The emerging role and targetability of the TCA cycle in cancer metabolism.
Anderson, Nicole M; Mucka, Patrick; Kern, Joseph G; Feng, Hui
2018-02-01
The tricarboxylic acid (TCA) cycle is a central route for oxidative phosphorylation in cells, and fulfills their bioenergetic, biosynthetic, and redox balance requirements. Despite early dogma that cancer cells bypass the TCA cycle and primarily utilize aerobic glycolysis, emerging evidence demonstrates that certain cancer cells, especially those with deregulated oncogene and tumor suppressor expression, rely heavily on the TCA cycle for energy production and macromolecule synthesis. As the field progresses, the importance of aberrant TCA cycle function in tumorigenesis and the potentials of applying small molecule inhibitors to perturb the enhanced cycle function for cancer treatment start to evolve. In this review, we summarize current knowledge about the fuels feeding the cycle, effects of oncogenes and tumor suppressors on fuel and cycle usage, common genetic alterations and deregulation of cycle enzymes, and potential therapeutic opportunities for targeting the TCA cycle in cancer cells. With the application of advanced technology and in vivo model organism studies, it is our hope that studies of this previously overlooked biochemical hub will provide fresh insights into cancer metabolism and tumorigenesis, subsequently revealing vulnerabilities for therapeutic interventions in various cancer types.
Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.
Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal
2005-01-01
Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.
Metabolism: Part II. The Tricarboxylic Acid (TCA), Citric Acid, or Krebs Cycle.
ERIC Educational Resources Information Center
Bodner, George M.
1986-01-01
Differentiates the tricarboxylic acid (TCA) cycle (or Krebs cycle) from glycolysis, and describes the bridge between the two as being the conversion of pyruvate into acetyl coenzyme A. Discusses the eight steps in the TCA cycle, the results of isotopic labeling experiments, and the net effects of the TCA cycle. (TW)
Origin of the Reductive Tricarboxylic Acid (rTCA) Cycle-Type CO2 Fixation: A Perspective
Fujishima, Kosuke
2017-01-01
The reductive tricarboxylic acid (rTCA) cycle is among the most plausible candidates for the first autotrophic metabolism in the earliest life. Extant enzymes fixing CO2 in this cycle contain cofactors at the catalytic centers, but it is unlikely that the protein/cofactor system emerged at once in a prebiotic process. Here, we discuss the feasibility of non-enzymatic cofactor-assisted drive of the rTCA reactions in the primitive Earth environments, particularly focusing on the acetyl-CoA conversion to pyruvate. Based on the energetic and mechanistic aspects of this reaction, we propose that the deep-sea hydrothermal vent environments with active electricity generation in the presence of various sulfide catalysts are a promising setting for it to progress. Our view supports the theory of an autotrophic origin of life from primordial carbon assimilation within a sulfide-rich hydrothermal vent.
Tiwari, Vivek; Ambadipudi, Susmitha; Patel, Anant B
2013-10-01
The (13)C nuclear magnetic resonance (NMR) studies together with the infusion of (13)C-labeled substrates in rats and humans have provided important insight into brain energy metabolism. In the present study, we have extended a three-compartment metabolic model in mouse to investigate glutamatergic and GABAergic tricarboxylic acid (TCA) cycle and neurotransmitter cycle fluxes across different regions of the brain. The (13)C turnover of amino acids from [1,6-(13)C2]glucose was monitored ex vivo using (1)H-[(13)C]-NMR spectroscopy. The astroglial glutamate pool size, one of the important parameters of the model, was estimated by a short infusion of [2-(13)C]acetate. The ratio Vcyc/VTCA was calculated from the steady-state acetate experiment. The (13)C turnover curves of [4-(13)C]/[3-(13)C]glutamate, [4-(13)C]glutamine, [2-(13)C]/[3-(13)C]GABA, and [3-(13)C]aspartate from [1,6-(13)C2]glucose were analyzed using a three-compartment metabolic model to estimate the rates of the TCA cycle and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The glutamatergic TCA cycle rate was found to be highest in the cerebral cortex (0.91 ± 0.05 μmol/g per minute) and least in the hippocampal region (0.64 ± 0.07 μmol/g per minute) of the mouse brain. In contrast, the GABAergic TCA cycle flux was found to be highest in the thalamus-hypothalamus (0.28 ± 0.01 μmol/g per minute) and least in the cerebral cortex (0.24 ± 0.02 μmol/g per minute). These findings indicate that the energetics of excitatory and inhibitory function is distinct across the mouse brain.
Capitanio, Daniele; Fania, Chiara; Torretta, Enrica; Viganò, Agnese; Moriggi, Manuela; Bravatà, Valentina; Caretti, Anna; Levett, Denny Z H; Grocott, Michael P W; Samaja, Michele; Cerretelli, Paolo; Gelfi, Cecilia
2017-08-29
In mammals, hypoxic stress management is under the control of the Hypoxia Inducible Factors, whose activity depends on the stabilization of their labile α subunit. In particular, the skeletal muscle appears to be able to react to changes in substrates and O 2 delivery by tuning its metabolism. The present study provides a comprehensive overview of skeletal muscle metabolic adaptation to hypoxia in mice and in human subjects exposed for 7/9 and 19 days to high altitude levels. The investigation was carried out combining proteomics, qRT-PCR mRNA transcripts analysis, and enzyme activities assessment in rodents, and protein detection by antigen antibody reactions in humans and rodents. Results indicate that the skeletal muscle react to a decreased O 2 delivery by rewiring the TCA cycle. The first TCA rewiring occurs in mice in 2-day hypoxia and is mediated by cytosolic malate whereas in 10-day hypoxia the rewiring is mediated by Idh1 and Fasn, supported by glutamine and HIF-2α increments. The combination of these specific anaplerotic steps can support energy demand despite HIFs degradation. These results were confirmed in human subjects, demonstrating that the TCA double rewiring represents an essential factor for the maintenance of muscle homeostasis during adaptation to hypoxia.
Tavsan, Zehra; Ayar Kayali, Hulya
2015-05-01
The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.
Temporal fluxomics reveals oscillations in TCA cycle flux throughout the mammalian cell cycle.
Ahn, Eunyong; Kumar, Praveen; Mukha, Dzmitry; Tzur, Amit; Shlomi, Tomer
2017-11-06
Cellular metabolic demands change throughout the cell cycle. Nevertheless, a characterization of how metabolic fluxes adapt to the changing demands throughout the cell cycle is lacking. Here, we developed a temporal-fluxomics approach to derive a comprehensive and quantitative view of alterations in metabolic fluxes throughout the mammalian cell cycle. This is achieved by combining pulse-chase LC-MS-based isotope tracing in synchronized cell populations with computational deconvolution and metabolic flux modeling. We find that TCA cycle fluxes are rewired as cells progress through the cell cycle with complementary oscillations of glucose versus glutamine-derived fluxes: Oxidation of glucose-derived flux peaks in late G1 phase, while oxidative and reductive glutamine metabolism dominates S phase. These complementary flux oscillations maintain a constant production rate of reducing equivalents and oxidative phosphorylation flux throughout the cell cycle. The shift from glucose to glutamine oxidation in S phase plays an important role in cell cycle progression and cell proliferation. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Fu, Yanfen; Li, Yi; Lidstrom, Mary
2017-07-01
Methanotrophs are a group of bacteria that use methane as sole carbon and energy source. Type I methanotrophs are gamma-proteobacterial methanotrophs using the ribulose monophosphate cycle (RuMP) cycle for methane assimilation. In order to facilitate metabolic engineering in the industrially promising Type I methanotroph Methylomicrobium buryatense 5GB1, flux analysis of cellular metabolism is needed and 13 C tracer analysis is a foundational tool for such work. This biological system has a single-carbon input and a special network topology that together pose challenges to the current well-established methodology for 13 C tracer analysis using a multi-carbon input such as glucose, and to date, no 13 C tracer analysis of flux in a Type I methanotroph has been reported. In this study, we showed that by monitoring labeling patterns of several key intermediate metabolites in core metabolism, it is possible to quantitate the relative flux ratios for important branch points, such as the malate node. In addition, it is possible to assess the operation of the TCA cycle, which has been thought to be incomplete in Type I methanotrophs. Surprisingly, our analysis provides direct evidence of a complete, oxidative TCA cycle operating in M. buryatense 5GB1 using methane as sole carbon and energy substrate, contributing about 45% of the total flux for de novo malate production. Combined with mutant analysis, this method was able to identify fumA (METBUDRAFT_1453/MBURv2__60244) as the primary fumarase involved in the oxidative TCA cycle, among 2 predicted fumarases, supported by 13 C tracer analysis on both fumA and fumC single knockouts. Interrupting the oxidative TCA cycle leads to a severe growth defect, suggesting that the oxidative TCA cycle functions to not only provide precursors for de novo biomass synthesis, but also to provide reducing power to the system. This information provides new opportunities for metabolic engineering of M. buryatense for the production of
Tao, Li; Zhang, Yulong; Fan, Shuru; Nobile, Clarissa J.; Guan, Guobo; Huang, Guanghua
2017-01-01
Morphological transitions and metabolic regulation are critical for the human fungal pathogen Candida albicans to adapt to the changing host environment. In this study, we generated a library of central metabolic pathway mutants in the tricarboxylic acid (TCA) cycle, and investigated the functional consequences of these gene deletions on C. albicans biology. Inactivation of the TCA cycle impairs the ability of C. albicans to utilize non-fermentable carbon sources and dramatically attenuates cell growth rates under several culture conditions. By integrating the Ras1-cAMP signaling pathway and the heat shock factor-type transcription regulator Sfl2, we found that the TCA cycle plays fundamental roles in the regulation of CO2 sensing and hyphal development. The TCA cycle and cAMP signaling pathways coordinately regulate hyphal growth through the molecular linkers ATP and CO2. Inactivation of the TCA cycle leads to lowered intracellular ATP and cAMP levels and thus affects the activation of the Ras1-regulated cAMP signaling pathway. In turn, the Ras1-cAMP signaling pathway controls the TCA cycle through both Efg1- and Sfl2-mediated transcriptional regulation in response to elevated CO2 levels. The protein kinase A (PKA) catalytic subunit Tpk1, but not Tpk2, may play a major role in this regulation. Sfl2 specifically binds to several TCA cycle and hypha-associated genes under high CO2 conditions. Global transcriptional profiling experiments indicate that Sfl2 is indeed required for the gene expression changes occurring in response to these elevated CO2 levels. Our study reveals the regulatory role of the TCA cycle in CO2 sensing and hyphal development and establishes a novel link between the TCA cycle and Ras1-cAMP signaling pathways. PMID:28787458
Etienne, Audrey; Génard, Michel; Bugaud, Christophe
2015-01-01
Citrate is one of the most important organic acids in many fruits and its concentration plays a critical role in organoleptic properties. The regulation of citrate accumulation throughout fruit development, and the origins of the phenotypic variability of the citrate concentration within fruit species remain to be clarified. In the present study, we developed a process-based model of citrate accumulation based on a simplified representation of the TCA cycle to predict citrate concentration in fruit pulp during the pre- and post-harvest stages. Banana fruit was taken as a reference because it has the particularity of having post-harvest ripening, during which citrate concentration undergoes substantial changes. The model was calibrated and validated on the two stages, using data sets from three contrasting cultivars in terms of citrate accumulation, and incorporated different fruit load, potassium supply, and harvest dates. The model predicted the pre and post-harvest dynamics of citrate concentration with fairly good accuracy for the three cultivars. The model suggested major differences in TCA cycle functioning among cultivars during post-harvest ripening of banana, and pointed to a potential role for NAD-malic enzyme and mitochondrial malate carriers in the genotypic variability of citrate concentration. The sensitivity of citrate accumulation to growth parameters and temperature differed among cultivars during post-harvest ripening. Finally, the model can be used as a conceptual basis to study citrate accumulation in fleshy fruits and may be a powerful tool to improve our understanding of fruit acidity.
Glucose-independent glutamine metabolism via TCA cycling for proliferation and survival in B-cells
Le, Anne; Lane, Andrew N.; Hamaker, Max; Bose, Sminu; Gouw, Arvin; Barbi, Joseph; Tsukamoto, Takashi; Rojas, Camilio J.; Slusher, Barbara S.; Zhang, Haixia; Zimmerman, Lisa J.; Liebler, Daniel C.; Slebos, Robbert J.C.; Lorkiewicz, Pawel K.; Higashi, Richard M.; Fan, Teresa W. M.; Dang, Chi V.
2012-01-01
Summary Because MYC plays a causal role in many human cancers, including those with hypoxic and nutrient-poor tumor microenvironments, we have determined the metabolic responses of a MYC-inducible human Burkitt lymphoma model P493 cell line to aerobic and hypoxic conditions, and to glucose deprivation, using Stable Isotope Resolved Metabolomics. Using [U-13C]-glucose as the tracer, both glucose consumption and lactate production were increased by MYC expression and hypoxia. Using [U-13C,15N]-glutamine as the tracer, glutamine import and metabolism through the TCA cycle persisted under hypoxia, and glutamine contributed significantly to citrate carbons. Under glucose deprivation, glutamine-derived fumarate, malate, and citrate were significantly increased. Their 13C labeling patterns demonstrate an alternative energy-generating glutaminolysis pathway involving a glucose-independent TCA cycle. The essential role of glutamine metabolism in cell survival and proliferation under hypoxia and glucose deficiency, makes them susceptible to the glutaminase inhibitor BPTES, and hence could be targeted for cancer therapy. PMID:22225880
Vicente, Joaquim A F; Gomes-Santos, Carina S S; Sousa, Ana Paula M; Madeira, Vítor M C
2005-03-01
Potato tubers and turnip roots were used to prepare purified mitochondria for laboratory practical work in the teaching of the citric acid cycle (TCA cycle). Plant mitochondria are particularly advantageous over the animal fractions to demonstrate the TCA cycle enzymatic steps, by using simple techniques to measure O(2) consumption and transmembrane potential (ΔΨ). The several TCA cycle intermediates induce specific enzyme activities, which can be identified by respiratory parameters. Such a strategy is also used to evidence properties of the TCA cycle enzymes: ADP stimulation of isocitrate dehydrogenase and α-ketoglutarate dehydrogenase; activation by citrate of downstream oxidation steps, e.g. succinate dehydrogenase; and regulation of the activity of isocitrate dehydrogenase by citrate action on the citrate/isocitrate carrier. Furthermore, it has been demonstrated that, in the absence of exogenous Mg(2+) , isocitrate-dependent respiration favors the alternative oxidase pathway, as judged by changes of the ADP/O elicited by the inhibitor n-propyl galate. These are some examples of assays related with TCA cycle intermediates we can use in laboratory courses. Copyright © 2005 International Union of Biochemistry and Molecular Biology, Inc.
Choi, Sol; Kim, Hyun Uk; Kim, Tae Yong; Lee, Sang Yup
2016-11-01
To address climate change and environmental problems, it is becoming increasingly important to establish biorefineries for the production of chemicals from renewable non-food biomass. Here we report the development of Escherichia coli strains capable of overproducing a four-carbon platform chemical 4-hybroxybutyric acid (4-HB). Because 4-HB production is significantly affected by aeration level, genome-scale metabolic model-based engineering strategies were designed under aerobic and microaerobic conditions with emphasis on oxidative/reductive TCA branches and glyoxylate shunt. Several different metabolic engineering strategies were employed to develop strains suitable for fermentation both under aerobic and microaerobic conditions. It was found that microaerobic condition was more efficient than aerobic condition in achieving higher titer and productivity of 4-HB. The final engineered strain produced 103.4g/L of 4-HB by microaerobic fed-batch fermentation using glycerol. The aeration-dependent optimization strategy of TCA cycle will be useful for developing microbial strains producing other reduced derivative chemicals of TCA cycle intermediates. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Pyruvate cycle increases aminoglycoside efficacy and provides respiratory energy in bacteria.
Su, Yu-Bin; Peng, Bo; Li, Hui; Cheng, Zhi-Xue; Zhang, Tian-Tuo; Zhu, Jia-Xin; Li, Dan; Li, Min-Yi; Ye, Jin-Zhou; Du, Chao-Chao; Zhang, Song; Zhao, Xian-Liang; Yang, Man-Jun; Peng, Xuan-Xian
2018-02-13
The emergence and ongoing spread of multidrug-resistant bacteria puts humans and other species at risk for potentially lethal infections. Thus, novel antibiotics or alternative approaches are needed to target drug-resistant bacteria, and metabolic modulation has been documented to improve antibiotic efficacy, but the relevant metabolic mechanisms require more studies. Here, we show that glutamate potentiates aminoglycoside antibiotics, resulting in improved elimination of antibiotic-resistant pathogens. When exploring the metabolic flux of glutamate, it was found that the enzymes that link the phosphoenolpyruvate (PEP)-pyruvate-AcCoA pathway to the TCA cycle were key players in this increased efficacy. Together, the PEP-pyruvate-AcCoA pathway and TCA cycle can be considered the pyruvate cycle (P cycle). Our results show that inhibition or gene depletion of the enzymes in the P cycle shut down the TCA cycle even in the presence of excess carbon sources, and that the P cycle operates routinely as a general mechanism for energy production and regulation in Escherichia coli and Edwardsiella tarda These findings address metabolic mechanisms of metabolite-induced potentiation and fundamental questions about bacterial biochemistry and energy metabolism.
Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle
Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro
2017-01-01
Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886
Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.
2012-01-01
ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869
The TCA cycle is not required for selection or survival of multidrug-resistant Salmonella
Ricci, Vito; Loman, Nick; Pallen, Mark; Ivens, Alasdair; Fookes, Maria; Langridge, Gemma C.; Wain, John; Piddock, Laura J. V.
2012-01-01
Objectives The initial aim of this study was to use a systems biology approach to analyse a ciprofloxacin-selected multidrug-resistant (MDR) Salmonella enterica serotype Typhimurium, L664. Methods The whole genome sequence and transcriptome of L664 were analysed. Site-directed mutagenesis to recreate each mutation was carried out, followed by phenotypic characterization and mutation frequency analysis. As a mutation in the TCA cycle was detected we tested the controversial hypothesis regarding the bacterial response to bactericidal antibiotics, put forward by Kohanski et al. (Cell 2007; 130: 797–810 and Mol Cell 2010; 37: 311–20), that exposure of bacteria to agents such as ciprofloxacin produces reactive oxygen species (ROS), which transiently increase the mutation rate giving rise to MDR bacteria. Results L664 contained a mutation in ramR that conferred MDR. A mutation in tctA affected the TCA cycle and conferred the inability to grow on minimal agar. The virulence of L664 was not attenuated. Ciprofloxacin exposure produced ROS in L664 and SL1344 (tctA::aph), but it was reduced and occurred later. There were no significant differences in the rates of killing or mutations per generation to antibiotic resistance between the strains. Conclusions Whilst we confirm production of ROS in response to ciprofloxacin, we have no data to support the hypothesis that this leads to selection of MDR strains. Our results indicate that the mutations in tctA and glgA were random as they did not pre-exist in the parental strain, and that the mutation in tctA did not provide a survival advantage or disadvantage in the presence of antibiotic. PMID:22186876
Veyrat-Durebex, Charlotte; Corcia, Philippe; Piver, Eric; Devos, David; Dangoumau, Audrey; Gouel, Flore; Vourc'h, Patrick; Emond, Patrick; Laumonnier, Frédéric; Nadal-Desbarats, Lydie; Gordon, Paul H; Andres, Christian R; Blasco, Hélène
2016-12-01
This study aims to develop a cellular metabolomics model that reproduces the pathophysiological conditions found in amyotrophic lateral sclerosis in order to improve knowledge of disease physiology. We used a co-culture model combining the motor neuron-like cell line NSC-34 and the astrocyte clone C8-D1A, with each over-expressing wild-type or G93C mutant human SOD1, to examine amyotrophic lateral sclerosis (ALS) physiology. We focused on the effects of mutant human SOD1 as well as oxidative stress induced by menadione on intracellular metabolism using a metabolomics approach through gas chromatography coupled with mass spectrometry (GC-MS) analysis. Preliminary non-supervised analysis by Principal Component Analysis (PCA) revealed that cell type, genetic environment, and time of culture influenced the metabolomics profiles. Supervised analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) on data from intracellular metabolomics profiles of SOD1 G93C co-cultures produced metabolites involved in glutamate metabolism and the tricarboxylic acid cycle (TCA) cycle. This study revealed the feasibility of using a metabolomics approach in a cellular model of ALS. We identified potential disruption of the TCA cycle and glutamate metabolism under oxidative stress, which is consistent with prior research in the disease. Analysis of metabolic alterations in an in vitro model is a novel approach to investigation of disease physiology.
Marden, James H
2013-12-01
Metabolic enzyme loci were some of the first genes accessible for molecular evolution and ecology research. New technologies now make the whole genome, transcriptome or proteome readily accessible, allowing unbiased scans for loci exhibiting significant differences in allele frequency or expression level and associated with phenotypes and/or responses to natural selection. With surprising frequency and in many cases in proportions greater than chance relative to other genes, glycolysis and TCA cycle enzyme loci appear among the genes with significant associations in these studies. Hence, there is an ongoing need to understand the basis for fitness effects of metabolic enzyme polymorphisms. Allele-specific effects on the binding affinity and catalytic rate of individual enzymes are well known, but often of uncertain significance because metabolic control theory and in vivo studies indicate that many individual metabolic enzymes do not affect pathway flux rate. I review research, so far little used in evolutionary biology, showing that metabolic enzyme substrates affect signalling pathways that regulate cell and organismal biology, and that these enzymes have moonlighting functions. To date there is little knowledge of how alleles in natural populations affect these phenotypes. I discuss an example in which alleles of a TCA enzyme locus associate with differences in a signalling pathway and development, organismal performance, and ecological dynamics. Ultimately, understanding how metabolic enzyme polymorphisms map to phenotypes and fitness remains a compelling and ongoing need for gaining robust knowledge of ecological and evolutionary processes. © 2013 John Wiley & Sons Ltd.
Genetic investigation of tricarboxylic acid metabolism during the Plasmodium falciparum life cycle.
Ke, Hangjun; Lewis, Ian A; Morrisey, Joanne M; McLean, Kyle J; Ganesan, Suresh M; Painter, Heather J; Mather, Michael W; Jacobs-Lorena, Marcelo; Llinás, Manuel; Vaidya, Akhil B
2015-04-07
New antimalarial drugs are urgently needed to control drug-resistant forms of the malaria parasite Plasmodium falciparum. Mitochondrial electron transport is the target of both existing and new antimalarials. Herein, we describe 11 genetic knockout (KO) lines that delete six of the eight mitochondrial tricarboxylic acid (TCA) cycle enzymes. Although all TCA KOs grew normally in asexual blood stages, these metabolic deficiencies halted life-cycle progression in later stages. Specifically, aconitase KO parasites arrested as late gametocytes, whereas α-ketoglutarate-dehydrogenase-deficient parasites failed to develop oocysts in the mosquitoes. Mass spectrometry analysis of (13)C-isotope-labeled TCA mutant parasites showed that P. falciparum has significant flexibility in TCA metabolism. This flexibility manifested itself through changes in pathway fluxes and through altered exchange of substrates between cytosolic and mitochondrial pools. Our findings suggest that mitochondrial metabolic plasticity is essential for parasite development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
TCA High Lift Preliminary Assessment
NASA Technical Reports Server (NTRS)
Wyatt, G. H.; Polito, R. C.; Yeh, D. T.; Elzey, M. E.; Tran, J. T.; Meredith, Paul T.
1999-01-01
This paper presents a TCA (Technology Concept Airplane) High lift Preliminary Assessment. The topics discussed are: 1) Model Description; 2) Data Repeatability; 3) Effect of Inboard L.E. (Leading Edge) Flap Span; 4) Comparison of 14'x22' TCA-1 With NTF (National Transonic Facility) Modified Ref. H; 5) Comparison of 14'x22' and NTF Ref. H Results; 6) Effect of Outboard Sealed Slat on TCA; 7) TCA Full Scale Build-ups; 8) Full Scale L/D Comparisons; 9) TCA Full Scale; and 10) Touchdown Lift Curves. This paper is in viewgraph form.
Microbial extracellular enzymes in biogeochemical cycling of ecosystems.
Luo, Ling; Meng, Han; Gu, Ji-Dong
2017-07-15
Extracellular enzymes, primarily produced by microorganisms, affect ecosystem processes because of their essential roles in degradation, transformation and mineralization of organic matter. Extracellular enzymes involved in the cycling of carbon (C), nitrogen (N) and phosphorus (P) have been widely investigated in many different ecosystems, and several enzymes have been recognized as key components in regulating C storage and nutrient cycling. In this review, it was the first time to summarize the specific extracellular enzymes related to C storage and nutrient cycling for better understanding the important role of microbial extracellular enzymes in biogeochemical cycling of ecosystems. Subsequently, ecoenzymatic stoichiometry - the relative ratio of extracellular enzyme, has been reviewed and further provided a new perspective for understanding biogeochemical cycling of ecosystems. Finally, the new insights of using microbial extracellular enzyme in indicating biogeochemical cycling and then protecting ecosystems have been suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rink, Cameron; Gnyawali, Surya; Stewart, Richard; Teplitsky, Seth; Harris, Hallie; Roy, Sashwati; Sen, Chandan K.; Khanna, Savita
2017-01-01
Ischemic stroke results in excessive release of glutamate, which contributes to neuronal cell death. Here, we test the hypothesis that otherwise neurotoxic glutamate can be productively metabolized by glutamate oxaloacetate transaminase (GOT) to maintain cellular energetics and protect the brain from ischemic stroke injury. The GOT-dependent metabolism of glutamate was studied in primary neural cells and in stroke-affected C57-BL6 mice using magnetic resonance spectroscopy and GC-MS. Extracellular Glu sustained cell viability under hypoglycemic conditions and increased GOT-mediated metabolism in vitro. Correction of stroke-induced hypoxia using supplemental oxygen in vivo lowered Glu levels as measured by 1H magnetic resonance spectroscopy. GOT knockdown abrogated this effect and caused ATP loss in the stroke-affected brain. GOT overexpression increased anaplerotic refilling of tricarboxylic acid cycle intermediates in mouse brain during ischemic stroke. Furthermore, GOT overexpression not only reduced ischemic stroke lesion volume but also attenuated neurodegeneration and improved poststroke sensorimotor function. Taken together, our results show that GOT enables metabolism of otherwise neurotoxic extracellular Glu through a truncated tricarboxylic acid cycle under hypoglycemic conditions.—Rink, C., Gnyawali, S., Stewart, R., Teplitsky, S., Harris, H., Roy, S., Sen, C. K., Khanna, S. Glutamate oxaloacetate transaminase enables anaplerotic refilling of TCA cycle intermediates in stroke-affected brain. PMID:28096234
Koontz, Laura
2014-01-01
Trichloroacetic acid (TCA) precipitation of proteins is commonly used to concentrate protein samples or remove contaminants, including salts and detergents, prior to downstream applications such as SDS-PAGE or 2D-gels. TCA precipitation denatures the protein, so it should not be used if the protein must remain in its folded state (e.g., if you want to measure a biochemical activity of the protein). © 2014 Elsevier Inc. All rights reserved.
Index markers of chronic fatigue syndrome with dysfunction of TCA and urea cycles
Yamano, Emi; Sugimoto, Masahiro; Hirayama, Akiyoshi; Kume, Satoshi; Yamato, Masanori; Jin, Guanghua; Tajima, Seiki; Goda, Nobuhito; Iwai, Kazuhiro; Fukuda, Sanae; Yamaguti, Kouzi; Kuratsune, Hirohiko; Soga, Tomoyoshi; Watanabe, Yasuyoshi; Kataoka, Yosky
2016-01-01
Chronic fatigue syndrome (CFS) is a persistent and unexplained pathological state characterized by exertional and severely debilitating fatigue, with/without infectious or neuropsychiatric symptoms, lasting at least 6 consecutive months. Its pathogenesis remains incompletely understood. Here, we performed comprehensive metabolomic analyses of 133 plasma samples obtained from CFS patients and healthy controls to establish an objective diagnosis of CFS. CFS patients exhibited significant differences in intermediate metabolite concentrations in the tricarboxylic acid (TCA) and urea cycles. The combination of ornithine/citrulline and pyruvate/isocitrate ratios discriminated CFS patients from healthy controls, yielding area under the receiver operating characteristic curve values of 0.801 (95% confidential interval [CI]: 0.711–0.890, P < 0.0001) and 0.750 (95% CI: 0.584–0.916, P = 0.0069) for training (n = 93) and validation (n = 40) datasets, respectively. These findings provide compelling evidence that a clinical diagnostic tool could be developed for CFS based on the ratios of metabolites in plasma. PMID:27725700
Differential expression of glucose-metabolizing enzymes in multiple sclerosis lesions.
Nijland, Philip G; Molenaar, Remco J; van der Pol, Susanne M A; van der Valk, Paul; van Noorden, Cornelis J F; de Vries, Helga E; van Horssen, Jack
2015-12-04
Demyelinated axons in multiple sclerosis (MS) lesions have an increased energy demand in order to maintain conduction. However, oxidative stress-induced mitochondrial dysfunction likely alters glucose metabolism and consequently impairs neuronal function in MS. Imaging and pathological studies indicate that glucose metabolism is altered in MS, although the underlying mechanisms and its role in neurodegeneration remain elusive. We investigated expression patterns of key enzymes involved in glycolysis, tricarboxylic acid (TCA) cycle and lactate metabolism in well-characterized MS tissue to establish which regulators of glucose metabolism are involved in MS and to identify underlying mechanisms. Expression levels of glycolytic enzymes were increased in active and inactive MS lesions, whereas expression levels of enzymes involved in the TCA cycle were upregulated in active MS lesions, but not in inactive MS lesions. We observed reduced expression and production capacity of mitochondrial α-ketoglutarate dehydrogenase (αKGDH) in demyelinated axons, which correlated with signs of axonal dysfunction. In inactive lesions, increased expression of lactate-producing enzymes was observed in astrocytes, whereas lactate-catabolising enzymes were mainly detected in axons. Our results demonstrate that the expression of various enzymes involved in glucose metabolism is increased in both astrocytes and axons in active MS lesions. In inactive MS lesions, we provide evidence that astrocytes undergo a glycolytic shift resulting in enhanced astrocyte-axon lactate shuttling, which may be pivotal for the survival of demyelinated axons. In conclusion, we show that key enzymes involved in energy metabolism are differentially expressed in active and inactive MS lesions. Our findings imply that, in addition to reduced oxidative phosphorylation activity, other bioenergetic pathways are affected as well, which may contribute to ongoing axonal degeneration in MS.
Durieux, P O; Schütz, P; Brun, R; Köhler, P
1991-03-01
A rapid switch from a fermentative to a primarily oxidative type of glucose utilization was observed during in vitro differentiation of Trypanosoma brucei STIB348 and EATRO1244 bloodstream to procyclic trypomastigotes. In accordance with previously published reports bloodstream populations produced pyruvate as the major end product of glucose catabolism, together with very small amounts of CO2, succinate and glycerol. During differentiation pyruvate excretion decreased within 48 h to the low levels produced by 28-day procyclic stages. Concomitant with the decline in pyruvate formation, acetate appeared as a new product and the rates of respiratory CO2 increased considerably. The amount of carbon released with these compounds could account for nearly all of the glucose carbon consumed. Rates of glucose utilization and formation of acetate and CO2 in cells differentiated for 48 h were essentially the same as those found in 28-day procyclics. Succinate and glycerol excretion remained low during the entire transformation process, and no significant difference in the pattern and quantities of end products were found between the two trypanosome strains. During trypanosome differentiation the changes in metabolism were associated with marked alterations in enzyme activity levels. Activities of the tricarboxylic acid (TCA) cycle enzymes citrate synthase, isocitrate dehydrogenase (NAD+), succinate dehydrogenase and fumarase were not detectable in bloodstream trypomastigotes but appeared upon differentiation for 24 h. An exception was citrate synthase whose activity was not demonstrable until 48 h postinoculation into culture. After 48 h the majority of the TCA cycle enzyme activities continued to increase steadily until day 28. Pyruvate kinase activity decreased in differentiating cells after 48 h to about 25% of the level found in bloodstream trypomastigotes.(ABSTRACT TRUNCATED AT 250 WORDS)
Min, Yoo Hong; Kim, Wootae; Kim, Ja-Eun
2016-01-01
Mitotic progression is crucial for the maintenance of chromosomal stability. A proper progression is ensured by the activities of multiple kinases. One of these enzymes, the serine/threonine kinase Aurora A, is required for proper mitosis through the regulation of centrosome and spindle assembly. In this study, we functionally characterized a newly developed Aurora kinase A inhibitor, TC-A2317. In human lung cancer cells, TC-A2317 slowed proliferation by causing aberrant formation of centrosome and microtubule spindles and prolonging the duration of mitosis. Abnormal mitotic progression led to accumulation of cells containing micronuclei or multinuclei. Furthermore, TC-A2317–treated cells underwent apoptosis, autophagy or senescence depending on cell type. In addition, TC-A2317 inactivated the spindle assembly checkpoint triggered by paclitaxel, thereby exacerbating mitotic catastrophe. Consistent with this, the expression level of Aurora A in tumors was inversely correlated with survival in lung cancer patients. Collectively, these data suggest that inhibition of Aurora kinase A using TC-A2317 is a promising target for anti-cancer therapeutics. PMID:27713168
Yang, Chendong; Ko, Bookyung; Hensley, Christopher T; Jiang, Lei; Wasti, Ajla T; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E; DeBerardinis, Ralph J
2014-11-06
Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and reroutes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. Copyright © 2014 Elsevier Inc. All rights reserved.
Yang, Chendong; Ko, Bookyung; Hensley, Christopher T.; Jiang, Lei; Wasti, Ajla T.; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E.; DeBerardinis, Ralph J.
2014-01-01
Summary Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and re-routes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. PMID:25458842
Sunny, Nishanth E.; Parks, Elizabeth J.; Browning, Jeffrey D.; Burgess, Shawn C.
2013-01-01
Summary Approximately one-third of the U.S. population has nonalcoholic fatty liver disease (NAFLD), a condition closely associated with insulin resistance and increased risk of liver injury. Dysregulated mitochondrial metabolism is central in these disorders, but the manner and degree of dysregulation are disputed. This study tested whether humans with NAFLD have abnormal in vivo hepatic mitochondrial metabolism. Subjects with low (3.0%) and high (17%) intrahepatic triglyceride (IHTG) were studied using 2H and 13C tracers to evaluate systemic lipolysis, hepatic glucose production, and mitochondrial pathways (TCA cycle, anaplerosis, and ketogenesis). Individuals with NAFLD had 50% higher rates of lipolysis and 30% higher rates of gluconeogenesis. There was a positive correlation between IHTG content and both mitochondrial oxidative and anaplerotic fluxes. These data indicate that mitochondrial oxidative metabolism is ∼2-fold greater in those with NAFLD, providing a potential link between IHTG content, oxidative stress, and liver damage. PMID:22152305
Gosling, J. P.; Duggan, P. F.
1971-01-01
Bakers' yeast oxidizes acetate at a high rate only after an adaptation period during which the capacity of the glyoxylate cycle is found to increase. There was apparently no necessity for the activity of acetyl-coenzyme A synthetase, the capacity of the tricarboxylic acid cycle, or the concentrations of the cytochromes to increase for this adaptation to occur. Elevation of fructose 1,6 diphosphatase occurred only when acetate oxidation was nearly maximal. Cycloheximide almost completely inhibited adaptation as well as increases in the activities of isocitrate lyase and aconitate hydratase, the only enzymes assayed. p-Fluorophenylalanine was partially effective and chloramphenicol did not inhibit at all. The presence of ammonium, which considerably delayed adaptation of the yeast to acetate oxidation, inhibited the increases in the activities of the glyoxylate cycle enzymes to different degrees, demonstrating noncoordinate control of these enzymes. Under the various conditions, the only enzyme activity increase consistently related to the rising oxygen uptake rate was that of isocitrate lyase which apparently limited the activity of the cycle. PMID:5557595
Tefera, Tesfaye W; Borges, Karin
2018-01-01
Although alterations in energy metabolism are known in ALS, the specific mechanisms leading to energy deficit are not understood. We measured metabolite levels derived from injected [1- 13 C]glucose and [1,2- 13 C]acetate (i.p.) in cerebral cortex and spinal cord extracts of wild type and hSOD1 G93A mice at onset and mid disease stages using high-pressure liquid chromatography, 1 H and 13 C nuclear magnetic resonance spectroscopy. Levels of spinal and cortical CNS total lactate, [3- 13 C]lactate, total alanine and [3- 13 C]alanine, but not cortical glucose and [1- 13 C]glucose, were reduced mostly at mid stage indicating impaired glycolysis. The [1- 13 C]glucose-derived [4- 13 C]glutamate, [4- 13 C]glutamine and [2- 13 C]GABA amounts were diminished at mid stage in cortex and both time points in spinal cord, suggesting decreased [3- 13 C]pyruvate entry into the TCA cycle. Lack of changes in [1,2- 13 C]acetate-derived [4,5- 13 C]glutamate, [4,5- 13 C]glutamine and [1,2- 13 C]GABA levels indicate unchanged astrocytic 13 C-acetate metabolism. Reduced levels of leucine, isoleucine and valine in CNS suggest compensatory breakdown to refill TCA cycle intermediate levels. Unlabelled, [2- 13 C] and [4- 13 C]GABA concentrations were decreased in spinal cord indicating that impaired glucose metabolism contributes to hyperexcitability and supporting the use of treatments which increase GABA amounts. In conclusion, CNS glucose metabolism is compromised, while astrocytic TCA cycling appears to be normal in the hSOD1 G93A mouse model at symptomatic disease stages.
Hinder, Lucy M; Vivekanandan-Giri, Anuradha; McLean, Lisa L; Pennathur, Subramaniam; Feldman, Eva L
2013-01-01
Diabetic neuropathy (DN) is the most common complication of diabetes and is characterized by distal-to-proximal loss of peripheral nerve axons. The idea of tissue-specific pathological alterations in energy metabolism in diabetic complications-prone tissues is emerging. Altered nerve metabolism in type 1 diabetes models is observed; however, therapeutic strategies based on these models offer limited efficacy to type 2 diabetic patients with DN. Therefore, understanding how peripheral nerves metabolically adapt to the unique type 2 diabetic environment is critical to develop disease-modifying treatments. In the current study, we utilized targeted liquid chromatography-tandem mass spectrometry (LC/MS/MS) to characterize the glycolytic and tricarboxylic acid (TCA) cycle metabolomes in sural nerve, sciatic nerve, and dorsal root ganglia (DRG) from male type 2 diabetic mice (BKS.Cg-m+/+Lepr(db); db/db) and controls (db/+). We report depletion of glycolytic intermediates in diabetic sural nerve and sciatic nerve (glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate (sural nerve only), 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvate, and lactate), with no significant changes in DRG. Citrate and isocitrate TCA cycle intermediates were decreased in sural nerve, sciatic nerve, and DRG from diabetic mice. Utilizing LC/electrospray ionization/MS/MS and HPLC methods, we also observed increased protein and lipid oxidation (nitrotyrosine; hydroxyoctadecadienoic acids) in db/db tissue, with a proximal-to-distal increase in oxidative stress, with associated decreased aconitase enzyme activity. We propose a preliminary model, whereby the greater change in metabolomic profile, increase in oxidative stress, and decrease in TCA cycle enzyme activity may cause distal peripheral nerves to rely on truncated TCA cycle metabolism in the type 2 diabetes environment.
Modelling urea-cycle disorder citrullinemia type 1 with disease-specific iPSCs.
Yoshitoshi-Uebayashi, Elena Yukie; Toyoda, Taro; Yasuda, Katsutaro; Kotaka, Maki; Nomoto, Keiko; Okita, Keisuke; Yasuchika, Kentaro; Okamoto, Shinya; Takubo, Noriyuki; Nishikubo, Toshiya; Soga, Tomoyoshi; Uemoto, Shinji; Osafune, Kenji
2017-05-06
Citrullinemia type 1 (CTLN1) is a urea cycle disorder (UCD) caused by mutations of the ASS1 gene, which is responsible for production of the enzyme argininosuccinate synthetase (ASS), and classically presented as life-threatening hyperammonemia in newborns. Therapeutic options are limited, and neurological sequelae may persist. To understand the pathophysiology and find novel treatments, induced pluripotent stem cells (iPSCs) were generated from a CTLN1 patient and differentiated into hepatocyte-like cells (HLCs). CTLN1-HLCs have lower ureagenesis, recapitulating part of the patient's phenotype. l-arginine, an amino acid clinically used for UCD treatment, improved this phenotype in vitro. Metabolome analysis revealed an increase in tricarboxylic acid (TCA) cycle metabolites in CTLN1, suggesting a connection between CTLN1 and the TCA cycle. This CTLN1-iPSC model improves the understanding of CTLN1 pathophysiology and can be used to pursue new therapeutic approaches. Copyright © 2017 Elsevier Inc. All rights reserved.
Metabolite profiling of human colon carcinoma--deregulation of TCA cycle and amino acid turnover.
Denkert, Carsten; Budczies, Jan; Weichert, Wilko; Wohlgemuth, Gert; Scholz, Martin; Kind, Tobias; Niesporek, Silvia; Noske, Aurelia; Buckendahl, Anna; Dietel, Manfred; Fiehn, Oliver
2008-09-18
Apart from genetic alterations, development and progression of colorectal cancer has been linked to influences from nutritional intake, hyperalimentation, and cellular metabolic changes that may be the basis for new diagnostic and therapeutic approaches. However, in contrast to genomics and proteomics, comprehensive metabolomic investigations of alterations in malignant tumors have rarely been conducted. In this study we investigated a set of paired samples of normal colon tissue and colorectal cancer tissue with gas-chromatography time-of-flight mass-spectrometry, which resulted in robust detection of a total of 206 metabolites. Metabolic phenotypes of colon cancer and normal tissues were different at a Bonferroni corrected significance level of p=0.00170 and p=0.00005 for the first two components of an unsupervised PCA analysis. Subsequent supervised analysis found 82 metabolites to be significantly different at p<0.01. Metabolites were connected to abnormalities in metabolic pathways by a new approach that calculates the distance of each pair of metabolites in the KEGG database interaction lattice. Intermediates of the TCA cycle and lipids were found down-regulated in cancer, whereas urea cycle metabolites, purines, pyrimidines and amino acids were generally found at higher levels compared to normal colon mucosa. This study demonstrates that metabolic profiling facilitates biochemical phenotyping of normal and neoplastic colon tissue at high significance levels and points to GC-TOF-based metabolomics as a new method for molecular pathology investigations.
Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M
2015-07-02
Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jezynski, Tomasz; /DESY; Larsen, Raymond
ATCA/{mu}TCA platforms are attractive because of the modern serial link architecture, high availability features and many packaging options. Less-demanding availability applications can be met economically by scaling back speed and redundancy. The ATCA specification was originally targeted for the Telecom industry but has gained recently a much wider user audience. The purpose of this paper is to report on present hardware and software R and D efforts where ATCA and {mu}TCA are planned, already being used or in development using selected examples for accelerator and detectors in the Physics community. It will present also the status of a proposal formore » physics extensions to ATCA/{mu}TCA specifications to promote inter-operability of laboratory and industry designs for physics.« less
Valero, E; Varón, R; García-Carmona, F
1995-01-01
A kinetic study is made of a system consisting of a specific enzymic cycling assay coupled to an enzymic reaction. A kinetic analysis of this system is presented, and the accumulation of chromophore involved in the cycle is seen to be parabolic, i.e. the rate of the reaction increases continuously with constant acceleration. The system is illustrated by the measurement of alkaline phosphatase activity using beta-NADP+ as substrate. The enzymes alcohol dehydrogenase and diaphorase are used to cycle beta-NAD+ in the presence of ethanol and p-Iodonitrotetrazolium Violet. During each turn of the cycle, one molecule of the tetrazolium salt is reduced to an intensely coloured formazan. A simple procedure for evaluating the kinetic parameters involved in the system and for optimizing this cycling assay is described. The method is applicable to the measurement of any enzyme, and its amplification capacity as well as the simplicity of determining kinetic parameters enable it to be employed in enzyme immunoassays to increase the magnitude of the measured response. PMID:7619054
In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance.
Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf
2012-12-01
The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics.
In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance
Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf
2012-01-01
The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics. PMID:22990416
K.M. Jenkins; S.V. Diehl; C.A. Clausen; F. Green
2011-01-01
Brown-rot fungi produce oxalate in large amounts; however, levels of accumulation and function vary by species. Copper-tolerant fungi, like Antrodia radiculosa, produce and accumulate high levels of oxalate in response to copper. Oxalate biosynthesis in copper-tolerant fungi has been linked to the glyoxylate and tricarboxylic acid (TCA) cycles. Within these two cycles...
Functional Study of the Vitamin K Cycle Enzymes in Live Cells
Tie, J.-K.; Stafford, D.W.
2018-01-01
Vitamin K-dependent carboxylation, an essential posttranslational modification catalyzed by gamma-glutamyl carboxylase, is required for the biological functions of proteins that control blood coagulation, vascular calcification, bone metabolism, and other important physiological processes. Concomitant with carboxylation, reduced vitamin K (KH2) is oxidized to vitamin K epoxide (KO). KO must be recycled back to KH2 by the enzymes vitamin K epoxide reductase and vitamin K reductase in a pathway known as the vitamin K cycle. Our current knowledge about the enzymes of the vitamin K cycle is mainly based on in vitro studies of each individual enzymes under artificial conditions, which are of limited usefulness in understanding how the complex carboxylation process is carried out in the physiological environment. In this chapter, we review the current in vitro activity assays for vitamin K cycle enzymes. We describe the rationale, establishment, and application of cell-based assays for the functional study of these enzymes in the native cellular milieu. In these cell-based assays, different vitamin K-dependent proteins were designed and stably expressed in mammalian cells as reporter proteins to accommodate the readily used enzyme-linked immunosorbent assay for carboxylation efficiency evaluation. Additionally, recently emerged genome-editing techniques TALENs and CRISPR-Cas9 were used to knock out the endogenous enzymes in the reporter cell lines to eliminate the background. These cell-based assays are easy to scale up for high-throughput screening of inhibitors of vitamin K cycle enzymes and have been successfully used to clarify the genotypes and their clinical phenotypes of enzymes of the vitamin K cycle. PMID:28065270
Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen
2018-01-01
Maca ( Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo . Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm . Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2 , Fh , and Mdh2 . In addition, the lipid
Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen
2018-01-01
Maca (Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo. Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm. Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2, Fh, and Mdh2. In addition, the lipid
Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang
2018-07-15
Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.
Lipotoxicity in steatohepatitis occurs despite an increase in tricarboxylic acid cycle activity
Patterson, Rainey E.; Kalavalapalli, Srilaxmi; Williams, Caroline M.; Nautiyal, Manisha; Mathew, Justin T.; Martinez, Janie; Reinhard, Mary K.; McDougall, Danielle J.; Rocca, James R.; Yost, Richard A.; Cusi, Kenneth; Garrett, Timothy J.
2016-01-01
The hepatic tricarboxylic acid (TCA) cycle is central to integrating macronutrient metabolism and is closely coupled to cellular respiration, free radical generation, and inflammation. Oxidative flux through the TCA cycle is induced during hepatic insulin resistance, in mice and humans with simple steatosis, reflecting early compensatory remodeling of mitochondrial energetics. We hypothesized that progressive severity of hepatic insulin resistance and the onset of nonalcoholic steatohepatitis (NASH) would impair oxidative flux through the hepatic TCA cycle. Mice (C57/BL6) were fed a high-trans-fat high-fructose diet (TFD) for 8 wk to induce simple steatosis and NASH by 24 wk. In vivo fasting hepatic mitochondrial fluxes were determined by 13C-nuclear magnetic resonance (NMR)-based isotopomer analysis. Hepatic metabolic intermediates were quantified using mass spectrometry-based targeted metabolomics. Hepatic triglyceride accumulation and insulin resistance preceded alterations in mitochondrial metabolism, since TCA cycle fluxes remained normal during simple steatosis. However, mice with NASH had a twofold induction (P < 0.05) of mitochondrial fluxes (μmol/min) through the TCA cycle (2.6 ± 0.5 vs. 5.4 ± 0.6), anaplerosis (9.1 ± 1.2 vs. 16.9 ± 2.2), and pyruvate cycling (4.9 ± 1.0 vs. 11.1 ± 1.9) compared with their age-matched controls. Induction of the TCA cycle activity during NASH was concurrent with blunted ketogenesis and accumulation of hepatic diacylglycerols (DAGs), ceramides (Cer), and long-chain acylcarnitines, suggesting inefficient oxidation and disposal of excess free fatty acids (FFA). Sustained induction of mitochondrial TCA cycle failed to prevent accretion of “lipotoxic” metabolites in the liver and could hasten inflammation and the metabolic transition to NASH. PMID:26814015
Ramirez-Malule, Howard; Junne, Stefan; Nicolás Cruz-Bournazou, Mariano; Neubauer, Peter; Ríos-Estepa, Rigoberto
2018-05-01
Clavulanic acid (CA) is produced by Streptomyces clavuligerus (S. clavuligerus) as a secondary metabolite. Knowledge about the carbon flux distribution along the various routes that supply CA precursors would certainly provide insights about metabolic performance. In order to evaluate metabolic patterns and the possible accumulation of tricarboxylic acid (TCA) cycle intermediates during CA biosynthesis, batch and subsequent continuous cultures with steadily declining feed rates were performed with glycerol as the main substrate. The data were used to in silico explore the metabolic capabilities and the accumulation of metabolic intermediates in S. clavuligerus. While clavulanic acid accumulated at glycerol excess, it steadily decreased at declining dilution rates; CA synthesis stopped when glycerol became the limiting substrate. A strong association of succinate, oxaloacetate, malate, and acetate accumulation with CA production in S. clavuligerus was observed, and flux balance analysis (FBA) was used to describe the carbon flux distribution in the network. This combined experimental and numerical approach also identified bottlenecks during the synthesis of CA in a batch and subsequent continuous cultivation and demonstrated the importance of this type of methodologies for a more advanced understanding of metabolism; this potentially derives valuable insights for future successful metabolic engineering studies in S. clavuligerus.
The Krebs Uric Acid Cycle: A Forgotten Krebs Cycle.
Salway, Jack G
2018-05-25
Hans Kornberg wrote a paper entitled 'Krebs and his trinity of cycles' commenting that every school biology student knows of the Krebs cycle, but few know that Krebs discovered two other cycles. These are (i) the ornithine cycle (urea cycle), (ii) the citric acid cycle (tricarboxylic acid or TCA cycle), and (iii) the glyoxylate cycle that was described by Krebs and Kornberg. Ironically, Kornberg, codiscoverer of the 'glyoxylate cycle', overlooked a fourth Krebs cycle - (iv) the uric acid cycle. Copyright © 2018 Elsevier Ltd. All rights reserved.
Li, Xinjian; Jiang, Yuhui; Meisenhelder, Jill; Yang, Weiwei; Hawke, David H; Zheng, Yanhua; Xia, Yan; Aldape, Kenneth; He, Jie; Hunter, Tony; Wang, Liwei; Lu, Zhimin
2016-03-03
It is unclear how the Warburg effect that exemplifies enhanced glycolysis in the cytosol is coordinated with suppressed mitochondrial pyruvate metabolism. We demonstrate here that hypoxia, EGFR activation, and expression of K-Ras G12V and B-Raf V600E induce mitochondrial translocation of phosphoglycerate kinase 1 (PGK1); this is mediated by ERK-dependent PGK1 S203 phosphorylation and subsequent PIN1-mediated cis-trans isomerization. Mitochondrial PGK1 acts as a protein kinase to phosphorylate pyruvate dehydrogenase kinase 1 (PDHK1) at T338, which activates PDHK1 to phosphorylate and inhibit the pyruvate dehydrogenase (PDH) complex. This reduces mitochondrial pyruvate utilization, suppresses reactive oxygen species production, increases lactate production, and promotes brain tumorigenesis. Furthermore, PGK1 S203 and PDHK1 T338 phosphorylation levels correlate with PDH S293 inactivating phosphorylation levels and poor prognosis in glioblastoma patients. This work highlights that PGK1 acts as a protein kinase in coordinating glycolysis and the tricarboxylic acid (TCA) cycle, which is instrumental in cancer metabolism and tumorigenesis. Copyright © 2016 Elsevier Inc. All rights reserved.
Effects of tretinoin pretreatment on TCA chemical peel in guinea pig skin.
Kim, I. H.; Kim, H. K.; Kye, Y. C.
1996-01-01
This study was done to characterize the structural changes in the tretinoin pretreatment on trichloroacetic acid(TCA) chemical peel. In guinea pigs, the right halves pretreated with tretinoin and the left halves treated nothing were compared in their structural changes after TCA chemical peel. Epidermal thickness in the tretinoin pretreated group was almost the same in the first and second week. But epidermis of the TCA group increased continuously. In the first week, mitotic figures in the epidermis were more increased in the TCA group, but those in hair follicles were more increased in the tretinoin pretreated group. In the second week, mitotic figures in the epidermis were almost same in both group, but in hair follicles of the tretinoin pretreated group, mitotic figures were much more increased. In alcian blue staining, glycosaminoglycan was stained much more strongly in dermis of the TCA group in first week, but was more strongly stained in the tretinoin pretreated group in second week. On electron microscopic findings, the fibroblasts in upper dermis were larger and had plentier cytoplasm with more organelles in the tretinoin pretreated group. Conclusively, tretinoin pretreatment on TCA chemical peel sustained the effects of TCA longer and showed synergistic effects of TCA and induced enhanced wound healing. PMID:8878803
Viscous Design of TCA Configuration
NASA Technical Reports Server (NTRS)
Krist, Steven E.; Bauer, Steven X. S.; Campbell, Richard L.
1999-01-01
The goal in this effort is to redesign the baseline TCA configuration for improved performance at both supersonic and transonic cruise. Viscous analyses are conducted with OVERFLOW, a Navier-Stokes code for overset grids, using PEGSUS to compute the interpolations between overset grids. Viscous designs are conducted with OVERDISC, a script which couples OVERFLOW with the Constrained Direct Iterative Surface Curvature (CDISC) inverse design method. The successful execution of any computational fluid dynamics (CFD) based aerodynamic design method for complex configurations requires an efficient method for regenerating the computational grids to account for modifications to the configuration shape. The first section of this presentation deals with the automated regridding procedure used to generate overset grids for the fuselage/wing/diverter/nacelle configurations analysed in this effort. The second section outlines the procedures utilized to conduct OVERDISC inverse designs. The third section briefly covers the work conducted by Dick Campbell, in which a dual-point design at Mach 2.4 and 0.9 was attempted using OVERDISC; the initial configuration from which this design effort was started is an early version of the optimized shape for the TCA configuration developed by the Boeing Commercial Airplane Group (BCAG), which eventually evolved into the NCV design. The final section presents results from application of the Natural Flow Wing design philosophy to the TCA configuration.
Springsteen, Greg; Yerabolu, Jayasudhan Reddy; Nelson, Julia; Rhea, Chandler Joel; Krishnamurthy, Ramanarayanan
2018-01-08
The development of metabolic approaches towards understanding the origins of life, which have focused mainly on the citric acid (TCA) cycle, have languished-primarily due to a lack of experimentally demonstrable and sustainable cycle(s) of reactions. We show here the existence of a protometabolic analog of the TCA involving two linked cycles, which convert glyoxylate into CO 2 and produce aspartic acid in the presence of ammonia. The reactions proceed from either pyruvate, oxaloacetate or malonate in the presence of glyoxylate as the carbon source and hydrogen peroxide as the oxidant under neutral aqueous conditions and at mild temperatures. The reaction pathway demonstrates turnover under controlled conditions. These results indicate that simpler versions of metabolic cycles could have emerged under potential prebiotic conditions, laying the foundation for the appearance of more sophisticated metabolic pathways once control by (polymeric) catalysts became available.
Hohnholt, Michaela C; Blumrich, Eva-Maria; Waagepetersen, Helle S; Dringen, Ralf
2017-11-01
Metformin is an antidiabetic drug that is used daily by millions of patients worldwide. Metformin is able to cross the blood-brain barrier and has recently been shown to increase glucose consumption and lactate release in cultured astrocytes. However, potential effects of metformin on mitochondrial tricarboxylic acid (TCA) cycle metabolism in astrocytes are unknown. We investigated this by mapping 13 C labeling in TCA cycle intermediates and corresponding amino acids after incubation of primary rat astrocytes with [U- 13 C]glucose. The presence of metformin did not compromise the viability of cultured astrocytes during 4 hr of incubation, but almost doubled cellular glucose consumption and lactate release. Compared with control cells, the presence of metformin dramatically lowered the molecular 13 C carbon labeling (MCL) of the cellular TCA cycle intermediates citrate, α-ketoglutarate, succinate, fumarate, and malate, as well as the MCL of the TCA cycle intermediate-derived amino acids glutamate, glutamine, and aspartate. In addition to the total molecular 13 C labeling, analysis of the individual isotopomers of TCA cycle intermediates confirmed a severe decline in labeling and a significant lowering in TCA cycling ratio in metformin-treated astrocytes. Finally, the oxygen consumption of mitochondria isolated from metformin-treated astrocytes was drastically reduced in the presence of complex I substrates, but not of complex II substrates. These data demonstrate that exposure to metformin strongly impairs complex I-mediated mitochondrial respiration in astrocytes, which is likely to cause the observed decrease in labeling of mitochondrial TCA cycle intermediates and the stimulation of glycolytic lactate production. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Sulfate radicals enable a non-enzymatic Krebs cycle precursor
Keller, Markus A.; Kampjut, Domen; Harrison, Stuart A.; Ralser, Markus
2017-01-01
The evolutionary origins of the tricarboxylic acid cycle (TCA), or Krebs cycle, are so far unclear. Despite a few years ago, the existence of a simple non-enzymatic Krebs-cycle catalyst has been dismissed ‘as an appeal to magic’, citrate and other intermediates have meanwhile been discovered on a carbonaceous meteorite and do interconvert non-enzymatically. To identify the non-enzymatic Krebs cycle catalyst, we used combinatorial, quantitative high-throughput metabolomics to systematically screen iron and sulfate reaction milieus that orient on Archean sediment constituents. TCA cycle intermediates are found stable in water and in the presence of most iron and sulfate species, including simple iron-sulfate minerals. However, we report that TCA intermediates undergo 24 interconversion reactions in the presence of sulfate radicals that form from peroxydisulfate. The non-enzymatic reactions critically cover a topology as present in the Krebs cycle, the glyoxylate shunt and the succinic semialdehyde pathways. Assembled in a chemical network, the reactions achieve more than ninety percent carbon recovery. Our results show that a non-enzymatic precursor for the Krebs cycle is biologically sensible, efficient, and forms spontaneously in the presence of sulfate radicals. PMID:28584880
NASA Astrophysics Data System (ADS)
Guzman, Marcelo I.; Martin, Scot T.
2008-10-01
The carboxylic acids produced by the reductive tricarboxylic acid (rTCA) cycle are possibly a biosynthetic core of initial life, although several steps such as the reductive kinetics of oxaloacetate (OAA) to malate (MA) are problematic by conventional chemical routes. In this context, we studied the kinetics of this reaction as promoted by ZnS mineral photoelectrochemistry. The quantum efficiency φMA of MA production from the photoelectrochemical reduction of OAA followed φMA=0.13 [OAA] (2.1×10-3+[OAA])-1 and was independent of temperature (5 to 50°C). To evaluate the importance of this forward rate under a prebiotic scenario, we also studied the temperature-dependent rate of the backward thermal decarboxylation of OAA to pyruvate (PA), which followed an Arrhenius behavior as log (k-2)=11.74 4956/T, where k-2 is in units of s-1. These measured rates were employed in conjunction with the indirectly estimated carboxylation rate of PA to OAA to assess the possible importance of mineral photoelectrochemistry in the conversion of OAA to MA under several scenarios of prebiotic conditions on early Earth. As an example, our analysis shows that there is 90% efficiency with a forward velocity of 3 yr/cycle for the OAA→MA step of the rTCA cycle at 280 K. Efficiency and velocity both decrease for increasing temperature. These results suggest high viability for mineral photoelectrochemistry as an enzyme-free engine to drive the rTCA cycle through the early aeons of early Earth, at least for the investigated OAA→MA step.
Zhang, Shuyi; Bryant, Donald A
2015-05-29
Cyanobacteria are important photoautotrophic bacteria with extensive but variable metabolic capacities. The existence of the glyoxylate cycle, a variant of the TCA cycle, is still poorly documented in cyanobacteria. Previous studies reported the activities of isocitrate lyase and malate synthase, the key enzymes of the glyoxylate cycle in some cyanobacteria, but other studies concluded that these enzymes are missing. In this study the genes encoding isocitrate lyase and malate synthase from Chlorogloeopsis fritschii PCC 9212 were identified, and the recombinant enzymes were biochemically characterized. Consistent with the presence of the enzymes of the glyoxylate cycle, C. fritschii could assimilate acetate under both light and dark growth conditions. Transcript abundances for isocitrate lyase and malate synthase increased, and C. fritschii grew faster, when the growth medium was supplemented with acetate. Adding acetate to the growth medium also increased the yield of poly-3-hydroxybutyrate. When the genes encoding isocitrate lyase and malate synthase were expressed in Synechococcus sp. PCC 7002, the acetate assimilation capacity of the resulting strain was greater than that of wild type. Database searches showed that the genes for the glyoxylate cycle exist in only a few other cyanobacteria, all of which are able to fix nitrogen. This study demonstrates that the glyoxylate cycle exists in a few cyanobacteria, and that this pathway plays an important role in the assimilation of acetate for growth in one of those organisms. The glyoxylate cycle might play a role in coordinating carbon and nitrogen metabolism under conditions of nitrogen fixation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
ENZYME ACTIVITIES DURING THE ASEXUAL CYCLE OF NEUROSPORA CRASSA
Stine, G. J.
1968-01-01
Three enzymes, (a) nicotinamide adenine diphosphate-dependent glutamic dehydrogenase (NAD enzyme), (b) nictoinamide adenine triphosphate-dependent glutamic dehydrogenase (NADP enzyme), and (c) nicotinamide-adenine dinucleotidase (NADase), were measured in separate extracts of Neurospora crassa grown in Vogel's medium N and medium N + glutamate. Specific activities and total units per culture of each enzyme were determined at nine separate intervals phased throughout the asexual cycle. The separate dehydrogenases were lowest in the conidia, increased slowly during germination, and increased rapidly during logarithmic mycelial growth. The amounts of these enzymes present during germination were small when compared with those found later during the production of the conidiophores. The NAD enzyme may be necessary for pregermination synthesis. The NADP-enzyme synthesis was associated with the appearance of the germ tube. Although higher levels of the dehydrogenases in the conidiophores resulted in more enzyme being found in the differentiated conidia, the rate of germination was uneffected. The greatest activity for the NADase enzyme was associated with the conidia, early phases of germination, and later production of new conidia. NADase decreased significantly with the onset of logarithmic growth, remained low during the differentiation of conidiophores, and increased considerably as the conidiophores aged. PMID:4384627
Sudheesh, N P; Ajith, T A; Janardhanan, K K
2013-04-30
Decreased mitochondrial function has been suggested to be one of the important pathological events in isoproterenol (ISO)-induced cardiotoxicity. In this communication, we have evaluated the protective effect of Ganoderma lucidum against ISO induced cardiac toxicity and mitochondrial dysfunction. Cardiac toxicity was assessed by determining the activities of creatine kinase (CK) and lactate dehydrogenases (LDH) after subcutaneous injection of ISO (85 mg/kg) at an interval of 24h for 2 days. The animals were sacrificed 24h after last ISO administration. G. lucidum (100 and 250 mg/kg, p.o.) was given to the rats once daily for 15 days prior to the ISO challenge. Similarly, α-Tocopherol (100mg/kg, p.o) was kept as the standard. To assess the extent of cardiac mitochondrial damage, the activities of Krebs cycle dehydrogenases and mitochondrial complexes I, II, III, and IV as well as the level of ROS and mitochondrial membrane potential (ΔΨmt) were evaluated. Administration of G. lucidum and α-tocopherol significantly protected the elevated activities of CK and LDH. Further, the activities of mitochondrial enzymes and the level of ΔΨmt were significantly enhanced and the level of ROS was significantly declined in the G. lucidum and α-tocopherol treatments. The present study concluded that the cardiac mitochondrial enzymes are markedly declined by the ISO challenge and the administration G. lucidum and α-Tocopherol significantly protected mitochondria by preventing the decline of antioxidant status and ΔΨmt or by directly scavenging the free radicals. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-09-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of (13)C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ~6% of glucose metabolism in cortical neurons and ~4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that (13)C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons.
Li, Yong; Wang, Huixia; Dai, Futao; Li, Pei; Jin, Xin; Huang, Yan; Nie, Zhou; Yao, Shouzhuo
2016-12-15
Citrate synthase (CS) is one of the key metabolic enzymes in the Krebs tricarboxylic acid (TCA) cycle. It regulates energy generation in mitochondrial respiration by catalysing the reaction between oxaloacetic acid (OAA) and acetyl coenzyme A (Ac-CoA) to generate citrate and coenzyme A (CoA). CS has been shown to be a biomarker of neurological diseases and various kinds of cancers. Here, a label-free fluorescent assay has been developed for homogeneously detecting CS and its inhibitor based on the in situ generation of CoA-Au(I) co-ordination polymer (CP) and the fluorescence signal-on by SYBR Green II-stained CoA-Au(I) CP. Because of the unique property of the CoA-Au(I) CP, this CS activity assay method could achieve excellent selectivity and sensitivity, with a linear range from 0.0033 U/μL to 0.264 U/μL and a limit of detection to be 0.00165 U/μL. Meanwhile, this assay method has advantages of being facile and cost effective with quick detection. Moreover, based on this method, a biomimetic logic system was established by rationally exploiting the cascade enzymatic interactions in TCA cycle for chemical information processing. In the TCA cycle-derived logic system, an AND-AND-AND-cascaded gate was rigorously operated step by step in one pot, and is outputted by a label-free fluorescent signal with visualized readout. Copyright © 2016 Elsevier B.V. All rights reserved.
Meringer, Markus; Cleaves, H James
2017-12-13
The reverse tricarboxylic acid (rTCA) cycle has been explored from various standpoints as an idealized primordial metabolic cycle. Its simplicity and apparent ubiquity in diverse organisms across the tree of life have been used to argue for its antiquity and its optimality. In 2000 it was proposed that chemoinformatics approaches support some of these views. Specifically, defined queries of the Beilstein database showed that the molecules of the rTCA are heavily represented in such compound databases. We explore here the chemical structure "space," e.g. the set of organic compounds which possesses some minimal set of defining characteristics, of the rTCA cycle's intermediates using an exhaustive structure generation method. The rTCA's chemical space as defined by the original criteria and explored by our method is some six to seven times larger than originally considered. Acknowledging that each assumption in what is a defining criterion making the rTCA cycle special limits possible generative outcomes, there are many unrealized compounds which fulfill these criteria. That these compounds are unrealized could be due to evolutionary frozen accidents or optimization, though this optimization may also be for systems-level reasons, e.g., the way the pathway and its elements interface with other aspects of metabolism.
NASA Astrophysics Data System (ADS)
Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abu Youssef, Morsy A.; Assem, Rania
2014-09-01
The new [Ag(3AQ)2(TCA)]; (3AQ = 3-aminoquinoline and TCA = Trichloroacetate) complex is synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry, vibrational frequencies, gauge-including atomic orbital (GIAO) 1H chemical shift values of the free and coordinated 3AQ in the ground state have been calculated by using DFT/B3LYP method. The TD-DFT results of the [Ag(3AQ)2(TCA)] complex showed a π-π* transition band at 240.3-242.6 nm (f = 0.1334-0.1348) which has longer wavelength and lower absorption intensity than that for the free 3AQ (233.2 nm, f = 0.3958). Dipole moment, polarizability and HOMO-LUMO gap values predicted better nonlinear optical properties (NLO) for the [Ag(3AQ)2(TCA)] than the 3AQ ligand. NBO analysis has been used to predict the most accurate Lewis structure of the studied molecules. The energies of the different intramolecular charge transfer (ICT) interactions within the studied molecules were estimated using second order perturbation theory.
The Tricarboxylic Acid Cycle, an Ancient Metabolic Network with a Novel Twist
Mailloux, Ryan J.; Bériault, Robin; Lemire, Joseph; Singh, Ranji; Chénier, Daniel R.; Hamel, Robert D.; Appanna, Vasu D.
2007-01-01
The tricarboxylic acid (TCA) cycle is an essential metabolic network in all oxidative organisms and provides precursors for anabolic processes and reducing factors (NADH and FADH2) that drive the generation of energy. Here, we show that this metabolic network is also an integral part of the oxidative defence machinery in living organisms and α-ketoglutarate (KG) is a key participant in the detoxification of reactive oxygen species (ROS). Its utilization as an anti-oxidant can effectively diminish ROS and curtail the formation of NADH, a situation that further impedes the release of ROS via oxidative phosphorylation. Thus, the increased production of KG mediated by NADP-dependent isocitrate dehydrogenase (NADP-ICDH) and its decreased utilization via the TCA cycle confer a unique strategy to modulate the cellular redox environment. Activities of α-ketoglutarate dehydrogenase (KGDH), NAD-dependent isocitrate dehydrogenase (NAD-ICDH), and succinate dehydrogenase (SDH) were sharply diminished in the cellular systems exposed to conditions conducive to oxidative stress. These findings uncover an intricate link between TCA cycle and ROS homeostasis and may help explain the ineffective TCA cycle that characterizes various pathological conditions and ageing. PMID:17668068
Evaluation results of xTCA equipment for HEP experiments at CERN
NASA Astrophysics Data System (ADS)
Di Cosmo, M.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.; Vichoudis, P.
2013-12-01
The MicroTCA and AdvancedTCA industry standards are candidate modular electronic platforms for the upgrade of the current generation of high energy physics experiments. The PH-ESE group at CERN launched in 2011 the xTCA evaluation project with the aim of performing technical evaluations and eventually providing support for commercially available components. Different devices from different vendors have been acquired, evaluated and interoperability tests have been performed. This paper presents the test procedures and facilities that have been developed and focuses on the evaluation results including electrical, thermal and interoperability aspects.
Orthotopic Liver Transplantation for Urea Cycle Enzyme Deficiency
Todo, Satoru; Starzl, Thomas E.; Tzakis, Andreas; Benkov, Keith J.; Kalousek, Frantisek; Saheki, Takeyori; Tanikawa, Kyuichi; Fenton, Wayne A.
2010-01-01
Hyperammonemia, abnormalities in plasma amino acids and abnormalities of standard liver functions were corrected by orthotopic liver transplantation in a 14-day-old boy with carbamyl phosphate synthetase-I deficiency and in a 35-yr-old man with argininosuccinic acid synthetase deficiency. The first patient had high plasma glutamine levels and no measureable citrulline, whereas citrulline values were markedly increased in Patient 2. Enzyme analysis of the original livers showed undetectable activity of carbamyl phosphate synthetase-I in Patient 1 and arginosuccinic acid synthetase in Patient 2. Both patients were comatose before surgery. Intellectual recovery of patient 1 has been slightly retarded because of a brain abscess caused by Aspergillus infection after surgery. Both patients are well at 34 and 40 mo, respectively, after surgery. Our experience has shown that orthotopic liver transplantation corrects the life-threatening metabolic abnormalities caused by deficiencies in the urea cycle enzymes carbamyl phosphate synthetase-I and arginosuccinic acid synthetase. Seven other patients–six with ornithine transcarbamylase deficiency and another with carbamyl phosphate synthetase-I deficiency–are known to have been treated elsewhere with liver transplantation 1½ yr or longer ago. Four of these seven recipients also are well, with follow-ups of 1½ to 5 yr. Thus liver transplantation corrects the metabolic abnormalities of three of the six urea cycle enzyme deficiencies, and presumably would correct all. PMID:1544622
Trivedi, Amit Kumar; Malik, Shalie; Rani, Sangeeta; Kumar, Vinod
2015-06-01
Eukaryotic cells produce chemical energy in the form of ATP by oxidative phosphorylation of metabolic fuels via a series of enzyme mediated biochemical reactions. We propose that the rates of these reactions are altered, as per energy needs of the seasonal metabolic states in avian migrants. To investigate this, blackheaded buntings were photoperiodically induced with non-migratory, premigratory, migratory and post-migratory phenotypes. High plasma levels of free fatty acids, citrate (an intermediate that begins the TCA cycle) and malate dehydrogenase (mdh, an enzyme involved at the end of the TCA cycle) confirmed increased availability of metabolic reserves and substrates to the TCA cycle during the premigratory and migratory states, respectively. Further, daily expression pattern of genes coding for enzymes involved in the oxidative decarboxylation of pyruvate to acetyl-CoA (pdc and pdk) and oxidative phosphorylation in the TCA cycle (cs, odgh, sdhd and mdh) was monitored in the hypothalamus and liver. Reciprocal relationship between pdc and pdk expressions conformed with the altered requirements of acetyl-CoA for the TCA cycle in different metabolic states. Except for pdk, all genes had a daily expression pattern, with high mRNA expression during the day in the premigratory/migratory phenotypes, and at night (cs, odhg, sdhd and mdh) in the nonmigratory phenotype. Differences in mRNA expression patterns of pdc, sdhd and mdh, but not of pdk, cs and odgh, between the hypothalamus and liver indicated a tissue dependent metabolism in buntings. These results suggest the adaptation of oxidative phosphorylation pathway(s) at gene levels to the seasonal alternations in metabolism in migratory songbirds. Copyright © 2015 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolar, Bradley B.; Herrmann, Jonathan; Bargar, John R.
In this paper, knowledge of the molecular ecology and environmental determinants of ammonia-oxidizing organisms is critical to understanding and predicting the global nitrogen (N) and carbon cycles, but an incomplete biochemical picture hinders in vitro studies of N-cycling enzymes. Although an integrative structural and dynamic characterization at the atomic scale would advance our understanding of function tremendously, structural knowlede of key N-cycling enzymes from ecologically-relevant ammonia oxidizers is unfortunately extremely limited. Here, we discuss the challenges and opportunities for examining the ecology of ammonia-oxidizing organisms, particularly uncultivated Thaumarchaeota, though (meta)genome-driven structural biology of the enzymes ammonia monooxygenase (AMO) andmore » nitrite reductase (NirK).« less
Tolar, Bradley B.; Herrmann, Jonathan; Bargar, John R.; ...
2017-07-05
In this paper, knowledge of the molecular ecology and environmental determinants of ammonia-oxidizing organisms is critical to understanding and predicting the global nitrogen (N) and carbon cycles, but an incomplete biochemical picture hinders in vitro studies of N-cycling enzymes. Although an integrative structural and dynamic characterization at the atomic scale would advance our understanding of function tremendously, structural knowlede of key N-cycling enzymes from ecologically-relevant ammonia oxidizers is unfortunately extremely limited. Here, we discuss the challenges and opportunities for examining the ecology of ammonia-oxidizing organisms, particularly uncultivated Thaumarchaeota, though (meta)genome-driven structural biology of the enzymes ammonia monooxygenase (AMO) andmore » nitrite reductase (NirK).« less
Tolar, Bradley B; Herrmann, Jonathan; Bargar, John R; van den Bedem, Henry; Wakatsuki, Soichi; Francis, Christopher A
2017-10-01
Knowledge of the molecular ecology and environmental determinants of ammonia-oxidizing organisms is critical to understanding and predicting the global nitrogen (N) and carbon cycles, but an incomplete biochemical picture hinders in vitro studies of N-cycling enzymes. Although an integrative structural and dynamic characterization at the atomic scale would advance our understanding of function tremendously, structural knowledge of key N-cycling enzymes from ecologically relevant ammonia oxidizers is unfortunately extremely limited. Here, we discuss the challenges and opportunities for examining the ecology of ammonia-oxidizing organisms, particularly uncultivated Thaumarchaeota, through (meta)genome-driven structural biology of the enzymes ammonia monooxygenase (AMO) and nitrite reductase (NirK). © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Neuroprotection of ebselen against ischemia/reperfusion injury involves GABA shunt enzymes.
Seo, Jeong Yeol; Lee, Choong Hyun; Cho, Jun Hwi; Choi, Jung Hoon; Yoo, Ki-Yeon; Kim, Dae Won; Park, Ok Kyu; Li, Hua; Choi, Soo Young; Hwang, In Koo; Won, Moo-Ho
2009-10-15
Seleno-organic compound, ebselen (2-phenyl-1,2-benzisoselenazol-3(2H)-one), is a substrate with radical-scavenging activity. In this study, we observed the neuroprotective effects of ebselen against ischemic damage and on GABA shunt enzymes such as glutamic acid decarboxylase 67 (GAD67), GABA transaminse (GABA-T) and succinic semialdehyde dehydrogenase (SSADH) in the hippocampal CA1 region after 5 min of transient forebrain ischemia in gerbils. For this, vehicle (physiological saline) or ebselen was administered 30 min before or after ischemia/reperfusion and sacrificed 4 days after ischemia/reperfusion. The administration of ebselen significantly reduced the neuronal death in the CA1 region induced by ischemia/reperfusion. In addition, treatment with ebselen markedly elevated GAD67, GABA-T and SSADH immunoreactivity and their protein levels compared to that in the vehicle-treated group, respectively. These results suggest that ebselen protects neurons from ischemic damage via control of the expressions of GABA shunt enzymes to enter the TCA cycle.
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-01-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-13C]glucose or [3-13C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of 13C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ∼6% of glucose metabolism in cortical neurons and ∼4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that 13C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons. PMID:22714050
Tcherkez, Guillaume; Mahé, Aline; Gauthier, Paul; Mauve, Caroline; Gout, Elizabeth; Bligny, Richard; Cornic, Gabriel; Hodges, Michael
2009-01-01
While the possible importance of the tricarboxylic acid (TCA) cycle reactions for leaf photosynthesis operation has been recognized, many uncertainties remain on whether TCA cycle biochemistry is similar in the light compared with the dark. It is widely accepted that leaf day respiration and the metabolic commitment to TCA decarboxylation are down-regulated in illuminated leaves. However, the metabolic basis (i.e. the limiting steps involved in such a down-regulation) is not well known. Here, we investigated the in vivo metabolic fluxes of individual reactions of the TCA cycle by developing two isotopic methods, 13C tracing and fluxomics and the use of H/D isotope effects, with Xanthium strumarium leaves. We provide evidence that the TCA “cycle” does not work in the forward direction like a proper cycle but, rather, operates in both the reverse and forward directions to produce fumarate and glutamate, respectively. Such a functional division of the cycle plausibly reflects the compromise between two contrasted forces: (1) the feedback inhibition by NADH and ATP on TCA enzymes in the light, and (2) the need to provide pH-buffering organic acids and carbon skeletons for nitrate absorption and assimilation. PMID:19675152
Go, Younghoon; Jeong, Ji Yun; Jeoung, Nam Ho; Jeon, Jae-Han; Park, Bo-Yoon; Kang, Hyeon-Ji; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Ham, Hye Jin; Kim, Byung-Gyu; Park, Keun-Gyu; Park, So Young; Lee, Chul-Ho; Choi, Cheol Soo; Park, Tae-Sik; Lee, W N Paul; Harris, Robert A; Lee, In-Kyu
2016-10-01
Hepatic steatosis is associated with increased insulin resistance and tricarboxylic acid (TCA) cycle flux, but decreased ketogenesis and pyruvate dehydrogenase complex (PDC) flux. This study examined whether hepatic PDC activation by inhibition of pyruvate dehydrogenase kinase 2 (PDK2) ameliorates these metabolic abnormalities. Wild-type mice fed a high-fat diet exhibited hepatic steatosis, insulin resistance, and increased levels of pyruvate, TCA cycle intermediates, and malonyl-CoA but reduced ketogenesis and PDC activity due to PDK2 induction. Hepatic PDC activation by PDK2 inhibition attenuated hepatic steatosis, improved hepatic insulin sensitivity, reduced hepatic glucose production, increased capacity for β-oxidation and ketogenesis, and decreased the capacity for lipogenesis. These results were attributed to altered enzymatic capacities and a reduction in TCA anaplerosis that limited the availability of oxaloacetate for the TCA cycle, which promoted ketogenesis. The current study reports that increasing hepatic PDC activity by inhibition of PDK2 ameliorates hepatic steatosis and insulin sensitivity by regulating TCA cycle anaplerosis and ketogenesis. The findings suggest PDK2 is a potential therapeutic target for nonalcoholic fatty liver disease. © 2016 by the American Diabetes Association.
Aydın, Birsen
2017-03-01
Argan oil (AO) is rich in minor compounds such as polyphenols and tocopherols which are powerful antioxidants. Acrylamide (ACR) has been classified as a neurotoxic agent in animals and humans. Mitochondrial oxidative stress and dysfunction is one of the most probable molecular mechanisms of neurodegenerative diseases. Female Sprague Dawley rats were exposed to ACR (50mg/kg i.p. three times a week), AO (6ml/kg,o.p, per day) or together for 30days. The activities of cytosolic enzymes such as xanthine oxidase (XO), glucose 6-phosphate dehydrogenase (G6PDH), glutathione-S-transferase (GST), mitochondrial oxidative stress, oxidative phosphorylation (OXPHOS) and tricarboxylic acid cycle (TCA) enzymes, mitochondrial metabolic function, adenosine triphosphate (ATP) level and acetylcholinesterase (AChE) activity were assessed in rat brain. Cytosolic and mitochondrial antioxidant enzymes were significantly diminished in the brains of rats treated with ACR compared to those in control. Besides, ACR treatment resulted in a significant reduction in brain ATP level, mitochondrial metabolic function, OXPHOS and TCA enzymes. Administration of AO restored both the cytosolic and mitochondrial oxidative stress by normalizing nicotinamide adenine dinucleotide phosphate (NADPH) generating enzymes. In addition, improved mitochondrial function primarily enhancing nicotinamide adenine dinucleotide (NADH) generated enzymes activities and ATP level in the mitochondria. The reason for AO's obvious beneficial effects in this study may be due to synergistic effects of its different bioactive compounds which is especially effective on mitochondria. Modulation of the brain mitochondrial functions and antioxidant systems by AO may lead to the development of new mitochondria-targeted antioxidants in the future. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
NF-κB controls four genes encoding core enzymes of tricarboxylic acid cycle.
Zhou, Fei; Xu, Xinhui; Wu, Jian; Wang, Danyang; Wang, Jinke
2017-07-20
NF-κB may promote tumor progression by altering cell metabolism. Hence, finding its target genes that are involved in cell metabolism is helpful for understanding its role in tumor growth. Here we discovered four metabolism-related target genes of this transcription factor. By analyzing a chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) data that characterizing the global binding sites (BSs) of NF-κB RelA in the TNFα-stimulated HeLa cells, we found that four genes that encode core enzymes of the tricarboxylic acid (TCA) cycle, including IDH1, IDH3A, ACO2, and SUCLA2, were multiply bound by this transcription factor. The subsequent bioinformatic analysis revealed that the NF-κB BSs contained many canonical κB sequences and the NF-κB-like DNA-binding motifs. Detection of ChIPed DNA with polymerase chain reaction (ChIP-PCR) also indicated that the NF-κB BSs were bound by NF-κB in both TNFα-treated HeLa and HepG2 cells. The reporter construct showed that the NF-κB BSs could activate the luciferase expression in cells in a NF-κB-specific manner. The quantitative PCR and Western blot detections demonstrated that NF-κB could regulate the expressions of IDH1, IDH3A, and ACO2 genes at both mRNA and protein levels and that of SUCLA2 gene at mRNA level in the TNFα-treated HeLa and HepG2 cells. Based on these investigations we identified the four genes as new target genes of NF-κB. The finding provides new insights into the role of NF-κB in cellular energetic metabolism, which may be beneficial for understanding the metabolic physiology of tumor growth. Copyright © 2017. Published by Elsevier B.V.
Wu, Fei; Pelster, Lindsey N; Minteer, Shelley D
2015-01-25
Dynamics of metabolon formation in mitochondria was probed by studying diffusional motion of two sequential Krebs cycle enzymes in a microfluidic channel. Enhanced directional co-diffusion of both enzymes against a substrate concentration gradient was observed in the presence of intermediate generation. This reveals a metabolite directed compartmentation of metabolic pathways.
Central metabolism controls transcription of a virulence gene regulator in Vibrio cholerae
Minato, Yusuke; Fassio, Sara R.; Wolfe, Alan J.
2013-01-01
ToxT is the central regulatory protein involved in activation of the main virulence genes in Vibrio cholerae. We have identified transposon insertions in central metabolism genes, whose disruption increases toxT transcription. These disrupted genes encode the primary respiration-linked sodium pump (NADH : ubiquinone oxidoreductase or NQR) and certain tricarboxylic acid (TCA) cycle enzymes. Observations made following stimulation of respiration in the nqr mutant or chemical inhibition of NQR activity in the TCA cycle mutants led to the hypothesis that NQR affects toxT transcription via the TCA cycle. That toxT transcription increased when the growth medium was supplemented with citrate, but decreased with oxaloacetate, focused our attention on the TCA cycle substrate acetyl-CoA and its non-TCA cycle metabolism. Indeed, both the nqr and the TCA cycle mutants increased acetate excretion. A similar correlation between acetate excretion and toxT transcription was observed in a tolC mutant and upon amino acid (NRES) supplementation. As acetate and its tendency to decrease pH exerted no strong effect on toxT transcription, and because disruption of the major acetate excretion pathway increased toxT transcription, we propose that toxT transcription is regulated by either acetyl-CoA or some close derivative. PMID:23429745
Beyond Vmax and Km: How details of enzyme function influence geochemical cycles
NASA Astrophysics Data System (ADS)
Steen, A. D.
2015-12-01
Enzymes catalyze the vast majority of chemical reactions relevant to geomicrobiology. Studies of the activities of enzymes in environmental systems often report Vmax (the maximum possible rate of reaction; often proportional to the concentration of enzymes in the system) and sometimes Km (a measure of the affinity between enzymes and their substrates). However, enzyme studies - particularly those related to enzymes involved in organic carbon oxidation - are often limited to only those parameters, and a relatively limited and mixed set of enzymes. Here I will discuss some novel methods to assay and characterize the specific sets of enzymes that may be important to the carbon cycle in aquatic environments. First, kinetic experiments revealed the collective properties of the complex mixtures of extracellular peptidases that occur where microbial communities are diverse. Crystal structures combined with biochemical characterization of specific enzymes can yield more detailed information about key steps in organic carbon transformations. These new techniques have the potential to provide mechanistic grounding to geomicrobiological models.
Design of an AdvancedTCA board management controller (IPMC)
NASA Astrophysics Data System (ADS)
Mendez, J.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.
2017-03-01
The AdvancedTCA (ATCA) standard has been selected as the hardware platform for the upgrade of the back-end electronics of the CMS and ATLAS experiments of the Large Hadron Collider (LHC) . In this context, the electronic systems for experiments group at CERN is running a project to evaluate, specify, design and support xTCA equipment. As part of this project, an Intelligent Platform Management Controller (IPMC) for ATCA blades, based on a commercial solution, has been designed to be used on existing and future ATCA blades. This paper reports on the status of this project presenting the hardware and software developments.
Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.
2011-01-01
Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293
Asparagine plays a critical role in regulating cellular adaptation to glutamine depletion.
Zhang, Ji; Fan, Jing; Venneti, Sriram; Cross, Justin R; Takagi, Toshimitsu; Bhinder, Bhavneet; Djaballah, Hakim; Kanai, Masayuki; Cheng, Emily H; Judkins, Alexander R; Pawel, Bruce; Baggs, Julie; Cherry, Sara; Rabinowitz, Joshua D; Thompson, Craig B
2014-10-23
Many cancer cells consume large quantities of glutamine to maintain TCA cycle anaplerosis and support cell survival. It was therefore surprising when RNAi screening revealed that suppression of citrate synthase (CS), the first TCA cycle enzyme, prevented glutamine-withdrawal-induced apoptosis. CS suppression reduced TCA cycle activity and diverted oxaloacetate, the substrate of CS, into production of the nonessential amino acids aspartate and asparagine. We found that asparagine was necessary and sufficient to suppress glutamine-withdrawal-induced apoptosis without restoring the levels of other nonessential amino acids or TCA cycle intermediates. In complete medium, tumor cells exhibiting high rates of glutamine consumption underwent rapid apoptosis when glutamine-dependent asparagine synthesis was suppressed, and expression of asparagine synthetase was statistically correlated with poor prognosis in human tumors. Coupled with the success of L-asparaginase as a therapy for childhood leukemia, the data suggest that intracellular asparagine is a critical suppressor of apoptosis in many human tumors.
van Rossum, Harmen M.; Kozak, Barbara U.; Niemeijer, Matthijs S.; Duine, Hendrik J.; Luttik, Marijke A. H.; Boer, Viktor M.; Kötter, Peter; Daran, Jean-Marc G.; van Maris, Antonius J. A.
2016-01-01
Pyruvate and acetyl-coenzyme A, located at the interface between glycolysis and TCA cycle, are important intermediates in yeast metabolism and key precursors for industrially relevant products. Rational engineering of their supply requires knowledge of compensatory reactions that replace predominant pathways when these are inactivated. This study investigates effects of individual and combined mutations that inactivate the mitochondrial pyruvate-dehydrogenase (PDH) complex, extramitochondrial citrate synthase (Cit2) and mitochondrial CoA-transferase (Ach1) in Saccharomyces cerevisiae. Additionally, strains with a constitutively expressed carnitine shuttle were constructed and analyzed. A predominant role of the PDH complex in linking glycolysis and TCA cycle in glucose-grown batch cultures could be functionally replaced by the combined activity of the cytosolic PDH bypass and Cit2. Strongly impaired growth and a high incidence of respiratory deficiency in pda1Δ ach1Δ strains showed that synthesis of intramitochondrial acetyl-CoA as a metabolic precursor requires activity of either the PDH complex or Ach1. Constitutive overexpression of AGP2, HNM1, YAT2, YAT1, CRC1 and CAT2 enabled the carnitine shuttle to efficiently link glycolysis and TCA cycle in l-carnitine-supplemented, glucose-grown batch cultures. Strains in which all known reactions at the glycolysis-TCA cycle interface were inactivated still grew slowly on glucose, indicating additional flexibility at this key metabolic junction. PMID:26895788
Barenholz, Uri; Davidi, Dan; Reznik, Ed; Bar-On, Yinon; Antonovsky, Niv; Noor, Elad; Milo, Ron
2017-01-01
A set of chemical reactions that require a metabolite to synthesize more of that metabolite is an autocatalytic cycle. Here, we show that most of the reactions in the core of central carbon metabolism are part of compact autocatalytic cycles. Such metabolic designs must meet specific conditions to support stable fluxes, hence avoiding depletion of intermediate metabolites. As such, they are subjected to constraints that may seem counter-intuitive: the enzymes of branch reactions out of the cycle must be overexpressed and the affinity of these enzymes to their substrates must be relatively weak. We use recent quantitative proteomics and fluxomics measurements to show that the above conditions hold for functioning cycles in central carbon metabolism of E. coli. This work demonstrates that the topology of a metabolic network can shape kinetic parameters of enzymes and lead to seemingly wasteful enzyme usage. DOI: http://dx.doi.org/10.7554/eLife.20667.001 PMID:28169831
Carrasco-Pozo, Catalina
2017-01-01
Abstract Temporal lobe epilepsy is a common form of adult epilepsy and shows high resistance to treatment. Increasing evidence has suggested that metabolic dysfunction contributes to the development of seizures, with previous studies indicating impairments in brain glucose metabolism. Here we aim to elucidate which pathways involved in glucose metabolism are impaired, by tracing the hippocampal metabolism of injected [U-13C]glucose (i.p.) during the chronic stage of the pilocarpine-status epilepticus mouse model of epilepsy. The enrichment of 13C in the intermediates of glycolysis and the TCA cycle were quantified in hippocampal extracts using liquid chromatography–tandem mass spectroscopy, along with the measurement of the activities of enzymes in each pathway. We show that there is reduced incorporation of 13C in the intermediates of glycolysis, with the percentage enrichment of all downstream intermediates being highly correlated with those of glucose 6-phosphate. Furthermore, the activities of all enzymes in this pathway including hexokinase and phosphofructokinase were unaltered, suggesting that glucose uptake is reduced in this model without further impairments in glycolysis itself. The key findings were 33% and 55% losses in the activities of pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase, respectively, along with reduced 13C enrichment in TCA cycle intermediates. This lower 13C enrichment is best explained in part by the reduced enrichment in glycolytic intermediates, whereas the reduction of key TCA cycle enzyme activity indicates that TCA cycling is also impaired in the hippocampal formation. Together, these data suggest that multitarget approaches may be necessary to restore metabolism in the epileptic brain. PMID:28303258
Doi, Yuki; Shimizu, Motoyuki; Fujita, Tomoya; Nakamura, Akira; Takizawa, Noboru
2014-01-01
We identified the extremely nitrite-tolerant bacterium Achromobacter denitrificans YD35 that can grow in complex medium containing 100 mM nitrite (NO2−) under aerobic conditions. Nitrite induced global proteomic changes and upregulated tricarboxylate (TCA) cycle enzymes as well as antioxidant proteins in YD35. Transposon mutagenesis generated NO2−-hypersensitive mutants of YD35 that had mutations at genes for aconitate hydratase and α-ketoglutarate dehydrogenase in the TCA cycle and a pyruvate dehydrogenase (Pdh) E1 component, indicating the importance of TCA cycle metabolism to NO2− tolerance. A mutant in which the pdh gene cluster was disrupted (Δpdh mutant) could not grow in the presence of 100 mM NO2−. Nitrite decreased the cellular NADH/NAD+ ratio and the cellular ATP level. These defects were more severe in the Δpdh mutant, indicating that Pdh contributes to upregulating cellular NADH and ATP and NO2−-tolerant growth. Exogenous acetate, which generates acetyl coenzyme A and then is metabolized by the TCA cycle, compensated for these defects caused by disruption of the pdh gene cluster and those caused by NO2−. These findings demonstrate a link between NO2− tolerance and pyruvate/acetate metabolism through the TCA cycle. The TCA cycle mechanism in YD35 enhances NADH production, and we consider that this contributes to a novel NO2−-tolerating mechanism in this strain. PMID:24413603
He, Lizhong; Li, Bin; Lu, Xiaomin; Yuan, Lingyun; Yang, Yanjuan; Yuan, Yinghui; Du, Jing; Guo, Shirong
2015-01-01
Hypoxia induces plant stress, particularly in cucumber plants under hydroponic culture. In plants, calcium is involved in stress signal transmission and growth. The ultimate goal of this study was to shed light on the mechanisms underlying the effects of exogenous calcium on the mitochondrial antioxidant system, the activity of respiratory metabolism enzymes, and ion transport in cucumber (Cucumis sativus L. cv. Jinchun No. 2) roots under hypoxic conditions. Our experiments revealed that exogenous calcium reduces the level of reactive oxygen species (ROS) and increases the activity of antioxidant enzymes in mitochondria under hypoxia. Exogenous calcium also enhances the accumulation of enzymes involved in glycolysis and the tricarboxylic acid (TCA) cycle. We utilized fluorescence and ultrastructural cytochemistry methods to observe that exogenous calcium increases the concentrations of Ca2+ and K+ in root cells by increasing the activity of plasma membrane (PM) H+-ATPase and tonoplast H+-ATPase and H+-PPase. Overall, our results suggest that hypoxic stress has an immediate and substantial effect on roots. Exogenous calcium improves metabolism and ion transport in cucumber roots, thereby increasing hypoxia tolerance in cucumber. PMID:26304855
He, Lizhong; Li, Bin; Lu, Xiaomin; Yuan, Lingyun; Yang, Yanjuan; Yuan, Yinghui; Du, Jing; Guo, Shirong
2015-08-25
Hypoxia induces plant stress, particularly in cucumber plants under hydroponic culture. In plants, calcium is involved in stress signal transmission and growth. The ultimate goal of this study was to shed light on the mechanisms underlying the effects of exogenous calcium on the mitochondrial antioxidant system, the activity of respiratory metabolism enzymes, and ion transport in cucumber (Cucumis sativus L. cv. Jinchun No. 2) roots under hypoxic conditions. Our experiments revealed that exogenous calcium reduces the level of reactive oxygen species (ROS) and increases the activity of antioxidant enzymes in mitochondria under hypoxia. Exogenous calcium also enhances the accumulation of enzymes involved in glycolysis and the tricarboxylic acid (TCA) cycle. We utilized fluorescence and ultrastructural cytochemistry methods to observe that exogenous calcium increases the concentrations of Ca(2+) and K(+) in root cells by increasing the activity of plasma membrane (PM) H(+)-ATPase and tonoplast H(+)-ATPase and H(+)-PPase. Overall, our results suggest that hypoxic stress has an immediate and substantial effect on roots. Exogenous calcium improves metabolism and ion transport in cucumber roots, thereby increasing hypoxia tolerance in cucumber.
Enzymes of the γ-Glutamyl Cycle in the Ciliary Body and Lens
Ross, Leonard L.; Barber, Lee; Tate, Suresh S.; Meister, Alton
1973-01-01
The enzymes of the γ-glutamyl cycle have been found in rabbit ciliary body and, except for 5-oxoprolinase, also in the ocular lens. Histochemical studies show that γ-glutamyl transpeptidase is localized mainly in the basal portions of the epithelial cells of the ciliary body; the findings are similar to those observed in the chloroid plexuses. The histochemical staining reaction in the ciliary epithelium is more intense than in the chloroid plexus, intestine, and kidney. γ-Glutamyl transpeptidase staining activity in the epithelium of the intestinal and renal proximal convoluted tubules is confined to the microvillus border. Moderate transpeptidase activity was found in the cytoplasm of nonpigmented epithelial cells of the iris at the posterior pupillary margin. The histochemical and enzyme activity studies are consistent with the thesis that the γ-glutamyl cycle functions in transport of amino acids across the blood-aqueous humor barrier. Images PMID:4152058
Dos Santos, Amilton Cesar; Conley, Alan James; de Oliveira, Moacir Franco; Oliveira, Gleidson Benevides; Viana, Diego Carvalho; Assis Neto, Antônio Chaves de
2017-04-24
The synthesis of sex steroids is controlled by several enzymes such as17α-hydroxylase cytochrome P450 (P450c17) catalyzing androgen synthesis and aromatase cytochrome P450 (P450arom) catalyzing estrogen synthesis, both of which must complex with the redox partner NADPH-cytochrome P450 oxidoreductase (CPR) for activity. Previous studies have identified expression of steroidogenic enzymes in vaginal tissue, suggesting local sex steroid synthesis. The current studies investigate P450c17, P450aromatase and CPR expression in vaginal mucosa of Galea spixii (Spix cavy) by immuno-histochemical and western immunoblot analyses. Stages of estrous cyclicity were monitored by vaginal exfoliative cytology. After euthanasia, vaginal tissues were retrieved, fixed and frozen at diestrus, proestrus, estrus and metestrus. The ovaries and testis were used as positive control tissues for immunohistochemistry. Data from cytological study allowed identification of different estrous cycle phases. Immunohistochemical analysis showed different sites of expression of steroidogenic enzymes along with tissue response throughout different phases of the estrous cycle. However, further studies are needed to characterize the derived hormones synthesized by, and the enzymes activities associated with, vaginal tissues. Current results not only support the expression of enzymes involved in sex steroid synthesis in the wall of the vagina, they also indicate that expression changes with the stage of the cycle, both the levels and types of cells exhibiting expression. Thus, changes in proliferation of vaginal epithelial cells and the differentiation of the mucosa may be influenced by local steroid synthesis as well as circulating androgens and estrogens.
IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...
EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database. The draft Toxicological Review of trichloroacetic acid provides scientific support and rationale for the hazard and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.
Glycation inhibits trichloroacetic acid (TCA)-induced whey protein precipitation
USDA-ARS?s Scientific Manuscript database
Four different WPI saccharide conjugates were successfully prepared to test whether glycation could inhibit WPI precipitation induced by trichloroacetic acid (TCA). Conjugates molecular weights after glycation were analyzed with SDS-PAGE. No significant secondary structure change due to glycation wa...
Evolutionary History of the Enzymes Involved in the Calvin-Benson Cycle in Euglenids.
Markunas, Chelsea M; Triemer, Richard E
2016-05-01
Euglenids are an ancient lineage that may have existed as early as 2 billion years ago. A mere 65 years ago, Melvin Calvin and Andrew A. Benson performed experiments on Euglena gracilis and elucidated the series of reactions by which carbon was fixed and reduced during photosynthesis. However, the evolutionary history of this pathway (Calvin-Benson cycle) in euglenids was more complex than Calvin and Benson could have imagined. The chloroplast present today in euglenophytes arose from a secondary endosymbiosis between a phagotrophic euglenid and a prasinophyte green alga. A long period of evolutionary time existed before this secondary endosymbiotic event took place, which allowed for other endosymbiotic events or gene transfers to occur prior to the establishment of the green chloroplast. This research revealed the evolutionary history of the major enzymes of the Calvin-Benson cycle throughout the euglenid lineage and showed that the majority of genes for Calvin-Benson cycle enzymes shared an ancestry with red algae and/or chromophytes suggesting they may have been transferred to the nucleus prior to the acquisition of the green chloroplast. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.
The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity
2012-03-01
mitochondrial OAA measurement is performed by a commercial kit from Biovision . Briefly, whole cell lysates or mitochondria fraction were obtained from... Biovision based on the manufacturer protocols. 2) Cellular oxygen consumption and reactive oxygen (ROS) production. One of the metabolic consequences of
The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity
2014-03-01
phosphorylation, Nat Rev Genet 2, 342-352. 17. Higgins , L. H., Withers, H. G., Garbens, A., Love, H. D., Magnoni, L., Hayward, S. W., and Moyes, C. D. (2009...MalateDehydrogenase 2ConfersDocetaxel Resistancevia Regulations of JNKSignaling andOxidativeMetabolism Qiong Liu, Chris T. Harvey, Hao Geng, Changhui...1036 Liuet al. The Prostate 40. Higgins LH, Withers HG, Garbens A, Love HD, Magnoni L, Hayward SW, Moyes CD. Hypoxia and the metabolic pheno- type of
Golgi enzymes do not cycle through the endoplasmic reticulum during protein secretion or mitosis
Villeneuve, Julien; Duran, Juan; Scarpa, Margherita; Bassaganyas, Laia; Van Galen, Josse; Malhotra, Vivek
2017-01-01
Golgi-specific sialyltransferase (ST) expressed as a chimera with the rapamycin-binding domain of mTOR, FRB, relocates to the endoplasmic reticulum (ER) in cells exposed to rapamycin that also express invariant chain (Ii)-FKBP in the ER. This result has been taken to indicate that Golgi-resident enzymes cycle to the ER constitutively. We show that ST-FRB is trapped in the ER even without Ii-FKBP upon rapamycin addition. This is because ER-Golgi–cycling FKBP proteins contain a C-terminal KDEL-like sequence, bind ST-FRB in the Golgi, and are transported together back to the ER by KDEL receptor–mediated retrograde transport. Moreover, depletion of KDEL receptor prevents trapping of ST-FRB in the ER by rapamycin. Thus ST-FRB cycles artificially by binding to FKBP domain–containing proteins. In addition, Golgi-specific O-linked glycosylation of a resident ER protein occurs only upon artificial fusion of Golgi membranes with ER. Together these findings support the consensus view that there is no appreciable mixing of Golgi-resident enzymes with ER under normal conditions. PMID:27807044
IRIS Toxicological Review of Trichloroacetic Acid (TCA) (External Review Draft)
EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database.
Key enzymes of the retinoid (visual) cycle in vertebrate retina
Kiser, Philip D.; Golczak, Marcin; Maeda, Akiko; Palczewski, Krzysztof
2011-01-01
A major goal in vision research over the past few decades has been to understand the molecular details of retinoid processing within the retinoid (visual) cycle. This includes the consequences of side reactions that result from delayed all-trans-retinal clearance and condensation with phospholipids that characterize a variety of serious retinal diseases. Knowledge of the basic retinoid biochemistry involved in these diseases is essential for development of effective therapeutics. Photoisomerization of the 11-cis-retinal chromophore of rhodopsin triggers a complex set of metabolic transformations collectively termed phototransduction that ultimately lead to light perception. Continuity of vision depends on continuous conversion of all-trans-retinal back to the 11-cis-retinal isomer. This process takes place in a series of reactions known as the retinoid cycle, which occur in photoreceptor and RPE cells. All-trans-retinal, the initial substrate of this cycle, is a chemically reactive aldehyde that can form toxic conjugates with proteins and lipids. Therefore, much experimental effort has been devoted to elucidate molecular mechanisms of the retinoid cycle and all-trans-retinal-mediated retinal degeneration, resulting in delineation of many key steps involved in regenerating 11-cis-retinal. Three particularly important reactions are catalyzed by enzymes broadly classified as acyltransferases, short-chain dehydrogenases/reductases and carotenoid/retinoid isomerases/oxygenases. PMID:21447403
van Straten, Giora; van Steenbeek, Frank G.; Grinwis, Guy C. M.; Favier, Robert P.; Kummeling, Anne; van Gils, Ingrid H.; Fieten, Hille; Groot Koerkamp, Marian J. A.; Holstege, Frank C. P.; Rothuizen, Jan; Spee, Bart
2014-01-01
The detoxification of ammonia occurs mainly through conversion of ammonia to urea in the liver via the urea cycle and glutamine synthesis. Congenital portosystemic shunts (CPSS) in dogs cause hyperammonemia eventually leading to hepatic encephalopathy. In this study, the gene expression of urea cycle enzymes (carbamoylphosphate synthetase (CPS1), ornithine carbamoyltransferase (OTC), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase (ARG1)), N-acetylglutamate synthase (NAGS), Glutamate dehydrogenase (GLUD1), and glutamate-ammonia ligase (GLUL) was evaluated in dogs with CPSS before and after surgical closure of the shunt. Additionally, immunohistochemistry was performed on urea cycle enzymes and GLUL on liver samples of healthy dogs and dogs with CPSS to investigate a possible zonal distribution of these enzymes within the liver lobule and to investigate possible differences in distribution in dogs with CPSS compared to healthy dogs. Furthermore, the effect of increasing ammonia concentrations on the expression of the urea cycle enzymes was investigated in primary hepatocytes in vitro. Gene-expression of CPS1, OTC, ASL, GLUD1 and NAGS was down regulated in dogs with CPSS and did not normalize after surgical closure of the shunt. In all dogs GLUL distribution was localized pericentrally. CPS1, OTC and ASS1 were localized periportally in healthy dogs, whereas in CPSS dogs, these enzymes lacked a clear zonal distribution. In primary hepatocytes higher ammonia concentrations induced mRNA levels of CPS1. We hypothesize that the reduction in expression of urea cycle enzymes, NAGS and GLUD1 as well as the alterations in zonal distribution in dogs with CPSS may be caused by a developmental arrest of these enzymes during the embryonic or early postnatal phase. PMID:24945279
van Straten, Giora; van Steenbeek, Frank G; Grinwis, Guy C M; Favier, Robert P; Kummeling, Anne; van Gils, Ingrid H; Fieten, Hille; Groot Koerkamp, Marian J A; Holstege, Frank C P; Rothuizen, Jan; Spee, Bart
2014-01-01
The detoxification of ammonia occurs mainly through conversion of ammonia to urea in the liver via the urea cycle and glutamine synthesis. Congenital portosystemic shunts (CPSS) in dogs cause hyperammonemia eventually leading to hepatic encephalopathy. In this study, the gene expression of urea cycle enzymes (carbamoylphosphate synthetase (CPS1), ornithine carbamoyltransferase (OTC), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase (ARG1)), N-acetylglutamate synthase (NAGS), Glutamate dehydrogenase (GLUD1), and glutamate-ammonia ligase (GLUL) was evaluated in dogs with CPSS before and after surgical closure of the shunt. Additionally, immunohistochemistry was performed on urea cycle enzymes and GLUL on liver samples of healthy dogs and dogs with CPSS to investigate a possible zonal distribution of these enzymes within the liver lobule and to investigate possible differences in distribution in dogs with CPSS compared to healthy dogs. Furthermore, the effect of increasing ammonia concentrations on the expression of the urea cycle enzymes was investigated in primary hepatocytes in vitro. Gene-expression of CPS1, OTC, ASL, GLUD1 and NAGS was down regulated in dogs with CPSS and did not normalize after surgical closure of the shunt. In all dogs GLUL distribution was localized pericentrally. CPS1, OTC and ASS1 were localized periportally in healthy dogs, whereas in CPSS dogs, these enzymes lacked a clear zonal distribution. In primary hepatocytes higher ammonia concentrations induced mRNA levels of CPS1. We hypothesize that the reduction in expression of urea cycle enzymes, NAGS and GLUD1 as well as the alterations in zonal distribution in dogs with CPSS may be caused by a developmental arrest of these enzymes during the embryonic or early postnatal phase.
Fumarate Reductase Activity Maintains an Energized Membrane in Anaerobic Mycobacterium tuberculosis
Watanabe, Shinya; Zimmermann, Michael; Goodwin, Michael B.; Sauer, Uwe; Barry, Clifton E.; Boshoff, Helena I.
2011-01-01
Oxygen depletion of Mycobacterium tuberculosis engages the DosR regulon that coordinates an overall down-regulation of metabolism while up-regulating specific genes involved in respiration and central metabolism. We have developed a chemostat model of M. tuberculosis where growth rate was a function of dissolved oxygen concentration to analyze metabolic adaptation to hypoxia. A drop in dissolved oxygen concentration from 50 mmHg to 0.42 mmHg led to a 2.3 fold decrease in intracellular ATP levels with an almost 70-fold increase in the ratio of NADH/NAD+. This suggests that re-oxidation of this co-factor becomes limiting in the absence of a terminal electron acceptor. Upon oxygen limitation genes involved in the reverse TCA cycle were upregulated and this upregulation was associated with a significant accumulation of succinate in the extracellular milieu. We confirmed that this succinate was produced by a reversal of the TCA cycle towards the non-oxidative direction with net CO2 incorporation by analysis of the isotopomers of secreted succinate after feeding stable isotope (13C) labeled precursors. This showed that the resulting succinate retained both carbons lost during oxidative operation of the TCA cycle. Metabolomic analyses of all glycolytic and TCA cycle intermediates from 13C-glucose fed cells under aerobic and anaerobic conditions showed a clear reversal of isotope labeling patterns accompanying the switch from normoxic to anoxic conditions. M. tuberculosis encodes three potential succinate-producing enzymes including a canonical fumarate reductase which was highly upregulated under hypoxia. Knockout of frd, however, failed to reduce succinate accumulation and gene expression studies revealed a compensatory upregulation of two homologous enzymes. These major realignments of central metabolism are consistent with a model of oxygen-induced stasis in which an energized membrane is maintained by coupling the reductive branch of the TCA cycle to succinate
NASA Astrophysics Data System (ADS)
Upton, R.; Bach, E.; Hofmockel, K. S.
2017-12-01
Microbes are mediators of soil carbon (C) and are influenced in membership and activity by nitrogen (N) fertilization and inter-annual abiotic factors. Microbial communities and their extracellular enzyme activities (EEA) are important parameters that influence ecosystem C cycling properties and are often included in microbial explicit C cycling models. In an effort to generate model relevant, empirical findings, we investigated how both microbial community structure and C degrading enzyme activity are influenced by inter-annual variability and N inputs in bioenergy crops. Our study was performed at the Comparison of Biofuel Systems field-site from 2011 to 2014, in three bioenergy cropping systems, continuous corn (CC) and two restored prairies, both fertilized (FP) and unfertilized (P). We hypothesized microbial community structure would diverge during the prairie restoration, leading to changes in C cycling enzymes over time. Using a sequencing approach (16S and ITS) we determined the bacterial and fungal community structure response to the cropping system, fertilization, and inter-annual variability. Additionally, we used EEA of β-glucosidase, cellobiohydrolase, and β-xylosidase to determine inter-annual and ecosystem impacts on microbial activity. Our results show cropping system was a main effect for microbial community structure, with corn diverging from both prairies to be less diverse. Inter-annual changes showed that a drought occurring in 2012 significantly impacted microbial community structure in both the P and CC, decreasing microbial richness. However, FP increased in microbial richness, suggesting the application of N increased resiliency to drought. Similarly, the only year in which C cycling enzymes were impacted by ecosystem was 2012, with FP supporting higher potential enzymatic activity then CC and P. The highest EEA across all ecosystems occurred in 2014, suggesting the continued root biomass and litter build-up in this no till system
Environment impacts the metabolic dependencies of Ras-driven non-small cell lung cancer
Davidson, Shawn M.; Papagiannakopoulos, Thales; Olenchock, Benjamin A.; Heyman, Julia E.; Keibler, Mark A.; Luengo, Alba; Bauer, Matthew R.; Jha, Abhishek K.; O’Brien, James P.; Pierce, Kerry A.; Gui, Dan Y.; Sullivan, Lucas B.; Wasylenko, Thomas M.; Subbaraj, Lakshmipriya; Chin, Christopher R.; Stephanopolous, Gregory; Mott, Bryan T.; Jacks, Tyler; Clish, Clary B.; Vander Heiden, Matthew G.
2016-01-01
SUMMARY Cultured cells convert glucose to lactate and glutamine is the major source of tricarboxylic acid (TCA) cycle carbon, but whether the same metabolic phenotype is found in tumors is less studied. We infused mice with lung cancers with isotope-labeled glucose or glutamine and compared the fate of these nutrients in tumor and normal tissue. As expected, lung tumors exhibit increased lactate production from glucose. However, glutamine utilization by both lung tumors and normal lung was minimal, with lung tumors showing increased glucose contribution to the TCA cycle relative to normal lung tissue. Deletion of enzymes involved in glucose oxidation demonstrates that glucose carbon contribution to the TCA cycle is required for tumor formation. These data suggest that understanding nutrient utilization by tumors can predict metabolic dependencies of cancers in vivo. Furthermore, these data argue that the in vivo environment is an important determinant of the metabolic phenotype of cancer cells. PMID:26853747
Heinen, Laura; Heuser, Thomas; Steinschulte, Alexander; Walther, Andreas
2017-08-09
Enzymes regulate complex functions and active behavior in natural systems and have shown increasing prospect for developing self-regulating soft matter systems. Striving for advanced autonomous hydrogel materials with fully programmable, self-regulated life cycles, we combine two enzymes with an antagonistic pH-modulating effect in a feedback-controlled biocatalytic reaction network (BRN) and couple it to pH-responsive DNA hydrogels to realize hydrogel systems with distinct preprogrammable lag times and lifetimes in closed systems. The BRN enables precise and orthogonal internal temporal control of the "ON" and "OFF" switching times of the temporary gel state by modulation of programmable, nonlinear pH changes. The time scales are tunable by variation of the enzyme concentrations and additional buffer substances. The resulting material system operates in full autonomy after injection of the chemical fuels driving the BRN. The concept may open new applications inherent to DNA hydrogels, for instance, autonomous shape memory behavior for soft robotics. We further foresee general applicability to achieve autonomous life cycles in other pH switchable systems.
IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...
EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development Process. Comments received from other Federal agencies and White House Offices are provided below with external peer review panel comments. The draft Toxicological Review of Trichloroacetic Acid provides scientific support and rationale for the hazard identification and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.
Comparative study of 15% TCA peel versus 35% glycolic acid peel for the treatment of melasma
Puri, Neerja
2012-01-01
Background: Chemical peels are the mainstay of a cosmetic practitioner's armamentarium because they can be used to treat some skin disorders and can provide aesthetic benefit. Objectives: To compare 15% TCA peel and 35% glycolic acid peel for the treatment of melasma. Material and Methods: We selected 30 participants of melasma aged between 20 and 50 years from the dermatology outpatient department and treated equal numbers with 15% TCA and 35% glycolic acid. Results: Subjective response as graded by the patient showed good or very good response in 70% participants in the glycolic acid group and 64% in the TCA group. Conclusions: There was statistically insignificant difference in the efficacy between the two groups for the treatment of melasma. PMID:23130283
Solovyev, Mikhail; Gisbert, Enric
2016-10-01
In this study, we tested the effects of long-term storage (2 years) at -20 °C and short-term storage (several hours) in ice and freeze/thaw cycles on the activities of pancreatic, gastric and intestinal (brush border and cytosolic) digestive enzymes in a teleost fish species. The results revealed a significant lose in activity of pancreatic (trypsin, chymotrypsin, total alkaline proteases and α-amylase) and intestinal cytosolic (leucine-alanine peptidase) enzymes between 140 and 270 days of storage at -20 °C, whereas in contrast, the activity of all the assayed brush border enzymes remained constant during the first 2 years of storage at -20 °C. During short-term storage conditions, the most stable enzymes assayed were those of the enterocytes of the brush border, which did not show any change in activity after being held for 5 h in ice. Five freezing and thawing cycles did not affect the activity of the intestinal brush border enzymes and the cytosolic ones, whereas the activity of trypsin, α-amylase and bile-salt-activated lipase was significantly affected by the number of freezing and thawing cycles. No changes in pepsin activity were found in samples exposed to 1 and 2 freezing and thawing cycles.
Nasri Nasrabadi, Mohammad Reza; Razavi, Seyed Hadi
2010-04-01
In this work, we applied statistical experimental design to a fed-batch process for optimization of tricarboxylic acid cycle (TCA) intermediates in order to achieve high-level production of canthaxanthin from Dietzia natronolimnaea HS-1 cultured in beet molasses. A fractional factorial design (screening test) was first conducted on five TCA cycle intermediates. Out of the five TCA cycle intermediates investigated via screening tests, alfaketoglutarate, oxaloacetate and succinate were selected based on their statistically significant (P<0.05) and positive effects on canthaxanthin production. These significant factors were optimized by means of response surface methodology (RSM) in order to achieve high-level production of canthaxanthin. The experimental results of the RSM were fitted with a second-order polynomial equation by means of a multiple regression technique to identify the relationship between canthaxanthin production and the three TCA cycle intermediates. By means of this statistical design under a fed-batch process, the optimum conditions required to achieve the highest level of canthaxanthin (13172 + or - 25 microg l(-1)) were determined as follows: alfaketoglutarate, 9.69 mM; oxaloacetate, 8.68 mM; succinate, 8.51 mM. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Lin, Jyun-Hao; Huang, Shyh-Jer; Su, Yan-Kuin
2014-01-01
A simple thermal cycle annealing (TCA) process was used to improve the quality of GaN grown on a Si substrate. The X-ray diffraction (XRD) and etch pit density (EPD) results revealed that using more process cycles, the defect density cannot be further reduced. However, the performance of GaN-based metal-semiconductor-metal (MSM) photodiodes (PDs) prepared on Si substrates showed significant improvement. With a two-cycle TCA process, it is found that the dark current of the device was only 1.46 × 10-11 A, and the photo-to-dark-current contrast ratio was about 1.33 × 105 at 5 V. Also, the UV/visible rejection ratios can reach as high as 1077.
NASA Astrophysics Data System (ADS)
Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abou Youssef, Morsy A.; Assem, Rania
2014-09-01
A new [Ag(E3Q)2(TCA)] complex; (E3Q = Ethyl 3-quinolinecarboxylate and TCA = Trichloroacetate) has been synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry and spectroscopic properties of the complex as well as the free ligand have been calculated using the hybrid B3LYP method. The calculations predicted a distorted tetrahedral arrangement around Ag(I) ion. The vibrational spectra of the studied compounds have been assigned using potential energy distribution (PED). TD-DFT method was used to predict the electronic absorption spectra. The most intense absorption band showed a bathochromic shift and lowering of intensity in case of the complex (233.7 nm, f = 0.5604) compared to E3Q (λmax = 228.0 nm, f = 0.9072). The calculated 1H NMR chemical shifts using GIAO method showed good correlations with the experimental data. The computed dipole moment, polarizability and HOMO-LUMO energy gap were used to predict the nonlinear optical (NLO) properties. It is found that Ag(I) enhances the NLO activity. The natural bond orbital (NBO) analyses were used to elucidate the intramolecular charge transfer interactions causing stabilization for the investigated systems.
Haggie, Peter M; Verkman, A S
2002-10-25
It has been proposed that enzymes in many metabolic pathways, including the tricarboxylic acid cycle in the mitochondrial matrix, are physically associated to facilitate substrate channeling and overcome diffusive barriers. We have used fluorescence recovery after photobleaching to measure the diffusional mobilities of chimeras consisting of green fluorescent protein (GFP) fused to the C terminus of four tricarboxylic acid cycle enzymes: malate dehydrogenase, citrate synthase, isocitrate dehydrogenase, and succinyl-CoA synthetase. The GFP-enzyme chimeras were localized selectively in the mitochondrial matrix in transfected Chinese hamster ovary (CHO) and COS7 cells. Laser photobleaching using a 0.7-microm diameter spot demonstrated restricted diffusion of the GFP-enzyme chimeras. Interestingly, all four chimeras had similar diffusional characteristics, approximately 45% of each chimera was mobile and had a diffusion coefficient of 4 x 10(-8) cm(2)/s. In contrast, unconjugated GFP in the mitochondrial matrix (targeted using COX8 leader sequence) diffused freely (nearly 100% mobility) with a greater diffusion coefficient of 20 x 10(-8) cm(2)/s. The mobility of the GFP-enzyme chimeras was insensitive to substrate source, ATP depletion, or inhibition of the adenine nucleotide translocase. These results indicate similar mobility characteristics of unrelated tricarboxylic acid cycle enzymes having different sizes and physical properties, providing biophysical evidence for a diffusible multienzyme complex in the mitochondrial matrix.
IRIS Toxicological Review of Trichloroacetic Acid (TCA) (Interagency Science Discussion Draft)
EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development ...
In vitro anticancer effects of insect tea in TCA8113 cells.
Qian, Yu; Li, Gui-Jie; Wang, Rui; Zhou, Ya-Lin; Sun, Peng; Zhao, Xin
2014-01-01
Insect tea is widely used a traditional drink or traditional Chinese medicine in China. This study was conducted with an aim to determine the in vitro anticancer effect of Insect tea in cancer cells. The anticancer effects of Insect tea were evaluated in human tongue carcinoma TCA8113 cells using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay, flow cytometry analysis, nuclear staining with 4,6-diamidino-2-phenylindole (DAPI), reverse transcription-polymerase chain reaction (RT-PCR) analysis, and western bolt assay. At 200 μg/mL, Insect tea inhibited the growth of TCA8113 cells by 80.7%, which was higher than the inhibition caused by 100 μg/mL Insect tea but lower than that of 200 μg/mL green tea. Compared to the control cancer cells, Insect tea significantly (P<0.05) induced apoptosis as determined by DAPI staining and flow cytometry analysis results. Insect tea significantly induced apoptosis in cancer cells by upregulating BAX, CASP3, CASP9 and downregulating BCL2. Genes encoding nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2) were significantly downregulated by Insect tea, demonstrating its anti-inflammatory properties. Insect tea also exerted a great anti-metastasis effect on cancer cells as demonstrated by decreased expression of matrix metalloproteinase (MMP) genes and increased expression of tissue inhibitors of metalloproteinases (TIMPs). The results showed that Insect tea has good in vitro anticancer effects in TCA8113 cells, like green tea.
An integrated model of cardiac mitochondrial energy metabolism and calcium dynamics.
Cortassa, Sonia; Aon, Miguel A; Marbán, Eduardo; Winslow, Raimond L; O'Rourke, Brian
2003-04-01
We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca(2+) handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH(2), which in turn are used by the electron transport chain to establish a proton motive force (Delta mu(H)), driving the F(1)F(0)-ATPase. In addition, mitochondrial matrix Ca(2+), determined by Ca(2+) uniporter and Na(+)/Ca(2+) exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (Delta Psi(m)), and matrix concentrations of Ca(2+), NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca(2+). The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca(2+) dynamics, and respiratory control. Significant increases in oxygen consumption (V(O(2))), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca(2+), are obtained when the Ca(2+)-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca(2+) plays an
An Integrated Model of Cardiac Mitochondrial Energy Metabolism and Calcium Dynamics
Cortassa, Sonia; Aon, Miguel A.; Marbán, Eduardo; Winslow, Raimond L.; O'Rourke, Brian
2003-01-01
We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca2+ handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH2, which in turn are used by the electron transport chain to establish a proton motive force (ΔμH), driving the F1F0-ATPase. In addition, mitochondrial matrix Ca2+, determined by Ca2+ uniporter and Na+/Ca2+ exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and α-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (ΔΨm), and matrix concentrations of Ca2+, NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca2+. The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca2+ dynamics, and respiratory control. Significant increases in oxygen consumption (VO2), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca2+, are obtained when the Ca2+-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca2+ plays an important role in matching energy supply with demand in
Carreira, Cíntia; Pauleta, Sofia R; Moura, Isabel
2017-12-01
The reduction of the potent greenhouse gas nitrous oxide requires a catalyst to overcome the large activation energy barrier of this reaction. Its biological decomposition to the inert dinitrogen can be accomplished by denitrifiers through nitrous oxide reductase, the enzyme that catalyzes the last step of the denitrification, a pathway of the biogeochemical nitrogen cycle. Nitrous oxide reductase is a multicopper enzyme containing a mixed valence CuA center that can accept electrons from small electron shuttle proteins, triggering electron flow to the catalytic sulfide-bridged tetranuclear copper "CuZ center". This enzyme has been isolated with its catalytic center in two forms, CuZ*(4Cu1S) and CuZ(4Cu2S), proven to be spectroscopic and structurally different. In the last decades, it has been a challenge to characterize the properties of this complex enzyme, due to the different oxidation states observed for each of its centers and the heterogeneity of its preparations. The substrate binding site in those two "CuZ center" forms and which is the active form of the enzyme is still a matter of debate. However, in the last years the application of different spectroscopies, together with theoretical calculations have been useful in answering these questions and in identifying intermediate species of the catalytic cycle. An overview of the spectroscopic, kinetics and structural properties of the two forms of the catalytic "CuZ center" is given here, together with the current knowledge on nitrous oxide reduction mechanism by nitrous oxide reductase and its intermediate species. Copyright © 2017 Elsevier Inc. All rights reserved.
Hanson, Mark L; Sibley, Paul K; Mabury, Scott A; Solomon, Keith R; Muir, Derek C G
2002-02-21
Trichloroacetic acid (TCA) and trifluoroacetic acid (TFA) have been detected together in environmental water samples throughout the world. TCA may enter into aquatic systems via rainout as the degradation product of chlorinated solvents, herbicide use, as a by-product of water disinfection and from emissions of spent bleach liquor of kraft pulp mills. Sources of TFA include degradation of hydrofluorocarbons (HFCs) refrigerants and pesticides. These substances are phytotoxic and widely distributed in aquatic environments. A study to assess the risk of a binary mixture of TCA and TFA to macrophytes in aquatic microcosms was conducted as part of a larger study on haloacetic acids. M. spicatum and M. sibiricum were exposed to 0.1, 1, 3 and 10 mg/l of both TCA and TFA (neutralized with sodium hydroxide) in replicate (n = 3) 12000 l aquatic microcosms for 49 days in an one-way analysis of variance design. Each microcosm was stocked with 14 individual apical shoots per species. The plants were sampled at regular intervals and assessed for the somatic endpoints of plant length, root growth, number of nodes and wet and dry mass and the biochemical endpoints of chlorophyll-a, chlorophyll-b, carotenoid content and citric acid levels. Results indicate that there were statistically significant effects of the TCA/TFA mixture on certain pigment concentrations immediately after the start of exposure (2-7 days), but the plants showed no signs of stress thereafter. These data suggest that TCA/TFA mixtures at environmentally relevant concentrations do not pose a significant risk to these aquatic macrophytes.
SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less
SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; ...
2014-10-21
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less
SbnG, a citrate synthase in Staphylococcus aureus: a new fold on an old enzyme.
Kobylarz, Marek J; Grigg, Jason C; Sheldon, Jessica R; Heinrichs, David E; Murphy, Michael E P
2014-12-05
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian
2015-11-01
Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.
Kumar, Akhilesh; Bachhawat, Anand Kumar
2010-03-01
Cystinosis, an inherited disease caused by a defect in the lysosomal cystine transporter (CTNS), is characterized by renal proximal tubular dysfunction. Adenosine triphosphate (ATP) depletion appears to be a key event in the pathophysiology of the disease, even though the manner in which ATP depletion occurs is still a puzzle. We present a model that explains how a futile cycle that is generated between two ATP-utilizing enzymes of the gamma-glutamyl cycle leads to ATP depletion. The enzyme gamma-glutamyl cysteine synthetase (gamma-GCS), in the absence of cysteine, forms 5-oxoproline (instead of the normal substrate, gamma-glutamyl cysteine) and the 5-oxoproline is converted into glutamate by the ATP-dependant enzyme, 5-oxoprolinase. Thus, in cysteine-limiting conditions, glutamate is cycled back into glutamate via 5-oxoproline at the cost of two ATP molecules without production of glutathione and is the cause of the decreased levels of glutathione synthesis, as well as the ATP depletion observed in these cells. The model is also compatible with the differences seen in the human patients and the mouse model of cystinosis, where renal failure is not observed.
Alcolombri, Uria; Ben-Dor, Shifra; Feldmesser, Ester; Levin, Yishai; Tawfik, Dan S; Vardi, Assaf
2015-06-26
Algal blooms produce large amounts of dimethyl sulfide (DMS), a volatile with a diverse signaling role in marine food webs that is emitted to the atmosphere, where it can affect cloud formation. The algal enzymes responsible for forming DMS from dimethylsulfoniopropionate (DMSP) remain unidentified despite their critical role in the global sulfur cycle. We identified and characterized Alma1, a DMSP lyase from the bloom-forming algae Emiliania huxleyi. Alma1 is a tetrameric, redox-sensitive enzyme of the aspartate racemase superfamily. Recombinant Alma1 exhibits biochemical features identical to the DMSP lyase in E. huxleyi, and DMS released by various E. huxleyi isolates correlates with their Alma1 levels. Sequence homology searches suggest that Alma1 represents a gene family present in major, globally distributed phytoplankton taxa and in other marine organisms. Copyright © 2015, American Association for the Advancement of Science.
Cell cycle effect on the activity of deoxynucleoside analogue metabolising enzymes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fyrberg, Anna; Albertioni, Freidoun; Lotfi, Kourosh
Deoxynucleoside analogues (dNAs) are cytotoxic towards both replicating and indolent malignancies. The impact of fluctuations in the metabolism of dNAs in relation to cell cycle could have strong implications regarding the activity of dNAs. Deoxycytidine kinase (dCK) and deoxyguanosine kinase (dGK) are important enzymes for phosphorylation/activation of dNAs. These drugs can be dephosphorylated/deactivated by 5'-nucleotidases (5'-NTs) and elevated activities of 5'-NTs and decreased dCK and/or dGK activities represent resistance mechanisms towards dNAs. The activities of dCK, dGK, and three 5'-NTs were investigated in four human leukemic cell lines in relationship to cell cycle progression and cytotoxicity of dNAs. Synchronization ofmore » cell cultures to arrest in G0/G1 by serum-deprivation was performed followed by serum-supplementation for cell cycle progression. The activities of dCK and dGK increased up to 3-fold in CEM, HL60, and MOLT-4 cells as they started to proliferate, while the activity of cytosolic nucleotidase I was reduced in proliferating cells. CEM, HL60, and MOLT-4 cells were also more sensitive to cladribine, cytarabine, 9-{beta}-D-arabinofuranosylguanine and clofarabine than K562 cells which demonstrated lower levels and less alteration of these enzymes and were least susceptible to the cytotoxic effects of most dNAs. The results suggest that, in the cell lines studied, the proliferation process is associated with a general shift in the direction of activation of dNAs by inducing activities of dCK/dGK and reducing the activity of cN-I which is favourable for the cytotoxic effects of cladribine, cytarabine and, 9-{beta}-D-arabinofuranosylguanine. These results emphasize the importance of cellular proliferation and dNA metabolism by both phosphorylation and dephosphorylation for susceptibility to dNAs. It underscores the need to understand the mechanisms of action and resistance to dNAs in order to increase efficacy of dNAs treatment by new
Chronic ethanol feeding modulates the synthesis of digestive enzymes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ponnappa, B.C.; Hoek, J.B.; Rubin, E.
1987-05-01
The effects of chronic ethanol feeding on pancreatic protein synthesis were investigated. Protein synthesis was assessed by studying the rate of incorporation of /sup 3/H-leucine into TCA-precipitable proteins in isolated pancreatic acini from rats. Chronic ethanol ingestion increased the rate of pancreatic protein synthesis by 2-4 fold. The onset of the increase in protein synthesis was detectable two days after ethanol feeding, reached a maximum after 7 days and remained unchanged after 4 months on the ethanol-containing diet. The rate of synthesis of individual digestive enzymes was studied by SDS-PAGE on extracts obtained from purified zymogen granules. Ethanol feeding inducedmore » an increase in the rate of synthesis of most of the digestive enzymes; chymotrypsinogen, trypsinogen and an unidentified protein were increased to a greater extent than other digestive enzymes. By contrast, the synthesis of amylase was selectively decreased after ethanol feeding. These results suggest that chronic ethanol ingestion has specific effects on the rate of synthesis of individual digestive enzymes in the exocrine pancreas.« less
Yadav, Saveg; Pandey, Shrish Kumar; Singh, Vinay Kumar; Goel, Yugal; Kumar, Ajay
2017-01-01
Altered metabolism is an emerging hallmark of cancer, as malignant cells display a mammoth up-regulation of enzymes responsible for steering their bioenergetic and biosynthetic machinery. Thus, the recent anticancer therapeutic strategies focus on the targeting of metabolic enzymes, which has led to the identification of specific metabolic inhibitors. One of such inhibitors is 3-bromopyruvate (3-BP), with broad spectrum of anticancer activity due to its ability to inhibit multiple metabolic enzymes. However, the molecular characterization of its binding to the wide spectrum of target enzymes remains largely elusive. Therefore, in the present study we undertook in silico investigations to decipher the molecular nature of the docking of 3-BP with key target enzymes of glycolysis and TCA cycle by PatchDock and YASARA docking tools. Additionally, derivatives of 3-BP, dibromopyruvate (DBPA) and propionic acid (PA), with reported biological activity, were also investigated for docking to important target metabolic enzymes of 3-BP, in order to predict their therapeutic efficacy versus that of 3-BP. A comparison of the docking scores with respect to 3-BP indicated that both of these derivatives display a better binding strength to metabolic enzymes. Further, analysis of the drug likeness of 3-BP, DBPA and PA by Lipinski filter, admetSAR and FAF Drug3 indicated that all of these agents showed desirable drug-like criteria. The outcome of this investigation sheds light on the molecular characteristics of the binding of 3-BP and its derivatives with metabolic enzymes and thus may significantly contribute in designing and optimizing therapeutic strategies against cancer by using these agents. PMID:28463978
Yadav, Saveg; Pandey, Shrish Kumar; Singh, Vinay Kumar; Goel, Yugal; Kumar, Ajay; Singh, Sukh Mahendra
2017-01-01
Altered metabolism is an emerging hallmark of cancer, as malignant cells display a mammoth up-regulation of enzymes responsible for steering their bioenergetic and biosynthetic machinery. Thus, the recent anticancer therapeutic strategies focus on the targeting of metabolic enzymes, which has led to the identification of specific metabolic inhibitors. One of such inhibitors is 3-bromopyruvate (3-BP), with broad spectrum of anticancer activity due to its ability to inhibit multiple metabolic enzymes. However, the molecular characterization of its binding to the wide spectrum of target enzymes remains largely elusive. Therefore, in the present study we undertook in silico investigations to decipher the molecular nature of the docking of 3-BP with key target enzymes of glycolysis and TCA cycle by PatchDock and YASARA docking tools. Additionally, derivatives of 3-BP, dibromopyruvate (DBPA) and propionic acid (PA), with reported biological activity, were also investigated for docking to important target metabolic enzymes of 3-BP, in order to predict their therapeutic efficacy versus that of 3-BP. A comparison of the docking scores with respect to 3-BP indicated that both of these derivatives display a better binding strength to metabolic enzymes. Further, analysis of the drug likeness of 3-BP, DBPA and PA by Lipinski filter, admetSAR and FAF Drug3 indicated that all of these agents showed desirable drug-like criteria. The outcome of this investigation sheds light on the molecular characteristics of the binding of 3-BP and its derivatives with metabolic enzymes and thus may significantly contribute in designing and optimizing therapeutic strategies against cancer by using these agents.
Alvarez, Maricel; Huygens, Dries; Olivares, Erick; Saavedra, Isabel; Alberdi, Miren; Valenzuela, Eduardo
2009-08-01
Drought stress conditions (DC) reduce plant growth and nutrition, restraining the sustainable reestablishment of Nothofagus dombeyi in temperate south Chilean forest ecosystems. Ectomycorrhizal symbioses have been documented to enhance plant nitrogen (N) and phosphorus (P) uptake under drought, but the regulation of involved assimilative enzymes remains unclear. We studied 1-year-old N. dombeyi (Mirb.) Oerst. plants in association with the ectomycorrhizal fungi Pisolithus tinctorius (Pers.) Coker & Couch. and Descolea antartica Sing. In greenhouse experiments, shoot and root dry weights, mycorrhizal colonization, foliar N and P concentrations, and root enzyme activities [glutamate synthase (glutamine oxoglutarate aminotransferase (GOGAT), EC 1.4.1.13-14), glutamine synthetase (GS, EC 6.3.1.2), glutamate dehydrogenase (GDH, EC 1.4.1.2-4), nitrate reductase (NR, EC 1.6.6.1), and acid phosphomonoesterase (PME, EC 3.1.3.1-2)] were determined as a function of soil-water content. Inoculation of N. dombeyi with P. tinctorius and D. antartica significantly stimulated plant growth and increased plant foliar N and P concentrations, especially under DC. Ectomycorrhizal inoculation increased the activity of all studied enzymes relative to non-mycorrhizal plants under drought. We speculate that GDH is a key enzyme involved in the enhancement of ectomycorrhizal carbon (C) availability by fuelling the tricarboxylic acid (TCA) cycle under conditions of drought-induced carbon deficit. All studied assimilative enzymes of the ectomycorrhizal associations, involved in C, N, and P transfers, are closely interlinked and interdependent. The up-regulation of assimilative enzyme activities by ectomycorrhizal fungal root colonizers acts as a functional mechanism to increase seedling endurance to drought. We insist upon incorporating ectomycorrhizal inoculation in existing Chilean afforestation programs.
USDA-ARS?s Scientific Manuscript database
To elucidate the cause of reported pyruvate accumulation in chilled stored cucumbers (Cucumis sativus L.) cv. ‘Toppugurin’, we have examined differences in the extent of incorporation of acetate-1,2-14C into the tricarboxylic acid (TCA) cycle and the specific activity of the enzyme citrate synthase ...
Thermodynamic framework for identifying free energy inventories of enzyme catalytic cycles
Fried, Stephen D.; Boxer, Steven G.
2013-01-01
Pauling’s suggestion that enzymes are complementary in structure to the activated complexes of the reactions they catalyze has provided the conceptual basis to explain how enzymes obtain their fantastic catalytic prowess, and has served as a guiding principle in drug design for over 50 y. However, this model by itself fails to predict the magnitude of enzymes’ rate accelerations. We construct a thermodynamic framework that begins with the classic concept of differential binding but invokes additional terms that are needed to account for subtle effects in the catalytic cycle’s proton inventory. Although the model presented can be applied generally, this analysis focuses on ketosteroid isomerase (KSI) as an example, where recent experiments along with a large body of kinetic and thermodynamic data have provided strong support for the noncanonical thermodynamic contribution described. The resulting analysis precisely predicts the free energy barrier of KSI’s reaction as determined from transition-state theory using only empirical thermodynamic data. This agreement is suggestive that a complete free energy inventory of the KSI catalytic cycle has been identified. PMID:23840058
Olofsson, Johanna; Barta, Zsolt; Börjesson, Pål; Wallberg, Ola
2017-01-01
Cellulase enzymes have been reported to contribute with a significant share of the total costs and greenhouse gas emissions of lignocellulosic ethanol production today. A potential future alternative to purchasing enzymes from an off-site manufacturer is to integrate enzyme and ethanol production, using microorganisms and part of the lignocellulosic material as feedstock for enzymes. This study modelled two such integrated process designs for ethanol from logging residues from spruce production, and compared it to an off-site case based on existing data regarding purchased enzymes. Greenhouse gas emissions and primary energy balances were studied in a life-cycle assessment, and cost performance in a techno-economic analysis. The base case scenario suggests that greenhouse gas emissions per MJ of ethanol could be significantly lower in the integrated cases than in the off-site case. However, the difference between the integrated and off-site cases is reduced with alternative assumptions regarding enzyme dosage and the environmental impact of the purchased enzymes. The comparison of primary energy balances did not show any significant difference between the cases. The minimum ethanol selling price, to reach break-even costs, was from 0.568 to 0.622 EUR L -1 for the integrated cases, as compared to 0.581 EUR L -1 for the off-site case. An integrated process design could reduce greenhouse gas emissions from lignocellulose-based ethanol production, and the cost of an integrated process could be comparable to purchasing enzymes produced off-site. This study focused on the environmental and economic assessment of an integrated process, and in order to strengthen the comparison to the off-site case, more detailed and updated data regarding industrial off-site enzyme production are especially important.
Dwell Time and Surface Parameter Effects on Removal of Silicone Oil From D6ac Steel Using TCA
NASA Technical Reports Server (NTRS)
Boothe, R. E.
2003-01-01
This study was conducted to evaluate the impact of dwell time, surface roughness, and the surface activation state on 1,1,1-trichloroethane's (TCA's) effectiveness for removing silicone oil from D6ac steel. Silicone-contaminated test articles were washed with TCA solvent, and then the surfaces were analyzed for residue, using Fourier transform infrared spectroscopy. The predominant factor affecting the ability to remove the silicone oil was surface roughness.
Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon
2014-07-01
2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.
Eoh, Hyungjin; Rhee, Kyu Y.
2014-01-01
Few mutations attenuate Mycobacterium tuberculosis (Mtb) more profoundly than deletion of its isocitrate lyases (ICLs). However, the basis for this attenuation remains incompletely defined. Mtb’s ICLs are catalytically bifunctional isocitrate and methylisocitrate lyases required for growth on even and odd chain fatty acids. Here, we report that Mtb’s ICLs are essential for survival on both acetate and propionate because of its methylisocitrate lyase (MCL) activity. Lack of MCL activity converts Mtb’s methylcitrate cycle into a “dead end” pathway that sequesters tricarboxylic acid (TCA) cycle intermediates into methylcitrate cycle intermediates, depletes gluconeogenic precursors, and results in defects of membrane potential and intrabacterial pH. Activation of an alternative vitamin B12-dependent pathway of propionate metabolism led to selective corrections of TCA cycle activity, membrane potential, and intrabacterial pH that specifically restored survival, but not growth, of ICL-deficient Mtb metabolizing acetate or propionate. These results thus resolve the biochemical basis of essentiality for Mtb’s ICLs and survival on fatty acids. PMID:24639517
Periyasamy, Kuppusamy; Sivabalan, Venkatachalam; Baskaran, Kuppusamy; Kasthuri, Kannayiram; Sakthisekaran, Dhanapal
2016-03-01
Breast cancer is the leading cause of death among women worldwide. Chemoprevention and chemotherapy play beneficial roles in reducing the incidence and mortality of cancer. Epidemiological and experimental studies showed that naturally-occurring antioxidants present in the diet may act as anticancer agents. Identifying the abnormalities of cellular energy metabolism facilitates early detection and management of breast cancer. The present study evaluated the effect of tangeretin on cellular metabolic energy fluxes in 7,12-dimethylbenz(a) anthracene (DMBA)-induced proliferative breast cancer. The results showed that the activities of glycolytic enzymes significantly increased in mammary tissues of DMBA-induced breast cancer bearing rats. The gluconeogenic tricarboxylic acid (TCA) cycle and respiratory chain enzyme activities significantly decreased in breast cancer-bearing rats. In addition, proliferating cell nuclear antigen (PCNA) was highly expressed in breast cancer tissues. However, the activities of glycolytic enzymes were significantly normalized in the tangeretin pre- and post-treated rats and the TCA cycle and respiratory chain enzyme activities were significantly increased in tangeretin treated rats. Furthermore, tangeretin down-regulated PCNA expression on breast cancer-bearing rats. Our study demonstrates that tangeretin specifically regulates cellular metabolic energy fluxes in DMBA-induced breast cancer-bearing rats. © 2016 by the Journal of Biomedical Research. All rights reserved.
Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego
2014-10-17
Oxygenated monoterpenes citral and carvacrol are common constituents of many essential oils (EOs) that have been extensively studied as antimicrobial agents but whose mechanisms of microbial inactivation have not been totally elucidated. A recent study described a mechanism of Escherichia coli death for (+)-limonene, a hydrocarbon monoterpene also frequently present in EOs, similar to the common mechanism proposed for bactericidal antibiotics. This mechanism involves the formation of Fenton-mediated hydroxyl radical, a reactive oxygen species (ROS), via tricarboxylic acid (TCA) cycle, which would ultimately inactivate cells. Our objective was to determine whether E. coli MG1655 inactivation by citral and carvacrol follows a similar mechanism of cell death. Challenging experiments with 300μL/L citral and 100μL/L carvacrol inactivated at least 2.5log10cycles of exponentially growing cells in 3h under aerobic conditions. The presence of thiourea (an ROS scavenger) reduced cell inactivation in 2log10cycles, demonstrating the role of ROS in cell death. Decreased resistance of a ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) indicated that citral and carvacrol caused oxidative damage to DNA. Although the mechanism of E. coli inactivation by carvacrol and citral was similarly mediated by ROS, their formation did not follow the same pathways described for (+)-limonene and bactericidal drugs because neither Fenton reaction nor NADH production via the TCA cycle was involved in cell death. Moreover, further experiments demonstrated antimicrobial activity of citral and carvacrol in anaerobic environments without the involvement of ROS. As a consequence, cell death by carvacrol and citral in anaerobiosis follows a different mechanism than that observed under aerobic conditions. These results demonstrated a different mechanism of inactivation by citral and carvacrol with regard to (+)-limonene and bactericidal antibiotics, indicating the
Schnarrenberger, Claus; Martin, William
2002-02-01
The citric acid or tricarboxylic acid cycle is a central element of higher-plant carbon metabolism which provides, among other things, electrons for oxidative phosphorylation in the inner mitochondrial membrane, intermediates for amino-acid biosynthesis, and oxaloacetate for gluconeogenesis from succinate derived from fatty acids via the glyoxylate cycle in glyoxysomes. The tricarboxylic acid cycle is a typical mitochondrial pathway and is widespread among alpha-proteobacteria, the group of eubacteria as defined under rRNA systematics from which mitochondria arose. Most of the enzymes of the tricarboxylic acid cycle are encoded in the nucleus in higher eukaryotes, and several have been previously shown to branch with their homologues from alpha-proteobacteria, indicating that the eukaryotic nuclear genes were acquired from the mitochondrial genome during the course of evolution. Here, we investigate the individual evolutionary histories of all of the enzymes of the tricarboxylic acid cycle and the glyoxylate cycle using protein maximum likelihood phylogenies, focusing on the evolutionary origin of the nuclear-encoded proteins in higher plants. The results indicate that about half of the proteins involved in this eukaryotic pathway are most similar to their alpha-proteobacterial homologues, whereas the remainder are most similar to eubacterial, but not specifically alpha-proteobacterial, homologues. A consideration of (a) the process of lateral gene transfer among free-living prokaryotes and (b) the mechanistics of endosymbiotic (symbiont-to-host) gene transfer reveals that it is unrealistic to expect all nuclear genes that were acquired from the alpha-proteobacterial ancestor of mitochondria to branch specifically with their homologues encoded in the genomes of contemporary alpha-proteobacteria. Rather, even if molecular phylogenetics were to work perfectly (which it does not), then some nuclear-encoded proteins that were acquired from the alpha
USDA-ARS?s Scientific Manuscript database
CP12 is a small intrinsically unstructured protein that forms a multiprotein complex with two Calvin Cycle enzymes, phosphoribulokinase (PRK) and NAD(P)-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The complex can be reconstituted in vitro from recombinant proteins under conditions t...
Kanetsuna, Fuminori; Carbonell, Luis M.
1966-01-01
Kanetsuna, Fuminori (Instituto Venezolano de Investigaciones Cientificas, Caracas, Venezuela), and Luis M. Carbonell. Enzymes in glycolysis and the citric acid cycle in the yeast and mycelial forms of Paracoccidioides brasiliensis. J. Bacteriol. 92:1315–1320. 1966.—Enzymatic activities in glycolysis, the hexose monophosphate shunt, and the citric acid cycle in cell-free extracts of the yeast and mycelial forms of Paracoccidioides brasiliensis were examined comparatively. Both forms have the enzymes of these pathways. Activities of glucose-6-phosphate dehydrogenase and malic dehydrogenase of the mycelial form were higher than those of the yeast form. Another 15 enzymatic activities of the mycelial form were lower than those of the yeast form. The activity of glyceraldehyde-3-phosphate dehydrogenase showed the most marked difference between the two forms, its activity in the mycelial form being about 20% of that in the yeast form. PMID:5924267
Leke, Renata; Bak, Lasse K; Anker, Malene; Melø, Torun M; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Ott, Peter; Portela, Luis V; Sonnewald, Ursula; Schousboe, Arne; Waagepetersen, Helle S
2011-04-01
Cerebral hyperammonemia is believed to play a pivotal role in the development of hepatic encephalopathy (HE), a debilitating condition arising due to acute or chronic liver disease. In the brain, ammonia is thought to be detoxified via the activity of glutamine synthetase, an astrocytic enzyme. Moreover, it has been suggested that cerebral tricarboxylic acid (TCA) cycle metabolism is inhibited and glycolysis enhanced during hyperammonemia. The aim of this study was to characterize the ammonia-detoxifying mechanisms as well as the effects of ammonia on energy-generating metabolic pathways in a mouse neuronal-astrocytic co-culture model of the GABAergic system. We found that 5 mM ammonium chloride affected energy metabolism by increasing the neuronal TCA cycle activity and switching the astrocytic TCA cycle toward synthesis of substrate for glutamine synthesis. Furthermore, ammonia exposure enhanced the synthesis and release of alanine. Collectively, our results demonstrate that (1) formation of glutamine is seminal for detoxification of ammonia; (2) neuronal oxidative metabolism is increased in the presence of ammonia; and (3) synthesis and release of alanine is likely to be important for ammonia detoxification as a supplement to formation of glutamine.
Shaerzadeh, Fatemeh; Motamedi, Fereshteh; Khodagholi, Fariba
2014-11-01
3-Methyladenine (3-MA), as a PI3K inhibitor, is widely used for inhibition of autophagy. Inhibition of PI3K class I leads to inhibition of Akt phosphorylation, a central molecule involved in diverse arrays of intracellular cascades in nervous system. Accordingly, in the present study, we aimed to determine the alterations of specific mitochondrial biogenesis markers and mitochondrial function in 3-MA-injected rats following amyloid beta (Aβ) insult. Our data revealed that inhibition of Akt phosphorylation downregulates master regulator of mitochondrial biogenesis, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α). Our data also showed that decrease in PGC-1α level presumably is due to decrease in the phosphorylation of cAMP-response element binding and AMP-activated kinase, two upstream activators of PGC-1α. As a consequence, the level of some mitochondrial biogenesis factors including nuclear respiratory factor-1, mitochondrial transcription factor A, and Cytochrome c decreased significantly. Also, activities of tricarboxylic acid cycle (TCA) enzymes such as Aconitase, a-ketoglutarate dehydrogenase, and malate dehydrogenase reduced in the presence of 3-MA with or without Aβ insult. Decrease in mitochondrial biogenesis factors and TCA enzyme activity in the rats receiving 3-MA and Aβ were more compared to the rats that received either alone; indicating the additive destructive effects of these two agents. In agreement with our molecular results, data obtained from behavioral test (using novel objective recognition test) indicated that inhibition of Akt phosphorylation with or without Aβ injection impaired novel recognition (non-spatial) memory. Our results suggest that 3-MA amplified deleterious effects of Aβ by targeting central molecule Akt.
Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang
2014-08-01
Icotinib, a selective EGFR tyrosine kinase inhibitor (EGFR-TKI), has been shown to exhibit anti-tumor activity against several tumor cell lines. However, the exact molecular mechanism of icotinib's anti-tumor effect remains unknown. This study aims to examine the zytotoxic effect of icotinib on Tca8113 cells and its potential molecular mechanism. Icotinib significantly resulted in dose-dependent cell death as determined by MTT assay, accompanied by increased levels of Bax and DNA fragmentation. Icotinib could also induce Reactive Oxygen Species (ROS) generation. Further studies confirmed that scavenging of reactive oxygen species by N-acetyl-L-cysteine (NAC), and pharmacological inhibition of MAPK reversed icotinib-induced apoptosis in Tca8113 cells. Our data provide evidence that icotinib induces apoptosis, possibly via ROS-mediated MAPK pathway in Tca8113 cells.
NASA Astrophysics Data System (ADS)
Leitner, Sonja; Zimmermann, Michael; Bockholt, Jan; Schartner, Markus; Brugner, Paul; Holtermann, Christian; Zechmeister-Boltenstern, Sophie
2014-05-01
Climate change research predicts that both frequency and intensity of weather extremes such as long drought periods and heavy rainfall events will increase in mid Europe over the next decades. Soil moisture is one of the major factors controlling microbial soil processes, and it has been widely agreed that feedback effects between altered precipitation and changed soil fluxes of the greenhouse gases CO2, CH4 and N2O could intensify climate change. In a field experiment in an Austrian beech forest, we established a precipitation manipulation experiment, which will be conducted for 3 years. We use roofs to exclude rainfall from reaching the forest soil and simulate drought periods, and a sprinkler system to simulate heavy rainfall events. We applied repeated dry-wet cycles in two intensities: one treatment received 6 cycles of 1 month drought followed by 75mm irrigation within 2 hours, and a parallel treatment received 3 cycles of 2 months drought followed by 150mm irrigation within 3 hours. We took soil samples 1 day before, 1 day after and 1 week after rewetting events and analyzed them for soil nutrients and extracellular enzyme activities. Soil fluxes of CO2, N2O and CH4 were constantly monitored with an automated flux chamber system, and environmental parameters were recorded via dataloggers. In addition, we determined fluxes and nutrient concentrations of bulk precipitation, throughfall, stemflow, litter percolate and soil water. Next we plan to analyze soil microbial community composition via PLFAs to investigate microbial stress resistance and resilience, and we will use ultrasonication to measure soil aggregate stability and protection of soil organic matter in stressed and control plots. The results of the first year show that experimental rainfall manipulation has influenced soil extracellular enzymes. Potential phenoloxidase activity was significantly reduced in stressed treatments compared to control plots. All measured hydrolytic enzymes (cellulase
Cigarette smoke induces mitochondrial metabolic reprogramming in lung cells.
Solanki, Hitendra S; Babu, Niraj; Jain, Ankit P; Bhat, Mohd Younis; Puttamallesh, Vinuth N; Advani, Jayshree; Raja, Remya; Mangalaparthi, Kiran K; Kumar, Mahesh M; Prasad, T S Keshava; Mathur, Premendu Prakash; Sidransky, David; Gowda, Harsha; Chatterjee, Aditi
2018-05-01
Cellular transformation owing to cigarette smoking is due to chronic exposure and not acute. However, systematic studies to understand the molecular alterations in lung cells due to cigarette smoke are lacking. To understand these molecular alterations induced by chronic cigarette smoke exposure, we carried out tandem mass tag (TMT) based temporal proteomic profiling of lung cells exposed to cigarette smoke for upto 12months. We identified 2620 proteins in total, of which 671 proteins were differentially expressed (1.5-fold) after 12months of exposure. Prolonged exposure of lung cells to smoke for 12months revealed dysregulation of oxidative phosphorylation and overexpression of enzymes involved in TCA cycle. In addition, we also observed overexpression of enzymes involved in glutamine metabolism, fatty acid degradation and lactate synthesis. This could possibly explain the availability of alternative source of carbon to TCA cycle apart from glycolytic pyruvate. Our data indicates that chronic exposure to cigarette smoke induces mitochondrial metabolic reprogramming in cells to support growth and survival. Copyright © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
Borjian, Farshad; Johnsen, Ulrike; Schönheit, Peter; Berg, Ivan A
2017-01-01
Growth on acetate or other acetyl-CoA-generating substrates as a sole source of carbon requires an anaplerotic pathway for the conversion of acetyl-CoA into cellular building blocks. Haloarchaea (class Halobacteria ) possess two different anaplerotic pathways, the classical glyoxylate cycle and the novel methylaspartate cycle. The methylaspartate cycle was discovered in Haloarcula spp. and operates in ∼40% of sequenced haloarchaea. In this cycle, condensation of one molecule of acetyl-CoA with oxaloacetate gives rise to citrate, which is further converted to 2-oxoglutarate and then to glutamate. The following glutamate rearrangement and deamination lead to mesaconate (methylfumarate) that needs to be activated to mesaconyl-C1-CoA and hydrated to β-methylmalyl-CoA. The cleavage of β-methylmalyl-CoA results in the formation of propionyl-CoA and glyoxylate. The carboxylation of propionyl-CoA and the condensation of glyoxylate with another acetyl-CoA molecule give rise to two C 4 -dicarboxylic acids, thus regenerating the initial acetyl-CoA acceptor and forming malate, its final product. Here we studied two enzymes of the methylaspartate cycle from Haloarcula hispanica , succinyl-CoA:mesaconate CoA-transferase (mesaconate CoA-transferase, Hah_1336) and mesaconyl-CoA hydratase (Hah_1340). Their genes were heterologously expressed in Haloferax volcanii , and the corresponding enzymes were purified and characterized. Mesaconate CoA-transferase was specific for its physiological substrates, mesaconate and succinyl-CoA, and produced only mesaconyl-C1-CoA and no mesaconyl-C4-CoA. Mesaconyl-CoA hydratase had a 3.5-fold bias for the physiological substrate, mesaconyl-C1-CoA, compared to mesaconyl-C4-CoA, and virtually no activity with other tested enoyl-CoA/3-hydroxyacyl-CoA compounds. Our results further prove the functioning of the methylaspartate cycle in haloarchaea and suggest that mesaconate CoA-transferase and mesaconyl-CoA hydratase can be regarded as
Chowdhury, Golam M I; Patel, Anant B; Mason, Graeme F; Rothman, Douglas L; Behar, Kevin L
2007-12-01
The contribution of glutamatergic and gamma-aminobutyric acid (GABA)ergic neurons to oxidative energy metabolism and neurotransmission in the developing brain is not known. Glutamatergic and GABAergic fluxes were assessed in neocortex of postnatal day 10 (P10) and 30 (P30) urethane-anesthetized rats infused intravenously with [1,6-(13)C(2)]glucose for different time intervals (time course) or with [2-(13)C]acetate for 2 to 3 h (steady state). Amino acid levels and (13)C enrichments were determined in tissue extracts ex vivo using (1)H-[(13)C]-NMR spectroscopy. Metabolic fluxes were estimated from the best fits of a three-compartment metabolic model (glutamatergic neurons, GABAergic neurons, and astroglia) to the (13)C-enrichment time courses of amino acids from [1,6-(13)C(2)]glucose, constrained by the ratios of neurotransmitter cycling (V(cyc))-to-tricarboxylic acid (TCA) cycle flux (V(TCAn)) calculated from the steady-state [2-(13)C]acetate enrichment data. From P10 to P30 increases in total neuronal (glutamate plus GABA) TCA cycle flux (3 x ; 0.24+/-0.05 versus 0.71+/-0.07 micromol per g per min, P<0.0001) and total neurotransmitter cycling flux (3.1 to 5 x ; 0.07 to 0.11 (+/-0.03) versus 0.34+/-0.03 micromol per g per min, P<0.0001) were approximately proportional. Incremental changes in total cycling (DeltaV(cyc(tot))) and neuronal TCA cycle flux (DeltaV(TCAn(tot))) between P10 and P30 were 0.23 to 0.27 and 0.47 micromol per g per min, respectively, similar to the approximately 1:2 relationship previously reported for adult cortex. For the individual neurons, increases in V(TCAn) and V(cyc) were similar in magnitude (glutamatergic neurons, 2.7 x versus 2.8 to 4.6 x ; GABAergic neurons, approximately 5 x versus approximately 7 x), although GABAergic flux changes were larger. The findings show that glutamate and GABA neurons undergo large and approximately proportional increases in neurotransmitter cycling and oxidative energy metabolism during this major
Hirasawa, Takashi; Saito, Masaki; Yoshikawa, Katsunori; Furusawa, Chikara; Shmizu, Hiroshi
2018-05-01
Corynebacterium glutamicum is known for its ability to produce glutamic acid and has been utilized for the fermentative production of various amino acids. Glutamic acid production in C. glutamicum is induced by penicillin. In this study, the transcriptome and metabolome of C. glutamicum is analyzed to understand the mechanism of penicillin-induced glutamic acid production. Transcriptomic analysis with DNA microarray revealed that expression of some glycolysis- and TCA cycle-related genes, which include those encoding the enzymes involved in conversion of glucose to 2-oxoglutaric acid, is upregulated after penicillin addition. Meanwhile, expression of some TCA cycle-related genes, encoding the enzymes for conversion of 2-oxoglutaric acid to oxaloacetic acid, and the anaplerotic reactions decreased. In addition, expression of NCgl1221 and odhI, encoding proteins involved in glutamic acid excretion and inhibition of the 2-oxoglutarate dehydrogenase, respectively, is upregulated. Functional category enrichment analysis of genes upregulated and downregulated after penicillin addition revealed that genes for signal transduction systems are enriched among upregulated genes, whereas those for energy production and carbohydrate and amino acid metabolisms are enriched among the downregulated genes. As for the metabolomic analysis using capillary electrophoresis time-of-flight mass spectrometry, the intracellular content of most metabolites of the glycolysis and the TCA cycle decreased dramatically after penicillin addition. Overall, these results indicate that the cellular metabolism and glutamic acid excretion are mainly optimized at the transcription level during penicillin-induced glutamic acid production by C. glutamicum. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liu, Huawei; Li, Zhiyong; Wang, Chao; Feng, Lin; Huang, Haitao; Liu, Changkui; Li, Fengxia
2016-01-01
As a long noncoding RNA, HOX transcript antisense intergenic RNA (HOTAIR) is highly expressed in many types of tumors. However, its expression and function in oral squamous cell carcinoma (OSCC) cells and tissues remains largely unknown. We herein studied the biological functions of HOTAIR in OSCC Tca8113 cells. Real-time quantitative PCR showed that HOTAIR, p21 and p53 mRNA expressions in doxorubicin (DOX)-treated or γ-ray-irradiated Tca8113 cells were up-regulated. Knockdown of p53 expression inhibited DOX-induced HOTAIR up-regulation, suggesting that DNA damage-induced HOTAIR expression may be associated with p53. Transfection and CCK-8 assays showed that compared with the control group, overexpression of HOTAIR promoted the proliferation of Tca8113 cells, while interfering with its expression played an opposite role. Flow cytometry exhibited that HOTAIR overexpression decreased the rate of DOX-induced apoptosis. When HOTAIR expression was inhibited by siRNA, the proportions of cells in G2/M and S phases increased and decreased respectively. Meanwhile, the rate of DOX-induced apoptosis rose. DNA damage-induced HOTAIR expression facilitated the proliferation of Tca8113 cells and decreased their apoptosis. However, whether the up-regulation depends on p53 still needs in-depth studies. PMID:27904675
IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...
On September 24, 2009, the Toxicological Review of Trichloroacetic Acid (TCA) and the charge to external peer reviewers were released for external peer review and public comment. The Toxicological Review and charge were reviewed internally by EPA and by other federal agencies and White House Offices before public release. In the new IRIS process, introduced by the EPA Administrator, all written comments on IRIS assessments submitted by other federal agencies and White House Offices will be made publicly available. Accordingly, interagency comments and the interagency science consultation draft of the IRIS Toxicological Review of Trichloroacetic Acid and the charge to external peer reviewers are posted on this site. The draft Toxicological Review of Trichloroacetic Acid provides scientific support and rationale for the hazard identification and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wan, Ni; DeLorenzo, Drew M.; He, Lian
Synechocystis sp. strain PCC 6803 has been widely used as a photo-biorefinery chassis. Based on its genome annotation, this species contains a complete TCA cycle, an Embden-Meyerhof-Parnas pathway (EMPP), an oxidative pentose phosphate pathway (OPPP), and an Entner–Doudoroff pathway (EDP). To evaluate how Synechocystis 6803 catabolizes glucose under heterotrophic conditions, we performed 13C metabolic flux analysis, metabolite pool size analysis, gene knockouts, and heterologous expressions. The results revealed a cyclic mode of flux through the OPPP. Small, but non-zero, fluxes were observed through the TCA cycle and the malic shunt. Independent knockouts of 6-phosphogluconate dehydrogenase (gnd) and malic enzyme (me)more » corroborated these results, as neither mutant could grow under dark heterotrophic conditions. Our data also indicate that Synechocystis 6803 metabolism relies upon oxidative phosphorylation to generate ATP from NADPH under dark or insufficient light conditions. The pool sizes of intermediates in the TCA cycle, particularly acetyl-CoA, were found to be several fold lower in Synechocystis 6803 (compared to E. coli metabolite pool sizes), while its sugar phosphate intermediates were several-fold higher. Moreover, negligible flux was detected through the native, or heterologous, EDP in the wild type or Δgnd strains under heterotrophic conditions. Comparing photoautotrophic, photomixotrophic, and heterotrophic conditions, the Calvin cycle, OPPP, and EMPP in Synechocystis 6803 possess the ability to regulate their fluxes under various growth conditions (plastic), whereas its TCA cycle always maintains at low levels (rigid). This work also demonstrates how genetic profiles do not always reflect actual metabolic flux through native or heterologous pathways. Biotechnol. Bioeng. 2017;114: 1593–1602. © 2017 Wiley Periodicals, Inc.« less
Topology of modified helical gears and Tooth Contact Analysis (TCA) program
NASA Technical Reports Server (NTRS)
Litvin, Faydor L.; Zhang, Jiao
1989-01-01
The contents of this report covers: (1) development of optimal geometries for crowned helical gears; (2) a method for their generation; (3) tooth contact analysis (TCA) computer programs for the analysis of meshing and bearing contact of the crowned helical gears; and (4) modelling and simulation of gear shaft deflection. The developed method for synthesis was used to determine the optimal geometry for a crowned helical pinion surface and was directed to localize the bearing contact and guarantee favorable shape and a low level of transmission errors. Two new methods for generation of the crowned helical pinion surface are proposed. One is based on the application of a tool with a surface of revolution that slightly deviates from a regular cone surface. The tool can be used as a grinding wheel or as a shaver. The other is based on a crowning pinion tooth surface with predesigned transmission errors. The pinion tooth surface can be generated by a computer-controlled automatic grinding machine. The TCA program simulates the meshing and bearing contact of the misaligned gears. The transmission errors are also determined. The gear shaft deformation was modelled and investigated. It was found that the deflection of gear shafts has the same effect as gear misalignment.
Evaluation of endogenous nitric oxide synthesis in congenital urea cycle enzyme defects.
Nagasaka, Hironori; Tsukahara, Hirokazu; Yorifuji, Tohru; Miida, Takashi; Murayama, Kei; Tsuruoka, Tomoko; Takatani, Tomozumi; Kanazawa, Masaki; Kobayashi, Kunihiko; Okano, Yoshiyuki; Takayanagi, Masaki
2009-03-01
Nitric oxide (NO) is synthesized from arginine and O(2) by nitric oxide synthase (NOS). Citrulline, which is formed as a by-product of the NOS reaction, can be recycled to arginine by the 2 enzymes acting in the urea cycle: argininosuccinate synthetase (ASS) and argininosuccinate lyase (ASL). Although the complete urea cycle is expressed only in the liver, ASS and ASL are expressed in other organs including the kidney and vascular endothelium. To examine possible alterations of the NO pathway in urea cycle defects, we measured plasma concentrations of arginine and citrulline and serum concentrations of nitrite/nitrate (NOx(-), stable NO metabolites) and asymmetric dimethylarginine (ADMA, an endogenous NOS inhibitor) in patients with congenital urea cycle disorders of 3 types: ornithine transcarbamylase (OTC) deficiency, ASS deficiency, and ASL deficiency. All were receiving oral arginine replacement at the time of this study. The same parameters were also measured in healthy subjects, who participated as controls. The OTC-deficient patients had significantly high NOx(-) and nonsignificantly high ADMA concentrations. Their NOx(-) was significantly positively correlated with arginine. The ASS-deficient patients had significantly low NOx(-) and significantly high ADMA concentrations. The ASL-deficient patients had normal NOx(-) and nonsignificantly high ADMA concentrations. In ASS-deficient and ASL-deficient patients, the NOx(-) was significantly inversely correlated with citrulline. These results suggest that NO synthesis is enhanced in OTC-deficient patients while receiving arginine but that NO synthesis remains low in ASS-deficient patients despite receiving arginine. They also suggest that endogenous NO synthesis is negatively affected by citrulline and ADMA in ASS-deficient and ASL-deficient patients. Although the molecular mechanisms remain poorly understood, we infer that the NO pathway might play a role in the pathophysiology related to congenital urea cycle
Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H; Pedersen, Peter L; Goffeau, Andre; Ułaszewski, Stanisław
2016-03-01
In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP.
You, Le; Berla, Bert; He, Lian; Pakrasi, Himadri B; Tang, Yinjie J
2014-05-01
The central carbon metabolism of cyanobacteria is under debate. For over 50 years, the lack of α-ketoglutarate dehydrogenase has led to the belief that cyanobacteria have an incomplete TCA cycle. Recent in vitro enzymatic experiments suggest that this cycle may in fact be closed. The current study employed (13) C isotopomers to delineate pathways in the cyanobacterium Synechocystis sp. PCC 6803. By tracing the incorporation of supplemented glutamate into the downstream metabolites in the TCA cycle, we observed a direct in vivo transformation of α-ketoglutarate to succinate. Additionally, isotopic tracing of glyoxylate did not show a functional glyoxylate shunt and glyoxylate was used for glycine synthesis. The photomixotrophic carbon metabolism was then profiled with (13) C-MFA under light and carbon-sufficient conditions. We observed that: (i) the in vivo flux through the TCA cycle reactions (α-ketoglutarate → succinate) was minimal (<2%); (ii) the flux ratio of CO2 fixation was six times higher than that of glucose utilization; (iii) the relative flux through the oxidative pentose phosphate pathway was low (<2%); (iv) high flux through malic enzyme served as a main route for pyruvate synthesis. Our results improve the understanding of the versatile metabolism in cyanobacteria and shed light on their application for photo-biorefineries. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lu, Qian; Zhao, Yue; Gao, Xintong; Wu, Junqiu; Zhou, Haixuan; Tang, Pengfei; Wei, Qingbin; Wei, Zimin
2018-05-01
Composting is an environment friendly method to recycling organic waste. However, with the increasing concern about greenhouse gases generated in global atmosphere, it is significant to reduce the emission of carbon dioxide (CO 2 ). This study analyzes tricarboxylic acid (TCA) cycle regulators on the effect of reducing CO 2 emission, and the relationship among organic component (OC) degradation and transformation and microorganism during composting. The results showed that adding adenosine tri-phosphate (ATP) and nicotinamide adenine dinucleotide (NADH) could enhance the transformation of OC and increase the diversity of microorganism community. Malonic acid (MA) as a competitive inhibitor could decrease the emission of CO 2 by inhibiting the TCA cycle. A structural equation model was established to explore effects of different OC and microorganism on humic acid (HA) concentration during composting. Furthermore, added MA provided an environmental benefit in reducing the greenhouse gas emission for manufacture sustainable products. Copyright © 2018 Elsevier Ltd. All rights reserved.
Li, Lin-feng; Zhai, Fang; Shang, Lu-qing; Yin, Zheng; Yuan, Ying-jin
2014-01-01
Identification of efficient key enzymes in biosynthesis pathway and optimization of the fitness between functional modules and chassis are important for improving the production of target compounds. In this study, the taxadiene biosynthesis pathway was firstly constructed in yeast by transforming ts gene and overexpressing erg20 and thmgr. Then, the catalytic capabilities of six different geranylgeranyl diphosphate synthases (GGPPS), the key enzyme in mevalonic acid (MVA) pathway catalyzing famesyl diphosphate (FPP) to geranylgeranyl diphosphate (GGPP), were predicted using enzyme-substrate docking strategy. GGPPSs from Taxus baccata x Taxus cuspidate (GGPPSbc), Erwinia herbicola (GGPPSeh), and S. cerevisiae (GGPPSsc) which ranked 1st, 4th and 6th in docking with FPP were selected for construction. The experimental results were consistent with the computer prediction that the engineered yeast with GGPPSbc exhibited the highest production. In addition, two chassis YSG50 and W303-1A were chosen, and the titer of taxadiene reached 72.8 mg/L in chassis YSG50 with GGPPSbc. Metabolomic study revealed that the contents of tricarboxylic acid cycle (TCA) intermediates and their precursor amino acids in chassis YSG50 was lower than those in W303-1A, indicating less carbon flux was divided into TCA cycle. Furthermore, the levels of TCA intermediates in the taxadiene producing yeasts were lower than those in chassis YSG50. Thus, it may result in more carbon flux in MVA pathway in chassis YSG50, which suggested that YSG50 was more suitable for engineering the taxadiene producing yeast. These results indicated that computer-aided protein modeling directed isoenzyme selection strategy and metabolomic study could guide the rational design of terpenes biosynthetic cells. PMID:25295588
Khurshed, Mohammed; Molenaar, Remco J; Lenting, Krissie; Leenders, William P; van Noorden, Cornelis J F
2017-07-25
Hotspot mutations in isocitrate dehydrogenase 1 (IDH1) initiate low-grade glioma and secondary glioblastoma and induce a neomorphic activity that converts α-ketoglutarate (α-KG) to the oncometabolite D-2-hydroxyglutarate (D-2-HG). It causes metabolic rewiring that is not fully understood. We investigated the effects of IDH1 mutations (IDH1MUT) on expression of genes that encode for metabolic enzymes by data mining The Cancer Genome Atlas. We analyzed 112 IDH1 wild-type (IDH1WT) versus 399 IDH1MUT low-grade glioma and 157 IDH1WT versus 9 IDH1MUT glioblastoma samples. In both glioma types, IDH1WT was associated with high expression levels of genes encoding enzymes that are involved in glycolysis and acetate anaplerosis, whereas IDH1MUT glioma overexpress genes encoding enzymes that are involved in the oxidative tricarboxylic acid (TCA) cycle. In vitro, we observed that IDH1MUT cancer cells have a higher basal respiration compared to IDH1WT cancer cells and inhibition of the IDH1MUT shifts the metabolism by decreasing oxygen consumption and increasing glycolysis. Our findings indicate that IDH1WT glioma have a typical Warburg phenotype whereas in IDH1MUT glioma the TCA cycle, rather than glycolytic lactate production, is the predominant metabolic pathway. Our data further suggest that the TCA in IDH1MUT glioma is driven by lactate and glutamate anaplerosis to facilitate production of α-KG, and ultimately D-2-HG. This metabolic rewiring may be a basis for novel therapies for IDH1MUT and IDH1WT glioma.
Saruhan, Neslihan; Terzi, Rabiye; Saglam, Aykut; Kadioglu, Asim
2009-01-01
The ascorbate-glutathione (ASC-GSH) cycle has an important role in defensive processes against oxidative damage generated by drought stress. In this study, the changes that take place in apoplastic and symplastic ASC-GSH cycle enzymes of the leaf and petiole were investigated under drought stress causing leaf rolling in Ctenanthe setosa (Rose.) Eichler (Marantaceae). Apoplastic and symplastic extractions of leaf and petiole were performed at different visual leaf rolling scores from 1 to 4 (1 is unrolled, 4 is tightly rolled and the others are intermediate forms). Glutathione reductase (GR), a key enzyme in the GSH regeneration cycle, and ascorbate (ASC) were present in apoplastic spaces of the leaf and petiole, whereas dehydroascorbate reductase (DHAR), which uses glutathione as reductant, monodehydroascorbate reductase (MDHAR), which uses NAD(P)H as reductant, and glutathione were absent. GR, DHAR and MDHAR activities increased in the symplastic and apoplastic areas of the leaf. Apoplastic and symplastic ASC and dehydroascorbate (DHA), the oxidized form of ascorbate, rose at all scores except score 4 of symplastic ASC in the leaf. On the other hand, while reduced glutathione (GSH) content was enhanced, oxidized glutathione (GSSG) content decreased in the leaf during rolling. As for the petiole, GR activity increased in the apoplastic area but decreased in the symplastic area. DHAR and MDHAR activities increased throughout all scores, but decreased to the score 1 level at score 4. The ASC content of the apoplast increased during leaf rolling. Conversely, symplastic ASC content increased at score 2, however decreased at the later scores. While the apoplastic DHA content declined, symplastic DHA rose at score 2, but later was down to the level of score 1. While GSH content enhanced during leaf rolling, GSSG content did not change except at score 2. As well, there were good correlations between leaf rolling and ASC-GSH cycle enzyme activities in the leaf (GR and DHAR
Elkalaf, Moustafa; Tůma, Petr; Weiszenstein, Martin; Polák, Jan; Trnka, Jan
2016-01-01
Methyltriphenylphosphonium (TPMP) salts have been widely used to measure the mitochondrial membrane potential and the triphenylphosphonium (TPP+) moiety has been attached to many bioactive compounds including antioxidants to target them into mitochondria thanks to their high affinity to accumulate in the mitochondrial matrix. The adverse effects of these compounds on cellular metabolism have been insufficiently studied and are still poorly understood. Micromolar concentrations of TPMP cause a progressive inhibition of cellular respiration in adherent cells without a marked effect on mitochondrial coupling. In permeabilized cells the inhibition was limited to NADH-linked respiration. We found a mixed inhibition of the Krebs cycle enzyme 2-oxoglutarate dehydrogenase complex (OGDHC) with an estimated IC50 3.93 [3.70-4.17] mM, which is pharmacologically plausible since it corresponds to micromolar extracellular concentrations. Increasing the lipophilic character of the used TPP+ compound further potentiates the inhibition of OGDHC activity. This effect of TPMP on the Krebs cycle ought to be taken into account when interpreting observations on cells and mitochondria in the presence of TPP+ derivatives. Compounds based on or similar to TPP+ derivatives may also be used to alter OGDHC activity for experimental or therapeutic purposes.
Elkalaf, Moustafa; Tůma, Petr; Weiszenstein, Martin; Polák, Jan
2016-01-01
Methyltriphenylphosphonium (TPMP) salts have been widely used to measure the mitochondrial membrane potential and the triphenylphosphonium (TPP+) moiety has been attached to many bioactive compounds including antioxidants to target them into mitochondria thanks to their high affinity to accumulate in the mitochondrial matrix. The adverse effects of these compounds on cellular metabolism have been insufficiently studied and are still poorly understood. Micromolar concentrations of TPMP cause a progressive inhibition of cellular respiration in adherent cells without a marked effect on mitochondrial coupling. In permeabilized cells the inhibition was limited to NADH-linked respiration. We found a mixed inhibition of the Krebs cycle enzyme 2-oxoglutarate dehydrogenase complex (OGDHC) with an estimated IC50 3.93 [3.70–4.17] mM, which is pharmacologically plausible since it corresponds to micromolar extracellular concentrations. Increasing the lipophilic character of the used TPP+ compound further potentiates the inhibition of OGDHC activity. This effect of TPMP on the Krebs cycle ought to be taken into account when interpreting observations on cells and mitochondria in the presence of TPP+ derivatives. Compounds based on or similar to TPP+ derivatives may also be used to alter OGDHC activity for experimental or therapeutic purposes. PMID:27537184
Wei, Bangdong; Shin, Sooan; LaPorte, David; Wolfe, Alan J.; Romeo, Tony
2000-01-01
The csrA gene encodes a small RNA-binding protein, which acts as a global regulator in Escherichia coli and other bacteria (T. Romeo, Mol. Microbiol. 29:1321–1330, 1998). Its key regulatory role in central carbon metabolism, both as an activator of glycolysis and as a potent repressor of glycogen biosynthesis and gluconeogenesis, prompted us to examine the involvement of csrA in acetate metabolism and the tricarboxylic acid (TCA) cycle. We found that growth of csrA rpoS mutant strains was very poor on acetate as a sole carbon source. Surprisingly, growth also was inhibited specifically by the addition of modest amounts of acetate to rich media (e.g., tryptone broth). Cultures grown in the presence of ≥25 mM acetate consisted substantially of glycogen biosynthesis (glg) mutants, which were no longer inhibited by acetate. Several classes of glg mutations were mapped to known and novel loci. Several hypotheses were examined to provide further insight into the effects of acetate on growth and metabolism in these strains. We determined that csrA positively regulates acs (acetyl-coenzyme A synthetase; Acs) expression and isocitrate lyase activity without affecting key TCA cycle enzymes or phosphotransacetylase. TCA cycle intermediates or pyruvate, but not glucose, galactose, or glycerol, restored growth and prevented the glg mutations in the presence of acetate. Furthermore, amino acid uptake was inhibited by acetate specifically in the csrA rpoS strain. We conclude that central carbon flux imbalance, inhibition of amino acid uptake, and a deficiency in acetate metabolism apparently are combined to cause metabolic stress by depleting the TCA cycle. PMID:10692369
Zhang, Huiqing; Guo, Xu; Dai, Jingyao; Wu, Yousheng; Ge, Naijian; Yang, Yefa; Ji, Jiansong; Zhang, Hongxin
2014-11-01
Metabolic reprogramming is an important hallmark of cancer cells, including the alterations of activity and expression in tricarboxylic acid (TCA) cycle key enzymes. Previous studies have reported the associations between tumor formation and three core enzymes involved in the TCA cycle. However, the association between functional single nucleotide polymorphisms (SNPs) in one of TCA cycle key gene isocitrate dehydrogenase (IDH) and the overall survival of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) has never been investigated. Five functional SNPs in IDH1 and IDH2 genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 419 unresectable Chinese HCC patients treated with TACE. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. We found that SNPs rs12478635 in IDH1 and rs11632348 in IDH2 gene exhibited significant associations with death risk in HCC patients in the dominant model (HR 1.33; 95 % CI 1.02-1.73; P = 0.037) and in recessive model (HR 1.87; 95 % CI 1.27-2.75; P = 0.001), respectively. Moreover, we observed a cumulative effect of these two SNPs on HCC overall survival, indicating a significant trend of death risk increase with increasing number of unfavorable genotypes (P for trend = 0.001). Additionally, our data suggest that unfavorable genotypes of two SNPs may be used as an independent prognostic marker in those with advanced stage and patients with serum AFP <200 μg/L. Our results for the first time suggest that IDH gene polymorphisms may serve as an independent prognostic marker for HCC patients treated with TACE.
NASA Astrophysics Data System (ADS)
Bazylinski, D. A.; Williams, T. J.; Zhang, C. L.; Scott, J. H.
2005-12-01
All cultured, marine, magnetite-producing, magnetotactic bacteria (MB) are capable of chemolithoautotrophy and use a number of electron donors to support this mode of growth including reduced sulfur compounds. Several vibrioid strains are known to rely on the Calvin-Benson-Bassham (CBB) cycle for autotrophy. An obligately microaerophilic, magnetite-producing, coccoid strain (MC-1) grew with sulfide and thiosulfate as electron donors and 14C-labelling experiments showed that virtually all cell C was derived from H14CO3-/14CO2 confirming autotrophy in this strain. Cell-free extracts of strain MC-1 did not exhibit ribulose-1,5-bisphosphate carboxylase-oxygenase (RubisCO) activity and nor were RubisCO genes found in the draft genome of the organism. Cell extracts also did not exhibit carbon monoxide dehydrogenase activity indicating that the acetyl-CoA pathway also does not function in strain MC-1. The 13C content of whole cells of strain MC-1 relative to the 13C content of the H14CO3-/14CO2 used for growth (Δδ13C) was -11.4 ppt. Cellular fatty acids showed enrichment of 13C relative to biomass. Activities for three key enzymes of the reverse or reductive tricarboxylic acid (rTCA) cycle were demonstrated for MC-1: fumarate reductase, pyruvate: acceptor oxidoreductase and 2-oxoglutarate: acceptor oxidoreductase. Although ATP citrate lyase (another key enzyme of the rTCA cycle) activity was not detected in cell-free extracts of strain MC-1 using commonly used assays for this enzyme, cell-free extract was found to rapidly cleave citrate, and the reaction was dependent upon the presence of ATP, coenzyme A and NADH. Thus, we infer the presence of an ATP-dependent citrate-cleaving enzyme or enzymes. The Δδ13C value and results from enzyme studies are consistent with the operation of the rTCA cycle for autotrophy in strain MC-1. Strain MC-1 appears to be the first known member of the alpha-Proteobacteria to assimilate CO2 during autotrophic growth using the rTCA cycle
Jęśko, Henryk; Lukiw, Walter J; Wilkaniec, Anna; Cieślik, Magdalena; Gąssowska-Dobrowolska, Magdalena; Murawska, Emilia; Hilgier, Wojciech; Adamczyk, Agata
2018-01-01
Urea cycle enzymes may play important yet poorly characterized roles in Alzheimer's disease (AD). Our previous results showed that amyloid-β (Aβ) affects urea cycle enzymes in rat pheochromocytoma (PC12) cells. The aim of the present study was to investigate the changes in arginases, other urea cycle enzymes, and nitric oxide synthases (NOSs) in PC12 cells transfected with AβPP bearing the double 'Swedish' mutation (APPsw, K670M/N671L) and in postmortem sporadic AD brain hippocampus; the mutation intensifies Aβ production and strongly associates with AD neuropathology. mRNA expression was analyzed using real-time PCR in cell cultures and DNA microarrays in hippocampal CA1 area of human AD brains. Arginase activity was measured spectrophotometrically, and arginine, ornithine, and citrulline levels by high-performance liquid chromatography. Our data demonstrated that the expression and activity of arginases (Arg1 and Arg2), as well as the expression of argininosuccinate synthase (Ass) were significantly reduced in APPsw cells compared to control. However, argininosuccinate lyase (Asl) was upregulated in APPsw cells. Real-time PCR analysis revealed significant elevation of neuronal nitric oxide synthase (Nnos) mRNA in APPsw cells, without changes in the endothelial Enos, whereas inducible Inos was undetectable. The changes were found to follow closely those observed in the human hippocampal CA1 region of sporadic AD brains. The changes in enzyme expression were accompanied in APPsw cells by significantly elevated citrulline, ornithine, and arginine. Our findings demonstrate that AβPP/Aβ alters arginine metabolism and induces a shift of cellular homeostasis that may support the oxidative/nitrosative stress observed in AD.
Marelja, Zvonimir; Leimkühler, Silke; Missirlis, Fanis
2018-01-01
Iron sulfur (Fe-S) clusters and the molybdenum cofactor (Moco) are present at enzyme sites, where the active metal facilitates electron transfer. Such enzyme systems are soluble in the mitochondrial matrix, cytosol and nucleus, or embedded in the inner mitochondrial membrane, but virtually absent from the cell secretory pathway. They are of ancient evolutionary origin supporting respiration, DNA replication, transcription, translation, the biosynthesis of steroids, heme, catabolism of purines, hydroxylation of xenobiotics, and cellular sulfur metabolism. Here, Fe-S cluster and Moco biosynthesis in Drosophila melanogaster is reviewed and the multiple biochemical and physiological functions of known Fe-S and Moco enzymes are described. We show that RNA interference of Mocs3 disrupts Moco biosynthesis and the circadian clock. Fe-S-dependent mitochondrial respiration is discussed in the context of germ line and somatic development, stem cell differentiation and aging. The subcellular compartmentalization of the Fe-S and Moco assembly machinery components and their connections to iron sensing mechanisms and intermediary metabolism are emphasized. A biochemically active Fe-S core complex of heterologously expressed fly Nfs1, Isd11, IscU, and human frataxin is presented. Based on the recent demonstration that copper displaces the Fe-S cluster of yeast and human ferredoxin, an explanation for why high dietary copper leads to cytoplasmic iron deficiency in flies is proposed. Another proposal that exosomes contribute to the transport of xanthine dehydrogenase from peripheral tissues to the eye pigment cells is put forward, where the Vps16a subunit of the HOPS complex may have a specialized role in concentrating this enzyme within pigment granules. Finally, we formulate a hypothesis that (i) mitochondrial superoxide mobilizes iron from the Fe-S clusters in aconitase and succinate dehydrogenase; (ii) increased iron transiently displaces manganese on superoxide dismutase, which
Marelja, Zvonimir; Leimkühler, Silke; Missirlis, Fanis
2018-01-01
Iron sulfur (Fe-S) clusters and the molybdenum cofactor (Moco) are present at enzyme sites, where the active metal facilitates electron transfer. Such enzyme systems are soluble in the mitochondrial matrix, cytosol and nucleus, or embedded in the inner mitochondrial membrane, but virtually absent from the cell secretory pathway. They are of ancient evolutionary origin supporting respiration, DNA replication, transcription, translation, the biosynthesis of steroids, heme, catabolism of purines, hydroxylation of xenobiotics, and cellular sulfur metabolism. Here, Fe-S cluster and Moco biosynthesis in Drosophila melanogaster is reviewed and the multiple biochemical and physiological functions of known Fe-S and Moco enzymes are described. We show that RNA interference of Mocs3 disrupts Moco biosynthesis and the circadian clock. Fe-S-dependent mitochondrial respiration is discussed in the context of germ line and somatic development, stem cell differentiation and aging. The subcellular compartmentalization of the Fe-S and Moco assembly machinery components and their connections to iron sensing mechanisms and intermediary metabolism are emphasized. A biochemically active Fe-S core complex of heterologously expressed fly Nfs1, Isd11, IscU, and human frataxin is presented. Based on the recent demonstration that copper displaces the Fe-S cluster of yeast and human ferredoxin, an explanation for why high dietary copper leads to cytoplasmic iron deficiency in flies is proposed. Another proposal that exosomes contribute to the transport of xanthine dehydrogenase from peripheral tissues to the eye pigment cells is put forward, where the Vps16a subunit of the HOPS complex may have a specialized role in concentrating this enzyme within pigment granules. Finally, we formulate a hypothesis that (i) mitochondrial superoxide mobilizes iron from the Fe-S clusters in aconitase and succinate dehydrogenase; (ii) increased iron transiently displaces manganese on superoxide dismutase, which
NASA Astrophysics Data System (ADS)
Alcolombri, Uria; Ben-Dor, Shifra; Feldmesser, Ester; Levin, Yishai; Tawfik, Dan S.; Vardi, Assaf
2015-06-01
Algal blooms produce large amounts of dimethyl sulfide (DMS), a volatile with a diverse signaling role in marine food webs that is emitted to the atmosphere, where it can affect cloud formation. The algal enzymes responsible for forming DMS from dimethylsulfoniopropionate (DMSP) remain unidentified despite their critical role in the global sulfur cycle. We identified and characterized Alma1, a DMSP lyase from the bloom-forming algae Emiliania huxleyi. Alma1 is a tetrameric, redox-sensitive enzyme of the aspartate racemase superfamily. Recombinant Alma1 exhibits biochemical features identical to the DMSP lyase in E. huxleyi, and DMS released by various E. huxleyi isolates correlates with their Alma1 levels. Sequence homology searches suggest that Alma1 represents a gene family present in major, globally distributed phytoplankton taxa and in other marine organisms.
Scaini, Giselli; Santos, Patricia M; Benedet, Joana; Rochi, Natália; Gomes, Lara M; Borges, Lislaine S; Rezin, Gislaine T; Pezente, Daiana P; Quevedo, João; Streck, Emilio L
2010-05-31
Several works report brain impairment of metabolism as a mechanism underlying depression. Citrate synthase and succinate dehydrogenase are enzymes localized within cells in the mitochondrial matrix and are important steps of Krebs cycle. In addition, citrate synthase has been used as a quantitative enzyme marker for the presence of intact mitochondria. Thus, we investigated citrate synthase and succinate dehydrogenase activities from rat brain after chronic administration of paroxetine, nortriptiline and venlafaxine. Adult male Wistar rats received daily injections of paroxetine (10mg/kg), nortriptiline (15mg/kg), venlafaxine (10mg/kg) or saline in 1.0mL/kg volume for 15 days. Twelve hours after the last administration, the rats were killed by decapitation, the hippocampus, striatum and prefrontal cortex were immediately removed, and activities of citrate synthase and succinate dehydrogenase were measured. We verified that chronic administration of paroxetine increased citrate synthase activity in the prefrontal cortex, hippocampus, striatum and cerebral cortex of adult rats; cerebellum was not affected. Chronic administration of nortriptiline and venlafaxine did not affect the enzyme activity in these brain areas. Succinate dehydrogenase activity was increased by chronic administration of paroxetine and nortriptiline in the prefrontal cortex, hippocampus, striatum and cerebral cortex of adult rats; cerebellum was not affected either. Chronic administration of venlafaxine increased succinate dehydrogenase activity in prefrontal cortex, but did not affect the enzyme activity in cerebellum, hippocampus, striatum and cerebral cortex. Considering that metabolism impairment is probably involved in the pathophysiology of depressive disorders, an increase in these enzymes by antidepressants may be an important mechanism of action of these drugs. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Sonnay, Sarah; Poirot, Jordan; Just, Nathalie; Clerc, Anne-Catherine; Gruetter, Rolf; Rainer, Gregor; Duarte, João M N
2018-03-01
Astrocytes play an important role in glutamatergic neurotransmission, namely by clearing synaptic glutamate and converting it into glutamine that is transferred back to neurons. The rate of this glutamate-glutamine cycle (V NT ) has been proposed to couple to that of glucose utilization and of neuronal tricarboxylic acid (TCA) cycle. In this study, we tested the hypothesis that glutamatergic neurotransmission is also coupled to the TCA cycle rate in astrocytes. For that we investigated energy metabolism by means of magnetic resonance spectroscopy (MRS) in the primary visual cortex of tree shrews (Tupaia belangeri) under light isoflurane anesthesia at rest and during continuous visual stimulation. After identifying the activated cortical volume by blood oxygenation level-dependent functional magnetic resonance imaging, 1 H MRS was performed to measure stimulation-induced variations in metabolite concentrations. Relative to baseline, stimulation of cortical activity for 20 min caused a reduction of glucose concentration by -0.34 ± 0.09 µmol/g (p < 0.001), as well as a -9% ± 1% decrease of the ratio of phosphocreatine-to-creatine (p < 0.05). Then 13 C MRS during [1,6- 13 C]glucose infusion was employed to measure fluxes of energy metabolism. Stimulation of glutamatergic activity, as indicated by a 20% increase of V NT , resulted in increased TCA cycle rates in neurons by 12% ( VTCAn, p < 0.001) and in astrocytes by 24% ( VTCAg, p = 0.007). We further observed linear relationships between V NT and both VTCAn and VTCAg. Altogether, these results suggest that in the tree shrew primary visual cortex glutamatergic neurotransmission is linked to overall glucose oxidation and to mitochondrial metabolism in both neurons and astrocytes. © 2017 Wiley Periodicals, Inc.
O'Neill, Ellis C.; Stevenson, Clare E. M.; Tantanarat, Krit; Latousakis, Dimitrios; Donaldson, Matthew I.; Rejzek, Martin; Nepogodiev, Sergey A.; Limpaseni, Tipaporn; Field, Robert A.; Lawson, David M.
2015-01-01
The degradation of transitory starch in the chloroplast to provide fuel for the plant during the night requires a suite of enzymes that generate a series of short chain linear glucans. However, glucans of less than four glucose units are no longer substrates for these enzymes, whereas export from the plastid is only possible in the form of either maltose or glucose. In order to make use of maltotriose, which would otherwise accumulate, disproportionating enzyme 1 (DPE1; a 4-α-glucanotransferase) converts two molecules of maltotriose to a molecule of maltopentaose, which can now be acted on by the degradative enzymes, and one molecule of glucose that can be exported. We have determined the structure of the Arabidopsis plastidial DPE1 (AtDPE1), and, through ligand soaking experiments, we have trapped the enzyme in a variety of conformational states. AtDPE1 forms a homodimer with a deep, long, and open-ended active site canyon contained within each subunit. The canyon is divided into donor and acceptor sites with the catalytic residues at their junction; a number of loops around the active site adopt different conformations dependent on the occupancy of these sites. The “gate” is the most dynamic loop and appears to play a role in substrate capture, in particular in the binding of the acceptor molecule. Subtle changes in the configuration of the active site residues may prevent undesirable reactions or abortive hydrolysis of the covalently bound enzyme-substrate intermediate. Together, these observations allow us to delineate the complete AtDPE1 disproportionation cycle in structural terms. PMID:26504082
Microbial Enzyme Activity and Carbon Cycling in Grassland Soil Fractions
NASA Astrophysics Data System (ADS)
Allison, S. D.; Jastrow, J. D.
2004-12-01
Extracellular enzymes are necessary to degrade complex organic compounds present in soils. Using physical fractionation procedures, we tested whether old soil carbon is spatially isolated from degradative enzymes across a prairie restoration chronosequence in Illinois, USA. We found that carbon-degrading enzymes were abundant in all soil fractions, including macroaggregates, microaggregates, and the clay fraction, which contains carbon with a mean residence time of ~200 years. The activities of two cellulose-degrading enzymes and a chitin-degrading enzyme were 2-10 times greater in organic matter fractions than in bulk soil, consistent with the rapid turnover of these fractions. Polyphenol oxidase activity was 3 times greater in the clay fraction than in the bulk soil, despite very slow carbon turnover in this fraction. Changes in enzyme activity across the restoration chronosequence were small once adjusted for increases in soil carbon concentration, although polyphenol oxidase activity per unit carbon declined by 50% in native prairie versus cultivated soil. These results are consistent with a `two-pool' model of enzyme and carbon turnover in grassland soils. In light organic matter fractions, enzyme production and carbon turnover both occur rapidly. However, in mineral-dominated fractions, both enzymes and their carbon substrates are immobilized on mineral surfaces, leading to slow turnover. Soil carbon accumulation in the clay fraction and across the prairie restoration chronosequence probably reflects increasing physical isolation of enzymes and substrates on the molecular scale, rather than the micron to millimeter scale.
Villa, R F; Gorini, A; Hoyer, S
2006-11-01
The effect of ageing on the activity of enzymes linked to Krebs' cycle, electron transfer chain and glutamate metabolism was studied in three different types of mitochondria of cerebral cortex of 1-year old and 2-year old male Wistar rats. We assessed the maximum rate (V(max)) of the mitochondrial enzyme activities in non-synaptic perikaryal mitochondria, and in two populations of intra-synaptic mitochondria. The results indicated that: (i) in normal, steady-state cerebral cortex the values of the catalytic activities of the enzymes markedly differed in the various populations of mitochondria; (ii) in intra-synaptic mitochondria, ageing affected the catalytic properties of the enzymes linked to Krebs' cycle, electron transfer chain and glutamate metabolism; (iii) these changes were more evident in intra-synaptic "heavy" than "light" mitochondria. These results indicate a different age-related vulnerability of subpopulations of mitochondria in vivo located into synapses than non-synaptic ones.
Rueda, Elda M.; Johnson, Jerry E.; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J.; Sigel, Irena; Chaney, Shawnta Y.
2016-01-01
Purpose The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. Methods mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. Results The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor
Rueda, Elda M; Johnson, Jerry E; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J; Sigel, Irena; Chaney, Shawnta Y; Fox, Donald A
2016-01-01
The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Keohane, Colleen E; Steele, Andrew D; Fetzer, Christian; Khowsathit, Jittasak; Van Tyne, Daria; Moynié, Lucile; Gilmore, Michael S; Karanicolas, John; Sieber, Stephan A; Wuest, William M
2018-02-07
Natural products have served as an inspiration to scientists both for their complex three-dimensional architecture and exquisite biological activity. Promysalin is one such Pseudomonad secondary metabolite that exhibits narrow-spectrum antibacterial activity, originally isolated from the rhizosphere. We herein utilize affinity-based protein profiling (AfBPP) to identify succinate dehydrogenase (Sdh) as the biological target of the natural product. The target was further validated in silico, in vitro, in vivo, and through the selection, and sequencing, of a resistant mutant. Succinate dehydrogenase plays an essential role in primary metabolism of Pseudomonas aeruginosa as the only enzyme that is involved both in the tricarboxylic acid cycle (TCA) and in respiration via the electron transport chain. These findings add credence to other studies that suggest that the TCA cycle is an understudied target in the development of novel therapeutics to combat P. aeruginosa, a significant pathogen in clinical settings.
Subramanian, Perumal; Jayakumar, Murugesan; Jayapalan, Jaime Jacqueline; Hashim, Onn Haji
2014-12-01
Elevated blood ammonia leads to hyperammonaemia that affects vital central nervous system (CNS) functions. Fisetin, a naturally occurring flavonoid, exhibits therapeutic benefits, such as anti-cancer, anti-diabetic, anti-oxidant, anti-angiogenic, neuroprotective and neurotrophic effects. In this study, the chronotherapeutic effect of fisetin on ammonium chloride (AC)-induced hyperammonaemic rats was investigated, to ascertain the time point at which the maximum drug effect is achieved. The anti-hyperammonaemic potential of fisetin (50mg/kg b.w. oral) was analysed when administered to AC treated (100mg/kg b.w. i.p.) rats at 06:00, 12:00, 18:00 and 00:00h. Amelioration of pathophysiological conditions by fisetin at different time points was measured by analysing the levels of expression of liver urea cycle enzymes (carbamoyl phosphate synthetase-I (CPS-I), ornithine transcarbamoylase (OTC) and argininosuccinate synthetase (ASS)), nuclear transcription factor kappaB (NF-κB p65), brain glutamine synthetase (GS) and inducible nitric oxide synthase (iNOS) by Western blot analysis. Fisetin increased the expression of CPS-I, OTC, ASS and GS and decreased iNOS and NF-κB p65 in hyperammonaemic rats. Fisetin administration at 00:00h showed more significant effects on the expression of liver and brain markers, compared with other time points. Fisetin could exhibit anti-hyperammonaemic effect owing to its anti-oxidant and cytoprotective influences. The temporal variation in the effect of fisetin could be due to the (i) chronopharmacological, chronopharmacokinetic properties of fisetin and (ii) modulations in the endogenous circadian rhythms of urea cycle enzymes, brain markers, redox enzymes and renal clearance during hyperammonaemia by fisetin. However, future studies in these lines are necessitated. Copyright © 2014 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H.; Pedersen, Peter L.; Goffeau, Andre; Ułaszewski, Stanisław
2016-01-01
In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP. PMID:26862728
Walsh, Patrick J; Kajimura, Makiko; Mommsen, Thomas P; Wood, Chris M
2006-08-01
In order to investigate the metabolic poise of the elasmobranch rectal gland, we conducted two lines of experimentation. First, we examined the effects of feeding on plasma metabolites and enzyme activities from several metabolic pathways in several tissues of the dogfish shark, Squalus acanthias, after starvation and at 6, 20, 30 and 48 h post-feeding. We found a rapid and sustained ten-fold decrease in plasma beta-hydroxybutyrate at 6 h and beyond compared with starved dogfish, suggesting an upregulation in the use of this substrate, a decrease in production, or both. Plasma acetoacetate levels remain unchanged, whereas there was a slight and transient decrease in plasma glucose levels at 6 h. Several enzymes showed a large increase in activity post-feeding, including beta-hydroxybutyrate dehydrogenase in rectal gland and liver, and in rectal gland, isocitrate dehydrogenase, citrate synthase, lactate dehydrogenase, aspartate amino transferase, alanine amino transferase, glutamine synthetase and Na(+)/K(+) ATPase. Also notable in these enzyme measurements was the overall high level of activity in the rectal gland in general. For example, activity of the Krebs' TCA cycle enzyme citrate synthase (over 30 U g(-1)) was similar to activities in muscle from other species of highly active fish. Surprisingly, lactate dehydrogenase activity in the gland was also high (over 150 U g(-1)), suggesting either an ability to produce lactate anaerobically or use lactate as an aerobic fuel. Given these interesting observations, in the second aspect of the study we examined the ability of several metabolic substrates (alone and in combination) to support chloride secretion by the rectal gland. Among the substrates tested at physiological concentrations (glucose, beta-hydroxybutyrate, lactate, alanine, acetoacetate, and glutamate), only glucose could consistently maintain a viable preparation. Whereas beta-hydroxybutyrate could enhance gland activity when presented in combination
Stepanova, Anna; Shurubor, Yevgeniya; Valsecchi, Federica; Manfredi, Giovanni; Galkin, Alexander
2016-09-01
Mitochondrial Complex II is a key mitochondrial enzyme connecting the tricarboxylic acid (TCA) cycle and the electron transport chain. Studies of complex II are clinically important since new roles for this enzyme have recently emerged in cell signalling, cancer biology, immune response and neurodegeneration. Oxaloacetate (OAA) is an intermediate of the TCA cycle and at the same time is an inhibitor of complex II with high affinity (Kd~10(-8)M). Whether or not OAA inhibition of complex II is a physiologically relevant process is a significant, but still controversial topic. We found that complex II from mouse heart and brain tissue has similar affinity to OAA and that only a fraction of the enzyme in isolated mitochondrial membranes (30.2±6.0% and 56.4±5.6% in the heart and brain, respectively) is in the free, active form. Since OAA could bind to complex II during isolation, we established a novel approach to deplete OAA in the homogenates at the early stages of isolation. In heart, this treatment significantly increased the fraction of free enzyme, indicating that OAA binds to complex II during isolation. In brain the OAA-depleting system did not significantly change the amount of free enzyme, indicating that a large fraction of complex II is already in the OAA-bound inactive form. Furthermore, short-term ischemia resulted in a dramatic decline of OAA in tissues, but it did not change the amount of free complex II. Our data show that in brain OAA is an endogenous effector of complex II, potentially capable of modulating the activity of the enzyme. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Thomas, Dennis G; Jaramillo-Riveri, Sebastian; Baxter, Douglas J; Cannon, William R
2014-12-26
We have applied a new stochastic simulation approach to predict the metabolite levels, material flux, and thermodynamic profiles of the oxidative TCA cycles found in E. coli and Synechococcus sp. PCC 7002, and in the reductive TCA cycle typical of chemolithoautotrophs and phototrophic green sulfur bacteria such as Chlorobaculum tepidum. The simulation approach is based on modeling states using statistical thermodynamics and employs an assumption similar to that used in transition state theory. The ability to evaluate the thermodynamics of metabolic pathways allows one to understand the relationship between coupling of energy and material gradients in the environment and the self-organization of stable biological systems, and it is shown that each cycle operates in the direction expected due to its environmental niche. The simulations predict changes in metabolite levels and flux in response to changes in cofactor concentrations that would be hard to predict without an elaborate model based on the law of mass action. In fact, we show that a thermodynamically unfavorable reaction can still have flux in the forward direction when it is part of a reaction network. The ability to predict metabolite levels, energy flow, and material flux should be significant for understanding the dynamics of natural systems and for understanding principles for engineering organisms for production of specialty chemicals.
Lamp, Jessica; Keyser, Britta; Koeller, David M; Ullrich, Kurt; Braulke, Thomas; Mühlhausen, Chris
2011-05-20
The inherited neurodegenerative disorder glutaric aciduria type 1 (GA1) results from mutations in the gene for the mitochondrial matrix enzyme glutaryl-CoA dehydrogenase (GCDH), which leads to elevations of the dicarboxylates glutaric acid (GA) and 3-hydroxyglutaric acid (3OHGA) in brain and blood. The characteristic clinical presentation of GA1 is a sudden onset of dystonia during catabolic situations, resulting from acute striatal injury. The underlying mechanisms are poorly understood, but the high levels of GA and 3OHGA that accumulate during catabolic illnesses are believed to play a primary role. Both GA and 3OHGA are known to be substrates for Na(+)-coupled dicarboxylate transporters, which are required for the anaplerotic transfer of the tricarboxylic acid cycle (TCA) intermediate succinate between astrocytes and neurons. We hypothesized that GA and 3OHGA inhibit the transfer of succinate from astrocytes to neurons, leading to reduced TCA cycle activity and cellular injury. Here, we show that both GA and 3OHGA inhibit the uptake of [(14)C]succinate by Na(+)-coupled dicarboxylate transporters in cultured astrocytic and neuronal cells of wild-type and Gcdh(-/-) mice. In addition, we demonstrate that the efflux of [(14)C]succinate from Gcdh(-/-) astrocytic cells mediated by a not yet identified transporter is strongly reduced. This is the first experimental evidence that GA and 3OHGA interfere with two essential anaplerotic transport processes: astrocytic efflux and neuronal uptake of TCA cycle intermediates, which occur between neurons and astrocytes. These results suggest that elevated levels of GA and 3OHGA may lead to neuronal injury and cell death via disruption of TCA cycle activity. © 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.
Azad, Kimi; Banerjee, Manidipa; Johnson, John E
2017-09-29
Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.
Ragsdale, Stephen W.
2009-01-01
Of the eight known nickel enzymes, all but glyoxylase I catalyze the use and/or production of gases central to the global carbon, nitrogen, and oxygen cycles. Nickel appears to have been selected for its plasticity in coordination and redox chemistry and is able to cycle through three redox states (1+, 2+, 3+) and to catalyze reactions spanning ∼1.5 V. This minireview focuses on the catalytic mechanisms of nickel enzymes, with an emphasis on the role(s) of the metal center. The metal centers vary from mononuclear to complex metal clusters and catalyze simple hydrolytic to multistep redox reactions. PMID:19363030
Integrated, Step-Wise, Mass-Isotopomeric Flux Analysis of the TCA Cycle.
Alves, Tiago C; Pongratz, Rebecca L; Zhao, Xiaojian; Yarborough, Orlando; Sereda, Sam; Shirihai, Orian; Cline, Gary W; Mason, Graeme; Kibbey, Richard G
2015-11-03
Mass isotopomer multi-ordinate spectral analysis (MIMOSA) is a step-wise flux analysis platform to measure discrete glycolytic and mitochondrial metabolic rates. Importantly, direct citrate synthesis rates were obtained by deconvolving the mass spectra generated from [U-(13)C6]-D-glucose labeling for position-specific enrichments of mitochondrial acetyl-CoA, oxaloacetate, and citrate. Comprehensive steady-state and dynamic analyses of key metabolic rates (pyruvate dehydrogenase, β-oxidation, pyruvate carboxylase, isocitrate dehydrogenase, and PEP/pyruvate cycling) were calculated from the position-specific transfer of (13)C from sequential precursors to their products. Important limitations of previous techniques were identified. In INS-1 cells, citrate synthase rates correlated with both insulin secretion and oxygen consumption. Pyruvate carboxylase rates were substantially lower than previously reported but showed the highest fold change in response to glucose stimulation. In conclusion, MIMOSA measures key metabolic rates from the precursor/product position-specific transfer of (13)C-label between metabolites and has broad applicability to any glucose-oxidizing cell. Copyright © 2015 Elsevier Inc. All rights reserved.
Davuluri, Gangarao; Allawy, Allawy; Thapaliya, Samjhana; Rennison, Julie H.; Singh, Dharmvir; Kumar, Avinash; Sandlers, Yana; Van Wagoner, David R.; Flask, Chris A.; Hoppel, Charles; Kasumov, Takhar
2016-01-01
Key points Hyperammonaemia occurs in hepatic, cardiac and pulmonary diseases with increased muscle concentration of ammonia.We found that ammonia results in reduced skeletal muscle mitochondrial respiration, electron transport chain complex I dysfunction, as well as lower NAD+/NADH ratio and ATP content.During hyperammonaemia, leak of electrons from complex III results in oxidative modification of proteins and lipids.Tricarboxylic acid cycle intermediates are decreased during hyperammonaemia, and providing a cell‐permeable ester of αKG reversed the lower TCA cycle intermediate concentrations and increased ATP content.Our observations have high clinical relevance given the potential for novel approaches to reverse skeletal muscle ammonia toxicity by targeting the TCA cycle intermediates and mitochondrial ROS. Abstract Ammonia is a cytotoxic metabolite that is removed primarily by hepatic ureagenesis in humans. Hyperammonaemia occurs in advanced hepatic, cardiac and pulmonary disease, and in urea cycle enzyme deficiencies. Increased skeletal muscle ammonia uptake and metabolism are the major mechanism of non‐hepatic ammonia disposal. Non‐hepatic ammonia disposal occurs in the mitochondria via glutamate synthesis from α‐ketoglutarate resulting in cataplerosis. We show skeletal muscle mitochondrial dysfunction during hyperammonaemia in a comprehensive array of human, rodent and cellular models. ATP synthesis, oxygen consumption, generation of reactive oxygen species with oxidative stress, and tricarboxylic acid (TCA) cycle intermediates were quantified. ATP content was lower in the skeletal muscle from cirrhotic patients, hyperammonaemic portacaval anastomosis rat, and C2C12 myotubes compared to appropriate controls. Hyperammonaemia in C2C12 myotubes resulted in impaired intact cell respiration, reduced complex I/NADH oxidase activity and electron leak occurring at complex III of the electron transport chain. Consistently, lower NAD+/NADH ratio was observed
Sulfur isotopic constraints from a single enzyme on the cellular to global sulfur cycles
NASA Astrophysics Data System (ADS)
Sim, M. S.; Adkins, J. F.; Sessions, A. L.; Orphan, V. J.; McGlynn, S.
2017-12-01
Since first reported more than a half century ago, sulfur isotope fractionation between sulfate and sulfide has been used as a diagnostic indicator of microbial sulfate reduction, giving added dimensions to the microbial ecological and geochemical studies of the sulfur cycle. A wide range of fractionation has attracted particular attention because it may serve as a potential indicator of environmental or physiological variables such as substrate concentrations or specific respiration rates. In theory, the magnitude of isotope fractionation depends upon the sulfur isotope effect imparted by the involved enzymes and the relative rate of each enzymatic reaction. The former defines the possible range of fractionation quantitatively, while the latter responds to environmental stimuli, providing an underlying rationale for the varying fractionations. The experimental efforts so far have concentrated largely on the latter, the factors affecting the size of fractionation. Recently, however, the direct assessment of intracellular processes emerges as a promising means for the quantitative analysis of microbial sulfur isotope fractionation as a function of environmental or physiological variables. Here, we experimentally determined for the first time the sulfur isotope fractionation during APS reduction, the first reductive step in the dissimilatory sulfate reduction pathway, using the enzyme purified from Desulfovibrio vulgaris Miyazaki. APS reductase carried out the one-step, two-electron reduction of APS to sulfite, without the production of other metabolic intermediates. Nearly identical isotope effects were obtained at two different temperatures, while the rate of APS reduction more than quadrupled with a temperature increase from 20 to 32°C. When placed in context of the linear network model for microbial sulfur isotope fractionation, our finding could provide a new, semi-quantitative constraint on the sulfur cycle at levels from cellular to global.
Ji, Xiaotong; Ku, Tingting; Zhu, Na; Ning, Xia; Wei, Wei; Li, Guangke; Sang, Nan
2016-12-15
Buprofezin is known for its broad-spectrum action and environmental safety. The popularity of buprofezin has raised concerns about its potentially adverse effects on human health and risk to the environment. In this study, we first identified the liver as one of the major organs in which buprofezin accumulated, and we detected a severe oxidative stress response. Next, we demonstrated that sublethal concentrations of buprofezin promoted the conversion of energy metabolism from the aerobic tricarboxylic acid (TCA) cycle and oxidative phosphorylation to anaerobic glycolysis. Importantly, reactive oxygen species (ROS) generation partially accounted for the shunting of the energy metabolism through the buprofezin-mediated inhibition of cytochrome c oxidase activity. ROS directly perturbed the activities of several key TCA cycle enzymes, stimulated glycolysis, and indirectly disturbed the activity of the respiratory chain complex by altering mitochondrial DNA (mtDNA). These findings clarify the potential mechanisms of buprofezin toxicity and provide biomarkers for buprofezin-mediated hepatotoxicity at sublethal concentrations. Copyright © 2016 Elsevier B.V. All rights reserved.
TLNS3D/CDISC Multipoint Design of the TCA Concept
NASA Technical Reports Server (NTRS)
Campbell, Richard L.; Mann, Michael J.
1999-01-01
This paper presents the work done to date by the authors on developing an efficient approach to multipoint design and applying it to the design of the HSR TCA (High Speed Research Technology Concept Aircraft) configuration. While the title indicates that this exploratory study has been performed using the TLNS3DMB flow solver and the CDISC (Constrained Direct Iterative Surface Curvature) design method, the CDISC method could have been used with any flow solver, and the multipoint design approach does not require the use of CDISC. The goal of the study was to develop a multipoint design method that could achieve a design in about the same time as 10 analysis runs.
Bakthavatchalam, Yamuna Devi; Sudarsanam, Thambu David; Babu, Priyanka; Munuswamy, Elakkiya; Muthuirulandi Sethuvel, Dhiviya Prabaa; Devanga Ragupathi, Naveen Kumar; Veeraraghavan, Balaji
2017-07-24
Staphylococcus haemolyticus is a coagulase-negative staphylococcus that is frequently isolated from blood cultures. Here, we report a case of methicillin-susceptible S. haemolyticus that is resistant to teicoplanin (TEC) and heteroresistant to vancomycin (VAN). The isolate was susceptible to cefoxitin and resistant to TEC by Etest. Population analysis profile-area under the curve analysis confirmed the presence of a VAN heteroresistant subpopulation. Next-generation sequencing analysis of the genome revealed the presence of blaZ and msr(A), which encode cross-resistance to macrolide, lincosamide, and streptogramin B, and the quinolone resistance-conferring gene norA. In addition, several amino acid substitutions were observed in the TEC resistance operon tcaRAB, including I3N, I390N, and L450I in tcaA and L44V, G52V, and S87P in tcaR, as well as in the transpeptidase encoding gene walK (D336Y, R375L, and V404A) and L315 and P316 in graS. We hypothesized that this combination of mutations could confer TEC resistance and reduced VAN susceptibility.
Transcriptional response to petiole heat girdling in cassava.
Zhang, Yang; Ding, Zehong; Ma, Fangfang; Chauhan, Raj Deepika; Allen, Doug K; Brutnell, Thomas P; Wang, Wenquan; Peng, Ming; Li, Pinghua
2015-02-12
To examine the interactions of starch and sugar metabolism on photosynthesis in cassava, a heat-girdling treatment was applied to petioles of cassava leaves at the end of the light cycle to inhibit starch remobilization during the night. The inhibition of starch remobilization caused significant starch accumulation at the beginning of the light cycle, inhibited photosynthesis, and affected intracellular sugar levels. RNA-seq analysis of heat-treated and control plants revealed significantly decreased expression of genes related to photosynthesis, as well as N-metabolism and chlorophyll biosynthesis. However, expression of genes encoding TCA cycle enzymes and mitochondria electron transport components, and flavonoid biosynthetic pathway enzymes were induced. These studies reveal a dynamic transcriptional response to perturbation of sink demand in a single leaf, and provide useful information for understanding the regulations of cassava under sink or source limitation.
Transcriptional response to petiole heat girdling in cassava
Zhang, Yang; Ding, Zehong; Ma, Fangfang; Chauhan, Raj Deepika; Allen, Doug K.; Brutnell, Thomas P.; Wang, Wenquan; Peng, Ming; Li, Pinghua
2015-01-01
To examine the interactions of starch and sugar metabolism on photosynthesis in cassava, a heat-girdling treatment was applied to petioles of cassava leaves at the end of the light cycle to inhibit starch remobilization during the night. The inhibition of starch remobilization caused significant starch accumulation at the beginning of the light cycle, inhibited photosynthesis, and affected intracellular sugar levels. RNA-seq analysis of heat-treated and control plants revealed significantly decreased expression of genes related to photosynthesis, as well as N-metabolism and chlorophyll biosynthesis. However, expression of genes encoding TCA cycle enzymes and mitochondria electron transport components, and flavonoid biosynthetic pathway enzymes were induced. These studies reveal a dynamic transcriptional response to perturbation of sink demand in a single leaf, and provide useful information for understanding the regulations of cassava under sink or source limitation. PMID:25672661
Physiological and Proteomic Analysis of Escherichia coli Iron-Limited Chemostat Growth
Folsom, James Patrick; Parker, Albert E.
2014-01-01
Iron bioavailability is a major limiter of bacterial growth in mammalian host tissue and thus represents an important area of study. Escherichia coli K-12 metabolism was studied at four levels of iron limitation in chemostats using physiological and proteomic analyses. The data documented an E. coli acclimation gradient where progressively more severe iron scarcity resulted in a larger percentage of substrate carbon being directed into an overflow metabolism accompanied by a decrease in biomass yield on glucose. Acetate was the primary secreted organic by-product for moderate levels of iron limitation, but as stress increased, the metabolism shifted to secrete primarily lactate (∼70% of catabolized glucose carbon). Proteomic analysis reinforced the physiological data and quantified relative increases in glycolysis enzyme abundance and decreases in tricarboxylic acid (TCA) cycle enzyme abundance with increasing iron limitation stress. The combined data indicated that E. coli responds to limiting iron by investing the scarce resource in essential enzymes, at the cost of catabolic efficiency (i.e., downregulating high-ATP-yielding pathways containing enzymes with large iron requirements, like the TCA cycle). Acclimation to iron-limited growth was contrasted experimentally with acclimation to glucose-limited growth to identify both general and nutrient-specific acclimation strategies. While the iron-limited cultures maximized biomass yields on iron and increased expression of iron acquisition strategies, the glucose-limited cultures maximized biomass yields on glucose and increased expression of carbon acquisition strategies. This study quantified ecologically competitive acclimations to nutrient limitations, yielding knowledge essential for understanding medically relevant bacterial responses to host and to developing intervention strategies. PMID:24837288
Structural aspects of denitrifying enzymes.
Moura, I; Moura, J J
2001-04-01
The reduction of nitrate to nitrogen gas via nitrite, nitric oxide and nitrous oxide is the metabolic pathway usually known as denitrification, a key step in the nitrogen cycle. As observed for other elemental cycles, a battery of enzymes are utilized, namely the reductases for nitrate, nitrite, nitric oxide and nitrous oxide, as well as multiple electron donors that interact with these enzymes, in order to carry out the stepwise reactions that involve key intermediates. Because of the importance of this pathway (of parallel importance to the nitrogen-fixation pathway), efforts are underway to understand the structures of the participating enzymes and to uncover mechanistic aspects. Three-dimensional structures have been solved for the majority of these enzymes in the past few years, revealing the architecture of the active metal sites as well as global structural aspects, and possible mechanistic aspects. In addition, the recognition of specific electron-transfer partners raises important questions regarding specific electron-transfer pathways, partner recognition and control of metabolism.
USDA-ARS?s Scientific Manuscript database
This study aimed to determine the contribution of substrates to tricarboxylic acid (TCA) cycle fluxes in rumen epithelial (REC) and duodenal mucosal (DMC) cells isolated from bulls (n = 6) fed either a 75% forage (HF) or 75% concentrate (HC) diet. In separate incubations, [13C6]glucose, [13C5]glutam...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sadler, Natalie C.; Angel, Thomas E.; Lewis, Michael P.
High-fat diet (HFD) induced obesity and concomitant development of insulin resistance (IR) and type 2 diabetes mellitus have been linked to mitochondrial dysfunction. However, it is not clear whether mitochondrial dysfunction is a direct effect of a HFD or if the mitochondrial function is reduced with increased HFD duration. We hypothesized that the function of mitochondrial oxidative and lipid metabolism functions in skeletal muscle mitochondria for HFD mice are similar or elevated relative to standard diet (SD) mice, thereby IR is neither cause nor consequence of mitochondrial dysfunction. We applied a chemical probe approach to identify functionally reactive ATPases andmore » nucleotide-binding proteins in mitochondria isolated from skeletal muscle of C57Bl/6J mice fed HFD or SD chow for 2-, 8-, or 16-weeks; feeding time points known to induce IR. A total of 293 probe-labeled proteins were identified by mass spectrometry-based proteomics, of which 54 differed in abundance between HFD and SD mice. We found proteins associated with the TCA cycle, oxidative phosphorylation (OXPHOS), and lipid metabolism were altered in function when comparing SD to HFD fed mice at 2-weeks, however by 16-weeks HFD mice had TCA cycle, β-oxidation, and respiratory chain function at levels similar to or higher than SD mice.« less
Zhou, Jin; Zhu, Xiao-shan; Cai, Zhong-hua
2010-11-15
A toxicity test was performed to investigate the possible harmful effects of tributyltin (TBT) on abalone (Haliotis diversicolor supertexta). Animals were exposed to TBT in a range of environmentally relevant concentrations (2, 10 and 50 ng/L) for 30 days under laboratory conditions. TBT-free conditions were used as control treatments. The activity of antioxidant enzymes superoxide dismutase (SOD) and peroxidase (POD), and malondialdehyde (MDA), along with levels of haemolymph metabolites, and hepatopancreas histopathology were analyzed. The results showed that TBT decreased SOD activity, and increased POD level and MDA production in a dose-dependent way, indicating that oxidative injury was induced by TBT. Haemolymph metabolite measurements showed that TBT increased alanine and glutamate levels, and decreased glucose content, which suggested perturbation of energy metabolism. Elevated levels of acetate and pyruvate in the haemolymph indicated partial alteration of lipid metabolism. A decrease in lactate and an increase in succinate, an intermediate of the tricarboxylic acid (TCA) cycle, indicated disturbance of amino acid metabolism. Hepatopancreas tissues also exhibited inflammatory responses characterized by histopathological changes such as cell swelling, granular degeneration, and inflammation. Taken together, these results demonstrated that TBT was a potential toxin with a variety of deleterious effects on abalone. Copyright © 2010 Elsevier B.V. All rights reserved.
Ouyang, Qing; Nakayama, Tojo; Baytas, Ozan; Davidson, Shawn M.; Yang, Chendong; Schmidt, Michael; Lizarraga, Sofia B.; Mishra, Sasmita; EI-Quessny, Malak; Niaz, Saima; Gul Butt, Mirrat; Imran Murtaza, Syed; Javed, Afzal; Chaudhry, Haroon Rashid; Vaughan, Dylan J.; Hill, R. Sean; Partlow, Jennifer N.; Yoo, Seung-Yun; Lam, Anh-Thu N.; Nasir, Ramzi; Al-Saffar, Muna; Barkovich, A. James; Schwede, Matthew; Nagpal, Shailender; Rajab, Anna; DeBerardinis, Ralph J.; Housman, David E.; Mochida, Ganeshwaran H.; Morrow, Eric M.
2016-01-01
Mutations that cause neurological phenotypes are highly informative with regard to mechanisms governing human brain function and disease. We report autosomal recessive mutations in the enzyme glutamate pyruvate transaminase 2 (GPT2) in large kindreds initially ascertained for intellectual and developmental disability (IDD). GPT2 [also known as alanine transaminase 2 (ALT2)] is one of two related transaminases that catalyze the reversible addition of an amino group from glutamate to pyruvate, yielding alanine and α-ketoglutarate. In addition to IDD, all affected individuals show postnatal microcephaly and ∼80% of those followed over time show progressive motor symptoms, a spastic paraplegia. Homozygous nonsense p.Arg404* and missense p.Pro272Leu mutations are shown biochemically to be loss of function. The GPT2 gene demonstrates increasing expression in brain in the early postnatal period, and GPT2 protein localizes to mitochondria. Akin to the human phenotype, Gpt2-null mice exhibit reduced brain growth. Through metabolomics and direct isotope tracing experiments, we find a number of metabolic abnormalities associated with loss of Gpt2. These include defects in amino acid metabolism such as low alanine levels and elevated essential amino acids. Also, we find defects in anaplerosis, the metabolic process involved in replenishing TCA cycle intermediates. Finally, mutant brains demonstrate misregulated metabolites in pathways implicated in neuroprotective mechanisms previously associated with neurodegenerative disorders. Overall, our data reveal an important role for the GPT2 enzyme in mitochondrial metabolism with relevance to developmental as well as potentially to neurodegenerative mechanisms. PMID:27601654
Cheah, Hong-Leong; Lim, Vuanghao; Sandai, Doblin
2014-01-01
Candida albicans is an opportunistic pathogen that causes candidiasis in humans. In recent years, metabolic pathways in C. albicans have been explored as potential antifungal targets to treat candidiasis. The glyoxylate cycle, which enables C. albicans to survive in nutrient-limited host niches and its. Key enzymes (e.g., isocitrate lyase (ICL1), are particularly attractive antifungal targets for C. albicans. In this study, we used a new screening approach that better reflects the physiological environment that C. albicans cells experience during infection to identify potential inhibitors of ICL. Three compounds (caffeic acid (CAFF), rosmarinic acid (ROS), and apigenin (API)) were found to have antifungal activity against C. albicans when tested under glucose-depleted conditions. We further confirmed the inhibitory potential of these compounds against ICL using the ICL enzyme assay. Lastly, we assessed the bioavailability and toxicity of these compounds using Lipinski's rule-of-five and ADMET analysis. PMID:24781056
The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows
White, Heather M.
2015-01-01
The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows. PMID:26479386
The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows.
White, Heather M
2015-08-18
The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows.
Song, Dali; Xi, Xiangyin; Huang, Shaomin; Liang, Guoqing; Sun, Jingwen; Zhou, Wei; Wang, Xiubin
2016-01-01
Biochar (BC) addition to soil is a proposed strategy to enhance soil fertility and crop productivity. However, there is limited knowledge regarding responses of soil respiration and C-cycle enzyme activities to BC and nitrogen (N) additions in a calcareous soil. A 56-day incubation experiment was conducted to investigate the combined effects of BC addition rates (0, 0.5, 1.0, 2.5 and 5.0% by mass) and urea (U) application on soil nutrients, soil respiration and C-cycle enzyme activities in a calcareous soil in the North China Plain. Our results showed soil pH values in both U-only and U plus BC treatments significantly decreased within the first 14 days and then stabilized, and CO2emission rate in all U plus BC soils decreased exponentially, while there was no significant difference in the contents of soil total organic carbon (TOC), dissolved organic carbon (DOC), total nitrogen (TN), and C/N ratio in each treatment over time. At each incubation time, soil pH, electrical conductivity (EC), TOC, TN, C/N ratio, DOC and cumulative CO2 emission significantly increased with increasing BC addition rate, while soil potential activities of the four hydrolytic enzymes increased first and then decreased with increasing BC addition rate, with the largest values in the U + 1.0%BC treatment. However, phenol oxidase activity in all U plus BC soils showed a decreasing trend with the increase of BC addition rate. Our results suggest that U plus BC application at a rate of 1% promotes increases in hydrolytic enzymes, does not highly increase C/N and C mineralization, and can improve in soil fertility. PMID:27589265
Magnetically responsive enzyme powders
NASA Astrophysics Data System (ADS)
Pospiskova, Kristyna; Safarik, Ivo
2015-04-01
Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (-20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties.
Champagne, Cory D; Houser, Dorian S; Fowler, Melinda A; Costa, Daniel P; Crocker, Daniel E
2012-08-01
Animals that endure prolonged periods of food deprivation preserve vital organ function by sparing protein from catabolism. Much of this protein sparing is achieved by reducing metabolic rate and suppressing gluconeogenesis while fasting. Northern elephant seals (Mirounga angustirostris) endure prolonged fasts of up to 3 mo at multiple life stages. During these fasts, elephant seals maintain high levels of activity and energy expenditure associated with breeding, reproduction, lactation, and development while maintaining rates of glucose production typical of a postabsorptive mammal. Therefore, we investigated how fasting elephant seals meet the requirements of glucose-dependent tissues while suppressing protein catabolism by measuring the contribution of glycogenolysis, glycerol, and phosphoenolpyruvate (PEP) to endogenous glucose production (EGP) during their natural 2-mo postweaning fast. Additionally, pathway flux rates associated with the tricarboxylic acid (TCA) cycle were measured specifically, flux through phosphoenolpyruvate carboxykinase (PEPCK) and pyruvate cycling. The rate of glucose production decreased during the fast (F(1,13) = 5.7, P = 0.04) but remained similar to that of postabsorptive mammals. The fractional contributions of glycogen, glycerol, and PEP did not change with fasting; PEP was the primary gluconeogenic precursor and accounted for ∼95% of EGP. This large contribution of PEP to glucose production occurred without substantial protein loss. Fluxes through the TCA cycle, PEPCK, and pyruvate cycling were higher than reported in other species and were the most energetically costly component of hepatic carbohydrate metabolism. The active pyruvate recycling fluxes detected in elephant seals may serve to rectify gluconeogeneic PEP production during restricted anaplerotic inflow in these fasting-adapted animals.
Sykes, Steven; Szempruch, Anthony; Hajduk, Stephen
2015-03-01
α-Ketoglutarate decarboxylase (α-KDE1) is a Krebs cycle enzyme found in the mitochondrion of the procyclic form (PF) of Trypanosoma brucei. The bloodstream form (BF) of T. brucei lacks a functional Krebs cycle and relies exclusively on glycolysis for ATP production. Despite the lack of a functional Krebs cycle, α-KDE1 was expressed in BF T. brucei and RNA interference knockdown of α-KDE1 mRNA resulted in rapid growth arrest and killing. Cell death was preceded by progressive swelling of the flagellar pocket as a consequence of recruitment of both flagellar and plasma membranes into the pocket. BF T. brucei expressing an epitope-tagged copy of α-KDE1 showed localization to glycosomes and not the mitochondrion. We used a cell line transfected with a reporter construct containing the N-terminal sequence of α-KDE1 fused to green fluorescent protein to examine the requirements for glycosome targeting. We found that the N-terminal 18 amino acids of α-KDE1 contain overlapping mitochondrion- and peroxisome-targeting sequences and are sufficient to direct localization to the glycosome in BF T. brucei. These results suggest that α-KDE1 has a novel moonlighting function outside the mitochondrion in BF T. brucei. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Identification of PSD-95 Depalmitoylating Enzymes.
Yokoi, Norihiko; Fukata, Yuko; Sekiya, Atsushi; Murakami, Tatsuro; Kobayashi, Kenta; Fukata, Masaki
2016-06-15
Postsynaptic density (PSD)-95, the most abundant postsynaptic scaffolding protein, plays a pivotal role in synapse development and function. Continuous palmitoylation cycles on PSD-95 are essential for its synaptic clustering and regulation of AMPA receptor function. However, molecular mechanisms for palmitate cycling on PSD-95 remain incompletely understood, as PSD-95 depalmitoylating enzymes remain unknown. Here, we isolated 38 mouse or rat serine hydrolases and found that a subset specifically depalmitoylated PSD-95 in heterologous cells. These enzymes showed distinct substrate specificity. α/β-Hydrolase domain-containing protein 17 members (ABHD17A, 17B, and 17C), showing the strongest depalmitoylating activity to PSD-95, showed different localization from other candidates in rat hippocampal neurons, and were distributed to recycling endosomes, the dendritic plasma membrane, and the synaptic fraction. Expression of ABHD17 in neurons selectively reduced PSD-95 palmitoylation and synaptic clustering of PSD-95 and AMPA receptors. Furthermore, taking advantage of the acyl-PEGyl exchange gel shift (APEGS) method, we quantitatively monitored the palmitoylation stoichiometry and the depalmitoylation kinetics of representative synaptic proteins, PSD-95, GluA1, GluN2A, mGluR5, Gαq, and HRas. Unexpectedly, palmitate on all of them did not turn over in neurons. Uniquely, most of the PSD-95 population underwent rapid palmitoylation cycles, and palmitate cycling on PSD-95 decelerated accompanied by its increased stoichiometry as synapses developed, probably contributing to postsynaptic receptor consolidation. Finally, inhibition of ABHD17 expression dramatically delayed the kinetics of PSD-95 depalmitoylation. This study suggests that local palmitoylation machinery composed of synaptic DHHC palmitoylating enzymes and ABHD17 finely controls the amount of synaptic PSD-95 and synaptic function. Protein palmitoylation, the most common lipid modification, dynamically
Identification of PSD-95 Depalmitoylating Enzymes
Yokoi, Norihiko; Sekiya, Atsushi; Murakami, Tatsuro; Kobayashi, Kenta
2016-01-01
Postsynaptic density (PSD)-95, the most abundant postsynaptic scaffolding protein, plays a pivotal role in synapse development and function. Continuous palmitoylation cycles on PSD-95 are essential for its synaptic clustering and regulation of AMPA receptor function. However, molecular mechanisms for palmitate cycling on PSD-95 remain incompletely understood, as PSD-95 depalmitoylating enzymes remain unknown. Here, we isolated 38 mouse or rat serine hydrolases and found that a subset specifically depalmitoylated PSD-95 in heterologous cells. These enzymes showed distinct substrate specificity. α/β-Hydrolase domain-containing protein 17 members (ABHD17A, 17B, and 17C), showing the strongest depalmitoylating activity to PSD-95, showed different localization from other candidates in rat hippocampal neurons, and were distributed to recycling endosomes, the dendritic plasma membrane, and the synaptic fraction. Expression of ABHD17 in neurons selectively reduced PSD-95 palmitoylation and synaptic clustering of PSD-95 and AMPA receptors. Furthermore, taking advantage of the acyl-PEGyl exchange gel shift (APEGS) method, we quantitatively monitored the palmitoylation stoichiometry and the depalmitoylation kinetics of representative synaptic proteins, PSD-95, GluA1, GluN2A, mGluR5, Gαq, and HRas. Unexpectedly, palmitate on all of them did not turn over in neurons. Uniquely, most of the PSD-95 population underwent rapid palmitoylation cycles, and palmitate cycling on PSD-95 decelerated accompanied by its increased stoichiometry as synapses developed, probably contributing to postsynaptic receptor consolidation. Finally, inhibition of ABHD17 expression dramatically delayed the kinetics of PSD-95 depalmitoylation. This study suggests that local palmitoylation machinery composed of synaptic DHHC palmitoylating enzymes and ABHD17 finely controls the amount of synaptic PSD-95 and synaptic function. SIGNIFICANCE STATEMENT Protein palmitoylation, the most common lipid
Li, Haixing; Liang, Zhijun; Ding, Guangda; Shi, Lei; Xu, Fangsen; Cai, Hongmei
2016-01-01
Light and temperature are two particularly important environmental cues for plant survival. Carbon and nitrogen are two essential macronutrients required for plant growth and development, and cellular carbon and nitrogen metabolism must be tightly coordinated. In order to understand how the natural light/dark cycle regulates carbon and nitrogen metabolism in rice plants, we analyzed the photosynthesis, key carbon-nitrogen metabolites, and enzyme activities, and differentially expressed genes and miRNAs involved in the carbon and nitrogen metabolic pathway in rice shoots at the following times: 2:00, 6:00, 10:00, 14:00, 18:00, and 22:00. Our results indicated that more CO2 was fixed into carbohydrates by a high net photosynthetic rate, respiratory rate, and stomatal conductance in the daytime. Although high levels of the nitrate reductase activity, free ammonium and carbohydrates were exhibited in the daytime, the protein synthesis was not significantly facilitated by the light and temperature. In mRNA sequencing, the carbon and nitrogen metabolism-related differentially expressed genes were obtained, which could be divided into eight groups: photosynthesis, TCA cycle, sugar transport, sugar metabolism, nitrogen transport, nitrogen reduction, amino acid metabolism, and nitrogen regulation. Additionally, a total of 78,306 alternative splicing events have been identified, which primarily belong to alternative 5' donor sites, alternative 3' acceptor sites, intron retention, and exon skipping. In sRNA sequencing, four carbon and nitrogen metabolism-related miRNAs (osa-miR1440b, osa-miR2876-5p, osa-miR1877 and osa-miR5799) were determined to be regulated by natural light/dark cycle. The expression level analysis showed that the four carbon and nitrogen metabolism-related miRNAs negatively regulated their target genes. These results may provide a good strategy to study how natural light/dark cycle regulates carbon and nitrogen metabolism to ensure plant growth and
Andreozzi, Stefano; Chakrabarti, Anirikh; Soh, Keng Cher; Burgard, Anthony; Yang, Tae Hoon; Van Dien, Stephen; Miskovic, Ljubisa; Hatzimanikatis, Vassily
2016-05-01
Rational metabolic engineering methods are increasingly employed in designing the commercially viable processes for the production of chemicals relevant to pharmaceutical, biotechnology, and food and beverage industries. With the growing availability of omics data and of methodologies capable to integrate the available data into models, mathematical modeling and computational analysis are becoming important in designing recombinant cellular organisms and optimizing cell performance with respect to desired criteria. In this contribution, we used the computational framework ORACLE (Optimization and Risk Analysis of Complex Living Entities) to analyze the physiology of recombinant Escherichia coli producing 1,4-butanediol (BDO) and to identify potential strategies for improved production of BDO. The framework allowed us to integrate data across multiple levels and to construct a population of large-scale kinetic models despite the lack of available information about kinetic properties of every enzyme in the metabolic pathways. We analyzed these models and we found that the enzymes that primarily control the fluxes leading to BDO production are part of central glycolysis, the lower branch of tricarboxylic acid (TCA) cycle and the novel BDO production route. Interestingly, among the enzymes between the glucose uptake and the BDO pathway, the enzymes belonging to the lower branch of TCA cycle have been identified as the most important for improving BDO production and yield. We also quantified the effects of changes of the target enzymes on other intracellular states like energy charge, cofactor levels, redox state, cellular growth, and byproduct formation. Independent earlier experiments on this strain confirmed that the computationally obtained conclusions are consistent with the experimentally tested designs, and the findings of the present studies can provide guidance for future work on strain improvement. Overall, these studies demonstrate the potential and
[Phenotypic properties of Sulfobacillus thermotolerans: comparative aspects].
Tsaplina, I A; Krasil'nikova, E N; Zhuravleva, A E; Egorova, M A; Zakharchuk, L M; Suzina, N E; Duda, V I; Bogdanova, T I; Stadnichuk, I N; Kondrat'eva, T F
2008-01-01
The phenotypic characteristics of the species Sulfobacillus thermotolerans Kr1(T), as dependent on the cultivation conditions, are described in detail. High growth rates (0.22-0.30 h(-1)) and high oxidative activity were recorded under optimum mixotrophic conditions at 40 degrees C on medium with inorganic (Fe(II), S(0), or pyrite-arsenopyrite concentrate) and organic (glucose and/or yeast extract) substrates. In cells grown under optimum conditions on medium with iron, hemes a, b, and, most probably, c were present, indicating the presence of the corresponding cytochromes. Peculiar extended structures in the form of cylindrical cords, never observed previously, were revealed; a mucous matrix, likely of polysaccharide nature, occurred around the cells. In the cells of sulfobacilli grown litho-, organo-, and mixotrophically at 40 degrees C, the enzymes of the three main pathways of carbon utilization and some enzymes of the TCA cycle were revealed. The enzyme activity was maximum under mixotrophic growth conditions. The growth rate in the regions of limiting temperatures (55 degrees C and 12-14 degrees C) decreased two- and tenfold, respectively; no activity of 6-phosphogluconate dehydrogenase, one of the key enzymes of the oxidative pentose phosphate pathway, could be revealed; and a decrease in the activity of almost all enzymes of glucose metabolism and of the TCA cycle was observed. The rate of 14CO2 fixation by cells under auto-, mixo-, and heterotrophic conditions constituted 31.8, 23.3, and 10.3 nmol/(h mg protein), respectively. The activities of RuBP carboxylase (it peaked during lithotrophic growth) and of carboxylases of heterotrophic carbon dioxide fixation were recorded. The physiological and biochemical peculiarities of the thermotolerant sulfobacillus are compared versus moderately thermophilic sulfobacilli.
Pinto-Fernandez, Adan; Kessler, Benedikt M
2016-01-01
Controlling cell proliferation is one of the hallmarks of cancer. A number of critical checkpoints ascertain progression through the different stages of the cell cycle, which can be aborted when perturbed, for instance by errors in DNA replication and repair. These molecular checkpoints are regulated by a number of proteins that need to be present at the right time and quantity. The ubiquitin system has emerged as a central player controlling the fate and function of such molecules such as cyclins, oncogenes and components of the DNA repair machinery. In particular, proteases that cleave ubiquitin chains, referred to as deubiquitylating enzymes (DUBs), have attracted recent attention due to their accessibility to modulation by small molecules. In this review, we describe recent evidence of the critical role of DUBs in aspects of cell cycle checkpoint control, associated DNA repair mechanisms and regulation of transcription, representing pathways altered in cancer. Therefore, DUBs involved in these processes emerge as potentially critical targets for the treatment of not only hematological, but potentially also solid tumors.
Pinto-Fernandez, Adan; Kessler, Benedikt M.
2016-01-01
Controlling cell proliferation is one of the hallmarks of cancer. A number of critical checkpoints ascertain progression through the different stages of the cell cycle, which can be aborted when perturbed, for instance by errors in DNA replication and repair. These molecular checkpoints are regulated by a number of proteins that need to be present at the right time and quantity. The ubiquitin system has emerged as a central player controlling the fate and function of such molecules such as cyclins, oncogenes and components of the DNA repair machinery. In particular, proteases that cleave ubiquitin chains, referred to as deubiquitylating enzymes (DUBs), have attracted recent attention due to their accessibility to modulation by small molecules. In this review, we describe recent evidence of the critical role of DUBs in aspects of cell cycle checkpoint control, associated DNA repair mechanisms and regulation of transcription, representing pathways altered in cancer. Therefore, DUBs involved in these processes emerge as potentially critical targets for the treatment of not only hematological, but potentially also solid tumors. PMID:27516771
Bromke, Mariusz A.; Giavalisco, Patrick; Willmitzer, Lothar; Hesse, Holger
2013-01-01
This report describes the metabolic and lipidomic profiling of 97 low-molecular weight compounds from the primary metabolism and 124 lipid compounds of the diatom Thalassiosira pseudonana. The metabolic profiles were created for diatoms perturbed for 24 hours with four different treatments: (I) removal of nitrogen, (II) lower iron concentration, (III) addition of sea salt, (IV) addition of carbonate to their growth media. Our results show that as early as 24 hours after nitrogen depletion significant qualitative and quantitative change in lipid composition as well as in the primary metabolism of Thalassiosira pseudonana occurs. So we can observe the accumulation of several storage lipids, namely triacylglycerides, and TCA cycle intermediates, of which citric acid increases more than 10-fold. These changes are positively correlated with expression of TCA enzymes genes. Next to the TCA cycle intermediates and storage lipid changes, we have observed decrease in N-containing lipids and primary metabolites such as amino acids. As a measure of counteracting nitrogen starvation, we have observed elevated expression levels of nitrogen uptake and amino acid biosynthetic genes. This indicates that diatoms can fast and efficiently adapt to changing environment by altering the metabolic fluxes and metabolite abundances. Especially, the accumulation of proline and the decrease of dimethylsulfoniopropionate suggest that the proline is the main osmoprotectant for the diatom in nitrogen rich conditions. PMID:23799147
Cheeke, Tanya E; Phillips, Richard P; Brzostek, Edward R; Rosling, Anna; Bever, James D; Fransson, Petra
2017-04-01
While it is well established that plants associating with arbuscular mycorrhizal (AM) and ectomycorrhizal (ECM) fungi cycle carbon (C) and nutrients in distinct ways, we have a limited understanding of whether varying abundance of ECM and AM plants in a stand can provide integrative proxies for key biogeochemical processes. We explored linkages between the relative abundance of AM and ECM trees and microbial functioning in three hardwood forests in southern Indiana, USA. Across each site's 'mycorrhizal gradient', we measured fungal biomass, fungal : bacterial (F : B) ratios, extracellular enzyme activities, soil carbon : nitrogen ratio, and soil pH over a growing season. We show that the percentage of AM or ECM trees in a plot promotes microbial communities that both reflect and determine the C to nutrient balance in soil. Soils dominated by ECM trees had higher F : B ratios and more standing fungal biomass than AM stands. Enzyme stoichiometry in ECM soils shifted to higher investment in extracellular enzymes needed for nitrogen and phosphorus acquisition than in C-acquisition enzymes, relative to AM soils. Our results suggest that knowledge of mycorrhizal dominance at the stand or landscape scale may provide a unifying framework for linking plant and microbial community dynamics, and predicting their effects on ecological function. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Sadykov, Marat R; Ahn, Jong-Sam; Widhelm, Todd J; Eckrich, Valerie M; Endres, Jennifer L; Driks, Adam; Rutkowski, Gregory E; Wingerd, Kevin L; Bayles, Kenneth W
2017-06-01
Numerous bacteria accumulate poly(3-hydroxybutyrate) (PHB) as an intracellular reservoir of carbon and energy in response to imbalanced nutritional conditions. In Bacillus spp., where PHB biosynthesis precedes the formation of the dormant cell type called the spore (sporulation), the direct link between PHB accumulation and efficiency of sporulation was observed in multiple studies. Although the idea of PHB as an intracellular carbon and energy source fueling sporulation was proposed several decades ago, the mechanisms underlying PHB contribution to sporulation have not been defined. Here, we demonstrate that PHB deficiency impairs Bacillus anthracis sporulation through diminishing the energy status of the cells and by reducing carbon flux into the tricarboxylic acid (TCA) cycle and de novo lipid biosynthesis. Consequently, this metabolic imbalance decreased biosynthesis of the critical components required for spore integrity and resistance, such as dipicolinic acid (DPA) and the spore's inner membrane. Supplementation of the PHB deficient mutant with exogenous fatty acids overcame these sporulation defects, highlighting the importance of the TCA cycle and lipid biosynthesis during sporulation. Combined, the results of this work reveal the molecular mechanisms of PHB contribution to B. anthracis sporulation and provide valuable insight into the metabolic requirements for this developmental process in Bacillus species. © 2017 John Wiley & Sons Ltd.
Takagi, Wataru; Kajimura, Makiko; Bell, Justin D; Toop, Tes; Donald, John A; Hyodo, Susumu
2012-04-01
Cartilaginous fish comprise two subclasses, the Holocephali (chimaeras) and Elasmobranchii (sharks, skates and rays). Little is known about osmoregulatory mechanisms in holocephalan fishes except that they conduct urea-based osmoregulation, as in elasmobranchs. In the present study, we examined the ornithine urea cycle (OUC) enzymes that play a role in urea biosynthesis in the holocephalan elephant fish, Callorhinchus milii (cm). We obtained a single mRNA encoding carbamoyl phosphate synthetase III (cmCPSIII) and ornithine transcarbamylase (cmOTC), and two mRNAs encoding glutamine synthetases (cmGSs) and two arginases (cmARGs), respectively. The two cmGSs were structurally and functionally separated into two types: brain/liver/kidney-type cmGS1 and muscle-type cmGS2. Furthermore, two alternatively spliced transcripts with different sizes were found for cmgs1 gene. The longer transcript has a putative mitochondrial targeting signal (MTS) and was predominantly expressed in the liver and kidney. MTS was not found in the short form of cmGS1 and cmGS2. A high mRNA expression and enzyme activities were found in the liver and muscle. Furthermore, in various tissues examined, mRNA levels of all the enzymes except cmCPSIII were significantly increased after hatching. The data show that the liver is the important organ for urea biosynthesis in elephant fish, but, extrahepatic tissues such as the kidney and muscle may also contribute to the urea production. In addition to the role of the extrahepatic tissues and nitrogen metabolism, the molecular and functional characteristics of multiple isoforms of GSs and ARGs are discussed. Copyright © 2011 Elsevier Inc. All rights reserved.
Mycobacterium avium Genes Associated with the Ability To Form a Biofilm
Yamazaki, Yoshitaka; Danelishvili, Lia; Wu, Martin; MacNab, Molly; Bermudez, Luiz E.
2006-01-01
Mycobacterium avium is widely distributed in the environment, and it is chiefly found in water and soil. M. avium, as well as Mycobacterium smegmatis, has been recognized to produce a biofilm or biofilm-like structure. We screened an M. avium green fluorescent protein (GFP) promoter library in M. smegmatis for genes involved in biofilm formation on polyvinyl chloride (PVC) plates. Clones associated with increased GFP expression ≥2.0-fold over the baseline were sequenced. Seventeen genes, most encoding proteins of the tricarboxylic acid (TCA) cycle and GDP-mannose and fatty acid biosynthesis, were identified. Their regulation in M. avium was confirmed by examining the expression of a set of genes by real-time PCR after incubation on PVC plates. In addition, screening of 2,000 clones of a transposon mutant bank constructed using M. avium strain A5, a mycobacterial strain with the ability to produce large amounts of biofilm, revealed four mutants with an impaired ability to form biofilm. Genes interrupted by transposons were homologues of M. tuberculosis 6-oxodehydrogenase (sucA), enzymes of the TCA cycle, protein synthetase (pstB), enzymes of glycopeptidolipid (GPL) synthesis, and Rv1565c (a hypothetical membrane protein). In conclusion, it appears that GPL biosynthesis, including the GDP-mannose biosynthesis pathway, is the most important pathway involved in the production of M. avium biofilm. PMID:16391123
Alternative Fuels in Epilepsy and Amyotrophic Lateral Sclerosis.
Tefera, Tesfaye W; Tan, Kah Ni; McDonald, Tanya S; Borges, Karin
2017-06-01
This review summarises the recent findings on metabolic treatments for epilepsy and Amyotrophic Lateral Sclerosis (ALS) in honour of Professor Ursula Sonnewald. The metabolic impairments in rodent models of these disorders as well as affected patients are being discussed. In both epilepsy and ALS, there are defects in glucose uptake and reduced tricarboxylic acid (TCA) cycling, at least in part due to reduced amounts of C4 TCA cycle intermediates. In addition there are impairments in glycolysis in ALS. A reduction in glucose uptake can be addressed by providing the brain with alternative fuels, such as ketones or medium-chain triglycerides. As anaplerotic fuels, such as the triglyceride of heptanoate, triheptanoin, refill the TCA cycle C4/C5 intermediate pool that is deficient, they are ideal to boost TCA cycling and thus the oxidative metabolism of all fuels.
McDonald, Tanya S; Borges, Karin
2017-07-01
To determine changes in glucose metabolism and the enzymes involved in the hippocampus ictally and postictally in the acute mouse flurothyl seizure model. [U- 13 C]-Glucose was injected (i.p.) prior to, or following a 5 min flurothyl-induced seizure. Fifteen minutes later, mice were killed and the total metabolite levels and % 13 C enrichment were analyzed in the hippocampal formation using gas chromatography-mass spectrometry. Activities of key metabolic and antioxidant enzymes and the phosphorylation status of pyruvate dehydrogenase were measured, along with lipid peroxidation. During seizures, total lactate levels increased 1.7-fold; however, [M + 3] enrichment of both lactate and alanine were reduced by 30% and 43%, respectively, along with a 28% decrease in phosphofructokinase activity. Postictally the % 13 C enrichments of all measured tricarboxylic acid (TCA) cycle intermediates and the amino acids were reduced by 46-93%. At this time, pyruvate dehydrogenase (PDH) activity was 56% of that measured in controls, and there was a 1.9-fold increase in the phosphorylation of PDH at ser232. Phosphorylation of PDH is known to decrease its activity. Here, we show that the increase of lactate levels during flurothyl seizures is from a source other than [U- 13 C]-glucose, such as glycogen. Surprisingly, although we saw a reduction in phosphofructokinase activity during the seizure, metabolism of [U- 13 C]-glucose into the TCA cycle seemed unaffected. Similar to our recent findings in the chronic phase of the pilocarpine model, postictally the metabolism of glucose by glycolysis and the TCA cycle was impaired along with reduced PDH activity. Although this decrease in activity may be a protective mechanism to reduce oxidative stress, which is observed in the flurothyl model, ATP is critical to the recovery of ion and neurotransmitter balance and return to normal brain function. Thus we identified promising novel strategies to enhance energy metabolism and recovery from
YANG, CAILING; YAN, JIANGUO; YUAN, GUOYAN; ZHANG, YINGHUA; LU, DERONG; REN, MINGXIN; CUI, WEIGANG
2014-01-01
Icotinib is an epidermal growth factor receptor tyrosine kinase inhibitor, which has been revealed to inhibit proliferation in tumor cells. However, the effect of icotinib on cancer cell metastasis remains to be explained. This study examines the effect of icotinib on the migration and invasion of squamous cells of tongue carcinoma (Tca8113 cells) in vitro. The results of the Boyden chamber invasion assay demonstrated that icotinib reduced cell invasion, suppressed the protein levels of matrix metalloproteinases (MMPs), MMP-2 and MMP-9, and increased the expression of tissue inhibitor of metalloproteinase-1. In addition, icotinib was found to significantly decrease the protein levels of nuclear factor κB (NF-κB) p65, which suggested that icotinib inhibits NF-κB activity. Furthermore, treatment with the NF-κB inhibitor, pyrrolidine dithiocarbamate, suppressed cell invasion and MMP-2 expression. These results suggested that icotinib inhibits the invasion of Tca8113 cells by downregulating MMP via the inactivation of the NF-κB signaling pathways. PMID:25120710
Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang
2014-09-01
Icotinib is an epidermal growth factor receptor tyrosine kinase inhibitor, which has been revealed to inhibit proliferation in tumor cells. However, the effect of icotinib on cancer cell metastasis remains to be explained. This study examines the effect of icotinib on the migration and invasion of squamous cells of tongue carcinoma (Tca8113 cells) in vitro . The results of the Boyden chamber invasion assay demonstrated that icotinib reduced cell invasion, suppressed the protein levels of matrix metalloproteinases (MMPs), MMP-2 and MMP-9, and increased the expression of tissue inhibitor of metalloproteinase-1. In addition, icotinib was found to significantly decrease the protein levels of nuclear factor κB (NF-κB) p65, which suggested that icotinib inhibits NF-κB activity. Furthermore, treatment with the NF-κB inhibitor, pyrrolidine dithiocarbamate, suppressed cell invasion and MMP-2 expression. These results suggested that icotinib inhibits the invasion of Tca8113 cells by downregulating MMP via the inactivation of the NF-κB signaling pathways.
Narayan, Shoba; Devi, R S; Devi, C S Shyamala
2007-11-20
Free radicals produced by ulcerogenic agents affect the TCA cycle enzymes located in the outer membrane of the mitochondria. Upon induction with ulcerogens, peroxidation of membrane lipids bring about alterations in the mitochondrial enzyme activity. This indicates an increase in the permeability levels of the mitochondrial membrane. The ability of PSE to scavenge the reactive oxygen species results in restoration of activities of TCA cycle enzymes. NSAIDs interfere with the mitochondrial beta-oxidation of fatty acids in vitro and in vivo, resulting in uncoupling of mitochondrial oxidative phosphorylation process. This usually results in diminished cellular ATP production. The recovery of gastric mucosal barrier function through maintenance of energy metabolism results in maintenance of ATP levels, as observed in this study upon treatment with PSE. Membrane integrity altered by peroxidation is known to have a modified fatty acid composition, a disruption of permeability, a decrease in electrical resistance, and increase in flip-flopping between monolayers and inactivated cross-linked proteins. The severe depletion of arachidonic acid in ulcer induced groups was prevented upon treatment with PSE. The acid inhibitory property of the herbal extract enables the maintenance of GL activity upon treatment with PSE. The ability to prevent membrane peroxidation has been traced to the presence of active constituents in the PSE. In essence, PSE has been found to prevent mitochondrial dysfunction, provide mitochondrial cell integrity, through the maintenance of lipid bilayer by its ability to provide a hydrophobic character to the gastric mucosa, further indicating its ability to reverse the action of NSAIDs and mast cell degranulators in gastric mucosa.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karamooz, Saeed; Breeding, John Eric; Justice, T Alan
As MicroTCA expands into applications beyond the telecommunications industry from which it originated, it faces new challenges in the area of inter-blade communications. The ability to achieve deterministic, low-latency communications between blades is critical to realizing a scalable architecture. In the past, legacy bus architectures accomplished inter-blade communications using dedicated parallel buses across the backplane. Because of limited fabric resources on its backplane, MicroTCA uses the carrier hub (MCH) for this purpose. Unfortunately, MCH products from commercial vendors are limited to standard bus protocols such as PCI Express, Serial Rapid IO and 10/40GbE. While these protocols have exceptional throughput capability,more » they are neither deterministic nor necessarily low-latency. To overcome this limitation, an MCH has been developed based on the Xilinx Virtex-7 690T FPGA. This MCH provides the system architect/developer complete flexibility in both the interface protocol and routing of information between blades. In this paper, we present the application of this configurable MCH concept to the Machine Protection System under development for the Spallation Neutron Sources's proton accelerator. Specifically, we demonstrate the use of the configurable MCH as a 12x4-lane crossbar switch using the Aurora protocol to achieve a deterministic, low-latency data link. In this configuration, the crossbar has an aggregate bandwidth of 48 GB/s.« less
MacGregor, Barbara J; Biddle, Jennifer F; Harbort, Christopher; Matthysse, Ann G; Teske, Andreas
2013-09-01
A near-complete draft genome has been obtained for a single vacuolated orange Beggiatoa (Cand. Maribeggiatoa) filament from a Guaymas Basin seafloor microbial mat, the third relatively complete sequence for the Beggiatoaceae. Possible pathways for sulfide oxidation; nitrate respiration; inorganic carbon fixation by both Type II RuBisCO and the reductive tricarboxylic acid cycle; acetate and possibly formate uptake; and energy-generating electron transport via both oxidative phosphorylation and the Rnf complex are discussed here. A role in nitrite reduction is suggested for an abundant orange cytochrome produced by the Guaymas strain; this has a possible homolog in Beggiatoa (Cand. Isobeggiatoa) sp. PS, isolated from marine harbor sediment, but not Beggiatoa alba B18LD, isolated from a freshwater rice field ditch. Inferred phylogenies for the Calvin-Benson-Bassham (CBB) cycle and the reductive (rTCA) and oxidative (TCA) tricarboxylic acid cycles suggest that genes encoding succinate dehydrogenase and enzymes for carboxylation and/or decarboxylation steps (including RuBisCO) may have been introduced to (or exported from) one or more of the three genomes by horizontal transfer, sometimes by different routes. Sequences from the two marine strains are generally more similar to each other than to sequences from the freshwater strain, except in the case of RuBisCO: only the Guaymas strain encodes a Type II enzyme, which (where studied) discriminates less against oxygen than do Type I RuBisCOs. Genes subject to horizontal transfer may represent key steps for adaptation to factors such as oxygen and carbon dioxide concentration, organic carbon availability, and environmental variability. © 2013.
Conformational diversity and computational enzyme design
Lassila, Jonathan K.
2010-01-01
The application of computational protein design methods to the design of enzyme active sites offers potential routes to new catalysts and new reaction specificities. Computational design methods have typically treated the protein backbone as a rigid structure for the sake of computational tractability. However, this fixed-backbone approximation introduces its own special challenges for enzyme design and it contrasts with an emerging picture of natural enzymes as dynamic ensembles with multiple conformations and motions throughout a reaction cycle. This review considers the impact of conformational variation and dynamics on computational enzyme design and it highlights new approaches to addressing protein conformational diversity in enzyme design including recent advances in multistate design, backbone flexibility, and computational library design. PMID:20829099
Janzer, Andreas; German, Natalie J.; Gonzalez-Herrera, Karina N.; Asara, John M.; Haigis, Marcia C.; Struhl, Kevin
2014-01-01
Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation. PMID:25002509
Janzer, Andreas; German, Natalie J; Gonzalez-Herrera, Karina N; Asara, John M; Haigis, Marcia C; Struhl, Kevin
2014-07-22
Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation.
Lloyd, Julie C.; Raines, Christine A.
2011-01-01
In darkened leaves the Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a regulatory multi-enzyme complex with the small chloroplast protein CP12. GAPDH also forms a high molecular weight regulatory mono-enzyme complex. Given that there are different reports as to the number and subunit composition of these complexes and that enzyme regulatory mechanisms are known to vary between species, it was reasoned that protein–protein interactions may also vary between species. Here, this variation is investigated. This study shows that two different tetramers of GAPDH (an A2B2 heterotetramer and an A4 homotetramer) have the capacity to form part of the PRK/GAPDH/CP12 complex. The role of the PRK/GAPDH/CP12 complex is not simply to regulate the ‘non-regulatory’ A4 GAPDH tetramer. This study also demonstrates that the abundance and nature of PRK/GAPDH/CP12 interactions are not equal in all species and that whilst NAD enhances complex formation in some species, this is not sufficient for complex formation in others. Furthermore, it is shown that the GAPDH mono-enzyme complex is more abundant as a 2(A2B2) complex, rather than the larger 4(A2B2) complex. This smaller complex is sensitive to cellular metabolites indicating that it is an important regulatory isoform of GAPDH. This comparative study has highlighted considerable heterogeneity in PRK and GAPDH protein interactions between closely related species and the possible underlying physiological basis for this is discussed. PMID:21498632
Howard, Thomas P; Lloyd, Julie C; Raines, Christine A
2011-07-01
In darkened leaves the Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a regulatory multi-enzyme complex with the small chloroplast protein CP12. GAPDH also forms a high molecular weight regulatory mono-enzyme complex. Given that there are different reports as to the number and subunit composition of these complexes and that enzyme regulatory mechanisms are known to vary between species, it was reasoned that protein-protein interactions may also vary between species. Here, this variation is investigated. This study shows that two different tetramers of GAPDH (an A2B2 heterotetramer and an A4 homotetramer) have the capacity to form part of the PRK/GAPDH/CP12 complex. The role of the PRK/GAPDH/CP12 complex is not simply to regulate the 'non-regulatory' A4 GAPDH tetramer. This study also demonstrates that the abundance and nature of PRK/GAPDH/CP12 interactions are not equal in all species and that whilst NAD enhances complex formation in some species, this is not sufficient for complex formation in others. Furthermore, it is shown that the GAPDH mono-enzyme complex is more abundant as a 2(A2B2) complex, rather than the larger 4(A2B2) complex. This smaller complex is sensitive to cellular metabolites indicating that it is an important regulatory isoform of GAPDH. This comparative study has highlighted considerable heterogeneity in PRK and GAPDH protein interactions between closely related species and the possible underlying physiological basis for this is discussed.
NASA Astrophysics Data System (ADS)
Vergara, Fredd; Kikuchi, Jun; Breuer, Christian
2016-05-01
Autopolyploidy is a process whereby the chromosome set is multiplied and it is a common phenomenon in angiosperms. Autopolyploidy is thought to be an important evolutionary force that has led to the formation of new plant species. Despite its relevance, the consequences of autopolyploidy in plant metabolism are poorly understood. This study compares the metabolic profiles of natural diploids and artificial autotetraploids of Arabidopsis thaliana Col-0. Different physiological parameters are compared between diploids and autotetraploids using nuclear magnetic resonance (NMR), elemental analysis (carbon:nitrogen balance) and quantitative real-time PCR (qRT-PCR). The main difference between diploid and autotetraploid A. thaliana Col-0 is observed in the concentration of metabolites related to the tricarboxylic acid cycle (TCA) and γ-amino butyric acid (GABA) shunt, as shown by multivariate statistical analysis of NMR spectra. qRT-PCR shows that genes related to the TCA and GABA shunt are also differentially expressed between diploids and autotetraploids following similar trends as their corresponding metabolites. Solid evidence is presented to demonstrate that autopolyploidy influences core plant metabolic processes.
Weger, H G; Turpin, D H
1989-02-01
Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH(4) (+), NO(2) (-), NO(3) (-)) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO(2) release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH(4) (+) assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O(2) consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO(3) (-) and NO(2) (-) assimilation resulted in a larger stimulation of TCA cycle CO(2) release than did NH(4) (+), but a much smaller stimulation of mitochondrial O(2) consumption. NH(4) (+) assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO(3) (-) and NO(2) (-) assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH(4) (+), NO(3) (-) and NO(2) (-) assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO(3) (-) and NO(2) (-) assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O(2) consumption during NO(3) (-) and NO(2) (-) assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO(3) (-) and NO(2) (-) reduction.
Isomerization of α-pinene in the terpentin oil with TCA/Natural Zeolite using microwave irradiation
NASA Astrophysics Data System (ADS)
Wijayati, N.; Supartono; Kusumastuti, E.
2018-04-01
The catalytic potensial of trichloroacetic acid (TCA)//Natural Zeolite in the isomerization of α-pinene in the terpentin oil was investigated. The purpose of this study is to investigate the influence of the power of microvawe on activity and selectivity of catalyst. The main product were champhene, terpinene, limonene, p-cymene, and terpinolene. The highest selectivity was 28.26% with a conversion of 23.25%, whereas the higher conversion was 98.99% with selectivity of 16.90% at room temperature using power of microwave 640 W.
Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin
2017-01-01
The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis. Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis. Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis. However, these results require verification in further studies. PMID:28962162
Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin
2017-09-01
The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis . Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis . Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis . However, these results require verification in further studies.
How Enzymes Work: A Look through the Perspective of Molecular Viscoelastic Properties
NASA Astrophysics Data System (ADS)
Qu, Hao; Zocchi, Giovanni
2013-01-01
We present nanorheology measurements on the folded state of an enzyme that show directly that the (ensemble-averaged) stress-strain relations are nonlinear and frequency dependent beyond 1-Å deformation. We argue that this frequency dependence allows for opening a nonequilibrium cycle in the force-deformation plane if the forward and backward conformational changes of the enzyme during catalysis happen at different speeds. Using a heuristic model for the experimentally established viscoelastic properties of the enzyme, we examine a number of general features of enzymatic action. We find that the proposed viscoelastic cycle is consistent with the linear decrease of the speed of motor proteins with load. We find a relation between the stall force and the maximum rate for enzymes (in general) and motors (in particular). We estimate the stall force of the motor protein kinesin from thermodynamic quantities and estimate the maximum rate of enzymes from purely mechanical quantities. We propose that the viscoelastic cycle provides a framework for considering mechanochemical coupling in enzymes on the basis of possibly universal materials properties of the folded state of proteins.
NASA Astrophysics Data System (ADS)
Martin, T. S.; Casciotti, K. L.
2014-12-01
The marine nitrogen (N) cycle is a dynamic system of critical importance, since nitrogen is the limiting nutrient in over half of the world's oceans. Denitrification and anammox, the main N loss processes from the ocean, have different effects on carbon cycling and greenhouse gas emission. Understanding the balance between the two processes is vital to understanding the role of the N cycle in global climate change. One approach for investigating these processes is by using stable isotope analysis to estimate the relative magnitudes of N fluxes, particularly for biologically mediated processes. In order to make the most of the currently available isotope analysis techniques, it is necessary to know the isotope effects for each processes occurring in the environment. Nitrite reduction is an important step in denitrification. Previous work had begun to explore the N isotope effects for nitrite reduction, but no oxygen (O) isotope effect has been measured. Additionally, no consideration has been given to the type of nitrite reductase carrying out the reaction. There are two main types of respiratory nitrite reductase, one that is Cu-based and another that is Fe-based. We performed batch culture experiments with denitrifier strains possessing either a Cu-type or Fe-type nitrite reductase. Both N and O isotope effects for nitrite reduction were determined for each of these experiments by measuring the NO2- concentration, as well as the N and O isotopes of nitrite and applying a Rayleigh fractionation model. Both the N and O isotope effects were found to be significantly different between the two types of enzymes. This enzyme-linked difference in isotope effects emphasizes the importance of microbial community composition within the global N cycle.
A reverse glyoxylate shunt to build a non-native route from C4 to C2 in Escherichia coli.
Mainguet, Samuel E; Gronenberg, Luisa S; Wong, Sio Si; Liao, James C
2013-09-01
Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C4 carboxylates into two molecules of acetyl-CoA without loss of CO2. Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. © 2013 Elsevier Inc. All rights reserved.
McCammon, M. T.
1996-01-01
The two carbon compounds, ethanol and acetate, can be oxidatively metabolized as well as assimilated into carbohydrate in the yeast Saccharomyces cerevisiae. The distribution of acetate metabolic enzymes among several cellular compartments, mitochondria, peroxisomes, and cytoplasm makes it an intriguing system to study complex metabolic interactions. To investigate the complex process of carbon catabolism and assimilation, mutants unable to grow on acetate were isolated. One hundred five Acn(-) (``ACetate Nonutilizing'') mutants were sorted into 21 complementation groups with an additional 20 single mutants. Five of the groups have defects in TCA cycle enzymes: MDH1, CIT1, ACO1, IDH1, and IDH2. A defect in RTG2, involved in the retrograde communication between the mitochondrion and the nucleus, was also identified. Four genes encode enzymes of the glyoxylate cycle and gluconeogenesis: ICL1, MLS1, MDH2, and PCK1. Five other genes appear to be defective in regulating metabolic activity since elevated levels of enzymes in several metabolic pathways, including the glyoxylate cycle, gluconeogenesis, and acetyl-CoA metabolism, were detected in these mutants: ACN8, ACN9, ACN17, ACN18, and ACN42. In summary, this analysis has identified at least 22 and as many as 41 different genes involved in acetate metabolism. PMID:8878673
Boone, Cory H T; Grove, Ryan A; Adamcova, Dana; Braga, Camila P; Adamec, Jiri
2016-07-01
Clinical usage of lidocaine, a pro-oxidant has been linked with severe, mostly neurological complications. The mechanism(s) causing these complications is independent of the blockade of voltage-gated sodium channels. The budding yeast Saccharomyces cerevisiae lacks voltage-gated sodium channels, thus provides an ideal system to investigate lidocaine-induced protein and pathway alterations. Whole-proteome alterations leading to these complications have not been identified. To address this, S. cerevisiae was grown to stationary phase and exposed to an LC50 dose of lidocaine. The differential proteomes of lidocaine treatment and control were resolved 6 h post exposure using 2D DIGE. Amine reactive dyes and carbonyl reactive dyes were used to assess protein abundance and protein oxidation, respectively. Quantitative analysis of these dyes (⩾ 1.5-fold alteration, p ⩽ 0.05) revealed a total of 33 proteoforms identified by MS differing in abundance and/or oxidation upon lidocaine exposure. Network analysis showed enrichment of apoptotic proteins and cell wall maintenance proteins, while the abundance of proteins central to carbohydrate metabolism, such as triosephosphate isomerase and glyceraldehyde-3-phosphate dehydrogenase, and redox proteins superoxide dismutase and peroxiredoxin were significantly decreased. Enzymes of carbohydrate metabolism, such as phosphoglycerate kinase and enolase, the TCA cycle enzyme aconitase, and multiple ATP synthase subunits were found to be oxidatively modified. Also, the activity of aconitase was found to be decreased. Overall, these data suggest that toxic doses of lidocaine induce significant disruption of glycolytic pathways, energy production, and redox balance, potentially leading to cell malfunction and death. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Steinweg, J. M.; Kostka, J. E.; Hanson, P. J.; Schadt, C. W.
2017-12-01
Northern peatlands have large amounts of soil organic matter due to reduced decomposition. Breakdown of organic matter is initially mediated by extracellular enzymes, the activity of which may be controlled by temperature, moisture, and substrate availability, all of which vary seasonally throughout the year and with depth. In typical soils the majority of the microbial biomass and decomposition occurs within the top 30cm due to reduced organic matter inputs in the subsurface however peatlands by their very nature contain large amounts of organic matter throughout their depth profile. We hypothesized that potential enzyme activity would be greatest at the surface of the peat due to a larger microbial biomass compared to 40cm and 175cm below the surface and that temperature sensitivity would be greatest at the surface during winter but lowest during the summer due to high temperatures and enzyme efficiency. Peat samples were collected in February, July, and August 2012 from the DOE Spruce and Peatland Responses Under Climatic and Environmental Change project at Marcell Experimental Forest S1 bog. We measured potential activity of hydrolytic enzymes involved in three different nutrient cycles: beta-glucosidase (carbon), leucine amino peptidase (nitrogen), and phosphatase (phosphorus) at 15 temperature points ranging from 3°C to 65°C. Enzyme activity decreased with depth as expected but there was no concurrent change in activation energy (Ea). The reduction in enzyme activity with depth indicates a smaller pool which coincided with a decreased microbial biomass. Differences in enzyme activity with depth also mirrored the changes in peat composition from the acrotelm to the catotelm. Season did play a role in temperature sensitivity with Ea of β-glucosidase and phosphatase being the lowest in August as expected but leucine amino peptidase (a nitrogen acquiring enzyme) Ea was not influenced by season. As temperatures rise, especially in winter months, enzymatic
Mitochondrial Respiration Can Support NO3− and NO2− Reduction during Photosynthesis 1
Weger, Harold G.; Turpin, David H.
1989-01-01
Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH4+, NO2−, NO3−) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO2 release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH4+ assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O2 consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO3− and NO2− assimilation resulted in a larger stimulation of TCA cycle CO2 release than did NH4+, but a much smaller stimulation of mitochondrial O2 consumption. NH4+ assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO3− and NO2− assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH4+, NO3− and NO2− assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO3− and NO2− assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O2 consumption during NO3− and NO2− assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO3− and NO2− reduction. PMID:16666557
Starch-Branching Enzyme IIa Is Required for Proper Diurnal Cycling of Starch in Leaves of Maize1[OA
Yandeau-Nelson, Marna D.; Laurens, Lieve; Shi, Zi; Xia, Huan; Smith, Alison M.; Guiltinan, Mark J.
2011-01-01
Starch-branching enzyme (SBE), a glucosyl transferase, is required for the highly regular pattern of α-1,6 bonds in the amylopectin component of starch. In the absence of SBEIIa, as shown previously in the sbe2a mutant of maize (Zea mays), leaf starch has drastically reduced branching and the leaves exhibit a severe senescence-like phenotype. Detailed characterization of the maize sbe2a mutant revealed that SBEIIa is the primary active branching enzyme in the leaf and that in its absence plant growth is affected. Both seedling and mature sbe2a mutant leaves do not properly degrade starch during the night, resulting in hyperaccumulation. In mature sbe2a leaves, starch hyperaccumulation is greatest in visibly senescing regions but also observed in green tissue and is correlated to a drastic reduction in photosynthesis within the leaf. Starch granules from sbe2a leaves observed via scanning electron microscopy and transmission electron microscopy analyses are larger, irregular, and amorphous as compared with the highly regular, discoid starch granules observed in wild-type leaves. This appears to trigger premature senescence, as shown by an increased expression of genes encoding proteins known to be involved in senescence and programmed cell death processes. Together, these results indicate that SBEIIa is required for the proper diurnal cycling of transitory starch within the leaf and suggest that SBEIIa is necessary in producing an amylopectin structure amenable to degradation by starch metabolism enzymes. PMID:21508184
Folsom, James Patrick
2015-01-01
Escherichia coli physiological, biomass elemental composition and proteome acclimations to ammonium-limited chemostat growth were measured at four levels of nutrient scarcity controlled via chemostat dilution rate. These data were compared with published iron- and glucose-limited growth data collected from the same strain and at the same dilution rates to quantify general and nutrient-specific responses. Severe nutrient scarcity resulted in an overflow metabolism with differing organic byproduct profiles based on limiting nutrient and dilution rate. Ammonium-limited cultures secreted up to 35 % of the metabolized glucose carbon as organic byproducts with acetate representing the largest fraction; in comparison, iron-limited cultures secreted up to 70 % of the metabolized glucose carbon as lactate, and glucose-limited cultures secreted up to 4 % of the metabolized glucose carbon as formate. Biomass elemental composition differed with nutrient limitation; biomass from ammonium-limited cultures had a lower nitrogen content than biomass from either iron- or glucose-limited cultures. Proteomic analysis of central metabolism enzymes revealed that ammonium- and iron-limited cultures had a lower abundance of key tricarboxylic acid (TCA) cycle enzymes and higher abundance of key glycolysis enzymes compared with glucose-limited cultures. The overall results are largely consistent with cellular economics concepts, including metabolic tradeoff theory where the limiting nutrient is invested into essential pathways such as glycolysis instead of higher ATP-yielding, but non-essential, pathways such as the TCA cycle. The data provide a detailed insight into ecologically competitive metabolic strategies selected by evolution, templates for controlling metabolism for bioprocesses and a comprehensive dataset for validating in silico representations of metabolism. PMID:26018546
Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr.
Datta, Prasun K; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C; Fecchio, Chiara; Barrero, Carlos A
2016-09-01
HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS.
Yano, Takanori; Yoshida, Nobuyuki; Yu, Fujio; Wakamatsu, Miki; Takagi, Hiroshi
2015-07-01
Rhodococcus erythropolis N9T-4 shows extremely oligotrophic growth requiring atmospheric CO2 and forms its colonies on an inorganic basal medium (BM) without any additional carbon source. Screening of a random mutation library constructed by a unique genome deletion method that we established indicated that the aceA, aceB, and pckG genes encoding isocitrate lyase, malate synthase, and phosphoenolpyruvate carboxykinase, respectively, were requisite for survival on BM plates. The aceA- and aceB deletion mutants and the pckG deletion mutant grew well on BM plates containing L-malate and D-glucose, respectively, suggesting that the glyoxylate (GO) shunt and gluconeogenesis are essential for the oligotrophic growth of N9T-4. Interestingly, most of the enzyme activities in the TCA cycle were observed in the cell-free extract of N9T-4, with perhaps the most important exception being α-ketoglutarate dehydrogenase (KGDH) activity. Instead of the KGDH activity, we detected a remarkable level of α-ketoglutarate decarboxylase (KGD) activity, which is the activity exhibited by the E1 component of the KGDH complex in Mycobacterium tuberculosis. The recombinant KGD of N9T-4 catalyzed the decarboxylation of α-ketoglutarate to form succinic semialdehyde (SSA) in a time-dependent manner. Since N9T-4 also showed a detectable SSA dehydrogenase activity, we concluded that N9T-4 possesses a variant TCA cycle, which uses SSA rather than succinyl-CoA. These results suggest that oligotrophic N9T-4 cells utilize the GO shunt to avoid the loss of carbons as CO2 and to conserve CoA units in the TCA cycle.
Liu, Miao; Yang, Xiao-Ning; Zhu, Hui-Xia; Jia, Yuan-Yuan; Jia, Shi-Ru; Piergiovanni, Luciano
2014-01-01
A better understanding of metabolic fluxes is important for manipulating microbial metabolism toward desired end products, or away from undesirable by-products. A mutant strain, Gluconacetobacter xylinus AX2-16, was obtained by combined chemical mutation of the parent strain (G. xylinus CGMCC 2955) using DEC (diethyl sulfate) and LiCl. The highest bacterial cellulose production for this mutant was obtained at about 11.75 g/L, which was an increase of 62% compared with that by the parent strain. In contrast, gluconic acid (the main byproduct) concentration was only 5.71 g/L for mutant strain, which was 55.7% lower than that of parent strain. Metabolic flux analysis indicated that 40.1% of the carbon source was transformed to bacterial cellulose in mutant strain, compared with 24.2% for parent strain. Only 32.7% and 4.0% of the carbon source were converted into gluconic acid and acetic acid in mutant strain, compared with 58.5% and 9.5% of that in parent strain. In addition, a higher flux of tricarboxylic acid (TCA) cycle was obtained in mutant strain (57.0%) compared with parent strain (17.0%). It was also indicated from the flux analysis that more ATP was produced in mutant strain from pentose phosphate pathway (PPP) and TCA cycle. The enzymatic activity of succinate dehydrogenase (SDH), which is one of the key enzymes in TCA cycle, was 1.65-fold higher in mutant strain than that in parent strain at the end of culture. It was further validated by the measurement of ATPase that 3.53–6.41 fold higher enzymatic activity was obtained from mutant strain compared with parent strain. PMID:24901455
Araújo, Wagner L.; Tohge, Takayuki; Nunes-Nesi, Adriano; Daloso, Danilo M.; Nimick, Mhairi; Krahnert, Ina; Bunik, Victoria I.; Moorhead, Greg B. G.; Fernie, Alisdair R.
2012-01-01
Although the role of the 2-oxoglutarate dehydrogenase complex (2-OGDHC) has previously been demonstrated in plant heterotrophic tissues its role in photosynthetically active tissues remains poorly understood. By using a combination of metabolite and transcript profiles we here investigated the function of 2-OGDHC in leaves of Arabidopsis thaliana via use of specific phosphonate inhibitors of the enzyme. Incubation of leaf disks with the inhibitors revealed that they produced the anticipated effects on the in situ enzyme activity. In vitro experiments revealed that succinyl phosphonate (SP) and a carboxy ethyl ester of SP are slow-binding inhibitors of the 2-OGDHC. Our results indicate that the reduced respiration rates are associated with changes in the regulation of metabolic and signaling pathways leading to an imbalance in carbon-nitrogen metabolism and cell homeostasis. The inducible alteration of primary metabolism was associated with altered expression of genes belonging to networks of amino acids, plant respiration, and sugar metabolism. In addition, by using isothermal titration calorimetry we excluded the possibility that the changes in gene expression resulted from an effect on 2-oxoglutarate (2OG) binding to the carbon/ATP sensing protein PII. We also demonstrated that the 2OG degradation by the 2-oxoglutarate dehydrogenase strongly influences the distribution of intermediates of the tricarboxylic acid (TCA) cycle and the GABA shunt. Our results indicate that the TCA cycle activity is clearly working in a non-cyclic manner upon 2-OGDHC inhibition during the light period. PMID:22876250
Ghosh, Arpan C.; O’Connor, Michael B.
2014-01-01
The ability to maintain cellular and physiological metabolic homeostasis is key for the survival of multicellular organisms in changing environmental conditions. However, our understanding of extracellular signaling pathways that modulate metabolic processes remains limited. In this study we show that the Activin-like ligand Dawdle (Daw) is a major regulator of systemic metabolic homeostasis and cellular metabolism in Drosophila. We find that loss of canonical Smad signaling downstream of Daw leads to defects in sugar and systemic pH homeostasis. Although Daw regulates sugar homeostasis by positively influencing insulin release, we find that the effect of Daw on pH balance is independent of its role in insulin signaling and is caused by accumulation of organic acids that are primarily tricarboxylic acid (TCA) cycle intermediates. RNA sequencing reveals that a number of TCA cycle enzymes and nuclear-encoded mitochondrial genes including genes involved in oxidative phosphorylation and β-oxidation are up-regulated in the daw mutants, indicating either a direct or indirect role of Daw in regulating these genes. These findings establish Activin signaling as a major metabolic regulator and uncover a functional link between TGF-β signaling, insulin signaling, and metabolism in Drosophila. PMID:24706779
PIK3CA mutant tumors depend on oxoglutarate dehydrogenase | Office of Cancer Genomics
Oncogenic PIK3CA mutations are found in a significant fraction of human cancers, but therapeutic inhibition of PI3K has only shown limited success in clinical trials. To understand how mutant PIK3CA contributes to cancer cell proliferation, we used genome scale loss-of-function screening in a large number of genomically annotated cancer cell lines. As expected, we found that PIK3CA mutant cancer cells require PIK3CA but also require the expression of the TCA cycle enzyme 2-oxoglutarate dehydrogenase (OGDH).
Brunner, Patrick C; Torriani, Stefano F F; Croll, Daniel; Stukenbrock, Eva H; McDonald, Bruce A
2013-06-01
Zymoseptoria tritici is an important fungal pathogen on wheat that originated in the Fertile Crescent. Its closely related sister species Z. pseudotritici and Z. ardabiliae infect wild grasses in the same region. This recently emerged host-pathogen system provides a rare opportunity to investigate the evolutionary processes shaping the genome of an emerging pathogen. Here, we investigate genetic signatures in plant cell wall degrading enzymes (PCWDEs) that are likely affected by or driving coevolution in plant-pathogen systems. We hypothesize four main evolutionary scenarios and combine comparative genomics, transcriptomics, and selection analyses to assign the majority of PCWDEs in Z. tritici to one of these scenarios. We found widespread differential transcription among different members of the same gene family, challenging the idea of functional redundancy and suggesting instead that specialized enzymatic activity occurs during different stages of the pathogen life cycle. We also find that natural selection has significantly affected at least 19 of the 48 identified PCWDEs. The majority of genes showed signatures of purifying selection, typical for the scenario of conserved substrate optimization. However, six genes showed diversifying selection that could be attributed to either host adaptation or host evasion. This study provides a powerful framework to better understand the roles played by different members of multigene families and to determine which genes are the most appropriate targets for wet laboratory experimentation, for example, to elucidate enzymatic function during relevant phases of a pathogen's life cycle.
2015-01-01
Whey protein intake is associated with the modulation of energy metabolism and altered body composition both in human subjects and in animals, but the underlying mechanisms are not yet elucidated. We fed obesity-prone C57BL/6J mice high-fat diets with either casein (HF casein) or whey (HF whey) for 6 weeks. At equal energy intake and apparent fat and nitrogen digestibility, mice fed HF whey stored less energy as lipids, evident both as lower white adipose tissue mass and as reduced liver lipids, compared with HF-casein-fed mice. Explorative analyses of 48 h urine, both by 1H NMR and LC–MS metabolomic platforms, demonstrated higher urinary excretion of tricarboxylic acid (TCA) cycle intermediates citric acid and succinic acid (identified by both platforms), and cis-aconitic acid and isocitric acid (identified by LC–MS platform) in the HF whey, relative to in the HF-casein-fed mice. Targeted LC–MS analyses revealed higher citric acid and cis-aconitic acid concentrations in fed state plasma, but not in liver of HF-whey-fed mice. We propose that enhanced urinary loss of TCA cycle metabolites drain available substrates for anabolic processes, such as lipogenesis, thereby leading to reduced lipid accretion in HF-whey-fed compared to HF-casein-fed mice. PMID:24702026
The effects of estrus cycle on drug metabolism in the rat.
Brandstetter, Y; Kaplanski, J; Leibson, V; Ben-Zvi, Z
1986-01-01
The effect of the female rat estral cycle on microsomal drug metabolism in-vivo and in-vitro has been studied. Two microsomal enzymes, aminopyrine-N-demethylase and aniline hydroxylase showed a greater specific activity (p less than 0.01) in the diestrus phase of the estral cycle while the oxidative enzyme aryl hydrocarbon hydroxylase and the conjugative enzyme, glucuronyl transferase, were not affected. In vivo studies which included theophylline and antipyrine metabolism, and hexobarbital sleeping times showed no difference between the different phases of the estral cycle. Conflicting evidence about the effect of steroid sex hormones on hepatic drug metabolism is discussed.
NASA Astrophysics Data System (ADS)
Farrell, Stuart Bennett
Mercury Cadmium Telluride (HgCdTe) is a material of great importance for infrared focal plane array applications. In order to produce large format detector arrays this material needs to be grown on a large area substrate, with silicon being the most mature substrate, it is the optimal choice for large format arrays. To help mitigate the effect of the lattice mismatch between the two materials, cadmium telluride (CdTe) is used as a buffer layer. The CdTe itself has nearly the same lattice mismatch (19.3%) to silicon, but due to the technological advantages it offers and compatibility with HgCdTe, it is the best buffer layer choice. The lattice mismatch between HgCdTe/CdTe and the silicon substrate leads to the formation of dislocations at densities in the mid 106 to low 107 cm-2 range in the epilayers. Such a high dislocation density greatly effects detector device performance quantities such as operability and sensitivity. Hence, the dislocation density should be brought down by at least an order of magnitude by adopting novel in situ and ex situ material processing techniques. In this work, in situ and ex situ thermal cycle annealing (TCA) methods have been used to decrease dislocation density in CdTe and HgCdTe. During the molecular beam epitaxial (MBE) growth of the CdTe buffer layer, the growth was interrupted and the layer was subjected to an annealing cycle within the growth chamber under tellurium overpressure. During the annealing cycle the temperature is raised to beyond the growth temperature (290 → 550 °C) and then allowed to cool before resuming growth again. This process was repeated several times during the growth. After growth, a portion of the material was subjected to a dislocation decoration etch in order to count the etch pit density (EPD) which has a direct correspondence with the dislocation density in the crystal. The crystalline quality was also characterized by x-ray diffraction rocking curves and photoluminescence. The in situ TCA
Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whitaker, W. Brian; Jones, J. Andrew; Bennett, R. Kyle
Methanol is an attractive substrate for biological production of chemicals and fuels. Engineering methylotrophic Escherichia coli as a platform organism for converting methanol to metabolites is desirable. Prior efforts to engineer methylotrophic E. coli were limited by methanol dehydrogenases (Mdhs) with unfavorable enzyme kinetics. We engineered E. coli to utilize methanol using a superior NAD-dependent Mdh from Bacillus stearothermophilus and ribulose monophosphate (RuMP) pathway enzymes from B. methanolicus. Using 13C-labeling, we demonstrate this E. coli strain converts methanol into biomass components. For example, the key TCA cycle intermediates, succinate and malate, exhibit labeling up to 39%, while the lower glycolyticmore » intermediate, 3-phosphoglycerate, up to 53%. Multiple carbons are labeled for each compound, demonstrating a cycling RuMP pathway for methanol assimilation to support growth. In conclusion, by incorporating the pathway to synthesize the flavanone naringenin, we demonstrate the first example of in vivo conversion of methanol into a specialty chemical in E. coli.« less
Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli
Whitaker, W. Brian; Jones, J. Andrew; Bennett, R. Kyle; ...
2016-11-01
Methanol is an attractive substrate for biological production of chemicals and fuels. Engineering methylotrophic Escherichia coli as a platform organism for converting methanol to metabolites is desirable. Prior efforts to engineer methylotrophic E. coli were limited by methanol dehydrogenases (Mdhs) with unfavorable enzyme kinetics. We engineered E. coli to utilize methanol using a superior NAD-dependent Mdh from Bacillus stearothermophilus and ribulose monophosphate (RuMP) pathway enzymes from B. methanolicus. Using 13C-labeling, we demonstrate this E. coli strain converts methanol into biomass components. For example, the key TCA cycle intermediates, succinate and malate, exhibit labeling up to 39%, while the lower glycolyticmore » intermediate, 3-phosphoglycerate, up to 53%. Multiple carbons are labeled for each compound, demonstrating a cycling RuMP pathway for methanol assimilation to support growth. In conclusion, by incorporating the pathway to synthesize the flavanone naringenin, we demonstrate the first example of in vivo conversion of methanol into a specialty chemical in E. coli.« less
Eloqayli, Haytham; Qu, Hong; Unsgård, Geirmund; Sletvold, Olav; Hadidi, Hakam; Sonnewald, Ursula
2002-02-01
This study was performed to analyze the effects of glutamate and the epileptogenic agent pentylenetetrazole (PTZ) on neuronal glucose metabolism. Cerebellar granule neurons were incubated for 2 h in medium containing 3 mM [U-(13)C]glucose, with and without 0.25 mM glutamate and/or 10 mM PTZ. In the presence of PTZ, decreased glucose consumption with unchanged lactate release was observed, indicating decreased glucose oxidation. PTZ also slowed down tricarboxylic acid (TCA) cycle activity as evidenced by the decreased amounts of labeled aspartate and [1,2-(13)C]glutamate. When glutamate was present, glucose consumption was also decreased. However, the amount of glutamate, derived from [U-(13)C]glucose via the first turn of the TCA cycle, was increased. The decreased amount of [1,2-(13)C]glutamate, derived from the second turn in the TCA cycle, and increased amount of aspartate indicated the dilution of label due to the entrance of unlabeled glutamate into TCA cycle. In the presence of glutamate plus PTZ, the effect of PTZ was enhanced by glutamate. Labeled alanine was detected only in the presence of glutamate plus PTZ, which indicated that oxaloacetate was a better amino acid acceptor than pyruvate. Furthermore, there was also evidence for intracellular compartmentation of oxaloacetate metabolism. Glutamate and PTZ caused similar metabolic changes, however, via different mechanisms. Glutamate substituted for glucose as energy substrate in the TCA cycle, whereas, PTZ appeared to decrease mitochondrial activity.
Sunny, Nishanth E; Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J; Nautiyal, Manisha; Mathew, Justin T; Williams, Caroline M; Cusi, Kenneth
2015-08-15
Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD.
Imaging Prostate Cancer (PCa) Phenotype and Evolution
2016-10-01
inhibit growth of some but not all cell lines. 2. Keywords: Deferiprone, aconitase, metabolism, tricarboxylic acid cycle , magnetic resonance 3...TRAMP C2 and MycCaP cell proliferation, migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity...migration and inhibits TCA cycle (metabolism). Similarly in vivo (Aim 2), we 6 Fig. 2: Effect of DFP on in vivo growth of MycCaP (left) and TRAMP C2
Lee, Yie-Vern; Wahab, Habibah A.
2015-01-01
Isocitrate lyase (ICL) is the first enzyme involved in glyoxylate cycle. Many plants and microorganisms are relying on glyoxylate cycle enzymes to survive upon downregulation of tricarboxylic acid cycle (TCA cycle), especially Mycobacterium tuberculosis (MTB). In fact, ICL is a potential drug target for MTB in dormancy. With the urge for new antitubercular drug to overcome tuberculosis treat such as multidrug resistant strain and HIV-coinfection, the pace of drug discovery has to be increased. There are many approaches to discovering potential inhibitor for MTB ICL and we hereby review the updated list of them. The potential inhibitors can be either a natural compound or synthetic compound. Moreover, these compounds are not necessary to be discovered only from MTB ICL, as it can also be discovered by a non-MTB ICL. Our review is categorized into four sections, namely, (a) MTB ICL with natural compounds; (b) MTB ICL with synthetic compounds; (c) non-MTB ICL with natural compounds; and (d) non-MTB ICL with synthetic compounds. Each of the approaches is capable of overcoming different challenges of inhibitor discovery. We hope that this paper will benefit the discovery of better inhibitor for ICL. PMID:25649791
Boros, László G; D'Agostino, Dominic P; Katz, Howard E; Roth, Justine P; Meuillet, Emmanuelle J; Somlyai, Gábor
2016-02-01
The naturally occurring isotope of hydrogen ((1)H), deuterium ((2)H), could have an important biological role. Deuterium depleted water delays tumor progression in mice, dogs, cats and humans. Hydratase enzymes of the tricarboxylic acid (TCA) cycle control cell growth and deplete deuterium from redox cofactors, fatty acids and DNA, which undergo hydride ion and hydrogen atom transfer reactions. A model is proposed that emphasizes the terminal complex of mitochondrial electron transport chain reducing molecular oxygen to deuterium depleted water (DDW); this affects gluconeogenesis as well as fatty acid oxidation. In the former, the DDW is thought to diminish the deuteration of sugar-phosphates in the DNA backbone, helping to preserve stability of hydrogen bond networks, possibly protecting against aneuploidy and resisting strand breaks, occurring upon exposure to radiation and certain anticancer chemotherapeutics. DDW is proposed here to link cancer prevention and treatment using natural ketogenic diets, low deuterium drinking water, as well as DDW production as the mitochondrial downstream mechanism of targeted anti-cancer drugs such as Avastin and Glivec. The role of (2)H in biology is a potential missing link to the elusive cancer puzzle seemingly correlated with cancer epidemiology in western populations as a result of excessive (2)H loading from processed carbohydrate intake in place of natural fat consumption. Published by Elsevier Ltd.
A reverse glyoxylate shunt to build a non-native route from C-4 to C-2 in Escherichia coli
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mainguet, SE; Gronenberg, LS; Wong, SS
2013-09-01
Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C-4 carboxylates into two molecules of acetyl-CoA without loss of CO2.more » Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. (C) 2013 Elsevier Inc. All rights reserved.« less
Enzymes of Glyoxylate in Conifers 12
Firenzuoli, A. M.; Vanni, P.; Mastronuzzi, E.; Zanobini, A.; Baccari, V.
1968-01-01
The high level of lipids in seeds of some species of conifers suggested that the glyoxylate cycle might have a role in conifer seed metabolism. Six species (Pinus pinea, Pinus pinaster, Pinus canariensis, Pinus strobus, Abies alba, and Cupressus sempervirens) were investigated for their lipid content and malate synthase and isocitrate lyase level. The fatty acid composition of the triglyceride fraction was also investigated. The correlation between lipid content of germinating seed with the presence of the cycle was confirmed. The enzymes of the glyoxylate cycle were not detected in Cupressus sempervirens where the lipid content is very low. PMID:16656892
Carmon, Amber; MacIntyre, Ross
2010-01-01
The genome sequences of 12 Drosophila species contain 3 paralogs for alpha glycerophosphate dehydrogenase (GPDH) and for the mitochondrial alpha glycerophosphate oxidase (GPO). These 2 enzymes participate in the alpha glycerophosphate cycle in the adult thoracic flight muscles. The flight muscle enzymes are encoded by gpdh-1 at 26A2 and gpo-1 at 52C8. In this paper, we show that the GPDH paralogs share the same evolutionarily conserved functional domains and most intron positions, whereas the GPO paralogs share only some of the functional domains of mitochondrial oxidoreductases. The GPO paralogs not expressed in the flight muscles essentially lack introns. GPDH paralogs encoded by gpdh-2 and gpdh-3 and the GPO paralogs encoded by gpo-2 and gpo-3 are expressed only in the testes. Gene trees for the GPDH and GPO paralogs indicate that the genes expressed in the flight muscles are evolving very slowly presumably under strong purifying selection whereas the paralogs expressed in the testes are evolving more rapidly. The concordance between species and gene trees, d(N)/d(S) ratios, phylogenetic analysis by maximum likelihood-based tests, and analyses of radical and conservative substitutions all indicate that the additional GPDH and GPO paralogs are also evolving under purifying selection.
Enzyme cofactors: Double-edged sword for catalysis
NASA Astrophysics Data System (ADS)
Ivanov, Ivaylo
2013-01-01
The metal cofactors responsible for the activity of CDK2 -- a representative member of the kinase superfamily of enzymes -- have now been shown to also have inhibitory effects during the catalytic cycle.
Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr
Datta, Prasun K.; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C.; Fecchio, Chiara; Barrero, Carlos A.
2016-01-01
ABSTRACT HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS. PMID:27245560
Shi, Qingli; Xu, Hui; Kleinman, Wayne A.; Gibson, Gary E.
2011-01-01
Measures in autopsied brains from Alzheimer’s Disease (AD) patients reveal a decrease in the activity of α-ketoglutarate dehydrogenase complex (KGDHC) and an increase in malate dehydrogenase (MDH) activity. The present experiments tested whether both changes could be caused by the common oxidant H2O2 and to probe the mechanism underlying these changes. Since the response to H2O2 is modified by the level of the E2k subunit of KGDHC, the interaction of MDH and KGDHC was studied in cells with varying levels of E2k. In cells with only 23% of normal E2k protein levels, one hour treatment with H2O2 decreased KGDHC and increased MDH activity as well as the mRNA level for both cytosolic and mitochondrial MDH. The increase in MDH did not occur in cells with 100% or 46% of normal E2k. Longer treatments with H2O2 inhibited the activity of both enzymes. Glutathione is a major regulator of cellular redox state and can modify enzyme activities. H2O2 converts reduced glutathione (GSH) to oxidized glutathione (GSSG), which reacts with protein thiols. Treatment of purified KGDHC with GSSG leads to glutathionylation of all three KGDHC subunits. Thus, cellular glutathione level was manipulated by two means to determine the effect on KGDHC and MDH activities. Both buthionine sulfoximine (BSO), which inhibits glutathione synthesis without altering redox state, and H2O2 diminished glutathione to a similar level after 24 hrs. However, H2O2, but not BSO, reduced KGDHC and MDH activities, and the reduction was greater in the E2k-23 line. These findings suggest that the E2k may mediate diverse responses of KGDHC and MDH to oxidants. In addition, the differential response of activities to BSO and H2O2 together with the in vitro interaction of KGDHC with GSSG suggests that glutathionylation is one possible mechanism underlying oxidative stress-induced inhibition of the TCA cycle enzymes. PMID:18206986
Shibayama, Junko; Yuzyuk, Tatiana N.; Cox, James; Makaju, Aman; Miller, Mickey; Lichter, Justin; Li, Hui; Leavy, Jane D.; Franklin, Sarah; Zaitsev, Alexey V.
2015-01-01
Heart failure (HF) is accompanied by complex alterations in myocardial energy metabolism. Up to 40% of HF patients have dyssynchronous ventricular contraction, which is an independent indicator of mortality. We hypothesized that electromechanical dyssynchrony significantly affects metabolic remodeling in the course of HF. We used a canine model of tachypacing-induced HF. Animals were paced at 200 bpm for 6 weeks either in the right atrium (synchronous HF, SHF) or in the right ventricle (dyssynchronous HF, DHF). We collected biopsies from left ventricular apex and performed comprehensive metabolic pathway analysis using multi-platform metabolomics (GC/MS; MS/MS; HPLC) and LC-MS/MS label-free proteomics. We found important differences in metabolic remodeling between SHF and DHF. As compared to Control, ATP, phosphocreatine (PCr), creatine, and PCr/ATP (prognostic indicator of mortality in HF patients) were all significantly reduced in DHF, but not SHF. In addition, the myocardial levels of carnitine (mitochondrial fatty acid carrier) and fatty acids (12:0, 14:0) were significantly reduced in DHF, but not SHF. Carnitine parmitoyltransferase I, a key regulatory enzyme of fatty acid ß-oxidation, was significantly upregulated in SHF but was not different in DHF, as compared to Control. Both SHF and DHF exhibited a reduction, but to a different degree, in creatine and the intermediates of glycolysis and the TCA cycle. In contrast to this, the enzymes of creatine kinase shuttle were upregulated, and the enzymes of glycolysis and the TCA cycle were predominantly upregulated or unchanged in both SHF and DHF. These data suggest a systemic mismatch between substrate supply and demand in pacing-induced HF. The energy deficit observed in DHF, but not in SHF, may be associated with a critical decrease in fatty acid delivery to the ß-oxidation pipeline, primarily due to a reduction in myocardial carnitine content. PMID:25790351
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Burch, Micah L.
Rationale: Defects in muscle glucose metabolism are linked to type 2 diabetes. Mechanistic studies examining these defects rely on the use of high fat-fed rodent models and typically involve the determination of muscle glucose uptake under insulin-stimulated conditions. While insightful, they do not necessarily reflect the physiology of the postprandial state. In addition, most studies do not examine aspects of glucose metabolism beyond the uptake process. Here we present an approach to study rodent muscle glucose and intermediary metabolism under the dynamic and physiologically relevant setting of the oral glucose tolerance test (OGTT). Methods and results: In vivo muscle glucose andmore » intermediary metabolism was investigated following oral administration of [U-{sup 13}C] glucose. Quadriceps muscles were collected 15 and 60 min after glucose administration and metabolite flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates via gas chromatography–mass spectrometry. While no dietary effects were noted in the glycolytic pathway, muscle from mice fed a high fat diet (HFD) exhibited a reduction in labelling in TCA intermediates. Interestingly, this appeared to be independent of alterations in flux through pyruvate dehydrogenase. In addition, our findings suggest that TCA cycle anaplerosis is negligible in muscle during an OGTT. Conclusions: Under the dynamic physiologically relevant conditions of the OGTT, skeletal muscle from HFD fed mice exhibits alterations in glucose metabolism at the level of the TCA cycle. - Highlights: • Dynamic metabolomics was used to investigate muscle glucose metabolism in vivo. • Mitochondrial TCA cycle metabolism is altered in muscle of HFD mice. • This defect was not pyruvate dehydrogenase mediated, as has been previously thought. • Mitochondrial TCA cycle anaplerosis in muscle is virtually absent during the OGTT.« less
Kajimura, Makiko; Walsh, Patrick J; Mommsen, Thomas P; Wood, Chris M
2006-01-01
Urea not only is utilized as a major osmolyte in marine elasmobranchs but also constitutes their main nitrogenous waste. This study investigated the effect of feeding, and thus elevated nitrogen intake, on nitrogen metabolism in the Pacific spiny dogfish Squalus acanthias. We determined the activities of ornithine urea cycle (O-UC) and related enzymes in liver and nonhepatic tissues. Carbamoyl phosphate synthetase III (the rate-limiting enzyme of the O-UC) activity in muscle is high compared with liver, and the activities in both tissues increased after feeding. The contribution of muscle to urea synthesis in the dogfish body appears to be much larger than that of liver when body mass is considered. Furthermore, enhanced activities of the O-UC and related enzymes (glutamine synthetase, ornithine transcarbamoylase, arginase) were seen after feeding in both liver and muscle and were accompanied by delayed increases in plasma urea, trimethylamine oxide, total free amino acids, alanine, and chloride concentrations, as well as in total osmolality. The O-UC and related enzymes also occurred in the intestine but showed little change after feeding. Feeding did not change the rate of urea excretion, indicating strong N retention after feeding. Ammonia excretion, which constituted only a small percentage of total N excretion, was raised in fed fish, while plasma ammonia did not change, suggesting that excess ammonia in plasma is quickly ushered into synthesis of urea or protein. In conclusion, we suggest that N conservation is a high priority in this elasmobranch and that feeding promotes ureogenesis and growth. Furthermore, exogenous nitrogen from food is converted into urea not only by the liver but also by the muscle and to a small extent by the intestine.
Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J.; Nautiyal, Manisha; Mathew, Justin T.; Williams, Caroline M.; Cusi, Kenneth
2015-01-01
Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD. PMID:26058864
Browning, Jeffrey D.; Weis, Brian; Davis, Jeannie; Satapati, Santhosh; Merritt, Matthew; Malloy, Craig R.; Burgess, Shawn C.
2009-01-01
Carbohydrate-restriction is a common weight-loss approach that modifies hepatic metabolism by increasing gluconeogenesis and ketosis. Because little is known regarding the effect of carbohydrate-restriction on the origin of gluconeogenic precursors (gluconeogenesis from glycerol (GNGglycerol) and lactate/amino acids (GNGPEP)) or its consequence to hepatic energy homeostasis, we studied these parameters in a group of overweight/obese subjects undergoing weight-loss via dietary restriction. We used 2H and 13C tracers and nuclear magnetic resonance spectroscopy to measure the sources of hepatic glucose and TCA cycle flux in weight-stable subjects(n=7) and subjects following carbohydrate-(n=7) or calorie-restriction(n=7). The majority of hepatic glucose production in carbohydrate-restricted subjects came from GNGPEP. The contribution of glycerol to gluconeogenesis was similar in all groups despite evidence of increased fat oxidation in carbohydrate-restricted subjects. A strong correlation between TCA cycle flux and GNGPEP was found, though the reliance on TCA cycle energy production for gluconeogenesis was attenuated in subjects undergoing carbohydrate restriction. Together, these data imply that the TCA cycle is the energetic patron of gluconeogenesis. However, the relationship between these two pathways is modified by carbohydrate restriction, suggesting an increased reliance of the hepatocyte on energy generated outside of the TCA cycle when GNGPEP is maximal. In conclusion, carbohydrate-restriction modifies hepatic gluconeogenesis by increasing reliance on substrates like lactate or amino acids but not glycerol. This modification is associated with a reorganization of hepatic energy metabolism suggestive of enhanced hepatic β-oxidation. PMID:18925642
Stabilizing effect of biochar on soil extracellular enzymes after a denaturing stress
USDA-ARS?s Scientific Manuscript database
Stabilization of extracellular enzymes may maintain enzymatic activity for ecosystem services such as carbon sequestration, nutrient cycling, and bioremediation, while protecting enzymes from proteolysis and denaturation. A laboratory incubation study was conducted to determine whether a fast pyroly...
Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen
2017-01-01
Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.
Potentials for Soil Enzyme as Indicators of Ecological Management
NASA Technical Reports Server (NTRS)
Senwo, Z. N.; Manu, A.; Coleman, T. L.
1997-01-01
Activity measurements of selected soil enzymes (cellulase, glucosidase, amidohydrolase, phosphatase, arylsulfatase) involved in carbon, nitrogen, phosphorus, and sulfur cycling in the biosphere, hold potential as early and sensitive indicators of soil ecological stress and restoration, These measurements are advantageous because the procedures are simple, rapid, and reproducible over time. Enzyme activities are sensitive to short-term changes in soil and kind-use management. Enzyme activities have also been observed to be closely related to soil organic matter proposed as an index of soil quality.
Selected soil enzyme activities in an oak-hickory forest following long-term prescribed burning
M. R. Bayan; F. Eivazi
1993-01-01
The biochemical reactions within the soil are mediated by soil flora and fauna, and are catalyzed by enzymes. Therefore, enzymes play a significant role in nutrient cycling. Enzymes are specific for the type of chemical reactions in which they participate. Arylsulfatase is the enzyme that catalyzes the hydrolysis of an arylsulfate anion by fission of the oxygen-sulfur...
Wang, Wenbing; Wu, Yanqing; Zhang, Chi
2017-03-01
Anaerobic microorganisms were applied to degrade organic contaminants in groundwater with permeable reactive barriers (PRBs). However, anaerobic microorganisms need to select optimal immobilizing material as carrier. The potential of high-density natural luffa sponge (HDLS) (a new variety of luffa) for the immobilization and protection of anaerobic microorganisms was investigated. The HDLS has a dense structure composed of a complicated interwoven fibrous network. Therefore, the abrasion rate of HDLS (0.0068 g s -1 ) was the smallest among the four carriers [HDLS, ordinary natural luffa sponge (OLS), polyurethane sponge (PS), and gel carrier AQUAPOROUSGEL (APG)]. The results suggest that it also had the greatest water retention (10.26 H 2 O-g dry carrier-g -1 ) and SS retention (0.21 g dry carrier-g -1 ). In comparison to well-established commercialized gel carrier APG, HDLS was of much better mechanical strength, hydrophilicity and stability. Microbial-immobilized HDLS also had the best performance for the remediation of 1,1,1-TCA simulated groundwater. Analysis of the clone libraries from microorganism-immobilized HDLS showed the HDLS could protect microorganisms from the toxicity of 1,1,1-TCA and maintain the stability of microbial community diversity. The mechanism of HDLS immobilizing and protecting microorganisms was proposed as follows. The HDLS had a micron-scale honeycomb structure (30-40 μm) and an irregular ravine structure (4-20 μm), which facilitate the immobilization of anaerobic microorganisms and protect the anaerobic microorganisms.
Visser, Franziska; Müller, Boje; Rose, Judith; Prüfer, Dirk; Noll, Gundula A
2016-08-09
The immobilisation of enzymes plays an important role in many applications, including biosensors that require enzyme activity, stability and recyclability in order to function efficiently. Here we show that forisomes (plant-derived mechanoproteins) can be functionalised with enzymes by translational fusion, leading to the assembly of structures designated as forizymes. When forizymes are expressed in the yeast Saccharomyces cerevisiae, the enzymes are immobilised by the self-assembly of forisome subunits to form well-structured protein bodies. We used glucose-6-phosphate dehydrogenase (G6PDH) and hexokinase 2 (HXK2) as model enzymes for the one-step production and purification of catalytically active forizymes. These structures retain the typical stimulus-response reaction of the forisome and the enzyme remains active even after multiple assay cycles, which we demonstrated using G6PDH forizymes as an example. We also achieved the co-incorporation of both HXK2 and G6PDH in a single forizyme, facilitating a two-step reaction cascade that was 30% faster than the coupled reaction using the corresponding enzymes on different forizymes or in solution. Our novel forizyme immobilisation technique therefore not only combines the sensory properties of forisome proteins with the catalytic properties of enzymes but also allows the development of multi-enzyme complexes for incorporation into technical devices.
Chan, Jeannine; Oshiro, Tyler; Thomas, Sarah; Higa, Allyson; Black, Stephen; Todorovic, Aleksandar; Elbarbry, Fawzy
2016-01-01
Human exposure to trans-cinnamic aldehyde [t-CA; cinnamaldehyde; cinnamal; (E)-3-phenylprop-2-enal] is common through diet and through the use of cinnamon powder for diabetes and to provide flavor and scent in commercial products. We evaluated the likelihood of t-CA to influence metabolism by inhibition of P450 enzymes. IC50 values from recombinant enzymes indicated that an interaction is most probable for CYP2A6 (IC50 = 6.1 µM). t-CA was 10.5-fold more selective for human CYP2A6 than for CYP2E1; IC50 values for P450s 1A2, 2B6, 2C9, 2C19, 2D6, and 3A4 were 15.8-fold higher or more. t-CA is a type I ligand for CYP2A6 (KS = 14.9 µM). Inhibition of CYP2A6 by t-CA was metabolism-dependent; inhibition required NADPH and increased with time. Glutathione lessened the extent of inhibition modestly and statistically significantly. The carbon monoxide binding spectrum was dramatically diminished after exposure to NADPH and t-CA, suggesting degradation of the heme or CYP2A6 apoprotein. Using a static model and mechanism-based inhibition parameters (KI = 18.0 µM; kinact = 0.056 minute−1), changes in the area under the concentration-time curve (AUC) for nicotine and letrozole were predicted in the presence of t-CA (0.1 and 1 µM). The AUC fold-change ranged from 1.1 to 3.6. In summary, t-CA is a potential source of pharmacokinetic variability for CYP2A6 substrates due to metabolism-dependent inhibition, especially in scenarios when exposure to t-CA is elevated due to high dietary exposure, or when cinnamon is used as a treatment of specific disease states (e.g., diabetes). PMID:26851241
Substrate-Wrapped, Single-Walled Carbon Nanotube Probes for Hydrolytic Enzyme Characterization.
Kallmyer, Nathaniel E; Musielewicz, Joseph; Sutter, Joel; Reuel, Nigel F
2018-04-17
Hydrolytic enzymes are a topic of continual study and improvement due to their industrial impact and biological implications; however, the ability to measure the activity of these enzymes, especially in high-throughput assays, is limited to an established, few enzymes and often involves the measurement of secondary byproducts or the design of a complex degradation probe. Herein, a versatile single-walled carbon nanotube (SWNT)-based biosensor that is straightforward to produce and measure is described. The hydrolytic enzyme substrate is rendered as an amphiphilic polymer, which is then used to solubilize the hydrophobic nanotubes. When the target enzyme degrades the wrapping, the SWNT fluorescent signal is quenched due to increased solvent accessibility and aggregation, allowing quantitative measurement of hydrolytic enzyme activity. Using (6,5) chiral SWNT suspended with polypeptides and polysaccharides, turnover frequencies are estimated for cellulase, pectinase, and bacterial protease. Responses are recorded for concentrations as low as 5 fM using a well-characterized protease, Proteinase K. An established trypsin-based plate reader assay is used to compare this nanotube probe assay with standard techniques. Furthermore, the effect of freeze-thaw cycles and elevated temperature on enzyme activity is measured, suggesting freezing to have minimal impact even after 10 cycles and heating to be detrimental above 60 °C. Finally, rapid optimization of enzyme operating conditions is demonstrated by generating a response surface of cellulase activity with respect to temperature and pH to determine optimal conditions within 2 h of serial scans.
Ultrasound assisted three phase partitioning of a fibrinolytic enzyme.
Avhad, Devchand N; Niphadkar, Sonali S; Rathod, Virendra K
2014-03-01
The present investigation is aimed at ultrasound assisted three phase partitioning (UATPP) of a fibrinolytic enzyme from Bacillus sphaericus MTCC 3672. Three phase partitioning integrates the concentration and partial purification step of downstream processing of a biomolecule. Three phase system is formed with simultaneous addition of ammonium sulfate to crude broth and followed by t-butanol. UATPP of a fibrinolytic enzyme was studied by varying different process parameters such as ammonium sulfate saturation concentration, pH, broth to t-butanol ratio, temperature, ultrasound frequency, ultrasonication power, and duty cycle. The optimized parameters yielding maximum purity of 16.15-fold of fibrinolytic enzyme with 65% recovery comprised of 80% ammonium sulfate saturation, pH 9, temperature 30 °C, broth to t-butanol ratio 0.5 (v/v), at 25 kHz frequency and 150 W ultrasonication power with 40% duty cycle for 5 min irradiation time. SDS PAGE analysis of partitioned enzyme shows partial purification with a molecular weight in the range of 55-70 kDa. Enhanced mass transfer of UATPP resulted in higher fold purity of fibrinolytic enzyme with reduced time of operation from 1 h to 5 min as compared to conventional TPP. Outcome of our findings highlighted the use of UATPP as an efficient biosepartion technique. Copyright © 2013 Elsevier B.V. All rights reserved.
Watch Out for the "Living Dead": Cell-Free Enzymes and Their Fate.
Baltar, Federico
2017-01-01
Microbes are the engines driving biogeochemical cycles. Microbial extracellular enzymatic activities (EEAs) are the "gatekeepers" of the carbon cycle. The total EEA is the sum of cell-bound (i.e., cell-attached), and dissolved (i.e., cell-free) enzyme activities. Cell-free enzymes make up a substantial proportion (up to 100%) of the total marine EEA. Although we are learning more about how microbial diversity and function (including total EEA) will be affected by environmental changes, little is known about what factors control the importance of the abundant cell-free enzymes. Since cell-attached EEAs are linked to the cell, their fate will likely be linked to the factors controlling the cell's fate. In contrast, cell-free enzymes belong to a kind of "living dead" realm because they are not attached to a living cell but still are able to perform their function away from the cell; and as such, the factors controlling their activity and fate might differ from those affecting cell-attached enzymes. This article aims to place cell-free EEA into the wider context of hydrolysis of organic matter, deal with recent studies assessing what controls the production, activity and lifetime of cell-free EEA, and what their fate might be in response to environmental stressors. This perspective article advocates the need to go "beyond the living things," studying the response of cells/organisms to different stressors, but also to study cell-free enzymes, in order to fully constrain the future and evolution of marine biogeochemical cycles.
Eddhif, Balkis; Guignard, Nadia; Batonneau, Yann; Clarhaut, Jonathan; Papot, Sébastien; Geffroy-Rodier, Claude; Poinot, Pauline
2018-04-01
The data presented here are related to the research paper entitled "Study of a Novel Agent for TCA Precipitated Proteins Washing - Comprehensive Insights into the Role of Ethanol/HCl on Molten Globule State by Multi-Spectroscopic Analyses" (Eddhif et al., submitted for publication) [1]. The suitability of ethanol/HCl for the washing of TCA-precipitated proteins was first investigated on standard solution of HSA, cellulase, ribonuclease and lysozyme. Recoveries were assessed by one-dimensional gel electrophoresis, Bradford assays and UPLC-HRMS. The mechanistic that triggers protein conformational changes at each purification stage was then investigated by Raman spectroscopy and spectrofluorometry. Finally, the efficiency of the method was evaluated on three different complex samples (mouse liver, river biofilm, loamy soil surface). Proteins profiling was assessed by gel electrophoresis and by UPLC-HRMS.
Green, Laura S.; Li, Youzhong; Emerich, David W.; Bergersen, Fraser J.; Day, David A.
2000-01-01
A complete tricarboxylic acid (TCA) cycle is generally considered necessary for energy production from the dicarboxylic acid substrates malate, succinate, and fumarate. However, a Bradyrhizobium japonicum sucA mutant that is missing α-ketoglutarate dehydrogenase is able to grow on malate as its sole source of carbon. This mutant also fixes nitrogen in symbiosis with soybean, where dicarboxylic acids are its principal carbon substrate. Using a flow chamber system to make direct measurements of oxygen consumption and ammonium excretion, we confirmed that bacteroids formed by the sucA mutant displayed wild-type rates of respiration and nitrogen fixation. Despite the absence of α-ketoglutarate dehydrogenase activity, whole cells of the mutant were able to decarboxylate α-[U-14C]ketoglutarate and [U-14C]glutamate at rates similar to those of wild-type B. japonicum, indicating that there was an alternative route for α-ketoglutarate catabolism. Because cell extracts from B. japonicum decarboxylated [U-14C]glutamate very slowly, the γ-aminobutyrate shunt is unlikely to be the pathway responsible for α-ketoglutarate catabolism in the mutant. In contrast, cell extracts from both the wild type and mutant showed a coenzyme A (CoA)-independent α-ketoglutarate decarboxylation activity. This activity was independent of pyridine nucleotides and was stimulated by thiamine PPi. Thin-layer chromatography showed that the product of α-ketoglutarate decarboxylation was succinic semialdehyde. The CoA-independent α-ketoglutarate decarboxylase, along with succinate semialdehyde dehydrogenase, may form an alternative pathway for α-ketoglutarate catabolism, and this pathway may enhance TCA cycle function during symbiotic nitrogen fixation. PMID:10781553
Raman, Babu; Nandakumar, M P; Muthuvijayan, Vignesh; Marten, Mark R
2005-11-05
Proteome analysis was used to compare global protein expression changes in Escherichia coli fermentation between exponential and glucose-limited fed-batch phase. Two-dimensional gel electrophoresis and MALDI-TOF mass spectrometry were used to separate and identify 49 proteins showing >2-fold difference in expression. Proteins upregulated during exponential phase include ribonucleotide biosynthesis enzymes and ribosomal recycling factor. Proteins upregulated during fed-batch phase include those involved in high-affinity glucose uptake, transport and degradation of alternate carbon sources and TCA cycle, suggesting an enhanced role of the cycle under glucose- and energy-limited conditions. We report the upregulation of several putative proteins (ytfQ, ygiS, ynaF, yggX, yfeX), not identified in any previous study under carbon-limited conditions. Copyright (c) 2005 Wiley Periodicals, Inc.
Neill, Meaghan Anne; Aschner, Judy; Barr, Frederick; Summar, Marshall L.
2009-01-01
The urea cycle and nitric oxide cycle play significant roles in complex biochemical and physiologic reactions. These cycles have distinct biochemical goals including the clearance of waste nitrogen; the production of the intermediates ornithine, citrulline, and arginine for the urea cycle; and the production of nitric oxide for the nitric oxide pathway. Despite their disparate functions, the two pathways share two enzymes, argininosuccinic acid synthase and argininosuccinic acid lyase, and a transporter, citrin. Studying the gene expression of these enzymes is paramount in understanding these complex biochemical pathways. Here, we examine the expression of genes involved in the urea cycle and the nitric oxide cycle in a panel of eleven different tissue samples obtained from individual adults without known inborn errors of metabolism. In this study, the pattern of co-expressed enzymes provides a global view of the metabolic activity of the urea and nitric oxide cycles in human tissues. Our results show that these transcripts are differentially expressed in different tissues. The pattern of co-expressed enzymes provides a global view of the metabolic activity of the urea and nitric oxide cycles in human tissues. Using the co-expression profiles, we discovered that the combination of expression of enzyme transcripts as detected in our study, might serve to fulfill specific physiologic function(s) in tissue including urea production/nitrogen removal, arginine/citrulline production, nitric oxide production, and ornithine production. Our study reveals the importance of studying not only the expression profile of an enzyme of interest, but also studying the expression profiles of the other enzymes involved in a particular pathway so as to better understand the context of expression. The tissue patterns we observed highlight the variety of important functions they conduct and provide insight into many of the clinical observations from their disruption. PMID:19345634
Contrasting features of urea cycle disorders in human patients and knockout mouse models.
Deignan, Joshua L; Cederbaum, Stephen D; Grody, Wayne W
2008-01-01
The urea cycle exists for the removal of excess nitrogen from the body. Six separate enzymes comprise the urea cycle, and a deficiency in any one of them causes a urea cycle disorder (UCD) in humans. Arginase is the only urea cycle enzyme with an alternate isoform, though no known human disorder currently exists due to a deficiency in the second isoform. While all of the UCDs usually present with hyperammonemia in the first few days to months of life, most disorders are distinguished by a characteristic profile of plasma amino acid alterations that can be utilized for diagnosis. While enzyme assay is possible, an analysis of the underlying mutation is preferable for an accurate diagnosis. Mouse models for each of the urea cycle disorders exist (with the exception of NAGS deficiency), and for almost all of them, their clinical and biochemical phenotypes rather closely resemble the phenotypes seen in human patients. Consequently, all of the current mouse models are highly useful for future research into novel pharmacological and dietary treatments and gene therapy protocols for the management of urea cycle disorders.
NASA Astrophysics Data System (ADS)
Hoang Thi Thu, Duyen; Razavi, Bahar S.
2016-04-01
Earthworms boost microbial activities and consequently form hotspots in soil. The distribution of enzyme activities inside the earthworm biopores is completely unknown. For the first time, we analyzed enzyme kinetics and visualized enzyme distribution inside and outside biopores by in situ soil zymography. Kinetic parameters (Vmax and Km) of 6 enzymes β-glucosidase (GLU), cellobiohydrolase (CBH), xylanase (XYL), chitinase (NAG), leucine aminopeptidase (LAP) and acid phosphatase (APT) were determined in biopores formed by Lumbricus terrestris L.. The spatial distributions of GLU, NAG and APT become visible via zymograms in comparison between earthworm-inhabited and earthworm-free soil. Zymography showed heterogeneous distribution of hotspots in the rhizosphere and biopores. The hotspot areas were 2.4 to 14 times larger in the biopores than in soil without earthworms. The significantly higher Vmax values for GLU, CBH, XYL, NAG and APT in biopores confirmed the stimulation of enzyme activities by earthworms. For CBH, XYL and NAG, the 2- to 3-fold higher Km values in biopores indicated different enzyme systems with lower substrate affinity compared to control soil. The positive effects of earthworms on Vmax were cancelled by the Km increase for CBH, XYL and NAG at a substrate concentration below 20 μmol g-1 soil. The change of enzyme systems reflected a shift in dominant microbial populations toward species with lower affinity to holo-celluloses and to N-acetylglucosamine, and with higher affinity to proteins as compared to the biopores-free soil. We conclude that earthworm biopores are microbial hotspots with much higher and dense distribution of enzyme activities compared to bulk soil. References Spohn M, Kuzyakov Y. (2014) Spatial and temporal dynamics of hotspots of enzyme activity in soil as affected by living and dead roots - a soil zymography analysis, Plant Soil 379: 67-77. Blagodatskaya, E., Kuzyakov, Y., 2013. Review paper: Active microorganisms in soil
A new MicroTCA-based waveform digitizer for the Muon g-2 experiment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sweigart, David A.
We present the design of a newmore » $$\\mu$$TCA-based waveform digitizer, which will be deployed in the Muon g-2 experiment at Fermilab and will allow our pileup identification requirement to be met. This digitizer features five independent channels, each with 12-bit, 800-MSPS digitization and a 1-Gbit memory buffer. The data storage and readout along with configuration are handled by six Xilinx Kintex-7 FPGAs. In addition, the digitizer is equipped with a mezzanine card for analog signal conditioning prior to digitization, further widening its range of possible applications. The performance results of this design are also presented, highlighting its $$0.51 \\pm 0.13$$ mV intrinsic noise level and $< 22$ ps intrinsic timing resolution between channels. We believe that its performance, together with its flexible design, could be of interest to future experiments in search of a cost-effective waveform digitizer.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aklujkar, Muktak; Haveman, Shelley; DiDonatoJr, Raymond
2012-01-01
Background: The bacterium Pelobacter carbinolicus is able to grow by fermentation, syntrophic hydrogen/formate transfer, or electron transfer to sulfur from short-chain alcohols, hydrogen or formate; it does not oxidize acetate and is not known to ferment any sugars or grow autotrophically. The genome of P. carbinolicus was sequenced in order to understand its metabolic capabilities and physiological features in comparison with its relatives, acetate-oxidizing Geobacter species. Results: Pathways were predicted for catabolism of known substrates: 2,3-butanediol, acetoin, glycerol, 1,2-ethanediol, ethanolamine, choline and ethanol. Multiple isozymes of 2,3-butanediol dehydrogenase, ATP synthase and [FeFe]-hydrogenase were differentiated and assigned roles according to theirmore » structural properties and genomic contexts. The absence of asparagine synthetase and the presence of a mutant tRNA for asparagine encoded among RNA-active enzymes suggest that P. carbinolicus may make asparaginyl-tRNA in a novel way. Catabolic glutamate dehydrogenases were discovered, implying that the tricarboxylic acid (TCA) cycle can function catabolically. A phosphotransferase system for uptake of sugars was discovered, along with enzymes that function in 2,3-butanediol production. Pyruvate: ferredoxin/flavodoxin oxidoreductase was identified as a potential bottleneck in both the supply of oxaloacetate for oxidation of acetate by the TCA cycle and the connection of glycolysis to production of ethanol. The P. carbinolicus genome was found to encode autotransporters and various appendages, including three proteins with similarity to the geopilin of electroconductive nanowires. Conclusions: Several surprising metabolic capabilities and physiological features were predicted from the genome of P. carbinolicus, suggesting that it is more versatile than anticipated.« less
Introduction to the Glutamate-Glutamine Cycle.
Sonnewald, Ursula; Schousboe, Arne
2016-01-01
The term 'glutamate-glutamine cycle' was coined several decades ago based on the observation that using certain 14 C-labeled precursors for studies of brain metabolism the specific radioactivity of glutamine generated from glutamate was higher than that of glutamate, its immediate precursor. This is metabolically impossible unless it is assumed that at least two distinct pools of these amino acids exist. This combined with the finding that the enzyme synthesizing glutamine from glutamate was expressed in astrocytes but not in neurons formed the basis of the notion that a cycle must exist in which glutamate released from neurons is transported into astrocytes, converted to glutamine which is subsequently returned to neurons and converted to glutamate by an enzyme the activity of which is much higher in neurons than in astrocytes. Originally this cycle was supposed to function in a stoichiometric fashion but more recent research has seriously questioned this.This volume of Advances in Neurobiology is intended to provide a detailed discussion of recent developments in research aimed at delineating the functional roles of the cycle taking into account that in order for this system to work there must be a tight coupling between metabolism of glutamate in astrocytes, transfer of glutamine to neurons and de novo synthesis of glutamine in astrocytes. To understand this, knowledge about the activity and regulation of the enzymes and transporters involved in these processes is required and as can be seen from the table of contents these issues will be dealt with in detail in the individual chapters of the book.
Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli.
Whitaker, W Brian; Jones, J Andrew; Bennett, R Kyle; Gonzalez, Jacqueline E; Vernacchio, Victoria R; Collins, Shannon M; Palmer, Michael A; Schmidt, Samuel; Antoniewicz, Maciek R; Koffas, Mattheos A; Papoutsakis, Eleftherios T
2017-01-01
Methanol is an attractive substrate for biological production of chemicals and fuels. Engineering methylotrophic Escherichia coli as a platform organism for converting methanol to metabolites is desirable. Prior efforts to engineer methylotrophic E. coli were limited by methanol dehydrogenases (Mdhs) with unfavorable enzyme kinetics. We engineered E. coli to utilize methanol using a superior NAD-dependent Mdh from Bacillus stearothermophilus and ribulose monophosphate (RuMP) pathway enzymes from B. methanolicus. Using 13 C-labeling, we demonstrate this E. coli strain converts methanol into biomass components. For example, the key TCA cycle intermediates, succinate and malate, exhibit labeling up to 39%, while the lower glycolytic intermediate, 3-phosphoglycerate, up to 53%. Multiple carbons are labeled for each compound, demonstrating a cycling RuMP pathway for methanol assimilation to support growth. By incorporating the pathway to synthesize the flavanone naringenin, we demonstrate the first example of in vivo conversion of methanol into a specialty chemical in E. coli. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Vaishlya, O. B.; Osipov, N. N.; Guseva, N. V.
2015-09-01
We conducted pre-sowing seed treatment of spring wheat carbon nanotubes modified with thionyl chloride, ethylene diamine, azobenzole, and dodecylamine. CNTs did not disrupt the structure of the crop, but the activity of extracellular enzymes in the rhizosphere of plants in the flowering stage changed: laccase works more poorly in the variant of the CNTs with the amino groups exochitinase and phosphatase activity increased in the case of chlorinated CNTs, OH and COOH groups on the surface of the nanotubes twice accelerate work β-glucosidase. The changes observed in the biogeochemical cycles in the rhizosphere are a possible cause of the effect of nanotubes on the development of epidemic diseases of wheat.
Wu, Fei; Minteer, Shelley
2015-02-02
It has been hypothesized that the high metabolic flux in the mitochondria is due to the self-assembly of enzyme supercomplexes (called metabolons) that channel substrates from one enzyme to another, but there has been no experimental confirmation of this structure or the channeling. A structural investigation of enzyme organization within the Krebs cycle metabolon was accomplished by in vivo cross-linking and mass spectrometry. Eight Krebs cycle enzyme components were isolated upon chemical fixation, and interfacial residues between mitochondrial malate dehydrogenase, citrate synthase, and aconitase were identified. Using constraint protein docking, a low-resolution structure for the three-enzyme complex was achieved, as well as the two-fold symmetric octamer. Surface analysis showed formation of electrostatic channeling upon protein-protein association, which is the first structural evidence of substrate channeling in the Krebs cycle metabolon. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rumpho, Mary E.; Pochareddy, Sirisha; Worful, Jared M.; Summer, Elizabeth J.; Bhattacharya, Debashish; Pelletreau, Karen N.; Tyler, Mary S.; Lee, Jungho; Manhart, James R.; Soule, Kara M.
2009-01-01
Phosphoribulokinase (PRK), a nuclear-encoded plastid-localized enzyme unique to the photosynthetic carbon reduction (Calvin) cycle, was cloned and characterized from the stramenopile alga Vaucheria litorea. This alga is the source of plastids for the mollusc (sea slug) Elysia chlorotica which enable the animal to survive for months solely by photoautotrophic CO2 fixation. The 1633-bp V. litorea prk gene was cloned and the coding region, found to be interrupted by four introns, encodes a 405-amino acid protein. This protein contains the typical bipartite target sequence expected of nuclear-encoded proteins that are directed to complex (i.e. four membrane-bound) algal plastids. De novo synthesis of PRK and enzyme activity were detected in E. chlorotica in spite of having been starved of V. litorea for several months. Unlike the algal enzyme, PRK in the sea slug did not exhibit redox regulation. Two copies of partial PRK-encoding genes were isolated from both sea slug and aposymbiotic sea slug egg DNA using PCR. Each copy contains the nucleotide region spanning exon 1 and part of exon 2 of V. litorea prk, including the bipartite targeting peptide. However, the larger prk fragment also includes intron 1. The exon and intron sequences of prk in E. chlorotica and V. litorea are nearly identical. These data suggest that PRK is differentially regulated in V. litorea and E. chlorotica and at least a portion of the V. litorea nuclear PRK gene is present in sea slugs that have been starved for several months. PMID:19995736
Watch Out for the “Living Dead”: Cell-Free Enzymes and Their Fate
Baltar, Federico
2018-01-01
Microbes are the engines driving biogeochemical cycles. Microbial extracellular enzymatic activities (EEAs) are the “gatekeepers” of the carbon cycle. The total EEA is the sum of cell-bound (i.e., cell-attached), and dissolved (i.e., cell-free) enzyme activities. Cell-free enzymes make up a substantial proportion (up to 100%) of the total marine EEA. Although we are learning more about how microbial diversity and function (including total EEA) will be affected by environmental changes, little is known about what factors control the importance of the abundant cell-free enzymes. Since cell-attached EEAs are linked to the cell, their fate will likely be linked to the factors controlling the cell’s fate. In contrast, cell-free enzymes belong to a kind of “living dead” realm because they are not attached to a living cell but still are able to perform their function away from the cell; and as such, the factors controlling their activity and fate might differ from those affecting cell-attached enzymes. This article aims to place cell-free EEA into the wider context of hydrolysis of organic matter, deal with recent studies assessing what controls the production, activity and lifetime of cell-free EEA, and what their fate might be in response to environmental stressors. This perspective article advocates the need to go “beyond the living things,” studying the response of cells/organisms to different stressors, but also to study cell-free enzymes, in order to fully constrain the future and evolution of marine biogeochemical cycles. PMID:29354095
Mitchell, Sabrina; Ellingson, Clint; Coyne, Thomas; Hall, Lynn; Neill, Meaghan; Christian, Natalie; Higham, Catherine; Dobrowolski, Steven F; Tuchman, Mendel; Summar, Marshall
2009-01-01
The urea cycle is the primary means of nitrogen metabolism in humans and other ureotelic organisms. There are five key enzymes in the urea cycle: carbamoyl-phosphate synthetase 1 (CPS1), ornithine transcarbamylase (OTC), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase 1 (ARG1). Additionally, a sixth enzyme, N-acetylglutamate synthase (NAGS), is critical for urea cycle function, providing CPS1 with its necessary cofactor. Deficiencies in any of these enzymes result in elevated blood ammonia concentrations, which can have detrimental effects, including central nervous system dysfunction, brain damage, coma, and death. Functional variants, which confer susceptibility for disease or dysfunction, have been described for enzymes within the cycle; however, a comprehensive screen of all the urea cycle enzymes has not been performed. We examined the exons and intron/exon boundaries of the five key urea cycle enzymes, NAGS, and two solute carrier transporter genes (SLC25A13 and SLC25A15) for sequence alterations using single-stranded conformational polymorphism (SSCP) analysis and high-resolution melt profiling. SSCP was performed on a set of DNA from 47 unrelated North American individuals with a mixture of ethnic backgrounds. High-resolution melt profiling was performed on a nonoverlapping DNA set of either 47 or 100 unrelated individuals with a mixture of backgrounds. We identified 33 unarchived polymorphisms in this screen that potentially play a role in the variation observed in urea cycle function. Screening all the genes in the pathway provides a catalog of variants that can be used in investigating candidate diseases. Copyright 2008 Wiley-Liss, Inc.
Perchat, Nadia; Saaidi, Pierre-Loïc; Darii, Ekaterina; Pellé, Christine; Petit, Jean-Louis; Besnard-Gonnet, Marielle; de Berardinis, Véronique; Dupont, Maeva; Gimbernat, Alexandra; Salanoubat, Marcel; Fischer, Cécile; Perret, Alain
2018-05-08
Trigonelline (TG; N- methylnicotinate) is a ubiquitous osmolyte. Although it is known that it can be degraded, the enzymes and metabolites have not been described so far. In this work, we challenged the laboratory model soil-borne, gram-negative bacterium Acinetobacter baylyi ADP1 (ADP1) for its ability to grow on TG and we identified a cluster of catabolic, transporter, and regulatory genes. We dissected the pathway to the level of enzymes and metabolites, and proceeded to in vitro reconstruction of the complete pathway by six purified proteins. The four enzymatic steps that lead from TG to methylamine and succinate are described, and the structures of previously undescribed metabolites are provided. Unlike many aromatic compounds that undergo hydroxylation prior to ring cleavage, the first step of TG catabolism proceeds through direct cleavage of the C5-C6 bound, catalyzed by a flavin-dependent, two-component oxygenase, which yields ( Z )-2-(( N- methylformamido)methylene)-5-hydroxy-butyrolactone (MFMB). MFMB is then oxidized into ( E )-2-(( N- methylformamido) methylene) succinate (MFMS), which is split up by a hydrolase into carbon dioxide, methylamine, formic acid, and succinate semialdehyde (SSA). SSA eventually fuels up the TCA by means of an SSA dehydrogenase, assisted by a Conserved Hypothetical Protein. The cluster is conserved across marine, soil, and plant-associated bacteria. This emphasizes the role of TG as a ubiquitous nutrient for which an efficient microbial catabolic toolbox is available.
Pedagogical view of model metabolic cycles.
García-Herrero, Victor; Sillero, Antonio
2015-01-01
The main purpose of this study was to present a simplified view of model metabolic cycles. Although the models have been elaborated with the Mathematica Program, and using a system of differential equations, the main conclusions were presented in a rather intuitive way, easily understandable by students of general courses of Biochemistry, and without any need of mathematical support. A change in any kinetic constant (Km or Vmax) of only one enzyme affected the metabolic profile of all the substrates of the cycle. In addition, it is shown how an increase in the Km or a decrease in the Vmax values of any particular enzyme promoted an increase of its substrate; the contrary occurred decreasing the Km or increasing the Vmax values. © 2015 The International Union of Biochemistry and Molecular Biology.
Contrasting Features of Urea Cycle Disorders in Human Patients and Knockout Mouse Models
Deignan, Joshua L.; Cederbaum, Stephen D.; Grody, Wayne W.
2009-01-01
The urea cycle exists for the removal of excess nitrogen from the body. Six separate enzymes comprise the urea cycle, and a deficiency in any one of them causes a urea cycle disorder (UCD) in humans. Arginase is the only urea cycle enzyme with an alternate isoform, though no known human disorder currently exists due to a deficiency in the second isoform. While all of the UCDs usually present with hyperammonemia in the first few days to months of life, most disorders are distinguished by a characteristic profile of plasma amino acid alterations that can be utilized for diagnosis. While enzyme assay is possible, an analysis of the underlying mutation is preferable for an accurate diagnosis. Mouse models for each of the urea cycle disorders exist (with the exception of NAGS deficiency), and for almost all of them, their clinical and biochemical phenotypes rather closely resemble the phenotypes seen in human patients. Consequently, all of the current mouse models are highly useful for future research into novel pharmacological and dietary treatments and gene therapy protocols for the management of urea cycle disorders. PMID:17933574
Sengupta, Prabuddha; Satpute-Krishnan, Prasanna; Seo, Arnold Y.; Burnette, Dylan T.; Patterson, George H.; Lippincott-Schwartz, Jennifer
2015-01-01
Whether Golgi enzymes remain localized within the Golgi or constitutively cycle through the endoplasmic reticulum (ER) is unclear, yet is important for understanding Golgi dependence on the ER. Here, we demonstrate that the previously reported inefficient ER trapping of Golgi enzymes in a rapamycin-based assay results from an artifact involving an endogenous ER-localized 13-kD FK506 binding protein (FKBP13) competing with the FKBP12-tagged Golgi enzyme for binding to an FKBP-rapamycin binding domain (FRB)-tagged ER trap. When we express an FKBP12-tagged ER trap and FRB-tagged Golgi enzymes, conditions precluding such competition, the Golgi enzymes completely redistribute to the ER upon rapamycin treatment. A photoactivatable FRB-Golgi enzyme, highlighted only in the Golgi, likewise redistributes to the ER. These data establish Golgi enzymes constitutively cycle through the ER. Using our trapping scheme, we identify roles of rab6a and calcium-independent phospholipase A2 (iPLA2) in Golgi enzyme recycling, and show that retrograde transport of Golgi membrane underlies Golgi dispersal during microtubule depolymerization and mitosis. PMID:26598700
Rockwell, N C; Fuller, R S
2001-10-19
Kex2 protease from Saccharomyces cerevisiae is the prototype for a family of eukaryotic proprotein processing proteases belonging to the subtilase superfamily of serine proteases. Kex2 can be distinguished from degradative subtilisins on the basis of stringent substrate specificity and distinct pre-steady-state behavior. To better understand these mechanistic differences, we have examined the effects of substrate residues at P(1) and P(4) on individual steps in the Kex2 catalytic cycle with a systematic series of isosteric peptidyl amide and ester substrates. The results demonstrate that substrates based on known, physiological cleavage sites exhibit high acylation rates (> or =550 s(-1)) with Kex2. Substitution of Lys for the physiologically correct Arg at P(1) resulted in a > or =200-fold drop in acylation rate with almost no apparent effect on binding or deacylation. In contrast, substitution of the physiologically incorrect Ala for Nle at P(4) resulted in a much smaller defect in acylation and a modest but significant effect on binding with Lys at P(1). This substitution also had no effect on deacylation. These results demonstrate that Kex2 utilizes enzyme-substrate interactions in different ways at different steps in the catalytic cycle, with the S(1)-P(1) contact providing a key specificity determinant at the acylation step.
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis
Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F.; Lane, Andrew N.; Romick-Rosendale, Lindsey E.; Wells, Susanne I.
2017-01-01
The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth. PMID:28558019
Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis.
Matrka, Marie C; Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F; Lane, Andrew N; Romick-Rosendale, Lindsey E; Wells, Susanne I
2017-01-01
The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth.
A cell-free framework for rapid biosynthetic pathway prototyping and enzyme discovery.
Karim, Ashty S; Jewett, Michael C
2016-07-01
Speeding up design-build-test (DBT) cycles is a fundamental challenge facing biochemical engineering. To address this challenge, we report a new cell-free protein synthesis driven metabolic engineering (CFPS-ME) framework for rapid biosynthetic pathway prototyping. In our framework, cell-free cocktails for synthesizing target small molecules are assembled in a mix-and-match fashion from crude cell lysates either containing selectively enriched pathway enzymes from heterologous overexpression or directly producing pathway enzymes in lysates by CFPS. As a model, we apply our approach to n-butanol biosynthesis showing that Escherichia coli lysates support a highly active 17-step CoA-dependent n-butanol pathway in vitro. The elevated degree of flexibility in the cell-free environment allows us to manipulate physiochemical conditions, access enzymatic nodes, discover new enzymes, and prototype enzyme sets with linear DNA templates to study pathway performance. We anticipate that CFPS-ME will facilitate efforts to define, manipulate, and understand metabolic pathways for accelerated DBT cycles without the need to reengineer organisms. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Genetic alterations in Krebs cycle and its impact on cancer pathogenesis.
Sajnani, Karishma; Islam, Farhadul; Smith, Robert Anthony; Gopalan, Vinod; Lam, Alfred King-Yin
2017-04-01
Cancer cells exhibit alterations in many cellular processes, including oxygen sensing and energy metabolism. Glycolysis in non-oxygen condition is the main energy production process in cancer rather than mitochondrial respiration as in benign cells. Genetic and epigenetic alterations of Krebs cycle enzymes favour the shift of cancer cells from oxidative phosphorylation to anaerobic glycolysis. Mutations in genes encoding aconitase, isocitrate dehydrogenase, succinate dehydrogenase, fumarate hydratase, and citrate synthase are noted in many cancers. Abnormalities of Krebs cycle enzymes cause ectopic production of Krebs cycle intermediates (oncometabolites) such as 2-hydroxyglutarate, and citrate. These oncometabolites stabilize hypoxia inducible factor 1 (HIF1), nuclear factor like 2 (Nrf2), inhibit p53 and prolyl hydroxylase 3 (PDH3) activities as well as regulate DNA/histone methylation, which in turn activate cell growth signalling. They also stimulate increased glutaminolysis, glycolysis and production of reactive oxygen species (ROS). Additionally, genetic alterations in Krebs cycle enzymes are involved with increased fatty acid β-oxidations and epithelial mesenchymal transition (EMT) induction. These altered phenomena in cancer could in turn promote carcinogenesis by stimulating cell proliferation and survival. Overall, epigenetic and genetic changes of Krebs cycle enzymes lead to the production of oncometabolite intermediates, which are important driving forces of cancer pathogenesis and progression. Understanding and applying the knowledge of these mechanisms opens new therapeutic options for patients with cancer. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Santa, Cátia; Anjo, Sandra I; Manadas, Bruno
2016-07-01
Proteomic approaches are extremely valuable in many fields of research, where mass spectrometry methods have gained an increasing interest, especially because of the ability to perform quantitative analysis. Nonetheless, sample preparation prior to mass spectrometry analysis is of the utmost importance. In this work, two protein precipitation approaches, widely used for cleaning and concentrating protein samples, were tested and compared in very diluted samples solubilized in a strong buffer (containing SDS). The amount of protein recovered after acetone and TCA/acetone precipitation was assessed, as well as the protein identification and relative quantification by SWATH-MS yields were compared with the results from the same sample without precipitation. From this study, it was possible to conclude that in the case of diluted samples in denaturing buffers, the use of cold acetone as precipitation protocol is more favourable than the use of TCA/acetone in terms of reproducibility in protein recovery and number of identified and quantified proteins. Furthermore, the reproducibility in relative quantification of the proteins is even higher in samples precipitated with acetone compared with the original sample. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Takahashi, Shoko; Saito, Kenji; Jia, Huijuan; Kato, Hisanori
2014-01-01
Many epidemiological studies have indicated that coffee consumption may reduce the risks of developing obesity and diabetes, but the underlying mechanisms of these effects are poorly understood. Our previous study revealed the changes on gene expression profiles in the livers of C57BL/6J mice fed a high-fat diet containing three types of coffee (caffeinated, decaffeinated and green unroasted coffee), using DNA microarrays. The results revealed remarkable alterations in lipid metabolism-related molecules which may be involved in the anti-obesity effects of coffee. We conducted the present study to further elucidate the metabolic alterations underlying the effects of coffee consumption through comprehensive proteomic and metabolomic analyses. Proteomics revealed an up-regulation of isocitrate dehydrogenase (a key enzyme in the TCA cycle) and its related proteins, suggesting increased energy generation. The metabolomics showed an up-regulation of metabolites involved in the urea cycle, with which the transcriptome data were highly consistent, indicating accelerated energy expenditure. The TCA cycle and the urea cycle are likely be accelerated in a concerted manner, since they are directly connected by mutually providing each other's intermediates. The up-regulation of these pathways might result in a metabolic shift causing increased ATP turnover, which is related to the alterations of lipid metabolism. This mechanism may play an important part in the suppressive effects of coffee consumption on obesity, inflammation, and hepatosteatosis. This study newly revealed global metabolic alterations induced by coffee intake, providing significant insights into the association between coffee intake and the prevention of type 2 diabetes, utilizing the benefits of multi-omics analyses. PMID:24618914
PEPCK Coordinates the Regulation of Central Carbon Metabolism to Promote Cancer Cell Growth.
Montal, Emily D; Dewi, Ruby; Bhalla, Kavita; Ou, Lihui; Hwang, Bor Jang; Ropell, Ashley E; Gordon, Chris; Liu, Wan-Ju; DeBerardinis, Ralph J; Sudderth, Jessica; Twaddel, William; Boros, Laszlo G; Shroyer, Kenneth R; Duraisamy, Sekhar; Drapkin, Ronny; Powers, R Scott; Rohde, Jason M; Boxer, Matthew B; Wong, Kwok-Kin; Girnun, Geoffrey D
2015-11-19
Phosphoenolpyruvate carboxykinase (PEPCK) is well known for its role in gluconeogenesis. However, PEPCK is also a key regulator of TCA cycle flux. The TCA cycle integrates glucose, amino acid, and lipid metabolism depending on cellular needs. In addition, biosynthetic pathways crucial to tumor growth require the TCA cycle for the processing of glucose and glutamine derived carbons. We show here an unexpected role for PEPCK in promoting cancer cell proliferation in vitro and in vivo by increasing glucose and glutamine utilization toward anabolic metabolism. Unexpectedly, PEPCK also increased the synthesis of ribose from non-carbohydrate sources, such as glutamine, a phenomenon not previously described. Finally, we show that the effects of PEPCK on glucose metabolism and cell proliferation are in part mediated via activation of mTORC1. Taken together, these data demonstrate a role for PEPCK that links metabolic flux and anabolic pathways to cancer cell proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.
Glutamate and asparagine cataplerosis underlie glutamine addiction in melanoma
Ratnikov, Boris; Aza-Blanc, Pedro; Ronai, Ze'ev A.; Smith, Jeffrey W.; Osterman, Andrei L.; Scott, David A.
2015-01-01
Glutamine dependence is a prominent feature of cancer metabolism, and here we show that melanoma cells, irrespective of their oncogenic background, depend on glutamine for growth. A quantitative audit of how carbon from glutamine is used showed that TCA-cycle-derived glutamate is, in most melanoma cells, the major glutamine-derived cataplerotic output and product of glutaminolysis. In the absence of glutamine, TCA cycle metabolites were liable to depletion through aminotransferase-mediated α-ketoglutarate-to-glutamate conversion and glutamate secretion. Aspartate was an essential cataplerotic output, as melanoma cells demonstrated a limited capacity to salvage external aspartate. Also, the absence of asparagine increased the glutamine requirement, pointing to vulnerability in the aspartate-asparagine biosynthetic pathway within melanoma metabolism. In contrast to melanoma cells, melanocytes could grow in the absence of glutamine. Melanocytes use more glutamine for protein synthesis rather than secreting it as glutamate and are less prone to loss of glutamate and TCA cycle metabolites when starved of glutamine. PMID:25749035
Wu, J L; Wu, Q P; Huang, J M; Chen, R; Cai, M; Tan, J B
2007-01-01
L-malate, a tricarboxylic acid cycle (TCA) intermediate, plays an important role in transporting NADH from cytosol to mitochondria for energy production and may be involved in the beneficial effects of improving physical stamina. In the present study, we investigated the effects of L-malate on the performance of forced swimming time and blood biochemical parameters related to fatigue - blood urea nitrogen (BUN), glucose (Glc), creatine kinase (CK),total protein (TP) and lactic acid (LA). To investigate the effects of L-malate on the malate-aspartate shuttle and energy metabolism in mice, the activities of enzymes related to the malate-aspartate shuttle were measured. L-malate was orally administered to mice continuously for 30 days using a feeding atraumatic needle. The swimming time was increased by 26.1 % and 28.5 %, respectively, in the 0.210 g/kg and 0.630 g/kg L-malate-treated group compared with the control group. There were no differences in the concentrations of Glc, BUN and TP between the L-malate-treated groups and the control groups. However, the levels of CK were significantly decreased in the L-malate-treated groups. The results predict a potential benefit of L-malate for improving physical stamina and minimizing muscle damage during swimming exercise. The activities of cytosolic and mitochondrial malate dehydrogenase were significantly elevated in the L-malate-treated group compared with the control group. These enzymatic activities may be useful indicators for evaluating changes affecting the malate-aspartate shuttle and energy metabolism in the liver of mice.
Insa, S; Anticó, E; Ferreira, V
2005-09-30
A reliable solid-phase extraction (SPE) method for the simultaneous determination of 2,4,6-trichloroanisole (TCA) and 2,4,6-tribromoanisole (TBA) in wines has been developed. In the proposed procedure 50 mL of wine are extracted in a 1 mL cartridge filled with 50 mg of LiChrolut EN resins. Most wine volatiles are washed up with 12.5 mL of a water:methanol solution (70%, v/v) containing 1% of NaHCO3. Analytes are further eluted with 0.6 mL of dichloromethane. A 40 microL aliquot of this extract is directly injected into a PTV injector operated in the solvent split mode, and analysed by gas chromatography (GC)-ion trap mass spectrometry using the selected ion storage mode. The solid-phase extraction, including sample volume and rinsing and elution solvents, and the large volume GC injection have been carefully evaluated and optimized. The resulting method is precise (RSD (%) < 6% at 100 ng L(-1)), sensitive (LOD were 0.2 and 0.4 ng/L for TCA and TBA, respectively), robust (the absolute recoveries of both analytes are higher than 80% and consistent wine to wine) and friendly to the GC-MS system (the extract is clean, simple and free from non-volatiles).
Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego
2014-01-01
(+)-limonene is a lipophilic antimicrobial compound, extracted from citrus fruits' essential oils, that is used as a flavouring agent and organic solvent by the food industry. A recent study has proposed a common and controversial mechanism of cell death for bactericidal antibiotics, in which hydroxyl radicals ultimately inactivated cells. Our objective was to determine whether the mechanism of Escherichia coli MG1655 inactivation by (+)-limonene follows that of bactericidal antibiotics. A treatment with 2,000 μL/L (+)-limonene inactivated 4 log10 cycles of exponentially growing E. coli cells in 3 hours. On one hand, an increase of cell survival in the ΔacnB mutant (deficient in a TCA cycle enzyme), or in the presence of 2,2′-dipyridyl (inhibitor of Fenton reaction by iron chelation), thiourea, or cysteamine (hydroxyl radical scavengers) was observed. Moreover, the ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) was more sensitive to (+)-limonene. Thus, this indirect evidence indicates that the mechanism of exponentially growing E. coli cells inactivation by 2,000 μL/L (+)-limonene is due to the TCA cycle and Fenton-mediated hydroxyl radical formation that caused oxidative DNA damage, as observed for bactericidal drugs. However, several differences have been observed between the proposed mechanism for bactericidal drugs and for (+)-limonene. In this regard, our results demonstrated that E. coli inactivation was influenced by its physiological state and the drug's concentration: experiments with stationary-phase cells or 4,000 μL/L (+)-limonene uncovered a different mechanism of cell death, likely unrelated to hydroxyl radicals. Our research has also shown that drug's concentration is an important factor influencing the mechanism of bacterial inactivation by antibiotics, such as kanamycin. These results might help in improving and spreading the use of (+)-limonene as an antimicrobial compound, and in clarifying the controversy
Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego
2014-01-01
(+)-limonene is a lipophilic antimicrobial compound, extracted from citrus fruits' essential oils, that is used as a flavouring agent and organic solvent by the food industry. A recent study has proposed a common and controversial mechanism of cell death for bactericidal antibiotics, in which hydroxyl radicals ultimately inactivated cells. Our objective was to determine whether the mechanism of Escherichia coli MG1655 inactivation by (+)-limonene follows that of bactericidal antibiotics. A treatment with 2,000 μL/L (+)-limonene inactivated 4 log10 cycles of exponentially growing E. coli cells in 3 hours. On one hand, an increase of cell survival in the ΔacnB mutant (deficient in a TCA cycle enzyme), or in the presence of 2,2'-dipyridyl (inhibitor of Fenton reaction by iron chelation), thiourea, or cysteamine (hydroxyl radical scavengers) was observed. Moreover, the ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) was more sensitive to (+)-limonene. Thus, this indirect evidence indicates that the mechanism of exponentially growing E. coli cells inactivation by 2,000 μL/L (+)-limonene is due to the TCA cycle and Fenton-mediated hydroxyl radical formation that caused oxidative DNA damage, as observed for bactericidal drugs. However, several differences have been observed between the proposed mechanism for bactericidal drugs and for (+)-limonene. In this regard, our results demonstrated that E. coli inactivation was influenced by its physiological state and the drug's concentration: experiments with stationary-phase cells or 4,000 μL/L (+)-limonene uncovered a different mechanism of cell death, likely unrelated to hydroxyl radicals. Our research has also shown that drug's concentration is an important factor influencing the mechanism of bacterial inactivation by antibiotics, such as kanamycin. These results might help in improving and spreading the use of (+)-limonene as an antimicrobial compound, and in clarifying the controversy about
Dong, Haifeng; Meng, Xiangdan; Dai, Wenhao; Cao, Yu; Lu, Huiting; Zhou, Shufeng; Zhang, Xueji
2015-04-21
Herein, a highly sensitive and selective microRNA (miRNA) detection strategy using DNA-bio-bar-code amplification (BCA) and Nb·BbvCI nicking enzyme-assisted strand cycle for exponential signal amplification was designed. The DNA-BCA system contains a locked nucleic acid (LNA) modified DNA probe for improving hybridization efficiency, while a signal reported molecular beacon (MB) with an endonuclease recognition site was designed for strand cycle amplification. In the presence of target miRNA, the oligonucleotides functionalized magnetic nanoprobe (MNP-DNA) and gold nanoprobe (AuNP-DNA) with numerous reported probes (RP) can hybridize with target miRNA, respectively, to form a sandwich structure. After sandwich structures were separated from the solution by the magnetic field, the RP were released under high temperature to recognize the MB and cleaved the hairpin DNA to induce the dissociation of RP. The dissociated RP then triggered the next strand cycle to produce exponential fluorescent signal amplification for miRNA detection. Under optimized conditions, the exponential signal amplification system shows a good linear range of 6 orders of magnitude (from 0.3 pM to 3 aM) with limit of detection (LOD) down to 52.5 zM, while the sandwich structure renders the system with high selectivity. Meanwhile, the feasibility of the proposed strategy for cell miRNA detection was confirmed by analyzing miRNA-21 in HeLa lysates. Given the high-performance for miRNA analysis, the strategy has a promising application in biological detection and in clinical diagnosis.
Guarnieri, Michael T.; Chou, Yat-Chen; Salvachúa, Davinia; Mohagheghi, Ali; St. John, Peter C.; Peterson, Darren J.; Bomble, Yannick J.
2017-01-01
ABSTRACT Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of the key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Overall, this work demonstrates genetic modifications that can lead to succinic
Guarnieri, Michael T; Chou, Yat-Chen; Salvachúa, Davinia; Mohagheghi, Ali; St John, Peter C; Peterson, Darren J; Bomble, Yannick J; Beckham, Gregg T
2017-09-01
Actinobacillus succinogenes , a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes , enabling examination of SA flux determinants via knockout of the primary competing pathways-namely, acetate and formate production-and overexpression of the key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Overall, this work demonstrates genetic modifications that can lead to succinic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guarnieri, Michael T.; Chou, Yat -Chen; Salvachua, Davinia Rodriquez
Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of themore » key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Altogether, this work demonstrates genetic modifications that can lead to succinic
Guarnieri, Michael T.; Chou, Yat -Chen; Salvachua, Davinia Rodriquez; ...
2017-06-16
Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of themore » key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Altogether, this work demonstrates genetic modifications that can lead to succinic
Sepiapterin Reductase Mediates Chemical Redox Cycling in Lung Epithelial Cells*
Yang, Shaojun; Jan, Yi-Hua; Gray, Joshua P.; Mishin, Vladimir; Heck, Diane E.; Laskin, Debra L.; Laskin, Jeffrey D.
2013-01-01
In the lung, chemical redox cycling generates highly toxic reactive oxygen species that can cause alveolar inflammation and damage to the epithelium, as well as fibrosis. In this study, we identified a cytosolic NADPH-dependent redox cycling activity in mouse lung epithelial cells as sepiapterin reductase (SPR), an enzyme important for the biosynthesis of tetrahydrobiopterin. Human SPR was cloned and characterized. In addition to reducing sepiapterin, SPR mediated chemical redox cycling of bipyridinium herbicides and various quinones; this activity was greatest for 1,2-naphthoquinone followed by 9,10-phenanthrenequinone, 1,4-naphthoquinone, menadione, and 2,3-dimethyl-1,4-naphthoquinone. Whereas redox cycling chemicals inhibited sepiapterin reduction, sepiapterin had no effect on redox cycling. Additionally, inhibitors such as dicoumarol, N-acetylserotonin, and indomethacin blocked sepiapterin reduction, with no effect on redox cycling. Non-redox cycling quinones, including benzoquinone and phenylquinone, were competitive inhibitors of sepiapterin reduction but noncompetitive redox cycling inhibitors. Site-directed mutagenesis of the SPR C-terminal substrate-binding site (D257H) completely inhibited sepiapterin reduction but had minimal effects on redox cycling. These data indicate that SPR-mediated reduction of sepiapterin and redox cycling occur by distinct mechanisms. The identification of SPR as a key enzyme mediating chemical redox cycling suggests that it may be important in generating cytotoxic reactive oxygen species in the lung. This activity, together with inhibition of sepiapterin reduction by redox-active chemicals and consequent deficiencies in tetrahydrobiopterin, may contribute to tissue injury. PMID:23640889
Redox regulation of the Calvin–Benson cycle: something old, something new
Michelet, Laure; Zaffagnini, Mirko; Morisse, Samuel; Sparla, Francesca; Pérez-Pérez, María Esther; Francia, Francesco; Danon, Antoine; Marchand, Christophe H.; Fermani, Simona; Trost, Paolo; Lemaire, Stéphane D.
2013-01-01
Reversible redox post-translational modifications such as oxido-reduction of disulfide bonds, S-nitrosylation, and S-glutathionylation, play a prominent role in the regulation of cell metabolism and signaling in all organisms. These modifications are mainly controlled by members of the thioredoxin and glutaredoxin families. Early studies in photosynthetic organisms have identified the Calvin–Benson cycle, the photosynthetic pathway responsible for carbon assimilation, as a redox regulated process. Indeed, 4 out of 11 enzymes of the cycle were shown to have a low activity in the dark and to be activated in the light through thioredoxin-dependent reduction of regulatory disulfide bonds. The underlying molecular mechanisms were extensively studied at the biochemical and structural level. Unexpectedly, recent biochemical and proteomic studies have suggested that all enzymes of the cycle and several associated regulatory proteins may undergo redox regulation through multiple redox post-translational modifications including glutathionylation and nitrosylation. The aim of this review is to detail the well-established mechanisms of redox regulation of Calvin–Benson cycle enzymes as well as the most recent reports indicating that this pathway is tightly controlled by multiple interconnected redox post-translational modifications. This redox control is likely allowing fine tuning of the Calvin–Benson cycle required for adaptation to varying environmental conditions, especially during responses to biotic and abiotic stresses. PMID:24324475
Metabolic interaction between urea cycle and citric acid cycle shunt: A guided approach.
Pesi, Rossana; Balestri, Francesco; Ipata, Piero L
2018-03-01
This article is a guided pedagogical approach, devoted to postgraduate students specializing in biochemistry, aimed at presenting all single reactions and overall equations leading to the metabolic interaction between ureagenesis and citric acid cycle to be incorporated into a two-three lecture series about the interaction of urea cycle with other metabolic pathways. We emphasize that citrate synthetase, aconitase, and isocitrate dehydrogenase, three enzymes of the citric acid cycle are not involved, thus creating a shunt in citric acid cycle. In contrast, the glutamic-oxaloacetate transaminase, which does not belong to citric acid cycle, has a paramount importance in the metabolic interaction of the two cycles, because it generates aspartate, one of the two fuel molecules of urea cycle, and a-ketoglutarate, an intermediate of the citric acid cycle. Finally, students should appreciate that balancing equations for all atoms and charges is not only a stoichiometric task, but strongly facilitates the discussion of the physiological roles of metabolic pathways. Indeed, this exercise has been used in the classroom, to encourage a deeper level of understanding of an important biochemical issue. © 2017 by The International Union of Biochemistry and Molecular Biology, 46(2):182-185, 2018. © 2017 The International Union of Biochemistry and Molecular Biology.
NASA Technical Reports Server (NTRS)
1992-01-01
Malic Enzyme is a target protein for drug design because it is a key protein in the life cycle of intestinal parasites. After 2 years of effort on Earth, investigators were unable to produce any crystals that were of high enough quality and for this reason the structure of this important protein could not be determined. Crystals obtained from one STS-50 were of superior quality allowing the structure to be determined. This is just one example why access to space is so vital for these studies. Principal Investigator is Larry DeLucas.
Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids.
Terpolilli, Jason J; Masakapalli, Shyam K; Karunakaran, Ramakrishnan; Webb, Isabel U C; Green, Rob; Watmough, Nicholas J; Kruger, Nicholas J; Ratcliffe, R George; Poole, Philip S
2016-10-15
Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2 Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [(13)C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2 However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox
Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids
Terpolilli, Jason J.; Masakapalli, Shyam K.; Karunakaran, Ramakrishnan; Webb, Isabel U. C.; Green, Rob; Watmough, Nicholas J.; Kruger, Nicholas J.; Ratcliffe, R. George
2016-01-01
ABSTRACT Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2. Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [13C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. IMPORTANCE Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2. However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent
Stobbs, L. W.
1990-01-01
In this paper, plans are given for the construction of an inexpensive enzyme-linked immunosorbent assay plate washer from readily available materials. The wash unit uses an intermittent wash cycle based on a wash manifold cycling over the microdilution plates for a predetermined time. Laboratory tests showed that the unit provided reliable, rapid washing of plates with tap water, with no detectable contamination between wells. Substrate absorbance values for test samples from machine-washed plates were equal to or greater than absorbance values for corresponding samples from plates washed manually by an accepted protocol, by using either enzyme-linked immunosorbent assay wash buffer or tap water. Images PMID:16348216
Gluconeogenesis from labeled carbon: estimating isotope dilution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kelleher, J.K.
1986-03-01
To estimate the rate of gluconeogenesis from steady-state incorporation of labeled 3-carbon precursors into glucose, isotope dilution must be considered so that the rate of labeling of glucose can be quantitatively converted to the rate of gluconeogenesis. An expression for the value of this isotope dilution can be derived using mathematical techniques and a model of the tricarboxylic acid (TCA) cycle. The present investigation employs a more complex model than that used in previous studies. This model includes the following pathways that may affect the correction for isotope dilution: 1) flux of 3-carbon precursor to the oxaloacetate pool via acetyl-CoAmore » and the TCA cycle; 2) flux of 4- or 5-carbon compounds into the TCA cycle; 3) reversible flux between oxaloacetate (OAA) and pyruvate and between OAA and fumarate; 4) incomplete equilibrium between OAA pools; and 5) isotope dilution of 3-carbon tracers between the experimentally measured pool and the precursor for the TCA-cycle OAA pool. Experimental tests are outlined which investigators can use to determine whether these pathways are significant in a specific steady-state system. The study indicated that flux through these five pathways can significantly affect the correction for isotope dilution. To correct for the effects of these pathways an alternative method for calculating isotope dilution is proposed using citrate to relate the specific activities of acetyl-CoA and OAA.« less
Conformational Sub-states and Populations in Enzyme Catalysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Agarwal, Pratul K; Doucet, Nicholas; Chennubholta, C
reactants in the active site, chemical turnover, and release of products. In addition to formation of crucial structural interactions between enzyme and substrate(s), coordinated motions within the enzyme substrate complex allow reaction to proceed at a much faster rate, compared to the reaction in solution and in the absence of enzyme. An increasing number of enzyme systems show the presence of conserved protein motions that are important for function. A wide variety of motions are naturally sampled (over femtosecond to millisecond time-scales) as the enzyme complex moves along the energetic landscape, driven by temperature and dynamical events from the surroundingmore » environment. Areas of low energy along the landscape form conformational sub-states, which show higher conformational populations than surrounding areas. A small number of these protein conformational sub-states contain functionally important structural and dynamical features, which assist the enzyme mechanism along the catalytic cycle. Identification and characterization of these higher-energy (also called excited) sub-states and the associated populations are challenging, as these sub-states are very short-lived and therefore rarely populated. Specialized techniques based on computer simulations, theoretical modeling, and nuclear magnetic resonance have been developed for quantitative characterization of these sub-states and populations. This chapter discusses these techniques and provides examples of their applications to enzyme systems.« less
Rehman, Haneef Ur; Aman, Afsheen; Zohra, Raheela Rahmat; Qader, Shah Ali Ul
2014-02-15
Pectinase from Bacillus licheniformis KIBGE IB-21 was immobilized in agar-agar matrix using entrapment technique. Effect of different concentrations of agar-agar on pectinase immobilization was investigated and it was found that maximum immobilization was achieved at 3.0% agar-agar with 80% enzyme activity. After immobilization, the optimum temperature of enzyme increased from 45 to 50 °C and reaction time from 5 to 10 minutes as compared to free enzyme. Due to the limited diffusion of high molecular weight substrate, K(m) of immobilized enzyme slightly increased from 1.017 to 1.055 mg ml(-1), while Vmax decreased from 23,800 to 19,392 μM min(-1) as compared to free enzyme. After 120 h entrapped pectinase retained their activity up to 82% and 71% at 30 °C and 40 °C, respectively. The entrapped pectinase showed activity until 10th cycle and maintain 69.21% activity even after third cycle. Copyright © 2013 Elsevier Ltd. All rights reserved.
Park, Seonhwa; Singh, Amardeep; Kim, Sinyoung; Yang, Haesik
2014-02-04
We compare herein biosensing performance of two electroreduction-based electrochemical-enzymatic (EN) redox-cycling schemes [the redox cycling combined with simultaneous enzymatic amplification (one-enzyme scheme) and the redox cycling combined with preceding enzymatic amplification (two-enzyme scheme)]. To minimize unwanted side reactions in the two-enzyme scheme, β-galactosidase (Gal) and tyrosinase (Tyr) are selected as an enzyme label and a redox enzyme, respectively, and Tyr is selected as a redox enzyme label in the one-enzyme scheme. The signal amplification in the one-enzyme scheme consists of (i) enzymatic oxidation of catechol into o-benzoquinone by Tyr and (ii) electroreduction-based EN redox cycling of o-benzoquinone. The signal amplification in the two-enzyme scheme consists of (i) enzymatic conversion of phenyl β-d-galactopyranoside into phenol by Gal, (ii) enzymatic oxidation of phenol into catechol by Tyr, and (iii) electroreduction-based EN redox cycling of o-benzoquinone including further enzymatic oxidation of catechol to o-benzoquinone by Tyr. Graphene oxide-modified indium-tin oxide (GO/ITO) electrodes, simply prepared by immersing ITO electrodes in a GO-dispersed aqueous solution, are used to obtain better electrocatalytic activities toward o-benzoquinone reduction than bare ITO electrodes. The detection limits for mouse IgG, measured with GO/ITO electrodes, are lower than when measured with bare ITO electrodes. Importantly, the detection of mouse IgG using the two-enzyme scheme allows lower detection limits than that using the one-enzyme scheme, because the former gives higher signal levels at low target concentrations although the former gives lower signal levels at high concentrations. The detection limit for cancer antigen (CA) 15-3, a biomarker of breast cancer, measured using the two-enzyme scheme and GO/ITO electrodes is ca. 0.1 U/mL, indicating that the immunosensor is highly sensitive.
Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen
2011-01-01
Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.
Choi, Yong-Min; Kim, Han-Kyul; Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun
2015-01-01
The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player.
Zhang, Qi; Chen, Shuo; Wang, Hua; Yu, Hongtao
2018-03-14
Hydrogen peroxide (H 2 O 2 ) is a key reactant in the Fenton process. As a byproduct of enzymatic reaction, H 2 O 2 can be obtained via catalytical oxidation of glucose using glucose oxidase in the presence of O 2 . Another oxidation product (gluconic acid) can suitably adjust the microenvironmental pH contributing to the Fe 3+ /Fe 2+ cycle in the Fenton reaction. Enzymes are extremely efficient at catalyzing a variety of reactions with high catalytic activity, substrate specificity, and yields in living organisms. Inspired by the multiple functions of natural multienzyme systems, an exquisite nanozyme-modified α-FeOOH/porous carbon (PC) biomimetic catalyst constructed by in situ growth of glucose oxidase-mimicking Au nanoparticles and crystallization of adsorbed ferric ions within carboxyl into hierarchically PC is developed as an efficient enzyme-Fenton catalyst. The products (H 2 O 2 , ∼4.07 mmol·L -1 ) of the first enzymatic reaction are immediately used as substrates for the second Fenton-like reaction to generate the valuable • OH (∼96.84 μmol·L -1 ), thus mimicking an enzyme cascade pathway. α-FeOOH nanocrystals, attached by C-O-Fe bondings, are encapsulated into the mesoporous PC frameworks, facilitating the electron transfer between α-FeOOH and the PC support and greatly suppressing iron leaching. This study paves a new avenue for designing biomimetic enzyme-based Fenton catalysts mimicking a natural system for • OH production.
Ames Optimized TCA Configuration
NASA Technical Reports Server (NTRS)
Cliff, Susan E.; Reuther, James J.; Hicks, Raymond M.
1999-01-01
Configuration design at Ames was carried out with the SYN87-SB (single block) Euler code using a 193 x 49 x 65 C-H grid. The Euler solver is coupled to the constrained (NPSOL) and the unconstrained (QNMDIF) optimization packages. Since the single block grid is able to model only wing-body configurations, the nacelle/diverter effects were included in the optimization process by SYN87's option to superimpose the nacelle/diverter interference pressures on the wing. These interference pressures were calculated using the AIRPLANE code. AIRPLANE is an Euler solver that uses a unstructured tetrahedral mesh and is capable of computations about arbitrary complete configurations. In addition, the buoyancy effects of the nacelle/diverters were also included in the design process by imposing the pressure field obtained during the design process onto the triangulated surfaces of the nacelle/diverter mesh generated by AIRPLANE. The interference pressures and nacelle buoyancy effects are added to the final forces after each flow field calculation. Full details of the (recently enhanced) ghost nacelle capability are given in a related talk. The pseudo nacelle corrections were greatly improved during this design cycle. During the Ref H and Cycle 1 design activities, the nacelles were only translated and pitched. In the cycle 2 design effort the nacelles can translate vertically, and pitch to accommodate the changes in the lower surface geometry. The diverter heights (between their leading and trailing edges) were modified during design as the shape of the lower wing changed, with the drag of the diverter changing accordingly. Both adjoint and finite difference gradients were used during optimization. The adjoint-based gradients were found to give good direction in the design space for configurations near the starting point, but as the design approached a minimum, the finite difference gradients were found to be more accurate. Use of finite difference gradients was limited by the
A unified model for surface electrocatalysis based on observations with enzymes.
Hexter, Suzannah V; Esterle, Thomas F; Armstrong, Fraser A
2014-06-28
Despite being so large, many enzymes are not only excellent electrocatalysts - making possible chemical transformations under almost reversible conditions - but they also facilitate our understanding of electrocatalysis by allowing complex processes to be dissected systematically. The electrocatalytic voltammograms obtained for enzymes attached to an electrode expose fundamental aspects of electrocatalysis that can be addressed in ways that are not available to conventional molecular or surface electrocatalysts. The roles of individual components, each characterisable by diffraction or spectroscopy, can be tested and optimised by genetic engineering. Importantly, unlike small-molecule electrocatalysts (RMM < 1000) that are structurally well-defined but invariably altered by being attached to a surface, the enzyme is a giant, multi-component assembly in which the active site is buried and relatively insensitive to the presence of the electrode and solvent interface. A central assertion is that for a given driving force (electrode potential) a true catalyst has no influence on the direction of the reaction; consequently, 'catalytic bias', i.e. the common observation that an enzyme or indeed any electrocatalyst operates preferentially in one direction, must arise from secondary effects beyond the elementary catalytic cycle. This Perspective highlights and extends a general model for electrocatalysis by surface-confined enzymes, and explains how two secondary effects control the bias: (i) the electrode potential at which electrons enter or leave the catalytic cycle; (ii) potential-dependent interconversions between states of the catalyst differing in catalytic activity due to changes in the composition and arrangements of atoms. The model, which is easily applied to enzymes that have been studied recently, highlights important considerations for understanding and developing surface-confined electrocatalysts.
Atmospheric Hydrogen Scavenging: from Enzymes to Ecosystems
Constant, Philippe; Hards, Kiel; Morales, Sergio E.; Oakeshott, John G.; Russell, Robyn J.; Taylor, Matthew C.; Berney, Michael; Conrad, Ralf; Cook, Gregory M.
2014-01-01
We have known for 40 years that soils can consume the trace amounts of molecular hydrogen (H2) found in the Earth's atmosphere. This process is predicted to be the most significant term in the global hydrogen cycle. However, the organisms and enzymes responsible for this process were only recently identified. Pure culture experiments demonstrated that several species of Actinobacteria, including streptomycetes and mycobacteria, can couple the oxidation of atmospheric H2 to the reduction of ambient O2. A combination of genetic, biochemical, and phenotypic studies suggest that these organisms primarily use this fuel source to sustain electron input into the respiratory chain during energy starvation. This process is mediated by a specialized enzyme, the group 5 [NiFe]-hydrogenase, which is unusual for its high affinity, oxygen insensitivity, and thermostability. Atmospheric hydrogen scavenging is a particularly dependable mode of energy generation, given both the ubiquity of the substrate and the stress tolerance of its catalyst. This minireview summarizes the recent progress in understanding how and why certain organisms scavenge atmospheric H2. In addition, it provides insight into the wider significance of hydrogen scavenging in global H2 cycling and soil microbial ecology. PMID:25501483
MicroTCA-based Global Trigger Upgrade project for the CMS experiment at LHC
NASA Astrophysics Data System (ADS)
Rahbaran, B.; Arnold, B.; Bergauer, H.; Eichberger, M.; Rabady, D.
2011-12-01
The electronics of the first Level Global Trigger (GT) of CMS is the last stage of the Level-1 trigger system [1]. At LHC up to 40 million collisions of proton bunches occur every second, resulting in about 800 million proton collisions. The CMS Level-1 Global Trigger [1], a custom designed electronics system based on FPGA technology and the VMEbus system, performs a quick on-line analysis of each collision every 25 ns and decides whether to reject or to accept it for further analysis. The CMS trigger group of the Institute of High Energy Physics in Vienna (HEPHY) is involved in the Level-1 trigger of the CMS experiment at CERN. As part of the Trigger Upgrade, the Level-1 Global Trigger will be redesigned and implemented in MicroTCA based technology, which allows engineers to detect all possible faults on plug-in boards, in the power supply and in the cooling system. The upgraded Global Trigger will be designed to have the same basic categories of functions as the present GT, but will have more algorithms and more possibilities for combining trigger candidates. Additionally, reconfigurability and testability will be supported based on the next system generation.
NASA Astrophysics Data System (ADS)
Foster, E.; Fogle, E. J.; Cotrufo, M. F.
2017-12-01
Enzymes catalyze biogeochemical reactions in soils and play a key role in nutrient cycling in agricultural systems. Often, to increase soil nutrients, agricultural managers add organic amendments and have recently experimented with charcoal-like biocarbon products. These amendments can enhance soil water and nutrient holding capacity through increasing porosity. However, the large surface area of the biocarbon has the potential to sorb nutrients and other organic molecules. Does the biocarbon decrease nutrient cycling through sorption of enzymes? In a laboratory setting, we compared the interaction of two purified enzymes β-glucosidase and acid phosphatase with a sandy clay loam and two biocarbons. We quantified the sorbed enzymes at three different pHs using a Bradford protein assay and then measured the activity of the sorbed enzyme via high-throughput fluorometric analysis. Both sorption and activity depended upon the solid phase, pH, and specific enzyme. Overall the high surface area biocarbon impacted the catalytic capacity of the enzymes more than the loam soil, which may have implications for soil nutrient management with these organic amendments.
Chromatin Structure and the Cell Cycle
Pederson, Thoru
1972-01-01
Pancreatic DNase I is used to probe the structure of chromatin isolated from synchronized HeLa cells. The degree to which DNA in chromatin is protected from DNase attack varies during the G1, S, and G2 phases of the cell cycle. In addition, the DNase sensitivity of chromatin from contact-inhibited African green monkey kidney cells differs from that of actively dividing, subconfluent cultures. These cell cycle-dependent chromatin changes were observed consistently at all enzyme concentrations (5000-fold range) and incubation times (15 min-2 hr) tested. The results indicate that the degree of complexing between DNA and chromosomal proteins changes during interphase, and they suggest that the chromosome coiling cycle of visible mitosis may extend in more subtle form over the entire cell cycle. PMID:4626402
The Role of Neprilysin in Regulating the Hair Cycle
Morisaki, Naoko; Ohuchi, Atsushi; Moriwaki, Shigeru
2013-01-01
In most mammals, each hair follicle undergoes a cyclic process of growing, regressing and resting phases (anagen, catagen, telogen, respectively) called the hair cycle. Various biological factors have been reported to regulate or to synchronize with the hair cycle. Some factors involved in the extracellular matrix, which is a major component of skin tissue, are also thought to regulate the hair cycle. We have focused on an enzyme that degrades elastin, which is associated with skin elasticity. Since our previous study identified skin fibroblast elastase as neprilysin (NEP), we examined the fluctuation of NEP enzyme activity and its expression during the synchronized hair cycle of rats. NEP activity in the skin was elevated at early anagen, and decreased during catagen to telogen. The expression of NEP mRNA and protein levels was modulated similarly. Immunostaining showed changes in NEP localization throughout the hair cycle, from the follicular epithelium during early anagen to the dermal papilla during catagen. To determine whether NEP plays an important role in regulating the hair cycle, we used a specific inhibitor of NEP (NPLT). NPLT was applied topically daily to the dorsal skin of C3H mice, which had been depilated in advance. Mice treated with NPLT had significantly suppressed hair growth. These data suggest that NEP plays an important role in regulating the hair cycle by its increased expression and activity in the follicular epithelium during early anagen. PMID:23418484
Ultrasound assisted intensification of enzyme activity and its properties: a mini-review.
Nadar, Shamraja S; Rathod, Virendra K
2017-08-22
Over the last decade, ultrasound technique has emerged as the potential technology which shows large applications in food and biotechnology processes. Earlier, ultrasound has been employed as a method of enzyme inactivation but recently, it has been found that ultrasound does not inactivate all enzymes, particularly, under mild conditions. It has been shown that the use of ultrasonic treatment at appropriate frequencies and intensity levels can lead to enhanced enzyme activity due to favourable conformational changes in protein molecules without altering its structural integrity. The present review article gives an overview of influence of ultrasound irradiation parameters (intensity, duty cycle and frequency) and enzyme related factors (enzyme concentration, temperature and pH) on the catalytic activity of enzyme during ultrasound treatment. Also, it includes the effect of ultrasound on thermal kinetic parameters and Michaelis-Menten kinetic parameters (k m and V max ) of enzymes. Further, in this review, the physical and chemical effects of ultrasound on enzyme have been correlated with thermodynamic parameters (enthalpy and entropy). Various techniques used for investigating the conformation changes in enzyme after sonication have been highlighted. At the end, different techniques of immobilization for ultrasound treated enzyme have been summarized.
Gottardi, Manuela; Grün, Peter; Bode, Helge B; Hoffmann, Thomas; Schwab, Wilfried; Oreb, Mislav; Boles, Eckhard
2017-12-01
Trans-cinnamic acid (tCA) and hydrocinnamyl alcohol (HcinOH) are valuable aromatic compounds with applications in the flavour, fragrance and cosmetic industry. They can be produced with recombinant yeasts from sugars via phenylalanine after expression of a phenylalanine ammonia lyase (PAL) and an aryl carboxylic acid reductase. Here, we show that in Saccharomyces cerevisiae a PAL enzyme from the bacterium Photorhabdus luminescens was superior to a previously used plant PAL enzyme for the production of tCA. Moreover, after expression of a UDP-glucose:cinnamate glucosyltransferase (FaGT2) from Fragaria x ananassa, tCA could be converted to cinnamoyl-D-glucose which is expected to be less toxic to the yeast cells. Production of tCA and HcinOH from glucose could be increased by eliminating feedback-regulated steps of aromatic amino acid biosynthesis and diminishing the decarboxylation step of the competing Ehrlich pathway. Finally, an unknown by-product resulting from further metabolisation of a carboligation product of cinnamaldehyde (cinALD) with activated acetaldehyde, mediated by pyruvate decarboxylases, could be identified as cinnamyl methyl ketone providing a new route for the biosynthesis of precursors, such as (2S,3R) 5-phenylpent-4-ene-2,3-diol, necessary for the chemical synthesis of specific biologically active drugs such as daunomycin. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Saccharification of Spirulina platensis biomass using free and immobilized amylolytic enzymes.
Rempel, Alan; Machado, Tainara; Treichel, Helen; Colla, Eliane; Margarites, Ana Cláudia; Colla, Luciane Maria
2018-04-30
We aimed to use physical methods of microalgal biomass rupture to study saccharification strategies using free and immobilized amylolytic enzymes. The biomass of Spirulina platensis, which consists of 50-60% carbohydrates, was exposed to physical cell rupture treatments, with better results obtained using freeze/thaw cycles following by gelatinization. In saccharification tests, it was possible to hydrolyze Spirulina biomass with hydrolysis efficiencies above 99% and 83%, respectively, using 1% (v/v) of free enzymes or 1% (m/v) of amylolytic enzymes immobilized together. The use of free and immobilized enzymes yielded high levels of conversion of polysaccharides to simple sugars in Spirulina biomass, showing that these processes are promising for the advancement of bioethanol production using microalgal biomass. Copyright © 2018 Elsevier Ltd. All rights reserved.
Nutrient Dependence of RNase E Essentiality in Escherichia coli
Tamura, Masaru; Moore, Christopher J.
2013-01-01
Escherichia coli cells normally require RNase E activity to form colonies (colony-forming ability [CFA]). The CFA-defective phenotype of cells lacking RNase E is partly reversed by overexpression of the related endoribonuclease RNase G or by mutation of the gene encoding the RNA helicase DeaD. We found that the carbon source utilization by rne deaD doubly mutant bacteria differs from that of rne+ cells and from that of cells mutated in deaD alone and that the loss of rne function in these bacteria limits conversion of the glycolytic pathway product phosphoenolpyruvate to the tricarboxylic acid (TCA) cycle intermediate oxaloacetic acid. We show that the mechanism underlying this effect is reduced production of the enzyme phosphoenolpyruvate carboxylase (PPC) and that adventitious overexpression of PPC, which facilitates phosphoenolpyruvate utilization and connects the glycolytic pathway with the TCA cycle, restored CFA to rne deaD mutant bacteria cultured on carbon sources that otherwise were unable to sustain growth. We further show that bacteria producing full-length RNase E, which allows formation of degradosomes, have nutritional requirements different from those of cells supplied with only the N-terminal catalytic region of RNase E and that mitigation of RNase E deficiency by overexpression of a related RNase, RNase G, is also affected by carbon source. Our results reveal previously unsuspected effects of RNase E deficiency and degradosome formation on nutrient utilization by E. coli cells. PMID:23275245
Alvarez, Gaël; Shahzad, Tanvir; Andanson, Laurence; Bahn, Michael; Wallenstein, Matthew D; Fontaine, Sébastien
2018-04-23
Most current models of soil C dynamics predict that climate warming will accelerate soil C mineralization, resulting in a long-term CO 2 release and positive feedback to global warming. However, ecosystem warming experiments show that CO 2 loss from warmed soils declines to control levels within a few years. Here, we explore the temperature dependence of enzymatic conversion of polymerized soil organic C (SOC) into assimilable compounds, which is presumed the rate-limiting step of SOC mineralization. Combining literature review, modelling and enzyme assays, we studied the effect of temperature on activity of enzymes considering their thermal inactivation and catalytic activity. We defined the catalytic power of enzymes (E power ) as the cumulative amount of degraded substrate by one unit of enzyme until its complete inactivation. We show a universal pattern of enzyme's thermodynamic properties: activation energy of catalytic activity (EA cat ) < activation energy of thermal inactivation (EA inact ). By investing in stable enzymes (high EA inact ) having high catalytic activity (low EA cat ), microorganisms may maximize the E power of their enzymes. The counterpart of such EAs' hierarchical pattern is the higher relative temperature sensitivity of enzyme inactivation than catalysis, resulting in a reduction in E power under warming. Our findings could explain the decrease with temperature in soil enzyme pools, microbial biomass (MB) and carbon use efficiency (CUE) reported in some warming experiments and studies monitoring the seasonal variation in soil enzymes. They also suggest that a decrease in soil enzyme pools due to their faster inactivation under warming contributes to the observed attenuation of warming effect on soil C mineralization. This testable theory predicts that the ultimate response of SOC degradation to warming can be positive or negative depending on the relative temperature response of E power and microbial production of enzymes. © 2018 John
McCommis, Kyle S; Chen, Zhouji; Fu, Xiaorong; McDonald, William G; Colca, Jerry R; Kletzien, Rolf F; Burgess, Shawn C; Finck, Brian N
2015-10-06
Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite for gluconeogenesis in hepatocytes, which is important for the maintenance of normoglycemia during prolonged food deprivation but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2(-/-)) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte conversion of labeled pyruvate to TCA cycle intermediates and glucose. Unbiased metabolomic analyses of livers from fasted LS-Mpc2(-/-) mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for the loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2(-/-) hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. Copyright © 2015 Elsevier Inc. All rights reserved.
Jiang, Cheng-Ying; Liu, Li-Jun; Guo, Xu; You, Xiao-Yan; Liu, Shuang-Jiang; Poetsch, Ansgar
2014-09-23
Metallosphaera cuprina is able to grow either heterotrophically on organics or autotrophically on CO2 with reduced sulfur compounds as electron donor. These traits endowed the species desirable for application in biomining. In order to obtain a global overview of physiological adaptations on the proteome level, proteomes of cytoplasmic and membrane fractions from cells grown autotrophically on CO2 plus sulfur or heterotrophically on yeast extract were compared. 169 proteins were found to change their abundance depending on growth condition. The proteins with increased abundance under autotrophic growth displayed candidate enzymes/proteins of M. cuprina for fixing CO2 through the previously identified 3-hydroxypropionate/4-hydroxybutyrate cycle and for oxidizing elemental sulfur as energy source. The main enzymes/proteins involved in semi- and non-phosphorylating Entner-Doudoroff (ED) pathway and TCA cycle were less abundant under autotrophic growth. Also some transporter proteins and proteins of amino acid metabolism changed their abundances, suggesting pivotal roles for growth under the respective conditions. The described work is of great significance: For general microbiology: How do extremophile organisms use their unique metabolic capabilities in adapting to autotrophic and hetetrotrophic growth conditions? Which are important enzymes involved in the metabolic adaptation and which enzyme candidate should be investigated in more detail with microbiological/biochemical approaches? For applied microbiology: Which are the key enzymes and reaction pathways for sulfur oxidation and autotrophic growth? This knowledge should accelerate future design of improved bioleaching processes in biomining industries or bioremediation. Copyright © 2014 Elsevier B.V. All rights reserved.
Quantifying fluctuations in reversible enzymatic cycles and clocks
NASA Astrophysics Data System (ADS)
Wierenga, Harmen; ten Wolde, Pieter Rein; Becker, Nils B.
2018-04-01
Biochemical reactions are fundamentally noisy at a molecular scale. This limits the precision of reaction networks, but it also allows fluctuation measurements that may reveal the structure and dynamics of the underlying biochemical network. Here, we study nonequilibrium reaction cycles, such as the mechanochemical cycle of molecular motors, the phosphorylation cycle of circadian clock proteins, or the transition state cycle of enzymes. Fluctuations in such cycles may be measured using either of two classical definitions of the randomness parameter, which we show to be equivalent in general microscopically reversible cycles. We define a stochastic period for reversible cycles and present analytical solutions for its moments. Furthermore, we associate the two forms of the randomness parameter with the thermodynamic uncertainty relation, which sets limits on the timing precision of the cycle in terms of thermodynamic quantities. Our results should prove useful also for the study of temporal fluctuations in more general networks.
Integrating microbial physiology and enzyme traits in the quality model
NASA Astrophysics Data System (ADS)
Sainte-Marie, Julien; Barrandon, Matthieu; Martin, Francis; Saint-André, Laurent; Derrien, Delphine
2017-04-01
microbial physiology and enzyme traits can be incorporated in a model based on a continuous representation of the organic matter and evaluate how it can improve our ability to predict soil C cycling. To do so, we analyse the properties of the model by implementing different scenarii and test the sensitivity of its parameters. Agren, G. I., & Bosatta, E. (1998). Theoretical ecosystem ecology: understanding element cycles. Cambridge University Press.
Adaptability in linkage of soil carbon nutrient cycles - the SEAM model
NASA Astrophysics Data System (ADS)
Wutzler, Thomas; Zaehle, Sönke; Schrumpf, Marion; Ahrens, Bernhard; Reichstein, Markus
2017-04-01
In order to understand the coupling of carbon (C) and nitrogen (N) cycles, it is necessary to understand C and N-use efficiencies of microbial soil organic matter (SOM) decomposition. While important controls of those efficiencies by microbial community adaptations have been shown at the scale of a soil pore, an abstract simplified representation of community adaptations is needed at ecosystem scale. Therefore we developed the soil enzyme allocation model (SEAM), which takes a holistic, partly optimality based approach to describe C and N dynamics at the spatial scale of an ecosystem and time-scales of years and longer. We explicitly modelled community adaptation strategies of resource allocation to extracellular enzymes and enzyme limitations on SOM decomposition. Using SEAM, we explored whether alternative strategy-hypotheses can have strong effects on SOM and inorganic N cycling. Results from prototypical simulations and a calibration to observations of an intensive pasture site showed that the so-called revenue enzyme allocation strategy was most viable. This strategy accounts for microbial adaptations to both, stoichiometry and amount of different SOM resources, and supported the largest microbial biomass under a wide range of conditions. Predictions of the SEAM model were qualitatively similar to models explicitly representing competing microbial groups. With adaptive enzyme allocation under conditions of high C/N ratio of litter inputs, N in formerly locked in slowly degrading SOM pools was made accessible, whereas with high N inputs, N was sequestered in SOM and protected from leaching. The finding that adaptation in enzyme allocation changes C and N-use efficiencies of SOM decomposition implies that concepts of C-nutrient cycle interactions should take account for the effects of such adaptations. This can be done using a holistic optimality approach.
Salminen, Antero; Kauppinen, Anu; Hiltunen, Mikko; Kaarniranta, Kai
2014-07-01
Many aging theories have proposed that mitochondria and energy metabolism have a major role in the aging process. There are recent studies indicating that Krebs cycle intermediates can shape the epigenetic landscape of chromatin by regulating DNA and histone methylation. A growing evidence indicates that epigenetics plays an important role in the regulation of healthspan but also is involved in the aging process. 2-Oxoglutarate (α-ketoglutarate) is a key metabolite in the Krebs cycle but it is also an obligatory substrate for 2-oxoglutarate-dependent dioxygenases (2-OGDO). The 2-OGDO enzyme family includes the major enzymes of DNA and histone demethylation, i.e. Ten-Eleven Translocation (TETs) and Jumonji C domain containing (JmjC) demethylases. In addition, 2-OGDO members can regulate collagen synthesis and hypoxic responses in a non-epigenetical manner. Interestingly, succinate and fumarate, also Krebs cycle intermediates, are potent inhibitors of 2-OGDO enzymes, i.e. the balance of Krebs cycle reactions can affect the level of DNA and histone methylation and thus control gene expression. We will review the epigenetic mechanisms through which Krebs cycle intermediates control the DNA and histone methylation. We propose that age-related disturbances in the Krebs cycle function induce stochastic epigenetic changes in chromatin structures which in turn promote the aging process. Copyright © 2014 Elsevier B.V. All rights reserved.
Human recombinant arginase enzyme reduces plasma arginine in mouse models of arginase deficiency
Burrage, Lindsay C.; Sun, Qin; Elsea, Sarah H.; Jiang, Ming-Ming; Nagamani, Sandesh C.S.; Frankel, Arthur E.; Stone, Everett; Alters, Susan E.; Johnson, Dale E.; Rowlinson, Scott W.; Georgiou, George; Lee, Brendan H.
2015-01-01
Arginase deficiency is caused by deficiency of arginase 1 (ARG1), a urea cycle enzyme that converts arginine to ornithine. Clinical features of arginase deficiency include elevated plasma arginine levels, spastic diplegia, intellectual disability, seizures and growth deficiency. Unlike other urea cycle disorders, recurrent hyperammonemia is typically less severe in this disorder. Normalization of plasma arginine levels is the consensus treatment goal, because elevations of arginine and its metabolites are suspected to contribute to the neurologic features. Using data from patients enrolled in a natural history study conducted by the Urea Cycle Disorders Consortium, we found that 97% of plasma arginine levels in subjects with arginase deficiency were above the normal range despite conventional treatment. Recently, arginine-degrading enzymes have been used to deplete arginine as a therapeutic strategy in cancer. We tested whether one of these enzymes, a pegylated human recombinant arginase 1 (AEB1102), reduces plasma arginine in murine models of arginase deficiency. In neonatal and adult mice with arginase deficiency, AEB1102 reduced the plasma arginine after single and repeated doses. However, survival did not improve likely, because this pegylated enzyme does not enter hepatocytes and does not improve hyperammonemia that accounts for lethality. Although murine models required dosing every 48 h, studies in cynomolgus monkeys indicate that less frequent dosing may be possible in patients. Given that elevated plasma arginine rather than hyperammonemia is the major treatment challenge, we propose that AEB1102 may have therapeutic potential as an arginine-reducing agent in patients with arginase deficiency. PMID:26358771
The Use of a Simple Enzyme Assay in 'Seed-Hardening' Studies
ERIC Educational Resources Information Center
Ead, J.; Devonald, V. G.
1975-01-01
Describes a single technique for an enzyme assay of catalase. The method shows that vegetable seeds submitted to pre-sowing 'hardening' cycles of imbition and drying have greater catalase activity and more rapid germination than do the controls. (LS)
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Michalik, Stephan; Bernhardt, Jörg; Otto, Andreas; Moche, Martin; Becher, Dörte; Meyer, Hanna; Lalk, Michael; Schurmann, Claudia; Schlüter, Rabea; Kock, Holger; Gerth, Ulf; Hecker, Michael
2012-09-01
The cellular amount of proteins not only depends on synthesis but also on degradation. Here, we expand the understanding of differential protein levels by complementing synthesis data with a proteome-wide, mass spectrometry-based stable isotope labeling with amino acids in cell culture analysis of protein degradation in the human pathogen Staphylococcus aureus during glucose starvation. Monitoring protein stability profiles in a wild type and an isogenic clpP protease mutant revealed that 1) proteolysis mainly affected proteins with vegetative functions, anabolic and selected catabolic enzymes, whereas the expression of TCA cycle and gluconeogenesis enzymes increased; 2) most proteins were prone to aggregation in the clpP mutant; 3) the absence of ClpP correlated with protein denaturation and oxidative stress responses, deregulation of virulence factors and a CodY repression. We suggest that degradation of redundant, inactive proteins disintegrated from functional complexes and thereby amenable to proteolytic attack is a fundamental cellular process in all organisms to regain nutrients and guarantee protein homeostasis.
Life and Death of Proteins: A Case Study of Glucose-starved Staphylococcus aureus*
Michalik, Stephan; Bernhardt, Jörg; Otto, Andreas; Moche, Martin; Becher, Dörte; Meyer, Hanna; Lalk, Michael; Schurmann, Claudia; Schlüter, Rabea; Kock, Holger; Gerth, Ulf; Hecker, Michael
2012-01-01
The cellular amount of proteins not only depends on synthesis but also on degradation. Here, we expand the understanding of differential protein levels by complementing synthesis data with a proteome-wide, mass spectrometry-based stable isotope labeling with amino acids in cell culture analysis of protein degradation in the human pathogen Staphylococcus aureus during glucose starvation. Monitoring protein stability profiles in a wild type and an isogenic clpP protease mutant revealed that 1) proteolysis mainly affected proteins with vegetative functions, anabolic and selected catabolic enzymes, whereas the expression of TCA cycle and gluconeogenesis enzymes increased; 2) most proteins were prone to aggregation in the clpP mutant; 3) the absence of ClpP correlated with protein denaturation and oxidative stress responses, deregulation of virulence factors and a CodY repression. We suggest that degradation of redundant, inactive proteins disintegrated from functional complexes and thereby amenable to proteolytic attack is a fundamental cellular process in all organisms to regain nutrients and guarantee protein homeostasis. PMID:22556279
Gene expression analysis of six GC-rich Gram-negative phytopathogens.
Fu, Qing-Shan; Li, Feng; Chen, Ling-Ling
2005-07-01
Predicted highly expressed (PHX) genes are comparatively analyzed for six GC-rich Gram-negative phytopathogens, i.e., Ralstonia solanacearum, Agrobacterium tumefaciens, Xanthomonas campestris pv. campestris (Xcc), Xanthomonas axonopodis pv. citri (Xac), Pseudomonas syringae pv. tomato, and Xylella fastidiosa. Enzymes involved in energy metabolism, such as ATP synthase, and genes involved in TCA cycle, are PHX in most bacteria except X. fastidiosa, which prefers an anaerobic environment. Most pathogenicity-related factors, including flagellar proteins and some outer membrane proteins, are PHX, except that flagellar proteins are missing in X. fastidiosa which is spread by insects and does not need to move during invasion. Although type III secretion system apparatus are homologous to flagellar proteins, none of them is PHX, which support the viewpoint that the two types of genes have evolved independently. Furthermore, it is revealed that some biosynthesis-related enzymes are highly expressed in certain bacteria. The PHX genes may provide potential drug targets for the design of new bactericide.
Highlights of the DNA cutters: a short history of the restriction enzymes.
Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G; Murray, Noreen E
2014-01-01
In the early 1950's, 'host-controlled variation in bacterial viruses' was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine.
Zhao, Yuan; She, Nai; Zhang, Xin; Wang, Chaojie; Mo, Yirong
2017-08-01
Yeast cytosine deaminase (yCD) is critical in gene-directed enzyme prodrug therapy as it catalyzes the hydrolytic deamination of cytosine. The product (uracil) release process is considered as rate-limiting in the whole enzymatic catalysis and includes the cleavage of the uracil-metal bond and the delivery of free uracil out of the reactive site. Herein extensive combined random acceleration molecular dynamics (RAMD) and molecular dynamics (MD) simulations coupled with the umbrella sampling technique have been performed to study the product transport mechanism. Five channels have been identified, and the thermodynamic and dynamic characterizations for the two most favorable channels have been determined and analyzed. The free energy barrier for the most beneficial pathway is about 13kcal/mol and mainly results from the cleavage of hydrogen bonds between the ligand uracil and surrounding residues Asn51, Glu64, and Asp155. The conjugated rings of Phe114 and Trp152 play gating and guiding roles in the product delivery via π⋯π van der Waals interactions with the product. Finally, the full cycle of the enzymatic catalysis has been determined, making the whole process computationally more precise. Copyright © 2017 Elsevier B.V. All rights reserved.
Variation in pH optima of hydrolytic enzyme activities in tropical rain forest soils.
Turner, Benjamin L
2010-10-01
Extracellular enzymes synthesized by soil microbes play a central role in the biogeochemical cycling of nutrients in the environment. The pH optima of eight hydrolytic enzymes involved in the cycles of carbon, nitrogen, phosphorus, and sulfur, were assessed in a series of tropical forest soils of contrasting pH values from the Republic of Panama. Assays were conducted using 4-methylumbelliferone-linked fluorogenic substrates in modified universal buffer. Optimum pH values differed markedly among enzymes and soils. Enzymes were grouped into three classes based on their pH optima: (i) enzymes with acidic pH optima that were consistent among soils (cellobiohydrolase, β-xylanase, and arylsulfatase), (ii) enzymes with acidic pH optima that varied systematically with soil pH, with the most acidic pH optima in the most acidic soils (α-glucosidase, β-glucosidase, and N-acetyl-β-glucosaminidase), and (iii) enzymes with an optimum pH in either the acid range or the alkaline range depending on soil pH (phosphomonoesterase and phosphodiesterase). The optimum pH values of phosphomonoesterase were consistent among soils, being 4 to 5 for acid phosphomonoesterase and 10 to 11 for alkaline phosphomonoesterase. In contrast, the optimum pH for phosphodiesterase activity varied systematically with soil pH, with the most acidic pH optima (3.0) in the most acidic soils and the most alkaline pH optima (pH 10) in near-neutral soils. Arylsulfatase activity had a very acidic optimum pH in all soils (pH ≤3.0) irrespective of soil pH. The differences in pH optima may be linked to the origins of the enzymes and/or the degree of stabilization on solid surfaces. The results have important implications for the interpretation of hydrolytic enzyme assays using fluorogenic substrates.
Bacterial quorum sensing and nitrogen cycling in rhizosphere soil
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeAngelis, K.M.; Lindow, S.E.; Firestone, M.K.
2008-10-01
Plant photosynthate fuels carbon-limited microbial growth and activity, resulting in increased rhizosphere nitrogen (N)-mineralization. Most soil organic N is macromolecular (chitin, protein, nucleotides); enzymatic depolymerization is likely rate-limiting for plant N accumulation. Analyzing Avena (wild oat) planted in microcosms containing sieved field soil, we observed increased rhizosphere chitinase and protease specific activities, bacterial cell densities, and dissolved organic nitrogen (DON) compared to bulk soil. Low-molecular weight DON (<3000 Da) was undetectable in bulk soil but comprised 15% of rhizosphere DON. Extracellular enzyme production in many bacteria requires quorum sensing (QS), cell-density dependent group behavior. Because proteobacteria are considered major rhizospheremore » colonizers, we assayed the proteobacterial QS signals acyl-homoserine lactones (AHLs), which were significantly increased in the rhizosphere. To investigate the linkage between soil signaling and N cycling, we characterized 533 bacterial isolates from Avena rhizosphere: 24% had chitinase or protease activity and AHL production; disruption of QS in 7 of 8 eight isolates disrupted enzyme activity. Many {alpha}-Proteobacteria were newly found with QS-controlled extracellular enzyme activity. Enhanced specific activities of N-cycling enzymes accompanied by bacterial density-dependent behaviors in rhizosphere soil gives rise to the hypothesis that QS could be a control point in the complex process of rhizosphere N-mineralization.« less
Bichell, Terry Jo V; Wegrzynowicz, Michal; Tipps, K Grace; Bradley, Emma M; Uhouse, Michael A; Bryan, Miles; Horning, Kyle; Fisher, Nicole; Dudek, Karrie; Halbesma, Timothy; Umashanker, Preethi; Stubbs, Andrew D; Holt, Hunter K; Kwakye, Gunnar F; Tidball, Andrew M; Colbran, Roger J; Aschner, Michael; Neely, M Diana; Di Pardo, Alba; Maglione, Vittorio; Osmand, Alexander; Bowman, Aaron B
2017-06-01
Huntington's disease (HD) is caused by a mutation in the huntingtin gene (HTT), resulting in profound striatal neurodegeneration through an unknown mechanism. Perturbations in the urea cycle have been reported in HD models and in HD patient blood and brain. In neurons, arginase is a central urea cycle enzyme, and the metal manganese (Mn) is an essential cofactor. Deficient biological responses to Mn, and reduced Mn accumulation have been observed in HD striatal mouse and cell models. Here we report in vivo and ex vivo evidence of a urea cycle metabolic phenotype in a prodromal HD mouse model. Further, either in vivo or in vitro Mn supplementation reverses the urea-cycle pathology by restoring arginase activity. We show that Arginase 2 (ARG2) is the arginase enzyme present in these mouse brain models, with ARG2 protein levels directly increased by Mn exposure. ARG2 protein is not reduced in the prodromal stage, though enzyme activity is reduced, indicating that altered Mn bioavailability as a cofactor leads to the deficient enzymatic activity. These data support a hypothesis that mutant HTT leads to a selective deficiency of neuronal Mn at an early disease stage, contributing to HD striatal urea-cycle pathophysiology through an effect on arginase activity. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.
Mineralogical impact on long-term patterns of soil nitrogen and phosphorus enzyme activities
NASA Astrophysics Data System (ADS)
Mikutta, Robert; Turner, Stephanie; Meyer-Stüve, Sandra; Guggenberger, Georg; Dohrmann, Reiner; Schippers, Axel
2014-05-01
Soil chronosequences provide a unique opportunity to study microbial activity over time in mineralogical diverse soils of different ages. The main objective of this study was to test the effect of mineralogical properties, nutrient and organic matter availability over whole soil pro-files on the abundance and activity of the microbial communities. We focused on microbio-logical processes involved in nitrogen and phosphorus cycling at the 120,000-year Franz Josef soil chronosequence. Microbial abundances (microbial biomass and total cell counts) and enzyme activities (protease, urease, aminopeptidase, and phosphatase) were determined and related to nutrient contents and mineralogical soil properties. Both, microbial abundances and enzyme activities decreased with soil depth at all sites. In the organic layers, microbial biomass and the activities of N-hydrolyzing enzymes showed their maximum at the intermediate-aged sites, corresponding to a high aboveground biomass. In contrast, the phosphatase activity increased with site age. The activities of N-hydrolyzing enzymes were positively correlated with total carbon and nitrogen contents, whereas the phosphatase activity was negatively correlated with the phosphorus content. In the mineral soil, the enzyme activities were generally low, thus reflecting the presence of strongly sorbing minerals. Sub-strate-normalized enzyme activities correlated negatively to clay content as well as poorly crystalline Al and Fe oxyhydroxides, supporting the view that the evolution of reactive sec-ondary mineral phases alters the activity of the microbial communities by constraining sub-strate availability. Our data suggest a strong mineralogical influence on nutrient cycling par-ticularly in subsoil environments.
Nitrogen inputs accelerate phosphorus cycling rates across a wide variety of terrestrial ecosystems.
Marklein, Alison R; Houlton, Benjamin Z
2012-02-01
• Biologically essential elements--especially nitrogen (N) and phosphorus (P)--constrain plant growth and microbial functioning; however, human activities are drastically altering the magnitude and pattern of such nutrient limitations on land. Here we examine interactions between N and P cycles of P mineralizing enzyme activities (phosphatase enzymes) across a wide variety of terrestrial biomes. • We synthesized results from 34 separate studies and used meta-analysis to evaluate phosphatase activity with N, P, or N×P fertilization. • Our results show that N fertilization enhances phosphatase activity, from the tropics to the extra-tropics, both on plant roots and in bulk soils. By contrast, P fertilization strongly suppresses rates of phosphatase activity. • These results imply that phosphatase enzymes are strongly responsive to changes in local nutrient cycle conditions. We also show that plant phosphatases respond more strongly to fertilization than soil phosphatases. The tight coupling between N and P provides a mechanism for recent observations of N and P co-limitation on land. Moreover, our results suggest that terrestrial plants and microbes can allocate excess N to phosphatase enzymes, thus delaying the onset of single P limitation to plant productivity as can occur via human modifications to the global N cycle. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.
NASA Technical Reports Server (NTRS)
Baughcum, Steven L.; Henderson, Stephen C.
1998-01-01
This report describes the development of a three-dimensional database of aircraft fuel burn and emissions (fuel burned, NOx, CO, and hydrocarbons) from projected fleets of high speed civil transports (HSCTs) on a universal airline network. Inventories for 500 and 1000 HSCT fleets, as well as the concurrent subsonic fleets, were calculated. The HSCT scenarios are calculated using the NASA technology concept airplane (TCA) and update an earlier report. These emissions inventories are available for use by atmospheric scientists conducting the Atmospheric Effects of Stratospheric Aircraft (AESA) modeling studies. Fuel burned and emissions of nitrogen oxides (NOx as NO2), carbon monoxide, and hydrocarbons have been calculated on a 1 degree latitude x 1 degree longitude x 1 kilometer pressure altitude grid and delivered to NASA as electronic files.
Trchounian, Armen; Gary Sawers, R
2014-01-01
Escherichia coli possesses four [NiFe]-hydrogenases that catalyze the reversible redox reaction of 2H(+) + 2e(-) ↔ H2. These enzymes together have the potential to form a hydrogen cycle across the membrane. Their activity, operational direction, and interaction with each other depend on the fermentation substrate and particularly pH. The enzymes producing H2 are likely able to translocate protons through the membrane. Moreover, the activity of some of these enzymes is dependent on the F0 F1 -ATPase, thus linking a proton cycle with the cycling of hydrogen. These two cycles are suggested to have a primary basic role in modulating the cell's energetics during mixed-acid fermentation, particularly in response to pH. Nevertheless, the mechanisms underlying the physical interactions between these enzyme complexes, as well as how this is controlled, are still not clearly understood. Here, we present a synopsis of the potential impact of proton-hydrogen cycling in fermentative bioenergetics. © 2013 International Union of Biochemistry and Molecular Biology.
A Role for Cytosolic Fumarate Hydratase in Urea Cycle Metabolism and Renal Neoplasia
Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O’Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A.; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J.; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J.
2013-01-01
Summary The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. PMID:23643539
Mogilevskaya, Ekaterina; Demin, Oleg; Goryanin, Igor
2006-10-01
This paper studies the effect of salicylate on the energy metabolism of mitochondria using in silico simulations. A kinetic model of the mitochondrial Krebs cycle is constructed using information on the individual enzymes. Model parameters for the rate equations are estimated using in vitro experimental data from the literature. Enzyme concentrations are determined from data on respiration in mitochondrial suspensions containing glutamate and malate. It is shown that inhibition in succinate dehydrogenase and alpha-ketoglutarate dehydrogenase by salicylate contributes substantially to the cumulative inhibition of the Krebs cycle by salicylates. Uncoupling of oxidative phosphorylation has little effect and coenzyme A consumption in salicylates transformation processes has an insignificant effect on the rate of substrate oxidation in the Krebs cycle. It is found that the salicylate-inhibited Krebs cycle flux can be increased by flux redirection through addition of external glutamate and malate, and depletion in external alpha-ketoglutarate and glycine concentrations.
Identification of enzymes involved in oxidation of phenylbutyrate.
Palir, Neža; Ruiter, Jos P N; Wanders, Ronald J A; Houtkooper, Riekelt H
2017-05-01
In recent years the short-chain fatty acid, 4-phenylbutyrate (PB), has emerged as a promising drug for various clinical conditions. In fact, PB has been Food and Drug Administration-approved for urea cycle disorders since 1996. PB is more potent and less toxic than its metabolite, phenylacetate (PA), and is not just a pro-drug for PA, as was initially assumed. The metabolic pathway of PB, however, has remained unclear. Therefore, we set out to identify the enzymes involved in the β-oxidation of PB. We used cells deficient in specific steps of fatty acid β-oxidation and ultra-HPLC to measure which enzymes were able to convert PB or its downstream products. We show that the first step in PB oxidation is catalyzed solely by the enzyme, medium-chain acyl-CoA dehydrogenase. The second (hydration) step can be catalyzed by all three mitochondrial enoyl-CoA hydratase enzymes, i.e., short-chain enoyl-CoA hydratase, long-chain enoyl-CoA hydratase, and 3-methylglutaconyl-CoA hydratase. Enzymes involved in the third step include both short- and long-chain 3-hydroxyacyl-CoA dehydrogenase. The oxidation of PB is completed by only one enzyme, i.e., long-chain 3-ketoacyl-CoA thiolase. Taken together, the enzymatic characteristics of the PB degradative pathway may lead to better dose finding and limiting the toxicity of this drug. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
Dioxygen Binding, Activation, and Reduction to H2O by Cu Enzymes.
Solomon, Edward I
2016-07-05
Oxygen intermediates in copper enzymes exhibit unique spectroscopic features that reflect novel geometric and electronic structures that are key to reactivity. This perspective will describe: (1) the bonding origin of the unique spectroscopic features of the coupled binuclear copper enzymes and how this overcomes the spin forbiddenness of O2 binding and activates monooxygenase activity, (2) how the difference in exchange coupling in the non-coupled binuclear Cu enzymes controls the reaction mechanism, and (3) how the trinuclear Cu cluster present in the multicopper oxidases leads to a major structure/function difference in enabling the irreversible reductive cleavage of the O-O bond with little overpotential and generating a fully oxidized intermediate, different from the resting enzyme studied by crystallography, that is key in enabling fast PCET in the reductive half of the catalytic cycle.
Turner, Emma L; Malo, Mackenzie E; Pisclevich, Marnie G; Dash, Megan D; Davies, Gerald F; Arnason, Terra G; Harkness, Troy A A
2010-10-01
The anaphase-promoting complex (APC), a large evolutionarily conserved ubiquitin ligase complex, regulates cell cycle progression through mitosis and G(1). Here, we present data suggesting that APC-dependent cell cycle progression relies on a specific set of posttranslational histone-modifying enzymes. Multiple APC subunit mutants were impaired in total and modified histone H3 protein content. Acetylated H3K56 (H3K56(Ac)) levels were as reduced as those of total H3, indicating that loading histones with H3K56(Ac) is unaffected in APC mutants. However, under restrictive conditions, H3K9(Ac) and dimethylated H3K79 (H3K79(me2)) levels were more greatly reduced than those of total H3. In a screen for histone acetyltransferase (HAT) and histone deacetylase (HDAC) mutants that genetically interact with the apc5(CA) (chromatin assembly) mutant, we found that deletion of GCN5 or ELP3 severely hampered apc5(CA) temperature-sensitive (ts) growth. Further analyses showed that (i) the elp3Δ gcn5Δ double mutant ts defect was epistatic to that observed in apc5(CA) cells; (ii) gcn5Δ and elp3Δ mutants accumulate in mitosis; and (iii) turnover of the APC substrate Clb2 is not impaired in elp3Δ gcn5Δ cells. Increased expression of ELP3 and GCN5, as well as genes encoding the HAT Rtt109 and the chromatin assembly factors Msi1 and Asf1, suppressed apc5(CA) defects, while increased APC5 expression partially suppressed elp3Δ gcn5Δ growth defects. Finally, we demonstrate that Gcn5 is unstable during G(1) and following G(1) arrest and is stabilized in APC mutants. We present our working model in which Elp3/Gcn5 and the APC work together to facilitate passage through mitosis and G(1). To progress into S, we propose that at least Gcn5 must then be targeted for degradation in an APC-dependent fashion.
A magnetic tri-enzyme nanobiocatalyst for fruit juice clarification.
Sojitra, Uttam V; Nadar, Shamraja S; Rathod, Virendra K
2016-12-15
The major complications in fruit juice quality improvement are the presence of polysaccharides components in the form of disrupted fruit cell wall and cell materials. Hence, breakdown of cellulose along with pectin and starch is important for the juice processing. In this context, magnetic tri-enzyme nanobiocatalyst was prepared by simultaneously co-immobilizing three enzymes; α-amylase, pectinase and cellulase onto amino-functionalized magnetic nanoparticle by 60mM glutaraldehyde concentration with 10h cross-linking time for one pot juice clarification. The prepared nanobiocatalyst was characterized by FT-IR, SEM and XRD. The thermal (50-70°C) and pH (3-6) stability studies indicated more than two folds increment in half-life and enhanced tolerance to lower pH. The immobilized enzymes retained up to 75% of residual activity even after eight consecutive cycles of reuse. Finally, the clarification of apple, grapes and pineapple juices using magnetic tri-enzyme showed 41%, 46% and 53% respective reduction in turbidity till 150min treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mata-Sotres, José Antonio; Moyano, Francisco Javier; Martínez-Rodríguez, Gonzalo; Yúfera, Manuel
2016-07-01
In order to identify daily changes in digestive physiology in developing gilthead seabream larvae, the enzyme activity (trypsin, lipases and α-amylase) and gene expression (trypsinogen-try, chymotrypsinogen-ctrb, bile salt-activated lipase-cel1b, phospholipase A2-pla2 and α-amylase-amy2a) were measured during a 24h cycle in larvae reared under a 12h light/12h dark photoperiod. Larvae were sampled at 10, 18, 30 and 60days post-hatch. In each sampling day, larvae were sampled every 3h during a complete 24h cycle. The enzyme activity and gene expression exhibited a marked dependent behavior to the light/darkness cycle in all tested ages. The patterns of activity and expression of all tested enzymes were compared to the feeding pattern found in the same larvae, which showed a rhythmic feeding pattern with a strong light synchronization. In the four tested ages, the activities of trypsin, and to a lesser extent lipases and amylase, were related to feeding activity. Molecular expression of the pancreatic enzymes tended to increase during the night, probably as an anticipation of the forthcoming ingestion of food that will take place during the next light period. It follows that the enzymatic activities are being regulated at translational and/or post-translational level. The potential variability of enzyme secretion along the whole day is an important factor to take into account in future studies. A particularly striking consequence of the present results is the reliability of studies based in only one daily sample taken at the same hour of the day, as those focused to assess ontogeny of digestive enzymes. Copyright © 2016 Elsevier Inc. All rights reserved.
Highlights of the DNA cutters: a short history of the restriction enzymes
Loenen, Wil A. M.; Dryden, David T. F.; Raleigh, Elisabeth A.; Wilson, Geoffrey G.; Murray, Noreen E.
2014-01-01
In the early 1950’s, ‘host-controlled variation in bacterial viruses’ was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine. PMID:24141096
Sucharitakul, Jeerus; Tongsook, Chanakan; Pakotiprapha, Danaya; van Berkel, Willem J. H.; Chaiyen, Pimchai
2013-01-01
3-Hydroxybenzoate 6-hydroxylase (3HB6H) from Rhodococcus jostii RHA1 is an NADH-specific flavoprotein monooxygenase that catalyzes the para-hydroxylation of 3-hydroxybenzoate (3HB) to form 2,5-dihydroxybenzoate (2,5-DHB). Based on results from stopped-flow spectrophotometry, the reduced enzyme-3HB complex reacts with oxygen to form a C4a-peroxy flavin with a rate constant of 1.13 ± 0.01 × 106 m−1 s−1 (pH 8.0, 4 °C). This intermediate is subsequently protonated to form a C4a-hydroperoxyflavin with a rate constant of 96 ± 3 s−1. This step shows a solvent kinetic isotope effect of 1.7. Based on rapid-quench measurements, the hydroxylation occurs with a rate constant of 36 ± 2 s−1. 3HB6H does not exhibit substrate inhibition on the flavin oxidation step, a common characteristic found in most ortho-hydroxylation enzymes. The apparent kcat at saturating concentrations of 3HB, NADH, and oxygen is 6.49 ± 0.02 s−1. Pre-steady state and steady-state kinetic data were used to construct the catalytic cycle of the reaction. The data indicate that the steps of product release (11.7 s−1) and hydroxylation (36 ± 2 s−1) partially control the overall turnover. PMID:24129570
Marine-derived fungi: diversity of enzymes and biotechnological applications
Bonugli-Santos, Rafaella C.; dos Santos Vasconcelos, Maria R.; Passarini, Michel R. Z.; Vieira, Gabriela A. L.; Lopes, Viviane C. P.; Mainardi, Pedro H.; dos Santos, Juliana A.; de Azevedo Duarte, Lidia; Otero, Igor V. R.; da Silva Yoshida, Aline M.; Feitosa, Valker A.; Pessoa, Adalberto; Sette, Lara D.
2015-01-01
The ocean is considered to be a great reservoir of biodiversity. Microbial communities in marine environments are ecologically relevant as intermediaries of energy, and play an important role in nutrient regeneration cycles as decomposers of dead and decaying organic matter. In this sense, marine-derived fungi can be considered as a source of enzymes of industrial and/or environmental interest. Fungal strains isolated from different substrates, such as invertebrates, decaying wood, seawater, sediments, and mangrove detritus, have been reported to be producers of hydrolytic and/or oxidative enzymes, with alginate lyase, amylase, cellulase, chitinase, glucosidase, inulinase, keratinase, ligninase, lipase, nuclease, phytase, protease, and xylanase being among the enzymes produced by fungi of marine origin. These enzymes present temperature and pH optima ranging from 35 to 70∘C, and 3.0 to 11.0, respectively. High-level production in bioreactors is mainly performed using submerged-state fermentation. Certain marine-derived fungal strains present enzymes with alkaline and cold-activity characteristics, and salinity is considered an important condition in screening and production processes. The adaptability of marine-derived fungi to oceanic conditions can be considered an attractive point in the field of fungal marine biotechnology. In this review, we focus on the advances in discovering enzymes from marine-derived fungi and their biotechnological relevance. PMID:25914680
MICROBIAL ENZYME ACTIVITY FOR CHARACTERIZING NUTRIENT LOADING TO GREAT LAKES COASTAL WETLANDS
Energy and material flows in aquatic ecosystems are mediated by microbial carbon and nutrient cycling. Extracellular enzymes produced by the microbial community aid in the degradation of organic matter and the resultant acquisition of limiting nutrients. Organic carbon sequestrat...
McCommis, Kyle S.; Chen, Zhouji; Fu, Xiaorong; McDonald, William G.; Colca, Jerry R.; Kletzien, Rolf F.; Burgess, Shawn C.; Finck, Brian N.
2015-01-01
SUMMARY Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite step for gluconeogenesis in hepatocytes, which is important for maintenance of normoglycemia during prolonged food deprivation, but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2−/−) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte pyruvate metabolism, labelled pyruvate conversion to TCA cycle intermediates and glucose, and glucose production from pyruvate. Unbiased metabolomic analyses of livers from fasted LS-Mpc2−/− mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2−/− hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. PMID:26344101
A role for cytosolic fumarate hydratase in urea cycle metabolism and renal neoplasia.
Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O'Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J
2013-05-30
The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Enzyme dynamics in paddy soils of the rice district (NE Italy) under different cropping patterns
NASA Astrophysics Data System (ADS)
Bini, Claudio; Nadimi-Goki, Mandana; Kato, Yoichi; Fornasier, Flavio; Wahsha, Mohammad; Spiandorello, Massimo
2014-05-01
The recent widespread interest on soil enzymes is due to the need to develop sensitive indicators of soil quality that reflect the effects of land management on soil and assist land managers in promoting long-term sustainability of terrestrial ecosystems. The activities of six important enzymes involved in C, N, P, and S cycling were investigated in a paddy soil from the Veneto region, Italy, in four different rotation systems (rice-rice-rice: R-R-R; soya-rice-rice: S-R-R; fallow-rice: F-R; pea-soya-rice: P-S-R) with three replications in April (after field preparation, field moist condition), June (after seedling, waterlogged soil condition), August (after tillering stage of rice, waterlogged soil condition) and October (after rice harvesting, drained soil condition) over the 2012 growing season. Our results demonstrated that enzyme activities varied with rotation systems and growth stages in paddy soil. Compared with field moist soil, drained soil condition resulted in a significant increase (P < 0.05) of β-glucosidase, arylsulfatase, alkaline and acid phosphatases, leucine aminopeptidase (except of fallow-rice), and chitinase activities in all rotations, while compared with drained soil, early waterlogging (in month of June) significantly decreased (P moist soil> late waterlogged>early waterlogged. There was an inhibitory effect of waterlogging (except P-S-R rotation) for both alkaline and acid phosphatases due to high pH and redox conditions. However, the response of enzymes to waterlogging differed with the chemical species and the cropping pattern. The best rotation system for chitinase, leucine aminopeptidase and β-glucosidase activity (C and N cycles) proved R-R-R, while for arylsulfatase, alkaline and acid phosphatases (P and S cycles) it was the S-R-R. Key Words: enzyme activity, paddy soil, Crop Rotation System, Italy __ Corresponding Author: Mandana Nadimi-Goki, Tel.: +39 3891356251 E-mail address: mandy.nadimi@gmail.com
Phosphatidylcholine and the CDP-Choline Cycle
Fagone, Paolo; Jackowski, Suzanne
2012-01-01
The CDP-choline pathway of phosphatidylcholine (PtdCho) biosynthesis was first described more than 50 years ago. Investigation of the CDP-choline pathway in yeast provides a basis for understanding the CDP-choline pathway in mammals. PtdCho is considered as an intermediate in a cycle of synthesis and degradation, and the activity of a CDP-choline cycle is linked to subcellular membrane lipid movement. The components of the mammalian CDP-choline pathway include choline transport, choline kinase, phosphocholine cytidylyltransferase, and choline phosphotransferase activities. The protein isoforms and biochemical mechanisms of regulation of the pathway enzymes are related to their cell and tissue-specific functions. Regulated PtdCho turnover mediated by phospholipases or neuropathy target esterase participates in the mammalian CDP-choline cycle. Knockout mouse models define the biological functions of the CDP-choline cycle in mammalian cells and tissues. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:23010477
Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun
2015-01-01
The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player. PMID:26247588
Strong Effects of a Shelfbreak Jet on Microbial Enzyme Activities
NASA Astrophysics Data System (ADS)
Hoarfrost, A.; Balmonte, J. P.; Ziervogel, K.; Ghobrial, S.; Gawarkiewicz, G.; Arnosti, C.
2016-02-01
The activities of extracellular enzymes are critical in initiating microbial cycling of organic carbon, yet the dynamics of heterotrophic enzyme activities in marine environments are still poorly understood. Variations at a given site in rates of activity and the spectrum of organic substrates hydrolyzed may depend upon environmental context. We measured the extracellular enzymatic hydrolysis of 13 high- and low-molecular-weight organic substrates in surface and bottom waters along a closely spaced 4-station transect at 71 W on the North Atlantic continental shelf, in the vicinity of the shelfbreak front. This transect intersects a robust upwelling cell that typically shows high biologic productivity, and is locatable by changes in T/S profiles and chl a concentrations along sharp spatial gradients. At the time of sampling, cold pool waters over the continental shelf were relatively cold, 3.5 Deg. C, compared to 12 Deg. C over the upper continental slope. Satellite thermal imagery indicated that shelf water extended offshore and interacted with a large crest of the Gulf Stream. The surface and bottom waters associated with the upwelling jet were characterized by enzyme activities a factor of 20 more rapid than closer inshore waters, and surface water chl a concentrations that were two to three times higher than the inshore waters. The spectrum of enzyme activities also differed markedly between surface and bottom waters both within the jet and at near-shore stations. Microbial extracellular enzymatic activities were strongly influenced by differences in their environmental context along the continental slope and shelfbreak front. Constraining the factors controlling heterotrophic activity across the diverse marine environment is an important step in understanding microbial controls on carbon cycling.
Adult onset urea cycle disorder in a patient with presumed hepatic encephalopathy.
Atiq, Muslim; Holt, Andrew F; Safdar, Kamran; Weber, Frederick; Ravinuthala, Ravi; Jonas, Mark E; Neff, Guy W
2008-02-01
Deficiency of any of the 5 enzymes in the urea cycle results in the accumulation of ammonia, leading to encephalopathy; which if untreated, can be lethal and produce devastating neurologic sequelae in long-term survivors. We hereby present an interesting case that presented with hyperammonemia and encephalopathy; later found to have an urea cycle defect.
NADPH oxidase: an enzyme for multicellularity?
Lalucque, Hervé; Silar, Philippe
2003-01-01
Multicellularity has evolved several times during the evolution of eukaryotes. One evolutionary pressure that permits multicellularity relates to the division of work, where one group of cells functions as nutrient providers and the other in specialized roles such as defence or reproduction. This requires signalling systems to ensure harmonious development of multicellular structures. Here, we show that NADPH oxidases are specifically present in organisms that differentiate multicellular structures during their life cycle and are absent from unicellular life forms. The biochemical properties of these enzymes make them ideal candidates for a role in intercellular signalling.
Natural variations in xenobiotic-metabolizing enzymes: developing tools for coral monitoring
NASA Astrophysics Data System (ADS)
Rougée, L. R. A.; Richmond, R. H.; Collier, A. C.
2014-06-01
The continued deterioration of coral reefs worldwide demonstrates the need to develop diagnostic tools for corals that go beyond general ecological monitoring and can identify specific stressors at sublethal levels. Cellular diagnostics present an approach to defining indicators (biomarkers) that have the potential to reflect the impact of stress at the cellular level, allowing for the detection of intracellular changes in corals prior to outright mortality. Detoxification enzymes, which may be readily induced or inhibited by environmental stressors, present such a set of indicators. However, in order to apply these diagnostic tools for the detection of stress, a detailed understanding of their normal, homeostatic levels within healthy corals must first be established. Herein, we present molecular and biochemical evidence for the expression and activity of major Phase I detoxification enzymes cytochrome P450 (CYP450), CYP2E1, and CYP450 reductase, as well as the Phase II enzymes UDP, glucuronosyltransferase (UGT), β-glucuronidase, glutathione- S-transferase (GST), and arylsulfatase C (ASC) in the coral Pocillopora damicornis. Additionally, we characterized enzyme expression and activity variations over a reproductive cycle within a coral's life history to determine natural endogenous changes devoid of stress exposure. Significant changes in enzyme activity over the coral's natural lunar reproductive cycle were observed for CYP2E1 and CYP450 reductase as well as UGT and GST, while β-glucuronidase and ASC did not fluctuate significantly. The data represent a baseline description of `health' for the expression and activity of these enzymes that can be used toward understanding the impact of environmental stressors on corals. Such knowledge can be applied to address causes of coral reef ecosystem decline and to monitor effectiveness of mitigation strategies. Achieving a better understanding of cause-and-effect relationships between putative stressors and biological
Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...
NASA Astrophysics Data System (ADS)
Zhu, Xing; He, Bin; Zhao, Changwen; Ma, Yuhong; Yang, Wantai
2018-04-01
Developing facile and mild strategy to construct multi-enzymes immobilization system has attracted considerable attentions in recent years. Here a simple immobilization strategy called visible light induced graft polymerization that can simultaneously and separately encapsulate two kinds of enzymes on one polymer film was proposed. Two incompatible enzymes, trypsin and transglutaminase (TGase) were selected as model dual-enzymes system and simultaneously immobilized on two sides of low-density polyethylene (LDPE) film. After immobilization, it was found that more than 90% of the enzymes can be embedded into dual-enzymes loaded film without leakage. And the activities of both separately immobilized enzymes were higher than the activities of mixed co-immobilized enzymes or the sequential immobilized ones. This dual-enzymes loaded film (DEL film) showed excellent recyclability and can retain >87% activities of both enzymes after 4 cycles of utilization. As an example, this DEL film was used to conjugate a prodrug of cytarabine with a target peptide. The successful preparation of expected product demonstrated that the separately immobilized two enzymes can worked well together to catalyze a two-step reaction.
Gibson, Gary E.; Xu, Hui; Chen, Huan-Lian; Chen, Wei; Denton, Travis; Zhang, Sheng
2015-01-01
Reversible post-translation modifications of proteins are common in all cells and appear to regulate many processes. Nevertheless, the enzyme(s) responsible for the alterations and the significance of the modification are largely unknown. Succinylation of proteins occurs and causes large changes in the structure of proteins; however, the source of the succinyl groups, the targets, and the consequences of these modifications on other proteins are unknown. These studies focused on succinylation of mitochondrial proteins. The results demonstrate that the α-ketoglutarate dehydrogenase complex (KGDHC) can serve as a trans-succinylase that mediates succinylation in an α-ketoglutarate-dependent manner. Inhibition of KGDHC reduced suc-cinylation of both cytosolic and mitochondrial proteins in cultured neurons and in a neuronal cell line. Purified KGDHC can succinylate multiple proteins including other enzymes of the tricarboxylic acid (TCA) cycle leading to modification of their activity. Inhibition of KGDHC also modifies acetylation by modifying the pyruvate dehydrogenase complex. The much greater effectiveness of KGDHC than succinyl CoA suggests that the catalysis due to the E2k suc-cinyltransferase is important. Succinylation appears to be a major signaling system and it can be mediated by KGDHC. PMID:25772995
NASA Astrophysics Data System (ADS)
Strick, Terence R.; Charvin, Gilles; Dekker, Nynke H.; Allemand, Jean-François; Bensimon, David; Croquette, Vincent
In this article, we describe single-molecule assays using magnetic traps and we applied these assays to topoisomerase enzymes which unwind and disentangle DNA molecules. First, the elasticity of single DNA molecule is characterized using the magnetic trap. We show that a twisting constraint may be easily applied and that its effect upon DNA may be measured accurately. Then we describe how the topoisomerase activity may be observed at the single-molecule level giving direct access to the important biological parameters of the enzyme such as velocity and processivity. Furthermore, individual cycles of unwinding can be observed in real time. This permits an accurate characterization of the enzyme's biochemical cycle. The data treatment required to identify and analyze individual topoisomerization cycles will be presented in detail. This analysis is applicable to a wide variety of molecular motors. To cite this article: T.R. Strick et al., C. R. Physique 3 (2002) 595-618.
The γ-Glutamyl Cycle in the Choroid Plexus: Its Possible Function in Amino Acid Transport
Tate, Suresh S.; Ross, Leonard L.; Meister, Alton
1973-01-01
Various anatomic regions of rabbit brain have been examined for activities of the enzymes of the γ-glutamyl cycle. While these enzyme activities were widely distributed in the brain, they are present in much higher concentrations in the choroid plexus than in other parts of the brain. The activities observed are of about the same order of magnitude as found in the kidney. These observations and other considerations suggest that the γ-glutamyl cycle may play a significant role in the transport of amino acids between blood and cerebrospinal fluid. PMID:4145786
Adewale, Peter; Dumont, Marie-Josée; Ngadi, Michael
2015-11-01
The use of ultrasonic processing was evaluated for its ability to achieve adequate mixing while providing sufficient activation energy for the enzymatic transesterification of waste tallow. The effects of ultrasonic parameters (amplitude, cycle and pulse) and major reaction factors (molar ratio and enzyme concentration) on the reaction kinetics of biodiesel generation from waste tallow bio-catalyzed by immobilized lipase [Candida antarctica lipase B (CALB)] were investigated. Three sets of experiments namely A, B, and C were conducted. In experiment set A, two factors (ultrasonic amplitude and cycle) were investigated at three levels; in experiment set B, two factors (molar ratio and enzyme concentration) were examined at three levels; and in experiment set C, two factors (ultrasonic amplitude and reaction time) were investigated at five levels. A Ping Pong Bi Bi kinetic model approach was employed to study the effect of ultrasonic amplitude on the enzymatic transesterification. Kinetic constants of transesterification reaction were determined at different ultrasonic amplitudes (30%, 35%, 40%, 45%, and 50%) and enzyme concentrations (4, 6, and 8 wt.% of fat) at constant molar ratio (fat:methanol); 1:6, and ultrasonic cycle; 5 Hz. Optimal conditions for ultrasound-assisted biodiesel production from waste tallow were fat:methanol molar ratio, 1:4; catalyst level 6% (w/w of fat); reaction time, 20 min (30 times less than conventional batch processes); ultrasonic amplitude 40% at 5 Hz. The kinetic model results revealed interesting features of ultrasound assisted enzyme-catalyzed transesterification (as compared to conventional system): at ultrasonic amplitude 40%, the reaction activities within the system seemed to be steady after 20 min which means the reaction could proceed with or without ultrasonic mixing. Reversed phase high performance liquid chromatography indicated the biodiesel yield to be 85.6±0.08%. Copyright © 2015 Elsevier B.V. All rights reserved.
Hatazawa, Yukino; Minami, Kimiko; Yoshimura, Ryoji; Onishi, Takumi; Manio, Mark Christian; Inoue, Kazuo; Sawada, Naoki; Suzuki, Osamu; Miura, Shinji; Kamei, Yasutomi
2016-12-09
The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared with that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α's function in the oxidative energy metabolism of skeletal muscles. Copyright © 2016 Elsevier Inc. All rights reserved.
Hung, Chun-Hsien; Kanehara, Kazue; Nakamura, Yuki
2016-09-01
Triacylglycerol (TAG), a major source of biodiesel production, accumulates in nitrogen-starved Chlamydomonas reinhardtii. However, the metabolic pathway of starch-to-TAG conversion remains elusive because an enzyme that affects the starch degradation is unknown. Here, we isolated a new class of mutant bgal1, which expressed an overaccumulation of starch granules and defective photosynthetic growth. The bgal1 was a null mutant of a previously uncharacterized β-galactosidase-like gene (Cre02.g119700), which decreased total β-galactosidase activity 40% of the wild type. Upon nitrogen starvation, the bgal1 mutant showed decreased TAG accumulation mainly due to the reduced flux of de novo TAG biosynthesis evidenced by increased unsaturation of fatty acid composition in TAG and reduced TAG accumulation by additional supplementation of acetate to the culture media. Metabolomic analysis of the bgal1 mutant showed significantly reduced levels of metabolites following the hydrolysis of starch and substrates for TAG accumulation, whereas metabolites in TCA cycle were unaffected. Upon nitrogen starvation, while levels of glucose 6-phosphate, fructose 6-phosphate and acetyl-CoA remained lower, most of the other metabolites in glycolysis were increased but those in the TCA cycle were decreased, supporting TAG accumulation. We suggest that BGAL1 may be involved in the degradation of starch, which affects TAG accumulation in nitrogen-starved C. reinhardtii. This article is part of a Special Issue entitled: Plant Lipid Biology edited by Kent D. Chapman and Ivo Feussner. Copyright © 2016 Elsevier B.V. All rights reserved.
Lee, Hooi Xian; Ahmad, Fisal; Saad, Bahruddin; Ismail, Mohd Nazri
2017-11-26
Date fruits are well known to be very nutritious. Nevertheless, the protein contents of the fruit, particularly the seed and flesh, are still understudied, largely due to their difficult physical characteristics. This study was conducted to compare three different protein extraction methods which were the trichloroacetic acid (TCA)-acetone (TCA-A), phenol (Phe), and TCA-acetone-phenol (TCA-A-Phe), and to perform proteomic analysis on date palm seed and flesh. Phe extraction method showed the highest protein yields for both seed (8.26 mg/g) and flesh (1.57 mg/g). Through sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Phe, and TCA-A-Phe extraction methods were shown to be efficient in removing interfering compounds and gave well-resolved bands over a wide range of molecular weights. Following liquid chromatography-tandem mass spectrometry analysis, about 50-64% of extracted proteins were identified with known functions including those involved in glycolysis, Krebs cycle, defense, and storage. Phe protein extraction method was proven to be the optimal method for date flesh and seed.
Keomanivong, F E; Grazul-Bilska, A T; Redmer, D A; Bass, C S; Kaminski, S L; Borowicz, P P; Kirsch, J D; Swanson, K C
2017-04-01
To determine the effect of feed intake and arginine treatment during different stages of the estrous cycle on pancreatic mass, digestive enzyme activity, and histological measurements, ewes (n = 120) were randomly allocated to 1 of 3 dietary groups; control (CON; 2.14-Mcal metabolizable energy/kg), underfed (UF; 0.6 × CON), or overfed (OF; 2 × CON) over 2 yr. Estrus was synchronized using a controlled internal drug release device for 14 d. At controlled internal drug release withdrawal, ewes from each dietary group were assigned to 1 of 2 treatments; Arg (L-Arg HCl, 155-μmol/kg BW) or Sal (approximately 10-mL saline). Treatments were administered 3 times daily via jugular catheter and continued until slaughter on d (day) 5 and 10 of the second estrus cycle (early luteal phase, n = 41 and mid-luteal phase, n = 39; yr 1) and d 15 of the first estrus cycle (late luteal phase, n = 40; yr 2). A blood sample collected from jugular catheters for serum insulin analysis before slaughter. The pancreas was then removed, trimmed of mesentery and fat, weighed, and a sample snap-frozen until enzyme analysis. Additional pancreatic samples were fixed in 10% formalin solution for histological examination of size and distribution of insulin-containing cell clusters. Data were analyzed as a completely randomized design with a factorial arrangement of treatments. Diet, treatment, and diet × treatment were blocked by yr and included in the model with initial BW used as a covariate. Day of the estrous cycle was initially included in the model but later removed as no effects (P > 0.10) were observed for any pancreatic variables tested. Overfed ewes had the greatest (P < 0.001) change in BW, final BW, change in BCS, and final BCS. A diet × treatment interaction was observed for change in BW and final BW (P ≤ 0.004). Overfed and CON had increased (P < 0.001) pancreas weight (g) compared with UF ewes. Protein concentration (g/pancreas) was the lowest (P < 0.001) in UF ewes, whereas
Activation energy of extracellular enzymes in soils from different biomes.
Steinweg, J Megan; Jagadamma, Sindhu; Frerichs, Joshua; Mayes, Melanie A
2013-01-01
Enzyme dynamics are being incorporated into soil carbon cycling models and accurate representation of enzyme kinetics is an important step in predicting belowground nutrient dynamics. A scarce number of studies have measured activation energy (Ea) in soils and fewer studies have measured Ea in arctic and tropical soils, or in subsurface soils. We determined the Ea for four typical lignocellulose degrading enzymes in the A and B horizons of seven soils covering six different soil orders. We also elucidated which soil properties predicted any measurable differences in Ea. β-glucosidase, cellobiohydrolase, phenol oxidase and peroxidase activities were measured at five temperatures, 4, 21, 30, 40, and 60°C. Ea was calculated using the Arrhenius equation. β-glucosidase and cellobiohydrolase Ea values for both A and B horizons in this study were similar to previously reported values, however we could not make a direct comparison for B horizon soils because of the lack of data. There was no consistent relationship between hydrolase enzyme Ea and the environmental variables we measured. Phenol oxidase was the only enzyme that had a consistent positive relationship between Ea and pH in both horizons. The Ea in the arctic and subarctic zones for peroxidase was lower than the hydrolases and phenol oxidase values, indicating peroxidase may be a rate limited enzyme in environments under warming conditions. By including these six soil types we have increased the number of soil oxidative enzyme Ea values reported in the literature by 50%. This study is a step towards better quantifying enzyme kinetics in different climate zones.
Helman, Guy; Pacheco-Colón, Ileana; Gropman, Andrea L
2014-07-01
The urea cycle is the primary nitrogen-disposal pathway in humans. It requires the coordinated function of six enzymes and two mitochondrial transporters to catalyze the conversion of a molecule of ammonia, the α-nitrogen of aspartate, and bicarbonate into urea. Whereas ammonia is toxic, urea is relatively inert, soluble in water, and readily excreted by the kidney in the urine. Accumulation of ammonia and other toxic intermediates of the cycle lead to predominantly neurologic sequelae. The disorders may present at any age from the neonatal period to adulthood, with the more severely affected patients presenting earlier in life. Patients are at risk for metabolic decompensation throughout life, often triggered by illness, fasting, surgery and postoperative states, peripartum, stress, and increased exogenous protein load. Here the authors address neurologic presentations of ornithine transcarbamylase deficiency in detail, the most common of the urea cycle disorders, neuropathology, neurophysiology, and our studies in neuroimaging. Special attention to late-onset presentations is given. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Overcoming substrate limitations for improved production of ethylene in E. coli.
Lynch, Sean; Eckert, Carrie; Yu, Jianping; Gill, Ryan; Maness, Pin-Ching
2016-01-01
Ethylene is an important industrial compound for the production of a wide variety of plastics and chemicals. At present, ethylene production involves steam cracking of a fossil-based feedstock, representing the highest CO2-emitting process in the chemical industry. Biological ethylene production can be achieved via expression of a single protein, the ethylene-forming enzyme (EFE), found in some bacteria and fungi; it has the potential to provide a sustainable alternative to steam cracking, provided that significant increases in productivity can be achieved. A key barrier is determining factors that influence the availability of substrates for the EFE reaction in potential microbial hosts. In the presence of O2, EFE catalyzes ethylene formation from the substrates α-ketoglutarate (AKG) and arginine. The concentrations of AKG, a key TCA cycle intermediate, and arginine are tightly controlled by an intricate regulatory system that coordinates carbon and nitrogen metabolism. Therefore, reliably predicting which genetic changes will ultimately lead to increased AKG and arginine availability is challenging. We systematically explored the effects of media composition (rich versus defined), gene copy number, and the addition of exogenous substrates and other metabolites on the formation of ethylene in Escherichia coli expressing EFE. Guided by these results, we tested a number of genetic modifications predicted to improve substrate supply and ethylene production, including knockout of competing pathways and overexpression of key enzymes. Several such modifications led to higher AKG levels and higher ethylene productivity, with the best performing strain more than doubling ethylene productivity (from 81 ± 3 to 188 ± 13 nmol/OD600/mL). Both EFE activity and substrate supply can be limiting factors in ethylene production. Targeted modifications in central carbon metabolism, such as overexpression of isocitrate dehydrogenase, and deletion of glutamate synthase or the
A short history of RubisCO: the rise and fall (?) of Nature's predominant CO2 fixing enzyme.
Erb, Tobias J; Zarzycki, Jan
2018-02-01
Ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) is arguably one of the most abundant proteins in the biosphere and a key enzyme in the global carbon cycle. Although RubisCO has been intensively studied, its evolutionary origins and rise as Nature's most dominant carbon dioxide (CO 2 )-fixing enzyme still remain in the dark. In this review we will bring together biochemical, structural, physiological, microbiological, as well as phylogenetic data to speculate on the evolutionary roots of the CO 2 -fixation reaction of RubisCO, the emergence of RubisCO-based autotrophic CO 2 -fixation in the context of the Calvin-Benson-Bassham cycle, and the further evolution of RubisCO into the 'RubisCOsome', a complex of various proteins assembling and interacting with the enzyme to improve its operational capacity (functionality) under different biological and environmental conditions. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E
2017-06-01
The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.
Enzyme efficiency: An open reaction system perspective
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee, Kinshuk, E-mail: kb36@rice.edu; Bhattacharyya, Kamal, E-mail: pchemkb@gmail.com
2015-12-21
A measure of enzyme efficiency is proposed for an open reaction network that, in suitable form, applies to closed systems as well. The idea originates from the description of classical enzyme kinetics in terms of cycles. We derive analytical expressions for the efficiency measure by treating the network not only deterministically but also stochastically. The latter accounts for any significant amount of noise that can be present in biological systems and hence reveals its impact on efficiency. Numerical verification of the results is also performed. It is found that the deterministic equation overestimates the efficiency, the more so for verymore » small system sizes. Roles of various kinetics parameters and system sizes on the efficiency are thoroughly explored and compared with the standard definition k{sub 2}/K{sub M}. Study of substrate fluctuation also indicates an interesting efficiency-accuracy balance.« less
PEPCK-M expression in mouse liver potentiates, not replaces, PEPCK-C mediated gluconeogenesis
Méndez-Lucas, Andrés; Duarte, João; Sunny, Nishanth E.; Satapati, Santhosh; He, TianTeng; Fu, Xiaorong; Bermúdez, Jordi; Burgess, Shawn C.; Perales, Jose C.
2013-01-01
Background & Aims Hepatic gluconeogenesis helps maintain systemic energy homeostasis by compensating for discontinuities in nutrient supply. Liver specific deletion of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) abolishes gluconeogenesis from mitochondrial substrates, deregulates lipid metabolism and affects TCA cycle. While, mouse liver almost exclusively expresses PEPCK-C, humans equally present a mitochondrial isozyme (PEPCK-M). Despite clear relevance to human physiology, the role of PEPCK-M and its gluconeogenic potential remain unknown. Here, we test the significance of PEPCK-M in gluconeogenesis and TCA cycle function in liver-specific PEPCK-C knockout and WT mice. Methods The effects of the overexpression of PEPCK-M were examined by a combination of tracer studies and molecular biology techniques. Partial PEPCK-C re-expression was used as a positive control. Metabolic fluxes were evaluated in isolated livers by NMR using 2H and 13C tracers. Gluconeogenic potential, together with metabolic profiling, were investigated in vivo and in primary hepatocytes. Results PEPCK-M expression partially rescued defects in lipid metabolism, gluconeogenesis and TCA cycle function impaired by PEPCK-C deletion, while ~10% re-expression of PEPCK-C normalized most parameters. When PEPCK-M was expressed in the presence of PEPCK-C, the mitochondrial isozyme amplified total gluconeogenic capacity, suggesting autonomous regulation of oxaloacetate to phosphoenolpyruvate fluxes by the individual isoforms. Conclusions We conclude that PEPCK-M has gluconeogenic potential per se, and cooperates with PEPCK-C to adjust gluconeogenic/TCA flux to changes in substrate or energy availability, hinting at a role in the regulation of glucose and lipid metabolism in human liver. PMID:23466304
Statistical optimization of arsenic biosorption by microbial enzyme via Ca-alginate beads.
Banerjee, Suchetana; Banerjee, Anindita; Sarkar, Priyabrata
2018-04-16
Bioremediation of arsenic using green technology via microbial enzymes has attracted scientists due to its simplicity and cost effectiveness. Statistical optimization of arsenate bioremediation was conducted by the enzyme arsenate reductase extracted from arsenic tolerant bacterium Pseudomonas alcaligenes. Response surface methodology based on Box-Behnken design matrix was performed to determine the optimal operational conditions of a multivariable system and their interactive effects on the bioremediation process. The highest biosorptive activity of 96.2 µg gm -1 of beads was achieved under optimized conditions (pH = 7.0; As (V) concentration = 1000 ppb; time = 2 h). SEM analysis showed the morphological changes on the surface of enzyme immobilized gluteraldehyde crosslinked Ca-alginate beads. The immobilized enzyme retained its activity for 8 cycles. ANOVA with a high correlation coefficient (R 2 > 0.99) and lower "Prob > F"value (<0.0001) corroborated the second-order polynomial model for the biosorption process. This study on the adsorptive removal of As (V) by enzyme-loaded biosorbent revealed a possible way of its application in large scale treatment of As (V)-contaminated water bodies.
Bate, Paul; Warwicker, Jim
2004-07-02
Calculations of charge interactions complement analysis of a characterised active site, rationalising pH-dependence of activity and transition state stabilisation. Prediction of active site location through large DeltapK(a)s or electrostatic strain is relevant for structural genomics. We report a study of ionisable groups in a set of 20 enzymes, finding that false positives obscure predictive potential. In a larger set of 156 enzymes, peaks in solvent-space electrostatic properties are calculated. Both electric field and potential match well to active site location. The best correlation is found with electrostatic potential calculated from uniform charge density over enzyme volume, rather than from assignment of a standard atom-specific charge set. Studying a shell around each molecule, for 77% of enzymes the potential peak is within that 5% of the shell closest to the active site centre, and 86% within 10%. Active site identification by largest cleft, also with projection onto a shell, gives 58% of enzymes for which the centre of the largest cleft lies within 5% of the active site, and 70% within 10%. Dielectric boundary conditions emphasise clefts in the uniform charge density method, which is suited to recognition of binding pockets embedded within larger clefts. The variation of peak potential with distance from active site, and comparison between enzyme and non-enzyme sets, gives an optimal threshold distinguishing enzyme from non-enzyme. We find that 87% of the enzyme set exceeds the threshold as compared to 29% of the non-enzyme set. Enzyme/non-enzyme homologues, "structural genomics" annotated proteins and catalytic/non-catalytic RNAs are studied in this context.
Inflammation and ER Stress Regulate Branched-Chain Amino Acid Uptake and Metabolism in Adipocytes
Burrill, Joel S.; Long, Eric K.; Reilly, Brian; Deng, Yingfeng; Armitage, Ian M.; Scherer, Philipp E.
2015-01-01
Inflammation plays a critical role in the pathology of obesity-linked insulin resistance and is mechanistically linked to the effects of macrophage-derived cytokines on adipocyte energy metabolism, particularly that of the mitochondrial branched-chain amino acid (BCAA) and tricarboxylic acid (TCA) pathways. To address the role of inflammation on energy metabolism in adipocytes, we used high fat-fed C57BL/6J mice and lean controls and measured the down-regulation of genes linked to BCAA and TCA cycle metabolism selectively in visceral but not in subcutaneous adipose tissue, brown fat, liver, or muscle. Using 3T3-L1 cells, TNFα, and other proinflammatory cytokine treatments reduced the expression of the genes linked to BCAA transport and oxidation. Consistent with this, [14C]-leucine uptake and conversion to triglycerides was markedly attenuated in TNFα-treated adipocytes, whereas the conversion to protein was relatively unaffected. Because inflammatory cytokines lead to the induction of endoplasmic reticulum stress, we evaluated the effects of tunicamycin or thapsigargin treatment of 3T3-L1 cells and measured a similar down-regulation in the BCAA/TCA cycle pathway. Moreover, transgenic mice overexpressing X-box binding protein 1 in adipocytes similarly down-regulated genes of BCAA and TCA metabolism in vivo. These results indicate that inflammation and endoplasmic reticulum stress attenuate lipogenesis in visceral adipose depots by down-regulating the BCAA/TCA metabolism pathway and are consistent with a model whereby the accumulation of serum BCAA in the obese insulin-resistant state is linked to adipose inflammation. PMID:25635940
Huang, Renliang; Wu, Mengyun; Goldman, Mark J; Li, Zhi
2015-06-01
Enzyme encapsulation is a simple, gentle, and general method for immobilizing enzyme, but it often suffers from one or more problems regarding enzyme loading efficiency, enzyme leakage, mechanical stability, and recyclability. Here we report a novel, simple, and efficient method for enzyme encapsulation to overcome these problems by forming stable organic-inorganic hybrid capsules. A new, facile, one-step, and template-free synthesis of organic-inorganic capsules in aqueous phase were developed based on PEI-induced simultaneous interfacial self-assembly of Fmoc-FF and polycondensation of silicate. Addition of an aqueous solution of Fmoc-FF and sodium silicate into an aqueous solution of PEI gave a new class of organic-inorganic hybrid capsules (FPSi) with multi-layered structure in high yield. The capsules are mechanically stable due to the incorporation of inorganic silica. Direct encapsulation of enzyme such as epoxide hydrolase SpEH and BSA along with the formation of the organic-inorganic capsules gave high yield of enzyme-containing capsules (∼1.2 mm in diameter), >90% enzyme loading efficiency, high specific enzyme loading (158 mg protein g(-1) carrier), and low enzyme leakage (<3% after 48 h incubation). FPSi-SpEH capsules catalyzed the hydrolysis of cyclohexene oxide to give (1R, 2R)-cyclohexane-1,2-diol in high yield and concentration, with high specific activity (6.94 U mg(-1) protein) and the same high enantioselectivity as the free enzyme. The immobilized SpEH demonstrated also excellent operational stability and recyclability: retaining 87% productivity after 20 cycles with a total reaction time of 80 h. The new enzyme encapsulation method is efficient, practical, and also better than other reported encapsulation methods. © 2015 Wiley Periodicals, Inc.
Ammonia toxicity and its prevention in inherited defects of the urea cycle.
Walker, V
2009-09-01
The urea cycle is the final pathway for removal of surplus nitrogen from the body, and the major route in humans for detoxification of ammonia. The full complement of enzymes is expressed only in liver. Inherited deficiencies of urea cycle enzymes lead to hyperammonaemia, which causes brain damage. Severe defects present with hyperammonaemic crises in neonates. Equally devastating episodes may occur in previously asymptomatic adults with mild defects, most often X-linked ornithine transcarbamylase (OTC) deficiency. Several mechanisms probably contribute to pathogenesis. Treatment aims to reduce plasma ammonia quickly, reduce production of waste nitrogen, dispose of waste nitrogen using alternative pathways to the urea cycle and replace arginine. These therapies have increased survival and probably improve the neurological outcome. Arginine, sodium benzoate, sodium phenylbutyrate and, less often, sodium phenylacetate are used. Long-term correction is achieved by liver transplantation. Gene therapy for OTC deficiency is effective in animals, and work is ongoing to improve persistence and safety.
Dascalu, A M; Cherecheanu, A P; Stana, D; Voinea, L; Ciuluvica, R; Savlovschi, C; Serban, D
2014-01-01
to investigate the sensitivity and specificity of the stereometric parameters change analysis vs. Topographic Change Analysis in early detection of glaucoma progression. 81 patients with POAG were monitored for 4 years (GAT monthly, SAP at every 6 months, optic disc photographs and HRT3 yearly). The exclusion criteria were other optic disc or retinal pathology; topographic standard deviation (TSD>30; inter-test variation of reference height>25 μm. The criterion for structural progression was the following: at least 20 adjacent super-pixels with a clinically significant decrease in height (>5%). 16 patients of the total 81 presented structural progression on TCA. The most useful stereometric parameters for the early detection of glaucoma progression were the following: Rim Area change (sensitivity 100%, specificity 74.2% for a "cut-off " value of -0.05), C/D Area change (sensitivity 85.7%, specificity 71.5% for a "cut off " value of 0.02), C/D linear change (sensitivity 85.7%, specificity 71.5% for a "cut-off " value of 0.02), Rim Volume change (sensitivity 71.4%, specificity 88.8% for a "cut-off " value of -0.04). RNFL Thickness change (<0) was highly sensitive (82%), but less specific for glaucoma progression (45,2%). Changes of the other stereometric parameters have a limited diagnostic value for the early detection of glaucoma progression. TCA is a valuable tool for the assessment of the structural progression in glaucoma patients and its inter-test variability is low. On long-term, the quantitative analysis according to stereometric parameters change is also very important. The most relevant parameters to detect progression are RA, C/D Area, Linear C/D and RV.
Pawar, Shweta V; Rathod, Virendra K
2018-07-01
Low energy ultrasound irradiation was used to enhance co-production of enzymes uricase and alkaline protease using Bacillus licheniformis NRRL 14209. Production of uricase and alkaline protease was evaluated for different ultrasound parameters such as ultrasound power, time of irradiation, duty cycle and growth stage of organisms at which irradiation is carried out. Maximum uricase production of 0.825 U/mL and alkaline protease of 0.646 U/mL have been obtained when fermentation broth was irradiated at 6 h of growth stage with 60 W power for 15 min of duration having 40% of duty cycle. The enzyme yield was found to be enhanced by a factor of 1.9-3.8 and 1.2-2.2 for uricase and alkaline protease respectively. Nevertheless, intracellular uricase was also observed in a fermentation broth after ultrasonic process intensification. The results indicate the effectiveness of low frequency ultrasound in improving enzyme yields with a vision of commercial applicability of the process. Copyright © 2018 Elsevier B.V. All rights reserved.
Recovery of functionally-active protein from inclusion bodies using a thermal-cycling method.
Sadavarte, Rahul; Filipe, Carlos D M; Ghosh, Raja
2017-01-01
Heterologous overexpression of genes in Escherichia coli has made it possible to obtain high titers of recombinant proteins. However, this can result in the formation of aggregated protein particles known as 'inclusion bodies'. Protein sequestered as inclusion body is inactive and needs to be converted back to its functional form by refolding using appropriate techniques. In the current study inclusion bodies of the enzyme aminoglycoside nucleotidyl transferase (or ANT(2″)-Ia) were first solubilized in urea and subsequently subjected to thermal cycling under controlled conditions as part of the refolding strategy. Thermal cycling led to disaggregation of the individual protein chains and simultaneously refolding the released protein molecules to their native state. The optimum condition was identified as 10-80°C thermal cycling at 3°C s -1 for 2 h. Enzyme activity measurements showed that thermal cycling under optimized conditions resulted in 257% activity recovery when compared with nonrefolded protein. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 33:133-139, 2017. © 2016 American Institute of Chemical Engineers.
NASA Astrophysics Data System (ADS)
Prajapati, A. S.; Panchal, K.; Subramanian, R. B.; Patel, D. H.; Sudhir, A. P.; Dave, B. R.
2015-12-01
Global demand for energy has grown with the development of new industries, requiring constant improvement and search for new sources of energy. One of the challenges today is releasing the energy of glucose that nature has cleverly locked into lignocellulosic biomass. Potent and efficient enzyme preparations need to be developed for the enzymatic saccharification process to be more economical. Approaches like enzyme engineering, reconstitution of enzyme mixtures and bioprospecting for superior enzymes are gaining importance. The ocean is considered to be a great reservoir of biodiversity. Because enzymes have unequalled advantages, many industries are keenly interested in adapting enzymatic methods for their processes. Microbial communities in marine environments are ecologically relevant as intermediaries of energy and play an important role in nutrient regeneration cycles as decomposers of dead and decaying organic matter. The exploitation of marine bacteria in the search for improved enzymes or strategies provides a means to upgrade feasibility for lignocellulosic biomass conversion, ultimately providing means to a 'greener' technology. Several industrial enzymes are derived from terrestrial sources, whereas, marine environment which encompasses about 71 percent of the earth's surface and a vast resources for useful enzymes, remain unexplored. Marine microorganisms take active part in the mineralization of complex organic matter through degradative pathways of their metabolism. Bacteria from marine environments secrete different enzymes based on their habitat and their ecological functions. Therefore marine microbial enzymes have become the focal point of interest. Even though many of these enzymes are being isolated, the efficiency of hydrolysis is very poor. This could be overcome by altering the substrate specificity of lignocellulases. Protein engineering could prove to be useful to improve the catalytic function these enzymes.
Saunders, G.C.
1982-03-04
The disclosure relates to the quantitation of a primary enzyme concentration by utilizing a substrate for the primary enzyme labeled with a second enzyme which is an indicator enzyme. Enzyme catalysis of the substrate occurs and results in release of the indicator enzyme in an amount directly proportional to the amount of primary enzyme present. By quantifying the free indicator enzyme one determines the amount of primary enzyme present.
2011-01-01
Background Biochemical models predict that photosynthesis in C3 plants is most frequently limited by the slower of two processes, the maximum capacity of the enzyme Rubisco to carboxylate RuBP (Vc,max), or the regeneration of RuBP via electron transport (J). At current atmospheric [CO2] levels Rubisco is not saturated; consequently, elevating [CO2] increases the velocity of carboxylation and inhibits the competing oxygenation reaction which is also catalyzed by Rubisco. In the future, leaf photosynthesis (A) should be increasingly limited by RuBP regeneration, as [CO2] is predicted to exceed 550 ppm by 2050. The C3 cycle enzyme sedoheptulose-1,7 bisphosphatase (SBPase, EC 3.1.3.17) has been shown to exert strong metabolic control over RuBP regeneration at light saturation. Results We tested the hypothesis that tobacco transformed to overexpressing SBPase will exhibit greater stimulation of A than wild type (WT) tobacco when grown under field conditions at elevated [CO2] (585 ppm) under fully open air fumigation. Growth under elevated [CO2] stimulated instantaneous A and the diurnal photosynthetic integral (A') more in transformants than WT. There was evidence of photosynthetic acclimation to elevated [CO2] via downregulation of Vc,max in both WT and transformants. Nevertheless, greater carbon assimilation and electron transport rates (J and Jmax) for transformants led to greater yield increases than WT at elevated [CO2] compared to ambient grown plants. Conclusion These results provide proof of concept that increasing content and activity of a single photosynthesis enzyme can enhance carbon assimilation and yield of C3 crops grown at [CO2] expected by the middle of the 21st century. PMID:21884586
Soil Minerals Affect Extracellular Enzyme Activities in Cold and Warm Environments
NASA Astrophysics Data System (ADS)
Yang, Z.; Morin, M. M.; Graham, D. E.; Wullschleger, S. D.; Gu, B.
2017-12-01
Extracellular enzymes are mainly responsible for degrading and cycling soil organic matter (SOM) in both cold and warm terrestrial ecosystems. Minerals can play important roles in affecting soil enzyme activities, however, the interactions between enzyme and soil minerals remain poorly understood. In this study, we developed a model soil-enzyme system to examine the mineral effects on a hydrolytic enzyme (i.e., β-glucosidase) under both cold (4°C) and relatively warm (20 and 30°C) conditions. Minerals including iron oxides and clays (e.g., kaolinite and montmorillonite) were used to mimic different types of soils, and enzyme adsorption experiments were conducted to determine the enzyme interactions with different mineral surfaces. Time-series experiments were also carried out to measure enzymatic degradation of the organic substrates, such as cellobiose and indican. We observed that fractions of adsorbed enzyme and the hydrolytic activity were higher on iron oxides (e.g., hematite) compared to kaolinite and montmorillonite at given experimental conditions. The degradation of cellobiose was significantly faster than that of indican in the presence of minerals. We also found that the adsorption of enzyme was not dependent on the mineral surface areas, but was controlled by the mineral surface charge. In addition, temperature increase from 4 to 30°C enhanced mineral-assisted glucosidase hydrolysis by 2 to 4 fold, suggesting greater degradation under warmer environments. The present work demonstrates that the enzyme activity is influenced not only by the soil temperature but also by the surface chemistry of soil minerals. Our results highlight the need to consider the physical and chemical properties of minerals in biogeochemical models, which could provide a better prediction for enzyme-facilitated SOM transformations in terrestrial ecosystems.
Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I.
2018-01-01
ABSTRACT Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L-serine, L-threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L-proline, L-aspartic acid, and L-pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L-proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector. PMID:28594267
Killiny, Nabil; Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I
2018-01-01
Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L -serine, L -threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L -proline, L -aspartic acid, and L -pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L -proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector.
DOE R&D Accomplishments Database
Calvin, Melvin
1955-03-21
A cyclic sequence of transformations, including the carboxylation of RuDP (ribulose diphosphate) and its re-formation, has been deduced as the route for the creation of reduced carbon compounds in photosynthetic organisms. With the demonstration of RuDP as substrate for the carboxylation in a cell-free system, each of the reactions has now been carried out independently in vitro. Further purification of this last enzyme system has confirmed the deduction that the carboxylation of RuDP leads directly to the two molecules of PGA (phosphoglyceric acid) involving an internal dismutation and suggesting the name "carboxydismutase" for the enzyme. As a consequence of this knowledge of each of the steps in the photosynthetic CO{sub 2} reduction cycle, it is possible to define the reagent requirements to maintain it. The net requirement for the reduction of one molecule of CO{sub 2} is four equivalents of [H]and three molecules of ATP (adenine triphosphate). These must ultimately be supplied by the photochemical reaction. Some possible ways in which this may be accomplished are discussed.
Catalytic and mechanical cycles in F-ATP synthases. Fourth in the Cycles Review Series.
Dimroth, Peter; von Ballmoos, Christoph; Meier, Thomas
2006-03-01
Cycles have a profound role in cellular life at all levels of organization. Well-known cycles in cell metabolism include the tricarboxylic acid and the urea cycle, in which a specific carrier substrate undergoes a sequence of chemical transformations and is regenerated at the end. Other examples include the interconversions of cofactors, such as NADH or ATP, which are present in the cell in limiting amounts and have to be recycled effectively for metabolism to continue. Every living cell performs a rapid turnover of ATP to ADP to fulfil various energetic demands and effectively regenerates the ATP from ADP in an energy-consuming process. The turnover of the ATP cycle is impressive; a human uses about its body weight in ATP per day. Enzymes perform catalytic reaction cycles in which they undergo several chemical and physical transformations before they are converted back to their original states. The ubiquitous F1F(o) ATP synthase is of particular interest not only because of its biological importance, but also owing to its unique rotational mechanism. Here, we give an overview of the membrane-embedded F(o) sector, particularly with respect to the recent crystal structure of the c ring from Ilyobacter tartaricus, and summarize current hypotheses for the mechanism by which rotation of the c ring is generated.
Asada, Kozi
1999-06-01
Photoreduction of dioxygen in photosystem I (PSI) of chloroplasts generates superoxide radicals as the primary product. In intact chloroplasts, the superoxide and the hydrogen peroxide produced via the disproportionation of superoxide are so rapidly scavenged at the site of their generation that the active oxygens do not inactivate the PSI complex, the stromal enzymes, or the scavenging system itself. The overall reaction for scavenging of active oxygens is the photoreduction of dioxygen to water via superoxide and hydrogen peroxide in PSI by the electrons derived from water in PSII, and the water-water cycle is proposed for these sequences. An overview is given of the molecular mechanism of the water-water cycle and microcompartmentalization of the enzymes participating in it. Whenever the water-water cycle operates properly for scavenging of active oxygens in chloroplasts, it also effectively dissipates excess excitation energy under environmental stress. The dual functions of the water-water cycle for protection from photoinihibition are discussed.
Zarzycki, Jan; Brecht, Volker; Müller, Michael; Fuchs, Georg
2009-12-15
The phototrophic bacterium Chloroflexus aurantiacus uses a yet unsolved 3-hydroxypropionate cycle for autotrophic CO(2) fixation. It starts from acetyl-CoA, with acetyl-CoA and propionyl-CoA carboxylases acting as carboxylating enzymes. In a first cycle, (S)-malyl-CoA is formed from acetyl-CoA and 2 molecules of bicarbonate. (S)-Malyl-CoA cleavage releases the CO(2) fixation product glyoxylate and regenerates the starting molecule acetyl-CoA. Here we complete the missing steps devoted to glyoxylate assimilation. In a second cycle, glyoxylate is combined with propionyl-CoA, an intermediate of the first cycle, to form beta-methylmalyl-CoA. This condensation is followed by dehydration to mesaconyl-C1-CoA. An unprecedented CoA transferase catalyzes the intramolecular transfer of the CoA moiety to the C4 carboxyl group of mesaconate. Mesaconyl-C4-CoA then is hydrated by an enoyl-CoA hydratase to (S)-citramalyl-CoA. (S)-Citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by a tri-functional lyase, which previously cleaved (S)-malyl-CoA and formed beta-methylmalyl-CoA. Thus, the enigmatic disproportionation of glyoxylate and propionyl-CoA into acetyl-CoA and pyruvate is solved in an elegant and economic way requiring only 3 additional enzymes. The whole bicyclic pathway results in pyruvate formation from 3 molecules of bicarbonate and involves 19 steps but only 13 enzymes. Elements of the 3-hydroxypropionate cycle may be used for the assimilation of small organic molecules. The 3-hydroxypropionate cycle is compared with the Calvin-Benson-Bassham cycle and other autotrophic pathways.
Falade, Titilayo D O; Chrysanthopoulos, Panagiotis K; Hodson, Mark P; Sultanbawa, Yasmina; Fletcher, Mary; Darnell, Ross; Korie, Sam; Fox, Glen
2018-05-07
Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol ( R = 0.48) and turanose and ( R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity.
Araújo, Wagner L.; Nunes-Nesi, Adriano; Osorio, Sonia; Usadel, Björn; Fuentes, Daniela; Nagy, Réka; Balbo, Ilse; Lehmann, Martin; Studart-Witkowski, Claudia; Tohge, Takayuki; Martinoia, Enrico; Jordana, Xavier; DaMatta, Fábio M.; Fernie, Alisdair R.
2011-01-01
Transgenic tomato (Solanum lycopersicum) plants expressing a fragment of the Sl SDH2-2 gene encoding the iron sulfur subunit of the succinate dehydrogenase protein complex in the antisense orientation under the control of the 35S promoter exhibit an enhanced rate of photosynthesis. The rate of the tricarboxylic acid (TCA) cycle was reduced in these transformants, and there were changes in the levels of metabolites associated with the TCA cycle. Furthermore, in comparison to wild-type plants, carbon dioxide assimilation was enhanced by up to 25% in the transgenic plants under ambient conditions, and mature plants were characterized by an increased biomass. Analysis of additional photosynthetic parameters revealed that the rate of transpiration and stomatal conductance were markedly elevated in the transgenic plants. The transformants displayed a strongly enhanced assimilation rate under both ambient and suboptimal environmental conditions, as well as an elevated maximal stomatal aperture. By contrast, when the Sl SDH2-2 gene was repressed by antisense RNA in a guard cell–specific manner, changes in neither stomatal aperture nor photosynthesis were observed. The data obtained are discussed in the context of the role of TCA cycle intermediates both generally with respect to photosynthetic metabolism and specifically with respect to their role in the regulation of stomatal aperture. PMID:21307286
Muoio, Deborah M; Koves, Timothy R
2007-10-01
Dyslipidemia and intramuscular accumulation of fatty acid metabolites are increasingly recognized as core features of obesity and type 2 diabetes. Emerging evidence suggests that normal physiological adaptations to a heavy lipid load depend on the coordinated actions of broad transcriptional regulators such as the peroxisome proliferator activated receptors (PPARs) and PPAR gamma coactivator 1 alpha (PGC1 alpha). The application of transcriptomics and targeted metabolic profiling tools based on mass spectrometry has led to our finding that lipid-induced insulin resistance is a condition in which upregulation of PPAR-targeted genes and high rates of beta-oxidation are not supported by a commensurate upregulation of tricarboxylic acid (TCA) cycle activity. In contrast, exercise training enhances mitochondrial performance, favoring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high-fat diet. The exercise-activated transcriptional coactivator, PGC1 alpha, plays a key role in coordinating metabolic flux through these 2 intersecting metabolic pathways, and its suppression by overfeeding may contribute to diet-induced mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from a mitochondrial disconnect between beta-oxidation and TCA cycle activity. Understanding of this "disconnect" and its molecular basis may lead to new therapeutic approaches to combatting metabolic disease.
Weger, H G; Birch, D G; Elrifi, I R; Turpin, D H
1988-03-01
Mass spectrometric analysis of O(2) and CO(2) exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH(4)Cl resulted in nearly a 250% increase in the rate of TCA cycle CO(2) efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O(2) consumption in both light and dark. Anaerobiosis inhibited the CO(2) release caused by NH(4)Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O(2) consumption in the light. This implied that the Mehler reaction did not play a significant role in O(2) consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions.
Ammonium Assimilation Requires Mitochondrial Respiration in the Light 1
Weger, Harold G.; Birch, Douglas G.; Elrifi, Ivor R.; Turpin, David H.
1988-01-01
Mass spectrometric analysis of O2 and CO2 exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH4Cl resulted in nearly a 250% increase in the rate of TCA cycle CO2 efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O2 consumption in both light and dark. Anaerobiosis inhibited the CO2 release caused by NH4Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O2 consumption in the light. This implied that the Mehler reaction did not play a significant role in O2 consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions. PMID:16665971
Fresh insight to functioning of selected enzymes of the nitrogen cycle.
Eady, Robert R; Antonyuk, Svetlana V; Hasnain, S Samar
2016-04-01
The global nitrogen cycle is the process in which different forms of environmental N are interconverted by microorganisms either for assimilation into biomass or in respiratory energy-generating pathways. This short review highlights developments over the last 5 years in our understanding of functionality of nitrogenase, Cu-nitrite reductase, NO reductase and N2O reductase, complex metalloenzymes that catalyze electron/proton-coupled substrate reduction reactions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika
2012-01-01
Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471
NADPH-generating systems in bacteria and archaea
Spaans, Sebastiaan K.; Weusthuis, Ruud A.; van der Oost, John; Kengen, Servé W. M.
2015-01-01
Reduced nicotinamide adenine dinucleotide phosphate (NADPH) is an essential electron donor in all organisms. It provides the reducing power that drives numerous anabolic reactions, including those responsible for the biosynthesis of all major cell components and many products in biotechnology. The efficient synthesis of many of these products, however, is limited by the rate of NADPH regeneration. Hence, a thorough understanding of the reactions involved in the generation of NADPH is required to increase its turnover through rational strain improvement. Traditionally, the main engineering targets for increasing NADPH availability have included the dehydrogenase reactions of the oxidative pentose phosphate pathway and the isocitrate dehydrogenase step of the tricarboxylic acid (TCA) cycle. However, the importance of alternative NADPH-generating reactions has recently become evident. In the current review, the major canonical and non-canonical reactions involved in the production and regeneration of NADPH in prokaryotes are described, and their key enzymes are discussed. In addition, an overview of how different enzymes have been applied to increase NADPH availability and thereby enhance productivity is provided. PMID:26284036
Bai, Bing; Sikron, Noga; Gendler, Tanya; Kazachkova, Yana; Barak, Simon; Grafi, Gideon; Khozin-Goldberg, Inna; Fait, Aaron
2012-01-01
Seeds in the seed bank experience diurnal cycles of imbibition followed by complete dehydration. These conditions pose a challenge to the regulation of germination. The effect of recurring hydration-dehydration (Hy-Dh) cycles were tested on seeds from four Arabidopsis thaliana accessions [Col-0, Cvi, C24 and Ler]. Diurnal Hy-Dh cycles had a detrimental effect on the germination rate and on the final percentage of germination in Col-0, Cvi and C24 ecotypes, but not in the Ler ecotype, which showed improved vigor following the treatments. Membrane permeability measured by ion conductivity was generally increased following each Hy-Dh cycle and was correlated with changes in the redox status represented by the GSSG/GSH (oxidized/reduced glutathione) ratio. Among the ecotypes, Col-0 seeds displayed the highest membrane permeability, whilst Ler was characterized by the greatest increase in electrical conductivity following Hy-Dh cycles. Following Dh 2 and Dh 3, the respiratory activity of Ler seeds significantly increased, in contrast to the other ecotypes, indicative of a dramatic shift in metabolism. These differences were associated with accession-specific content and patterns of change of (i) cell wall-related laminaribiose and mannose; (ii) fatty acid composition, specifically of the unsaturated oleic acid and α-linoleic acid; and (iii) asparagine, ornithine and the related polyamine putrescine. Furthermore, in the Ler ecotype the content of the tricarboxylic acid (TCA) cycle intermediates fumarate, succinate and malate increased in response to dehydration, in contrast to a decrease in the other three ecotypes. These findings provide a link between seed respiration, energy metabolism, fatty acid β-oxidation, nitrogen mobilization and membrane permeability and the improved germination of Ler seeds following Hy-Dh cycles.
Elgersma, Kenneth J; Ehrenfeld, Joan G; Yu, Shen; Vor, Torsten
2011-11-01
Plant invasions can have substantial consequences for the soil ecosystem, altering microbial community structure and nutrient cycling. However, relatively little is known about what drives these changes, making it difficult to predict the effects of future invasions. In addition, because most studies compare soils from uninvaded areas to long-established dense invasions, little is known about the temporal dependence of invasion impacts. We experimentally manipulated forest understory vegetation in replicated sites dominated either by exotic Japanese barberry (Berberis thunbergii), native Viburnums, or native Vacciniums, so that each vegetation type was present in each site-type. We compared the short-term effect of vegetation changes to the lingering legacy effects of the previous vegetation type by measuring soil microbial community structure (phospholipid fatty acids) and function (extracellular enzymes and nitrogen mineralization). We also replaced the aboveground litter in half of each plot with an inert substitute to determine if changes in the soil microbial community were driven by aboveground or belowground plant inputs. We found that after 2 years, the microbial community structure and function was largely determined by the legacy effect of the previous vegetation type, and was not affected by the current vegetation. Aboveground litter removal had only weak effects, suggesting that changes in the soil microbial community and nutrient cycling were driven largely by belowground processes. These results suggest that changes in the soil following either invasion or restoration do not occur quickly, but rather exhibit long-lasting legacy effects from previous belowground plant inputs.
Jekabsons, Mika B; Gebril, Hoda M; Wang, Yan-Hong; Avula, Bharathi; Khan, Ikhlas A
2017-10-01
A hexose phosphate recycling model previously developed to infer fluxes through the major glucose consuming pathways in cultured cerebellar granule neurons (CGNs) from neonatal rats metabolizing [1,2- 13 C 2 ]glucose was revised by considering reverse flux through the non-oxidative pentose phosphate pathway (PPP) and symmetrical succinate oxidation within the tricarboxylic acid (TCA) cycle. The model adjusts three flux ratios to effect 13 C distribution in the hexose, pentose, and triose phosphate pools, and in TCA cycle malate to minimize the error between predicted and measured 13 C labeling in exported lactate (i.e., unlabeled, single-, double-, and triple-labeled; M, M1, M2, and M3, respectively). Inclusion of reverse non-oxidative PPP flux substantially increased the number of calculations but ultimately had relatively minor effects on the labeling of glycolytic metabolites. From the error-minimized solution in which the predicted M-M3 lactate differed by 0.49% from that measured by liquid chromatography-triple quadrupole mass spectrometry, the neurons exhibited negligible forward non-oxidative PPP flux. Thus, no glucose was used by the pentose cycle despite explicit consideration of hexose phosphate recycling. Mitochondria consumed only 16% of glucose while 45% was exported as lactate by aerobic glycolysis. The remaining 39% of glucose was shunted to pentose phosphates presumably for de novo nucleotide synthesis, but the proportion metabolized through the oxidative PPP vs. the reverse non-oxidative PPP could not be determined. The lactate exported as M1 (2.5%) and M3 (1.2%) was attributed to malic enzyme, which was responsible for 7.8% of pyruvate production (vs. 92.2% by glycolysis). The updated model is more broadly applicable to different cell types by considering bi-directional flux through the non-oxidative PPP. Its application to cultured neurons utilizing glucose as the sole exogenous substrate has demonstrated substantial oxygen-independent glucose
Enzyme nanoparticle fabrication: magnetic nanoparticle synthesis and enzyme immobilization.
Johnson, Patrick A; Park, Hee Joon; Driscoll, Ashley J
2011-01-01
Immobilized enzymes are drawing significant attention for potential commercial applications as biocatalysts by reducing operational expenses and by increasing process utilization of the enzymes. Typically, immobilized enzymes have greater thermal and operational stability at various pH values, ionic strengths and are more resistant to denaturation that the soluble native form of the enzyme. Also, immobilized enzymes can be recycled by utilizing the physical or chemical properties of the supporting material. Magnetic nanoparticles provide advantages as the supporting material for immobilized enzymes over competing materials such as: higher surface area that allows for greater enzyme loading, lower mass transfer resistance, less fouling effect, and selective, nonchemical separation from the reaction mixture by an applied a magnetic field. Various surface modifications of magnetic nanoparticles, such as silanization, carbodiimide activation, and PEG or PVA spacing, aid in the binding of single or multienzyme systems to the particles, while cross-linking using glutaraldehyde can also stabilize the attached enzymes.
Effects of multiple enzyme-substrate interactions in basic units of cellular signal processing
NASA Astrophysics Data System (ADS)
Seaton, D. D.; Krishnan, J.
2012-08-01
Covalent modification cycles are a ubiquitous feature of cellular signalling networks. In these systems, the interaction of an active enzyme with the unmodified form of its substrate is essential for signalling to occur. However, this interaction is not necessarily the only enzyme-substrate interaction possible. In this paper, we analyse the behaviour of a basic model of signalling in which additional, non-essential enzyme-substrate interactions are possible. These interactions include those between the inactive form of an enzyme and its substrate, and between the active form of an enzyme and its product. We find that these additional interactions can result in increased sensitivity and biphasic responses, respectively. The dynamics of the responses are also significantly altered by the presence of additional interactions. Finally, we evaluate the consequences of these interactions in two variations of our basic model, involving double modification of substrate and scaffold-mediated signalling, respectively. We conclude that the molecular details of protein-protein interactions are important in determining the signalling properties of enzymatic signalling pathways.
Cline, Gary W; Pongratz, Rebecca L; Zhao, Xiaojian; Papas, Klearchos K
2011-11-11
Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with (31)P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by (13)C NMR isotopomer analysis of the fate of [U-(13)C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media. Copyright © 2011 Elsevier Inc. All
NASA Astrophysics Data System (ADS)
Siyuan, He; Changhong, Zhang; Liang, Tao; Weifeng, Zhang; Longyue, Zeng; Wei, Lü; Haijun, Wu
2013-03-01
A CMOS long-term evolution (LTE) direct convert receiver that eliminates the interstage SAW filter is presented. The receiver consists of a low noise variable gain transconductance amplifier (TCA), a quadrature passive current commutating mixer with a 25% duty-cycle LO, a trans-impedance amplifier (TIA), a 7th-order Chebyshev filter and programmable gain amplifiers (PGAs). A wide dynamic gain range is allocated in the RF and analog parts. A current commutating passive mixer with a 25% duty-cycle LO improves gain, noise, and linearity. An LPF based on a Tow-Thomas biquad suppresses out-of-band interference. Fabricated in a 0.13 μm CMOS process, the receiver chain achieves a 107 dB maximum voltage gain, 2.7 dB DSB NF (from PAD port), -11 dBm IIP3, and > +65 dBm IIP2 after calibration, 96 dB dynamic control range with 1 dB steps, less than 2% error vector magnitude (EVM) from 2.3 to 2.7 GHz. The total receiver (total I Q path) draws 89 mA from a 1.2-V LDO on chip supply.
Samokhvalov, V; Ignatov, V; Kondrashova, M
2004-01-01
We investigated oxidative processes in mitochondria of Saccharomyces cerevisiae grown on ethanol in the course of chronological aging. We elaborated a model of chronological aging that avoids the influence of exhaustion of medium, as well as the accumulation of toxic metabolites during aging. A decrease in total respiration of cells and, even more, of the contribution of respiration coupled with ATP-synthesis was observed during aging. Aging is also related with the decrease of the contribution of malonate-insensitive respiration. Activities of citrate-synthase (CS), alpha-ketoglutarate dehydrogenase (KGDH) and malate dehydrogenase (MDH) were threefold decreased. The activity of NADP-dependent isocitrate dehydrogenase (NADP-ICDH) decreased more significantly, while the activity of NAD-dependent isocitrate dehydrogenase (NAD-ICDH) fell even greater, being completely inactivated on the third week of aging. In contrast, succinate dehydrogenase (SDH), enzymes of glyoxylate cycle (GCL) (isocitrate lyase (ICL) and malate synthase (MLS)), and enzymes of ethanol oxidation (alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ACDH)), were activated by 50% or more. The behavior of oxidative enzymes and metabolic pathways are apparently inherent to a more viable, long-lived cells in population, selected in the course of chronological aging. This selection allows cells to reveal the mechanism of their higher viability as caused by shunting of complete Krebs cycle by glyoxylate cycle, with a concomitant increased rate of the most efficient energy source, namely succinate formation and oxidation. Thiobarbituric-reactive species (TAR species) increased during aging. We supposed that to be the immediate cause of damage of a part of yeast population. These data show that a greater succinate contribution to respiration in more active cells is a general property of yeast and animal tissues.
García-Espinosa, María A; Rodrigues, Tiago B; Sierra, Alejandra; Benito, Marina; Fonseca, Carla; Gray, Heather L; Bartnik, Brenda L; García-Martín, María L; Ballesteros, Paloma; Cerdán, Sebastián
2004-01-01
We review briefly 13C NMR studies of cerebral glucose metabolism with an emphasis on the roles of glial energetics and the glutamine cycle. Mathematical modeling analysis of in vivo 13C turnover experiments from the C4 carbons of glutamate and glutamine are consistent with: (i) the glutamine cycle being the major cerebral metabolic route supporting glutamatergic neurotransmission, (ii) glial glutamine synthesis being stoichiometrically coupled to glycolytic ATP production, (iii) glutamine serving as the main precursor of neurotransmitter glutamate and (iv) glutamatergic neurotransmission being supported by lactate oxidation in the neurons in a process accounting for 60-80% of the energy derived from glucose catabolism. However, more recent experimental approaches using inhibitors of the glial tricarboxylic acid (TCA) cycle (trifluoroacetic acid, TFA) or of glutamine synthase (methionine sulfoximine, MSO) reveal that a considerable portion of the energy required to support glutamine synthesis is derived from the oxidative metabolism of glucose in the astroglia and that a significant amount of the neurotransmitter glutamate is produced from neuronal glucose or lactate rather than from glial glutamine. Moreover, a redox switch has been proposed that allows the neurons to use either glucose or lactate as substrates for oxidation, depending on the relative availability of these fuels under resting or activation conditions, respectively. Together, these results suggest that the coupling mechanisms between neuronal and glial metabolism are more complex than initially envisioned.
Thongkum, Angkana; Wu, Chunjing; Li, Ying-Ying; Wangpaichitr, Medhi; Navasumrit, Panida; Parnlob, Varabhorn; Sricharunrat, Thaniya; Bhudhisawasdi, Vajarabhongsa; Ruchirawat, Mathuros; Savaraj, Niramol
2017-01-01
Argininosuccinate synthetase (ASS), a key enzyme to synthesize arginine is down regulated in many tumors including hepatocellular carcinoma (HCC). Similar to previous reports, we have found the decrease in ASS expression in poorly differentiated HCC. These ASS(-) tumors are auxotrophic for arginine. Pegylated arginine deiminase (ADI-PEG20), which degrades arginine, has shown activity in these tumors, but the antitumor effect is not robust and hence combination treatment is needed. Herein, we have elucidated the effectiveness of ADI-PEG20 combined with 5-Fluorouracil (5-FU) in ASS(-)HCC by targeting urea cycle and pyrimidine metabolism using four HCC cell lines as model. SNU398 and SNU387 express very low levels of ASS or ASS(-) while Huh-1, and HepG2 express high ASS similar to normal cells. Our results showed that the augmented cytotoxic effect of combination treatment only occurs in SNU398 and SNU387, and not in HepG2 and Huh-1 (ASS(+)) cells, and is partly due to reduced anti-apoptotic proteins X-linked inhibitor of apoptosis protein (XIAP), myeloid leukemia cell differentiation protein (Mcl-1) and B-cell lymphoma-2 (Bcl-2). Importantly, lack of ASS also influences essential enzymes in pyrimidine synthesis (carbamoyl-phosphate synthetase2, aspartate transcarbamylase and dihydrooratase (CAD) and thymidylate synthase (TS)) and malate dehydrogenase-1 (MDH-1) in TCA cycle. ADI-PEG20 treatment decreased these enzymes and made them more vulnerable to 5-FU. Transfection of ASS restored these enzymes and abolished the sensitivity to ADI-PEG20 and combination treatment. Overall, our data suggest that ASS influences multiple enzymes involved in 5-FU sensitivity. Combining ADI-PEG20 and 5-FU may be effective to treat ASS(-)hepatoma and warrants further clinical investigation. PMID:28587170
Thongkum, Angkana; Wu, Chunjing; Li, Ying-Ying; Wangpaichitr, Medhi; Navasumrit, Panida; Parnlob, Varabhorn; Sricharunrat, Thaniya; Bhudhisawasdi, Vajarabhongsa; Ruchirawat, Mathuros; Savaraj, Niramol
2017-06-01
Argininosuccinate synthetase (ASS), a key enzyme to synthesize arginine is down regulated in many tumors including hepatocellular carcinoma (HCC). Similar to previous reports, we have found the decrease in ASS expression in poorly differentiated HCC. These ASS(-) tumors are auxotrophic for arginine. Pegylated arginine deiminase (ADI-PEG20), which degrades arginine, has shown activity in these tumors, but the antitumor effect is not robust and hence combination treatment is needed. Herein, we have elucidated the effectiveness of ADI-PEG20 combined with 5-Fluorouracil (5-FU) in ASS(-)HCC by targeting urea cycle and pyrimidine metabolism using four HCC cell lines as model. SNU398 and SNU387 express very low levels of ASS or ASS(-) while Huh-1, and HepG2 express high ASS similar to normal cells. Our results showed that the augmented cytotoxic effect of combination treatment only occurs in SNU398 and SNU387, and not in HepG2 and Huh-1 (ASS(+)) cells, and is partly due to reduced anti-apoptotic proteins X-linked inhibitor of apoptosis protein (XIAP), myeloid leukemia cell differentiation protein (Mcl-1) and B-cell lymphoma-2 (Bcl-2). Importantly, lack of ASS also influences essential enzymes in pyrimidine synthesis (carbamoyl-phosphate synthetase2, aspartate transcarbamylase and dihydrooratase (CAD) and thymidylate synthase (TS)) and malate dehydrogenase-1 (MDH-1) in TCA cycle. ADI-PEG20 treatment decreased these enzymes and made them more vulnerable to 5-FU. Transfection of ASS restored these enzymes and abolished the sensitivity to ADI-PEG20 and combination treatment. Overall, our data suggest that ASS influences multiple enzymes involved in 5-FU sensitivity. Combining ADI-PEG20 and 5-FU may be effective to treat ASS(-)hepatoma and warrants further clinical investigation.
Hexter, Suzannah V.; Grey, Felix; Happe, Thomas; Climent, Victor; Armstrong, Fraser A.
2012-01-01
The extraordinary ability of Fe- and Ni-containing enzymes to catalyze rapid and efficient H+/H2 interconversion—a property otherwise exclusive to platinum metals—has been investigated in a series of experiments combining variable-temperature protein film voltammetry with mathematical modeling. The results highlight important differences between the catalytic performance of [FeFe]-hydrogenases and [NiFe]-hydrogenases and justify a simple model for reversible catalytic electron flow in enzymes and electrocatalysts that should be widely applicable in fields as diverse as electrochemistry, catalysis, and bioenergetics. The active site of [FeFe]-hydrogenases, an intricate Fe-carbonyl complex known as the “H cluster,” emerges as a supreme catalyst. PMID:22802675
Ries, Laure Nicolas Annick; de Assis, Leandro José; Rodrigues, Fernando José Santos; Caldana, Camila; Rocha, Marina Campos; Malavazi, Iran; Bayram, Özgür; Goldman, Gustavo H
2018-05-24
The pyruvate dehydrogenase complex (PDH), that converts pyruvate to acetyl-coA, is regulated by pyruvate dehydrogenase kinases (PDHK) and phosphatases (PDHP) that have been shown to be important for morphology, pathogenicity and carbon source utilisation in different fungal species. The aim of this study was to investigate the role played by the three PDHKs PkpA, PkpB and PkpC in carbon source utilisation in the reference filamentous fungus Aspergillus nidulans , in order to unravel regulatory mechanisms which could prove useful for fungal biotechnological and biomedical applications. PkpA and PkpB were shown to be mitochondrial whereas PkpC localised to the mitochondria in a carbon source-dependent manner. Only PkpA was shown to regulate PDH activity. In the presence of glucose, deletion of pkpA and pkpC resulted in reduced glucose utilisation, which affected carbon catabolite repression (CCR) and hydrolytic enzyme secretion, due to de-regulated glycolysis and TCA cycle enzyme activities. Furthermore, PkpC was shown to be required for the correct metabolic utilisation of cellulose and acetate. PkpC negatively regulated the activity of the glyoxylate cycle enzyme isocitrate lyase (ICL), required for acetate metabolism. In summary, this study identified PDHKs important for the regulation of central carbon metabolism in the presence of different carbon sources, with effects on the secretion of biotechnologically important enzymes and carbon source-related growth. This work demonstrates how central carbon metabolism can affect a variety of fungal traits and lays a basis for further investigation into these characteristics with potential interest for different applications. Copyright © 2018, G3: Genes, Genomes, Genetics.
2013-01-01
Background There is extensive evidence for the interaction of metabolic enzymes with the eukaryotic cytoskeleton. The significance of these interactions is far from clear. Presentation of the hypothesis In the cytoskeletal integrative sensor hypothesis presented here, the cytoskeleton senses and integrates the general metabolic activity of the cell. This activity depends on the binding to the cytoskeleton of enzymes and, depending on the nature of the enzyme, this binding may occur if the enzyme is either active or inactive but not both. This enzyme-binding is further proposed to stabilize microtubules and microfilaments and to alter rates of GTP and ATP hydrolysis and their levels. Testing the hypothesis Evidence consistent with the cytoskeletal integrative sensor hypothesis is presented in the case of glycolysis. Several testable predictions are made. There should be a relationship between post-translational modifications of tubulin and of actin and their interaction with metabolic enzymes. Different conditions of cytoskeletal dynamics and enzyme-cytoskeleton binding should reveal significant differences in local and perhaps global levels and ratios of ATP and GTP. The different functions of moonlighting enzymes should depend on cytoskeletal binding. Implications of the hypothesis The physical and chemical effects arising from metabolic sensing by the cytoskeleton would have major consequences on cell shape, dynamics and cell cycle progression. The hypothesis provides a framework that helps the significance of the enzyme-decorated cytoskeleton be determined. PMID:23398642
Glial dysfunction in abstinent methamphetamine abusers
Sailasuta, Napapon; Abulseoud, Osama; Harris, Kent C; Ross, Brian D
2010-01-01
Persistent neurochemical abnormalities in frontal brain structures are believed to result from methamphetamine use. We developed a localized 13C magnetic resonance spectroscopy (MRS) assay on a conventional MR scanner, to quantify selectively glial metabolic flux rate in frontal brain of normal subjects and a cohort of recovering abstinent methamphetamine abusers. Steady-state bicarbonate concentrations were similar, between 11 and 15 mmol/L in mixed gray-white matter of frontal brain of normal volunteers and recovering methamphetamine-abusing subjects (P>0.1). However, glial 13C-bicarbonate production rate from [1-13C]acetate, equating with glial tricarboxylic acid (TCA) cycle rate, was significantly reduced in frontal brain of abstinent methamphetamine-addicted women (methamphetamine 0.04 μmol/g per min (N=5) versus controls 0.11 μmol/g per min (N=5), P=0.001). This is equivalent to 36% of the normal glial TCA cycle rate. Severe reduction in glial TCA cycle rate that normally comprises 10% of total cerebral metabolic rate may impact operation of the neuronal glial glutamate cycle and result in accumulation of frontal brain glutamate, as observed in these recovering methamphetamine abusers. Although these are the first studies to define directly an abnormality in glial metabolism in human methamphetamine abuse, sequential studies using analogous 13C MRS methods may determine ‘cause and effect' between glial failure and neuronal injury. PMID:20040926
Metabolic profiles of exercise in patients with McArdle disease or mitochondrial myopathy
Sharma, Rohit; Tadvalkar, Laura; Clish, Clary B.; Haller, Ronald G.; Mootha, Vamsi K.
2017-01-01
McArdle disease and mitochondrial myopathy impair muscle oxidative phosphorylation (OXPHOS) by distinct mechanisms: the former by restricting oxidative substrate availability caused by blocked glycogen breakdown, the latter because of intrinsic respiratory chain defects. We applied metabolic profiling to systematically interrogate these disorders at rest, when muscle symptoms are typically minimal, and with exercise, when symptoms of premature fatigue and potential muscle injury are unmasked. At rest, patients with mitochondrial disease exhibit elevated lactate and reduced uridine; in McArdle disease purine nucleotide metabolites, including xanthine, hypoxanthine, and inosine are elevated. During exercise, glycolytic intermediates, TCA cycle intermediates, and pantothenate expand dramatically in both mitochondrial disease and control subjects. In contrast, in McArdle disease, these metabolites remain unchanged from rest; but urea cycle intermediates are increased, likely attributable to increased ammonia production as a result of exaggerated purine degradation. Our results establish skeletal muscle glycogen as the source of TCA cycle expansion that normally accompanies exercise and imply that impaired TCA cycle flux is a central mechanism of restricted oxidative capacity in this disorder. Finally, we report that resting levels of long-chain triacylglycerols in mitochondrial myopathy correlate with the severity of OXPHOS dysfunction, as indicated by the level of impaired O2 extraction from arterial blood during peak exercise. Our integrated analysis of exercise and metabolism provides unique insights into the biochemical basis of these muscle oxidative defects, with potential implications for their clinical management. PMID:28716914
Neuropsychiatric manifestations in late-onset urea cycle disorder patients.
Serrano, Mercedes; Martins, Cecilia; Pérez-Dueñas, Belén; Gómez-López, Lilian; Murgui, Empar; Fons, Carmen; García-Cazorla, Angels; Artuch, Rafael; Jara, Fernando; Arranz, José A; Häberle, Johannes; Briones, Paz; Campistol, Jaume; Pineda, Mercedes; Vilaseca, Maria A
2010-03-01
Inherited urea cycle disorders represent one of the most common groups of inborn errors of metabolism. Late-onset urea cycle disorders caused by partial enzyme deficiencies may present with unexpected clinical phenotypes. We report 9 patients followed up in our hospital presenting late-onset urea cycle disorders who initially manifested neuropsychiatric/neurodevelopmental symptoms (the most prevalent neuropsychiatric/neurodevelopmental diagnoses were mental retardation, attention-deficit hyperactivity disorder [ADHD], language disorder, and delirium). Generally, these clinical pictures did not benefit from pharmacological treatment. Conversely, dietary treatment improved the symptoms. Regarding biochemical data, 2 patients showed normal ammonium but high glutamine levels. This study highlights the fact that neuropsychiatric/neurodevelopmental findings are common among the initial symptomatology of late-onset urea cycle disorders. The authors recommend that unexplained or nonresponsive neuropsychiatric/neurodevelopmental symptoms appearing during childhood or adolescence be followed by a study of ammonia and amino acid plasmatic levels to rule out a urea cycle disorder.
Chiang, Ming-Chang; Chen, Hui-Mei; Lee, Yi-Hsin; Chang, Hao-Hung; Wu, Yi-Chih; Soong, Bing-Wen; Chen, Chiung-Mei; Wu, Yih-Ru; Liu, Chin-San; Niu, Dau-Ming; Wu, Jer-Yuarn; Chen, Yuan-Tsong; Chern, Yijuang
2007-03-01
Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by a CAG trinucleotide expansion in the Huntingtin (Htt) gene. Using two mouse models of HD, we demonstrate that the urea cycle deficiency characterized by hyperammonemia, high blood citrulline and suppression of urea cycle enzymes is a prominent feature of HD. The resultant ammonia toxicity might exacerbate the neurological deficits of HD. Suppression of C/EBPalpha, a crucial transcription factor for the transcription of urea cycle enzymes, appears to mediate the urea cycle deficiency in HD. We found that in the presence of mutant Htt, C/EBPalpha loses its ability to interact with an important cofactor (CREB-binding protein). Moreover, mutant Htt recruited C/EBPalpha into aggregates, as well as suppressed expression of the C/EBPalpha gene. Consumption of protein-restricted diets not only led to the restoration of C/EBPalpha's activity, and repair of the urea cycle deficiency and hyperammonemia, but also ameliorated the formation of Htt aggregates, the motor deterioration, the suppression of striatal brain-derived neurotrophic factor and the normalization of three protein chaperones (Hsp27, Hsp70 and Hsp90). Treatments aimed at repairing the urea cycle deficiency may provide a new strategy for dealing with HD.
Hu, D; Luo, W; Fan, L F; Liu, F L; Gu, J; Deng, H M; Zhang, C; Huang, L H; Feng, Q L
2016-04-01
Significant changes usually take place in the internal metabolism of insects during metamorphosis. The glycolysis-tricarboxylic acid (glycolysis-TCA) pathway is important for energy metabolism. To elucidate its dynamics, the mRNA levels of genes involved in this pathway were examined in the midgut of Spodoptera litura during metamorphosis, and the pyruvate content was quantified. The expression patterns of these genes in response to starvation were examined, and the interaction between protein phosphatase 1 (PP1) and phosphofructokinase (PFK) was studied. The results revealed that the expression or activities of most glycolytic enzymes was down-regulated in prepupae and then recovered in some degree in pupae, and all TCA-related genes were remarkably suppressed in both the prepupae and pupae. Pyruvate was enriched in the pupal midgut. Taken together, these results suggest that insects decrease both glycolysis and TCA in prepupae to save energy and then up-regulate glycolysis but down-regulate TCA in pupae to increase the supply of intermediates for construction of new organs. The expression of all these genes were down-regulated by starvation, indicating that non-feeding during metamorphosis may be a regulator of glycolysis-TCA pathway in the midgut. Importantly, interaction between PP1 and PFK was identified and is suggested to be involved in the regulation of glycolysis. © 2015 The Royal Entomological Society.
Vesley, Donald; Langholz, Ann C.; Rohlfing, Stephen R.; Foltz, William E.
1992-01-01
A biological indicator based on fluorimetric detection within 60 min of a Bacillus stearothermophilus spore-bound enzyme, α-d-glucosidase, has been developed. Results indicate that the enzyme survived slightly longer than spores observed after 24 h of incubation. The new system shows promise for evaluating flash sterilization cycles within 60 min compared with conventional 24-h systems. PMID:16348654
Rubisco Activases: AAA+ Chaperones Adapted to Enzyme Repair
Bhat, Javaid Y.; Thieulin-Pardo, Gabriel; Hartl, F. Ulrich; Hayer-Hartl, Manajit
2017-01-01
Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco), the key enzyme of the Calvin-Benson-Bassham cycle of photosynthesis, requires conformational repair by Rubisco activase for efficient function. Rubisco mediates the fixation of atmospheric CO2 by catalyzing the carboxylation of the five-carbon sugar ribulose-1,5-bisphosphate (RuBP). It is a remarkably inefficient enzyme, and efforts to increase crop yields by bioengineering Rubisco remain unsuccessful. This is due in part to the complex cellular machinery required for Rubisco biogenesis and metabolic maintenance. To function, Rubisco must undergo an activation process that involves carboxylation of an active site lysine by a non-substrate CO2 molecule and binding of a Mg2+ ion. Premature binding of the substrate RuBP results in an inactive enzyme. Moreover, Rubisco can also be inhibited by a range of sugar phosphates, some of which are “misfire” products of its multistep catalytic reaction. The release of the inhibitory sugar molecule is mediated by the AAA+ protein Rubisco activase (Rca), which couples hydrolysis of ATP to the structural remodeling of Rubisco. Rca enzymes are found in the vast majority of photosynthetic organisms, from bacteria to higher plants. They share a canonical AAA+ domain architecture and form six-membered ring complexes but are diverse in sequence and mechanism, suggesting their convergent evolution. In this review, we discuss recent advances in understanding the structure and function of this important group of client-specific AAA+ proteins. PMID:28443288
Rubisco Activases: AAA+ Chaperones Adapted to Enzyme Repair.
Bhat, Javaid Y; Thieulin-Pardo, Gabriel; Hartl, F Ulrich; Hayer-Hartl, Manajit
2017-01-01
Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco), the key enzyme of the Calvin-Benson-Bassham cycle of photosynthesis, requires conformational repair by Rubisco activase for efficient function. Rubisco mediates the fixation of atmospheric CO 2 by catalyzing the carboxylation of the five-carbon sugar ribulose-1,5-bisphosphate (RuBP). It is a remarkably inefficient enzyme, and efforts to increase crop yields by bioengineering Rubisco remain unsuccessful. This is due in part to the complex cellular machinery required for Rubisco biogenesis and metabolic maintenance. To function, Rubisco must undergo an activation process that involves carboxylation of an active site lysine by a non-substrate CO 2 molecule and binding of a Mg 2+ ion. Premature binding of the substrate RuBP results in an inactive enzyme. Moreover, Rubisco can also be inhibited by a range of sugar phosphates, some of which are "misfire" products of its multistep catalytic reaction. The release of the inhibitory sugar molecule is mediated by the AAA+ protein Rubisco activase (Rca), which couples hydrolysis of ATP to the structural remodeling of Rubisco. Rca enzymes are found in the vast majority of photosynthetic organisms, from bacteria to higher plants. They share a canonical AAA+ domain architecture and form six-membered ring complexes but are diverse in sequence and mechanism, suggesting their convergent evolution. In this review, we discuss recent advances in understanding the structure and function of this important group of client-specific AAA+ proteins.
Yeung, A T; Bascomb, N F; Turner, K J; Schmidt, R R
1981-05-01
By use of a rocket immunoelectrophoresis-activity stain procedure, it was shown that catalytic activity of an ammonium-inducible nicotinamide adenine dinucleotide phosphate-specific glutamate dehydrogenase (NADP-GDH) was accompanied by a coincident increase in enzyme antigen during the cell cycle of preinduced synchronous Chlorella sorokiniana cells growing in the continuous presence of ammonia. Between the fourth and fifth hours of the G-1 phase of the cell cycle, a three- to fourfold increase in linear accumulation of enzyme antigen was observed. Pulse-chase studies with [35S]sulfate, coupled with a specific indirect immunoadsorption procedure for enzyme antigen, showed that NADP-GDH antigen undergoes continuous degradation (i.e., a half-life of 88 to 110 min) during its linear pattern of accumulation during the cell cycle. The apparent half-life of the enzyme increased by approximately 23% of the 4.5-h positive rate change in antigen accumulation during the cell cycle. This increase in half-life is insufficient in itself to account for the large change in rate of NADP-GDH antigen accumulation. The data from immunoelectrophoresis, pulse-chase, and initial 35S incorporation rate experiments taken together support the inference that changes in the rate of NADP-GDH synthesis are primarily responsible for the accumulation patterns of NADP-GDH activity during the C. sorokiniana cell cycle.
Quesne, Matthew G; Latifi, Reza; Gonzalez-Ovalle, Luis E; Kumar, Devesh; de Visser, Sam P
2014-01-01
AlkB repair enzymes are important nonheme iron enzymes that catalyse the demethylation of alkylated DNA bases in humans, which is a vital reaction in the body that heals externally damaged DNA bases. Its mechanism is currently controversial and in order to resolve the catalytic mechanism of these enzymes, a quantum mechanics/molecular mechanics (QM/MM) study was performed on the demethylation of the N1-methyladenine fragment by AlkB repair enzymes. Firstly, the initial modelling identified the oxygen binding site of the enzyme. Secondly, the oxygen activation mechanism was investigated and a novel pathway was found, whereby the catalytically active iron(IV)–oxo intermediate in the catalytic cycle undergoes an initial isomerisation assisted by an Arg residue in the substrate binding pocket, which then brings the oxo group in close contact with the methyl group of the alkylated DNA base. This enables a subsequent rate-determining hydrogen-atom abstraction on competitive σ-and π-pathways on a quintet spin-state surface. These findings give evidence of different locations of the oxygen and substrate binding channels in the enzyme and the origin of the separation of the oxygen-bound intermediates in the catalytic cycle from substrate. Our studies are compared with small model complexes and the effect of protein and environment on the kinetics and mechanism is explained. PMID:24339041
Danne, Jillian C; Gornik, Sebastian G; Macrae, James I; McConville, Malcolm J; Waller, Ross F
2013-01-01
Mitochondrial metabolism is central to the supply of ATP and numerous essential metabolites in most eukaryotic cells. Across eukaryotic diversity, however, there is evidence of much adaptation of the function of this organelle according to specific metabolic requirements and/or demands imposed by different environmental niches. This includes substantial loss or retailoring of mitochondrial function in many parasitic groups that occupy potentially nutrient-rich environments in their metazoan hosts. Infrakingdom Alveolata comprises a well-supported alliance of three disparate eukaryotic phyla-dinoflagellates, apicomplexans, and ciliates. These major taxa represent diverse lifestyles of free-living phototrophs, parasites, and predators and offer fertile territory for exploring character evolution in mitochondria. The mitochondria of apicomplexan parasites provide much evidence of loss or change of function from analysis of mitochondrial protein genes. Much less, however, is known of mitochondrial function in their closest relatives, the dinoflagellate algae. In this study, we have developed new models of mitochondrial metabolism in dinoflagellates based on gene predictions and stable isotope labeling experiments. These data show that many changes in mitochondrial gene content previously only known from apicomplexans are found in dinoflagellates also. For example, loss of the pyruvate dehydrogenase complex and changes in tricarboxylic acid (TCA) cycle enzyme complement are shared by both groups and, therefore, represent ancestral character states. Significantly, we show that these changes do not result in loss of typical TCA cycle activity fueled by pyruvate. Thus, dinoflagellate data show that many changes in alveolate mitochondrial metabolism are independent of the major lifestyle changes seen in these lineages and provide a revised view of mitochondria character evolution during evolution of parasitism in apicomplexans.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Yinjie J.; Sapra, Rajat; Joyner, Dominique
2009-01-20
A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and istolerant to high ethanol concentrations (10percent, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner?Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (includingmore » the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accuratelydetermined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)-1 h-1) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64+-3 to 25+-2 and from 30+-2 to 19+-2, respectively. The carbon flux under micro-aerobic growth was directed formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38+-0.07 mol mol-1 glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yieldby approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production.« less
Cryoprotective ability of betaine-type metabolite analogs during freezing denaturation of enzymes.
Nakagawa, Yuichi; Sota, Masahiro; Koumoto, Kazuya
2015-08-01
To evaluate an analog library of betaine-type cellular metabolites, which are naturally found in polar fish for survival in subzero temperatures, for preventing denaturation of enzymes during freezing. Comparison of the cryoprotective ability of reported cryoprotectants, such as dimethylsulfoxide, glycerol, ectoine, hydroxyectoine, and trehalose, with betaine-type analogs using α-glucosidase revealed that analogs introducing C3-C6 alkyl chains into an ammonium cation retained 20 % higher activity than the control cryoprotectants at the same concentration. In particular, the analog possessing triplicate n-butyl chains showed a profound effect. It allowed retention of enzyme activity to 95 % even after 100 freeze-thaw cycles, while addition of the control cryoprotectants decreased the activity to 10-20 %. The cryoprotective ability of betaine-type analogs can be applied not only to α-glucosidase but also other enzymes such as β-glucosidase, alkaline phosphatase, lactose dehydrogenase, sulfatase, and horseradish peroxidase. Synthetic betaine-type metabolite analogs possess practicable cryoprotective ability for various enzymes, and are considerably superior to previously reported cryoprotectants.
Detailed kinetics and regulation of mammalian 2-oxoglutarate dehydrogenase
2011-01-01
Background Mitochondrial 2-oxoglutarate (α-ketoglutarate) dehydrogenase complex (OGDHC), a key regulatory point of tricarboxylic acid (TCA) cycle, plays vital roles in multiple pathways of energy metabolism and biosynthesis. The catalytic mechanism and allosteric regulation of this large enzyme complex are not fully understood. Here computer simulation is used to test possible catalytic mechanisms and mechanisms of allosteric regulation of the enzyme by nucleotides (ATP, ADP), pH, and metal ion cofactors (Ca2+ and Mg2+). Results A model was developed based on an ordered ter-ter enzyme kinetic mechanism combined with con-formational changes that involve rotation of one lipoic acid between three catalytic sites inside the enzyme complex. The model was parameterized using a large number of kinetic data sets on the activity of OGDHC, and validated by comparison of model predictions to independent data. Conclusions The developed model suggests a hybrid rapid-equilibrium ping-pong random mechanism for the kinetics of OGDHC, consistent with previously reported mechanisms, and accurately describes the experimentally observed regulatory effects of cofactors on the OGDHC activity. This analysis provides a single consistent theoretical explanation for a number of apparently contradictory results on the roles of phosphorylation potential, NAD (H) oxidation-reduction state ratio, as well as the regulatory effects of metal ions on ODGHC function. PMID:21943256
Kuang, Ye; Han, Xiaoyun; Xu, Mu; Wang, Yue; Zhao, Yuxiang; Yang, Qing
2018-05-31
Chemical injury is partly due to free radical lipid peroxidation, which can induce oxidative stress and produce a large number of reactive oxygen species (ROS). Oxaloacetic acid is an important intermediary in the tricarboxylic acid cycle (TCA cycle) and participates in metabolism and energy production. In our study, we found that oxaloacetate (OA) effectively alleviated liver injury which was induced by hydrogen peroxide (H₂O₂) in vitro and carbon tetrachloride (CCl₄) in vivo. OA scavenged ROS, prevented oxidative damage and maintained the normal structure of mitochondria. We further confirmed that OA increased adenosine triphosphate (ATP) by promoting the TCA production cycle and oxidative phosphorylation (OXPHOS). Finally, OA inhibited the mitogen-activated protein kinase (MAPK) and apoptotic pathways by suppressing tumor necrosis factor-α (TNF-α). Our findings reveal a mechanism for OA ameliorating chemical liver injury and suggest a possible implementation for preventing the chemical liver injury.
Wang, Ye; Lim, Lynette; Madilao, Lina; Lah, Ljerka; Bohlmann, Joerg; Breuil, Colette
2014-08-01
To successfully colonize and eventually kill pine trees, Grosmannia clavigera (Gs cryptic species), the main fungal pathogen associated with the mountain pine beetle (Dendroctonus ponderosae), has developed multiple mechanisms to overcome host tree chemical defenses, of which terpenoids are a major component. In addition to a monoterpene efflux system mediated by a recently discovered ABC transporter, Gs has genes that are highly induced by monoterpenes and that encode enzymes that modify or utilize monoterpenes [especially (+)-limonene]. We showed that pine-inhabiting Ophiostomale fungi are tolerant to monoterpenes, but only a few, including Gs, are known to utilize monoterpenes as a carbon source. Gas chromatography-mass spectrometry (GC-MS) revealed that Gs can modify (+)-limonene through various oxygenation pathways, producing carvone, p-mentha-2,8-dienol, perillyl alcohol, and isopiperitenol. It can also degrade (+)-limonene through the C-1-oxygenated pathway, producing limonene-1,2-diol as the most abundant intermediate. Transcriptome sequencing (RNA-seq) data indicated that Gs may utilize limonene 1,2-diol through beta-oxidation and then valine and tricarboxylic acid (TCA) metabolic pathways. The data also suggested that at least two gene clusters, located in genome contigs 108 and 161, were highly induced by monoterpenes and may be involved in monoterpene degradation processes. Further, gene knockouts indicated that limonene degradation required two distinct Baeyer-Villiger monooxygenases (BVMOs), an epoxide hydrolase and an enoyl coenzyme A (enoyl-CoA) hydratase. Our work provides information on enzyme-mediated limonene utilization or modification and a more comprehensive understanding of the interaction between an economically important fungal pathogen and its host's defense chemicals.
Bacterial whole-cell biocatalysts by surface display of enzymes: toward industrial application.
Schüürmann, Jan; Quehl, Paul; Festel, Gunter; Jose, Joachim
2014-10-01
Despite the first report on the bacterial display of a recombinant peptide appeared almost 30 years ago, industrial application of cells with surface-displayed enzymes is still limited. To display an enzyme on the surface of a living cell bears several advantages. First of all, neither the substrate nor the product of the enzymatic reaction needs to cross a membrane barrier. Second, the enzyme being linked to the cell can be separated from the reaction mixture and hence the product by simple centrifugation. Transfer to a new substrate preparation results in multiple cycles of enzymatic conversion. Finally, the anchoring in a matrix, in this case, the cell envelope stabilizes the enzyme and makes it less accessible to proteolytic degradation and material adsorption resulting in continuous higher activities. These advantages in common need to balance some disadvantages before this application can be taken into account for industrial processes, e.g., the exclusion of the enzyme from the cellular metabolome and hence from redox factors or other co-factors that need to be supplied. Therefore, this digest describes the different systems in Gram-positive and Gram-negative bacteria that have been used for the surface display of enzymes so far and focuses on examples among these which are suitable for industrial purposes or for the production of valuable resources, not least in order to encourage a broader application of whole-cell biocatalysts with surface-displayed enzymes.
Marri, Lucia; Zaffagnini, Mirko; Collin, Valérie; Issakidis-Bourguet, Emmanuelle; Lemaire, Stéphane D; Pupillo, Paolo; Sparla, Francesca; Miginiac-Maslow, Myroslawa; Trost, Paolo
2009-03-01
The Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) can form under oxidizing conditions a supramolecular complex with the regulatory protein CP12. Both GAPDH and PRK activities are inhibited within the complex, but they can be fully restored by reduced thioredoxins (TRXs). We have investigated the interactions of eight different chloroplast thioredoxin isoforms (TRX f1, m1, m2, m3, m4, y1, y2, x) with GAPDH (A(4), B(4), and B(8) isoforms), PRK and CP12 (isoform 2), all from Arabidopsis thaliana. In the complex, both A(4)-GAPDH and PRK were promptly activated by TRX f1, or more slowly by TRXs m1 and m2, but all other TRXs were ineffective. Free PRK was regulated by TRX f1, m1, or m2, while B(4)- and B(8)-GAPDH were absolutely specific for TRX f1. Interestingly, reductive activation of PRK caged in the complex was much faster than reductive activation of free oxidized PRK, and activation of A(4)-GAPDH in the complex was much faster (and less demanding in terms of reducing potential) than activation of free oxidized B(4)- or B(8)-GAPDH. It is proposed that CP12-assembled supramolecular complex may represent a reservoir of inhibited enzymes ready to be released in fully active conformation following reduction and dissociation of the complex by TRXs upon the shift from dark to low light. On the contrary, autonomous redox-modulation of GAPDH (B-containing isoforms) would be more suited to conditions of very active photosynthesis.
[Human drug metabolizing enzymes. II. Conjugation enzymes].
Vereczkey, L; Jemnitz, K; Gregus, Z
1998-09-01
In this review we focus on human conjugation enzymes (UDP-glucuronyltransferases, methyl-trasferases, N-acetyl-transferases, O-acetyl-transferases, Amidases/carboxyesterases, sulfotransferases, Glutation-S-transferases and the enzymes involved in the conjugation with amino acids) that participate in the metabolism of xenobiotics. Although conjugation reactions in most of the cases result in detoxication, more and more publications prove that the reactions catalysed by these enzymes very often lead to activated molecules that may attack macromolecules (proteins, RNAs, DNAs), resulting in toxicity (liver, neuro-, embryotoxicity, allergy, carcinogenecity). We have summarised the data available on these enzymes concerning their catalytic profile and specificity, inhibition, induction properties, their possible role in the generation of toxic compounds, their importance in clinical practice and drug development.
USDA-ARS?s Scientific Manuscript database
Inorganic and organic phosphates react strongly with soil constituents, resulting in relatively low concentrations of soluble phosphates in the soil solution. Multiple competing reactions control the solution-phase concentration and the cycling of phosphorus-containing organic substrates and the re...
The role of CYP26 enzymes in retinoic acid clearance.
Thatcher, Jayne E; Isoherranen, Nina
2009-08-01
Retinoic acid (RA) is a critical signaling molecule that regulates gene transcription and the cell cycle. Understanding of RA signaling has increased dramatically over the past decades, but the connection between whole body RA homeostasis and gene regulation in individual cells is still unclear. It has been proposed that cytochrome P450 family 26 (CYP26) enzymes have a role in determining the cellular exposure to RA by inactivating RA in cells that do not need RA. The CYP26 enzymes have been shown to metabolize RA efficiently and they are also inducible by RA in selected systems. However, their expression patterns in different cell types and a mechanistic understanding of their function is still lacking. Based on preliminary kinetic data and protein expression levels, one may predict that if CYP26A1 is expressed in the liver at even very low levels, it will be the major RA hydroxylase in this tissue. As such, it is an attractive pharmacological target for drug development when one aims to increase circulating or cellular RA concentrations. To further the understanding of how CYP26 enzymes contribute to the regulation of RA homeostasis, structural information of the CYP26s, commercially available recombinant enzymes and good specific and sensitive antibodies are needed.
The role of CYP26 enzymes in retinoic acid clearance
Thatcher, Jayne E.; Isoherranen, Nina
2009-01-01
Retinoic acid (RA) is a critical signaling molecule that regulates gene transcription and the cell cycle. Understanding of RA signaling has increased dramatically over the past decades, but the connection between whole body RA homeostasis and gene regulation in individual cells is still unclear. It has been proposed that cytochrome P450 family 26 (CYP26) enzymes have a role in determining the cellular exposure to RA by inactivating RA in cells that do not need RA. The CYP26 enzymes have been shown to metabolize RA efficiently and they are also inducible by RA in selected systems. However, their expression patterns in different cell types and a mechanistic understanding of their function is still lacking. Based on preliminary kinetic data and protein expression levels, one may predict that if CYP26A1 is expressed in the liver at even very low levels, it will be the major RA hydroxylase in this tissue. As such, it is an attractive pharmacological target for drug development when one aims to increase circulating or cellular RA concentrations. To further the understanding of how CYP26 enzymes contribute to the regulation of RA homeostasis, structural information of the CYP26’s, commercially available recombinant enzymes and good specific and sensitive antibodies are needed. PMID:19519282
Kim, Jin Yeong; Wu, Jingni; Kwon, Soon Jae; Oh, Haram; Lee, So Eui; Kim, Sang Gon; Wang, Yiming; Agrawal, Ganesh Kumar; Rakwal, Randeep; Kang, Kyu Young; Ahn, Il-Pyung; Kim, Beom-Gi; Kim, Sun Tae
2014-10-01
Necrotrophic fungal pathogen Cochliobolus miyabeanus causes brown spot disease in rice leaves upon infection, resulting in critical rice yield loss. To better understand the rice-C. miyabeanus interaction, we employed proteomic approaches to establish differential proteomes of total and secreted proteins from the inoculated leaves. The 2DE approach after PEG-fractionation of total proteins coupled with MS (MALDI-TOF/TOF and nESI-LC-MS/MS) analyses led to identification of 49 unique proteins out of 63 differential spots. SDS-PAGE in combination with nESI-LC-MS/MS shotgun approach was applied to identify secreted proteins in the leaf apoplast upon infection and resulted in cataloging of 501 unique proteins, of which 470 and 31 proteins were secreted from rice and C. miyabeanus, respectively. Proteins mapped onto metabolic pathways implied their reprogramming upon infection. The enzymes involved in Calvin cycle and glycolysis decreased in their protein abundance, whereas enzymes in the TCA cycle, amino acids, and ethylene biosynthesis increased. Differential proteomes also generated distribution of identified proteins in the intracellular and extracellular spaces, providing a better insight into defense responses of proteins in rice against C. miyabeanus. Established proteome of the rice-C. miyabeanus interaction serves not only as a good resource for the scientific community but also highlights its significance from biological aspects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Deletion of creB in Aspergillus oryzae increases secreted hydrolytic enzyme activity.
Hunter, A J; Morris, T A; Jin, B; Saint, C P; Kelly, J M
2013-09-01
Aspergillus oryzae has been used in the food and beverage industry for centuries, and industrial strains have been produced by multiple rounds of selection. Targeted gene deletion technology is particularly useful for strain improvement in such strains, particularly when they do not have a well-characterized meiotic cycle. Phenotypes of an Aspergillus nidulans strain null for the CreB deubiquitinating enzyme include effects on growth and repression, including increased activity levels of various enzymes. We show that Aspergillus oryzae contains a functional homologue of the CreB deubiquitinating enzyme and that a null strain shows increased activity levels of industrially important secreted enzymes, including cellulases, xylanases, amylases, and proteases, as well as alleviated inhibition of spore germination on glucose medium. Reverse transcription-quantitative PCR (RT-qPCR) analysis showed that the increased levels of enzyme activity in both Aspergillus nidulans and Aspergillus oryzae are mirrored at the transcript level, indicating transcriptional regulation. We report that Aspergillus oryzae DAR3699, originally isolated from soy fermentation, has a similar phenotype to that of a creB deletion mutant of the RIB40 strain, and it contains a mutation in the creB gene. Collectively, the results for Aspergillus oryzae, Aspergillus nidulans, Trichoderma reesei, and Penicillium decumbens show that deletion of creB may be broadly useful in diverse fungi for increasing production of a variety of enzymes.
Deletion of creB in Aspergillus oryzae Increases Secreted Hydrolytic Enzyme Activity
Hunter, A. J.; Morris, T. A.; Jin, B.; Saint, C. P.
2013-01-01
Aspergillus oryzae has been used in the food and beverage industry for centuries, and industrial strains have been produced by multiple rounds of selection. Targeted gene deletion technology is particularly useful for strain improvement in such strains, particularly when they do not have a well-characterized meiotic cycle. Phenotypes of an Aspergillus nidulans strain null for the CreB deubiquitinating enzyme include effects on growth and repression, including increased activity levels of various enzymes. We show that Aspergillus oryzae contains a functional homologue of the CreB deubiquitinating enzyme and that a null strain shows increased activity levels of industrially important secreted enzymes, including cellulases, xylanases, amylases, and proteases, as well as alleviated inhibition of spore germination on glucose medium. Reverse transcription-quantitative PCR (RT-qPCR) analysis showed that the increased levels of enzyme activity in both Aspergillus nidulans and Aspergillus oryzae are mirrored at the transcript level, indicating transcriptional regulation. We report that Aspergillus oryzae DAR3699, originally isolated from soy fermentation, has a similar phenotype to that of a creB deletion mutant of the RIB40 strain, and it contains a mutation in the creB gene. Collectively, the results for Aspergillus oryzae, Aspergillus nidulans, Trichoderma reesei, and Penicillium decumbens show that deletion of creB may be broadly useful in diverse fungi for increasing production of a variety of enzymes. PMID:23835170
Measuring the Enzyme Activity of Arabidopsis Deubiquitylating Enzymes.
Kalinowska, Kamila; Nagel, Marie-Kristin; Isono, Erika
2016-01-01
Deubiquitylating enzymes, or DUBs, are important regulators of ubiquitin homeostasis and substrate stability, though the molecular mechanisms of most of the DUBs in plants are not yet understood. As different ubiquitin chain types are implicated in different biological pathways, it is important to analyze the enzyme characteristic for studying a DUB. Quantitative analysis of DUB activity is also important to determine enzyme kinetics and the influence of DUB binding proteins on the enzyme activity. Here, we show methods to analyze DUB activity using immunodetection, Coomassie Brilliant Blue staining, and fluorescence measurement that can be useful for understanding the basic characteristic of DUBs.
NASA Astrophysics Data System (ADS)
Zhou, Xiaoqi; Wang, Shen S. J.; Chen, Chengrong
2017-12-01
Forest plantations have been widely used as an effective measure for increasing soil carbon (C), and nitrogen (N) stocks and soil enzyme activities play a key role in soil C and N losses during decomposition of soil organic matter. However, few studies have been carried out to elucidate the mechanisms behind the differences in soil C and N cycling by different tree species in response to climate warming. Here, we measured the responses of soil's extracellular enzyme activity (EEA) to a gradient of temperatures using incubation methods in 78-year-old forest plantations with different tree species. Based on a soil enzyme kinetics model, we established a new statistical model to investigate the effects of temperature and tree species on soil EEA. In addition, we established a tree species-enzyme-C/N model to investigate how temperature and tree species influence soil C/N contents over time without considering plant C inputs. These extracellular enzymes included C acquisition enzymes (β-glucosidase, BG), N acquisition enzymes (N-acetylglucosaminidase, NAG; leucine aminopeptidase, LAP) and phosphorus acquisition enzymes (acid phosphatases). The results showed that incubation temperature and tree species significantly influenced all soil EEA and Eucalyptus had 1.01-2.86 times higher soil EEA than coniferous tree species. Modeling showed that Eucalyptus had larger soil C losses but had 0.99-2.38 times longer soil C residence time than the coniferous tree species over time. The differences in the residual soil C and N contents between Eucalyptus and coniferous tree species, as well as between slash pine (Pinus elliottii Engelm. var. elliottii) and hoop pine (Araucaria cunninghamii Ait.), increase with time. On the other hand, the modeling results help explain why exotic slash pine can grow faster, as it has 1.22-1.38 times longer residual soil N residence time for LAP, which mediate soil N cycling in the long term, than native coniferous tree species like hoop pine and
Rapid diagnostic methods for influenza virus in clinical specimens - A comparative study
NASA Technical Reports Server (NTRS)
Evans, A. S.; Olson, B.
1982-01-01
A comparison of five rapid viral diagnostic techniques for identifying influenza virus in nasopharyngeal aspirates has been made on patients with influenza-like illnesses. Initial results with immune electron microscopy were positive in only one of 11 specimens from which virus was isolated and further work abandoned. Four other rapid tests were carried out on 39 specimens from which influenza virus had been isolated in tissue culture in 28. Of these 28 specimens yielding virus, 24 (85.7 percent) were positive by an indirect fluorescent antibody test (IFAT) on nasopharyngeal cells, 18 (64.3 percent) by enzyme-linked immunosorbent assay (ELISA), 19 (67.8 percent) by enzyme-linked fluorescent assay (ELFA), and 26 (92.8 percent) by a rapid tissue culture amplification method (TCA) in a continuous Rhesus monkey kidney line (LLC-MK2) with identification of virus by fluorescent antibody. In terms of sensitivity, simplicity, and rapidity, a combination of the IFAT and TCA methods seems to be very useful.
Diacylglycerol, phosphatidic acid, and their metabolic enzymes in synaptic vesicle recycling.
Tu-Sekine, Becky; Goldschmidt, Hana; Raben, Daniel M
2015-01-01
The synaptic vesicle (SV) cycle includes exocytosis of vesicles loaded with a neurotransmitter such as glutamate, coordinated recovery of SVs by endocytosis, refilling of vesicles, and subsequent release of the refilled vesicles from the presynaptic bouton. SV exocytosis is tightly linked with endocytosis, and variations in the number of vesicles, and/or defects in the refilling of SVs, will affect the amount of neurotransmitter available for release (Sudhof, 2004). There is increasing interest in the roles synaptic vesicle lipids and lipid metabolizing enzymes play in this recycling. Initial emphasis was placed on the role of polyphosphoinositides in SV cycling as outlined in a number of reviews (Lim and Wenk, 2009; Martin, 2012; Puchkov and Haucke, 2013; Rohrbough and Broadie, 2005). Other lipids are now recognized to also play critical roles. For example, PLD1 (Humeau et al., 2001; Rohrbough and Broadie, 2005) and some DGKs (Miller et al., 1999; Nurrish et al., 1999) play roles in neurotransmission which is consistent with the critical roles for phosphatidic acid (PtdOH) and diacylglycerol (DAG) in the regulation of SV exo/endocytosis (Cremona et al., 1999; Exton, 1994; Huttner and Schmidt, 2000; Lim and Wenk, 2009; Puchkov and Haucke, 2013; Rohrbough and Broadie, 2005). PLD generates phosphatidic acid by catalyzing the hydrolysis of phosphatidylcholine (PtdCho) and in some systems this PtdOH is de-phosphorylated to generate DAG. In contrast, DGK catalyzes the phosphorylation of DAG thereby converting it into PtdOH. While both enzymes are poised to regulate the levels of DAG and PtdOH, therefore, they both lead to the generation of PtdOH and could have opposite effects on DAG levels. This is particularly important for SV cycling as PtdOH and DAG are both needed for evoked exocytosis (Lim and Wenk, 2009; Puchkov and Haucke, 2013; Rohrbough and Broadie, 2005). Two lipids and their involved metabolic enzymes, two sphingolipids have also been implicated in
Problem-Based Test: Replication of Mitochondrial DNA during the Cell Cycle
ERIC Educational Resources Information Center
Setalo, Gyorgy, Jr.
2013-01-01
Terms to be familiar with before you start to solve the test: cell cycle, generation time, S-phase, cell culture synchronization, isotopic pulse-chase labeling, density labeling, equilibrium density-gradient centrifugation, buoyant density, rate-zonal centrifugation, nucleoside, nucleotide, kinase enzymes, polymerization of nucleic acids,…
Is the urea cycle involved in Alzheimer's disease?
Hansmannel, Franck; Sillaire, Adeline; Kamboh, M Ilyas; Lendon, Corinne; Pasquier, Florence; Hannequin, Didier; Laumet, Geoffroy; Mounier, Anais; Ayral, Anne-Marie; DeKosky, Steven T; Hauw, Jean-Jacques; Berr, Claudine; Mann, David; Amouyel, Philippe; Campion, Dominique; Lambert, Jean-Charles
2010-01-01
Since previous observations indicated that the urea cycle may have a role in the Alzheimer's disease (AD) process, we set out to quantify the expression of each gene involved in the urea cycle in control and AD brains and establish whether these genes could be genetic determinants of AD. We first confirmed that all the urea cycle enzyme genes are expressed in the AD brain. The expression of arginase 2 was greater in the AD brain than in the control brain. The presence of the rare arginase 2 allele rs742869 was associated with an increase in the risk of AD in men and with an earlier age-at-onset for both genders. None of the other genes in the pathway appeared to be differentially expressed in the AD brain or act as genetic determinants of the disease.
Garrido-Sanz, Daniel; Manzano, Javier; Martín, Marta; Redondo-Nieto, Miguel; Rivilla, Rafael
2018-01-01
Polychlorinated biphenyls (PCBs) are widespread persistent pollutants that cause several adverse health effects. Aerobic bioremediation of PCBs involves the activity of either one bacterial species or a microbial consortium. Using multiple species will enhance the range of PCB congeners co-metabolized since different PCB-degrading microorganisms exhibit different substrate specificity. We have isolated a bacterial consortium by successive enrichment culture using biphenyl (analog of PCBs) as the sole carbon and energy source. This consortium is able to grow on biphenyl, benzoate, and protocatechuate. Whole-community DNA extracted from the consortium was used to analyze biodiversity by Illumina sequencing of a 16S rRNA gene amplicon library and to determine the metagenome by whole-genome shotgun Illumina sequencing. Biodiversity analysis shows that the consortium consists of 24 operational taxonomic units (≥97% identity). The consortium is dominated by strains belonging to the genus Pseudomonas, but also contains betaproteobacteria and Rhodococcus strains. whole-genome shotgun (WGS) analysis resulted in contigs containing 78.3 Mbp of sequenced DNA, representing around 65% of the expected DNA in the consortium. Bioinformatic analysis of this metagenome has identified the genes encoding the enzymes implicated in three pathways for the conversion of biphenyl to benzoate and five pathways from benzoate to tricarboxylic acid (TCA) cycle intermediates, allowing us to model the whole biodegradation network. By genus assignment of coding sequences, we have also been able to determine that the three biphenyl to benzoate pathways are carried out by Rhodococcus strains. In turn, strains belonging to Pseudomonas and Bordetella are the main responsible of three of the benzoate to TCA pathways while the benzoate conversion into TCA cycle intermediates via benzoyl-CoA and the catechol meta-cleavage pathways are carried out by beta proteobacteria belonging to genera such as
Collagen Matrix Density Drives the Metabolic Shift in Breast Cancer Cells.
Morris, Brett A; Burkel, Brian; Ponik, Suzanne M; Fan, Jing; Condeelis, John S; Aguirre-Ghiso, Julio A; Castracane, James; Denu, John M; Keely, Patricia J
2016-11-01
Increased breast density attributed to collagen I deposition is associated with a 4-6 fold increased risk of developing breast cancer. Here, we assessed cellular metabolic reprogramming of mammary carcinoma cells in response to increased collagen matrix density using an in vitro 3D model. Our initial observations demonstrated changes in functional metabolism in both normal mammary epithelial cells and mammary carcinoma cells in response to changes in matrix density. Further, mammary carcinoma cells grown in high density collagen matrices displayed decreased oxygen consumption and glucose metabolism via the tricarboxylic acid (TCA) cycle compared to cells cultured in low density matrices. Despite decreased glucose entry into the TCA cycle, levels of glucose uptake, cell viability, and ROS were not different between high and low density matrices. Interestingly, under high density conditions the contribution of glutamine as a fuel source to drive the TCA cycle was significantly enhanced. These alterations in functional metabolism mirrored significant changes in the expression of metabolic genes involved in glycolysis, oxidative phosphorylation, and the serine synthesis pathway. This study highlights the broad importance of the collagen microenvironment to cellular expression profiles, and shows that changes in density of the collagen microenvironment can modulate metabolic shifts of cancer cells. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Krznar, Petra; Hörl, Manuel; Ammar, Zeinab; Montessuit, Sylvie; Pierredon, Sandra; Zamboni, Nicola; Martinou, Jean-Claude
2016-01-01
Mitochondrial import of pyruvate by the mitochondrial pyruvate carrier (MPC) is a central step which links cytosolic and mitochondrial intermediary metabolism. To investigate the role of the MPC in mammalian physiology and development, we generated a mouse strain with complete loss of MPC1 expression. This resulted in embryonic lethality at around E13.5. Mouse embryonic fibroblasts (MEFs) derived from mutant mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, and both defects could be restored by reexpression of MPC1. Labeling experiments using 13C-labeled glucose and glutamine demonstrated that MPC deficiency causes increased glutaminolysis and reduced contribution of glucose-derived pyruvate to the TCA cycle. Morphological defects were observed in mutant embryonic brains, together with major alterations of their metabolome including lactic acidosis, diminished TCA cycle intermediates, energy deficit and a perturbed balance of neurotransmitters. Strikingly, these changes were reversed when the pregnant dams were fed a ketogenic diet, which provides acetyl-CoA directly to the TCA cycle and bypasses the need for a functional MPC. This allowed the normal gestation and development of MPC deficient pups, even though they all died within a few minutes post-delivery. This study establishes the MPC as a key player in regulating the metabolic state necessary for embryonic development, neurotransmitter balance and post-natal survival. PMID:27176894
Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula
2006-02-15
Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.
Protein-bound NAD(P)H Lifetime is Sensitive to Multiple Fates of Glucose Carbon.
Sharick, Joe T; Favreau, Peter F; Gillette, Amani A; Sdao, Sophia M; Merrins, Matthew J; Skala, Melissa C
2018-04-03
While NAD(P)H fluorescence lifetime imaging (FLIM) can detect changes in flux through the TCA cycle and electron transport chain (ETC), it remains unclear whether NAD(P)H FLIM is sensitive to other potential fates of glucose. Glucose carbon can be diverted from mitochondria by the pentose phosphate pathway (via glucose 6-phosphate dehydrogenase, G6PDH), lactate production (via lactate dehydrogenase, LDH), and rejection of carbon from the TCA cycle (via pyruvate dehydrogenase kinase, PDK), all of which can be upregulated in cancer cells. Here, we demonstrate that multiphoton NAD(P)H FLIM can be used to quantify the relative concentrations of recombinant LDH and malate dehydrogenase (MDH) in solution. In multiple epithelial cell lines, NAD(P)H FLIM was also sensitive to inhibition of LDH and PDK, as well as the directionality of LDH in cells forced to use pyruvate versus lactate as fuel sources. Among the parameters measurable by FLIM, only the lifetime of protein-bound NAD(P)H (τ 2 ) was sensitive to these changes, in contrast to the optical redox ratio, mean NAD(P)H lifetime, free NAD(P)H lifetime, or the relative amount of free and protein-bound NAD(P)H. NAD(P)H τ 2 offers the ability to non-invasively quantify diversions of carbon away from the TCA cycle/ETC, which may support mechanisms of drug resistance.
Nanomaterials with enzyme-like characteristics (nanozymes): next-generation artificial enzymes.
Wei, Hui; Wang, Erkang
2013-07-21
Over the past few decades, researchers have established artificial enzymes as highly stable and low-cost alternatives to natural enzymes in a wide range of applications. A variety of materials including cyclodextrins, metal complexes, porphyrins, polymers, dendrimers and biomolecules have been extensively explored to mimic the structures and functions of naturally occurring enzymes. Recently, some nanomaterials have been found to exhibit unexpected enzyme-like activities, and great advances have been made in this area due to the tremendous progress in nano-research and the unique characteristics of nanomaterials. To highlight the progress in the field of nanomaterial-based artificial enzymes (nanozymes), this review discusses various nanomaterials that have been explored to mimic different kinds of enzymes. We cover their kinetics, mechanisms and applications in numerous fields, from biosensing and immunoassays, to stem cell growth and pollutant removal. We also summarize several approaches to tune the activities of nanozymes. Finally, we make comparisons between nanozymes and other catalytic materials (other artificial enzymes, natural enzymes, organic catalysts and nanomaterial-based catalysts) and address the current challenges and future directions (302 references).
2014-01-01
Summary The acquired form of 5-oxoproline (pyroglutamic acid) metabolic acidosis was first described in 1989 and its relationship to chronic acetaminophen ingestion was proposed the next year. Since then, this cause of chronic anion gap metabolic acidosis has been increasingly recognized. Many cases go unrecognized because an assay for 5-oxoproline is not widely available. Most cases occur in malnourished, chronically ill women with a history of chronic acetaminophen ingestion. Acetaminophen levels are very rarely in the toxic range; rather, they are usually therapeutic or low. The disorder generally resolves with cessation of acetaminophen and administration of intravenous fluids. Methionine or N-acetyl cysteine may accelerate resolution and methionine is protective in a rodent model. The disorder has been attributed to glutathione depletion and activation of a key enzyme in the γ-glutamyl cycle. However, the specific metabolic derangements that cause the 5-oxoproline accumulation remain unclear. An ATP-depleting futile 5-oxoproline cycle can explain the accumulation of 5-oxoproline after chronic acetaminophen ingestion. This cycle is activated by the depletion of both glutathione and cysteine. This explanation contributes to our understanding of acetaminophen-induced 5-oxoproline metabolic acidosis and the beneficial role of N-acetyl cysteine therapy. The ATP-depleting futile 5-oxoproline cycle may also play a role in the energy depletions that occur in other acetaminophen-related toxic syndromes. PMID:24235282
Emmett, Michael
2014-01-01
The acquired form of 5-oxoproline (pyroglutamic acid) metabolic acidosis was first described in 1989 and its relationship to chronic acetaminophen ingestion was proposed the next year. Since then, this cause of chronic anion gap metabolic acidosis has been increasingly recognized. Many cases go unrecognized because an assay for 5-oxoproline is not widely available. Most cases occur in malnourished, chronically ill women with a history of chronic acetaminophen ingestion. Acetaminophen levels are very rarely in the toxic range; rather, they are usually therapeutic or low. The disorder generally resolves with cessation of acetaminophen and administration of intravenous fluids. Methionine or N-acetyl cysteine may accelerate resolution and methionine is protective in a rodent model. The disorder has been attributed to glutathione depletion and activation of a key enzyme in the γ-glutamyl cycle. However, the specific metabolic derangements that cause the 5-oxoproline accumulation remain unclear. An ATP-depleting futile 5-oxoproline cycle can explain the accumulation of 5-oxoproline after chronic acetaminophen ingestion. This cycle is activated by the depletion of both glutathione and cysteine. This explanation contributes to our understanding of acetaminophen-induced 5-oxoproline metabolic acidosis and the beneficial role of N-acetyl cysteine therapy. The ATP-depleting futile 5-oxoproline cycle may also play a role in the energy depletions that occur in other acetaminophen-related toxic syndromes.
Naveilhan, P; Baudet, C; Jabbour, W; Wion, D
1994-09-01
A model that may explain the limited division potential of certain cells such as human fibroblasts in culture is presented. The central postulate of this theory is that there exists, prior to certain key exons that code for materials needed for cell division, a unique sequence of specific repeating segments of DNA. One copy of such repeating segments is deleted during each cell cycle in cells that are not protected from such deletion through methylation of their cytosine residues. According to this theory, the means through which such repeated sequences are removed, one per cycle, is through the sequential action of enzymes that act much as bacterial restriction enzymes do--namely to produce scissions in both strands of DNA in areas that correspond to the DNA base sequence recognition specificities of such enzymes. After the first scission early in a replicative cycle, that enzyme becomes inhibited, but the cleavage of the first site exposes the closest site in the repetitive element to the action of a second restriction enzyme after which that enzyme also becomes inhibited. Then repair occurs, regenerating the original first site. Through this sequential activation and inhibition of two different restriction enzymes, only one copy of the repeating sequence is deleted during each cell cycle. In effect, the repeating sequence operates as a precise counter of the numbers of cell doubling that have occurred since the cells involved differentiated during development.
Marubashi, Soujiro; Shimada, Hikaru; Fukuda, Mitsunori; Ohbayashi, Norihiko
2016-01-15
Two cell type-specific Rab proteins, Rab32 and Rab38 (Rab32/38), have been proposed as regulating the trafficking of melanogenic enzymes, including tyrosinase and tyrosinase-related protein 1 (Tyrp1), to melanosomes in melanocytes. Like other GTPases, Rab32/38 function as switch molecules that cycle between a GDP-bound inactive form and a GTP-bound active form; the cycle is thought to be regulated by an activating enzyme, guanine nucleotide exchange factor (GEF), and an inactivating enzyme, GTPase-activating protein (GAP), which stimulates the GTPase activity of Rab32/38. Although BLOC-3 has already been identified as a Rab32/38-specific GEF that regulates the trafficking of tyrosinase and Tyrp1, no physiological GAP for Rab32/38 in melanocytes has ever been identified, and it has remained unclear whether Rab32/38 is involved in the trafficking of dopachrome tautomerase, another melanogenic enzyme, in mouse melanocytes. In this study we investigated RUTBC1, which was originally characterized as a Rab9-binding protein and GAP for Rab32 and Rab33B in vitro, and the results demonstrated that RUTBC1 functions as a physiological GAP for Rab32/38 in the trafficking of all three melanogenic enzymes in mouse melanocytes. The results of this study also demonstrated the involvement of Rab9A in the regulation of the RUTBC1 localization and in the trafficking of all three melanogenic enzymes. We discovered that either excess activation or inactivation of Rab32/38 achieved by manipulating RUTBC1 inhibits the trafficking of all three melanogenic enzymes. These results collectively indicate that proper spatiotemporal regulation of Rab32/38 is essential for the trafficking of all three melanogenic enzymes in mouse melanocytes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Marubashi, Soujiro; Shimada, Hikaru; Fukuda, Mitsunori; Ohbayashi, Norihiko
2016-01-01
Two cell type-specific Rab proteins, Rab32 and Rab38 (Rab32/38), have been proposed as regulating the trafficking of melanogenic enzymes, including tyrosinase and tyrosinase-related protein 1 (Tyrp1), to melanosomes in melanocytes. Like other GTPases, Rab32/38 function as switch molecules that cycle between a GDP-bound inactive form and a GTP-bound active form; the cycle is thought to be regulated by an activating enzyme, guanine nucleotide exchange factor (GEF), and an inactivating enzyme, GTPase-activating protein (GAP), which stimulates the GTPase activity of Rab32/38. Although BLOC-3 has already been identified as a Rab32/38-specific GEF that regulates the trafficking of tyrosinase and Tyrp1, no physiological GAP for Rab32/38 in melanocytes has ever been identified, and it has remained unclear whether Rab32/38 is involved in the trafficking of dopachrome tautomerase, another melanogenic enzyme, in mouse melanocytes. In this study we investigated RUTBC1, which was originally characterized as a Rab9-binding protein and GAP for Rab32 and Rab33B in vitro, and the results demonstrated that RUTBC1 functions as a physiological GAP for Rab32/38 in the trafficking of all three melanogenic enzymes in mouse melanocytes. The results of this study also demonstrated the involvement of Rab9A in the regulation of the RUTBC1 localization and in the trafficking of all three melanogenic enzymes. We discovered that either excess activation or inactivation of Rab32/38 achieved by manipulating RUTBC1 inhibits the trafficking of all three melanogenic enzymes. These results collectively indicate that proper spatiotemporal regulation of Rab32/38 is essential for the trafficking of all three melanogenic enzymes in mouse melanocytes. PMID:26620560
Solomon, Ariel; Akabayov, Barak; Frenkel, Anatoly; Milla, Marcos E.; Sagi, Irit
2007-01-01
Despite their key roles in many normal and pathological processes, the molecular details by which zinc-dependent proteases hydrolyze their physiological substrates remain elusive. Advanced theoretical analyses have suggested reaction models for which there is limited and controversial experimental evidence. Here we report the structure, chemistry and lifetime of transient metal–protein reaction intermediates evolving during the substrate turnover reaction of a metalloproteinase, the tumor necrosis factor-α converting enzyme (TACE). TACE controls multiple signal transduction pathways through the proteolytic release of the extracellular domain of a host of membrane-bound factors and receptors. Using stopped-flow x-ray spectroscopy methods together with transient kinetic analyses, we demonstrate that TACE's catalytic zinc ion undergoes dynamic charge transitions before substrate binding to the metal ion. This indicates previously undescribed communication pathways taking place between distal protein sites and the enzyme catalytic core. The observed charge transitions are synchronized with distinct phases in the reaction kinetics and changes in metal coordination chemistry mediated by the binding of the peptide substrate to the catalytic metal ion and product release. Here we report key local charge transitions critical for proteolysis as well as long sought evidence for the proposed reaction model of peptide hydrolysis. This study provides a general approach for gaining critical insights into the molecular basis of substrate recognition and turnover by zinc metalloproteinases that may be used for drug design. PMID:17360351
Enzyme linked immunoassay with stabilized polymer saccharide enzyme conjugates
Callstrom, Matthew R.; Bednarski, Mark D.; Gruber, Patrick R.
1997-01-01
An improvement in enzyme linked immunoassays is disclosed wherein the enzyme is in the form of a water soluble polymer saccharide conjugate which is stable in hostile environments. The conjugate comprises the enzyme which is linked to the polymer at multiple points through saccharide linker groups.
NASA Technical Reports Server (NTRS)
Lesley, Michael W.; Davis, Lawrence E.; Moulder, John F.; Carlson, Brad A.
1995-01-01
The role of surface-sensitive chemical analysis (ESCA, AES, and SIMS) in a study to select a process to replace 1, 1, 1-trichloroethane (TCA) vapor degreasing as a steel and aluminum bonding surface preparation method is described. The effort was primarily concerned with spray-in-air cleaning processes involving aqueous alkaline and semi-aqueous cleaners and a contamination sensitive epoxy-to-metal bondline. While all five cleaners tested produced bonding strength results equal to or better than those produced by vapor degreasing, the aqueous alkaline cleaners yielded results which were superior to those produced by the semi-aqueous cleaners. The main reason for the enhanced performance appears to be a silicate layer left behind by the aqueous alkaline cleaners. The silicate layer increases the polarity of the surface and enhances epoxy-to-metal bonding. On the other hand, one of the semi-aqueous cleaners left a nonpolar carbonaceous residue which appeared to have a negative effect on epoxy-to-metal bonding. Differences in cleaning efficiency between cleaners/processes were also identified. These differences in surface chemistry, which were sufficient to affect bonding, were not detected by conventional chemical analysis techniques.
[Advances on enzymes and enzyme inhibitors research based on microfluidic devices].
Hou, Feng-Hua; Ye, Jian-Qing; Chen, Zuan-Guang; Cheng, Zhi-Yi
2010-06-01
With the continuous development in microfluidic fabrication technology, microfluidic analysis has evolved from a concept to one of research frontiers in last twenty years. The research of enzymes and enzyme inhibitors based on microfluidic devices has also made great progress. Microfluidic technology improved greatly the analytical performance of the research of enzymes and enzyme inhibitors by reducing the consumption of reagents, decreasing the analysis time, and developing automation. This review focuses on the development and classification of enzymes and enzyme inhibitors research based on microfluidic devices.
Dovgerd, A P; Zharkov, D O
2014-01-01
PCR amplification of severely degraded DNA, including ancient DNA, forensic samples, and preparations from deeply processed foodstuffs, is a serious problem. Living organisms have a set of enzymes to repair lesions in their DNA. In this work, we have developed and characterized model systems of degraded high-molecular-weight DNA with a predominance of different types of damage. It was shown that depurination and oxidation of the model plasmid DNA template led to a decrease in the PCR efficiency. A set of enzymes performing a full cycle of excision repair of some lesions was determined. The treatment of model-damaged substrates with this set of enzymes resulted in an increased PCR product yield as compared with that of the unrepaired samples.
Igamberdiev, Abir U.; Eprintsev, Alexander T.
2016-01-01
Organic acids are synthesized in plants as a result of the incomplete oxidation of photosynthetic products and represent the stored pools of fixed carbon accumulated due to different transient times of conversion of carbon compounds in metabolic pathways. When redox level in the cell increases, e.g., in conditions of active photosynthesis, the tricarboxylic acid (TCA) cycle in mitochondria is transformed to a partial cycle supplying citrate for the synthesis of 2-oxoglutarate and glutamate (citrate valve), while malate is accumulated and participates in the redox balance in different cell compartments (via malate valve). This results in malate and citrate frequently being the most accumulated acids in plants. However, the intensity of reactions linked to the conversion of these compounds can cause preferential accumulation of other organic acids, e.g., fumarate or isocitrate, in higher concentrations than malate and citrate. The secondary reactions, associated with the central metabolic pathways, in particularly with the TCA cycle, result in accumulation of other organic acids that are derived from the intermediates of the cycle. They form the additional pools of fixed carbon and stabilize the TCA cycle. Trans-aconitate is formed from citrate or cis-aconitate, accumulation of hydroxycitrate can be linked to metabolism of 2-oxoglutarate, while 4-hydroxy-2-oxoglutarate can be formed from pyruvate and glyoxylate. Glyoxylate, a product of either glycolate oxidase or isocitrate lyase, can be converted to oxalate. Malonate is accumulated at high concentrations in legume plants. Organic acids play a role in plants in providing redox equilibrium, supporting ionic gradients on membranes, and acidification of the extracellular medium. PMID:27471516
Johansen, Maja L; Bak, Lasse K; Schousboe, Arne; Iversen, Peter; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Gjedde, Albert; Ott, Peter; Waagepetersen, Helle S
2007-06-01
Cerebral hyperammonemia is a hallmark of hepatic encephalopathy, a debilitating condition arising secondary to liver disease. Pyruvate oxidation including tricarboxylic acid (TCA) cycle metabolism has been suggested to be inhibited by hyperammonemia at the pyruvate and alpha-ketoglutarate dehydrogenase steps. Catabolism of the branched-chain amino acid isoleucine provides both acetyl-CoA and succinyl-CoA, thus by-passing both the pyruvate dehydrogenase and the alpha-ketoglutarate dehydrogenase steps. Potentially, this will enable the TCA cycle to work in the face of ammonium-induced inhibition. In addition, this will provide the alpha-ketoglutarate carbon skeleton for glutamate and glutamine synthesis by glutamate dehydrogenase and glutamine synthetase (astrocytes only), respectively, both reactions fixing ammonium. Cultured cerebellar neurons (primarily glutamatergic) or astrocytes were incubated in the presence of either [U-13C]glucose (2.5 mM) and isoleucine (1 mM) or [U-13C]isoleucine and glucose. Cell cultures were treated with an acute ammonium chloride load of 2 (astrocytes) or 5 mM (neurons and astrocytes) and incorporation of 13C-label into glutamate, aspartate, glutamine and alanine was determined employing mass spectrometry. Labeling from [U-13C]glucose in glutamate and aspartate increased as a result of ammonium-treatment in both neurons and astrocytes, suggesting that the TCA cycle was not inhibited. Labeling in alanine increased in neurons but not in astrocytes, indicating elevated glycolysis in neurons. For both neurons and astrocytes, labeling from [U-13C]isoleucine entered glutamate and aspartate albeit to a lower extent than from [U-13C]glucose. Labeling in glutamate and aspartate from [U-13C]isoleucine was decreased by ammonium treatment in neurons but not in astrocytes, the former probably reflecting increased metabolism of unlabeled glucose. In astrocytes, ammonia treatment resulted in glutamine production and release to the medium, partially
Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou
2015-03-18
Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified
Enzyme linked immunoassay with stabilized polymer saccharide enzyme conjugates
Callstrom, M.R.; Bednarski, M.D.; Gruber, P.R.
1997-11-25
An improvement in enzyme linked immunoassays is disclosed wherein the enzyme is in the form of a water soluble polymer saccharide conjugate which is stable in hostile environments. The conjugate comprises the enzyme which is linked to the polymer at multiple points through saccharide linker groups. 19 figs.
Computational enzyme design: transitioning from catalytic proteins to enzymes.
Mak, Wai Shun; Siegel, Justin B
2014-08-01
The widespread interest in enzymes stem from their ability to catalyze chemical reactions under mild and ecologically friendly conditions with unparalleled catalytic proficiencies. While thousands of naturally occurring enzymes have been identified and characterized, there are still numerous important applications for which there are no biological catalysts capable of performing the desired chemical transformation. In order to engineer enzymes for which there is no natural starting point, efforts using a combination of quantum chemistry and force-field based protein molecular modeling have led to the design of novel proteins capable of catalyzing chemical reactions not catalyzed by naturally occurring enzymes. Here we discuss the current status and potential avenues to pursue as the field of computational enzyme design moves forward. Published by Elsevier Ltd.
Developmental roles of tyrosine metabolism enzymes in the blood-sucking insect Rhodnius prolixus
Oliveira, Pedro L.
2017-01-01
The phenylalanine/tyrosine degradation pathway is frequently described as a catabolic pathway that funnels aromatic amino acids into citric acid cycle intermediates. Previously, we demonstrated that the accumulation of tyrosine generated during the hydrolysis of blood meal proteins in Rhodnius prolixus is potentially toxic, a harmful outcome that is prevented by the action of the first two enzymes in the tyrosine degradation pathway. In this work, we further evaluated the relevance of all other enzymes involved in phenylalanine/tyrosine metabolism in the physiology of this insect. The knockdown of most of these enzymes produced a wide spectrum of distinct phenotypes associated with reproduction, development and nymph survival, demonstrating a highly pleiotropic role of tyrosine metabolism. The phenotypes obtained for two of these enzymes, homogentisate dioxygenase and fumarylacetoacetase, have never before been described in any arthropod. To our knowledge, this report is the first comprehensive gene-silencing analysis of an amino acid metabolism pathway in insects. Amino acid metabolism is exceptionally important in haematophagous arthropods due to their particular feeding behaviour. PMID:28469016
Developmental roles of tyrosine metabolism enzymes in the blood-sucking insect Rhodnius prolixus.
Sterkel, Marcos; Oliveira, Pedro L
2017-05-17
The phenylalanine/tyrosine degradation pathway is frequently described as a catabolic pathway that funnels aromatic amino acids into citric acid cycle intermediates. Previously, we demonstrated that the accumulation of tyrosine generated during the hydrolysis of blood meal proteins in Rhodnius prolixus is potentially toxic, a harmful outcome that is prevented by the action of the first two enzymes in the tyrosine degradation pathway. In this work, we further evaluated the relevance of all other enzymes involved in phenylalanine/tyrosine metabolism in the physiology of this insect. The knockdown of most of these enzymes produced a wide spectrum of distinct phenotypes associated with reproduction, development and nymph survival, demonstrating a highly pleiotropic role of tyrosine metabolism. The phenotypes obtained for two of these enzymes, homogentisate dioxygenase and fumarylacetoacetase, have never before been described in any arthropod. To our knowledge, this report is the first comprehensive gene-silencing analysis of an amino acid metabolism pathway in insects. Amino acid metabolism is exceptionally important in haematophagous arthropods due to their particular feeding behaviour. © 2017 The Author(s).
Functional diversity of carbohydrate-active enzymes enabling a bacterium to ferment plant biomass.
Boutard, Magali; Cerisy, Tristan; Nogue, Pierre-Yves; Alberti, Adriana; Weissenbach, Jean; Salanoubat, Marcel; Tolonen, Andrew C
2014-11-01
Microbial metabolism of plant polysaccharides is an important part of environmental carbon cycling, human nutrition, and industrial processes based on cellulosic bioconversion. Here we demonstrate a broadly applicable method to analyze how microbes catabolize plant polysaccharides that integrates carbohydrate-active enzyme (CAZyme) assays, RNA sequencing (RNA-seq), and anaerobic growth screening. We apply this method to study how the bacterium Clostridium phytofermentans ferments plant biomass components including glucans, mannans, xylans, galactans, pectins, and arabinans. These polysaccharides are fermented with variable efficiencies, and diauxies prioritize metabolism of preferred substrates. Strand-specific RNA-seq reveals how this bacterium responds to polysaccharides by up-regulating specific groups of CAZymes, transporters, and enzymes to metabolize the constituent sugars. Fifty-six up-regulated CAZymes were purified, and their activities show most polysaccharides are degraded by multiple enzymes, often from the same family, but with divergent rates, specificities, and cellular localizations. CAZymes were then tested in combination to identify synergies between enzymes acting on the same substrate with different catalytic mechanisms. We discuss how these results advance our understanding of how microbes degrade and metabolize plant biomass.
Kim, June-Bum; Lim, Nary; Kim, Sung-Jo; Heo, Tae-Hwe
2012-12-01
Batten disease is an inherited disorder characterized by early onset neurodegeneration due to the mutation of the CLN3 gene. The function of the CLN3 protein is not clear, but an association with oxidative stress has been proposed. Oxidative stress and DNA damage play critical roles in the pathogenesis of neurodegenerative diseases. Antioxidants are of interest because of their therapeutic potential for treating neurodegenerative diseases. We tested whether N-acetylcysteine (NAC), a well-known antioxidant, improves the pathology of cells from patients with Batten disease. At first, the expression levels of urea cycle components and DNA repair enzymes were compared between Batten disease cells and normal cells. We used both mRNA expression levels and Western blot analysis. We found that carbamoyl phosphate synthetase 1, an enzyme involved in the urea cycle, 8-oxoguanine DNA glycosylase 1 and DNA polymerase beta, enzymes involved in DNA repair, were expressed at higher levels in Batten disease cells than in normal cells. The treatment of Batten disease cells with NAC for 48 h attenuated activities of the urea cycle and of DNA repair, as indicated by the substantially decreased expression levels of carbamoyl phosphate synthetase 1, 8-oxoguanine DNA glycosylase 1 and DNA polymerase beta proteins compared with untreated Batten cells. NAC may serve in alleviating the burden of urea cycle and DNA repair processes in Batten disease cells. We propose that NAC may have beneficial effects in patients with Batten disease. Copyright © 2012 John Wiley & Sons, Ltd.
The Impacts of Thawing and Rewetting Cycles on Greenhouse Gas Production in Wetland Soils
NASA Astrophysics Data System (ADS)
Eden, V.; Schade, J. D.
2016-12-01
Climate models predict longer periods of drought followed by intense precipitation, which will have an impact on the expansion and contraction of saturated soils and the extent of anoxic zones near wetlands. Climate models also predict reductions in snowpack which may increase soil freeze thaw cycles. These changes in soil conditions will impact microbial activities. To investigate these processes, we collected soils from saturated, seasonally saturated (SS), and dry areas of a wetland in central Minnesota. We simulated freeze/thaw cycles (FT), dry/rewet (DR), and combination of the two (FTDR) in anoxic incubations of soils from three different positions along a soil moisture gradient for 8-weeks. We also measured soil moisture and organic matter and extracellular enzyme activities of these soils to assess resource use by microbes. Results showed that N2O emissions were high in each area over the first week, suggesting that initially denitrifiers outcompeted methanogens for SOM. The SS soils produced especially high levels of N2O. N-acquiring enzymes involved in the breakdown of plant litter were found to be produced at a lower rate in all treatments of this zone when compared to the others, which indicates that those microbes were less nitrogen limited. CH4 emissions were low during the first two weeks in the control, DR, and FTDR treatments, but significantly higher in the FT treatment, suggesting that this cycle stimulates methanogenesis. This pattern continued in dry soils through the course of the incubation process, which could be the methanogens' reaction to a greater amount of saturation than normal. Enzyme analyses showed that enzymes involved in carbon acquisition were produced at the highest rate in FT treatment in dry soils, suggesting methanogens were carbon limited. Our results suggest that increasing the frequency of FT cycles could lead to higher methane production when wetland soils are saturated, which represents a potential positive feedback on