolipoprotein B levels and subsequent hypertriglyceridemia. We tested whether turnover of triglycerides in fat cells was related to dyslipidemia. Methods and Results The age of triglycerides (reflecting removal) and triglyceride storage in adipocytes was determined under free living conditions by measuring incorporation of atmospheric 14C into these lipids within the adipocytes in 47 women and 26 men with a large interindividual variability in body mass index. Because limited 14C data were available, triglyceride age was also determined in 97 men and 233 women by using an algorithm based on adipocyte lipolysis, body fat content, waist‐to‐hip ratio, and insulin sensitivity. This cohort consisted of nonobese subjects since obesity per se is related to all components in the algorithm. Triglyceride turnover (age and storage) was compared with plasma levels of apolipoproteins and lipids. Plasma levels of apolipoprotein B and triglycerides were positively related to triglyceride age in adipocytes, when measured directly using radiocarbon analyses (r=0.45 to 0.47; P<0.0001). This effect was independent of subject age, waist circumference measures, and insulin sensitivity (partial r=0.29 to 0.45; P from 0.03 to <0.0001). Triglyceride storage showed no independent correlation (partial r=0.02 to 0.11; P=0.42 to 0.91). Algorithm‐based values for adipocyte removal of triglycerides were positively associated with plasma triglycerides and apolipoprotein B (r=0.44 to 0.45; P<0.0001) and (also positively) with the inflammation status of adipose tissue (r=0.39 to 0.47; P<0.05). These correlations were statistically independent of subject age and observed in men and women as well as in lean and overweight subjects when subgroups were examined separately

  3. Efficacy of five-element gymnastics in glucose and lipid control in Taiwanese patients with type 2 diabetes.

    PubMed

    Huang, Chiu-Ling; Tai, Yen-Kuang; Yang, Yi-Hsin; Wang, Ruey-Hsia

    2012-08-01

    The purpose of this quasi-experimental study was to determine the efficacy of Five-Element Gymnastics (FEG) in controlling glycosylated hemoglobin (HbA1C), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG) at the 8th and the 16th weeks of intervention for patients with type 2 diabetes in Taiwan. FEG consolidates several traditional Chinese exercises including Qigong, Xiang Gong, and martial arts with gymnastics. The experimental group (n = 31) practiced FEG at home for 16 weeks. The control group (n = 35) maintained usual activities. FEG was associated with decrease of HbA1C, TG, and LDL-C levels at the 8th week and continuous decrease of HbA1C through the 16th week. FEG could be an exercise choice for patients with type 2 diabetes. Copyright © 2012 Wiley Periodicals, Inc.

  4. Low Birth Weight as a Predictor of Cardiovascular Risk Factors in Childhood and Adolescence? The PEP Family Heart Study

    PubMed Central

    Haas, Gerda-Maria; Liepold, Evelyn; Schwandt, Peter

    2015-01-01

    Background: Low birth weight is considered a risk factor for cardiovascular disease (CVD) in later life. Because data in children and adolescents are sparse and controversial, we assessed the association of birth weight with CVD risk factors in German youths. Methods: We categorized 843 urban children and adolescents aged 3-18 years by quintiles of birth weight and measured nine traditional risk factors in terms of body mass index (BMI), waist circumference (WC), systolic (SBP) and diastolic (DBP) blood pressure, total cholesterol (TC), LDL-C, HDL-C, Non HDL-C and triglycerides (TG). SPSS 21 was used for statistical analysis. Results: Mean values and prevalence of nine anthropometric and lipid risk variables were equally distributed over the five birth weight groups. Though risk factors clustered between 3.0 kg and 4.0 kg of birth weight in both genders we found only one significant correlation of birth weight with TG for males and females and another one for HDL-C in males. The strongest clustering of significant regression coefficients occurred in the 2nd birth weight quintile for SBP (ß 0.018), TC (ß -0.050), LDL-C (ß -0.039), non LDL-C (ß -0.049) and log TG (ß -0.001) in males and females. Conclusions: Overall we did not find significant associations between birth weight and nine traditional cardiovascular risk factors in children and adolescents. However, the 2nd quintile of birth weight might suggest clustering of risk factors. PMID:26900435

  5. The effects of branched-chain amino acid granules on the accumulation of tissue triglycerides and uncoupling proteins in diet-induced obese mice.

    PubMed

    Arakawa, Mie; Masaki, Takayuki; Nishimura, Junko; Seike, Masataka; Yoshimatsu, Hironobu

    2011-01-01

    It has been demonstrated the involvement of branched-chain amino acids (BCAA) on obesity and related metabolic disorder. We investigated the effects of branched-chain amino acids (BCAA) on obesity and on glucose/fat homeostasis in mice fed on a high-fat (45%) diet. BCAA was dissolved in 0.5% methylcellulose and added to the drinking water (BCAA-treated group). A high-fat diet was provided for 6 weeks and BCAA was given for 2 weeks. The BCAA-treated group gained almost 7% less body weight and had less epididymal adipose tissue (WAT) mass than the control group (p<0.05). BCAA supplementation also reduced the hepatic and skeletal muscle triglyceride (TG) concentrations (p<0.05). The hepatic levels of PPAR-alpha and uncoupling protein (UCP) 2, and the level of PPAR-alpha and UCP3 in the skeletal muscle were greater in the BCAA-treated group than in the control mice (p<0.05). These results demonstrate that the liver and muscle TG concentration are less in BCAA-treated group. BCAA affects PPAR-alpha and UCP expression in muscle and liver tissue.

  6. Isotropic cosmological models in F(T,TG) theory

    NASA Astrophysics Data System (ADS)

    Sharif, M.; Nazir, Kanwal

    2016-09-01

    This paper is devoted to study evolution of the isotropic universe models in the framework of F(T,TG) gravity (T represents torsion scalar and TG is the teleparallel equivalent of the Gauss-Bonnet (GB) term). We construct F(T,TG) models by taking different eras of the universe like non-relativistic and relativistic matter eras, dark energy (DE) dominated era and their combinations. It is found that the reconstructed models indicate decreasing behavior for DE dominated era and its combination with other eras. We also discuss stability of each reconstructed model. Finally, we evaluate equation of state (EoS) parameter by considering two models and study its behavior graphically.

  7. CD64-Neutrophil expression and stress metabolic patterns in early sepsis and severe traumatic brain injury in children.

    PubMed

    Fitrolaki, Diana-Michaela; Dimitriou, Helen; Kalmanti, Maria; Briassoulis, George

    2013-03-01

    Critical illness constitutes a serious derangement of metabolism. The aim of our study was to compare acute phase metabolic patterns in children with sepsis (S) or severe sepsis/septic shock (SS) to those with severe traumatic brain injury (TBI) and healthy controls (C) and to evaluate their relations to neutrophil, lymphocyte and monocyte expressions of CD64 and CD11b. Sixty children were enrolled in the study. Forty-five children with systemic inflammatory response syndrome (SIRS) were classified into three groups: TBI (n = 15), S (n = 15), and SS (n = 15). C consisted of 15 non- SIRS patients undergoing screening tests for minor elective surgery. Blood samples were collected within 6 hours after admission for flow cytometry of neutrophil, lymphocyte and monocyte expression of CD64 and CD11b (n = 60). Procalcitonin (PCT), C-reactive protein (CRP), glucose, triglycerides (TG), total cholesterol (TC), high (HDL) or low-density-lipoproteins (LDL) were also determined in all groups, and repeated on day 2 and 3 in the 3 SIRS groups (n = 150). CRP, PCT and TG (p < 0.01) were significantly increased in S and SS compared to TBI and C; glucose did not differ among critically ill groups. Significantly lower were the levels of TC, LDL, and HDL in septic groups compared to C and to moderate changes in TBI (p < 0.0001) but only LDL differed between S and SS (p < 0.02). Among septic patients, PCT levels declined significantly (p < 0.02) with time, followed by parallel decrease of HDL (p < 0.03) and increase of TG (p < 0.02) in the SS group. Neutrophil CD64 (nCD64) expression was higher in patients with SS (81.2%) and S (78.8%) as compared to those with TBI (5.5%) or C (0.9%, p < 0.0001). nCD64 was positively related with CRP, PCT, glucose, and TG (p < 0.01) and negatively with TC, LDL, and HDL (p < 0.0001), but not with severity of illness, hematologic indices, length of stay or mechanical ventilation duration. In sepsis, the early stress-metabolic pattern is characterized by

  8. TG-FTIR analysis on pyrolysis and combustion of marine sediment

    NASA Astrophysics Data System (ADS)

    Oudghiri, Fatiha; Allali, Nabil; Quiroga, José María; Rodríguez-Barroso, María Rocío

    2016-09-01

    In this paper, the pyrolysis and combustion of sediment have been compared using thermogravimetric analysis (TG) coupled with Fourier transform infrared spectrometry (TG-FTIR) analysis. The TG results showed that both the pyrolysis and combustion of sediment presented four weight loss stages, each. The evolving gaseous products during pyrolysis were H2O, CO2 and hydrocarbons, while combustion yielded considerable amounts of CO2, in addition to H2O, CO, Cdbnd C, Cdbnd O and NH3. Comparing the pyrolysis and combustion TG-FTIR curves, it is possible to evaluate the effect of oxygen presence in the temperature range of 200-600 °C, which increases the volatilisation rate of organic matter in sediment. For the better detection of organic and inorganic matter in sediment by TG-FTIR analysis it is recommended to work in combustion mode of sediment.

  9. Evalution on nutritive value of Portunus trituberculatus

    NASA Astrophysics Data System (ADS)

    Su, Xiu-Rong; Li, Tai-Wu; Ding, Ming-Jin; Chien, Paul K.

    1997-06-01

    This study on the nutritive indexes (total nitrogen, amino acids, crude fats, inorganic elements, unsaturated fatty acids) of meat, male and female reproductive gland of Portunus trituberculatus showed that their nutritive value is in the order meat>female reproductive gland>male reproductive gland and that they do not raise the total cholesterol (TC) and triglyceride (TG) contents of the serum of the animals which eat them but increase the contents of high density lipoprotein cholesterol (HDL-C) in the animal's blood. These findings implied that people who have high blood lipid and aortic atheroma can safely use them as food. This study showed that P. trituberculatus has high nutritive value.

  10. Elevated triglycerides may affect cystatin C recovery.

    PubMed

    Witzel, Samantha H; Butts, Katherine; Filler, Guido

    2014-05-01

    The purpose of this study was to investigate the effect of triglyceride concentration on cystatin C (CysC) measurements. Serum samples collected from 10 nephrology patients, 43 to 78years of age, were air centrifuged to separate aqueous and lipid layers. The lipid layer from each patient was pooled together to create a mixture with a high triglyceride concentration. This pooled lipid layer was mixed with each of the ten patient aqueous layers in six different ratios. Single factor ANOVA was used to assess whether CysC recovery was affected by triglyceride levels. Regression analysis was used to develop a formula to correct for the effect of triglycerides on CysC measurement, based on samples from 6 randomly chosen patients from our study population. The formula was validated with the 4 remaining samples. The analysis revealed a significant reduction in measured CysC with increasing concentrations of triglycerides (Pearson r=-0.56, p<0.0001). The following formula was developed to correct for the effect of triglycerides: Subsequent Bland-Altman plots revealed a bias (mean±1 standard deviation [SD]) of -3.7±15.6% for the data used to generate the correction formula and a bias of 3.52±9.38% for the validation set. Our results suggest that triglyceride concentrations significantly impact cystatin C measurements and that this effect may be corrected in samples that cannot be sufficiently clarified by air centrifugation using the equation that we developed. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  11. Accessing Forbidden Glass Regimes through High-Pressure Sub-Tg Annealing

    PubMed Central

    Svenson, Mouritz N.; Mauro, John C.; Rzoska, Sylwester J.; Bockowski, Michal; Smedskjaer, Morten M.

    2017-01-01

    Density and hardness of glasses are known to increase upon both compression at the glass transition temperature (Tg) and ambient pressure sub-Tg annealing. However, a serial combination of the two methods does not result in higher density and hardness, since the effect of compression is countered by subsequent annealing and vice versa. In this study, we circumvent this by introducing a novel treatment protocol that enables the preparation of high-density, high-hardness bulk aluminosilicate glasses. This is done by first compressing a sodium-magnesium aluminosilicate glass at 1 GPa at Tg, followed by sub-Tg annealing in-situ at 1 GPa. Through density, hardness, and heat capacity measurements, we demonstrate that the effects of hot compression and sub-Tg annealing can be combined to access a “forbidden glass” regime that is inaccessible through thermal history or pressure history variation alone. We also study the relaxation behavior of the densified samples during subsequent ambient pressure sub-Tg annealing. Density and hardness are found to relax and approach their ambient condition values upon annealing, but the difference in relaxation time of density and hardness, which is usually observed for hot compressed glasses, vanishes for samples previously subjected to high-pressure sub-Tg annealing. This confirms the unique configurational state of these glasses. PMID:28418017

  12. Hypocholesterolemic effect of emodin by simultaneous determination of in vitro and in vivo bile salts binding.

    PubMed

    Wang, Jiaoying; Ji, Jun; Song, Zijing; Zhang, Wenjun; He, Xin; Li, Fei; Zhang, Chunfeng; Guo, Changrun; Wang, Chongzhi; Yuan, Chunsu

    2016-04-01

    Emodin is an active anthraquinone derivative from Rheum palmatum and some other Chinese herbs and it is traditionally used for treating a variety of diseases. In this study, we investigated the hypocholesterolemic effects and mechanism of emodin on hypercholesterolemia rats. In vitro, capability of emodin binding to sodium deoxycholate which is one kind of bile salts (BAs) was evaluated by detection of surplus content of sodium deoxycholate. In vivo, hypocholesterolemic effects were assessed by determining total cholesterol (TC), triglyceride (TG), low density lipoprotein cholesterol (LDL-C) and high density lipoprotein cholesterol (HDL-C) level of serum and TC, TG level of the liver. Oil red O staining was employed to determine lipid droplet of the liver. The mechanism was explored by BAs in feces, the liver and small intestine. Furthermore, cholesterol 7α-hydroxylase (CYP7A1) activity was measured to evaluate cholesterol's transforming to BAs. The results indicated that TC level of emodin group apparently decreased comparing with model group (p<0.05). Emodin could bind to BAs both in vivo (p<0.05) and in vitro. CYP7A1 activity in emodin group apparently increased comparing with model group (p<0.05). Data suggested that emodin had the potential value for treatment of hypercholesterolemia. The underlying mechanism is probably associated with binding capability to BAs and subsequent increasing expression of CYP7A1. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. JTT-553, a novel Acyl CoA:diacylglycerol acyltransferase (DGAT) 1 inhibitor, improves glucose metabolism in diet-induced obesity and genetic T2DM mice.

    PubMed

    Tomimoto, Daisuke; Okuma, Chihiro; Ishii, Yukihito; Kobayashi, Akio; Ohta, Takeshi; Kakutani, Makoto; Imanaka, Tsuneo; Ogawa, Nobuya

    2015-09-01

    Type 2 diabetes mellitus (T2DM) arises primarily due to lifestyle factors and genetics. A number of lifestyle factors are known to be important in the development of T2DM, including obesity. JTT-553, a novel Acyl CoA:diacylglycerol acyltransferase 1 inhibitor, reduced body weight depending on dietary fat in diet-induced obesity (DIO) rats in our previous study. Here, the effect of JTT-553 on glucose metabolism was evaluated using body weight reduction in T2DM mice. JTT-553 was repeatedly administered to DIO and KK-A(y) mice. JTT-553 reduced body weight gain and fat weight in both mouse models. In DIO mice, JTT-553 decreased insulin, non-esterified fatty acid (NEFA), total cholesterol (TC), and liver triglyceride (TG) plasma concentrations in non-fasting conditions. JTT-553 also improved insulin-dependent glucose uptake in adipose tissues and glucose intolerance in DIO mice. In KK-A(y) mice, JTT-553 decreased glucose, NEFA, TC and liver TG plasma concentrations in non-fasting conditions. JTT-553 also decreased glucose, insulin, and TC plasma concentrations in fasting conditions. In addition, JTT-553 decreased TNF-α mRNA levels and increased GLUT4 mRNA levels in adipose tissues in KK-A(y) mice. These results suggest that JTT-553 improves insulin resistance in adipose tissues and systemic glucose metabolism through reductions in body weight. Copyright © 2015 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

  14. Mendelian randomisation implicates hyperlipidaemia as a risk factor for colorectal cancer.

    PubMed

    Rodriguez-Broadbent, Henry; Law, Philip J; Sud, Amit; Palin, Kimmo; Tuupanen, Sari; Gylfe, Alexandra; Hänninen, Ulrika A; Cajuso, Tatiana; Tanskanen, Tomas; Kondelin, Johanna; Kaasinen, Eevi; Sarin, Antti-Pekka; Ripatti, Samuli; Eriksson, Johan G; Rissanen, Harri; Knekt, Paul; Pukkala, Eero; Jousilahti, Pekka; Salomaa, Veikko; Palotie, Aarno; Renkonen-Sinisalo, Laura; Lepistö, Anna; Böhm, Jan; Mecklin, Jukka-Pekka; Al-Tassan, Nada A; Palles, Claire; Martin, Lynn; Barclay, Ella; Farrington, Susan M; Timofeeva, Maria N; Meyer, Brian F; Wakil, Salma M; Campbell, Harry; Smith, Christopher G; Idziaszczyk, Shelley; Maughan, Timothy S; Kaplan, Richard; Kerr, Rachel; Kerr, David; Passarelli, Michael N; Figueiredo, Jane C; Buchanan, Daniel D; Win, Aung K; Hopper, John L; Jenkins, Mark A; Lindor, Noralane M; Newcomb, Polly A; Gallinger, Steven; Conti, David; Schumacher, Fred; Casey, Graham; Aaltonen, Lauri A; Cheadle, Jeremy P; Tomlinson, Ian P; Dunlop, Malcolm G; Houlston, Richard S

    2017-06-15

    While elevated blood cholesterol has been associated with an increased risk of colorectal cancer (CRC) in observational studies, causality is uncertain. Here we apply a Mendelian randomisation (MR) analysis to examine the potential causal relationship between lipid traits and CRC risk. We used single nucleotide polymorphisms (SNPs) associated with blood levels of total cholesterol (TC), triglyceride (TG), low-density lipoprotein (LDL), and high-density lipoprotein (HDL) as instrumental variables (IV). We calculated MR estimates for each risk factor with CRC using SNP-CRC associations from 9,254 cases and 18,386 controls. Genetically predicted higher TC was associated with an elevated risk of CRC (odds ratios (OR) per unit SD increase = 1.46, 95% confidence interval [CI]: 1.20-1.79, p = 1.68 × 10 -4 ). The pooled ORs for LDL, HDL, and TG were 1.05 (95% CI: 0.92-1.18, p = 0.49), 0.94 (95% CI: 0.84-1.05, p = 0.27), and 0.98 (95% CI: 0.85-1.12, p = 0.75) respectively. A genetic risk score for 3-hydoxy-3-methylglutaryl-coenzyme A reductase (HMGCR) to mimic the effects of statin therapy was associated with a reduced CRC risk (OR = 0.69, 95% CI: 0.49-0.99, p = 0.046). This study supports a causal relationship between higher levels of TC with CRC risk, and a further rationale for implementing public health strategies to reduce the prevalence of hyperlipidaemia. © 2017 UICC.

  15. The Impact of Cardiorespiratory Fitness on Age-Related Lipids and Lipoproteins

    PubMed Central

    Park, Yong-Moon Mark; Sui, Xuemei; Liu, Junxiu; Zhou, Haiming; Kokkinos, Peter F.; Lavie, Carl J.; Hardin, James W.; Blair, Steven N.

    2015-01-01

    Background Evidence on the effect of cardiorespiratory fitness (CRF) on age-related longitudinal changes of lipids and lipoproteins is scarce. Objectives This study sought to assess the longitudinal, aging trajectory of lipids and lipoproteins for the life course in adults, and to determine whether CRF modifies the age-associated trajectory of lipids and lipoproteins. Methods Data came from 11,418 men, 20 to 90 years of age, without known high cholesterol, high triglycerides, cardiovascular disease, and cancer at baseline and during follow-up from the Aerobics Center Longitudinal Study. There were 43,821 observations spanning 2 to 25 (mean 3.5) health examinations between 1970 and 2006. CRF was quantified by a maximal treadmill exercise test. Marginal models using generalized estimating equations were applied. Results Total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG), and non-high-density lipoprotein cholesterol (non-HDL-C) presented similar inverted U-shaped quadratic trajectories with aging: gradual increases were noted until the mid-40s to early 50s, with subsequent declines (all p < 0.0001). Compared to men with higher CRF, those with lower CRF developed abnormal values earlier in life: TC (≥200 mg/dl), LDL-C (≥130 mg/dl), non-HDL-C (≥160 mg/dl), and TG/HDL-C ratio (≥3.0). Notably, abnormal values for TC and LDL-C in men with low CRF were observed around 15 years earlier than in those with high CRF. After adjusting for time-varying covariates, a significant interaction was found between age and CRF in each trajectory, indicating that CRF was more strongly associated with the aging trajectories of lipids and lipoproteins in young to middle-aged men than in older men. Conclusions Our investigation reveals a differential trajectory of lipids and lipoproteins with aging according to CRF in healthy men, and suggests that promoting increased CRF levels may help delay the development of dyslipidemia. PMID:25975472

  16. Polymorphism at the TNF-alpha gene interacts with Mediterranean diet to influence triglyceride metabolism and inflammation status in metabolic syndrome patients: From the CORDIOPREV clinical trial.

    PubMed

    Gomez-Delgado, Francisco; Alcala-Diaz, Juan Francisco; Garcia-Rios, Antonio; Delgado-Lista, Javier; Ortiz-Morales, Ana; Rangel-Zuñiga, Oriol; Tinahones, Francisco Jose; Gonzalez-Guardia, Lorena; Malagon, Maria M; Bellido-Muñoz, Enrique; Ordovas, Jose M; Perez-Jimenez, Francisco; Lopez-Miranda, Jose; Perez-Martinez, Pablo

    2014-07-01

    To examine whether the consumption of a Mediterranean diet (MedDiet), compared with a low-fat diet, interacts with two single nucleotide polymorphisms at the tumor necrosis factor alpha gene (rs1800629, rs1799964) in order to improve triglycerides (TG), glycemic control, and inflammation markers. Genotyping, biochemical measurements, dietary intervention, and oral fat load test meal were determined in 507 metabolic syndrome (MetS) patients selected from all the subjects included in CORDIOPREV clinical trial (n = 1002). At baseline, G/G subjects (n = 408) at the rs1800629 polymorphism, showed higher fasting and postprandial TG (p = 0.003 and p = 0.025, respectively), and high sensitivity C-reactive protein (hsCRP) (p = 0.003) plasma concentrations than carriers of the minor A-allele (G/A + A/A) (n = 99). After 12 months of MedDiet, baseline differences between genotypes disappeared. The decrease in TG and hsCRP was statistically significant in G/G subjects (n = 203) compared with carriers of the minor A-allele (p = 0.005 and p = 0.034, respectively) (n = 48). No other gene-diet interactions were observed in either diet. These results suggest that the rs1800629 at the tumor necrosis factor alpha gene interacts with MedDiet to influence TG metabolism and inflammation status in MetS subjects. Understanding the role of gene-diet interactions may be the best strategy for personalized treatment of MetS. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Ginger extract and aerobic training reduces lipid profile in high-fat fed diet rats.

    PubMed

    Khosravani, M; Azarbayjani, M A; Abolmaesoomi, M; Yusof, A; Zainal Abidin, N; Rahimi, E; Feizolahi, F; Akbari, M; Seyedjalali, S; Dehghan, F

    2016-04-01

    Obesity, hyperglycemia and dyslipidemia, are major risk factors. However, natural therapies, dietary components, and physical activity may effect on these concerns. The aim of this study was to examine the effect of aerobic exercise and consumption of liquid ginger extract on lipid profile of Male rats with a high-fat fed diet. 32 rats were randomly divided into 4 groups: 1) aerobic exercise, 2) Ginger extract, 3) combined aerobic exercise and Ginger extract, and 4) the control. Subjects of the first three groups received ginger extract via gavage feeding of 250 mg/kg. The exercise program was 3 sessions per week on 3 different days over 4 weeks. Total cholesterol (TC), Triglyceride (TG), HDL and LDL were measured 24-h before the first session and 24-h after the final training session. The concentration of TG in the control group was significantly higher than other groups. In addition, the mean concentration of TG in the aerobic exercise group was significantly lower than Ginger extract group but there was no significant difference as compared to combined aerobic exercise and ginger extract group. The combination of aerobic exercise and ginger consumption significantly reduced the TG level compared to ginger group. TC and LDL concentrations were significantly decreased in all groups compare to control. The combination of aerobic exercise and ginger extract feeding caused a significant increase in HDL levels. The finding of this study suggests that the combination of aerobic exercise and liquid ginger extract consumption might be an effective method of reducing lipid profiles, which will reduce the risk of cardiovascular diseases caused by high-fat diets.

  18. UV decreases the synthesis of free fatty acids and triglycerides in the epidermis of human skin in vivo, contributing to development of skin photoaging.

    PubMed

    Kim, Eun Ju; Jin, Xing-Ji; Kim, Yeon Kyung; Oh, In Kyung; Kim, Ji Eun; Park, Chi-Hyun; Chung, Jin Ho

    2010-01-01

    Although fatty acids are known to be important in various skin functions, their roles on photoaging in human skin are poorly understood. We investigated the alteration of lipid metabolism in the epidermis by photoaging and acute UV irradiation in human skin. UV irradiated young volunteers (21-33 years, n=6) and elderly volunteers (70-75 years, n=7) skin samples were obtained by punch biopsy. Then the epidermis was separated from dermis and lipid metabolism was investigated. We observed that the amounts of free fatty acids (FFA) and triglycerides (TG) in the epidermis of photoaged or acutely UV irradiated human skin were significantly decreased. The expressions of genes related to lipid synthesis, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoyl-CoA desaturase (SCD), sterol regulatory element binding proteins (SREBPs), and peroxisome proliferator-activated receptors (PPARgamma) were also markedly decreased. To elucidate the significance of these changes of epidermal lipids in human skin, we investigated the effects of TG or various inhibitors for the enzymes involved in TG synthesis on the expression of matrix metalloproteinase-1 (MMP-1) in cultured human epidermal keratinocytes. We demonstrated that triolein (TG) reduced basal and UV-induced MMP-1 mRNA expression. In addition, each inhibitor for various lipid synthesis enzymes, such as TOFA (ACC inhibitor), cerulenin (FAS inhibitor) and trans-10, cis-12-CLA (SCD inhibitor), increased the MMP-1 expression significantly in a dose-dependent manner. We also demonstrated that triolein could inhibit cerulenin-induced MMP-1 expression. Furthermore, topical application of triolein (10%) significantly prevented UV-induced MMP-13, COX-2, and IL-1beta expression in hairless mice. Our results suggest that TG and FFA may play important roles in photoaging of human skin. Copyright 2009 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  19. Effect of high fluoride and high fat on serum lipid levels and oxidative stress in rabbits.

    PubMed

    Sun, Liyan; Gao, Yanhui; Zhang, Wei; Liu, Hui; Sun, Dianjun

    2014-11-01

    The purpose of this study was to explore the effects of high fluoride and high fat on triglyceride (TG), total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), total antioxidant capacity (T-AOC), lipid peroxide (LPO) and malondialdehyde (MDA) in rabbits. A factorial experimental design was used, with two factors (fluoride and fat) and three levels. Seventy-two male rabbits were randomly assigned into nine groups according to initial weight and serum lipid levels. The rabbits were fed with basic feed, moderate fat feed or high fat feed and drank tap water, fluoridated water at levels of 50 and 100mgfluorion/L freely. Biological materials were collected after 5 months, and serum lipid, T-AOC, LPO, and MDA levels were then measured. Using these data, the separate and interactive effects of high fluoride and high fat were analyzed. High fluoride and high fat both increased serum levels of TC, HDL-C and LDL-C significantly (P<0.05), and there was also a synergistic effect between high fluoride and high fat (P<0.05). High fluoride and high fat had different effects on TG levels: high fat significantly increased TG levels (P<0.01) whereas high fluoride had nothing to do with TG levels (P>0.05). High fat significantly elevated LPO and MDA levels and lowered T-AOC levels in serum (P<0.05). Similarly, high fluoride significantly increased LPO and MDA levels in serum (P<0.05). However, there was no interactive effect between high fat and high fluoride on these indexes. In summary, high fluoride and high fat increased serum TC and LDL-C levels individually and synergistically, and this would cause and aggravate hypercholesterolemia in rabbits. At the same time, high fluoride and high fat both made the accumulation of product of oxidative stress in experimental animals. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

    PubMed

    Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

    2018-01-01

    The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16) and percent truncal body fat (p<2*10-16). Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001). Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations. Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma

  1. [Treatment of combined hyperlipidemia patients by jiangzhi tongluo soft capsule combined atorvastatin calcium tablet: a clinical study].

    PubMed

    Xie, Ying; He, Yu-Bin; Zhang, Shi-Xin; Pan, Ai-Qun; Zhang, Jun; Guan, Xiao-Hong; Wang, Jin-Xue; Guo, Wen-Sheng

    2014-09-01

    To evaluate the efficacy and safety of using Jiangzhi Tongluo Soft Capsule (JTSC) combined with Atorvastatin Calcium Tablet (ACT) or ACT alone in treatment of combined hyperlipidemia. A randomized, double blinded, parallel control, and multi-center clinical research design was adopted. Totally 138 combined hyperlipidemia patients were randomly assigned to the combined treatment group (A) and the atorvastatin treatment group (B) by random digit table, 69 in each group. All patients took ACT 20 mg per day. Patients in the A group took JTSC 100 mg each time, 3 times per day. Those in the B group took JTSC simulated agent, 100 mg each time, 3 times per day. The treatment period for all was 8 weeks. Serum levels of triglyceride (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), and high density lipoprotein cholesterol (HDL-C) were observed before treatment, at week 4 and 8 after treatment; and safety was assessed as well. At week 4 and 8 after treatment serum TG decreased by 26.69% and 33.29% respectively in the A group (both P < 0.01), while it was decreased by 25.7% and 22.98% respectively in the B group (both P < 0.01). At week 8 decreased serum TG was obviously higher in the A group than in the B group (P < 0.05). Compared with before treatment, serum levels of LDL-C and TC levels decreased significantly in the two groups (all P < 0.01). There was no statistical difference in the drop-out value and the drop-out rate of serum LDL-C and TC levels (P > 0.05). At week 8 the serum HDL-C level showed an increasing tendency in the two groups. No obvious increase in peptase or creatase occurred in the two groups after treatment. JTSC combined with ACT could lower the serum TG level of combined hyperlipidemia patients with safety.

  2. Monitoring Tc dynamics in a bioreduced sediment: an investigation with gamma camera imaging of (99m)Tc-pertechnetate and (99m)Tc-DTPA.

    PubMed

    Vandehey, Nicholas T; O'Neil, James P; Slowey, Aaron J; Boutchko, Rostyslav; Druhan, Jennifer L; Moses, William W; Nico, Peter S

    2012-11-20

    We demonstrate the utility of nuclear medical imaging technologies and a readily available radiotracer, [(99m)Tc]TcO(4)(-), for the noninvasive monitoring of Fe(II) production in acetate-stimulated sediments from Old Rifle, CO, USA. Microcosms consisting of sediment in artificial groundwater media amended with acetate were probed by repeated injection of radiotracer over three weeks. Gamma camera imaging was used to noninvasively quantify the rate and extent of [(99m)Tc]TcO(4)(-) partitioning from solution to sediment. Aqueous Fe(II) and sediment-associated Fe(II) were also measured and correlated with the observed tracer behavior. For each injection of tracer, curves of (99m)Tc concentration in solution vs time were fitted to an analytic function that accounts for both the observed rate of sedimentation as well as the rate of (99m)Tc association with the sediment. The rate and extent of (99m)Tc association with the biostimulated sediment correlated well with the production of Fe(II), and a mechanism of [(99m)Tc]TcO(4)(-) reduction via reaction with surface-bound Fe(II) to form an immobile Tc(IV) species was inferred. After three weeks of bioreduction, a subset of microcosms was aerated in order to reoxidize the Fe(II) to Fe(III), which also destroyed the affinity of the [(99m)Tc]TcO(4)(-) for the sediments. However, within 3 days postoxidation, the rate of Tc(VII) reduction was faster than immediately before oxidation implying a rapid return to more extensive bioreduction. Furthermore, aeration soon after a tracer injection showed that sediment-bound Tc(IV) is rapidly resolubilized to Tc(VII). In contrast to the [(99m)Tc]TcO(4)(-), a second commercially available tracer, (99m)Tc-DTPA (diethylenetriaminepentaacetic acid), had minimal association with sediment in both controls and biostimulated sediments. These experiments show the promise of [(99m)Tc]TcO(4)(-) and (99m)Tc-DTPA as noninvasive imaging probes for a redox-sensitive radiotracer and a conservative flow

  3. Thermodynamic description of Tc(iv) solubility and carbonate complexation in alkaline NaHCO3-Na2CO3-NaCl systems.

    PubMed

    Baumann, A; Yalçıntaş, E; Gaona, X; Polly, R; Dardenne, K; Prüßmann, T; Rothe, J; Altmaier, M; Geckeis, H

    2018-03-28

    The solubility of 99 Tc(iv) was investigated in dilute to concentrated carbonate solutions (0.01 M ≤ C tot ≤ 1.0 M, with C tot = [HCO 3 - ] + [CO 3 2- ]) under systematic variation of ionic strength (I = 0.3-5.0 M NaHCO 3 -Na 2 CO 3 -NaCl-NaOH) and pH m (-log[H + ] = 8.5-14.5). Strongly reducing conditions (pe + pH m ≈ 2) were set with Sn(ii). Carbonate enhances the solubility of Tc(iv) in alkaline conditions by up to 3.5 log 10 -units compared to carbonate-free systems. Solvent extraction and XANES confirmed that Tc was kept as +IV during the timeframe of the experiments (≤ 650 days). Solid phase characterization performed by XAFS, XRD, SEM-EDS, chemical analysis and TG-DTA confirmed that TcO 2 ·0.6H 2 O(am) controls the solubility of Tc(iv) under the conditions investigated. Slope analysis of the solubility data in combination with solid/aqueous phase characterization and DFT calculations indicate the predominance of the species Tc(OH) 3 CO 3 - at pH m ≤ 11 and C tot ≥ 0.01 M, for which thermodynamic and activity models are derived. Solubility data obtained above pH m ≈ 11 indicates the formation of previously unreported Tc(iv)-carbonate species, possibly Tc(OH) 4 CO 3 2- , although the likely formation of additional complexes prevents deriving a thermodynamic model valid for this pH m -region. This work provides the most comprehensive thermodynamic dataset available for the system Tc 4+ -Na + -Cl - -OH - -HCO 3 - -CO 3 2- -H 2 O(l) valid under a range of conditions relevant for nuclear waste disposal.

  4. The effect of bacterial sepsis severity on triglyceride value

    NASA Astrophysics Data System (ADS)

    Fahila, R.; Kembaren, T.; Rahimi, A.

    2018-03-01

    Sepsis can increase the amount of triglyceride as well as change the functional and structural components of lipoproteins. The triglyceride level is directly proportional to the severity of sepsis and associated with a systemic inflammatory response. The study aims to determine the correlation between the severity of bacterial sepsis with triglyceride value. An observational study with case control design from January2017 to March 2017 in 30 sepsis and 30 non-sepsis patients at H. Adam Malik General Hospital Medan. We examined Procalcitonin (PCT) and triglyceride level on the 1st, 3rd and 5th day and then analyzed using MannWhitney to assess their correlation.The triglyceride value in the sepsis group was 120 ± 5.1 mg/dl on day 1, non-sepsis 117.53 ± 36.37mg/dl. However, on the fifth day, the sepsis group of triglyceride values was 124.2±50.29mg/dl and the non-sepsis group triglyceride values 134.03±68.12mg/dl. There was no specific connection between the severity of sepsis and triglyceride value in a patient with sepsis.

  5. Managing the residual cardiovascular disease risk associated with HDL-cholesterol and triglycerides in statin-treated patients: a clinical update.

    PubMed

    Reiner, Z

    2013-09-01

    Cardiovascular disease (CVD) is a significant cause of death in Europe. In addition to patients with proven CVD, those with type 2 diabetes (T2D) are at a particularly high-risk of CVD and associated mortality. Treatment for dyslipidaemia, a principal risk factor for CVD, remains a healthcare priority; evidence supports the reduction of low-density lipoprotein cholesterol (LDL-C) as the primary objective of dyslipidaemia management. While statins are the treatment of choice for lowering LDL-C in the majority of patients, including those with T2D, many patients retain a high CVD risk despite achieving the recommended LDL-C targets with statins. This 'residual risk' is mainly due to elevated triglyceride (TG) and low high-density lipoprotein cholesterol (HDL-C) levels. Following statin therapy optimisation additional pharmacotherapy should be considered as part of a multifaceted approach to risk reduction. Fibrates (especially fenofibrate) are the principal agents recommended for add-on therapy to treat elevated TG or low HDL-C levels. Currently, the strongest evidence of benefit is for the addition of fenofibrate to statin treatment in high-risk patients with T2D and dyslipidaemia. An alternative approach is the addition of agents to reduce LDL-C beyond the levels attainable with statin monotherapy. Here, addition of fibrates and niacin to statin therapy is discussed, and novel approaches being developed for HDL-C and TG management, including cholesteryl ester transfer protein inhibitors, Apo A-1 analogues, mipomersen, lomitapide and monoclonal antibodies against PCSK9, are reviewed. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Triglyceride accumulation protects against fatty acid-induced lipotoxicity

    PubMed Central

    Listenberger, Laura L.; Han, Xianlin; Lewis, Sarah E.; Cases, Sylvaine; Farese, Robert V.; Ory, Daniel S.; Schaffer, Jean E.

    2003-01-01

    Excess lipid accumulation in non-adipose tissues is associated with insulin resistance, pancreatic β-cell apoptosis and heart failure. Here, we demonstrate in cultured cells that the relative toxicity of two common dietary long chain fatty acids is related to channeling of these lipids to distinct cellular metabolic fates. Oleic acid supplementation leads to triglyceride accumulation and is well tolerated, whereas excess palmitic acid is poorly incorporated into triglyceride and causes apoptosis. Unsaturated fatty acids rescue palmitate-induced apoptosis by channeling palmitate into triglyceride pools and away from pathways leading to apoptosis. Moreover, in the setting of impaired triglyceride synthesis, oleate induces lipotoxicity. Our findings support a model of cellular lipid metabolism in which unsaturated fatty acids serve a protective function against lipotoxicity though promotion of triglyceride accumulation. PMID:12629214

  7. Postprandial triglyceride-rich lipoproteins promote lipid accumulation and apolipoprotein B-48 receptor transcriptional activity in human circulating and murine bone marrow neutrophils in a fatty acid-dependent manner.

    PubMed

    Ortega-Gómez, Almudena; Varela, Lourdes M; López, Sergio; Montserrat de la Paz, Sergio; Sánchez, Rosario; Muriana, Francisco J G; Bermúdez, Beatriz; Abia, Rocío

    2017-09-01

    Postprandial triglyceride-rich lipoproteins (TRLs) promote atherosclerosis. Recent research points the bone marrow (BM) as a primary site in atherosclerosis. We elucidated how the acute administration of monounsaturated fatty acids (MUFAs) MUFAs, omega-3 polyunsaturated fatty acids (PUFAs) PUFAs and saturated fatty acids (SFAs) affects human circulating and murine BM neutrophil lipid accumulation and functionality. Postprandial hypertriglyceridemia was induced in healthy subjects and Apoe -/- mice by the acute administration of dietary fats enriched in MUFAs, PUFAs, or SFAs. Postprandial hypertriglyceridemia increased apolipoprotein-B48 receptor (ApoB48R) transcriptional activity that was linearly correlated with intracellular triglycerides (TGs) TGs accumulation in human circulating and murine BM neutrophils. MUFA and omega-3 PUFAs attenuated ApoB48R gene expression and intracellular TG accumulation compared to SFAs. TRLs induced apoB48R-dependent TG accumulation in human neutrophils ex vivo. Murine BM neutrophils showed a decrease in surface L-selectin and an increase in TNF-α and IL-1β mRNA expressions only after SFAs administration. TRLs enriched in SFAs induced BM neutrophil degranulation ex vivo suggesting cell priming/activation. Postprandial TRLs disrupts the normal biology and function of circulating and BM neutrophils. MUFA- and omega-3 PUFA-rich dietary fats such as virgin olive oil or fish oil has the potential to prevent excessive neutrophil lipid accumulation and activation by targeting the fatty acid composition of TRLs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Effects of dietary probiotic supplementation on LXRα and CYP7α1 gene expression, liver enzyme activities and fat metabolism in ducks.

    PubMed

    Huang, Z; Mu, C; Chen, Y; Zhu, Z; Chen, C; Lan, L; Xu, Q; Zhao, W; Chen, G

    2015-04-01

    1. The objective of this study was to investigate the effects of dietary probiotic supplementation on liver X receptor alpha (LXRα) and cholesterol 7α-hydroxylase (CYP7α1) mRNA levels, protein enzymatic activities and fat metabolism in Cherry Valley Pekin ducks. 2. A total of 750 one-day-old Cherry Valley Pekin ducks were randomly divided into 5 groups with three replicates of 50 ducks each in a completely randomised experiment. Each group was fed on a basal diet supplemented with 0, 500, 1000, 1500 or 2000 mg probiotics/kg. 3. Body rate and feed conversion ratio were highest and abdominal subcutaneous fat % was lowest at 1000 mg probiotic/kg. 4. The mRNA levels of LXRα and CYP7α1 in liver tissue was estimated by RT-PCR; serum triglyceride (TG) and total cholesterol (TC) concentrations were measured by ELISA. 5. The expression levels and enzyme activity of LXRα and CYP7α1 increased in conjunction with decreases in TG and TC concentrations following probiotic supplementation to a maximum at 1000 mg probiotics/kg and decreased thereafter. 6. It is concluded that dietary probiotics can enhance LXRα and CYP7α1 enzyme activities in the liver and reduce lipid concentrations and fat deposition in ducks.

  9. Protective Effect of Pulp Oil Extracted from Canarium odontophyllum Miq. Fruit on Blood Lipids, Lipid Peroxidation, and Antioxidant Status in Healthy Rabbits

    PubMed Central

    Shakirin, Faridah Hanim; Azlan, Azrina; Ismail, Amin; Amom, Zulkhairi; Cheng Yuon, Lau

    2012-01-01

    The aim of this paper was to compare the effects of pulp and kernel oils of Canarium odontophyllum Miq. (CO) on lipid profile, lipid peroxidation, and oxidative stress of healthy rabbits. The oils are rich in SFAs and MUFAs (mainly palmitic and oleic acids). The pulp oil is rich in polyphenols. Male New Zealand white (NZW) rabbits were fed for 4 weeks on a normal diet containing pulp (NP) or kernel oil (NK) of CO while corn oil was used as control (NC). Total cholesterol (TC), HDL-C, LDL-c and triglycerides (TG) levels were measured in this paper. Antioxidant enzymes (superoxide dismutase and glutathione peroxidise), thiobarbiturate reactive substances (TBARSs), and plasma total antioxidant status (TAS) were also evaluated. Supplementation of CO pulp oil resulted in favorable changes in blood lipid and lipid peroxidation (increased HDL-C, reduced LDL-C, TG, TBARS levels) with enhancement of SOD, GPx, and plasma TAS levels. Meanwhile, supplementation of kernel oil caused lowering of plasma TC and LDL-C as well as enhancement of SOD and TAS levels. These changes showed that oils of CO could be beneficial in improving lipid profile and antioxidant status as when using part of normal diet. The oils can be used as alternative to present vegetable oil. PMID:22685623

  10. Protective effect of pulp oil extracted from Canarium odontophyllum Miq. Fruit on blood lipids, lipid peroxidation, and antioxidant status in healthy rabbits.

    PubMed

    Shakirin, Faridah Hanim; Azlan, Azrina; Ismail, Amin; Amom, Zulkhairi; Yuon, Lau Cheng

    2012-01-01

    The aim of this paper was to compare the effects of pulp and kernel oils of Canarium odontophyllum Miq. (CO) on lipid profile, lipid peroxidation, and oxidative stress of healthy rabbits. The oils are rich in SFAs and MUFAs (mainly palmitic and oleic acids). The pulp oil is rich in polyphenols. Male New Zealand white (NZW) rabbits were fed for 4 weeks on a normal diet containing pulp (NP) or kernel oil (NK) of CO while corn oil was used as control (NC). Total cholesterol (TC), HDL-C, LDL-c and triglycerides (TG) levels were measured in this paper. Antioxidant enzymes (superoxide dismutase and glutathione peroxidise), thiobarbiturate reactive substances (TBARSs), and plasma total antioxidant status (TAS) were also evaluated. Supplementation of CO pulp oil resulted in favorable changes in blood lipid and lipid peroxidation (increased HDL-C, reduced LDL-C, TG, TBARS levels) with enhancement of SOD, GPx, and plasma TAS levels. Meanwhile, supplementation of kernel oil caused lowering of plasma TC and LDL-C as well as enhancement of SOD and TAS levels. These changes showed that oils of CO could be beneficial in improving lipid profile and antioxidant status as when using part of normal diet. The oils can be used as alternative to present vegetable oil.

  11. The Potential Effect of Chinese Herbal Formula Hongqijiangzhi Fang in Improving NAFLD: Focusing on NLRP3 Inflammasome and Gut Microbiota

    PubMed Central

    Liang, Shu; Zhang, Yupei; Deng, Yuanjun; He, Yifang; Liang, Yinji; Liang, Zien; Chen, Yanning; Tang, Kairui; Chen, Runsen

    2018-01-01

    The present study investigates the potential therapeutic mechanism underlying the effects of the Chinese herbal formula Hongqijiangzhi Fang (HJF) on nonalcoholic fatty liver disease (NAFLD) in rats. Male Sprague Dawley (SD) rats were randomly divided into 4 groups (n = 8): control group was fed a normal diet, three other groups were fed high-fat diets (HFD), and the two treatment groups were intragastrically given a compound probiotic or HJF during the molding time. After 16 w, related indices were detected. The results showed that HJF significantly reduced abdominal aorta serum cholesterol (TC), triglyceride (TG), low-density lipoprotein (LDL), IL-1β, and IL-18, portal venous serum lipopolysaccharide (LPS), and liver TC and TG levels in HFD-fed rats. HJF ameliorated hepatic steatosis in the liver and improved the intestinal barrier in HFD-fed rats. Activation of the NLRP3 inflammasome was reduced by HJF in HFD-fed rats. Additionally, the abundances of A. muciniphila (Verrucomicrobiaceae), F. rappini (Helicobacteraceae), and Enterobacteriaceae bacteria significantly decreased in HJF-treated HFD-fed rats. In conclusion, these result suggested that the Chinese herbal formula HJF reduced hepatic steatosis maybe through decreasing certain gut bacteria (such as Enterobacteriaceae bacteria and F. rappini), alleviating intestinal endotoxemia and reducing NLRP3 inflammasome activation. PMID:29675053

  12. High temperature- and high pressure-processed garlic improves lipid profiles in rats fed high cholesterol diets.

    PubMed

    Sohn, Chan Wok; Kim, Hyunae; You, Bo Ram; Kim, Min Jee; Kim, Hyo Jin; Lee, Ji Yeon; Sok, Dai-Eun; Kim, Jin Hee; Lee, Kun Jong; Kim, Mee Ree

    2012-05-01

    Garlic protects against degenerative diseases such as hyperlipidemia and cardiovascular diseases. However, raw garlic has a strong pungency, which is unpleasant. In this study, we examined the effect of high temperature/high pressure-processed garlic on plasma lipid profiles in rats. Sprague-Dawley rats were fed a normal control diet, a high cholesterol (0.5% cholesterol) diet (HCD) only, or a high cholesterol diet supplemented with 0.5% high temperature/high pressure-processed garlic (HCP) or raw garlic (HCR) for 10 weeks. The body weights of the rats fed the garlic-supplemented diets decreased, mostly because of reduced fat pad weights. Plasma levels of total cholesterol (TC), low-density lipoprotein cholesterol, and triglyceride (TG) in the HCP and HCR groups decreased significantly compared with those in the HCD group. Additionally, fecal TC and TG increased significantly in the HCP and HCR groups. It is notable that no significant differences in plasma or fecal lipid profiles were observed between the HCP and HCR groups. High temperature/high pressure-processed garlic contained a higher amount of S-allyl cysteine than raw garlic (P<.05). The results suggest that high temperature/high pressure-processed garlic may be useful as a functional food to improve lipid profiles.

  13. Cardioprotective Effects of Tualang Honey: Amelioration of Cholesterol and Cardiac Enzymes Levels.

    PubMed

    Khalil, Md Ibrahim; Tanvir, E M; Afroz, Rizwana; Sulaiman, Siti Amrah; Gan, Siew Hua

    2015-01-01

    The present study was designed to investigate the cardioprotective effects of Malaysian Tualang honey against isoproterenol- (ISO-) induced myocardial infarction (MI) in rats by investigating changes in the levels of cardiac marker enzymes, cardiac troponin I (cTnI), triglycerides (TG), total cholesterol (TC), lipid peroxidation (LPO) products, and antioxidant defense system combined with histopathological examination. Male albino Wistar rats (n = 40) were pretreated orally with Tualang honey (3 g/kg/day) for 45 days. Subcutaneous injection of ISO (85 mg/kg in saline) for two consecutive days caused a significant increase in serum cardiac marker enzymes (creatine kinase-MB (CK-MB), lactate dehydrogenase (LDH), and aspartate transaminase (AST)), cTnI, serum TC, and TG levels. In addition, ISO-induced myocardial injury was confirmed by a significant increase in heart lipid peroxidation (LPO) products (TBARS) and a significant decrease in antioxidant enzymes (SOD, GPx, GRx, and GST). Pretreatment of ischemic rats with Tualang honey conferred significant protective effects on all of the investigated biochemical parameters. The biochemical findings were further confirmed by histopathological examination in both Tualang-honey-pretreated and ISO-treated hearts. The present study demonstrates that Tualang honey confers cardioprotective effects on ISO-induced oxidative stress by contributing to endogenous antioxidant enzyme activity via inhibition of lipid peroxidation.

  14. High Temperature- and High Pressure-Processed Garlic Improves Lipid Profiles in Rats Fed High Cholesterol Diets

    PubMed Central

    Sohn, Chan Wok; Kim, Hyunae; You, Bo Ram; Kim, Min Jee; Kim, Hyo Jin; Lee, Ji Yeon; Sok, Dai-Eun; Kim, Jin Hee; Lee, Kun Jong

    2012-01-01

    Abstract Garlic protects against degenerative diseases such as hyperlipidemia and cardiovascular diseases. However, raw garlic has a strong pungency, which is unpleasant. In this study, we examined the effect of high temperature/high pressure-processed garlic on plasma lipid profiles in rats. Sprague–Dawley rats were fed a normal control diet, a high cholesterol (0.5% cholesterol) diet (HCD) only, or a high cholesterol diet supplemented with 0.5% high temperature/high pressure-processed garlic (HCP) or raw garlic (HCR) for 10 weeks. The body weights of the rats fed the garlic-supplemented diets decreased, mostly because of reduced fat pad weights. Plasma levels of total cholesterol (TC), low-density lipoprotein cholesterol, and triglyceride (TG) in the HCP and HCR groups decreased significantly compared with those in the HCD group. Additionally, fecal TC and TG increased significantly in the HCP and HCR groups. It is notable that no significant differences in plasma or fecal lipid profiles were observed between the HCP and HCR groups. High temperature/high pressure-processed garlic contained a higher amount of S-allyl cysteine than raw garlic (P<.05). The results suggest that high temperature/high pressure-processed garlic may be useful as a functional food to improve lipid profiles. PMID:22404600

  15. The effects of high-intensity resistance exercise on the blood lipid profile and liver function in hypercholesterolemic hamsters.

    PubMed

    Frajacomo, Fernando Tadeu Trevisan; Demarzo, Marcelo Marcos Piva; Fernandes, Cleverson Rodrigues; Martinello, Flávia; Bachur, José Alexandre; Uyemura, Sérgio Akira; Perez, Sérgio Eduardo de Andrade; Garcia, Sérgio Britto

    2012-06-01

    It is well established that atherogenic dyslipidemia, characterized by high levels of triglycerides (TG), total cholesterol (TC), and low-density lipoprotein (LDL) cholesterol and low levels of high-density lipoprotein (HDL) cholesterol, constitutes important risk factors for cardiovascular disease. Regular exercise has been associated with a reduced risk for metabolic diseases. However, studies supporting the concept that resistance exercise is a modifier of blood lipid parameters are often contradictory. The aim of this study was to investigate the effects of high-intensity resistance exercise on the serum levels of TG, TC, HDL and non-HDL cholesterol, glucose, and the liver function enzymes alanine aminotransferase (ALT, EC 2.6.1.2) and aspartate aminotransferase (AST, EC 2.6.1.1) in golden Syrian hamsters (Mesocricetus auratus (Waterhouse, 1839)) fed a hypercholesterolemic diet. Sedentary groups (S) and exercise groups (E) were fed a standard diet (SS and ES) or a cholesterol-enriched diet (standard plus 1% cholesterol, SC and EC). Resistance exercise was performed by jumps in the water, carrying a load strapped to the chest, representing 10 maximum repetitions (10 RM, 30 s rest, five days per week for five weeks). Mean blood sample comparisons were made by ANOVA + Tukey or ANOVA + Kruskal-Wallis tests (p < 0.05) to compare parametric and nonparametric samples, respectively. There were no differences in blood lipids between the standard diet groups (SS and ES) (p > 0.05). However, the EC group increased the glucose, non-HDL, and TC levels in comparison with the ES group. Moreover, the EC group increased the TG levels versus the SC group (p < 0.05). In addition, the ALT levels were increased only by diet treatment. These findings indicated that high-intensity resistance exercise contributed to dyslipidemia in hamsters fed a hypercholesterolemic diet, whereas liver function enzymes did not differ in regards to the exercise protocol.

  16. The effect of consumption of soy foods on the blood lipid profile of women: a pilot study from Qwa-Qwa.

    PubMed

    Oldewage-Theron, Wilna; Egal, Abdulkadir

    2013-01-01

    The objective of this study was to compare the long-term effect of 40-g daily whole bean soy consumption for a period of 18 mo on blood lipid levels of women. A single-system design was used and 90 women randomly selected in peri-urban Qwa-Qwa, South Africa. Measurements included dietary intake (24-h recall), anthropometric (weight and height) and biochemical lipid parameters with venous blood samples. The respondents were divided into a hypercholesterolemic and normo-cholesterolemic (NC) group and data analyses included descriptive statistics and t-tests on SPSS, version 21.0. The results showed that a large percentage (40%) of the women was hypercholesterolemic. The hypercholesterolemic group showed abnormal mean values for all the lipid parameters at baseline whereas the NC group showed total cholesterol (TC) and LDL-cholesterol (LDL-C) values in the normal range, but abnormally low mean HDL-cholesterol (HDL-C) (0.9±0.6) and high mean triglyceride (TG) (2.3±0.8) levels. At follow-up, the hypercholesterolemic group had significantly improved HDL-C (p=0.000), LDL-C (p=0.032) and TG (p=0.000) levels, but with significantly increased TC (p=0.01). A similar trend was observed in the NC group; however, no significantly improved HDL-C or TG values were observed. It can be concluded that dyslipidemia and obesity were prevalent amongst this group of women. The daily consumption of 40 g of whole soybean, had no significant positive effect on TC, but had a beneficial effect on LDL-C in the women in Qwa-Qwa. The HDL:LDL ratio was also improved in the in the hypercholesterolemic group, thus reducing the risk for CVD. The consumption of whole soybean thus had a beneficial effect on the lipid profile of the women in Qwa-Qwa.

  17. A Genome Wide Association Study Identifies Common Variants Associated with Lipid Levels in the Chinese Population

    PubMed Central

    Wu, Chen; Yang, Handong; Yu, Dianke; Yang, Xiaobo; Zhang, Xiaomin; Wang, Yiqin; Sun, Jielin; Gao, Yong; Tan, Aihua; He, Yunfeng; Zhang, Haiying; Qin, Xue; Zhu, Jingwen; Li, Huaixing; Lin, Xu; Zhu, Jiang; Min, Xinwen; Lang, Mingjian; Li, Dongfeng; Zhai, Kan; Chang, Jiang; Tan, Wen; Yuan, Jing; Chen, Weihong; Wang, Youjie; Wei, Sheng; Miao, Xiaoping; Wang, Feng; Fang, Weimin; Liang, Yuan; Deng, Qifei; Dai, Xiayun; Lin, Dafeng; Huang, Suli; Guo, Huan; Lilly Zheng, S.; Xu, Jianfeng; Lin, Dongxin; Hu, Frank B.; Wu, Tangchun

    2013-01-01

    Plasma lipid levels are important risk factors for cardiovascular disease and are influenced by genetic and environmental factors. Recent genome wide association studies (GWAS) have identified several lipid-associated loci, but these loci have been identified primarily in European populations. In order to identify genetic markers for lipid levels in a Chinese population and analyze the heterogeneity between Europeans and Asians, especially Chinese, we performed a meta-analysis of two genome wide association studies on four common lipid traits including total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL) and high-density lipoprotein cholesterol (HDL) in a Han Chinese population totaling 3,451 healthy subjects. Replication was performed in an additional 8,830 subjects of Han Chinese ethnicity. We replicated eight loci associated with lipid levels previously reported in a European population. The loci genome wide significantly associated with TC were near DOCK7, HMGCR and ABO; those genome wide significantly associated with TG were near APOA1/C3/A4/A5 and LPL; those genome wide significantly associated with LDL were near HMGCR, ABO and TOMM40; and those genome wide significantly associated with HDL were near LPL, LIPC and CETP. In addition, an additive genotype score of eight SNPs representing the eight loci that were found to be associated with lipid levels was associated with higher TC, TG and LDL levels (P = 5.52×10-16, 1.38×10-6 and 5.59×10-9, respectively). These findings suggest the cumulative effects of multiple genetic loci on plasma lipid levels. Comparisons with previous GWAS of lipids highlight heterogeneity in allele frequency and in effect size for some loci between Chinese and European populations. The results from our GWAS provided comprehensive and convincing evidence of the genetic determinants of plasma lipid levels in a Chinese population. PMID:24386095

  18. Protective effect of exercise and alpha tocopherol on atherosclerosis promotion in hypercholesterolemic domestic rabbits

    NASA Astrophysics Data System (ADS)

    Shekh, Mudhir S.; Mahmud, Almas M. R.

    2017-09-01

    This study was designed to determine effects of exercise training (Moderate and severe) and alpha tocopherol on lipid profiles and organ weights in hypercholesterolemic domestic rabbits. Hypercholesterolemia (HC) and atherosclerotic lesions were induced by feeding the male rabbits the standard chow supplemented with 1% cholesterol (atherogenic diet) for 36 days. Experimental rabbits were divided into seven groups: normal (T1), HC control (T2), HC plus alpha tocopherol (0.5mg /animal/day) (T3), HC plus moderate exercise 40 minutes/day (0.5km/day) 5 days/week (T4), HC plus severe exercise 40 minutes/day (1km/day) 5 days/week (T5), HC plus alpha tocopherol plus moderate exercise (T6) and HC plus alpha tocopherol plus severe exercise (T7). After the treatment period of 36th day, blood samples were collected and total cholesterol (TC), Triglyceride (TG), Very low-density lipoprotein (VLDL)-cholesterol, High-density lipoproteins (HDL)-cholesterol, Low-density lipoprotein (LDL)-cholesterol, serum glucose, body and organ weights were assayed and compared with hypercholesterolemic control. Combination of moderate exercise with alpha tocopherol produced significant reduction (P<0.01) in TG and high significant decrement (P<0.001), in VLDL-cholesterol, TC and LDL-cholesterol compared with hypercholesterolemic rabbits. Serum TC, LDL and VLDL (P<0.001) and TG (P<0.01) significantly increased when compared with normal rabbits diet, while, HDL decreased (P<0.05) significantly. Severe exercise group showed no significant change in all lipid profiles. However, the decrement in the above parameters was comparable with hypercholesterolemic rabbits in combination of severe exercise with alpha tocopherol. The results suggest that the combination of moderate exercise with alpha tocopherol can be exploited for prevention of atherosclerosis in hypercholesterolemic rabbits.

  19. Associated liver enzymes with hyperlipidemic profile in type 2 diabetes patients.

    PubMed

    Al-Jameil, Noura; Khan, Farah A; Arjumand, Sadia; Khan, Mohammad F; Tabassum, Hajera

    2014-01-01

    Type 2 diabetes mellitus (T2DM) is characterized by hyperglycemia and is associated with dyslipidemia and disturbed liver function. Aim of the present work is to assess the liver enzymes and to find its association with hyperlipidemic profile in T2DM. Total of 157 subjects were studied and divided into two groups; diabetes (n=81) and non-diabetes (n=76). Various biochemical parameters like fasting glucose, post prandial glucose, HbA1c, total cholesterol (TC), triglycerides (Tg), high density lipoprotein cholesterol (HDL-C), alanine amino transferase (ALT), aspartate amino transferase (AST) and gamma-glutamyl transferase (GGT) were analyzed by ROCHE module Cobas 6000 (C501 & C601) analyzer, kits were procured by ROCHE diagnostics. Low density lipoprotein cholesterol (LDL-C) was estimated by Freidwald's formula. Statistical analysis was performed by applying student t test and Pearson's correlation coefficient, at 0.0001 and 0.05 level of significance, respectively. All the glycemic control parameters, lipid profile parameters except HDL-C and liver enzymes were found increased in diabetes group and significantly differ from non-diabetes group (p>0.0001). ALT showed significant positive correlation with fasting glucose, post prandial glucose, HbA1c, TC, Tg, LDL-C and GGT at p>0.05. AST showed very weak relation with all parameters while GGT was positively associated with fasting glucose, post prandial glucose, HbA1c, TC, Tg, LDL-C and ALT at p>0.05. In conclusion, T2DM incline to elevate liver enzymes, especially ALT and GGT were of significance. Routine screening of ALT and GGT in T2DM patients may assists early detection of liver abnormalities and to arrest the progress of disease.

  20. Hypolipidaemic Effect of Hericium erinaceum Grown in Artemisia capillaris on Obese Rats

    PubMed Central

    Choi, Won-Sik; Kim, Young-Sun; Park, Byeoung-Soo; Kim, Jang-Eok

    2013-01-01

    In this study, ethanolic extracts from Hericium erinaceum cultivated with Artemisia capillaris (HEAC) were assessed for their ability to lower the cholesterol levels of male Sprague-Dawley rats fed a high-fat diet. Rats were randomly subdivided into seven test groups. Each group contained eight rats fed a high-fat diet during a growth period lasting 4 wk. Supplementation with the extracts was performed once a day for 2 wk after the high-fat diet. The control group (rats fed a high-fat diet) showed a high efficiency ratio (feed efficiency ratio) value compared to the normal group. Biochemical parameters, including total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-c), and triglyceride (TG) levels dramatically increased in the control group compared to the normal group. High-density lipoprotein-cholesterol (HDL-c) content in the control group was also significantly lower relative to the normal group. Two positive control groups, treated with simvastatin and atorvastatin, had lowered TC, LDL-c, and TG levels, and increased HDL-c content compared to the control group. Treatment with the tested extracts, including HEAC, ethanolic extracts from Hericium erinaceum, and ethanolic extracts from Artemisia capillaris reduced TC, LDL-c, and TG levels and elevated HDL-c content in the hyperlipidemia rats. The atherogenic index and cardiac risk factor values for the HEAC-treated group were 0.95 and 1.95, respectively. Simvastatin- and atorvastatin-treated groups showed atherogenic index values of 1.56 and 1.69, respectively, and cardiac risk factor values of 2.56 and 2.69, respectively. These results show HEAC possesses an ability to cure hyperlipidemia in rats and may serve as an effective natural medicine for treating hyperlipidemia in humans. PMID:23874132

  1. Fracture Simulation of Highly Crosslinked Polymer Networks: Triglyceride-Based Adhesives

    NASA Astrophysics Data System (ADS)

    Lorenz, Christian; Stevens, Mark; Wool, Richard

    2003-03-01

    The ACRES program at the U. of Delaware has shown that triglyceride oils derived from plants are a favorable alternative to the traditional adhesives. The triglyceride networks are formed from an initial mixture of styrene monomers, free-radical initiators and triglycerides. We have performed simulations to study the effect of physical composition and physical characteristics of the triglyceride network on the strength of triglyceride network. A coarse-grained, bead-spring model of the triglyceride system is used. The average triglyceride consists of 6 beads per chain, the styrenes are represented as a single bead and the initiators are two bead chains. The polymer network is formed using an off-lattice 3D Monte Carlo simulation, in which the initiators activate the styrene and triglyceride reactive sites and then bonds are randomly formed between the styrene and active triglyceride monomers producing a highly crosslinked polymer network. Molecular dynamics simulations of the network under tensile and shear strains were performed to determine the strength as a function of the network composition. The relationship between the network structure and its strength will also be discussed.

  2. 99mTc-EDDA/HYNIC-TOC in the diagnosis of differentiated thyroid carcinoma refractory to radioiodine treatment.

    PubMed

    Czepczyński, Rafał; Gryczyńska, Maria; Ruchała, Marek

    2016-01-01

    In majority of cases of differentiated thyroid carcinoma (DTC), the ablative radioiodine treatment shows high efficacy. In a small number of patients, mechanism of selective iodine uptake by the DTC cells is insufficient and alternative methods of diagnosis and treatment are needed. As demonstrated in vitro, DTC cells show expression of somatostatin recep-tors. Radiolabeled somatostatin analogs are widely used in the diagnosis of neuroendocrine tumors. The aim of the study was to evaluate the utility of peptide receptor scintigraphy with the use of 99mTc-EDDA/HYNIC-TOC in the diagnosis of DTC in patients with elevated thyroglobulin concentrations (Tg), negative WBS and no effect of the consecutive radioiodine therapies. Whole body scintigraphy as well as SPECT of neck and chest were performed 3 and 24 h after i.v. administration of 740 MBq 99mTc-EDDA/HYNIC-TOC. The obtained images were compared with other radionuclide and ra-diological imaging methods. Forty-three patients with DTC after surgery and ablative radioiodine treatment with negative WBS and elevated Tg were qualified. Patients' age: 18-83 years (mean 58.0). SRS showed foci of tracer accumulation in 29 cases (67.4%). Sensitivity was 69.0% specificity 78.6%. SRS correctly identified local recurrence in 8 pts., metastatic lymph nodes in 19 pts., lung metastases in 12 pts. and bone metastases in 5 pts. SRS showed high sensitivity in the detection of metastatic lymph nodes (100%) and bone metastases (83.3%) and lung metastases (63.2%). Positive SRS was found in pts. with higher Tg concentrations (130 ± 144 vs. 30 ± 54 ng/ml). Scintigraphy with the use of the studied technetium-99m-labeled somatostatin analog is useful in the evaluation of patients with advanced DTC. It shows relatively good sensitivity and specificity but not high enough to be recommended as a routine imaging method. The role of somatostatin receptor scintigraphy in DTC is complementary to other imaging modalities.

  3. Altered [99mTc]Tc-MDP biodistribution from neutron activation sourced 99Mo.

    PubMed

    Demeter, Sandor; Szweda, Roman; Patterson, Judy; Grigoryan, Marine

    2018-01-01

    Given potential worldwide shortages of fission sourced 99 Mo/ 99m Tc medical isotopes there is increasing interest in alternate production strategies. A neutron activated 99 Mo source was utilized in a single center phase III open label study comparing 99m Tc, as 99m Tc Methylene Diphosphonate ([ 99m Tc]Tc-MDP), obtained from solvent generator separation of neutron activation produced 99 Mo, versus nuclear reactor produced 99 Mo (e.g., fission sourced) in oncology patients for which an [ 99m Tc]Tc-MDP bone scan would normally have been indicated. Despite the investigational [ 99m Tc]Tc-MDP passing all standard, and above standard of care, quality assurance tests, which would normally be sufficient to allow human administration, there was altered biodistribution which could lead to erroneous clinical interpretation. The cause of the altered biodistribution remains unknown and requires further research.

  4. Fasting and nonfasting triglycerides in cardiovascular and other diseases.

    PubMed

    Piťha, J; Kovář, J; Blahová, T

    2015-01-01

    Moderately elevated plasma/serum triglycerides (2-10 mmol/l) signalize increased risk for cardiovascular disease or presence of non-alcoholic steatohepatitis. Extremely elevated triglycerides (more than 10 mmol/l) signalize increased risk for pancreatitis and lipemia retinalis. The concentration of triglycerides is regulated by many genetic and nongenetic factors. Extremely elevated triglycerides not provoked by nutritional factors, especially inappropriate alcohol intake are more likely to have a monogenic cause. On the contrary, mildly to moderately elevated triglycerides are often caused by polygenic disorders; these could be also associated with central obesity, insulin resistance, and diabetes mellitus. Concentration of triglycerides is also closely interconnected with presence of atherogenic remnant lipoproteins, impaired reverse cholesterol transport and more atherogenic small LDL particles. In general, there is tight association between triglycerides and many other metabolic factors including intermediate products of lipoprotein metabolism which are frequently atherogenic. Therefore, reliable evaluation of the independent role of triglycerides especially in atherosclerosis and cardiovascular disease is difficult. In individual cases values of HDL cholesterol, non-HDL cholesterol (total minus HDL cholesterol), non-HDL/nonLDL cholesterol (total minus HDL minus LDL cholesterol, especially in nonfasting status), atherogenic index of plasma and/or apolipoprotein B could help in decisions regarding aggressiveness of treatment.

  5. The effect of age, gender, TG/HDL-C ratio and behavioral lifestyles on the metabolic syndrome in the high risk Mediterranean Island population of Malta.

    PubMed

    Cuschieri, Sarah; Vassallo, Josanne; Calleja, Neville; Pace, Nikolai; Mamo, Julian

    2017-11-01

    Metabolic syndrome (MetS) is a public health epidemic, typically with female predominance. The aim was to analyse the effect of gender and age on MetS and its components; analyse effects of lifestyle, diabetes mellitus and identify predictors for MetS including TG/HDL ratio, on a national level in a Mediterranean island. Findings will provide evidence-based data for neighboring countries to aid in combat of this epidemic. A cross-sectional survey was conducted in Malta (2014-2016) on a randomized adults population sample. Various components of MetS were measured along with lifestyle habits (smoking, alcohol and physical activity) and family history (cardiovascular and diabetes). Both descriptive and statistical analyses were performed. A total of 80,788 Maltese adults estimated to suffer from MetS. Males were predominantly affected with significant difference from females. All MetS components were found to be significant predictors along with alcohol habits but not smoking. Neither physical inactivity nor family history of cardiovascular disease, showed any predictive ability for MetS even after adjustment. Elevated triglyceride levels exhibited highest predictive effect on MetS. TG/HDL ratio showed predictive ability in the Maltese population. Males were at higher risk for MetS in Malta. A number of predictors were established but not sedentary lifestyle. TG/HDL ratio may provide to be a good indicator for development of MetS. Copyright © 2017 Diabetes India. Published by Elsevier Ltd. All rights reserved.

  6. Synergetic cholesterol-lowering effects of main alkaloids from Rhizoma Coptidis in HepG2 cells and hypercholesterolemia hamsters.

    PubMed

    Kou, Shuming; Han, Bing; Wang, Yue; Huang, Tao; He, Kai; Han, Yulong; Zhou, Xia; Ye, Xiaoli; Li, Xuegang

    2016-04-15

    Hyperlipidemia contributes to the progression of cardiovascular diseases. Main alkaloids from Rhizoma Coptidis including berberine (BBR), coptisine (COP), palmatine (PAL), epiberberine (EPI) and jatrorrhizine (JAT), improved dyslipidemia in hypercholesterolemic hamsters to a different degree. In this study, HepG2 cells and hypercholesterolemic hamsters were used to investigate the synergetic cholesterol-lowering efficacy of these five main alkaloids. The cellular lipid and cholesterol accumulation and in HepG2 cells were evaluated by Oil Red O staining and HPLC analysis. LDL receptor, 3-Hydroxy-3-methylglutaryl CoA reductase (HMGCR) and cholesterol 7-alpha-hydroxylase (CYP7A1) that involving cholesterol metabolism in HepG2 cells were measured by qRT-PCR, western blot and immunofluorescence analysis. The serum profiles including total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-c) and high-density lipoprotein cholesterol (HDL-c), as well as TC and total bile acids (TBA) of feces in hypercholesterolemic hamsters were also measured. As compared to single alkaloids, the combination of five main alkaloids (COM) reduced the lipid and cholesterol accumulation in HepG2 cells more effectively and performed an advantageous effect on controlling TC, TG, LDL-c and HDL-c in hypercholesterolemic hamsters. More effective reduction of TBA and TC levels in feces of hamsters were achieved after the administration of COM. These effects were derived from the up-regulation of LDL receptor and CYP7A1, as well as HMGCR downregulation. Our results demonstrated that COM showed a synergetic cholesterol-lowering efficacy, which was better than single alkaloids and it might be considered as a potential therapy for hypercholesterolemia. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Performance of TcI/TcVI/TcII Chagas-Flow ATE-IgG2a for universal and genotype-specific serodiagnosis of Trypanosoma cruzi infection

    PubMed Central

    Alessio, Glaucia Diniz; de Araújo, Fernanda Fortes; Côrtes, Denise Fonseca; Sales Júnior, Policarpo Ademar; Lima, Daniela Cristina; Gomes, Matheus de Souza; do Amaral, Laurence Rodrigues; Xavier, Marcelo Antônio Pascoal; Teixeira-Carvalho, Andréa; Martins-Filho, Olindo Assis; de Lana, Marta

    2017-01-01

    Distinct Trypanosoma cruzi genotypes have been considered relevant for patient management and therapeutic response of Chagas disease. However, typing strategies for genotype-specific serodiagnosis of Chagas disease are still unavailable and requires standardization for practical application. In this study, an innovative TcI/TcVI/TcII Chagas Flow ATE-IgG2a technique was developed with applicability for universal and genotype-specific diagnosis of T. cruzi infection. For this purpose, the reactivity of serum samples (percentage of positive fluorescent parasites-PPFP) obtained from mice chronically infected with TcI/Colombiana, TcVI/CL or TcII/Y strain as well as non-infected controls were determined using amastigote-AMA, trypomastigote-TRYPO and epimastigote-EPI in parallel batches of TcI, TcVI and TcII target antigens. Data demonstrated that “α-TcII-TRYPO/1:500, cut-off/PPFP = 20%” presented an excellent performance for universal diagnosis of T. cruzi infection (AUC = 1.0, Se and Sp = 100%). The combined set of attributes “α-TcI-TRYPO/1:4,000, cut-off/PPFP = 50%”, “α-TcII-AMA/1:1,000, cut-off/PPFP = 40%” and “α-TcVI-EPI/1:1,000, cut-off/PPFP = 45%” showed good performance to segregate infections with TcI/Colombiana, TcVI/CL or TcII/Y strain. Overall, hosts infected with TcI/Colombiana and TcII/Y strains displayed opposite patterns of reactivity with “α-TcI TRYPO” and “α-TcII AMA”. Hosts infected with TcVI/CL strain showed a typical interweaved distribution pattern. The method presented a good performance for genotype-specific diagnosis, with global accuracy of 69% when the population/prototype scenario include TcI, TcVI and TcII infections and 94% when comprise only TcI and TcII infections. This study also proposes a receiver operating reactivity panel, providing a feasible tool to classify serum samples from hosts infected with distinct T. cruzi genotypes, supporting the potential of this method for universal and genotype

  8. Genetics of Triglycerides and the Risk of Atherosclerosis.

    PubMed

    Dron, Jacqueline S; Hegele, Robert A

    2017-07-01

    Plasma triglycerides are routinely measured with a lipid profile, and elevated plasma triglycerides are commonly encountered in the clinic. The confounded nature of this trait, which is correlated with numerous other metabolic perturbations, including depressed high-density lipoprotein cholesterol (HDL-C), has thwarted efforts to directly implicate triglycerides as causal in atherogenesis. Human genetic approaches involving large-scale populations and high-throughput genomic assessment under a Mendelian randomization framework have undertaken to sort out questions of causality. We review recent large-scale meta-analyses of cohorts and population-based sequencing studies designed to address whether common and rare variants in genes whose products are determinants of plasma triglycerides are also associated with clinical cardiovascular endpoints. The studied loci include genes encoding lipoprotein lipase and proteins that interact with it, such as apolipoprotein (apo) A-V, apo C-III and angiopoietin-like proteins 3 and 4, and common polymorphisms identified in genome-wide association studies. Triglyceride-raising variant alleles of these genes showed generally strong associations with clinical cardiovascular endpoints. However, in most cases, a second lipid disturbance-usually depressed HDL-C-was concurrently associated. While the findings collectively shift our understanding towards a potential causal role for triglycerides, we still cannot rule out the possibilities that triglycerides are a component of a joint phenotype with low HDL-C or that they are but markers of deeper causal metabolic disturbances that are not routinely measured in epidemiological-scale genetic studies.

  9. The independent relationship between triglycerides and coronary heart disease.

    PubMed

    Morrison, Alan; Hokanson, John E

    2009-01-01

    The aim was to review epidemiologic studies to reassess whether serum levels of triglycerides should be considered independently of high-density lipoprotein-cholesterol (HDL-C) as a predictor of coronary heart disease (CHD). We systematically reviewed population-based cohort studies in which baseline serum levels of triglycerides and HDL-C were included as explanatory variables in multivariate analyses with the development of CHD (coronary events or coronary death) as dependent variable. A total of 32 unique reports describing 38 cohorts were included. The independent association between elevated triglycerides and risk of CHD was statistically significant in 16 of 30 populations without pre-existing CHD. Among populations with diabetes mellitus or pre-existing CHD, or the elderly, triglycerides were not significantly independently associated with CHD in any of 8 cohorts. Triglycerides and HDL-C were mutually exclusive predictors of coronary events in 12 of 20 analyses of patients without pre-existing CHD. Epidemiologic studies provide evidence of an association between triglycerides and the development of primary CHD independently of HDL-C. Evidence of an inverse relationship between triglycerides and HDL-C suggests that both should be considered in CHD risk estimation and as targets for intervention.

  10. Comparison of non-HDL-cholesterol versus triglycerides-to-HDL-cholesterol ratio in relation to cardiometabolic risk factors and preclinical organ damage in overweight/obese children: the CARITALY study.

    PubMed

    Di Bonito, P; Valerio, G; Grugni, G; Licenziati, M R; Maffeis, C; Manco, M; Miraglia del Giudice, E; Pacifico, L; Pellegrin, M C; Tomat, M; Baroni, M G

    2015-05-01

    Lipid ratios to estimate atherosclerotic disease risk in overweight/obese children are receiving great attention. We aimed to compare the performance of non-high-density lipoprotein-cholesterol (HDL-C) versus triglycerides-to-HDL-C ratio (Tg/HDL-C) in identifying cardiometabolic risk factors (CMRFs) or preclinical signs of organ damage in outpatient Italian overweight/obese children. In this retrospective, cross-sectional study, 5505 children (age 5-18 years) were recruited from 10 Italian centers for the care of obesity, of which 4417 (78%) showed obesity or morbid obesity. Anthropometric, biochemical, and blood pressure variables were analyzed in all children. Liver ultrasound scan, carotid artery ultrasound, and echocardiography were performed in 1257, 601, and 252 children, respectively. The entire cohort was divided based on the 75th percentile of non-HDL-C (≥130 mg/dl) or Tg/HDL-C ratio (≥2.2). The odds ratio for insulin resistance, high blood pressure, metabolic syndrome, presence of liver steatosis, increased levels of carotid intima-media thickness (cIMT) and concentric left ventricular hypertrophy (cLVH) was higher in children with high levels of Tg/HDL-C with respect to children with high levels of non-HDL-C. In an outpatient setting of overweight/obese children, Tg/HDL-C ratio discriminated better than non-HDL-C children with CMRFs or preclinical signs of liver steatosis, and increased cIMT and cLVH. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Temperature Control in Radiatively Cooled Plasmas through Autoresonant Drive of TG-waves

    NASA Astrophysics Data System (ADS)

    Kabantsev, A. A.; Driscoll, C. F.

    2013-10-01

    We demonstrate accurate temperature control of pure electron plasmas, using driven wave heating ``autoresonantly'' in balance with cyclotron cooling. The mθ = 0 Trivelpiece-Gould wave frequencies are temperature-dependent, asfTG (T) =fTG (0) * [ 1 + ɛT ] ; and they exhibit a narrow Lorentzian absorption response R (f) with width γ ~10-3fTG . A continuous drive amplitude Adr then produces plasma heating power Ph ~Adr2 R (fdr) , which can exactly balance the cyclotron cooling powerPc ~ T /τc . This balance point is autoresonantly stable when fdr ~fTG (T) - γ : if T increases, then fTG (T) also increases and fdr gets further from resonance, so the heating power decreases and T decreases back to the balance point. (The second power-balance point at fdr ~fTG (T) + γ is unstable.) In practice, we use a mz = 3 TG wave having frequency range 5 . 2 TG < 6 . 2MHz at temperatures 0 . 03 < T < 3 .eV . The plasma temperature can be either ``pegged'' at a desired value; or varied cyclically, with rates limited by τc ~ 2 sec and by chosen drive amplitude. Simultaneously monitoring the mz = 1 TG frequency can serve as a verification of the autoresonant ``lock''. This ``at will'' control of T may be experimentally useful, especially for temperature sensitive processes like recombination, charge exchange and electron impact detachment in e +H- plasmas. Supported by NSF PHY-0903877 and DE-SC0002451.

  12. General Electric TG-180 Turbojet in the Altitude Wind Tunnel

    NASA Image and Video Library

    1947-09-21

    A General Electric TG-180 turbojet installed in the Altitude Wind Tunnel at the National Advisory Committee for Aeronautics (NACA) Lewis Flight Propulsion Laboratory. In 1943 the military asked General Electric to develop an axial-flow jet engine which became the TG-180. The military understood that the TG-180 would not be ready during World War II but recognized the axial-flow compressor’s long-term potential. Although the engine was bench tested in April 1944, it was not flight tested until February 1946. The TG-180 was brought to the Altitude Wind Tunnel in 1945 for a series of investigations. The studies, which continued intermittently into 1948, analyzed an array of performance issues. NACA modifications steadily improved the TG-180’s performance, including the first successful use of an afterburner. The Lewis researchers studied a 29-inch diameter afterburner over a range of altitude conditions using several different types of flameholders and fuel systems. Lewis researchers concluded that a three-stage flameholder with its largest stage upstream was the best burner configuration. Although the TG-180 (also known as the J35) was not the breakthrough engine that the military had hoped for, it did power the Douglas D-558-I Skystreak to a world speed record on August 20, 1947. The engines were also used on the Republic F-84 Thunderjet and the Northrup F-89 Scorpion.

  13. Study of galactic halo F(T,TG) wormhole solutions

    NASA Astrophysics Data System (ADS)

    Sharif, M.; Nazir, Kanwal

    In this paper, we investigate static spherically symmetric wormhole solutions with galactic halo region in the background of F(T,TG) gravity. Here, T represents torsion scalar and TG is teleparallel equivalent Gauss-Bonnet term. For this purpose, we consider a diagonal tetrad and two specific F(T,TG) models. We analyze the wormhole structure through shape function graphically for both models. We also investigate the behavior of null/weak energy conditions. Finally, we evaluate the equilibrium condition to check stability of the wormhole solutions. It is concluded that there exists physically viable wormhole solution only for the first model that turns out to be stable.

  14. Stereo electroencephalography-guided radiofrequency thermocoagulation (SEEG-guided RF-TC) in drug-resistant focal epilepsy: Results from a 10-year experience.

    PubMed

    Bourdillon, Pierre; Isnard, Jean; Catenoix, Hélène; Montavont, Alexandra; Rheims, Sylvain; Ryvlin, Philippe; Ostrowsky-Coste, Karine; Mauguiere, François; Guénot, Marc

    2017-01-01

    Stereo electroencephalography (SEEG)-guided radiofrequency thermocoagulation (SEEG-guided RF-TC) has been proposed since 2004 as a possible treatment of some focal drug-resistant epilepsy. The aim of this study is to provide extensive data about efficacy and safety of SEEG-guided RF-TC. Over a 10-year period, 162 patients with drug-resistant focal epilepsy were eligible for SEEG-guided RF-TG during phase II invasive investigation by SEEG. All follow-up and safety data were collected prospectively. The primary outcome was seizure freedom at 2 months and at 1 year after SEEG-guided RF-TC. Secondary outcomes were the responders' rate (patient with at least 50% decrease in seizure frequency) and their long-term follow-up. Twenty-five percent of patients were seizure-free at 2 months and 7% at 1 year. We reported 67% of responders at 2 months and 48% at 1 year; 58% of responders maintained their status during the long-term follow-up. The seizure outcome was significantly better when the SEEG-guided RF-TC involved the occipital region (p = 0.007). When surgery followed an SEEG-guided RF-TC, the positive predictive value of being a responder 2 months after an SEEG-guided RF-TC and to be Engel's class I or II after surgery was 93%. We reported 1.1% of permanent deficit and 2.4% of transient side effects. Our results, gathered in a large population over a 10-year period, confirm that SEEG-guided RF-TC is a safe technique, being efficient in many cases. More than two thirds of patients showed a short-term improvement, and almost half of them were responders at 1-year follow-up. The technique appears to be especially interesting for limited epileptic zone inaccessible to surgery and when epilepsy is related to a large unilateral network (network disruption by multiple RF-TC). Furthermore, SEEG-guided RF-TC effect is a predictor of outcome after conventional cortectomy in patients eligible for surgery. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  15. Triglyceride-glucose index (TyG index) in comparison with fasting plasma glucose improved diabetes prediction in patients with normal fasting glucose: The Vascular-Metabolic CUN cohort.

    PubMed

    Navarro-González, David; Sánchez-Íñigo, Laura; Pastrana-Delgado, Juan; Fernández-Montero, Alejandro; Martinez, J Alfredo

    2016-05-01

    We evaluated the potential role of the triglyceride-glucose index (TyG index) as a predictor of diabetes in a White European cohort, and compared it to fasting plasma glucose (FPG) and triglycerides. 4820 patients of the Vascular-Metabolic CUN cohort (VMCUN cohort) were examined and followed up for 8.84years (±4.39). We performed a Cox proportional hazard ratio with repeated-measures analyses to assess the risk of developing type 2 diabetes across quartiles of FPG, triglycerides and the TyG index (ln[fasting triglycerides (mg/dl)×fasting plasma glucose (mg/dl)/2]), and plotted a receiver operating characteristics (ROC) curve for discrimination. There were 332 incident cases of type 2 diabetes involving 43,197.32person-years of follow-up. We observed a progressively increased risk of diabetes in subjects with TyG index levels of 8.31 or more. Among those with normal fasting glucose at baseline, <100mg/dl, subjects with the TyG index in the fourth quartile were 6.87 times more likely to develop diabetes (95% CI, 2.76-16.85; P for trend<0.001), as compared with the bottom quartile. The areas under the ROC curves (95% CI) were 0.75 (0.70-0.81) for TyG index, 0.66 (0.60-0.72) for FPG and 0.71 (0.65-0.77) for TG, in subjects with normal fasting glucose (p=0.017). Our data suggest that the TyG index is useful for the early identification of individuals at risk of type 2 diabetes. The TyG index seems to be a better predictor than FPG or triglycerides of the potential development of type 2 diabetes in normoglycemic patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. TM6SF2 is a regulator of liver fat metabolism influencing triglyceride secretion and hepatic lipid droplet content

    PubMed Central

    Mahdessian, Hovsep; Taxiarchis, Apostolos; Popov, Sergej; Silveira, Angela; Franco-Cereceda, Anders; Hamsten, Anders; Eriksson, Per; van't Hooft, Ferdinand

    2014-01-01

    Genome-wide association studies have identified a locus on chromosome 19 associated with plasma triglyceride (TG) concentration and nonalcoholic fatty liver disease. However, the identity and functional role of the gene(s) responsible for these associations remain unknown. Of 19 expressed genes contained in this locus, none has previously been implicated in lipid metabolism. We performed gene expression studies and expression quantitative trait locus analysis in 206 human liver samples to identify the putative causal gene. Transmembrane 6 superfamily member 2 (TM6SF2), a gene with hitherto unknown function, expressed predominantly in liver and intestine, was identified as the putative causal gene. TM6SF2 encodes a protein of 351 amino acids with 7–10 predicted transmembrane domains. Otherwise, no other protein features were identified which could help to elucidate the function of TM6SF2. Protein subcellular localization studies with confocal microscopy demonstrated that TM6SF2 is localized in the endoplasmic reticulum and the ER-Golgi intermediate compartment of human liver cells. Functional studies for secretion of TG-rich lipoproteins (TRLs) and lipid droplet content were performed in human hepatoma Huh7 and HepG2 cells using confocal microscopy and siRNA inhibition and overexpression techniques. In agreement with the genome-wide association data, it was found that TM6SF2 siRNA inhibition was associated with reduced secretion of TRLs and increased cellular TG concentration and lipid droplet content, whereas TM6SF2 overexpression reduced liver cell steatosis. We conclude that TM6SF2 is a regulator of liver fat metabolism with opposing effects on the secretion of TRLs and hepatic lipid droplet content. PMID:24927523

  17. Usefulness of non-fasting lipid parameters in children.

    PubMed

    Kubo, Toshihide; Takahashi, Kyohei; Furujo, Mahoko; Hyodo, Yuki; Tsuchiya, Hiroki; Hattori, Mariko; Fujinaga, Shoko; Urayama, Kenji

    2017-01-01

    This study assessed whether non-fasting lipid markers could be substituted for fasting markers in screening for dyslipidemia, whether direct measurement of non-fasting low-density lipoprotein cholesterol [LDL-C (D)] could be substituted for the calculation of fasting LDL-C [LDL-C (F)], and the utility of measuring non-high-density lipoprotein cholesterol (non-HDL-C). In 33 children, the lipid profile was measured in the non-fasting and fasting states within 24 h. Correlations were examined between non-fasting LDL-C (D) or non-HDL-C levels and fasting LDL-C (F) levels. Non-fasting triglyceride (TG), total cholesterol (TC), HDL-C, LDL-C (D), and non-HDL-C levels were all significantly higher than the fasting levels, but the mean difference was within 10% (except for TG). Non-fasting LDL-C (D) and non-HDL-C levels were strongly correlated with the fasting LDL-C (F) levels. In conclusion, except for TG, non-fasting lipid parameters are useful when screening children for dyslipidemia. Direct measurement of non-fasting LDL-C and calculation of non-fasting non-HDL-C could replace the calculation of fasting LDL-C because of convenience.

  18. The independent relationship between triglycerides and coronary heart disease

    PubMed Central

    Morrison, Alan; Hokanson, John E

    2009-01-01

    Aims: The aim was to review epidemiologic studies to reassess whether serum levels of triglycerides should be considered independently of high-density lipoprotein-cholesterol (HDL-C) as a predictor of coronary heart disease (CHD). Methods and results: We systematically reviewed population-based cohort studies in which baseline serum levels of triglycerides and HDL-C were included as explanatory variables in multivariate analyses with the development of CHD (coronary events or coronary death) as dependent variable. A total of 32 unique reports describing 38 cohorts were included. The independent association between elevated triglycerides and risk of CHD was statistically significant in 16 of 30 populations without pre-existing CHD. Among populations with diabetes mellitus or pre-existing CHD, or the elderly, triglycerides were not significantly independently associated with CHD in any of 8 cohorts. Triglycerides and HDL-C were mutually exclusive predictors of coronary events in 12 of 20 analyses of patients without pre-existing CHD. Conclusions: Epidemiologic studies provide evidence of an association between triglycerides and the development of primary CHD independently of HDL-C. Evidence of an inverse relationship between triglycerides and HDL-C suggests that both should be considered in CHD risk estimation and as targets for intervention. PMID:19436658

  19. Effects of Omega-3 Fatty Acid Supplementation on Glucose Control and Lipid Levels in Type 2 Diabetes: A Meta-Analysis

    PubMed Central

    Chen, Cai; Yu, Xuefeng; Shao, Shiying

    2015-01-01

    Background Many studies assessed the impact of marine omega-3 fatty acids on glycemic homeostasis and lipid profiles in patients with type 2 diabetes (T2DM), but reported controversial results. Our goal was to systematically evaluate the effects of omega-3 on glucose control and lipid levels. Methods Medline, Pubmed, Cochrane Library, Embase, the National Research Register, and SIGLE were searched to identify eligible randomized clinical trials (RCTs). Extracted data from RCTs were analyzed using STATA 11.0 statistical software with fixed or random effects model. Effect sizes were presented as weighted mean differences (WMD) with 95% confidence intervals (95% CI). Heterogeneity was assessed using the Chi-square test with significance level set at p < 0.1. Results 20 RCT trials were included into this meta-analysis. Among patients with omega-3 supplementation, triglyceride (TG) levels were significantly decreased by 0.24 mmol/L. No marked change in total cholesterol (TC), HbA1c, fasting plasma glucose, postprandial plasma glucose, BMI or body weight was observed. High ratio of EPA/DHA contributed to a greater decreasing tendency in plasma insulin, HbAc1, TC, TG, and BMI measures, although no statistical significance was identified (except TG). FPG levels were increased by 0.42 mmol/L in Asians. No evidence of publication bias was observed in this meta-analysis. Conclusions The ratio of EPA/DHA and early intervention with omega 3 fatty acids may affect their effects on glucose control and lipid levels, which may serve as a dietary reference for clinicians or nutritionists who manage diabetic patients. PMID:26431431

  20. A randomized, placebo-controlled, double-blind study on the effects of (-)-epicatechin on the triglyceride/HDLc ratio and cardiometabolic profile of subjects with hypertriglyceridemia: Unique in vitro effects.

    PubMed

    Gutiérrez-Salmeán, Gabriela; Meaney, Eduardo; Lanaspa, Miguel A; Cicerchi, Christina; Johnson, Richard J; Dugar, Sundeep; Taub, Pam; Ramírez-Sánchez, Israel; Villarreal, Francisco; Schreiner, George; Ceballos, Guillermo

    2016-11-15

    Cardiometabolic disruptions such as insulin resistance, obesity, high blood pressure, hyperglycemia, and dyslipidemias, are known to increase the risk for cardiovascular and metabolic diseases such as type 2 diabetes mellitus and atherosclerosis. Several screening tools for assessing cardiometabolic risk have been developed including the TG/HDLc ratio, which has been, demonstrated to possess a strong association with insulin resistance and coronary disease. Dietary modifications, together with regular moderate exercise have proven to be effective in attenuating cardiometabolic disruptions. However, they often exhibit poor long-term patient compliance. Nutraceutics, including (-)-epicatechin (EPI), have gained increasing interest as coadjuvant effective and safe therapies that are able to attenuate hypertension, hyperglycemia, hyperinsulinemia, hypertriglyceridemia and hypoalphalipoproteinemia. The aims of this study were: 1) to compare the in vitro effect of EPI vs. (+)-catechin on fructose induced triglyceride accumulation and mitochondrial function in Hep2 cells in culture, 2) to evaluate the efficacy of EPI treatment in reducing fasting blood triglycerides and improving the TG/HDLc ratio in hypertriglyceridemic patients with a total daily dose of 100mg of EPI. Secondary clinical variables included total cholesterol, LDLc, fructosamine, glucose, insulin, and high sensitivity C-reactive protein blood levels. Our results provide preliminary evidence as to favorable effects of EPI on glycemia homeostasis, lipid profile and systemic inflammation such bioactive actions are not class-effects (i.e. limited to their antioxidant potential) but instead, may result from the specific activation of associated downstream signaling pathways since catechin has no effects. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.