Viral affects on metabolism: changes in glucose and glutamine utilization during human cytomegalovirus infection

PubMed Central

Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.

2011-01-01

Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293

Asparagine plays a critical role in regulating cellular adaptation to glutamine depletion.

PubMed

Zhang, Ji; Fan, Jing; Venneti, Sriram; Cross, Justin R; Takagi, Toshimitsu; Bhinder, Bhavneet; Djaballah, Hakim; Kanai, Masayuki; Cheng, Emily H; Judkins, Alexander R; Pawel, Bruce; Baggs, Julie; Cherry, Sara; Rabinowitz, Joshua D; Thompson, Craig B

2014-10-23

Many cancer cells consume large quantities of glutamine to maintain TCA cycle anaplerosis and support cell survival. It was therefore surprising when RNAi screening revealed that suppression of citrate synthase (CS), the first TCA cycle enzyme, prevented glutamine-withdrawal-induced apoptosis. CS suppression reduced TCA cycle activity and diverted oxaloacetate, the substrate of CS, into production of the nonessential amino acids aspartate and asparagine. We found that asparagine was necessary and sufficient to suppress glutamine-withdrawal-induced apoptosis without restoring the levels of other nonessential amino acids or TCA cycle intermediates. In complete medium, tumor cells exhibiting high rates of glutamine consumption underwent rapid apoptosis when glutamine-dependent asparagine synthesis was suppressed, and expression of asparagine synthetase was statistically correlated with poor prognosis in human tumors. Coupled with the success of L-asparaginase as a therapy for childhood leukemia, the data suggest that intracellular asparagine is a critical suppressor of apoptosis in many human tumors.

Mitochondrial Respiration Can Support NO(3) and NO(2) Reduction during Photosynthesis : Interactions between Photosynthesis, Respiration, and N Assimilation in the N-Limited Green Alga Selenastrum minutum.

PubMed

Weger, H G; Turpin, D H

1989-02-01

Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH(4) (+), NO(2) (-), NO(3) (-)) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO(2) release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH(4) (+) assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O(2) consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO(3) (-) and NO(2) (-) assimilation resulted in a larger stimulation of TCA cycle CO(2) release than did NH(4) (+), but a much smaller stimulation of mitochondrial O(2) consumption. NH(4) (+) assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO(3) (-) and NO(2) (-) assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH(4) (+), NO(3) (-) and NO(2) (-) assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO(3) (-) and NO(2) (-) assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O(2) consumption during NO(3) (-) and NO(2) (-) assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO(3) (-) and NO(2) (-) reduction.

Mitochondrial Respiration Can Support NO3− and NO2− Reduction during Photosynthesis 1

PubMed Central

Weger, Harold G.; Turpin, David H.

1989-01-01

Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH4+, NO2−, NO3−) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO2 release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH4+ assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O2 consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO3− and NO2− assimilation resulted in a larger stimulation of TCA cycle CO2 release than did NH4+, but a much smaller stimulation of mitochondrial O2 consumption. NH4+ assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO3− and NO2− assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH4+, NO3− and NO2− assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO3− and NO2− assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O2 consumption during NO3− and NO2− assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO3− and NO2− reduction. PMID:16666557

The Variations of Glycolysis and TCA Cycle Intermediate Levels Grown in Iron and Copper Mediums of Trichoderma harzianum.

PubMed

Tavsan, Zehra; Ayar Kayali, Hulya

2015-05-01

The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.

Computational exploration of the chemical structure space of possible reverse tricarboxylic acid cycle constituents.

PubMed

Meringer, Markus; Cleaves, H James

2017-12-13

The reverse tricarboxylic acid (rTCA) cycle has been explored from various standpoints as an idealized primordial metabolic cycle. Its simplicity and apparent ubiquity in diverse organisms across the tree of life have been used to argue for its antiquity and its optimality. In 2000 it was proposed that chemoinformatics approaches support some of these views. Specifically, defined queries of the Beilstein database showed that the molecules of the rTCA are heavily represented in such compound databases. We explore here the chemical structure "space," e.g. the set of organic compounds which possesses some minimal set of defining characteristics, of the rTCA cycle's intermediates using an exhaustive structure generation method. The rTCA's chemical space as defined by the original criteria and explored by our method is some six to seven times larger than originally considered. Acknowledging that each assumption in what is a defining criterion making the rTCA cycle special limits possible generative outcomes, there are many unrealized compounds which fulfill these criteria. That these compounds are unrealized could be due to evolutionary frozen accidents or optimization, though this optimization may also be for systems-level reasons, e.g., the way the pathway and its elements interface with other aspects of metabolism.

Evaluation of extraction methods for the identification of proteins from date palm (Phoenix dactylifera L.) seed and flesh.

PubMed

Lee, Hooi Xian; Ahmad, Fisal; Saad, Bahruddin; Ismail, Mohd Nazri

2017-11-26

Date fruits are well known to be very nutritious. Nevertheless, the protein contents of the fruit, particularly the seed and flesh, are still understudied, largely due to their difficult physical characteristics. This study was conducted to compare three different protein extraction methods which were the trichloroacetic acid (TCA)-acetone (TCA-A), phenol (Phe), and TCA-acetone-phenol (TCA-A-Phe), and to perform proteomic analysis on date palm seed and flesh. Phe extraction method showed the highest protein yields for both seed (8.26 mg/g) and flesh (1.57 mg/g). Through sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Phe, and TCA-A-Phe extraction methods were shown to be efficient in removing interfering compounds and gave well-resolved bands over a wide range of molecular weights. Following liquid chromatography-tandem mass spectrometry analysis, about 50-64% of extracted proteins were identified with known functions including those involved in glycolysis, Krebs cycle, defense, and storage. Phe protein extraction method was proven to be the optimal method for date flesh and seed.

Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle

PubMed Central

Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro

2017-01-01

Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886

A Process-Based Model of TCA Cycle Functioning to Analyze Citrate Accumulation in Pre- and Post-Harvest Fruits.

PubMed

Etienne, Audrey; Génard, Michel; Bugaud, Christophe

2015-01-01

Citrate is one of the most important organic acids in many fruits and its concentration plays a critical role in organoleptic properties. The regulation of citrate accumulation throughout fruit development, and the origins of the phenotypic variability of the citrate concentration within fruit species remain to be clarified. In the present study, we developed a process-based model of citrate accumulation based on a simplified representation of the TCA cycle to predict citrate concentration in fruit pulp during the pre- and post-harvest stages. Banana fruit was taken as a reference because it has the particularity of having post-harvest ripening, during which citrate concentration undergoes substantial changes. The model was calibrated and validated on the two stages, using data sets from three contrasting cultivars in terms of citrate accumulation, and incorporated different fruit load, potassium supply, and harvest dates. The model predicted the pre and post-harvest dynamics of citrate concentration with fairly good accuracy for the three cultivars. The model suggested major differences in TCA cycle functioning among cultivars during post-harvest ripening of banana, and pointed to a potential role for NAD-malic enzyme and mitochondrial malate carriers in the genotypic variability of citrate concentration. The sensitivity of citrate accumulation to growth parameters and temperature differed among cultivars during post-harvest ripening. Finally, the model can be used as a conceptual basis to study citrate accumulation in fleshy fruits and may be a powerful tool to improve our understanding of fruit acidity.

13C-MFA delineates the photomixotrophic metabolism of Synechocystis sp. PCC 6803 under light- and carbon-sufficient conditions.

PubMed

You, Le; Berla, Bert; He, Lian; Pakrasi, Himadri B; Tang, Yinjie J

2014-05-01

The central carbon metabolism of cyanobacteria is under debate. For over 50 years, the lack of α-ketoglutarate dehydrogenase has led to the belief that cyanobacteria have an incomplete TCA cycle. Recent in vitro enzymatic experiments suggest that this cycle may in fact be closed. The current study employed (13) C isotopomers to delineate pathways in the cyanobacterium Synechocystis sp. PCC 6803. By tracing the incorporation of supplemented glutamate into the downstream metabolites in the TCA cycle, we observed a direct in vivo transformation of α-ketoglutarate to succinate. Additionally, isotopic tracing of glyoxylate did not show a functional glyoxylate shunt and glyoxylate was used for glycine synthesis. The photomixotrophic carbon metabolism was then profiled with (13) C-MFA under light and carbon-sufficient conditions. We observed that: (i) the in vivo flux through the TCA cycle reactions (α-ketoglutarate → succinate) was minimal (<2%); (ii) the flux ratio of CO2 fixation was six times higher than that of glucose utilization; (iii) the relative flux through the oxidative pentose phosphate pathway was low (<2%); (iv) high flux through malic enzyme served as a main route for pyruvate synthesis. Our results improve the understanding of the versatile metabolism in cyanobacteria and shed light on their application for photo-biorefineries. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Imaging Prostate Cancer (PCa) Phenotype and Evolution

DTIC Science & Technology

2015-10-01

has two isoforms: m-Acon (mitochondrial aconitase) and c-Acon ( cytoplasmic ; additionally functions as iron regulatory protein 1, when the iron levels...migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity, glycolysis and lactate, and increase

Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.

PubMed

Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal

2005-01-01

Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.

The Tricarboxylic Acid Cycle, an Ancient Metabolic Network with a Novel Twist

PubMed Central

Mailloux, Ryan J.; Bériault, Robin; Lemire, Joseph; Singh, Ranji; Chénier, Daniel R.; Hamel, Robert D.; Appanna, Vasu D.

2007-01-01

The tricarboxylic acid (TCA) cycle is an essential metabolic network in all oxidative organisms and provides precursors for anabolic processes and reducing factors (NADH and FADH2) that drive the generation of energy. Here, we show that this metabolic network is also an integral part of the oxidative defence machinery in living organisms and α-ketoglutarate (KG) is a key participant in the detoxification of reactive oxygen species (ROS). Its utilization as an anti-oxidant can effectively diminish ROS and curtail the formation of NADH, a situation that further impedes the release of ROS via oxidative phosphorylation. Thus, the increased production of KG mediated by NADP-dependent isocitrate dehydrogenase (NADP-ICDH) and its decreased utilization via the TCA cycle confer a unique strategy to modulate the cellular redox environment. Activities of α-ketoglutarate dehydrogenase (KGDH), NAD-dependent isocitrate dehydrogenase (NAD-ICDH), and succinate dehydrogenase (SDH) were sharply diminished in the cellular systems exposed to conditions conducive to oxidative stress. These findings uncover an intricate link between TCA cycle and ROS homeostasis and may help explain the ineffective TCA cycle that characterizes various pathological conditions and ageing. PMID:17668068

Effects of pentylenetetrazole and glutamate on metabolism of [U-(13)C]glucose in cultured cerebellar granule neurons.

PubMed

Eloqayli, Haytham; Qu, Hong; Unsgård, Geirmund; Sletvold, Olav; Hadidi, Hakam; Sonnewald, Ursula

2002-02-01

This study was performed to analyze the effects of glutamate and the epileptogenic agent pentylenetetrazole (PTZ) on neuronal glucose metabolism. Cerebellar granule neurons were incubated for 2 h in medium containing 3 mM [U-(13)C]glucose, with and without 0.25 mM glutamate and/or 10 mM PTZ. In the presence of PTZ, decreased glucose consumption with unchanged lactate release was observed, indicating decreased glucose oxidation. PTZ also slowed down tricarboxylic acid (TCA) cycle activity as evidenced by the decreased amounts of labeled aspartate and [1,2-(13)C]glutamate. When glutamate was present, glucose consumption was also decreased. However, the amount of glutamate, derived from [U-(13)C]glucose via the first turn of the TCA cycle, was increased. The decreased amount of [1,2-(13)C]glutamate, derived from the second turn in the TCA cycle, and increased amount of aspartate indicated the dilution of label due to the entrance of unlabeled glutamate into TCA cycle. In the presence of glutamate plus PTZ, the effect of PTZ was enhanced by glutamate. Labeled alanine was detected only in the presence of glutamate plus PTZ, which indicated that oxaloacetate was a better amino acid acceptor than pyruvate. Furthermore, there was also evidence for intracellular compartmentation of oxaloacetate metabolism. Glutamate and PTZ caused similar metabolic changes, however, via different mechanisms. Glutamate substituted for glucose as energy substrate in the TCA cycle, whereas, PTZ appeared to decrease mitochondrial activity.

Mechanisms of Mitochondrial Defects in Gulf War Syndrome

DTIC Science & Technology

2012-08-01

oxidized; POR: porin; TCA: Tricarboxylic acid cycle ( Kreb cycle ). Page 2 Body: YEAR 1 of research (10/13/2009-7/14/2010) (9 months): Human... mitochondria , fatigue, myalgias 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON...abnormalities in genes that are related to mitochondrial function. Hence, investigation of mitochondrial dysfunction in GWS is a priority. Mitochondria

Biochemical consequences of alginate encapsulation: a NMR study of insulin-secreting cells.

PubMed

Simpson, Nicholas E; Grant, Samuel C; Gustavsson, Lenita; Peltonen, Vilje-Mia; Blackband, Stephen J; Constantinidis, Ioannis

2006-04-01

In this study we explore the biochemical consequences of alginate encapsulation on betaTC3 cells. (13)C NMR spectroscopy and isotopomer analysis were used to investigate the effects of encapsulation on several enzymatic processes associated with the TCA cycle. Our data show statistically significant differences in various enzymatic fluxes related to the TCA cycle and insulin secretion between monolayer and alginate-encapsulated cultures. The principal cause for these effects was the process of trypsinization. Embedding the trypsinized cells in alginate beads did not have a compounded effect on the enzymatic fluxes of entrapped cells. However, an additional small but statistically significant decrease in insulin secretion was measured in encapsulated cells. Finally, differences in either enzymatic fluxes or glucose consumption as a function of bead diameter were not observed. However, differences in T(2), assessed by (1)H NMR microimaging, were observed as a function of bead diameter, suggesting that smaller beads became more organized with time in culture, while larger beads displayed a looser organization.

Genetic investigation of tricarboxylic acid metabolism during the Plasmodium falciparum life cycle.

PubMed

Ke, Hangjun; Lewis, Ian A; Morrisey, Joanne M; McLean, Kyle J; Ganesan, Suresh M; Painter, Heather J; Mather, Michael W; Jacobs-Lorena, Marcelo; Llinás, Manuel; Vaidya, Akhil B

2015-04-07

New antimalarial drugs are urgently needed to control drug-resistant forms of the malaria parasite Plasmodium falciparum. Mitochondrial electron transport is the target of both existing and new antimalarials. Herein, we describe 11 genetic knockout (KO) lines that delete six of the eight mitochondrial tricarboxylic acid (TCA) cycle enzymes. Although all TCA KOs grew normally in asexual blood stages, these metabolic deficiencies halted life-cycle progression in later stages. Specifically, aconitase KO parasites arrested as late gametocytes, whereas α-ketoglutarate-dehydrogenase-deficient parasites failed to develop oocysts in the mosquitoes. Mass spectrometry analysis of (13)C-isotope-labeled TCA mutant parasites showed that P. falciparum has significant flexibility in TCA metabolism. This flexibility manifested itself through changes in pathway fluxes and through altered exchange of substrates between cytosolic and mitochondrial pools. Our findings suggest that mitochondrial metabolic plasticity is essential for parasite development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Imaging Prostate Cancer (PCa) Phenotype and Evolution

DTIC Science & Technology

2016-10-01

inhibit growth of some but not all cell lines. 2. Keywords: Deferiprone, aconitase, metabolism, tricarboxylic acid cycle , magnetic resonance 3...TRAMP C2 and MycCaP cell proliferation, migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity...migration and inhibits TCA cycle (metabolism). Similarly in vivo (Aim 2), we 6 Fig. 2: Effect of DFP on in vivo growth of MycCaP (left) and TRAMP C2

Pyruvate cycle increases aminoglycoside efficacy and provides respiratory energy in bacteria.

PubMed

Su, Yu-Bin; Peng, Bo; Li, Hui; Cheng, Zhi-Xue; Zhang, Tian-Tuo; Zhu, Jia-Xin; Li, Dan; Li, Min-Yi; Ye, Jin-Zhou; Du, Chao-Chao; Zhang, Song; Zhao, Xian-Liang; Yang, Man-Jun; Peng, Xuan-Xian

2018-02-13

The emergence and ongoing spread of multidrug-resistant bacteria puts humans and other species at risk for potentially lethal infections. Thus, novel antibiotics or alternative approaches are needed to target drug-resistant bacteria, and metabolic modulation has been documented to improve antibiotic efficacy, but the relevant metabolic mechanisms require more studies. Here, we show that glutamate potentiates aminoglycoside antibiotics, resulting in improved elimination of antibiotic-resistant pathogens. When exploring the metabolic flux of glutamate, it was found that the enzymes that link the phosphoenolpyruvate (PEP)-pyruvate-AcCoA pathway to the TCA cycle were key players in this increased efficacy. Together, the PEP-pyruvate-AcCoA pathway and TCA cycle can be considered the pyruvate cycle (P cycle). Our results show that inhibition or gene depletion of the enzymes in the P cycle shut down the TCA cycle even in the presence of excess carbon sources, and that the P cycle operates routinely as a general mechanism for energy production and regulation in Escherichia coli and Edwardsiella tarda These findings address metabolic mechanisms of metabolite-induced potentiation and fundamental questions about bacterial biochemistry and energy metabolism.

Use of response surface methodology in a fed-batch process for optimization of tricarboxylic acid cycle intermediates to achieve high levels of canthaxanthin from Dietzia natronolimnaea HS-1.

PubMed

Nasri Nasrabadi, Mohammad Reza; Razavi, Seyed Hadi

2010-04-01

In this work, we applied statistical experimental design to a fed-batch process for optimization of tricarboxylic acid cycle (TCA) intermediates in order to achieve high-level production of canthaxanthin from Dietzia natronolimnaea HS-1 cultured in beet molasses. A fractional factorial design (screening test) was first conducted on five TCA cycle intermediates. Out of the five TCA cycle intermediates investigated via screening tests, alfaketoglutarate, oxaloacetate and succinate were selected based on their statistically significant (P<0.05) and positive effects on canthaxanthin production. These significant factors were optimized by means of response surface methodology (RSM) in order to achieve high-level production of canthaxanthin. The experimental results of the RSM were fitted with a second-order polynomial equation by means of a multiple regression technique to identify the relationship between canthaxanthin production and the three TCA cycle intermediates. By means of this statistical design under a fed-batch process, the optimum conditions required to achieve the highest level of canthaxanthin (13172 + or - 25 microg l(-1)) were determined as follows: alfaketoglutarate, 9.69 mM; oxaloacetate, 8.68 mM; succinate, 8.51 mM. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Cross-talk between branched-chain amino acids and hepatic mitochondria is compromised in nonalcoholic fatty liver disease.

PubMed

Sunny, Nishanth E; Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J; Nautiyal, Manisha; Mathew, Justin T; Williams, Caroline M; Cusi, Kenneth

2015-08-15

Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD.

Cross-talk between branched-chain amino acids and hepatic mitochondria is compromised in nonalcoholic fatty liver disease

PubMed Central

Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J.; Nautiyal, Manisha; Mathew, Justin T.; Williams, Caroline M.; Cusi, Kenneth

2015-01-01

Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD. PMID:26058864

Alterations in Hepatic Glucose and Energy Metabolism as a Result of Calorie and Carbohydrate Restriction

PubMed Central

Browning, Jeffrey D.; Weis, Brian; Davis, Jeannie; Satapati, Santhosh; Merritt, Matthew; Malloy, Craig R.; Burgess, Shawn C.

2009-01-01

Carbohydrate-restriction is a common weight-loss approach that modifies hepatic metabolism by increasing gluconeogenesis and ketosis. Because little is known regarding the effect of carbohydrate-restriction on the origin of gluconeogenic precursors (gluconeogenesis from glycerol (GNGglycerol) and lactate/amino acids (GNGPEP)) or its consequence to hepatic energy homeostasis, we studied these parameters in a group of overweight/obese subjects undergoing weight-loss via dietary restriction. We used 2H and 13C tracers and nuclear magnetic resonance spectroscopy to measure the sources of hepatic glucose and TCA cycle flux in weight-stable subjects(n=7) and subjects following carbohydrate-(n=7) or calorie-restriction(n=7). The majority of hepatic glucose production in carbohydrate-restricted subjects came from GNGPEP. The contribution of glycerol to gluconeogenesis was similar in all groups despite evidence of increased fat oxidation in carbohydrate-restricted subjects. A strong correlation between TCA cycle flux and GNGPEP was found, though the reliance on TCA cycle energy production for gluconeogenesis was attenuated in subjects undergoing carbohydrate restriction. Together, these data imply that the TCA cycle is the energetic patron of gluconeogenesis. However, the relationship between these two pathways is modified by carbohydrate restriction, suggesting an increased reliance of the hepatocyte on energy generated outside of the TCA cycle when GNGPEP is maximal. In conclusion, carbohydrate-restriction modifies hepatic gluconeogenesis by increasing reliance on substrates like lactate or amino acids but not glycerol. This modification is associated with a reorganization of hepatic energy metabolism suggestive of enhanced hepatic β-oxidation. PMID:18925642

Embryonic Lethality of Mitochondrial Pyruvate Carrier 1 Deficient Mouse Can Be Rescued by a Ketogenic Diet

PubMed Central

Krznar, Petra; Hörl, Manuel; Ammar, Zeinab; Montessuit, Sylvie; Pierredon, Sandra; Zamboni, Nicola; Martinou, Jean-Claude

2016-01-01

Mitochondrial import of pyruvate by the mitochondrial pyruvate carrier (MPC) is a central step which links cytosolic and mitochondrial intermediary metabolism. To investigate the role of the MPC in mammalian physiology and development, we generated a mouse strain with complete loss of MPC1 expression. This resulted in embryonic lethality at around E13.5. Mouse embryonic fibroblasts (MEFs) derived from mutant mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, and both defects could be restored by reexpression of MPC1. Labeling experiments using 13C-labeled glucose and glutamine demonstrated that MPC deficiency causes increased glutaminolysis and reduced contribution of glucose-derived pyruvate to the TCA cycle. Morphological defects were observed in mutant embryonic brains, together with major alterations of their metabolome including lactic acidosis, diminished TCA cycle intermediates, energy deficit and a perturbed balance of neurotransmitters. Strikingly, these changes were reversed when the pregnant dams were fed a ketogenic diet, which provides acetyl-CoA directly to the TCA cycle and bypasses the need for a functional MPC. This allowed the normal gestation and development of MPC deficient pups, even though they all died within a few minutes post-delivery. This study establishes the MPC as a key player in regulating the metabolic state necessary for embryonic development, neurotransmitter balance and post-natal survival. PMID:27176894

Quantitative importance of the pentose phosphate pathway determined by incorporation of 13C from [2-13C]- and [3-13C]glucose into TCA cycle intermediates and neurotransmitter amino acids in functionally intact neurons.

PubMed

Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

2012-09-01

The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of (13)C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ~6% of glucose metabolism in cortical neurons and ~4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that (13)C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons.

Application of dynamic metabolomics to examine in vivo skeletal muscle glucose metabolism in the chronically high-fat fed mouse

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Burch, Micah L.

Rationale: Defects in muscle glucose metabolism are linked to type 2 diabetes. Mechanistic studies examining these defects rely on the use of high fat-fed rodent models and typically involve the determination of muscle glucose uptake under insulin-stimulated conditions. While insightful, they do not necessarily reflect the physiology of the postprandial state. In addition, most studies do not examine aspects of glucose metabolism beyond the uptake process. Here we present an approach to study rodent muscle glucose and intermediary metabolism under the dynamic and physiologically relevant setting of the oral glucose tolerance test (OGTT). Methods and results: In vivo muscle glucose andmore » intermediary metabolism was investigated following oral administration of [U-{sup 13}C] glucose. Quadriceps muscles were collected 15 and 60 min after glucose administration and metabolite flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates via gas chromatography–mass spectrometry. While no dietary effects were noted in the glycolytic pathway, muscle from mice fed a high fat diet (HFD) exhibited a reduction in labelling in TCA intermediates. Interestingly, this appeared to be independent of alterations in flux through pyruvate dehydrogenase. In addition, our findings suggest that TCA cycle anaplerosis is negligible in muscle during an OGTT. Conclusions: Under the dynamic physiologically relevant conditions of the OGTT, skeletal muscle from HFD fed mice exhibits alterations in glucose metabolism at the level of the TCA cycle. - Highlights: • Dynamic metabolomics was used to investigate muscle glucose metabolism in vivo. • Mitochondrial TCA cycle metabolism is altered in muscle of HFD mice. • This defect was not pyruvate dehydrogenase mediated, as has been previously thought. • Mitochondrial TCA cycle anaplerosis in muscle is virtually absent during the OGTT.« less

Systematic engineering of TCA cycle for optimal production of a four-carbon platform chemical 4-hydroxybutyric acid in Escherichia coli.

PubMed

Choi, Sol; Kim, Hyun Uk; Kim, Tae Yong; Lee, Sang Yup

2016-11-01

To address climate change and environmental problems, it is becoming increasingly important to establish biorefineries for the production of chemicals from renewable non-food biomass. Here we report the development of Escherichia coli strains capable of overproducing a four-carbon platform chemical 4-hybroxybutyric acid (4-HB). Because 4-HB production is significantly affected by aeration level, genome-scale metabolic model-based engineering strategies were designed under aerobic and microaerobic conditions with emphasis on oxidative/reductive TCA branches and glyoxylate shunt. Several different metabolic engineering strategies were employed to develop strains suitable for fermentation both under aerobic and microaerobic conditions. It was found that microaerobic condition was more efficient than aerobic condition in achieving higher titer and productivity of 4-HB. The final engineered strain produced 103.4g/L of 4-HB by microaerobic fed-batch fermentation using glycerol. The aeration-dependent optimization strategy of TCA cycle will be useful for developing microbial strains producing other reduced derivative chemicals of TCA cycle intermediates. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Sulfate radicals enable a non-enzymatic Krebs cycle precursor

PubMed Central

Keller, Markus A.; Kampjut, Domen; Harrison, Stuart A.; Ralser, Markus

2017-01-01

The evolutionary origins of the tricarboxylic acid cycle (TCA), or Krebs cycle, are so far unclear. Despite a few years ago, the existence of a simple non-enzymatic Krebs-cycle catalyst has been dismissed ‘as an appeal to magic’, citrate and other intermediates have meanwhile been discovered on a carbonaceous meteorite and do interconvert non-enzymatically. To identify the non-enzymatic Krebs cycle catalyst, we used combinatorial, quantitative high-throughput metabolomics to systematically screen iron and sulfate reaction milieus that orient on Archean sediment constituents. TCA cycle intermediates are found stable in water and in the presence of most iron and sulfate species, including simple iron-sulfate minerals. However, we report that TCA intermediates undergo 24 interconversion reactions in the presence of sulfate radicals that form from peroxydisulfate. The non-enzymatic reactions critically cover a topology as present in the Krebs cycle, the glyoxylate shunt and the succinic semialdehyde pathways. Assembled in a chemical network, the reactions achieve more than ninety percent carbon recovery. Our results show that a non-enzymatic precursor for the Krebs cycle is biologically sensible, efficient, and forms spontaneously in the presence of sulfate radicals. PMID:28584880

Adaptation of oxidative phosphorylation to photoperiod-induced seasonal metabolic states in migratory songbirds.

PubMed

Trivedi, Amit Kumar; Malik, Shalie; Rani, Sangeeta; Kumar, Vinod

2015-06-01

Eukaryotic cells produce chemical energy in the form of ATP by oxidative phosphorylation of metabolic fuels via a series of enzyme mediated biochemical reactions. We propose that the rates of these reactions are altered, as per energy needs of the seasonal metabolic states in avian migrants. To investigate this, blackheaded buntings were photoperiodically induced with non-migratory, premigratory, migratory and post-migratory phenotypes. High plasma levels of free fatty acids, citrate (an intermediate that begins the TCA cycle) and malate dehydrogenase (mdh, an enzyme involved at the end of the TCA cycle) confirmed increased availability of metabolic reserves and substrates to the TCA cycle during the premigratory and migratory states, respectively. Further, daily expression pattern of genes coding for enzymes involved in the oxidative decarboxylation of pyruvate to acetyl-CoA (pdc and pdk) and oxidative phosphorylation in the TCA cycle (cs, odgh, sdhd and mdh) was monitored in the hypothalamus and liver. Reciprocal relationship between pdc and pdk expressions conformed with the altered requirements of acetyl-CoA for the TCA cycle in different metabolic states. Except for pdk, all genes had a daily expression pattern, with high mRNA expression during the day in the premigratory/migratory phenotypes, and at night (cs, odhg, sdhd and mdh) in the nonmigratory phenotype. Differences in mRNA expression patterns of pdc, sdhd and mdh, but not of pdk, cs and odgh, between the hypothalamus and liver indicated a tissue dependent metabolism in buntings. These results suggest the adaptation of oxidative phosphorylation pathway(s) at gene levels to the seasonal alternations in metabolism in migratory songbirds. Copyright © 2015 Elsevier Inc. All rights reserved.

Anaplerotic Triheptanoin Diet Enhances Mitochondrial Substrate Use to Remodel the Metabolome and Improve Lifespan, Motor Function, and Sociability in MeCP2-Null Mice

PubMed Central

Li, Qun; Degano, Alicia L.; Penati, Judith; Zhuo, Justin; Roe, Charles R.; Ronnett, Gabriele V.

2014-01-01

Rett syndrome (RTT) is an autism spectrum disorder (ASD) caused by mutations in the X-linked MECP2 gene that encodes methyl-CpG binding protein 2 (MeCP2). Symptoms range in severity and include psychomotor disabilities, seizures, ataxia, and intellectual disability. Symptom onset is between 6-18 months of age, a critical period of brain development that is highly energy-dependent. Notably, patients with RTT have evidence of mitochondrial dysfunction, as well as abnormal levels of the adipokines leptin and adiponectin, suggesting overall metabolic imbalance. We hypothesized that one contributor to RTT symptoms is energy deficiency due to defective nutrient substrate utilization by the TCA cycle. This energy deficit would lead to a metabolic imbalance, but would be treatable by providing anaplerotic substrates to the TCA cycle to enhance energy production. We show that dietary therapy with triheptanoin significantly increased longevity and improved motor function and social interaction in male mice hemizygous for Mecp2 knockout. Anaplerotic therapy in Mecp2 knockout mice also improved indicators of impaired substrate utilization, decreased adiposity, increased glucose tolerance and insulin sensitivity, decreased serum leptin and insulin, and improved mitochondrial morphology in skeletal muscle. Untargeted metabolomics of liver and skeletal muscle revealed increases in levels of TCA cycle intermediates with triheptanoin diet, as well as normalizations of glucose and fatty acid biochemical pathways consistent with the improved metabolic phenotype in Mecp2 knockout mice on triheptanoin. These results suggest that an approach using dietary supplementation with anaplerotic substrate is effective in improving symptoms and metabolic health in RTT. PMID:25299635

Genetic variations in IDH gene as prognosis predictors in TACE-treated hepatocellular carcinoma patients.

PubMed

Zhang, Huiqing; Guo, Xu; Dai, Jingyao; Wu, Yousheng; Ge, Naijian; Yang, Yefa; Ji, Jiansong; Zhang, Hongxin

2014-11-01

Metabolic reprogramming is an important hallmark of cancer cells, including the alterations of activity and expression in tricarboxylic acid (TCA) cycle key enzymes. Previous studies have reported the associations between tumor formation and three core enzymes involved in the TCA cycle. However, the association between functional single nucleotide polymorphisms (SNPs) in one of TCA cycle key gene isocitrate dehydrogenase (IDH) and the overall survival of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) has never been investigated. Five functional SNPs in IDH1 and IDH2 genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 419 unresectable Chinese HCC patients treated with TACE. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. We found that SNPs rs12478635 in IDH1 and rs11632348 in IDH2 gene exhibited significant associations with death risk in HCC patients in the dominant model (HR 1.33; 95 % CI 1.02-1.73; P = 0.037) and in recessive model (HR 1.87; 95 % CI 1.27-2.75; P = 0.001), respectively. Moreover, we observed a cumulative effect of these two SNPs on HCC overall survival, indicating a significant trend of death risk increase with increasing number of unfavorable genotypes (P for trend = 0.001). Additionally, our data suggest that unfavorable genotypes of two SNPs may be used as an independent prognostic marker in those with advanced stage and patients with serum AFP <200 μg/L. Our results for the first time suggest that IDH gene polymorphisms may serve as an independent prognostic marker for HCC patients treated with TACE.

Spatial Distribution of Cellular Function: The Partitioning of Proteins between Mitochondria and the Nucleus in MCF7 Breast Cancer Cells

PubMed Central

Qattan, Amal T.; Radulovic, Marko; Crawford, Mark; Godovac-Zimmermann, Jasminka

2014-01-01

Concurrent proteomics analysis of the nuclei and mitochondria of MCF7 breast cancer cells identified 985 proteins (40% of all detected proteins) present in both organelles. Numerous proteins from all five complexes involved in oxidative phosphorylation (e.g., NDUFA5, NDUFB10, NDUFS1, NDUF2, SDHA, UQRB, UQRC2, UQCRH, COX5A, COX5B, MT-CO2, ATP5A1, ATP5B, ATP5H, etc.), from the TCA-cycle (DLST, IDH2, IDH3A, OGDH, SUCLAG2, etc.), and from glycolysis (ALDOA, ENO1, FBP1, GPI, PGK1, TALDO1, etc.) were distributed to both the nucleus and mitochondria. In contrast, proteins involved in nuclear/mitochondrial RNA processing/translation and Ras/Rab signaling showed different partitioning patterns. The identity of the OxPhos, TCA-cycle, and glycolysis proteins distributed to both the nucleus and mitochondria provides evidence for spatio-functional integration of these processes over the two different subcellular organelles. We suggest that there are unrecognized aspects of functional coordination between the nucleus and mitochondria, that integration of core functional processes via wide subcellular distribution of constituent proteins is a common characteristic of cells, and that subcellular spatial integration of function may be a vital aspect of cancer. PMID:23051583

Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.

PubMed

Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R

2017-03-06

Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.

Quantitative importance of the pentose phosphate pathway determined by incorporation of 13C from [2-13C]- and [3-13C]glucose into TCA cycle intermediates and neurotransmitter amino acids in functionally intact neurons

PubMed Central

Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

2012-01-01

The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-13C]glucose or [3-13C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of 13C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ∼6% of glucose metabolism in cortical neurons and ∼4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that 13C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons. PMID:22714050

Environment impacts the metabolic dependencies of Ras-driven non-small cell lung cancer

PubMed Central

Davidson, Shawn M.; Papagiannakopoulos, Thales; Olenchock, Benjamin A.; Heyman, Julia E.; Keibler, Mark A.; Luengo, Alba; Bauer, Matthew R.; Jha, Abhishek K.; O’Brien, James P.; Pierce, Kerry A.; Gui, Dan Y.; Sullivan, Lucas B.; Wasylenko, Thomas M.; Subbaraj, Lakshmipriya; Chin, Christopher R.; Stephanopolous, Gregory; Mott, Bryan T.; Jacks, Tyler; Clish, Clary B.; Vander Heiden, Matthew G.

2016-01-01

SUMMARY Cultured cells convert glucose to lactate and glutamine is the major source of tricarboxylic acid (TCA) cycle carbon, but whether the same metabolic phenotype is found in tumors is less studied. We infused mice with lung cancers with isotope-labeled glucose or glutamine and compared the fate of these nutrients in tumor and normal tissue. As expected, lung tumors exhibit increased lactate production from glucose. However, glutamine utilization by both lung tumors and normal lung was minimal, with lung tumors showing increased glucose contribution to the TCA cycle relative to normal lung tissue. Deletion of enzymes involved in glucose oxidation demonstrates that glucose carbon contribution to the TCA cycle is required for tumor formation. These data suggest that understanding nutrient utilization by tumors can predict metabolic dependencies of cancers in vivo. Furthermore, these data argue that the in vivo environment is an important determinant of the metabolic phenotype of cancer cells. PMID:26853747

Origin of the Reductive Tricarboxylic Acid (rTCA) Cycle-Type CO2 Fixation: A Perspective

PubMed Central

Fujishima, Kosuke

2017-01-01

The reductive tricarboxylic acid (rTCA) cycle is among the most plausible candidates for the first autotrophic metabolism in the earliest life. Extant enzymes fixing CO2 in this cycle contain cofactors at the catalytic centers, but it is unlikely that the protein/cofactor system emerged at once in a prebiotic process. Here, we discuss the feasibility of non-enzymatic cofactor-assisted drive of the rTCA reactions in the primitive Earth environments, particularly focusing on the acetyl-CoA conversion to pyruvate. Based on the energetic and mechanistic aspects of this reaction, we propose that the deep-sea hydrothermal vent environments with active electricity generation in the presence of various sulfide catalysts are a promising setting for it to progress. Our view supports the theory of an autotrophic origin of life from primordial carbon assimilation within a sulfide-rich hydrothermal vent.

Activity-Based Protein Profiling Reveals Mitochondrial Oxidative Enzyme Impairment and Restoration in Diet-Induced Obese Mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sadler, Natalie C.; Angel, Thomas E.; Lewis, Michael P.

High-fat diet (HFD) induced obesity and concomitant development of insulin resistance (IR) and type 2 diabetes mellitus have been linked to mitochondrial dysfunction. However, it is not clear whether mitochondrial dysfunction is a direct effect of a HFD or if the mitochondrial function is reduced with increased HFD duration. We hypothesized that the function of mitochondrial oxidative and lipid metabolism functions in skeletal muscle mitochondria for HFD mice are similar or elevated relative to standard diet (SD) mice, thereby IR is neither cause nor consequence of mitochondrial dysfunction. We applied a chemical probe approach to identify functionally reactive ATPases andmore » nucleotide-binding proteins in mitochondria isolated from skeletal muscle of C57Bl/6J mice fed HFD or SD chow for 2-, 8-, or 16-weeks; feeding time points known to induce IR. A total of 293 probe-labeled proteins were identified by mass spectrometry-based proteomics, of which 54 differed in abundance between HFD and SD mice. We found proteins associated with the TCA cycle, oxidative phosphorylation (OXPHOS), and lipid metabolism were altered in function when comparing SD to HFD fed mice at 2-weeks, however by 16-weeks HFD mice had TCA cycle, β-oxidation, and respiratory chain function at levels similar to or higher than SD mice.« less

Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids.

PubMed

Terpolilli, Jason J; Masakapalli, Shyam K; Karunakaran, Ramakrishnan; Webb, Isabel U C; Green, Rob; Watmough, Nicholas J; Kruger, Nicholas J; Ratcliffe, R George; Poole, Philip S

2016-10-15

Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2 Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [(13)C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2 However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance oxidation of plant-derived dicarboxylates in the TCA cycle with lipid synthesis. Pea bacteroids channel acetyl-CoA into both lipid and the lipid-like polymer poly-β-hydroxybutyrate, the latter via a type II PHB synthase. Lipogenesis is likely to be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids

PubMed Central

Terpolilli, Jason J.; Masakapalli, Shyam K.; Karunakaran, Ramakrishnan; Webb, Isabel U. C.; Green, Rob; Watmough, Nicholas J.; Kruger, Nicholas J.; Ratcliffe, R. George

2016-01-01

ABSTRACT Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2. Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [13C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. IMPORTANCE Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2. However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance oxidation of plant-derived dicarboxylates in the TCA cycle with lipid synthesis. Pea bacteroids channel acetyl-CoA into both lipid and the lipid-like polymer poly-β-hydroxybutyrate, the latter via a type II PHB synthase. Lipogenesis is likely to be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. PMID:27501983

Gluconeogenesis from labeled carbon: estimating isotope dilution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kelleher, J.K.

1986-03-01

To estimate the rate of gluconeogenesis from steady-state incorporation of labeled 3-carbon precursors into glucose, isotope dilution must be considered so that the rate of labeling of glucose can be quantitatively converted to the rate of gluconeogenesis. An expression for the value of this isotope dilution can be derived using mathematical techniques and a model of the tricarboxylic acid (TCA) cycle. The present investigation employs a more complex model than that used in previous studies. This model includes the following pathways that may affect the correction for isotope dilution: 1) flux of 3-carbon precursor to the oxaloacetate pool via acetyl-CoAmore » and the TCA cycle; 2) flux of 4- or 5-carbon compounds into the TCA cycle; 3) reversible flux between oxaloacetate (OAA) and pyruvate and between OAA and fumarate; 4) incomplete equilibrium between OAA pools; and 5) isotope dilution of 3-carbon tracers between the experimentally measured pool and the precursor for the TCA-cycle OAA pool. Experimental tests are outlined which investigators can use to determine whether these pathways are significant in a specific steady-state system. The study indicated that flux through these five pathways can significantly affect the correction for isotope dilution. To correct for the effects of these pathways an alternative method for calculating isotope dilution is proposed using citrate to relate the specific activities of acetyl-CoA and OAA.« less

Glutamine oxidation maintains the TCA cycle and cell survival during impaired mitochondrial pyruvate transport.

PubMed

Yang, Chendong; Ko, Bookyung; Hensley, Christopher T; Jiang, Lei; Wasti, Ajla T; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E; DeBerardinis, Ralph J

2014-11-06

Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and reroutes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. Copyright © 2014 Elsevier Inc. All rights reserved.

Glutamine oxidation maintains the TCA cycle and cell survival during impaired mitochondrial pyruvate transport

PubMed Central

Yang, Chendong; Ko, Bookyung; Hensley, Christopher T.; Jiang, Lei; Wasti, Ajla T.; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E.; DeBerardinis, Ralph J.

2014-01-01

Summary Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and re-routes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. PMID:25458842

Integrated Analysis of the Transcriptome and Metabolome of Corynebacterium glutamicum during Penicillin-Induced Glutamic Acid Production.

PubMed

Hirasawa, Takashi; Saito, Masaki; Yoshikawa, Katsunori; Furusawa, Chikara; Shmizu, Hiroshi

2018-05-01

Corynebacterium glutamicum is known for its ability to produce glutamic acid and has been utilized for the fermentative production of various amino acids. Glutamic acid production in C. glutamicum is induced by penicillin. In this study, the transcriptome and metabolome of C. glutamicum is analyzed to understand the mechanism of penicillin-induced glutamic acid production. Transcriptomic analysis with DNA microarray revealed that expression of some glycolysis- and TCA cycle-related genes, which include those encoding the enzymes involved in conversion of glucose to 2-oxoglutaric acid, is upregulated after penicillin addition. Meanwhile, expression of some TCA cycle-related genes, encoding the enzymes for conversion of 2-oxoglutaric acid to oxaloacetic acid, and the anaplerotic reactions decreased. In addition, expression of NCgl1221 and odhI, encoding proteins involved in glutamic acid excretion and inhibition of the 2-oxoglutarate dehydrogenase, respectively, is upregulated. Functional category enrichment analysis of genes upregulated and downregulated after penicillin addition revealed that genes for signal transduction systems are enriched among upregulated genes, whereas those for energy production and carbohydrate and amino acid metabolisms are enriched among the downregulated genes. As for the metabolomic analysis using capillary electrophoresis time-of-flight mass spectrometry, the intracellular content of most metabolites of the glycolysis and the TCA cycle decreased dramatically after penicillin addition. Overall, these results indicate that the cellular metabolism and glutamic acid excretion are mainly optimized at the transcription level during penicillin-induced glutamic acid production by C. glutamicum. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

PEPCK Coordinates the Regulation of Central Carbon Metabolism to Promote Cancer Cell Growth.

PubMed

Montal, Emily D; Dewi, Ruby; Bhalla, Kavita; Ou, Lihui; Hwang, Bor Jang; Ropell, Ashley E; Gordon, Chris; Liu, Wan-Ju; DeBerardinis, Ralph J; Sudderth, Jessica; Twaddel, William; Boros, Laszlo G; Shroyer, Kenneth R; Duraisamy, Sekhar; Drapkin, Ronny; Powers, R Scott; Rohde, Jason M; Boxer, Matthew B; Wong, Kwok-Kin; Girnun, Geoffrey D

2015-11-19

Phosphoenolpyruvate carboxykinase (PEPCK) is well known for its role in gluconeogenesis. However, PEPCK is also a key regulator of TCA cycle flux. The TCA cycle integrates glucose, amino acid, and lipid metabolism depending on cellular needs. In addition, biosynthetic pathways crucial to tumor growth require the TCA cycle for the processing of glucose and glutamine derived carbons. We show here an unexpected role for PEPCK in promoting cancer cell proliferation in vitro and in vivo by increasing glucose and glutamine utilization toward anabolic metabolism. Unexpectedly, PEPCK also increased the synthesis of ribose from non-carbohydrate sources, such as glutamine, a phenomenon not previously described. Finally, we show that the effects of PEPCK on glucose metabolism and cell proliferation are in part mediated via activation of mTORC1. Taken together, these data demonstrate a role for PEPCK that links metabolic flux and anabolic pathways to cancer cell proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

Glutamate and asparagine cataplerosis underlie glutamine addiction in melanoma

PubMed Central

Ratnikov, Boris; Aza-Blanc, Pedro; Ronai, Ze'ev A.; Smith, Jeffrey W.; Osterman, Andrei L.; Scott, David A.

2015-01-01

Glutamine dependence is a prominent feature of cancer metabolism, and here we show that melanoma cells, irrespective of their oncogenic background, depend on glutamine for growth. A quantitative audit of how carbon from glutamine is used showed that TCA-cycle-derived glutamate is, in most melanoma cells, the major glutamine-derived cataplerotic output and product of glutaminolysis. In the absence of glutamine, TCA cycle metabolites were liable to depletion through aminotransferase-mediated α-ketoglutarate-to-glutamate conversion and glutamate secretion. Aspartate was an essential cataplerotic output, as melanoma cells demonstrated a limited capacity to salvage external aspartate. Also, the absence of asparagine increased the glutamine requirement, pointing to vulnerability in the aspartate-asparagine biosynthetic pathway within melanoma metabolism. In contrast to melanoma cells, melanocytes could grow in the absence of glutamine. Melanocytes use more glutamine for protein synthesis rather than secreting it as glutamate and are less prone to loss of glutamate and TCA cycle metabolites when starved of glutamine. PMID:25749035

Glucose-independent glutamine metabolism via TCA cycling for proliferation and survival in B-cells

PubMed Central

Le, Anne; Lane, Andrew N.; Hamaker, Max; Bose, Sminu; Gouw, Arvin; Barbi, Joseph; Tsukamoto, Takashi; Rojas, Camilio J.; Slusher, Barbara S.; Zhang, Haixia; Zimmerman, Lisa J.; Liebler, Daniel C.; Slebos, Robbert J.C.; Lorkiewicz, Pawel K.; Higashi, Richard M.; Fan, Teresa W. M.; Dang, Chi V.

2012-01-01

Summary Because MYC plays a causal role in many human cancers, including those with hypoxic and nutrient-poor tumor microenvironments, we have determined the metabolic responses of a MYC-inducible human Burkitt lymphoma model P493 cell line to aerobic and hypoxic conditions, and to glucose deprivation, using Stable Isotope Resolved Metabolomics. Using [U-13C]-glucose as the tracer, both glucose consumption and lactate production were increased by MYC expression and hypoxia. Using [U-13C,15N]-glutamine as the tracer, glutamine import and metabolism through the TCA cycle persisted under hypoxia, and glutamine contributed significantly to citrate carbons. Under glucose deprivation, glutamine-derived fumarate, malate, and citrate were significantly increased. Their 13C labeling patterns demonstrate an alternative energy-generating glutaminolysis pathway involving a glucose-independent TCA cycle. The essential role of glutamine metabolism in cell survival and proliferation under hypoxia and glucose deficiency, makes them susceptible to the glutaminase inhibitor BPTES, and hence could be targeted for cancer therapy. PMID:22225880

Astrocytic and neuronal oxidative metabolism are coupled to the rate of glutamate-glutamine cycle in the tree shrew visual cortex.

PubMed

Sonnay, Sarah; Poirot, Jordan; Just, Nathalie; Clerc, Anne-Catherine; Gruetter, Rolf; Rainer, Gregor; Duarte, João M N

2018-03-01

Astrocytes play an important role in glutamatergic neurotransmission, namely by clearing synaptic glutamate and converting it into glutamine that is transferred back to neurons. The rate of this glutamate-glutamine cycle (V NT ) has been proposed to couple to that of glucose utilization and of neuronal tricarboxylic acid (TCA) cycle. In this study, we tested the hypothesis that glutamatergic neurotransmission is also coupled to the TCA cycle rate in astrocytes. For that we investigated energy metabolism by means of magnetic resonance spectroscopy (MRS) in the primary visual cortex of tree shrews (Tupaia belangeri) under light isoflurane anesthesia at rest and during continuous visual stimulation. After identifying the activated cortical volume by blood oxygenation level-dependent functional magnetic resonance imaging, 1 H MRS was performed to measure stimulation-induced variations in metabolite concentrations. Relative to baseline, stimulation of cortical activity for 20 min caused a reduction of glucose concentration by -0.34 ± 0.09 µmol/g (p < 0.001), as well as a -9% ± 1% decrease of the ratio of phosphocreatine-to-creatine (p < 0.05). Then 13 C MRS during [1,6- 13 C]glucose infusion was employed to measure fluxes of energy metabolism. Stimulation of glutamatergic activity, as indicated by a 20% increase of V NT , resulted in increased TCA cycle rates in neurons by 12% ( VTCAn, p < 0.001) and in astrocytes by 24% ( VTCAg, p = 0.007). We further observed linear relationships between V NT and both VTCAn and VTCAg. Altogether, these results suggest that in the tree shrew primary visual cortex glutamatergic neurotransmission is linked to overall glucose oxidation and to mitochondrial metabolism in both neurons and astrocytes. © 2017 Wiley Periodicals, Inc.

Glutamate oxaloacetate transaminase enables anaplerotic refilling of TCA cycle intermediates in stroke-affected brain

PubMed Central

Rink, Cameron; Gnyawali, Surya; Stewart, Richard; Teplitsky, Seth; Harris, Hallie; Roy, Sashwati; Sen, Chandan K.; Khanna, Savita

2017-01-01

Ischemic stroke results in excessive release of glutamate, which contributes to neuronal cell death. Here, we test the hypothesis that otherwise neurotoxic glutamate can be productively metabolized by glutamate oxaloacetate transaminase (GOT) to maintain cellular energetics and protect the brain from ischemic stroke injury. The GOT-dependent metabolism of glutamate was studied in primary neural cells and in stroke-affected C57-BL6 mice using magnetic resonance spectroscopy and GC-MS. Extracellular Glu sustained cell viability under hypoglycemic conditions and increased GOT-mediated metabolism in vitro. Correction of stroke-induced hypoxia using supplemental oxygen in vivo lowered Glu levels as measured by 1H magnetic resonance spectroscopy. GOT knockdown abrogated this effect and caused ATP loss in the stroke-affected brain. GOT overexpression increased anaplerotic refilling of tricarboxylic acid cycle intermediates in mouse brain during ischemic stroke. Furthermore, GOT overexpression not only reduced ischemic stroke lesion volume but also attenuated neurodegeneration and improved poststroke sensorimotor function. Taken together, our results show that GOT enables metabolism of otherwise neurotoxic extracellular Glu through a truncated tricarboxylic acid cycle under hypoglycemic conditions.—Rink, C., Gnyawali, S., Stewart, R., Teplitsky, S., Harris, H., Roy, S., Sen, C. K., Khanna, S. Glutamate oxaloacetate transaminase enables anaplerotic refilling of TCA cycle intermediates in stroke-affected brain. PMID:28096234

Linked cycles of oxidative decarboxylation of glyoxylate as protometabolic analogs of the citric acid cycle.

PubMed

Springsteen, Greg; Yerabolu, Jayasudhan Reddy; Nelson, Julia; Rhea, Chandler Joel; Krishnamurthy, Ramanarayanan

2018-01-08

The development of metabolic approaches towards understanding the origins of life, which have focused mainly on the citric acid (TCA) cycle, have languished-primarily due to a lack of experimentally demonstrable and sustainable cycle(s) of reactions. We show here the existence of a protometabolic analog of the TCA involving two linked cycles, which convert glyoxylate into CO 2 and produce aspartic acid in the presence of ammonia. The reactions proceed from either pyruvate, oxaloacetate or malonate in the presence of glyoxylate as the carbon source and hydrogen peroxide as the oxidant under neutral aqueous conditions and at mild temperatures. The reaction pathway demonstrates turnover under controlled conditions. These results indicate that simpler versions of metabolic cycles could have emerged under potential prebiotic conditions, laying the foundation for the appearance of more sophisticated metabolic pathways once control by (polymeric) catalysts became available.

Hyperammonaemia‐induced skeletal muscle mitochondrial dysfunction results in cataplerosis and oxidative stress

PubMed Central

Davuluri, Gangarao; Allawy, Allawy; Thapaliya, Samjhana; Rennison, Julie H.; Singh, Dharmvir; Kumar, Avinash; Sandlers, Yana; Van Wagoner, David R.; Flask, Chris A.; Hoppel, Charles; Kasumov, Takhar

2016-01-01

Key points Hyperammonaemia occurs in hepatic, cardiac and pulmonary diseases with increased muscle concentration of ammonia.We found that ammonia results in reduced skeletal muscle mitochondrial respiration, electron transport chain complex I dysfunction, as well as lower NAD+/NADH ratio and ATP content.During hyperammonaemia, leak of electrons from complex III results in oxidative modification of proteins and lipids.Tricarboxylic acid cycle intermediates are decreased during hyperammonaemia, and providing a cell‐permeable ester of αKG reversed the lower TCA cycle intermediate concentrations and increased ATP content.Our observations have high clinical relevance given the potential for novel approaches to reverse skeletal muscle ammonia toxicity by targeting the TCA cycle intermediates and mitochondrial ROS. Abstract Ammonia is a cytotoxic metabolite that is removed primarily by hepatic ureagenesis in humans. Hyperammonaemia occurs in advanced hepatic, cardiac and pulmonary disease, and in urea cycle enzyme deficiencies. Increased skeletal muscle ammonia uptake and metabolism are the major mechanism of non‐hepatic ammonia disposal. Non‐hepatic ammonia disposal occurs in the mitochondria via glutamate synthesis from α‐ketoglutarate resulting in cataplerosis. We show skeletal muscle mitochondrial dysfunction during hyperammonaemia in a comprehensive array of human, rodent and cellular models. ATP synthesis, oxygen consumption, generation of reactive oxygen species with oxidative stress, and tricarboxylic acid (TCA) cycle intermediates were quantified. ATP content was lower in the skeletal muscle from cirrhotic patients, hyperammonaemic portacaval anastomosis rat, and C2C12 myotubes compared to appropriate controls. Hyperammonaemia in C2C12 myotubes resulted in impaired intact cell respiration, reduced complex I/NADH oxidase activity and electron leak occurring at complex III of the electron transport chain. Consistently, lower NAD+/NADH ratio was observed during hyperammonaemia with reduced TCA cycle intermediates compared to controls. Generation of reactive oxygen species resulted in increased content of skeletal muscle carbonylated proteins and thiobarbituric acid reactive substances during hyperammonaemia. A cell‐permeable ester of α‐ketoglutarate reversed the low TCA cycle intermediates and ATP content in myotubes during hyperammonaemia. However, the mitochondrial antioxidant MitoTEMPO did not reverse the lower ATP content during hyperammonaemia. We provide for the first time evidence that skeletal muscle hyperammonaemia results in mitochondrial dysfunction and oxidative stress. Use of anaplerotic substrates to reverse ammonia‐induced mitochondrial dysfunction is a novel therapeutic approach. PMID:27558544

Decreased glycolytic and tricarboxylic acid cycle intermediates coincide with peripheral nervous system oxidative stress in a murine model of type 2 diabetes.

PubMed

Hinder, Lucy M; Vivekanandan-Giri, Anuradha; McLean, Lisa L; Pennathur, Subramaniam; Feldman, Eva L

2013-01-01

Diabetic neuropathy (DN) is the most common complication of diabetes and is characterized by distal-to-proximal loss of peripheral nerve axons. The idea of tissue-specific pathological alterations in energy metabolism in diabetic complications-prone tissues is emerging. Altered nerve metabolism in type 1 diabetes models is observed; however, therapeutic strategies based on these models offer limited efficacy to type 2 diabetic patients with DN. Therefore, understanding how peripheral nerves metabolically adapt to the unique type 2 diabetic environment is critical to develop disease-modifying treatments. In the current study, we utilized targeted liquid chromatography-tandem mass spectrometry (LC/MS/MS) to characterize the glycolytic and tricarboxylic acid (TCA) cycle metabolomes in sural nerve, sciatic nerve, and dorsal root ganglia (DRG) from male type 2 diabetic mice (BKS.Cg-m+/+Lepr(db); db/db) and controls (db/+). We report depletion of glycolytic intermediates in diabetic sural nerve and sciatic nerve (glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate (sural nerve only), 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvate, and lactate), with no significant changes in DRG. Citrate and isocitrate TCA cycle intermediates were decreased in sural nerve, sciatic nerve, and DRG from diabetic mice. Utilizing LC/electrospray ionization/MS/MS and HPLC methods, we also observed increased protein and lipid oxidation (nitrotyrosine; hydroxyoctadecadienoic acids) in db/db tissue, with a proximal-to-distal increase in oxidative stress, with associated decreased aconitase enzyme activity. We propose a preliminary model, whereby the greater change in metabolomic profile, increase in oxidative stress, and decrease in TCA cycle enzyme activity may cause distal peripheral nerves to rely on truncated TCA cycle metabolism in the type 2 diabetes environment.

Cyanobacterial carbon metabolism: Fluxome plasticity and oxygen dependence: Cyanobacterial Carbon Metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wan, Ni; DeLorenzo, Drew M.; He, Lian

Synechocystis sp. strain PCC 6803 has been widely used as a photo-biorefinery chassis. Based on its genome annotation, this species contains a complete TCA cycle, an Embden-Meyerhof-Parnas pathway (EMPP), an oxidative pentose phosphate pathway (OPPP), and an Entner–Doudoroff pathway (EDP). To evaluate how Synechocystis 6803 catabolizes glucose under heterotrophic conditions, we performed 13C metabolic flux analysis, metabolite pool size analysis, gene knockouts, and heterologous expressions. The results revealed a cyclic mode of flux through the OPPP. Small, but non-zero, fluxes were observed through the TCA cycle and the malic shunt. Independent knockouts of 6-phosphogluconate dehydrogenase (gnd) and malic enzyme (me)more » corroborated these results, as neither mutant could grow under dark heterotrophic conditions. Our data also indicate that Synechocystis 6803 metabolism relies upon oxidative phosphorylation to generate ATP from NADPH under dark or insufficient light conditions. The pool sizes of intermediates in the TCA cycle, particularly acetyl-CoA, were found to be several fold lower in Synechocystis 6803 (compared to E. coli metabolite pool sizes), while its sugar phosphate intermediates were several-fold higher. Moreover, negligible flux was detected through the native, or heterologous, EDP in the wild type or Δgnd strains under heterotrophic conditions. Comparing photoautotrophic, photomixotrophic, and heterotrophic conditions, the Calvin cycle, OPPP, and EMPP in Synechocystis 6803 possess the ability to regulate their fluxes under various growth conditions (plastic), whereas its TCA cycle always maintains at low levels (rigid). This work also demonstrates how genetic profiles do not always reflect actual metabolic flux through native or heterologous pathways. Biotechnol. Bioeng. 2017;114: 1593–1602. © 2017 Wiley Periodicals, Inc.« less

Alterations in Cytosolic and Mitochondrial [U-13C]Glucose Metabolism in a Chronic Epilepsy Mouse Model

PubMed Central

Carrasco-Pozo, Catalina

2017-01-01

Abstract Temporal lobe epilepsy is a common form of adult epilepsy and shows high resistance to treatment. Increasing evidence has suggested that metabolic dysfunction contributes to the development of seizures, with previous studies indicating impairments in brain glucose metabolism. Here we aim to elucidate which pathways involved in glucose metabolism are impaired, by tracing the hippocampal metabolism of injected [U-13C]glucose (i.p.) during the chronic stage of the pilocarpine-status epilepticus mouse model of epilepsy. The enrichment of 13C in the intermediates of glycolysis and the TCA cycle were quantified in hippocampal extracts using liquid chromatography–tandem mass spectroscopy, along with the measurement of the activities of enzymes in each pathway. We show that there is reduced incorporation of 13C in the intermediates of glycolysis, with the percentage enrichment of all downstream intermediates being highly correlated with those of glucose 6-phosphate. Furthermore, the activities of all enzymes in this pathway including hexokinase and phosphofructokinase were unaltered, suggesting that glucose uptake is reduced in this model without further impairments in glycolysis itself. The key findings were 33% and 55% losses in the activities of pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase, respectively, along with reduced 13C enrichment in TCA cycle intermediates. This lower 13C enrichment is best explained in part by the reduced enrichment in glycolytic intermediates, whereas the reduction of key TCA cycle enzyme activity indicates that TCA cycling is also impaired in the hippocampal formation. Together, these data suggest that multitarget approaches may be necessary to restore metabolism in the epileptic brain. PMID:28303258

Performance improvement of GaN-based metal-semiconductor-metal photodiodes grown on Si(111) substrate by thermal cycle annealing process

NASA Astrophysics Data System (ADS)

Lin, Jyun-Hao; Huang, Shyh-Jer; Su, Yan-Kuin

2014-01-01

A simple thermal cycle annealing (TCA) process was used to improve the quality of GaN grown on a Si substrate. The X-ray diffraction (XRD) and etch pit density (EPD) results revealed that using more process cycles, the defect density cannot be further reduced. However, the performance of GaN-based metal-semiconductor-metal (MSM) photodiodes (PDs) prepared on Si substrates showed significant improvement. With a two-cycle TCA process, it is found that the dark current of the device was only 1.46 × 10-11 A, and the photo-to-dark-current contrast ratio was about 1.33 × 105 at 5 V. Also, the UV/visible rejection ratios can reach as high as 1077.

Mitochondria-Translocated PGK1 Functions as a Protein Kinase to Coordinate Glycolysis and the TCA Cycle in Tumorigenesis.

PubMed

Li, Xinjian; Jiang, Yuhui; Meisenhelder, Jill; Yang, Weiwei; Hawke, David H; Zheng, Yanhua; Xia, Yan; Aldape, Kenneth; He, Jie; Hunter, Tony; Wang, Liwei; Lu, Zhimin

2016-03-03

It is unclear how the Warburg effect that exemplifies enhanced glycolysis in the cytosol is coordinated with suppressed mitochondrial pyruvate metabolism. We demonstrate here that hypoxia, EGFR activation, and expression of K-Ras G12V and B-Raf V600E induce mitochondrial translocation of phosphoglycerate kinase 1 (PGK1); this is mediated by ERK-dependent PGK1 S203 phosphorylation and subsequent PIN1-mediated cis-trans isomerization. Mitochondrial PGK1 acts as a protein kinase to phosphorylate pyruvate dehydrogenase kinase 1 (PDHK1) at T338, which activates PDHK1 to phosphorylate and inhibit the pyruvate dehydrogenase (PDH) complex. This reduces mitochondrial pyruvate utilization, suppresses reactive oxygen species production, increases lactate production, and promotes brain tumorigenesis. Furthermore, PGK1 S203 and PDHK1 T338 phosphorylation levels correlate with PDH S293 inactivating phosphorylation levels and poor prognosis in glioblastoma patients. This work highlights that PGK1 acts as a protein kinase in coordinating glycolysis and the tricarboxylic acid (TCA) cycle, which is instrumental in cancer metabolism and tumorigenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

Citral exerts its antifungal activity against Penicillium digitatum by affecting the mitochondrial morphology and function.

PubMed

Zheng, Shiju; Jing, Guoxing; Wang, Xiao; Ouyang, Qiuli; Jia, Lei; Tao, Nengguo

2015-07-01

This work investigated the effect of citral on the mitochondrial morphology and function of Penicillium digitatum. Citral at concentrations of 2.0 or 4.0 μL/mL strongly damaged mitochondria of test pathogen by causing the loss of matrix and increase of irregular mitochondria. The deformation extent of the mitochondria of P. digitatum enhanced with increasing concentrations of citral, as evidenced by a decrease in intracellular ATP content and an increase in extracellular ATP content of P. digitatum cells. Oxygen consumption showed that citral resulted in an inhibition in the tricarboxylic acid cycle (TCA) pathway of P. digitatum cells, induced a decrease in activities of citrate synthetase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, succinodehydrogenase and the content of citric acid, while enhancing the activity of malic dehydrogenase in P. digitatum cells. Our present results indicated that citral could damage the mitochondrial membrane permeability and disrupt the TCA pathway of P. digitatum. Copyright © 2015 Elsevier Ltd. All rights reserved.

Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis

PubMed Central

Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F.; Lane, Andrew N.; Romick-Rosendale, Lindsey E.; Wells, Susanne I.

2017-01-01

The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth. PMID:28558019

Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis.

PubMed

Matrka, Marie C; Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F; Lane, Andrew N; Romick-Rosendale, Lindsey E; Wells, Susanne I

2017-01-01

The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth.

Differential effects of ethanol on regional glutamatergic and GABAergic neurotransmitter pathways in mouse brain.

PubMed

Tiwari, Vivek; Veeraiah, Pandichelvam; Subramaniam, Vaidyanathan; Patel, Anant Bahadur

2014-03-01

This study investigates the effects of ethanol on neuronal and astroglial metabolism using (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of [1,6-(13)C2]/[1-(13)C]glucose or [2-(13)C]acetate, respectively. A three-compartment metabolic model was fitted to the (13)C turnover of GluC3 , GluC4, GABAC 2, GABAC 3, AspC3 , and GlnC4 from [1,6-(13)C2 ]glucose to determine the rates of tricarboxylic acid (TCA) and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The ratio of neurotransmitter cycle to TCA cycle fluxes for glutamatergic and GABAegic neurons was obtained from the steady-state [2-(13)C]acetate experiment and used as constraints during the metabolic model fitting. (1)H MRS measurement suggests that depletion of ethanol from cerebral cortex follows zero order kinetics with rate 0.18 ± 0.04 μmol/g/min. Acute exposure of ethanol reduces the level of glutamate and aspartate in cortical region. GlnC4 labeling was found to be unchanged from a 15 min infusion of [2-(13)C]acetate suggesting that acute ethanol exposure does not affect astroglial metabolism in naive mice. Rates of TCA and neurotransmitter cycle associated with glutamatergic and GABAergic neurons were found to be significantly reduced in cortical and subcortical regions. Acute exposure of ethanol perturbs the level of neurometabolites and decreases the excitatory and inhibitory activity differentially across the regions of brain. Depletion of ethanol and its effect on brain functions were measured using (1)H and (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of (13)C-labeled substrates. Ethanol depletion from brain follows zero order kinetics. Ethanol perturbs level of glutamate, and the excitatory and inhibitory activity in mice brain. © 2013 International Society for Neurochemistry.

Diversity of Total Bacterial Communities and Chemoautotrophic Populations in Sulfur-Rich Sediments of Shallow-Water Hydrothermal Vents off Kueishan Island, Taiwan.

PubMed

Wang, Li; Cheung, Man Kit; Liu, Rulong; Wong, Chong Kim; Kwan, Hoi Shan; Hwang, Jiang-Shiou

2017-04-01

Shallow-water hydrothermal vents (HTVs) are an ecologically important habitat with a geographic origin similar to that of deep-sea HTVs. Studies on shallow-water HTVs have not only facilitated understanding of the influences of vents on local ecosystems but also helped to extend the knowledge on deep-sea vents. In this study, the diversity of bacterial communities in the sediments of shallow-water HTVs off Kueishan Island, Taiwan, was investigated by examining the 16S ribosomal RNA gene as well as key functional genes involved in chemoautotrophic carbon fixation (aclB, cbbL and cbbM). In the vent area, Sulfurovum and Sulfurimonas of Epsilonproteobacteria appeared to dominate the benthic bacterial community. Results of aclB gene analysis also suggested involvement of these bacteria in carbon fixation using the reductive tricarboxylic acid (rTCA) cycle. Analysis of the cbbM gene showed that Alphaproteobacterial members such as the purple non-sulfur bacteria were the major chemoautotrophic bacteria involving in carbon fixation via the Calvin-Benson-Bassham (CBB) cycle. However, they only accounted for <2% of the total bacterial community in the vent area. These findings suggest that the rTCA cycle is the major chemoautotrophic carbon fixation pathway in sediments of the shallow-water HTVs off Kueishan Island.

Metabolomics and transcriptomics profiles reveal the dysregulation of the tricarboxylic acid cycle and related mechanisms in prostate cancer.

PubMed

Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang

2018-07-15

Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.

Neuronal glucose metabolism is impaired while astrocytic TCA cycling is unaffected at symptomatic stages in the hSOD1G93A mouse model of amyotrophic lateral sclerosis.

PubMed

Tefera, Tesfaye W; Borges, Karin

2018-01-01

Although alterations in energy metabolism are known in ALS, the specific mechanisms leading to energy deficit are not understood. We measured metabolite levels derived from injected [1- 13 C]glucose and [1,2- 13 C]acetate (i.p.) in cerebral cortex and spinal cord extracts of wild type and hSOD1 G93A mice at onset and mid disease stages using high-pressure liquid chromatography, 1 H and 13 C nuclear magnetic resonance spectroscopy. Levels of spinal and cortical CNS total lactate, [3- 13 C]lactate, total alanine and [3- 13 C]alanine, but not cortical glucose and [1- 13 C]glucose, were reduced mostly at mid stage indicating impaired glycolysis. The [1- 13 C]glucose-derived [4- 13 C]glutamate, [4- 13 C]glutamine and [2- 13 C]GABA amounts were diminished at mid stage in cortex and both time points in spinal cord, suggesting decreased [3- 13 C]pyruvate entry into the TCA cycle. Lack of changes in [1,2- 13 C]acetate-derived [4,5- 13 C]glutamate, [4,5- 13 C]glutamine and [1,2- 13 C]GABA levels indicate unchanged astrocytic 13 C-acetate metabolism. Reduced levels of leucine, isoleucine and valine in CNS suggest compensatory breakdown to refill TCA cycle intermediate levels. Unlabelled, [2- 13 C] and [4- 13 C]GABA concentrations were decreased in spinal cord indicating that impaired glucose metabolism contributes to hyperexcitability and supporting the use of treatments which increase GABA amounts. In conclusion, CNS glucose metabolism is compromised, while astrocytic TCA cycling appears to be normal in the hSOD1 G93A mouse model at symptomatic disease stages.

Glutaric aciduria type 1 metabolites impair the succinate transport from astrocytic to neuronal cells.

PubMed

Lamp, Jessica; Keyser, Britta; Koeller, David M; Ullrich, Kurt; Braulke, Thomas; Mühlhausen, Chris

2011-05-20

The inherited neurodegenerative disorder glutaric aciduria type 1 (GA1) results from mutations in the gene for the mitochondrial matrix enzyme glutaryl-CoA dehydrogenase (GCDH), which leads to elevations of the dicarboxylates glutaric acid (GA) and 3-hydroxyglutaric acid (3OHGA) in brain and blood. The characteristic clinical presentation of GA1 is a sudden onset of dystonia during catabolic situations, resulting from acute striatal injury. The underlying mechanisms are poorly understood, but the high levels of GA and 3OHGA that accumulate during catabolic illnesses are believed to play a primary role. Both GA and 3OHGA are known to be substrates for Na(+)-coupled dicarboxylate transporters, which are required for the anaplerotic transfer of the tricarboxylic acid cycle (TCA) intermediate succinate between astrocytes and neurons. We hypothesized that GA and 3OHGA inhibit the transfer of succinate from astrocytes to neurons, leading to reduced TCA cycle activity and cellular injury. Here, we show that both GA and 3OHGA inhibit the uptake of [(14)C]succinate by Na(+)-coupled dicarboxylate transporters in cultured astrocytic and neuronal cells of wild-type and Gcdh(-/-) mice. In addition, we demonstrate that the efflux of [(14)C]succinate from Gcdh(-/-) astrocytic cells mediated by a not yet identified transporter is strongly reduced. This is the first experimental evidence that GA and 3OHGA interfere with two essential anaplerotic transport processes: astrocytic efflux and neuronal uptake of TCA cycle intermediates, which occur between neurons and astrocytes. These results suggest that elevated levels of GA and 3OHGA may lead to neuronal injury and cell death via disruption of TCA cycle activity. © 2011 by The American Society for Biochemistry and Molecular Biology, Inc.

Global Regulatory Mutations in csrA and rpoS Cause Severe Central Carbon Stress in Escherichia coli in the Presence of Acetate

PubMed Central

Wei, Bangdong; Shin, Sooan; LaPorte, David; Wolfe, Alan J.; Romeo, Tony

2000-01-01

The csrA gene encodes a small RNA-binding protein, which acts as a global regulator in Escherichia coli and other bacteria (T. Romeo, Mol. Microbiol. 29:1321–1330, 1998). Its key regulatory role in central carbon metabolism, both as an activator of glycolysis and as a potent repressor of glycogen biosynthesis and gluconeogenesis, prompted us to examine the involvement of csrA in acetate metabolism and the tricarboxylic acid (TCA) cycle. We found that growth of csrA rpoS mutant strains was very poor on acetate as a sole carbon source. Surprisingly, growth also was inhibited specifically by the addition of modest amounts of acetate to rich media (e.g., tryptone broth). Cultures grown in the presence of ≥25 mM acetate consisted substantially of glycogen biosynthesis (glg) mutants, which were no longer inhibited by acetate. Several classes of glg mutations were mapped to known and novel loci. Several hypotheses were examined to provide further insight into the effects of acetate on growth and metabolism in these strains. We determined that csrA positively regulates acs (acetyl-coenzyme A synthetase; Acs) expression and isocitrate lyase activity without affecting key TCA cycle enzymes or phosphotransacetylase. TCA cycle intermediates or pyruvate, but not glucose, galactose, or glycerol, restored growth and prevented the glg mutations in the presence of acetate. Furthermore, amino acid uptake was inhibited by acetate specifically in the csrA rpoS strain. We conclude that central carbon flux imbalance, inhibition of amino acid uptake, and a deficiency in acetate metabolism apparently are combined to cause metabolic stress by depleting the TCA cycle. PMID:10692369

Temporal fluxomics reveals oscillations in TCA cycle flux throughout the mammalian cell cycle.

PubMed

Ahn, Eunyong; Kumar, Praveen; Mukha, Dzmitry; Tzur, Amit; Shlomi, Tomer

2017-11-06

Cellular metabolic demands change throughout the cell cycle. Nevertheless, a characterization of how metabolic fluxes adapt to the changing demands throughout the cell cycle is lacking. Here, we developed a temporal-fluxomics approach to derive a comprehensive and quantitative view of alterations in metabolic fluxes throughout the mammalian cell cycle. This is achieved by combining pulse-chase LC-MS-based isotope tracing in synchronized cell populations with computational deconvolution and metabolic flux modeling. We find that TCA cycle fluxes are rewired as cells progress through the cell cycle with complementary oscillations of glucose versus glutamine-derived fluxes: Oxidation of glucose-derived flux peaks in late G1 phase, while oxidative and reductive glutamine metabolism dominates S phase. These complementary flux oscillations maintain a constant production rate of reducing equivalents and oxidative phosphorylation flux throughout the cell cycle. The shift from glucose to glutamine oxidation in S phase plays an important role in cell cycle progression and cell proliferation. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Tonic-Clonic Activity at Subarachnoid Hemorrhage Onset: Impact on Complications and Outcome

PubMed Central

De Marchis, Gian Marco; Pugin, Deborah; Lantigua, Hector; Zammit, Christopher; Tadi, Prasanna; Schmidt, J. Michael; Falo, M. Cristina; Agarwal, Sachin; Mayer, Stephan A.; Claassen, Jan

2013-01-01

Objective Tonic-clonic activity (TCA) at onset complicates 3% to 21% of cases of subarachnoid hemorrhage (SAH). The impact of onset TCA on in-hospital complications, including seizures, remains unclear. One study associated onset TCA with poor clinical outcome at 6 weeks after SAH, but to our knowledge no other studies have confirmed this relationship. This study aims to assess the impact of onset TCA on in-hospital complications, poor functional outcome, mortality, and epilepsy at 3 months. Methods Analysis of a prospective study cohort of 1479 SAH patients admitted to Columbia University Medical Center between 1996 and 2012. TCA within 6 hours of hemorrhage onset was identified based on accounts of emergency care providers or family witnesses. Results TCA at onset was described in 170 patients (11%). Patients with onset TCA were younger (P = 0.002), presented more often with poor clinical grade (55% vs. 26%, P<0.001) and had larger amounts of cisternal, intraventricular, and intracerebral blood than those without onset TCA (all, P<0.001). After adjusting for known confounders, onset TCA was significantly associated with in-hospital seizures (OR 3.80, 95%-CI: 2.43–5.96, P<0.001), in-hospital pneumonia (OR 1.56, 95%-CI: 1.06–2.31, p = 0.02), and delayed cerebral ischemia (OR 1.77, 95%-CI: 1.21–2.58, P = 0.003). At 3 months, however, onset TCA was not associated with poor functional outcome, mortality, and epilepsy after adjusting for age, admission clinical grade, and cisternal blood volume. Conclusions Onset TCA is not a rare event as it complicates 11% of cases of SAH. New and clinically relevant findings are the association of onset TCA with in-hospital seizures, pneumonia and delayed cerebral ischemia. Despite the increased risk of in-hospital complications, onset TCA is not associated with disability, mortality, and epilepsy at 3 months. PMID:23951155

Detoxification of ammonia in mouse cortical GABAergic cell cultures increases neuronal oxidative metabolism and reveals an emerging role for release of glucose-derived alanine.

PubMed

Leke, Renata; Bak, Lasse K; Anker, Malene; Melø, Torun M; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Ott, Peter; Portela, Luis V; Sonnewald, Ursula; Schousboe, Arne; Waagepetersen, Helle S

2011-04-01

Cerebral hyperammonemia is believed to play a pivotal role in the development of hepatic encephalopathy (HE), a debilitating condition arising due to acute or chronic liver disease. In the brain, ammonia is thought to be detoxified via the activity of glutamine synthetase, an astrocytic enzyme. Moreover, it has been suggested that cerebral tricarboxylic acid (TCA) cycle metabolism is inhibited and glycolysis enhanced during hyperammonemia. The aim of this study was to characterize the ammonia-detoxifying mechanisms as well as the effects of ammonia on energy-generating metabolic pathways in a mouse neuronal-astrocytic co-culture model of the GABAergic system. We found that 5 mM ammonium chloride affected energy metabolism by increasing the neuronal TCA cycle activity and switching the astrocytic TCA cycle toward synthesis of substrate for glutamine synthesis. Furthermore, ammonia exposure enhanced the synthesis and release of alanine. Collectively, our results demonstrate that (1) formation of glutamine is seminal for detoxification of ammonia; (2) neuronal oxidative metabolism is increased in the presence of ammonia; and (3) synthesis and release of alanine is likely to be important for ammonia detoxification as a supplement to formation of glutamine.

Ammonium Assimilation Requires Mitochondrial Respiration in the Light 1

PubMed Central

Weger, Harold G.; Birch, Douglas G.; Elrifi, Ivor R.; Turpin, David H.

1988-01-01

Mass spectrometric analysis of O2 and CO2 exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH4Cl resulted in nearly a 250% increase in the rate of TCA cycle CO2 efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O2 consumption in both light and dark. Anaerobiosis inhibited the CO2 release caused by NH4Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O2 consumption in the light. This implied that the Mehler reaction did not play a significant role in O2 consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions. PMID:16665971

TCA cycle rewiring fosters metabolic adaptation to oxygen restriction in skeletal muscle from rodents and humans.

PubMed

Capitanio, Daniele; Fania, Chiara; Torretta, Enrica; Viganò, Agnese; Moriggi, Manuela; Bravatà, Valentina; Caretti, Anna; Levett, Denny Z H; Grocott, Michael P W; Samaja, Michele; Cerretelli, Paolo; Gelfi, Cecilia

2017-08-29

In mammals, hypoxic stress management is under the control of the Hypoxia Inducible Factors, whose activity depends on the stabilization of their labile α subunit. In particular, the skeletal muscle appears to be able to react to changes in substrates and O 2 delivery by tuning its metabolism. The present study provides a comprehensive overview of skeletal muscle metabolic adaptation to hypoxia in mice and in human subjects exposed for 7/9 and 19 days to high altitude levels. The investigation was carried out combining proteomics, qRT-PCR mRNA transcripts analysis, and enzyme activities assessment in rodents, and protein detection by antigen antibody reactions in humans and rodents. Results indicate that the skeletal muscle react to a decreased O 2 delivery by rewiring the TCA cycle. The first TCA rewiring occurs in mice in 2-day hypoxia and is mediated by cytosolic malate whereas in 10-day hypoxia the rewiring is mediated by Idh1 and Fasn, supported by glutamine and HIF-2α increments. The combination of these specific anaplerotic steps can support energy demand despite HIFs degradation. These results were confirmed in human subjects, demonstrating that the TCA double rewiring represents an essential factor for the maintenance of muscle homeostasis during adaptation to hypoxia.

Metabolic engineering in the biotechnological production of organic acids in the tricarboxylic acid cycle of microorganisms: Advances and prospects.

PubMed

Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian

2015-11-01

Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.

Deletion of the transcriptional coactivator PGC1α in skeletal muscles is associated with reduced expression of genes related to oxidative muscle function.

PubMed

Hatazawa, Yukino; Minami, Kimiko; Yoshimura, Ryoji; Onishi, Takumi; Manio, Mark Christian; Inoue, Kazuo; Sawada, Naoki; Suzuki, Osamu; Miura, Shinji; Kamei, Yasutomi

2016-12-09

The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared with that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α's function in the oxidative energy metabolism of skeletal muscles. Copyright © 2016 Elsevier Inc. All rights reserved.

Inflammation and ER Stress Regulate Branched-Chain Amino Acid Uptake and Metabolism in Adipocytes

PubMed Central

Burrill, Joel S.; Long, Eric K.; Reilly, Brian; Deng, Yingfeng; Armitage, Ian M.; Scherer, Philipp E.

2015-01-01

Inflammation plays a critical role in the pathology of obesity-linked insulin resistance and is mechanistically linked to the effects of macrophage-derived cytokines on adipocyte energy metabolism, particularly that of the mitochondrial branched-chain amino acid (BCAA) and tricarboxylic acid (TCA) pathways. To address the role of inflammation on energy metabolism in adipocytes, we used high fat-fed C57BL/6J mice and lean controls and measured the down-regulation of genes linked to BCAA and TCA cycle metabolism selectively in visceral but not in subcutaneous adipose tissue, brown fat, liver, or muscle. Using 3T3-L1 cells, TNFα, and other proinflammatory cytokine treatments reduced the expression of the genes linked to BCAA transport and oxidation. Consistent with this, [14C]-leucine uptake and conversion to triglycerides was markedly attenuated in TNFα-treated adipocytes, whereas the conversion to protein was relatively unaffected. Because inflammatory cytokines lead to the induction of endoplasmic reticulum stress, we evaluated the effects of tunicamycin or thapsigargin treatment of 3T3-L1 cells and measured a similar down-regulation in the BCAA/TCA cycle pathway. Moreover, transgenic mice overexpressing X-box binding protein 1 in adipocytes similarly down-regulated genes of BCAA and TCA metabolism in vivo. These results indicate that inflammation and endoplasmic reticulum stress attenuate lipogenesis in visceral adipose depots by down-regulating the BCAA/TCA metabolism pathway and are consistent with a model whereby the accumulation of serum BCAA in the obese insulin-resistant state is linked to adipose inflammation. PMID:25635940

Systemic Activin signaling independently regulates sugar homeostasis, cellular metabolism, and pH balance in Drosophila melanogaster

PubMed Central

Ghosh, Arpan C.; O’Connor, Michael B.

2014-01-01

The ability to maintain cellular and physiological metabolic homeostasis is key for the survival of multicellular organisms in changing environmental conditions. However, our understanding of extracellular signaling pathways that modulate metabolic processes remains limited. In this study we show that the Activin-like ligand Dawdle (Daw) is a major regulator of systemic metabolic homeostasis and cellular metabolism in Drosophila. We find that loss of canonical Smad signaling downstream of Daw leads to defects in sugar and systemic pH homeostasis. Although Daw regulates sugar homeostasis by positively influencing insulin release, we find that the effect of Daw on pH balance is independent of its role in insulin signaling and is caused by accumulation of organic acids that are primarily tricarboxylic acid (TCA) cycle intermediates. RNA sequencing reveals that a number of TCA cycle enzymes and nuclear-encoded mitochondrial genes including genes involved in oxidative phosphorylation and β-oxidation are up-regulated in the daw mutants, indicating either a direct or indirect role of Daw in regulating these genes. These findings establish Activin signaling as a major metabolic regulator and uncover a functional link between TGF-β signaling, insulin signaling, and metabolism in Drosophila. PMID:24706779

Systems responses of rats to aflatoxin B1 exposure revealed with metabonomic changes in multiple biological matrices.

PubMed

Zhang, Limin; Ye, Yangfang; An, Yanpeng; Tian, Yuan; Wang, Yulan; Tang, Huiru

2011-02-04

Exposure to aflatoxins causes liver fibrosis and hepatocellular carcinoma posing a significant health risk for human populations and livestock. To understand the mammalian systems responses to aflatoxin-B1 (AFB1) exposure, we analyzed the AFB1-induced metabonomic changes in multiple biological matrices (plasma, urine, and liver) of rats using (1)H NMR spectroscopy together with clinical biochemistry and histopathologic assessments. We found that AFB1 exposure caused significant elevation of glucose, amino acids, and choline metabolites (choline, phosphocholine, and glycerophosphocholine) in plasma but reduction of plasma lipids. AFB1 also induced elevation of liver lipids, amino acids (tyrosine, histidine, phenylalanine, leucine, isoleucine, and valine), choline, and nucleic acid metabolites (inosine, adenosine, and uridine) together with reduction of hepatic glycogen and glucose. AFB1 further caused decreases in urinary TCA cycle intermediates (2-oxoglutarate and citrate) and elevation of gut microbiota cometabolites (phenylacetylglycine and hippurate). These indicated that AFB1 exposure caused hepatic steatosis accompanied with widespread metabolic changes including lipid and cell membrane metabolisms, protein biosynthesis, glycolysis, TCA cycle, and gut microbiota functions. This implied that AFB1 exposure probably caused oxidative-stress-mediated impairments of mitochondria functions. These findings provide an overview of biochemical consequences of AFB1 exposure and comprehensive insights into the metabolic aspects of AFB1-induced hepatotoxicity in rats.

Dysfunctional BMPR2 signaling drives an abnormal endothelial requirement for glutamine in pulmonary arterial hypertension.

PubMed

Egnatchik, Robert A; Brittain, Evan L; Shah, Amy T; Fares, Wassim H; Ford, H James; Monahan, Ken; Kang, Christie J; Kocurek, Emily G; Zhu, Shijun; Luong, Thong; Nguyen, Thuy T; Hysinger, Erik; Austin, Eric D; Skala, Melissa C; Young, Jamey D; Roberts, L Jackson; Hemnes, Anna R; West, James; Fessel, Joshua P

2017-03-01

Pulmonary arterial hypertension (PAH) is increasingly recognized as a systemic disease driven by alteration in the normal functioning of multiple metabolic pathways affecting all of the major carbon substrates, including amino acids. We found that human pulmonary hypertension patients (WHO Group I, PAH) exhibit systemic and pulmonary-specific alterations in glutamine metabolism, with the diseased pulmonary vasculature taking up significantly more glutamine than that of controls. Using cell culture models and transgenic mice expressing PAH-causing BMPR2 mutations, we found that the pulmonary endothelium in PAH shunts significantly more glutamine carbon into the tricarboxylic acid (TCA) cycle than wild-type endothelium. Increased glutamine metabolism through the TCA cycle is required by the endothelium in PAH to survive, to sustain normal energetics, and to manifest the hyperproliferative phenotype characteristic of disease. The strict requirement for glutamine is driven by loss of sirtuin-3 (SIRT3) activity through covalent modification by reactive products of lipid peroxidation. Using 2-hydroxybenzylamine, a scavenger of reactive lipid peroxidation products, we were able to preserve SIRT3 function, to normalize glutamine metabolism, and to prevent the development of PAH in BMPR2 mutant mice. In PAH, targeting glutamine metabolism and the mechanisms that underlie glutamine-driven metabolic reprogramming represent a viable novel avenue for the development of potentially disease-modifying therapeutics that could be rapidly translated to human studies.

The influence of alternative pathways of respiration that utilize branched-chain amino acids following water shortage in Arabidopsis.

PubMed

Pires, Marcel V; Pereira Júnior, Adilson A; Medeiros, David B; Daloso, Danilo M; Pham, Phuong Anh; Barros, Kallyne A; Engqvist, Martin K M; Florian, Alexandra; Krahnert, Ina; Maurino, Veronica G; Araújo, Wagner L; Fernie, Alisdair R

2016-06-01

During dark-induced senescence isovaleryl-CoA dehydrogenase (IVDH) and D-2-hydroxyglutarate dehydrogenase (D-2HGDH) act as alternate electron donors to the ubiquinol pool via the electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO) pathway. However, the role of this pathway in response to other stresses still remains unclear. Here, we demonstrated that this alternative pathway is associated with tolerance to drought in Arabidopsis. In comparison with wild type (WT) and lines overexpressing D-2GHDH, loss-of-function etfqo-1, d2hgdh-2 and ivdh-1 mutants displayed compromised respiration rates and were more sensitive to drought. Our results demonstrated that an operational ETF/ETFQO pathway is associated with plants' ability to withstand drought and to recover growth once water becomes replete. Drought-induced metabolic reprogramming resulted in an increase in tricarboxylic acid (TCA) cycle intermediates and total amino acid levels, as well as decreases in protein, starch and nitrate contents. The enhanced levels of the branched-chain amino acids in loss-of-function mutants appear to be related to their increased utilization as substrates for the TCA cycle under water stress. Our results thus show that mitochondrial metabolism is highly active during drought stress responses and provide support for a role of alternative respiratory pathways within this response. © 2015 John Wiley & Sons Ltd.

Gluconeogenesis is associated with high rates of tricarboxylic acid and pyruvate cycling in fasting northern elephant seals.

PubMed

Champagne, Cory D; Houser, Dorian S; Fowler, Melinda A; Costa, Daniel P; Crocker, Daniel E

2012-08-01

Animals that endure prolonged periods of food deprivation preserve vital organ function by sparing protein from catabolism. Much of this protein sparing is achieved by reducing metabolic rate and suppressing gluconeogenesis while fasting. Northern elephant seals (Mirounga angustirostris) endure prolonged fasts of up to 3 mo at multiple life stages. During these fasts, elephant seals maintain high levels of activity and energy expenditure associated with breeding, reproduction, lactation, and development while maintaining rates of glucose production typical of a postabsorptive mammal. Therefore, we investigated how fasting elephant seals meet the requirements of glucose-dependent tissues while suppressing protein catabolism by measuring the contribution of glycogenolysis, glycerol, and phosphoenolpyruvate (PEP) to endogenous glucose production (EGP) during their natural 2-mo postweaning fast. Additionally, pathway flux rates associated with the tricarboxylic acid (TCA) cycle were measured specifically, flux through phosphoenolpyruvate carboxykinase (PEPCK) and pyruvate cycling. The rate of glucose production decreased during the fast (F(1,13) = 5.7, P = 0.04) but remained similar to that of postabsorptive mammals. The fractional contributions of glycogen, glycerol, and PEP did not change with fasting; PEP was the primary gluconeogenic precursor and accounted for ∼95% of EGP. This large contribution of PEP to glucose production occurred without substantial protein loss. Fluxes through the TCA cycle, PEPCK, and pyruvate cycling were higher than reported in other species and were the most energetically costly component of hepatic carbohydrate metabolism. The active pyruvate recycling fluxes detected in elephant seals may serve to rectify gluconeogeneic PEP production during restricted anaplerotic inflow in these fasting-adapted animals.

Disruption of TCA Cycle and Glutamate Metabolism Identified by Metabolomics in an In Vitro Model of Amyotrophic Lateral Sclerosis.

PubMed

Veyrat-Durebex, Charlotte; Corcia, Philippe; Piver, Eric; Devos, David; Dangoumau, Audrey; Gouel, Flore; Vourc'h, Patrick; Emond, Patrick; Laumonnier, Frédéric; Nadal-Desbarats, Lydie; Gordon, Paul H; Andres, Christian R; Blasco, Hélène

2016-12-01

This study aims to develop a cellular metabolomics model that reproduces the pathophysiological conditions found in amyotrophic lateral sclerosis in order to improve knowledge of disease physiology. We used a co-culture model combining the motor neuron-like cell line NSC-34 and the astrocyte clone C8-D1A, with each over-expressing wild-type or G93C mutant human SOD1, to examine amyotrophic lateral sclerosis (ALS) physiology. We focused on the effects of mutant human SOD1 as well as oxidative stress induced by menadione on intracellular metabolism using a metabolomics approach through gas chromatography coupled with mass spectrometry (GC-MS) analysis. Preliminary non-supervised analysis by Principal Component Analysis (PCA) revealed that cell type, genetic environment, and time of culture influenced the metabolomics profiles. Supervised analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) on data from intracellular metabolomics profiles of SOD1 G93C co-cultures produced metabolites involved in glutamate metabolism and the tricarboxylic acid cycle (TCA) cycle. This study revealed the feasibility of using a metabolomics approach in a cellular model of ALS. We identified potential disruption of the TCA cycle and glutamate metabolism under oxidative stress, which is consistent with prior research in the disease. Analysis of metabolic alterations in an in vitro model is a novel approach to investigation of disease physiology.

Glial dysfunction in abstinent methamphetamine abusers

PubMed Central

Sailasuta, Napapon; Abulseoud, Osama; Harris, Kent C; Ross, Brian D

2010-01-01

Persistent neurochemical abnormalities in frontal brain structures are believed to result from methamphetamine use. We developed a localized 13C magnetic resonance spectroscopy (MRS) assay on a conventional MR scanner, to quantify selectively glial metabolic flux rate in frontal brain of normal subjects and a cohort of recovering abstinent methamphetamine abusers. Steady-state bicarbonate concentrations were similar, between 11 and 15 mmol/L in mixed gray-white matter of frontal brain of normal volunteers and recovering methamphetamine-abusing subjects (P>0.1). However, glial 13C-bicarbonate production rate from [1-13C]acetate, equating with glial tricarboxylic acid (TCA) cycle rate, was significantly reduced in frontal brain of abstinent methamphetamine-addicted women (methamphetamine 0.04 μmol/g per min (N=5) versus controls 0.11 μmol/g per min (N=5), P=0.001). This is equivalent to 36% of the normal glial TCA cycle rate. Severe reduction in glial TCA cycle rate that normally comprises 10% of total cerebral metabolic rate may impact operation of the neuronal glial glutamate cycle and result in accumulation of frontal brain glutamate, as observed in these recovering methamphetamine abusers. Although these are the first studies to define directly an abnormality in glial metabolism in human methamphetamine abuse, sequential studies using analogous 13C MRS methods may determine ‘cause and effect' between glial failure and neuronal injury. PMID:20040926

A comprehensive analysis of myocardial substrate preference emphasizes the need for a synchronized fluxomic/metabolomic research design.

PubMed

Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E

2017-06-01

The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.

Proteomics and genetic analyses reveal the effects of arsenite oxidation on metabolic pathways and the roles of AioR in Agrobacterium tumefaciens GW4.

PubMed

Shi, Kaixiang; Wang, Qian; Fan, Xia; Wang, Gejiao

2018-04-01

A heterotrophic arsenite [As(III)]-oxidizing bacterium Agrobacterium tumefaciens GW4 isolated from As(III)-rich groundwater sediment showed high As(III) resistance and could oxidize As(III) to As(V). The As(III) oxidation could generate energy and enhance growth, and AioR was the regulator for As(III) oxidase. To determine the related metabolic pathways mediated by As(III) oxidation and whether AioR regulated other cellular responses to As(III), isobaric tags for relative and absolute quantitation (iTRAQ) was performed in four treatments, GW4 (+AsIII)/GW4 (-AsIII), GW4-ΔaioR (+AsIII)/GW4-ΔaioR (-AsIII), GW4-ΔaioR (-AsIII)/GW4 (-AsIII) and GW4-ΔaioR (+AsIII)/GW4 (+AsIII). A total of 41, 71, 82 and 168 differentially expressed proteins were identified, respectively. Using electrophoretic mobility shift assay (EMSA) and qRT-PCR, 12 genes/operons were found to interact with AioR. These results indicate that As(III) oxidation alters several cellular processes related to arsenite, such as As resistance (ars operon), phosphate (Pi) metabolism (pst/pho system), TCA cycle, cell wall/membrane, amino acid metabolism and motility/chemotaxis. In the wild type with As(III), TCA cycle flow is perturbed, and As(III) oxidation and fermentation are the main energy resources. However, when strain GW4-ΔaioR lost the ability of As(III) oxidation, the TCA cycle is the main way to generate energy. A regulatory cellular network controlled by AioR is constructed and shows that AioR is the main regulator for As(III) oxidation, besides, several other functions related to As(III) are regulated by AioR in parallel. Copyright © 2018 Elsevier Ltd. All rights reserved.

Impaired hippocampal glucose metabolism during and after flurothyl-induced seizures in mice: Reduced phosphorylation coincides with reduced activity of pyruvate dehydrogenase.

PubMed

McDonald, Tanya S; Borges, Karin

2017-07-01

To determine changes in glucose metabolism and the enzymes involved in the hippocampus ictally and postictally in the acute mouse flurothyl seizure model. [U- 13 C]-Glucose was injected (i.p.) prior to, or following a 5 min flurothyl-induced seizure. Fifteen minutes later, mice were killed and the total metabolite levels and % 13 C enrichment were analyzed in the hippocampal formation using gas chromatography-mass spectrometry. Activities of key metabolic and antioxidant enzymes and the phosphorylation status of pyruvate dehydrogenase were measured, along with lipid peroxidation. During seizures, total lactate levels increased 1.7-fold; however, [M + 3] enrichment of both lactate and alanine were reduced by 30% and 43%, respectively, along with a 28% decrease in phosphofructokinase activity. Postictally the % 13 C enrichments of all measured tricarboxylic acid (TCA) cycle intermediates and the amino acids were reduced by 46-93%. At this time, pyruvate dehydrogenase (PDH) activity was 56% of that measured in controls, and there was a 1.9-fold increase in the phosphorylation of PDH at ser232. Phosphorylation of PDH is known to decrease its activity. Here, we show that the increase of lactate levels during flurothyl seizures is from a source other than [U- 13 C]-glucose, such as glycogen. Surprisingly, although we saw a reduction in phosphofructokinase activity during the seizure, metabolism of [U- 13 C]-glucose into the TCA cycle seemed unaffected. Similar to our recent findings in the chronic phase of the pilocarpine model, postictally the metabolism of glucose by glycolysis and the TCA cycle was impaired along with reduced PDH activity. Although this decrease in activity may be a protective mechanism to reduce oxidative stress, which is observed in the flurothyl model, ATP is critical to the recovery of ion and neurotransmitter balance and return to normal brain function. Thus we identified promising novel strategies to enhance energy metabolism and recovery from seizures. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

Ammonium Assimilation Requires Mitochondrial Respiration in the Light : A Study with the Green Alga Selenastrum minutum.

PubMed

Weger, H G; Birch, D G; Elrifi, I R; Turpin, D H

1988-03-01

Mass spectrometric analysis of O(2) and CO(2) exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH(4)Cl resulted in nearly a 250% increase in the rate of TCA cycle CO(2) efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O(2) consumption in both light and dark. Anaerobiosis inhibited the CO(2) release caused by NH(4)Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O(2) consumption in the light. This implied that the Mehler reaction did not play a significant role in O(2) consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions.

An integrated model of cardiac mitochondrial energy metabolism and calcium dynamics.

PubMed

Cortassa, Sonia; Aon, Miguel A; Marbán, Eduardo; Winslow, Raimond L; O'Rourke, Brian

2003-04-01

We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca(2+) handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH(2), which in turn are used by the electron transport chain to establish a proton motive force (Delta mu(H)), driving the F(1)F(0)-ATPase. In addition, mitochondrial matrix Ca(2+), determined by Ca(2+) uniporter and Na(+)/Ca(2+) exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (Delta Psi(m)), and matrix concentrations of Ca(2+), NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca(2+). The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca(2+) dynamics, and respiratory control. Significant increases in oxygen consumption (V(O(2))), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca(2+), are obtained when the Ca(2+)-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca(2+) plays an important role in matching energy supply with demand in cardiac myocytes.

An Integrated Model of Cardiac Mitochondrial Energy Metabolism and Calcium Dynamics

PubMed Central

Cortassa, Sonia; Aon, Miguel A.; Marbán, Eduardo; Winslow, Raimond L.; O'Rourke, Brian

2003-01-01

We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca2+ handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH2, which in turn are used by the electron transport chain to establish a proton motive force (ΔμH), driving the F1F0-ATPase. In addition, mitochondrial matrix Ca2+, determined by Ca2+ uniporter and Na+/Ca2+ exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and α-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (ΔΨm), and matrix concentrations of Ca2+, NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca2+. The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca2+ dynamics, and respiratory control. Significant increases in oxygen consumption (VO2), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca2+, are obtained when the Ca2+-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca2+ plays an important role in matching energy supply with demand in cardiac myocytes. PMID:12668482

Biosynthesis of Taxadiene in Saccharomyces cerevisiae : Selection of Geranylgeranyl Diphosphate Synthase Directed by a Computer-Aided Docking Strategy

PubMed Central

Li, Lin-feng; Zhai, Fang; Shang, Lu-qing; Yin, Zheng; Yuan, Ying-jin

2014-01-01

Identification of efficient key enzymes in biosynthesis pathway and optimization of the fitness between functional modules and chassis are important for improving the production of target compounds. In this study, the taxadiene biosynthesis pathway was firstly constructed in yeast by transforming ts gene and overexpressing erg20 and thmgr. Then, the catalytic capabilities of six different geranylgeranyl diphosphate synthases (GGPPS), the key enzyme in mevalonic acid (MVA) pathway catalyzing famesyl diphosphate (FPP) to geranylgeranyl diphosphate (GGPP), were predicted using enzyme-substrate docking strategy. GGPPSs from Taxus baccata x Taxus cuspidate (GGPPSbc), Erwinia herbicola (GGPPSeh), and S. cerevisiae (GGPPSsc) which ranked 1st, 4th and 6th in docking with FPP were selected for construction. The experimental results were consistent with the computer prediction that the engineered yeast with GGPPSbc exhibited the highest production. In addition, two chassis YSG50 and W303-1A were chosen, and the titer of taxadiene reached 72.8 mg/L in chassis YSG50 with GGPPSbc. Metabolomic study revealed that the contents of tricarboxylic acid cycle (TCA) intermediates and their precursor amino acids in chassis YSG50 was lower than those in W303-1A, indicating less carbon flux was divided into TCA cycle. Furthermore, the levels of TCA intermediates in the taxadiene producing yeasts were lower than those in chassis YSG50. Thus, it may result in more carbon flux in MVA pathway in chassis YSG50, which suggested that YSG50 was more suitable for engineering the taxadiene producing yeast. These results indicated that computer-aided protein modeling directed isoenzyme selection strategy and metabolomic study could guide the rational design of terpenes biosynthetic cells. PMID:25295588

Fiat lux! Phylogeny and bioinformatics shed light on GABA functions in plants.

PubMed

Renault, Hugues

2013-06-01

The non-protein amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to a wide variety of environmental cues. Recent data point toward an involvement of GABA in tricarboxylic acid (TCA) cycle activity and respiration, especially in stressed roots. To gain further insights into potential GABA functions in plants, phylogenetic and bioinformatic approaches were undertaken. Phylogenetic reconstruction of the GABA transaminase (GABA-T) protein family revealed the monophyletic nature of plant GABA-Ts. However, this analysis also pointed to the common origin of several plant aminotransferases families, which were found more similar to plant GABA-Ts than yeast and human GABA-Ts. A computational analysis of AtGABA-T co-expressed genes was performed in roots and in stress conditions. This second approach uncovered a strong connection between GABA metabolism and glyoxylate cycle during stress. Both in silico analyses open new perspectives and hypotheses for GABA metabolic functions in plants.

Metabolic profiles of exercise in patients with McArdle disease or mitochondrial myopathy

PubMed Central

Sharma, Rohit; Tadvalkar, Laura; Clish, Clary B.; Haller, Ronald G.; Mootha, Vamsi K.

2017-01-01

McArdle disease and mitochondrial myopathy impair muscle oxidative phosphorylation (OXPHOS) by distinct mechanisms: the former by restricting oxidative substrate availability caused by blocked glycogen breakdown, the latter because of intrinsic respiratory chain defects. We applied metabolic profiling to systematically interrogate these disorders at rest, when muscle symptoms are typically minimal, and with exercise, when symptoms of premature fatigue and potential muscle injury are unmasked. At rest, patients with mitochondrial disease exhibit elevated lactate and reduced uridine; in McArdle disease purine nucleotide metabolites, including xanthine, hypoxanthine, and inosine are elevated. During exercise, glycolytic intermediates, TCA cycle intermediates, and pantothenate expand dramatically in both mitochondrial disease and control subjects. In contrast, in McArdle disease, these metabolites remain unchanged from rest; but urea cycle intermediates are increased, likely attributable to increased ammonia production as a result of exaggerated purine degradation. Our results establish skeletal muscle glycogen as the source of TCA cycle expansion that normally accompanies exercise and imply that impaired TCA cycle flux is a central mechanism of restricted oxidative capacity in this disorder. Finally, we report that resting levels of long-chain triacylglycerols in mitochondrial myopathy correlate with the severity of OXPHOS dysfunction, as indicated by the level of impaired O2 extraction from arterial blood during peak exercise. Our integrated analysis of exercise and metabolism provides unique insights into the biochemical basis of these muscle oxidative defects, with potential implications for their clinical management. PMID:28716914

Modelling urea-cycle disorder citrullinemia type 1 with disease-specific iPSCs.

PubMed

Yoshitoshi-Uebayashi, Elena Yukie; Toyoda, Taro; Yasuda, Katsutaro; Kotaka, Maki; Nomoto, Keiko; Okita, Keisuke; Yasuchika, Kentaro; Okamoto, Shinya; Takubo, Noriyuki; Nishikubo, Toshiya; Soga, Tomoyoshi; Uemoto, Shinji; Osafune, Kenji

2017-05-06

Citrullinemia type 1 (CTLN1) is a urea cycle disorder (UCD) caused by mutations of the ASS1 gene, which is responsible for production of the enzyme argininosuccinate synthetase (ASS), and classically presented as life-threatening hyperammonemia in newborns. Therapeutic options are limited, and neurological sequelae may persist. To understand the pathophysiology and find novel treatments, induced pluripotent stem cells (iPSCs) were generated from a CTLN1 patient and differentiated into hepatocyte-like cells (HLCs). CTLN1-HLCs have lower ureagenesis, recapitulating part of the patient's phenotype. l-arginine, an amino acid clinically used for UCD treatment, improved this phenotype in vitro. Metabolome analysis revealed an increase in tricarboxylic acid (TCA) cycle metabolites in CTLN1, suggesting a connection between CTLN1 and the TCA cycle. This CTLN1-iPSC model improves the understanding of CTLN1 pathophysiology and can be used to pursue new therapeutic approaches. Copyright © 2017 Elsevier Inc. All rights reserved.

Delineating potential epileptogenic areas utilizing resting functional magnetic resonance imaging (fMRI) in epilepsy patients.

PubMed

Pizarro, Ricardo; Nair, Veena; Meier, Timothy; Holdsworth, Ryan; Tunnell, Evelyn; Rutecki, Paul; Sillay, Karl; Meyerand, Mary E; Prabhakaran, Vivek

2016-08-01

Seizure localization includes neuroimaging like electroencephalogram, and magnetic resonance imaging (MRI) with limited ability to characterize the epileptogenic network. Temporal clustering analysis (TCA) characterizes epileptogenic network congruent with interictal epileptiform discharges by clustering together voxels with transient signals. We generated epileptogenic areas for 12 of 13 epilepsy patients with TCA, congruent with different areas of seizure onset. Resting functional MRI (fMRI) scans are noninvasive, and can be acquired quickly, in patients with different levels of severity and function. Analyzing resting fMRI data using TCA is quick and can complement clinical methods to characterize the epileptogenic network.

Oxaloacetate Ameliorates Chemical Liver Injury via Oxidative Stress Reduction and Enhancement of Bioenergetic Fluxes.

PubMed

Kuang, Ye; Han, Xiaoyun; Xu, Mu; Wang, Yue; Zhao, Yuxiang; Yang, Qing

2018-05-31

Chemical injury is partly due to free radical lipid peroxidation, which can induce oxidative stress and produce a large number of reactive oxygen species (ROS). Oxaloacetic acid is an important intermediary in the tricarboxylic acid cycle (TCA cycle) and participates in metabolism and energy production. In our study, we found that oxaloacetate (OA) effectively alleviated liver injury which was induced by hydrogen peroxide (H₂O₂) in vitro and carbon tetrachloride (CCl₄) in vivo. OA scavenged ROS, prevented oxidative damage and maintained the normal structure of mitochondria. We further confirmed that OA increased adenosine triphosphate (ATP) by promoting the TCA production cycle and oxidative phosphorylation (OXPHOS). Finally, OA inhibited the mitogen-activated protein kinase (MAPK) and apoptotic pathways by suppressing tumor necrosis factor-α (TNF-α). Our findings reveal a mechanism for OA ameliorating chemical liver injury and suggest a possible implementation for preventing the chemical liver injury.

Alveolate mitochondrial metabolic evolution: dinoflagellates force reassessment of the role of parasitism as a driver of change in apicomplexans.

PubMed

Danne, Jillian C; Gornik, Sebastian G; Macrae, James I; McConville, Malcolm J; Waller, Ross F

2013-01-01

Mitochondrial metabolism is central to the supply of ATP and numerous essential metabolites in most eukaryotic cells. Across eukaryotic diversity, however, there is evidence of much adaptation of the function of this organelle according to specific metabolic requirements and/or demands imposed by different environmental niches. This includes substantial loss or retailoring of mitochondrial function in many parasitic groups that occupy potentially nutrient-rich environments in their metazoan hosts. Infrakingdom Alveolata comprises a well-supported alliance of three disparate eukaryotic phyla-dinoflagellates, apicomplexans, and ciliates. These major taxa represent diverse lifestyles of free-living phototrophs, parasites, and predators and offer fertile territory for exploring character evolution in mitochondria. The mitochondria of apicomplexan parasites provide much evidence of loss or change of function from analysis of mitochondrial protein genes. Much less, however, is known of mitochondrial function in their closest relatives, the dinoflagellate algae. In this study, we have developed new models of mitochondrial metabolism in dinoflagellates based on gene predictions and stable isotope labeling experiments. These data show that many changes in mitochondrial gene content previously only known from apicomplexans are found in dinoflagellates also. For example, loss of the pyruvate dehydrogenase complex and changes in tricarboxylic acid (TCA) cycle enzyme complement are shared by both groups and, therefore, represent ancestral character states. Significantly, we show that these changes do not result in loss of typical TCA cycle activity fueled by pyruvate. Thus, dinoflagellate data show that many changes in alveolate mitochondrial metabolism are independent of the major lifestyle changes seen in these lineages and provide a revised view of mitochondria character evolution during evolution of parasitism in apicomplexans.

Methylcitrate cycle defines the bactericidal essentiality of isocitrate lyase for survival of Mycobacterium tuberculosis on fatty acids

PubMed Central

Eoh, Hyungjin; Rhee, Kyu Y.

2014-01-01

Few mutations attenuate Mycobacterium tuberculosis (Mtb) more profoundly than deletion of its isocitrate lyases (ICLs). However, the basis for this attenuation remains incompletely defined. Mtb’s ICLs are catalytically bifunctional isocitrate and methylisocitrate lyases required for growth on even and odd chain fatty acids. Here, we report that Mtb’s ICLs are essential for survival on both acetate and propionate because of its methylisocitrate lyase (MCL) activity. Lack of MCL activity converts Mtb’s methylcitrate cycle into a “dead end” pathway that sequesters tricarboxylic acid (TCA) cycle intermediates into methylcitrate cycle intermediates, depletes gluconeogenic precursors, and results in defects of membrane potential and intrabacterial pH. Activation of an alternative vitamin B12-dependent pathway of propionate metabolism led to selective corrections of TCA cycle activity, membrane potential, and intrabacterial pH that specifically restored survival, but not growth, of ICL-deficient Mtb metabolizing acetate or propionate. These results thus resolve the biochemical basis of essentiality for Mtb’s ICLs and survival on fatty acids. PMID:24639517

The Krebs Uric Acid Cycle: A Forgotten Krebs Cycle.

PubMed

Salway, Jack G

2018-05-25

Hans Kornberg wrote a paper entitled 'Krebs and his trinity of cycles' commenting that every school biology student knows of the Krebs cycle, but few know that Krebs discovered two other cycles. These are (i) the ornithine cycle (urea cycle), (ii) the citric acid cycle (tricarboxylic acid or TCA cycle), and (iii) the glyoxylate cycle that was described by Krebs and Kornberg. Ironically, Kornberg, codiscoverer of the 'glyoxylate cycle', overlooked a fourth Krebs cycle - (iv) the uric acid cycle. Copyright © 2018 Elsevier Ltd. All rights reserved.

Treatment of Functional Abdominal Pain With Antidepressants: Benefits, Adverse Effects, and the Gastroenterologist's Role.

PubMed

Zar-Kessler, Claire A M; Belkind-Gerson, Jaime; Bender, Suzanne; Kuo, Braden M

2017-07-01

Pediatric functional abdominal pain is often treated with tricyclic antidepressants (TCAs) and selective serotonin reuptake inhibitors (SSRIs). The aim is investigating antidepressant use for treatment efficacy, correlation of response to psychiatric factors, and impact of adverse effects in regard to physicians' prescribing patterns. Retrospective review (2005-2013) children (5-21 years old) with functional abdominal pain treated with SSRI or TCA. Of the 531 cases with functional abdominal pain, 192 initiated SSRIs or TCAs while followed by gastroenterology. Charts reviewed for symptoms, adverse effects, and response: decreased pain or increased daily functioning. Sixty-three of 84 (75%) SSRI patients improved, 56 of 92 (61%) TCA patients improved (P = 0.03). Logistic regression controlling for psychiatric factors: SSRI remained significant over TCA (P = 0.04). Thirty-two of 67 (48%) patients with constipation received TCAs and 26 of 45 (58%) patients with diarrhea received SSRIs (P = 0.64). Three SSRI patients reported gastrointestinal effects, all diarrheal-type symptoms, and 2 TCA patients reported gastrointestinal effects, both constipation, in all it led to discontinuation. Thirteen (29%) of diarrheal-type patients reported adverse effects causing discontinuation as compared to 7 (8%) in the constipation group (P = .01). Twenty-one (25%) SSRI patients reported adverse effects with 5 (6%) mood disturbances. Twenty (22%) TCA patients reported adverse effects, 13 (14%) with mood disturbances (P = .07). Overall, 12 (14%) SSRI patients discontinued medication due to adverse effects, whereas 16 (17%) TCA patients (P = 0.24) did. Patients had significantly greater response to SSRIs than TCAs, remaining significant after controlling for psychiatric factors. Little significance is given to patient's associated gastrointestinal symptoms, frequently resulting in adverse effects and termination of medication.

Integrated analysis of rice transcriptomic and metabolomic responses to elevated night temperatures identifies sensitivity- and tolerance-related profiles.

PubMed

Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen

2017-01-01

Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.

Distinct urine metabolome after Asian ginseng and American ginseng intervention based on GC-MS metabolomics approach

PubMed Central

Yang, Liu; Yu, Qing-Tao; Ge, Ya-Zhong; Zhang, Wen-Song; Fan, Yong; Ma, Chung-Wah; Liu, Qun; Qi, Lian-Wen

2016-01-01

Ginseng occupies a prominent position in the list of best-selling natural products worldwide. Asian ginseng (Panax ginseng) and American ginseng (Panax quinquefolius) show different properties and medicinal applications in pharmacology, even though the main active constituents of them are both thought to be ginsenosides. Metabolomics is a promising method to profile entire endogenous metabolites and monitor their fluctuations related to exogenous stimulus. Herein, an untargeted metabolomics approach was applied to study the overall urine metabolic differences between Asian ginseng and American ginseng in mice. Metabolomics analyses were performed using gas chromatography-mass spectrometry (GC-MS) together with multivariate statistical data analysis. A total of 21 metabolites related to D-glutamine and D-glutamate metabolism, glutathione metabolism, TCA cycle and glyoxylate and dicarboxylate metabolism, differed significantly under the Asian ginseng treatment; 34 metabolites mainly associated with glyoxylate and dicarboxylate metabolism, TCA cycle and taurine and hypotaurine metabolism, were significantly altered after American ginseng treatment. Urinary metabolomics reveal that Asian ginseng and American ginseng can benefit organism physiological and biological functions via regulating multiple metabolic pathways. The important pathways identified from Asian ginseng and American ginseng can also help to explore new therapeutic effects or action targets so as to broad application of these two ginsengs. PMID:27991533

Quantitative protein expression and cell surface characteristics of Escherichia coli MG1655 biofilms.

PubMed

Mukherjee, Joy; Ow, Saw Yen; Noirel, Josselin; Biggs, Catherine A

2011-02-01

Cell surface physicochemical characterization techniques were combined with quantitative changes in protein expression, to investigate the biological and biophysical changes of Escherichia coli MG1655 cells when grown as a biofilm (BIO). The overall surface charge of BIO cells was found to be less negative, highlighting the need for a lower electrophoretic mobility for attachment to occur. Comparison of the chemical functional groups on the cell surface showed similar profiles, with the absorbance intensity higher for proteins and carbohydrates in the BIO cells. Quantitative proteomic analysis demonstrated that 3 proteins were significantly increased, and 9 proteins significantly decreased in abundance, in cells grown as a BIO compared to their planktonic counterparts, with 7 of these total 12 proteins unique to this study. Proteins showing significant increased or decreased abundance include proteins involved in acid resistance, DNA protection and binding and ABC transporters. Further predictive analysis of the metabolic pathways showed an increased abundance of the amino acid metabolism and tricarboxylic acid (TCA) cycle, with a decrease in expression within the pentose phosphate and glycolysis pathways. It is therefore hypothesized that cells grown as a BIO are still energetically viable potentially using amino acids as an indirect carbon backbone source into the TCA cycle. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibitors of the alpha-ketoglutarate dehydrogenase complex alter [1-13C]glucose and [U-13C]glutamate metabolism in cerebellar granule neurons.

PubMed

Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula

2006-02-15

Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.

Metabolites Identified during Varied Doses of Aspergillus Species in Zea mays Grains, and Their Correlation with Aflatoxin Levels.

PubMed

Falade, Titilayo D O; Chrysanthopoulos, Panagiotis K; Hodson, Mark P; Sultanbawa, Yasmina; Fletcher, Mary; Darnell, Ross; Korie, Sam; Fox, Glen

2018-05-07

Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol ( R = 0.48) and turanose and ( R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity.

Antisense Inhibition of the Iron-Sulphur Subunit of Succinate Dehydrogenase Enhances Photosynthesis and Growth in Tomato via an Organic Acid–Mediated Effect on Stomatal Aperture[W][OA

PubMed Central

Araújo, Wagner L.; Nunes-Nesi, Adriano; Osorio, Sonia; Usadel, Björn; Fuentes, Daniela; Nagy, Réka; Balbo, Ilse; Lehmann, Martin; Studart-Witkowski, Claudia; Tohge, Takayuki; Martinoia, Enrico; Jordana, Xavier; DaMatta, Fábio M.; Fernie, Alisdair R.

2011-01-01

Transgenic tomato (Solanum lycopersicum) plants expressing a fragment of the Sl SDH2-2 gene encoding the iron sulfur subunit of the succinate dehydrogenase protein complex in the antisense orientation under the control of the 35S promoter exhibit an enhanced rate of photosynthesis. The rate of the tricarboxylic acid (TCA) cycle was reduced in these transformants, and there were changes in the levels of metabolites associated with the TCA cycle. Furthermore, in comparison to wild-type plants, carbon dioxide assimilation was enhanced by up to 25% in the transgenic plants under ambient conditions, and mature plants were characterized by an increased biomass. Analysis of additional photosynthetic parameters revealed that the rate of transpiration and stomatal conductance were markedly elevated in the transgenic plants. The transformants displayed a strongly enhanced assimilation rate under both ambient and suboptimal environmental conditions, as well as an elevated maximal stomatal aperture. By contrast, when the Sl SDH2-2 gene was repressed by antisense RNA in a guard cell–specific manner, changes in neither stomatal aperture nor photosynthesis were observed. The data obtained are discussed in the context of the role of TCA cycle intermediates both generally with respect to photosynthetic metabolism and specifically with respect to their role in the regulation of stomatal aperture. PMID:21307286

Skeletal muscle adaptation to fatty acid depends on coordinated actions of the PPARs and PGC1 alpha: implications for metabolic disease.

PubMed

Muoio, Deborah M; Koves, Timothy R

2007-10-01

Dyslipidemia and intramuscular accumulation of fatty acid metabolites are increasingly recognized as core features of obesity and type 2 diabetes. Emerging evidence suggests that normal physiological adaptations to a heavy lipid load depend on the coordinated actions of broad transcriptional regulators such as the peroxisome proliferator activated receptors (PPARs) and PPAR gamma coactivator 1 alpha (PGC1 alpha). The application of transcriptomics and targeted metabolic profiling tools based on mass spectrometry has led to our finding that lipid-induced insulin resistance is a condition in which upregulation of PPAR-targeted genes and high rates of beta-oxidation are not supported by a commensurate upregulation of tricarboxylic acid (TCA) cycle activity. In contrast, exercise training enhances mitochondrial performance, favoring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high-fat diet. The exercise-activated transcriptional coactivator, PGC1 alpha, plays a key role in coordinating metabolic flux through these 2 intersecting metabolic pathways, and its suppression by overfeeding may contribute to diet-induced mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from a mitochondrial disconnect between beta-oxidation and TCA cycle activity. Understanding of this "disconnect" and its molecular basis may lead to new therapeutic approaches to combatting metabolic disease.

Protein-bound NAD(P)H Lifetime is Sensitive to Multiple Fates of Glucose Carbon.

PubMed

Sharick, Joe T; Favreau, Peter F; Gillette, Amani A; Sdao, Sophia M; Merrins, Matthew J; Skala, Melissa C

2018-04-03

While NAD(P)H fluorescence lifetime imaging (FLIM) can detect changes in flux through the TCA cycle and electron transport chain (ETC), it remains unclear whether NAD(P)H FLIM is sensitive to other potential fates of glucose. Glucose carbon can be diverted from mitochondria by the pentose phosphate pathway (via glucose 6-phosphate dehydrogenase, G6PDH), lactate production (via lactate dehydrogenase, LDH), and rejection of carbon from the TCA cycle (via pyruvate dehydrogenase kinase, PDK), all of which can be upregulated in cancer cells. Here, we demonstrate that multiphoton NAD(P)H FLIM can be used to quantify the relative concentrations of recombinant LDH and malate dehydrogenase (MDH) in solution. In multiple epithelial cell lines, NAD(P)H FLIM was also sensitive to inhibition of LDH and PDK, as well as the directionality of LDH in cells forced to use pyruvate versus lactate as fuel sources. Among the parameters measurable by FLIM, only the lifetime of protein-bound NAD(P)H (τ 2 ) was sensitive to these changes, in contrast to the optical redox ratio, mean NAD(P)H lifetime, free NAD(P)H lifetime, or the relative amount of free and protein-bound NAD(P)H. NAD(P)H τ 2 offers the ability to non-invasively quantify diversions of carbon away from the TCA cycle/ETC, which may support mechanisms of drug resistance.

Oxaloacetate-to-malate conversion by mineral photoelectrochemistry: implications for the viability of the reductive tricarboxylic acid cycle in prebiotic chemistry

NASA Astrophysics Data System (ADS)

Guzman, Marcelo I.; Martin, Scot T.

2008-10-01

The carboxylic acids produced by the reductive tricarboxylic acid (rTCA) cycle are possibly a biosynthetic core of initial life, although several steps such as the reductive kinetics of oxaloacetate (OAA) to malate (MA) are problematic by conventional chemical routes. In this context, we studied the kinetics of this reaction as promoted by ZnS mineral photoelectrochemistry. The quantum efficiency φMA of MA production from the photoelectrochemical reduction of OAA followed φMA=0.13 [OAA] (2.1×10-3+[OAA])-1 and was independent of temperature (5 to 50°C). To evaluate the importance of this forward rate under a prebiotic scenario, we also studied the temperature-dependent rate of the backward thermal decarboxylation of OAA to pyruvate (PA), which followed an Arrhenius behavior as log (k-2)=11.74 4956/T, where k-2 is in units of s-1. These measured rates were employed in conjunction with the indirectly estimated carboxylation rate of PA to OAA to assess the possible importance of mineral photoelectrochemistry in the conversion of OAA to MA under several scenarios of prebiotic conditions on early Earth. As an example, our analysis shows that there is 90% efficiency with a forward velocity of 3 yr/cycle for the OAA→MA step of the rTCA cycle at 280 K. Efficiency and velocity both decrease for increasing temperature. These results suggest high viability for mineral photoelectrochemistry as an enzyme-free engine to drive the rTCA cycle through the early aeons of early Earth, at least for the investigated OAA→MA step.

Organic Acids: The Pools of Fixed Carbon Involved in Redox Regulation and Energy Balance in Higher Plants

PubMed Central

Igamberdiev, Abir U.; Eprintsev, Alexander T.

2016-01-01

Organic acids are synthesized in plants as a result of the incomplete oxidation of photosynthetic products and represent the stored pools of fixed carbon accumulated due to different transient times of conversion of carbon compounds in metabolic pathways. When redox level in the cell increases, e.g., in conditions of active photosynthesis, the tricarboxylic acid (TCA) cycle in mitochondria is transformed to a partial cycle supplying citrate for the synthesis of 2-oxoglutarate and glutamate (citrate valve), while malate is accumulated and participates in the redox balance in different cell compartments (via malate valve). This results in malate and citrate frequently being the most accumulated acids in plants. However, the intensity of reactions linked to the conversion of these compounds can cause preferential accumulation of other organic acids, e.g., fumarate or isocitrate, in higher concentrations than malate and citrate. The secondary reactions, associated with the central metabolic pathways, in particularly with the TCA cycle, result in accumulation of other organic acids that are derived from the intermediates of the cycle. They form the additional pools of fixed carbon and stabilize the TCA cycle. Trans-aconitate is formed from citrate or cis-aconitate, accumulation of hydroxycitrate can be linked to metabolism of 2-oxoglutarate, while 4-hydroxy-2-oxoglutarate can be formed from pyruvate and glyoxylate. Glyoxylate, a product of either glycolate oxidase or isocitrate lyase, can be converted to oxalate. Malonate is accumulated at high concentrations in legume plants. Organic acids play a role in plants in providing redox equilibrium, supporting ionic gradients on membranes, and acidification of the extracellular medium. PMID:27471516

Chemolithoautotrophy and its Relation to Magnetism and Biomineralization in Marine Magnetotactic Bacteria

NASA Astrophysics Data System (ADS)

Bazylinski, D. A.; Williams, T. J.; Zhang, C. L.; Scott, J. H.

2005-12-01

All cultured, marine, magnetite-producing, magnetotactic bacteria (MB) are capable of chemolithoautotrophy and use a number of electron donors to support this mode of growth including reduced sulfur compounds. Several vibrioid strains are known to rely on the Calvin-Benson-Bassham (CBB) cycle for autotrophy. An obligately microaerophilic, magnetite-producing, coccoid strain (MC-1) grew with sulfide and thiosulfate as electron donors and 14C-labelling experiments showed that virtually all cell C was derived from H14CO3-/14CO2 confirming autotrophy in this strain. Cell-free extracts of strain MC-1 did not exhibit ribulose-1,5-bisphosphate carboxylase-oxygenase (RubisCO) activity and nor were RubisCO genes found in the draft genome of the organism. Cell extracts also did not exhibit carbon monoxide dehydrogenase activity indicating that the acetyl-CoA pathway also does not function in strain MC-1. The 13C content of whole cells of strain MC-1 relative to the 13C content of the H14CO3-/14CO2 used for growth (Δδ13C) was -11.4 ppt. Cellular fatty acids showed enrichment of 13C relative to biomass. Activities for three key enzymes of the reverse or reductive tricarboxylic acid (rTCA) cycle were demonstrated for MC-1: fumarate reductase, pyruvate: acceptor oxidoreductase and 2-oxoglutarate: acceptor oxidoreductase. Although ATP citrate lyase (another key enzyme of the rTCA cycle) activity was not detected in cell-free extracts of strain MC-1 using commonly used assays for this enzyme, cell-free extract was found to rapidly cleave citrate, and the reaction was dependent upon the presence of ATP, coenzyme A and NADH. Thus, we infer the presence of an ATP-dependent citrate-cleaving enzyme or enzymes. The Δδ13C value and results from enzyme studies are consistent with the operation of the rTCA cycle for autotrophy in strain MC-1. Strain MC-1 appears to be the first known member of the alpha-Proteobacteria to assimilate CO2 during autotrophic growth using the rTCA cycle. Based on the type of chemolithoautotrophy described above, it is clear why marine magnetite-producing MB occupy a precise location, the oxic-anoxic interface, in vertical chemical gradients within chemically-stratified coastal environments: they must have an electron donor, sulfide and perhaps others, and an electron acceptor, O2. The presumed function of magnetosomes is that the magnetic dipole resulting from the magnetosomes aids the cell in locating and maintaining an optimal position within vertical chemical gradients. MB process large amounts of Fe in the biomineralization of magnetosomes: cells consist of 1-3% Fe (dry wt). Because of this, and the fact that many chemolithoautotrophic, non-magnetotactic bacteria occupy a similar niche, we have been investigating possible physiological reasons for the production of magnetosomes and the processing of such large amounts of Fe. We have found that some marine vibrioid strains grow in O2-gradient medium with Fe(II) as the electron donor. Cells appear to oxidize the Fe(II) and produce a layer of Fe oxyhydroxides within the gradient suggesting that cells obtain energy from the oxidation of Fe(II).

Metabonomics Indicates Inhibition of Fatty Acid Synthesis, β-Oxidation, and Tricarboxylic Acid Cycle in Triclocarban-Induced Cardiac Metabolic Alterations in Male Mice.

PubMed

Xie, Wenping; Zhang, Wenpeng; Ren, Juan; Li, Wentao; Zhou, Lili; Cui, Yuan; Chen, Huiming; Yu, Wenlian; Zhuang, Xiaomei; Zhang, Zhenqing; Shen, Guolin; Li, Haishan

2018-02-14

Triclocarban (TCC) has been identified as a new environmental pollutant that is potentially hazardous to human health; however, the effects of short-term TCC exposure on cardiac function are not known. The aim of this study was to use metabonomics and molecular biology techniques to systematically elucidate the molecular mechanisms of TCC-induced effects on cardiac function in mice. Our results show that TCC inhibited the uptake, synthesis, and oxidation of fatty acids, suppressed the tricarboxylic acid (TCA) cycle, and increased aerobic glycolysis levels in heart tissue after short-term TCC exposure. TCC also inhibited the nuclear peroxisome proliferator-activated receptor α (PPARα), confirming its inhibitory effects on fatty acid uptake and oxidation. Histopathology and other analyses further confirm that TCC altered mouse cardiac physiology and pathology, ultimately affecting normal cardiac metabolic function. We elucidate the molecular mechanisms of TCC-induced harmful effects on mouse cardiac metabolism and function from a new perspective, using metabonomics and bioinformatics analysis data.

The role of Pyruvate Dehydrogenase Complex in cardiovascular diseases.

PubMed

Sun, Wanqing; Liu, Quan; Leng, Jiyan; Zheng, Yang; Li, Ji

2015-01-15

The regulation of mammalian myocardial carbohydrate metabolism is complex; many factors such as arterial substrate and hormone levels, coronary flow, inotropic state and the nutritional status of the tissue play a role in regulating mammalian myocardial carbohydrate metabolism. The Pyruvate Dehydrogenase Complex (PDHc), a mitochondrial matrix multienzyme complex, plays an important role in energy homeostasis in the heart by providing the link between glycolysis and the tricarboxylic acid (TCA) cycle. In TCA cycle, PDHc catalyzes the conversion of pyruvate into acetyl-CoA. This review determines that there is altered cardiac glucose in various pathophysiological states consequently causing PDC to be altered. This review further summarizes evidence for the metabolism mechanism of the heart under normal and pathological conditions including ischemia, diabetes, hypertrophy and heart failure. Copyright © 2014 Elsevier Inc. All rights reserved.

PIK3CA mutant tumors depend on oxoglutarate dehydrogenase | Office of Cancer Genomics

Cancer.gov

Oncogenic PIK3CA mutations are found in a significant fraction of human cancers, but therapeutic inhibition of PI3K has only shown limited success in clinical trials. To understand how mutant PIK3CA contributes to cancer cell proliferation, we used genome scale loss-of-function screening in a large number of genomically annotated cancer cell lines. As expected, we found that PIK3CA mutant cancer cells require PIK3CA but also require the expression of the TCA cycle enzyme 2-oxoglutarate dehydrogenase (OGDH).

The odd-carbon medium-chain fatty triglyceride triheptanoin does not reduce hepatic steatosis.

PubMed

Comhair, Tine M; Garcia Caraballo, Sonia C; Dejong, Cornelis H C; Lamers, Wouter H; Koehler, S Eleonore

2017-02-01

Non-alcoholic fatty-liver disease (NAFLD) is the hepatic manifestation of the metabolic syndrome. Previously, we showed that a high-protein diet minimized diet-induced development of fatty liver and even reversed pre-existing steatosis. A high-protein diet leads to amino-acid catabolism, which in turn causes anaplerosis of the tricarboxylic-acid (TCA) cycle. Therefore, we hypothesized that anaplerosis of the TCA cycle could be responsible for the high-protein diet-induced improvement of NAFLD by channeling amino acids into the TCA cycle. Next we considered that an efficient anaplerotic agent, the odd-carbon medium-chain triglyceride triheptanoin (TH), might have similar beneficial effects. C57BL/6J mice were fed low-fat (8en%) or high-fat (42en%) oleate-containing diets with or without 15en% TH for 3 weeks. TH treatment enhanced the hepatic capacity for fatty-acid oxidation by a selective increase in hepatic Ppara, Acox, and Cd36 expression, and a decline in plasma acetyl-carnitines. It also induced pyruvate cycling through an increased hepatic PCK1 protein concentration and it increased thermogenesis reflected by an increased Ucp2 mRNA content. TH, however, did not reduce hepatic lipid content. The comparison of the present effects of dietary triheptanoin with a previous study by our group on protein supplementation shows that the beneficial effects of the high-protein diet are not mimicked by TH. This argues against anaplerosis as the sole explanatory mechanism for the anti-steatotic effect of a high-protein diet. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

The metabolic role of isoleucine in detoxification of ammonia in cultured mouse neurons and astrocytes.

PubMed

Johansen, Maja L; Bak, Lasse K; Schousboe, Arne; Iversen, Peter; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Gjedde, Albert; Ott, Peter; Waagepetersen, Helle S

2007-06-01

Cerebral hyperammonemia is a hallmark of hepatic encephalopathy, a debilitating condition arising secondary to liver disease. Pyruvate oxidation including tricarboxylic acid (TCA) cycle metabolism has been suggested to be inhibited by hyperammonemia at the pyruvate and alpha-ketoglutarate dehydrogenase steps. Catabolism of the branched-chain amino acid isoleucine provides both acetyl-CoA and succinyl-CoA, thus by-passing both the pyruvate dehydrogenase and the alpha-ketoglutarate dehydrogenase steps. Potentially, this will enable the TCA cycle to work in the face of ammonium-induced inhibition. In addition, this will provide the alpha-ketoglutarate carbon skeleton for glutamate and glutamine synthesis by glutamate dehydrogenase and glutamine synthetase (astrocytes only), respectively, both reactions fixing ammonium. Cultured cerebellar neurons (primarily glutamatergic) or astrocytes were incubated in the presence of either [U-13C]glucose (2.5 mM) and isoleucine (1 mM) or [U-13C]isoleucine and glucose. Cell cultures were treated with an acute ammonium chloride load of 2 (astrocytes) or 5 mM (neurons and astrocytes) and incorporation of 13C-label into glutamate, aspartate, glutamine and alanine was determined employing mass spectrometry. Labeling from [U-13C]glucose in glutamate and aspartate increased as a result of ammonium-treatment in both neurons and astrocytes, suggesting that the TCA cycle was not inhibited. Labeling in alanine increased in neurons but not in astrocytes, indicating elevated glycolysis in neurons. For both neurons and astrocytes, labeling from [U-13C]isoleucine entered glutamate and aspartate albeit to a lower extent than from [U-13C]glucose. Labeling in glutamate and aspartate from [U-13C]isoleucine was decreased by ammonium treatment in neurons but not in astrocytes, the former probably reflecting increased metabolism of unlabeled glucose. In astrocytes, ammonia treatment resulted in glutamine production and release to the medium, partially supported by catabolism of [U-13C]isoleucine. In conclusion, i) neuronal and astrocytic TCA cycle metabolism was not inhibited by ammonium and ii) isoleucine may provide the carbon skeleton for synthesis of glutamate/glutamine in the detoxification of ammonium.

Leukemia cells demonstrate a different metabolic perturbation provoked by 2-deoxyglucose.

PubMed

Miwa, Hiroshi; Shikami, Masato; Goto, Mineaki; Mizuno, Shohei; Takahashi, Miyuki; Tsunekawa-Imai, Norikazu; Ishikawa, Takamasa; Mizutani, Motonori; Horio, Tomohiro; Gotou, Mayuko; Yamamoto, Hidesuke; Wakabayashi, Motohiro; Watarai, Masaya; Hanamura, Ichiro; Imamura, Akira; Mihara, Hidetsugu; Nitta, Masakazu

2013-05-01

The shift in energy metabolism from oxidative phosphorylation to glycolysis can serve as a target for the inhibition of cancer growth. Here, we examined the metabolic changes induced by 2-deoxyglucose (2-DG), a glycolysis inhibitor, in leukemia cells by metabolome analysis. NB4 cells mainly utilized glucose as an energy source by glycolysis and oxidative phosphorylation in mitochondria, since metabolites in the glycolytic pathway and in the tricarboxylic acid (TCA) cycle were significantly decreased by 2-DG. In THP-1 cells, metabolites in the TCA cycle were not decreased to the same extent by 2-DG as in NB4 cells, which indicates that THP-1 utilizes energy sources other than glucose. TCA cycle metabolites in THP-1 cells may be derived from acetyl-CoA by fatty acid β-oxidation, which was supported by abundant detection of carnitine and acetylcarnitine in THP-1 cells. 2-DG treatment increased the levels of pentose phosphate pathway (PPP) metabolites and augmented the generation of NADPH by glucose-6-phosphate dehydrogenase. An increase in NADPH and upregulation of glutathione synthetase expression resulted in the increase in the reduced form of glutathione by 2-DG in NB4 cells. We demonstrated that a combination of 2-DG and inhibition of PPP by dehydroepiandrosterone (DHEA) effectively suppressed the growth of NB4 cells. The replenishment of the TCA cycle by fatty acid oxidation by carnitine palmitoyltransferase in THP-1 cells, treated by 2-DG, might be regulated by AMPK, as the combination of 2-DG and inhibition of AMPK by compound C potently suppressed the growth of THP-1 cells. Although 2-DG has been effective in preclinical and clinical studies, this treatment has not been fully explored due to concerns related to potential toxicities such as brain toxicity at high doses. We demonstrated that a combination of 2-DG and DHEA or compound C at a relatively low concentration effectively inhibits the growth of NB4 and THP-1 cells, respectively. These observations may aid in the identification of appropriate combinations of metabolic inhibitors at low concentrations which do not cause toxicities.

Dihydrolipoyl dehydrogenase as a potential UVB target in skin epidermis; using an integrated approach of label-free quantitative proteomics and targeted metabolite analysis.

PubMed

Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou

2015-03-18

Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified photobiological results from UVB-irradiated models and can elicit new diagnostic and treatment strategies based on altered metabolism. Copyright © 2015. Published by Elsevier B.V.

Triheptanoin Protects Motor Neurons and Delays the Onset of Motor Symptoms in a Mouse Model of Amyotrophic Lateral Sclerosis

PubMed Central

Barkl-Luke, Mallory E.; Ngo, Shyuan T.; Thomas, Nicola K.; McDonald, Tanya S.; Borges, Karin

2016-01-01

There is increasing evidence that energy metabolism is disturbed in Amyotrophic Lateral Sclerosis (ALS) patients and animal models. Treatment with triheptanoin, the triglyceride of heptanoate, is a promising approach to provide alternative fuel to improve oxidative phosphorylation and aid ATP generation. Heptanoate can be metabolized to propionyl-CoA, which after carboxylation can produce succinyl-CoA and thereby re-fill the tricarboxylic acid (TCA) cycle (anaplerosis). Here we tested the hypothesis that treatment with triheptanoin prevents motor neuron loss and delays the onset of disease symptoms in female mice overexpressing the mutant human SOD1G93A (hSOD1G93A) gene. When oral triheptanoin (35% of caloric content) was initiated at P35, motor neuron loss at 70 days of age was attenuated by 33%. In untreated hSOD1G93A mice, the loss of hind limb grip strength began at 16.7 weeks. Triheptanoin maintained hind limb grip strength for 2.8 weeks longer (p<0.01). Loss of balance on the rotarod and reduction of body weight were delayed by 13 and 11 days respectively (both p<0.01). Improved motor function occurred in parallel with alterations in the expression of genes associated with muscle metabolism. In gastrocnemius muscles, the mRNA levels of pyruvate, 2-oxoglutarate and succinate dehydrogenases and methyl-malonyl mutase were reduced by 24–33% in 10 week old hSOD1G93A mice when compared to wild-type mice, suggesting that TCA cycling in skeletal muscle may be slowed in this ALS mouse model at a stage when muscle strength is still normal. At 25 weeks of age, mRNA levels of succinate dehydrogenases, glutamic pyruvic transaminase 2 and the propionyl carboxylase β subunit were reduced by 69–84% in control, but not in triheptanoin treated hSOD1G93A animals. Taken together, our results suggest that triheptanoin slows motor neuron loss and the onset of motor symptoms in ALS mice by improving TCA cycling. PMID:27564703

Comparative transcriptome analysis reveals different molecular mechanisms of Bacillus coagulans 2-6 response to sodium lactate and calcium lactate during lactic acid production.

PubMed

Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping

2015-01-01

Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that 'ATP-binding cassette transporters' were significantly affected by calcium lactate stress, and 'amino sugar and nucleotide sugar metabolism' was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of 'glycolysis/gluconeogenesis' genes but positive effect on the expression of 'citrate cycle (TCA cycle)' genes. However, calcium lactate stress had positive influence on the expression of 'glycolysis/gluconeogenesis' genes and had minor influence on 'citrate cycle (TCA cycle)' genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cline, Gary W., E-mail: gary.cline@yale.edu; Department of Surgery, University of Minnesota-Twin Cities, Minneapolis, MN 55455; Pongratz, Rebecca L.

Highlights: Black-Right-Pointing-Pointer We studied media effects on mechanisms of insulin secretion of INS-1 cells. Black-Right-Pointing-Pointer Insulin secretion was higher in DMEM than KRB despite identical ATP synthesis rates. Black-Right-Pointing-Pointer Insulin secretion rates correlated with rates of anaplerosis and TCA cycle. Black-Right-Pointing-Pointer Mitochondria metabolism and substrate cycles augment secretion signal of ATP. -- Abstract: Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as amore » surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with {sup 31}P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by {sup 13}C NMR isotopomer analysis of the fate of [U-{sup 13}C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15 mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media.« less

Fiat lux!

PubMed Central

Renault, Hugues

2013-01-01

The non-protein amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to a wide variety of environmental cues. Recent data point toward an involvement of GABA in tricarboxylic acid (TCA) cycle activity and respiration, especially in stressed roots. To gain further insights into potential GABA functions in plants, phylogenetic and bioinformatic approaches were undertaken. Phylogenetic reconstruction of the GABA transaminase (GABA-T) protein family revealed the monophyletic nature of plant GABA-Ts. However, this analysis also pointed to the common origin of several plant aminotransferases families, which were found more similar to plant GABA-Ts than yeast and human GABA-Ts. A computational analysis of AtGABA-T co-expressed genes was performed in roots and in stress conditions. This second approach uncovered a strong connection between GABA metabolism and glyoxylate cycle during stress. Both in silico analyses open new perspectives and hypotheses for GABA metabolic functions in plants. PMID:23518583

Effect of tricarboxylic acid cycle regulator on carbon retention and organic component transformation during food waste composting.

PubMed

Lu, Qian; Zhao, Yue; Gao, Xintong; Wu, Junqiu; Zhou, Haixuan; Tang, Pengfei; Wei, Qingbin; Wei, Zimin

2018-05-01

Composting is an environment friendly method to recycling organic waste. However, with the increasing concern about greenhouse gases generated in global atmosphere, it is significant to reduce the emission of carbon dioxide (CO 2 ). This study analyzes tricarboxylic acid (TCA) cycle regulators on the effect of reducing CO 2 emission, and the relationship among organic component (OC) degradation and transformation and microorganism during composting. The results showed that adding adenosine tri-phosphate (ATP) and nicotinamide adenine dinucleotide (NADH) could enhance the transformation of OC and increase the diversity of microorganism community. Malonic acid (MA) as a competitive inhibitor could decrease the emission of CO 2 by inhibiting the TCA cycle. A structural equation model was established to explore effects of different OC and microorganism on humic acid (HA) concentration during composting. Furthermore, added MA provided an environmental benefit in reducing the greenhouse gas emission for manufacture sustainable products. Copyright © 2018 Elsevier Ltd. All rights reserved.

Lipid-induced metabolic dysfunction in skeletal muscle.

PubMed

Muoio, Deborah M; Koves, Timothy R

2007-01-01

Insulin resistance is a hallmark of type 2 diabetes and commonly observed in other energy-stressed settings such as obesity, starvation, inactivity and ageing. Dyslipidaemia and 'lipotoxicity'--tissue accumulation of lipid metabolites-are increasingly recognized as important drivers of insulin resistant states. Mounting evidence suggests that lipid-induced metabolic dysfunction in skeletal muscle is mediated in large part by stress-activated serine kinases that interfere with insulin signal transduction. However, the metabolic and molecular events that connect lipid oversupply to stress kinase activation and glucose intolerance are as yet unclear. Application of transcriptomics and targeted mass spectrometry-based metabolomics tools has led to our finding that insulin resistance is a condition in which muscle mitochondria are persistently burdened with a heavy lipid load. As a result, high rates of beta-oxidation outpace metabolic flux through the TCA cycle, leading to accumulation of incompletely oxidized acyl-carnitine intermediates. In contrast, exercise training enhances mitochondrial performance, favouring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high fat diet. The exercise-activated transcriptional co-activator, PGC1alpha, plays a key role in co-ordinating metabolic flux through these two intersecting metabolic pathways, and its suppression by overfeeding may contribute to obesity-associated mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from mitochondrial lipid stress and a resultant disconnect between beta-oxidation and TCA cycle activity. Understanding this 'disconnect' and its molecular basis may lead to new therapeutic targets for combating metabolic disease.

Glutamatergic and GABAergic neurotransmitter cycling and energy metabolism in rat cerebral cortex during postnatal development.

PubMed

Chowdhury, Golam M I; Patel, Anant B; Mason, Graeme F; Rothman, Douglas L; Behar, Kevin L

2007-12-01

The contribution of glutamatergic and gamma-aminobutyric acid (GABA)ergic neurons to oxidative energy metabolism and neurotransmission in the developing brain is not known. Glutamatergic and GABAergic fluxes were assessed in neocortex of postnatal day 10 (P10) and 30 (P30) urethane-anesthetized rats infused intravenously with [1,6-(13)C(2)]glucose for different time intervals (time course) or with [2-(13)C]acetate for 2 to 3 h (steady state). Amino acid levels and (13)C enrichments were determined in tissue extracts ex vivo using (1)H-[(13)C]-NMR spectroscopy. Metabolic fluxes were estimated from the best fits of a three-compartment metabolic model (glutamatergic neurons, GABAergic neurons, and astroglia) to the (13)C-enrichment time courses of amino acids from [1,6-(13)C(2)]glucose, constrained by the ratios of neurotransmitter cycling (V(cyc))-to-tricarboxylic acid (TCA) cycle flux (V(TCAn)) calculated from the steady-state [2-(13)C]acetate enrichment data. From P10 to P30 increases in total neuronal (glutamate plus GABA) TCA cycle flux (3 x ; 0.24+/-0.05 versus 0.71+/-0.07 micromol per g per min, P<0.0001) and total neurotransmitter cycling flux (3.1 to 5 x ; 0.07 to 0.11 (+/-0.03) versus 0.34+/-0.03 micromol per g per min, P<0.0001) were approximately proportional. Incremental changes in total cycling (DeltaV(cyc(tot))) and neuronal TCA cycle flux (DeltaV(TCAn(tot))) between P10 and P30 were 0.23 to 0.27 and 0.47 micromol per g per min, respectively, similar to the approximately 1:2 relationship previously reported for adult cortex. For the individual neurons, increases in V(TCAn) and V(cyc) were similar in magnitude (glutamatergic neurons, 2.7 x versus 2.8 to 4.6 x ; GABAergic neurons, approximately 5 x versus approximately 7 x), although GABAergic flux changes were larger. The findings show that glutamate and GABA neurons undergo large and approximately proportional increases in neurotransmitter cycling and oxidative energy metabolism during this major postnatal growth spurt.

Trichloroacetic Acid Versus Salicylic Acid in the Treatment of Acne Vulgaris in Dark-Skinned Patients.

PubMed

Abdel Meguid, Azza Mahfouz; Elaziz Ahmed Attallah, Dalia Abd; Omar, Howida

2015-12-01

Treatment options for acne include chemical peeling. Trichloroacetic acid (TCA) has been used for treating acne. The ability of TCA to diminish corneocyte cohesion and keratinocyte plugging addresses this mode of treatment. Salicylic acid is an excellent keratolytic agent. It is believed to function through solubilization of intercellular cement, thereby reducing corneocyte adhesion. Comparing the therapeutic efficacy of TCA 25% peels with those of salicylic acid 30% in patients with acne vulgaris. Twenty patients, Fitzpatrick skin Types III to V with facial acne, were enrolled. Twenty-five percent of TCA was applied to the right half of the face and 30% salicylic acid to the left half at 2-week interval for 2 months. Total improvement was more frequent with salicylic acid peeling (95%) versus (85%) with TCA. Total comedones improvement was more frequent with TCA peeling (80%) versus (70%) with salicylic acid. Improvement of inflammatory lesions was more frequent among the side treated with salicylic acid (85%) versus (80%) with TCA peeling. However, the results did not reach the statistical significance level. Trichloroacetic acid is more superior in treating comedonal lesions, whereas salicylic is more superior in treating inflammatory lesions, without significant different between their results.

Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate.

PubMed

Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H; Pedersen, Peter L; Goffeau, Andre; Ułaszewski, Stanisław

2016-03-01

In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Glucose enhances tilapia against Edwardsiella tarda infection through metabolome reprogramming.

PubMed

Zeng, Zao-hai; Du, Chao-Chao; Liu, Shi-Rao; Li, Hui; Peng, Xuan-Xian; Peng, Bo

2017-02-01

We have recently reported that the survival of tilapia, Oreochromis niloticus, during Edwardsiella tarda infection is tightly associated with their metabolome, where the survived O. niloticus has distinct metabolomic profile to dying O. niloticus. Glucose is the key metabolite to distinguish the survival- and dying-metabolome. More importantly, exogenous administration of glucose to the fish greatly enhances their survival for the infection, indicating the functional roles of glucose in metabolome repurposing, known as reprogramming metabolomics. However, the underlying information for the reprogramming is not yet available. Here, GC/MS based metabolomics is used to understand the mechanisms by which how exogenous glucose elevates O. niloticus, anti-infectious ability to E. tarda. Results showed that exogenous glucose promotes stearic acid and palmitic acid biosynthesis but attenuates TCA cycle to potentiate O. niloticus against bacterial infection, which is confirmed by the fact that exogenous stearic acid increases immune protection in O. niloticus against E. tarda infection in a manner of Mx protein. These results indicate that exogenous glucose reprograms O. niloticus anti-infective metabolome that characterizes elevation of stearic acid and palmitic acid and attenuation of the TCA cycle. Therefore, our results proposed a novel mechanism that glucose promotes unsaturated fatty acid biosynthesis to cope with infection, thereby highlighting a potential way of enhancing fish immunity in aquaculture. Copyright © 2016 Elsevier Ltd. All rights reserved.

Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate

PubMed Central

Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H.; Pedersen, Peter L.; Goffeau, Andre; Ułaszewski, Stanisław

2016-01-01

In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP. PMID:26862728

Brain mitochondrial metabolic dysfunction and glutamate level reduction in the pilocarpine model of temporal lobe epilepsy in mice

PubMed Central

Smeland, Olav B; Hadera, Mussie G; McDonald, Tanya S; Sonnewald, Ursula; Borges, Karin

2013-01-01

Although certain metabolic characteristics such as interictal glucose hypometabolism are well established for temporal lobe epilepsy (TLE), its pathogenesis still remains unclear. Here, we performed a comprehensive study of brain metabolism in a mouse model of TLE, induced by pilocarpine–status epilepticus (SE). To investigate glucose metabolism, we injected mice 3.5–4 weeks after SE with [1,2-13C]glucose before microwave fixation of the head. Using 1H and 13C nuclear magnetic resonance spectroscopy, gas chromatography—mass spectrometry and high-pressure liquid chromatography, we quantified metabolites and 13C labeling in extracts of cortex and hippocampal formation (HF). Hippocampal levels of glutamate, glutathione and alanine were decreased in pilocarpine–SE mice compared with controls. Moreover, the contents of N-acetyl aspartate, succinate and reduced nicotinamide adenine dinucleotide (phosphate) NAD(P)H were decreased in HF indicating impairment of mitochondrial function. In addition, the reduction in 13C enrichment of hippocampal citrate and malate suggests decreased tricarboxylic acid (TCA) cycle turnover in this region. In cortex, we found reduced 13C labeling of glutamate, glutamine and aspartate via the pyruvate carboxylation and pyruvate dehydrogenation pathways, suggesting slower turnover of these amino acids and/or the TCA cycle. In conclusion, mitochondrial metabolic dysfunction and altered amino-acid metabolism is found in both cortex and HF in this epilepsy model. PMID:23611869

Nutrient Dependence of RNase E Essentiality in Escherichia coli

PubMed Central

Tamura, Masaru; Moore, Christopher J.

2013-01-01

Escherichia coli cells normally require RNase E activity to form colonies (colony-forming ability [CFA]). The CFA-defective phenotype of cells lacking RNase E is partly reversed by overexpression of the related endoribonuclease RNase G or by mutation of the gene encoding the RNA helicase DeaD. We found that the carbon source utilization by rne deaD doubly mutant bacteria differs from that of rne+ cells and from that of cells mutated in deaD alone and that the loss of rne function in these bacteria limits conversion of the glycolytic pathway product phosphoenolpyruvate to the tricarboxylic acid (TCA) cycle intermediate oxaloacetic acid. We show that the mechanism underlying this effect is reduced production of the enzyme phosphoenolpyruvate carboxylase (PPC) and that adventitious overexpression of PPC, which facilitates phosphoenolpyruvate utilization and connects the glycolytic pathway with the TCA cycle, restored CFA to rne deaD mutant bacteria cultured on carbon sources that otherwise were unable to sustain growth. We further show that bacteria producing full-length RNase E, which allows formation of degradosomes, have nutritional requirements different from those of cells supplied with only the N-terminal catalytic region of RNase E and that mitigation of RNase E deficiency by overexpression of a related RNase, RNase G, is also affected by carbon source. Our results reveal previously unsuspected effects of RNase E deficiency and degradosome formation on nutrient utilization by E. coli cells. PMID:23275245

Dislocation Density Reduction in Cadmium Telluride and Mercury Cadmium Telluride Grown on Silicon Using Thermal Cycle Annealing

NASA Astrophysics Data System (ADS)

Farrell, Stuart Bennett

Mercury Cadmium Telluride (HgCdTe) is a material of great importance for infrared focal plane array applications. In order to produce large format detector arrays this material needs to be grown on a large area substrate, with silicon being the most mature substrate, it is the optimal choice for large format arrays. To help mitigate the effect of the lattice mismatch between the two materials, cadmium telluride (CdTe) is used as a buffer layer. The CdTe itself has nearly the same lattice mismatch (19.3%) to silicon, but due to the technological advantages it offers and compatibility with HgCdTe, it is the best buffer layer choice. The lattice mismatch between HgCdTe/CdTe and the silicon substrate leads to the formation of dislocations at densities in the mid 106 to low 107 cm-2 range in the epilayers. Such a high dislocation density greatly effects detector device performance quantities such as operability and sensitivity. Hence, the dislocation density should be brought down by at least an order of magnitude by adopting novel in situ and ex situ material processing techniques. In this work, in situ and ex situ thermal cycle annealing (TCA) methods have been used to decrease dislocation density in CdTe and HgCdTe. During the molecular beam epitaxial (MBE) growth of the CdTe buffer layer, the growth was interrupted and the layer was subjected to an annealing cycle within the growth chamber under tellurium overpressure. During the annealing cycle the temperature is raised to beyond the growth temperature (290 → 550 °C) and then allowed to cool before resuming growth again. This process was repeated several times during the growth. After growth, a portion of the material was subjected to a dislocation decoration etch in order to count the etch pit density (EPD) which has a direct correspondence with the dislocation density in the crystal. The crystalline quality was also characterized by x-ray diffraction rocking curves and photoluminescence. The in situ TCA resulted in almost a two order of magnitude reduction in the dislocation density, and factor of two reduction in the full width at half maximum of the x-ray rocking curves. Photoluminescence also suggested a decrease in the number of dislocations present in the material. This decrease is attributed to the movement of the dislocations during the annealing cycles and their subsequent interaction and annihilation. To decrease the dislocation density in HgCdTe layers grown on CdTe/Si composite substrates, ex situ TCA has been performed in a sealed quartz ampoule under a mercury overpressure in a conventional clam-shell furnace. The reduction in the dislocation density has been studied as a function of growth/annealing parameters such as the initial (as grown) dislocation density, buffer layer quality, Hg overpressure, annealing temperature, annealing duration, and the number of annealing cycles. It was found that the primary parameters that affect dislocation density reduction are the annealing temperature and the number of annealing cycles. Some secondary affects were observed by varying the duration spent at the maximum annealing temperature. Parameters such as the initial dislocation density and buffer layer quality did not play a significant role in dislocation reduction. Though no correlation between Hg overpressure and dislocation density was found, it did play a vital role in maintaining the quality of the surface. By using the ex situ TCA, a dislocation density of 1 x 106 cm-2 could be reliably and consistently achieved in HgCdTe layers that had a starting density ranging from 0.5 -- 3 x 107 cm-2. Examination of the annealing parameters revealed an exponential decay in the dislocation density as a function of increasing number of annealing cycles. In addition, a similar exponential decay was observed between the dislocation density and the annealing temperature. The decrease in the dislocation density is once again attributed to moving dislocations that interact and annihilate. This behavior was modeled using a second order reaction equation. It was found that the results of the model closely agreed with the experimental values for a wide range of annealing temperatures and number of annealing cycles.

The Aurora kinase A inhibitor TC-A2317 disrupts mitotic progression and inhibits cancer cell proliferation

PubMed Central

Min, Yoo Hong; Kim, Wootae; Kim, Ja-Eun

2016-01-01

Mitotic progression is crucial for the maintenance of chromosomal stability. A proper progression is ensured by the activities of multiple kinases. One of these enzymes, the serine/threonine kinase Aurora A, is required for proper mitosis through the regulation of centrosome and spindle assembly. In this study, we functionally characterized a newly developed Aurora kinase A inhibitor, TC-A2317. In human lung cancer cells, TC-A2317 slowed proliferation by causing aberrant formation of centrosome and microtubule spindles and prolonging the duration of mitosis. Abnormal mitotic progression led to accumulation of cells containing micronuclei or multinuclei. Furthermore, TC-A2317–treated cells underwent apoptosis, autophagy or senescence depending on cell type. In addition, TC-A2317 inactivated the spindle assembly checkpoint triggered by paclitaxel, thereby exacerbating mitotic catastrophe. Consistent with this, the expression level of Aurora A in tumors was inversely correlated with survival in lung cancer patients. Collectively, these data suggest that inhibition of Aurora kinase A using TC-A2317 is a promising target for anti-cancer therapeutics. PMID:27713168

Promysalin Elicits Species-Selective Inhibition of Pseudomonas aeruginosa by Targeting Succinate Dehydrogenase.

PubMed

Keohane, Colleen E; Steele, Andrew D; Fetzer, Christian; Khowsathit, Jittasak; Van Tyne, Daria; Moynié, Lucile; Gilmore, Michael S; Karanicolas, John; Sieber, Stephan A; Wuest, William M

2018-02-07

Natural products have served as an inspiration to scientists both for their complex three-dimensional architecture and exquisite biological activity. Promysalin is one such Pseudomonad secondary metabolite that exhibits narrow-spectrum antibacterial activity, originally isolated from the rhizosphere. We herein utilize affinity-based protein profiling (AfBPP) to identify succinate dehydrogenase (Sdh) as the biological target of the natural product. The target was further validated in silico, in vitro, in vivo, and through the selection, and sequencing, of a resistant mutant. Succinate dehydrogenase plays an essential role in primary metabolism of Pseudomonas aeruginosa as the only enzyme that is involved both in the tricarboxylic acid cycle (TCA) and in respiration via the electron transport chain. These findings add credence to other studies that suggest that the TCA cycle is an understudied target in the development of novel therapeutics to combat P. aeruginosa, a significant pathogen in clinical settings.

[Metabolic flux analysis of L-serine synthesis by Corynebacterium glutamicum SYPS-062].

PubMed

Zhang, Xiaomei; Dou, Wenfang; Xu, Hongyu; Xu, Zhenghong

2010-10-01

Corynebacterium glutamicum SYPS-062 was an L-serine producing strain stored at our lab and could produce L-serine directly from sugar. We studied the effects of cofactors in one carbon unit metabolism-folate and VB12 on the cell growth, sucrose consumption and L-serine production by SYPS-062. In the same time, the metabolic flux distribution was determined in different conditions. The supplementation of folate or VB12 enhanced the cell growth, energy synthesis, and finally increased the flux of pentose phosphate pathway (HMP), whereas the carbon flux to L-serine was decreased. The addition of VB12 not only increased the ratio of L-serine synthesis pathway on G3P joint, but also caused the insufficiency of tricarboxylic acid cycle (TCA) flux, which needed more anaplerotic reaction flux to replenish TCA cycle, that was an important limiting factor for the further increasing of the L-serine productivity.

SbnG, a Citrate Synthase in Staphylococcus aureus

PubMed Central

Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; Heinrichs, David E.; Murphy, Michael E. P.

2014-01-01

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. PMID:25336653

Deletion of the transcriptional coactivator PGC1α in skeletal muscles is associated with reduced expression of genes related to oxidative muscle function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hatazawa, Yukino; Research Fellow of Japan Society for the Promotion of Science, Tokyo; Minami, Kimiko

The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared withmore » that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α’s function in the oxidative energy metabolism of skeletal muscles. - Highlights: • Microarray analysis was performed in the skeletal muscle of PGC1α KO mice. • Expression of genes in the oxidative energy metabolism was decreased. • Bioinformatic analysis of promoter region of the genes predicted involvement of ERR. • PGC1α KO microarray data in this study show the mirror image of transgenic data.« less

Application of RNA Stable Isotope Probing (SIP) to Link Community Activity with Microorganisms Responsible for Autotrophy in the Subseafloor at Axial Seamount

NASA Astrophysics Data System (ADS)

Huber, J. A.; Fortunato, C. S.

2014-12-01

The global ocean comprises the Earth's largest biome, with microorganisms playing a dominant biogeochemical role. However, the potential for production of new microbial biomass within the subseafloor is rarely considered in traditional oceanographic paradigms of carbon cycling or microbial food webs. In this study, we used RNA Stable Isotope Probing (RNA SIP) to determine the microbial community composition and genetic repertoire of active subseafloor autotrophs in warm venting fluids from Axial Seamount. RNA is a responsive biomarker because it is a reflection of cellular activity independent of replication, and RNA SIP thus provides access to both the function of a microbial community and the phylogeny of the organisms accountable for key functions. Diffuse fluids were incubated shipboard at 30°C, 55°C, and 80°C with 13DIC and H2. Metatranscriptomic sequencing of both the enriched and non-enriched RNA was carried out from 13C and 12C controls. In addition, filtered fluid samples were preserved in situ for comparative meta -transcriptomic and -genomic analyses. Diverse lineages of bacteria and archaea and accompanying metabolisms were detected in situ, but RNA SIP results show dominance of three different groups of autotrophs active under each experimental condition. At 30°C, members of the Sulfurimonas genus dominated, with genes for hydrogen oxidation, nitrate reduction, and carbon fixation via the rTCA cycle highly expressed. At 55°C, both Caminibacter and Nautilia transcripts were detected for rTCA cycle, hydrogen oxidation, and nitrate reduction. At 80°C, transcripts for hydrogenotrophic methanogenesis mediated by members of Methanocaldococcus were detected. These results suggest the subseafloor hosts various anaerobic chemolithoautotrophs that span a wide temperature range, with hydrogen playing a key role in microbial metabolism. Complementary experiments are currently being carried out on the seafloor with a novel in situ incubator unit to provide further insights to primary productivity in the subseafloor.

Expression of long non-coding RNA-HOTAIR in oral squamous cell carcinoma Tca8113 cells and its associated biological behavior

PubMed Central

Liu, Huawei; Li, Zhiyong; Wang, Chao; Feng, Lin; Huang, Haitao; Liu, Changkui; Li, Fengxia

2016-01-01

As a long noncoding RNA, HOX transcript antisense intergenic RNA (HOTAIR) is highly expressed in many types of tumors. However, its expression and function in oral squamous cell carcinoma (OSCC) cells and tissues remains largely unknown. We herein studied the biological functions of HOTAIR in OSCC Tca8113 cells. Real-time quantitative PCR showed that HOTAIR, p21 and p53 mRNA expressions in doxorubicin (DOX)-treated or γ-ray-irradiated Tca8113 cells were up-regulated. Knockdown of p53 expression inhibited DOX-induced HOTAIR up-regulation, suggesting that DNA damage-induced HOTAIR expression may be associated with p53. Transfection and CCK-8 assays showed that compared with the control group, overexpression of HOTAIR promoted the proliferation of Tca8113 cells, while interfering with its expression played an opposite role. Flow cytometry exhibited that HOTAIR overexpression decreased the rate of DOX-induced apoptosis. When HOTAIR expression was inhibited by siRNA, the proportions of cells in G2/M and S phases increased and decreased respectively. Meanwhile, the rate of DOX-induced apoptosis rose. DNA damage-induced HOTAIR expression facilitated the proliferation of Tca8113 cells and decreased their apoptosis. However, whether the up-regulation depends on p53 still needs in-depth studies. PMID:27904675

Aerobic capacity and hepatic mitochondrial lipid oxidation alters susceptibility for chronic high-fat diet-induced hepatic steatosis.

PubMed

Morris, E Matthew; Meers, Grace M E; Koch, Lauren G; Britton, Steven L; Fletcher, Justin A; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C; Ibdah, Jamal A; Rector, R Scott; Thyfault, John P

2016-10-01

Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity.

Aerobic capacity and hepatic mitochondrial lipid oxidation alters susceptibility for chronic high-fat diet-induced hepatic steatosis

PubMed Central

Morris, E. Matthew; Meers, Grace M. E.; Koch, Lauren G.; Britton, Steven L.; Fletcher, Justin A.; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C.; Ibdah, Jamal A.; Rector, R. Scott

2016-01-01

Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity. PMID:27600823

Label-free fluorescent enzymatic assay of citrate synthase by CoA-Au(I) co-ordination polymer and its application in a multi-enzyme logic gate cascade.

PubMed

Li, Yong; Wang, Huixia; Dai, Futao; Li, Pei; Jin, Xin; Huang, Yan; Nie, Zhou; Yao, Shouzhuo

2016-12-15

Citrate synthase (CS) is one of the key metabolic enzymes in the Krebs tricarboxylic acid (TCA) cycle. It regulates energy generation in mitochondrial respiration by catalysing the reaction between oxaloacetic acid (OAA) and acetyl coenzyme A (Ac-CoA) to generate citrate and coenzyme A (CoA). CS has been shown to be a biomarker of neurological diseases and various kinds of cancers. Here, a label-free fluorescent assay has been developed for homogeneously detecting CS and its inhibitor based on the in situ generation of CoA-Au(I) co-ordination polymer (CP) and the fluorescence signal-on by SYBR Green II-stained CoA-Au(I) CP. Because of the unique property of the CoA-Au(I) CP, this CS activity assay method could achieve excellent selectivity and sensitivity, with a linear range from 0.0033 U/μL to 0.264 U/μL and a limit of detection to be 0.00165 U/μL. Meanwhile, this assay method has advantages of being facile and cost effective with quick detection. Moreover, based on this method, a biomimetic logic system was established by rationally exploiting the cascade enzymatic interactions in TCA cycle for chemical information processing. In the TCA cycle-derived logic system, an AND-AND-AND-cascaded gate was rigorously operated step by step in one pot, and is outputted by a label-free fluorescent signal with visualized readout. Copyright © 2016 Elsevier B.V. All rights reserved.

Inflammation promotes oral squamous carcinoma immune evasion via induced programmed death ligand-1 surface expression.

PubMed

Lu, Wanlu; Lu, Libing; Feng, Yun; Chen, Jiao; Li, Yan; Kong, Xiangli; Chen, Sixiu; Li, Xiaoyu; Chen, Qianming; Zhang, Ping

2013-05-01

The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8 + T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment.

Inflammation promotes oral squamous carcinoma immune evasion via induced programmed death ligand-1 surface expression

PubMed Central

LU, WANLU; LU, LIBING; FENG, YUN; CHEN, JIAO; LI, YAN; KONG, XIANGLI; CHEN, SIXIU; LI, XIAOYU; CHEN, QIANMING; ZHANG, PING

2013-01-01

The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8+ T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment PMID:23761816

The genome of Pelobacter carbinolicus reveals surprising metabolic capabilities and physiological features

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aklujkar, Muktak; Haveman, Shelley; DiDonatoJr, Raymond

2012-01-01

Background: The bacterium Pelobacter carbinolicus is able to grow by fermentation, syntrophic hydrogen/formate transfer, or electron transfer to sulfur from short-chain alcohols, hydrogen or formate; it does not oxidize acetate and is not known to ferment any sugars or grow autotrophically. The genome of P. carbinolicus was sequenced in order to understand its metabolic capabilities and physiological features in comparison with its relatives, acetate-oxidizing Geobacter species. Results: Pathways were predicted for catabolism of known substrates: 2,3-butanediol, acetoin, glycerol, 1,2-ethanediol, ethanolamine, choline and ethanol. Multiple isozymes of 2,3-butanediol dehydrogenase, ATP synthase and [FeFe]-hydrogenase were differentiated and assigned roles according to theirmore » structural properties and genomic contexts. The absence of asparagine synthetase and the presence of a mutant tRNA for asparagine encoded among RNA-active enzymes suggest that P. carbinolicus may make asparaginyl-tRNA in a novel way. Catabolic glutamate dehydrogenases were discovered, implying that the tricarboxylic acid (TCA) cycle can function catabolically. A phosphotransferase system for uptake of sugars was discovered, along with enzymes that function in 2,3-butanediol production. Pyruvate: ferredoxin/flavodoxin oxidoreductase was identified as a potential bottleneck in both the supply of oxaloacetate for oxidation of acetate by the TCA cycle and the connection of glycolysis to production of ethanol. The P. carbinolicus genome was found to encode autotransporters and various appendages, including three proteins with similarity to the geopilin of electroconductive nanowires. Conclusions: Several surprising metabolic capabilities and physiological features were predicted from the genome of P. carbinolicus, suggesting that it is more versatile than anticipated.« less

Glutamate is the major anaplerotic substrate in the tricarboxylic acid cycle of isolated rumen epithelial and duodenal mucosal cells from beef cattle

USDA-ARS?s Scientific Manuscript database

This study aimed to determine the contribution of substrates to tricarboxylic acid (TCA) cycle fluxes in rumen epithelial (REC) and duodenal mucosal (DMC) cells isolated from bulls (n = 6) fed either a 75% forage (HF) or 75% concentrate (HC) diet. In separate incubations, [13C6]glucose, [13C5]glutam...

Catabolism of α-Ketoglutarate by a sucA Mutant of Bradyrhizobium japonicum: Evidence for an Alternative Tricarboxylic Acid Cycle

PubMed Central

Green, Laura S.; Li, Youzhong; Emerich, David W.; Bergersen, Fraser J.; Day, David A.

2000-01-01

A complete tricarboxylic acid (TCA) cycle is generally considered necessary for energy production from the dicarboxylic acid substrates malate, succinate, and fumarate. However, a Bradyrhizobium japonicum sucA mutant that is missing α-ketoglutarate dehydrogenase is able to grow on malate as its sole source of carbon. This mutant also fixes nitrogen in symbiosis with soybean, where dicarboxylic acids are its principal carbon substrate. Using a flow chamber system to make direct measurements of oxygen consumption and ammonium excretion, we confirmed that bacteroids formed by the sucA mutant displayed wild-type rates of respiration and nitrogen fixation. Despite the absence of α-ketoglutarate dehydrogenase activity, whole cells of the mutant were able to decarboxylate α-[U-14C]ketoglutarate and [U-14C]glutamate at rates similar to those of wild-type B. japonicum, indicating that there was an alternative route for α-ketoglutarate catabolism. Because cell extracts from B. japonicum decarboxylated [U-14C]glutamate very slowly, the γ-aminobutyrate shunt is unlikely to be the pathway responsible for α-ketoglutarate catabolism in the mutant. In contrast, cell extracts from both the wild type and mutant showed a coenzyme A (CoA)-independent α-ketoglutarate decarboxylation activity. This activity was independent of pyridine nucleotides and was stimulated by thiamine PPi. Thin-layer chromatography showed that the product of α-ketoglutarate decarboxylation was succinic semialdehyde. The CoA-independent α-ketoglutarate decarboxylase, along with succinate semialdehyde dehydrogenase, may form an alternative pathway for α-ketoglutarate catabolism, and this pathway may enhance TCA cycle function during symbiotic nitrogen fixation. PMID:10781553

Analytic approximation for random muffin-tin alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mills, R.; Gray, L.J.; Kaplan, T.

1983-03-15

The methods introduced in a previous paper under the name of ''traveling-cluster approximation'' (TCA) are applied, in a multiple-scattering approach, to the case of a random muffin-tin substitutional alloy. This permits the iterative part of a self-consistent calculation to be carried out entirely in terms of on-the-energy-shell scattering amplitudes. Off-shell components of the mean resolvent, needed for the calculation of spectral functions, are obtained by standard methods involving single-site scattering wave functions. The single-site TCA is just the usual coherent-potential approximation, expressed in a form particularly suited for iteration. A fixed-point theorem is proved for the general t-matrix TCA, ensuringmore » convergence upon iteration to a unique self-consistent solution with the physically essential Herglotz properties.« less

Integrated metabolomic and proteomic analysis reveals systemic responses of Rubrivivax benzoatilyticus JA2 to aniline stress.

PubMed

Mujahid, Md; Prasuna, M Lakshmi; Sasikala, Ch; Ramana, Ch Venkata

2015-02-06

Aromatic amines are widely distributed in the environment and are major environmental pollutants. Although degradation of aromatic amines is well studied in bacteria, physiological adaptations and stress response to these toxic compounds is not yet fully understood. In the present study, systemic responses of Rubrivivax benzoatilyticus JA2 to aniline stress were deciphered using metabolite and iTRAQ-labeled protein profiling. Strain JA2 tolerated high concentrations of aniline (30 mM) with trace amounts of aniline being transformed to acetanilide. GC-MS metabolite profiling revealed aniline stress phenotype wherein amino acid, carbohydrate, fatty acid, nitrogen metabolisms, and TCA (tricarboxylic acid cycle) were modulated. Strain JA2 responded to aniline by remodeling the proteome, and cellular functions, such as signaling, transcription, translation, stress tolerance, transport and carbohydrate metabolism, were highly modulated. Key adaptive responses, such as transcription/translational changes, molecular chaperones to control protein folding, and efflux pumps implicated in solvent extrusion, were induced in response to aniline stress. Proteo-metabolomics indicated extensive rewiring of metabolism to aniline. TCA cycle and amino acid catabolism were down-regulated while gluconeogenesis and pentose phosphate pathways were up-regulated, leading to the synthesis of extracellular polymeric substances. Furthermore, increased saturated fatty acid ratios in membranes due to aniline stress suggest membrane adaptation. The present study thus indicates that strain JA2 employs multilayered responses: stress response, toxic compound tolerance, energy conservation, and metabolic rearrangements to aniline.

Phosphonate Analogs of 2-Oxoglutarate Perturb Metabolism and Gene Expression in Illuminated Arabidopsis Leaves

PubMed Central

Araújo, Wagner L.; Tohge, Takayuki; Nunes-Nesi, Adriano; Daloso, Danilo M.; Nimick, Mhairi; Krahnert, Ina; Bunik, Victoria I.; Moorhead, Greg B. G.; Fernie, Alisdair R.

2012-01-01

Although the role of the 2-oxoglutarate dehydrogenase complex (2-OGDHC) has previously been demonstrated in plant heterotrophic tissues its role in photosynthetically active tissues remains poorly understood. By using a combination of metabolite and transcript profiles we here investigated the function of 2-OGDHC in leaves of Arabidopsis thaliana via use of specific phosphonate inhibitors of the enzyme. Incubation of leaf disks with the inhibitors revealed that they produced the anticipated effects on the in situ enzyme activity. In vitro experiments revealed that succinyl phosphonate (SP) and a carboxy ethyl ester of SP are slow-binding inhibitors of the 2-OGDHC. Our results indicate that the reduced respiration rates are associated with changes in the regulation of metabolic and signaling pathways leading to an imbalance in carbon-nitrogen metabolism and cell homeostasis. The inducible alteration of primary metabolism was associated with altered expression of genes belonging to networks of amino acids, plant respiration, and sugar metabolism. In addition, by using isothermal titration calorimetry we excluded the possibility that the changes in gene expression resulted from an effect on 2-oxoglutarate (2OG) binding to the carbon/ATP sensing protein PII. We also demonstrated that the 2OG degradation by the 2-oxoglutarate dehydrogenase strongly influences the distribution of intermediates of the tricarboxylic acid (TCA) cycle and the GABA shunt. Our results indicate that the TCA cycle activity is clearly working in a non-cyclic manner upon 2-OGDHC inhibition during the light period. PMID:22876250

The contribution of ketone bodies to basal and activity-dependent neuronal oxidation in vivo.

PubMed

Chowdhury, Golam M I; Jiang, Lihong; Rothman, Douglas L; Behar, Kevin L

2014-07-01

The capacity of ketone bodies to replace glucose in support of neuronal function is unresolved. Here, we determined the contributions of glucose and ketone bodies to neocortical oxidative metabolism over a large range of brain activity in rats fasted 36 hours and infused intravenously with [2,4-(13)C₂]-D-β-hydroxybutyrate (BHB). Three animal groups and conditions were studied: awake ex vivo, pentobarbital-induced isoelectricity ex vivo, and halothane-anesthetized in vivo, the latter data reanalyzed from a recent study. Rates of neuronal acetyl-CoA oxidation from ketone bodies (V(acCoA-kbN)) and pyruvate (V(pdhN)), and the glutamate-glutamine cycle (V(cyc)) were determined by metabolic modeling of (13)C label trapped in major brain amino acid pools. V(acCoA-kbN) increased gradually with increasing activity, as compared with the steeper change in tricarboxylic acid (TCA) cycle rate (V(tcaN)), supporting a decreasing percentage of neuronal ketone oxidation: ∼100% (isoelectricity), 56% (halothane anesthesia), 36% (awake) with the BHB plasma levels achieved in our experiments (6 to 13 mM). In awake animals ketone oxidation reached saturation for blood levels >17 mM, accounting for 62% of neuronal substrate oxidation, the remainder (38%) provided by glucose. We conclude that ketone bodies present at sufficient concentration to saturate metabolism provides full support of basal (housekeeping) energy needs and up to approximately half of the activity-dependent oxidative needs of neurons.

Traveling-cluster approximation for uncorrelated amorphous systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sen, A.K.; Mills, R.; Kaplan, T.

1984-11-15

We have developed a formalism for including cluster effects in the one-electron Green's function for a positionally disordered (liquid or amorphous) system without any correlation among the scattering sites. This method is an extension of the technique known as the traveling-cluster approximation (TCA) originally obtained and applied to a substitutional alloy by Mills and Ratanavararaksa. We have also proved the appropriate fixed-point theorem, which guarantees, for a bounded local potential, that the self-consistent equations always converge upon iteration to a unique, Herglotz solution. To our knowledge, this is the only analytic theory for considering cluster effects. Furthermore, we have performedmore » some computer calculations in the pair TCA, for the model case of delta-function potentials on a one-dimensional random chain. These results have been compared with ''exact calculations'' (which, in principle, take into account all cluster effects) and with the coherent-potential approximation (CPA), which is the single-site TCA. The density of states for the pair TCA clearly shows some improvement over the CPA and yet, apparently, the pair approximation distorts some of the features of the exact results.« less

Concurrent planning and execution for a walking robot

NASA Astrophysics Data System (ADS)

Simmons, Reid

1990-07-01

The Planetary Rover project is developing the Ambler, a novel legged robot, and an autonomous software system for walking the Ambler over rough terrain. As part of the project, we have developed a system that integrates perception, planning, and real-time control to navigate a single leg of the robot through complex obstacle courses. The system is integrated using the Task Control Architecture (TCA), a general-purpose set of utilities for building and controlling distributed mobile robot systems. The walking system, as originally implemented, utilized a sequential sense-plan-act control cycle. This report describes efforts to improve the performance of the system by concurrently planning and executing steps. Concurrency was achieved by modifying the existing sequential system to utilize TCA features such as resource management, monitors, temporal constraints, and hierarchical task trees. Performance was increased in excess of 30 percent with only a relatively modest effort to convert and test the system. The results lend support to the utility of using TCA to develop complex mobile robot systems.

Metabolic Analysis of Adaptation to Short-Term Changes in Culture Conditions of the Marine Diatom Thalassiosira pseudonana

PubMed Central

Bromke, Mariusz A.; Giavalisco, Patrick; Willmitzer, Lothar; Hesse, Holger

2013-01-01

This report describes the metabolic and lipidomic profiling of 97 low-molecular weight compounds from the primary metabolism and 124 lipid compounds of the diatom Thalassiosira pseudonana. The metabolic profiles were created for diatoms perturbed for 24 hours with four different treatments: (I) removal of nitrogen, (II) lower iron concentration, (III) addition of sea salt, (IV) addition of carbonate to their growth media. Our results show that as early as 24 hours after nitrogen depletion significant qualitative and quantitative change in lipid composition as well as in the primary metabolism of Thalassiosira pseudonana occurs. So we can observe the accumulation of several storage lipids, namely triacylglycerides, and TCA cycle intermediates, of which citric acid increases more than 10-fold. These changes are positively correlated with expression of TCA enzymes genes. Next to the TCA cycle intermediates and storage lipid changes, we have observed decrease in N-containing lipids and primary metabolites such as amino acids. As a measure of counteracting nitrogen starvation, we have observed elevated expression levels of nitrogen uptake and amino acid biosynthetic genes. This indicates that diatoms can fast and efficiently adapt to changing environment by altering the metabolic fluxes and metabolite abundances. Especially, the accumulation of proline and the decrease of dimethylsulfoniopropionate suggest that the proline is the main osmoprotectant for the diatom in nitrogen rich conditions. PMID:23799147

Aqueous Extract of Black Maca Prevents Metabolism Disorder via Regulating the Glycolysis/Gluconeogenesis-TCA Cycle and PPARα Signaling Activation in Golden Hamsters Fed a High-Fat, High-Fructose Diet.

PubMed

Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen

2018-01-01

Maca ( Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo . Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm . Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2 , Fh , and Mdh2 . In addition, the lipid-lowering effects of AEM in boththe serum and liver may be partly related to PPARα signaling activation, including enhanced fatty acid β-oxidation and lipogenesis pathway inhibition. Together, our data demonstrated that AEM intervention significantly improved lipid and glucose metabolism disorder by regulating the glycolysis/gluconeogenesis-TCA cycle and by modulating gene expression levels involved in the PPARα signaling pathway.

Aqueous Extract of Black Maca Prevents Metabolism Disorder via Regulating the Glycolysis/Gluconeogenesis-TCA Cycle and PPARα Signaling Activation in Golden Hamsters Fed a High-Fat, High-Fructose Diet

PubMed Central

Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen

2018-01-01

Maca (Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo. Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm. Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2, Fh, and Mdh2. In addition, the lipid-lowering effects of AEM in boththe serum and liver may be partly related to PPARα signaling activation, including enhanced fatty acid β-oxidation and lipogenesis pathway inhibition. Together, our data demonstrated that AEM intervention significantly improved lipid and glucose metabolism disorder by regulating the glycolysis/gluconeogenesis-TCA cycle and by modulating gene expression levels involved in the PPARα signaling pathway. PMID:29681858

Triheptanoin for glucose transporter type I deficiency (G1D): Modulation of human ictogenesis, cerebral metabolic rate and cognitive indices by a food supplement

PubMed Central

Pascual, Juan M.; Liu, Peiying; Mao, Deng; Kelly, Dorothy; Hernandez, Ana; Sheng, Min; Good, Levi B.; Ma, Qian; Marin-Valencia, Isaac; Zhang, Xuchen; Park, Jason Y.; Hynan, Linda S.; Stavinoha, Peter; Roe, Charles R.; Lu, Hanzhang

2015-01-01

Objective G1D is commonly associated with electrographic spike-wave and - less-noticeably – with absence seizures. The G1D syndrome has long been attributed to energy (i.e., ATP-synthetic) failure, as have experimental, toxic-rodent epilepsies to impaired brain metabolism and tricarboxylic acid (TCA) cycle intermediate depletion. Indeed, a (seldom-acknowledged) function of glucose and other substrates is the generation of brain TCAs via carbon-donor reactions collectively named anaplerosis. However, TCAs are preserved in murine G1D. This renders inferences about energy failure premature and suggests a different hypothesis, also grounded on our findings, that consumption of alternate TCA precursors is stimulated, potentially detracting from other functions. Second, common ketogenic diets can ameliorate G1D seizures, but lead to a therapeutically-counterintuitive reduction in blood glucose available to the brain, and they can prove ineffective in 1/3 of cases. While developing G1D treatments, all of this motivated us to: a) uphold (rather than attenuate) the residual brain glucose flux that all G1D patients possess; and b) stimulate the TCA cycle, including anaplerosis. Therefore, we tested the medium-chain triglyceride triheptanoin, a widely-used medical food supplement that can fulfill both of these metabolic roles. The rationale is that ketone bodies derived from ketogenic diets are not anaplerotic, in contrast with triheptanoin metabolites, as we have shown in the G1D mouse brain. Design We supplemented the regular diet of a case series of G1D patients with food-grade triheptanoin. First we confirmed that, despite their frequent electroencephalographic (EEG) presence as spike-waves, most seizures are rarely visible, such that perceptions by patients or others are inadequate for treatment evaluation. Thus, we used EEG, quantitative neuropsychological, blood analytical, and MRI cerebral metabolic rate measurements as main outcomes. Setting Academic and unsponsored. Patients Fourteen G1D children and adults not receiving a ketogenic diet. Results Eleven patients tolerated triheptanoin without significant adverse effects. Spike-waves decreased robustly in all patients who manifested them. Additionally, neuropsychological performance and cerebral metabolic rate increased in most patients. Conclusions Triheptanoin can favorably influence cardinal aspects of neural function in G1D. Additionally, our outcome measures offer a framework for the evaluation of therapies for G1D and other encephalopathies associated with impaired intermediary metabolism. PMID:25110966

Quantitative assessment of brain glucose metabolic rates using in vivo deuterium magnetic resonance spectroscopy.

PubMed

Lu, Ming; Zhu, Xiao-Hong; Zhang, Yi; Mateescu, Gheorghe; Chen, Wei

2017-11-01

Quantitative assessment of cerebral glucose consumption rate (CMR glc ) and tricarboxylic acid cycle flux (V TCA ) is crucial for understanding neuroenergetics under physiopathological conditions. In this study, we report a novel in vivo Deuterium ( 2 H) MRS (DMRS) approach for simultaneously measuring and quantifying CMR glc and V TCA in rat brains at 16.4 Tesla. Following a brief infusion of deuterated glucose, dynamic changes of isotope-labeled glucose, glutamate/glutamine (Glx) and water contents in the brain can be robustly monitored from their well-resolved 2 H resonances. Dynamic DMRS glucose and Glx data were employed to determine CMR glc and V TCA concurrently. To test the sensitivity of this method in response to altered glucose metabolism, two brain conditions with different anesthetics were investigated. Increased CMR glc (0.46 vs. 0.28 µmol/g/min) and V TCA (0.96 vs. 0.6 µmol/g/min) were found in rats under morphine as compared to deeper anesthesia using 2% isoflurane. This study demonstrates the feasibility and new utility of the in vivo DMRS approach to assess cerebral glucose metabolic rates at high/ultrahigh field. It provides an alternative MRS tool for in vivo study of metabolic coupling relationship between aerobic and anaerobic glucose metabolisms in brain under physiopathological states.

Functionalization of carbon nanotubes with water-insoluble porphyrin in ionic liquid: direct electrochemistry and highly sensitive amperometric biosensing for trichloroacetic acid.

PubMed

Tu, Wenwen; Lei, Jianping; Ju, Huangxian

2009-01-01

A functional composite of single-walled carbon nanotubes (SWNTs) with hematin, a water-insoluble porphyrin, was first prepared in 1-butyl-3-methylimidazolium hexafluorophosphate ([BMIM][PF(6)]) ionic liquid. The novel composite in ionic liquid was characterized by scanning electron microscopy, ultraviolet absorption spectroscopy, and electrochemical impedance spectroscopy, and showed a pair of direct redox peaks of the Fe(III)/Fe(II) couple. The composite-[BMIM][PF(6)]-modified glassy carbon electrode showed excellent electrocatalytic activity toward the reduction of trichloroacetic acid (TCA) in neutral media due to the synergic effect among SWNTs, [BMIM][PF(6)], and porphyrin, which led to a highly sensitive and stable amperometric biosensor for TCA with a linear range from 9.0x10(-7) to 1.4x10(-4) M. The detection limit was 3.8x10(-7) M at a signal-to-noise ratio of 3. The TCA biosensor had good analytical performance, such as rapid response, good reproducibility, and acceptable accuracy, and could be successfully used for the detection of residual TCA in polluted water. The functional composite in ionic liquid provides a facile way to not only obtain the direct electrochemistry of water-insoluble porphyrin, but also construct novel biosensors for monitoring analytes in real environmental samples.

De novo Fatty Acid Biosynthesis Contributes Significantly to Establishment of a Bioenergetically Favorable Environment for Vaccinia Virus Infection

PubMed Central

Greseth, Matthew D.; Traktman, Paula

2014-01-01

The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in particular virion assembly, relies on the synthesis and mitochondrial import of fatty acids, where their β-oxidation drives robust ATP production. PMID:24651651

De novo fatty acid biosynthesis contributes significantly to establishment of a bioenergetically favorable environment for vaccinia virus infection.

PubMed

Greseth, Matthew D; Traktman, Paula

2014-03-01

The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in particular virion assembly, relies on the synthesis and mitochondrial import of fatty acids, where their β-oxidation drives robust ATP production.

Comparative Transcriptome Analysis Reveals Different Molecular Mechanisms of Bacillus coagulans 2-6 Response to Sodium Lactate and Calcium Lactate during Lactic Acid Production

PubMed Central

Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping

2015-01-01

Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that ‘ATP-binding cassette transporters’ were significantly affected by calcium lactate stress, and ‘amino sugar and nucleotide sugar metabolism’ was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of ‘glycolysis/gluconeogenesis’ genes but positive effect on the expression of ‘citrate cycle (TCA cycle)’ genes. However, calcium lactate stress had positive influence on the expression of ‘glycolysis/gluconeogenesis’ genes and had minor influence on ‘citrate cycle (TCA cycle)’ genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans. PMID:25875592

Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr.

PubMed

Datta, Prasun K; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C; Fecchio, Chiara; Barrero, Carlos A

2016-09-01

HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS.

Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr

PubMed Central

Datta, Prasun K.; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C.; Fecchio, Chiara; Barrero, Carlos A.

2016-01-01

ABSTRACT HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS. PMID:27245560

Anaerobic Respiration Using a Complete Oxidative TCA Cycle Drives Multicellular Swarming in Proteus mirabilis

PubMed Central

Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.

2012-01-01

ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869

The glyoxylate shunt is essential for CO2-requiring oligotrophic growth of Rhodococcus erythropolis N9T-4.

PubMed

Yano, Takanori; Yoshida, Nobuyuki; Yu, Fujio; Wakamatsu, Miki; Takagi, Hiroshi

2015-07-01

Rhodococcus erythropolis N9T-4 shows extremely oligotrophic growth requiring atmospheric CO2 and forms its colonies on an inorganic basal medium (BM) without any additional carbon source. Screening of a random mutation library constructed by a unique genome deletion method that we established indicated that the aceA, aceB, and pckG genes encoding isocitrate lyase, malate synthase, and phosphoenolpyruvate carboxykinase, respectively, were requisite for survival on BM plates. The aceA- and aceB deletion mutants and the pckG deletion mutant grew well on BM plates containing L-malate and D-glucose, respectively, suggesting that the glyoxylate (GO) shunt and gluconeogenesis are essential for the oligotrophic growth of N9T-4. Interestingly, most of the enzyme activities in the TCA cycle were observed in the cell-free extract of N9T-4, with perhaps the most important exception being α-ketoglutarate dehydrogenase (KGDH) activity. Instead of the KGDH activity, we detected a remarkable level of α-ketoglutarate decarboxylase (KGD) activity, which is the activity exhibited by the E1 component of the KGDH complex in Mycobacterium tuberculosis. The recombinant KGD of N9T-4 catalyzed the decarboxylation of α-ketoglutarate to form succinic semialdehyde (SSA) in a time-dependent manner. Since N9T-4 also showed a detectable SSA dehydrogenase activity, we concluded that N9T-4 possesses a variant TCA cycle, which uses SSA rather than succinyl-CoA. These results suggest that oligotrophic N9T-4 cells utilize the GO shunt to avoid the loss of carbons as CO2 and to conserve CoA units in the TCA cycle.

Revealing Differences in Metabolic Flux Distributions between a Mutant Strain and Its Parent Strain Gluconacetobacter xylinus CGMCC 2955

PubMed Central

Liu, Miao; Yang, Xiao-Ning; Zhu, Hui-Xia; Jia, Yuan-Yuan; Jia, Shi-Ru; Piergiovanni, Luciano

2014-01-01

A better understanding of metabolic fluxes is important for manipulating microbial metabolism toward desired end products, or away from undesirable by-products. A mutant strain, Gluconacetobacter xylinus AX2-16, was obtained by combined chemical mutation of the parent strain (G. xylinus CGMCC 2955) using DEC (diethyl sulfate) and LiCl. The highest bacterial cellulose production for this mutant was obtained at about 11.75 g/L, which was an increase of 62% compared with that by the parent strain. In contrast, gluconic acid (the main byproduct) concentration was only 5.71 g/L for mutant strain, which was 55.7% lower than that of parent strain. Metabolic flux analysis indicated that 40.1% of the carbon source was transformed to bacterial cellulose in mutant strain, compared with 24.2% for parent strain. Only 32.7% and 4.0% of the carbon source were converted into gluconic acid and acetic acid in mutant strain, compared with 58.5% and 9.5% of that in parent strain. In addition, a higher flux of tricarboxylic acid (TCA) cycle was obtained in mutant strain (57.0%) compared with parent strain (17.0%). It was also indicated from the flux analysis that more ATP was produced in mutant strain from pentose phosphate pathway (PPP) and TCA cycle. The enzymatic activity of succinate dehydrogenase (SDH), which is one of the key enzymes in TCA cycle, was 1.65-fold higher in mutant strain than that in parent strain at the end of culture. It was further validated by the measurement of ATPase that 3.53–6.41 fold higher enzymatic activity was obtained from mutant strain compared with parent strain. PMID:24901455

The TCA cycle is not required for selection or survival of multidrug-resistant Salmonella

PubMed Central

Ricci, Vito; Loman, Nick; Pallen, Mark; Ivens, Alasdair; Fookes, Maria; Langridge, Gemma C.; Wain, John; Piddock, Laura J. V.

2012-01-01

Objectives The initial aim of this study was to use a systems biology approach to analyse a ciprofloxacin-selected multidrug-resistant (MDR) Salmonella enterica serotype Typhimurium, L664. Methods The whole genome sequence and transcriptome of L664 were analysed. Site-directed mutagenesis to recreate each mutation was carried out, followed by phenotypic characterization and mutation frequency analysis. As a mutation in the TCA cycle was detected we tested the controversial hypothesis regarding the bacterial response to bactericidal antibiotics, put forward by Kohanski et al. (Cell 2007; 130: 797–810 and Mol Cell 2010; 37: 311–20), that exposure of bacteria to agents such as ciprofloxacin produces reactive oxygen species (ROS), which transiently increase the mutation rate giving rise to MDR bacteria. Results L664 contained a mutation in ramR that conferred MDR. A mutation in tctA affected the TCA cycle and conferred the inability to grow on minimal agar. The virulence of L664 was not attenuated. Ciprofloxacin exposure produced ROS in L664 and SL1344 (tctA::aph), but it was reduced and occurred later. There were no significant differences in the rates of killing or mutations per generation to antibiotic resistance between the strains. Conclusions Whilst we confirm production of ROS in response to ciprofloxacin, we have no data to support the hypothesis that this leads to selection of MDR strains. Our results indicate that the mutations in tctA and glgA were random as they did not pre-exist in the parental strain, and that the mutation in tctA did not provide a survival advantage or disadvantage in the presence of antibiotic. PMID:22186876

Contribution of the tricarboxylic acid (TCA) cycle and the glyoxylate shunt in Saccharomyces cerevisiae to succinic acid production during dough fermentation.

PubMed

Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M

2015-07-02

Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.

The depressed central carbon and energy metabolisms is associated to the acquisition of levofloxacin resistance in Vibrio alginolyticus.

PubMed

Cheng, Zhi-Xue; Yang, Man-Jun; Peng, Bo; Peng, Xuan-Xian; Lin, Xiang-Min; Li, Hui

2018-06-15

The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. It is especially required to understand for the mechanism of antibiotic resistance to control antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus with the most advanced iTRAQ quantitative proteomics technology. A total of 160 proteins of differential abundance were identified, where 70 were decreased and 90 were increased. Further analysis demonstrated that crucial metabolic pathways like TCA cycle were significantly down-regulated. qRT-PCR analysis demonstrated the decreased gene expression of glycolysis/gluconeogenesis, the TCA cycle, and fatty acid biosynthesis. Moreover, Na(+)-NQR complex gene expression, membrane potential and the adenylate energy charge ratio were decreased, indicating that the decreased central carbon metabolism is associated to the acquisition of levofloxacin resistance. Therefore, the reduced central carbon and energy metabolisms form a characteristic feature as fitness costs of V. alginolyticus in resistance to levofloxacin. The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. Understanding for the antibiotic resistance mechanisms is especially required to control these antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus using the most advanced iTRAQ quantitative proteomics technology. A total of 160 differential abundance of proteins were identified with 70 decreases and 90 increases by liquid chromatography matrix assisted laser desorption ionization mass spectrometry. Most interestingly, crucial metabolic pathways such as the TCA cycle sharply fluctuated. This is the first report that the reduced central carbon and energy metabolisms form a characteristic feature as a mechanism of V. alginolyticus in resistance to levofloxacin. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparative Analysis of the Mitochondrial Physiology of Pancreatic β Cells

PubMed Central

Kim, Chul; Patel, Pinal; Gouvin, Lindsey M.; Brown, Melissa L.; Khalil, Ahmed; Henchey, Elizabeth M; Heuck, Alejandro P.; Yadava, Nagendra

2014-01-01

The mitochondrial metabolism of β cells is thought to be highly specialized. Its direct comparison with other cells using isolated mitochondria is limited by the availability of islets/β cells in sufficient quantity. In this study, we have compared mitochondrial metabolism of INS1E/β cells with other cells in intact and permeabilized states. To selectively permeabilize the plasma membrane, we have evaluated the use of perfringolysin-O (PFO) in conjunction with microplate-based respirometry. PFO is a protein that binds membranes based on a threshold level of active cholesterol. Therefore, unless active cholesterol reaches a threshold level in mitochondria, they are expected to remain untouched by PFO. Cytochrome c sensitivity tests showed that in PFO-permeabilized cells, the mitochondrial integrity was completely preserved. Our data show that a time-dependent decline of the oligomycin-insensitive respiration observed in INS1E cells was due to a limitation in substrate supply to the respiratory chain. We predict that it is linked with the β cell-specific metabolism involving metabolites shuttling between the cytoplasm and mitochondria. In permeabilized β cells, the Complex l-dependent respiration was either transient or absent because of the inefficient TCA cycle. The TCA cycle insufficiency was confirmed by analysis of the CO2 evolution. This may be linked with lower levels of NAD+, which is required as a co-factor for CO2 producing reactions of the TCA cycle. β cells showed comparable OxPhos and respiratory capacities that were not affected by the inorganic phosphate (Pi) levels in the respiration medium. They showed lower ADP-stimulation of the respiration on different substrates. We believe that this study will significantly enhance our understanding of the β cell mitochondrial metabolism. PMID:25309834

Comparison of Optimal Thermodynamic Models of the Tricarboxylic Acid Cycle from Heterotrophs, Cyanobacteria, and Green Sulfur Bacteria.

PubMed

Thomas, Dennis G; Jaramillo-Riveri, Sebastian; Baxter, Douglas J; Cannon, William R

2014-12-26

We have applied a new stochastic simulation approach to predict the metabolite levels, material flux, and thermodynamic profiles of the oxidative TCA cycles found in E. coli and Synechococcus sp. PCC 7002, and in the reductive TCA cycle typical of chemolithoautotrophs and phototrophic green sulfur bacteria such as Chlorobaculum tepidum. The simulation approach is based on modeling states using statistical thermodynamics and employs an assumption similar to that used in transition state theory. The ability to evaluate the thermodynamics of metabolic pathways allows one to understand the relationship between coupling of energy and material gradients in the environment and the self-organization of stable biological systems, and it is shown that each cycle operates in the direction expected due to its environmental niche. The simulations predict changes in metabolite levels and flux in response to changes in cofactor concentrations that would be hard to predict without an elaborate model based on the law of mass action. In fact, we show that a thermodynamically unfavorable reaction can still have flux in the forward direction when it is part of a reaction network. The ability to predict metabolite levels, energy flow, and material flux should be significant for understanding the dynamics of natural systems and for understanding principles for engineering organisms for production of specialty chemicals.

The polyamines of Xanthium strumarium and their response to photoperiod.

PubMed

Hamasaki, N; Galston, A W

1990-01-01

Flowering plants of Xanthium strumarium L., grown in 8 h photoperiods, were analysed for polyamines. Putrescine, spermidine and spermine were found throughout the plant in three forms: (a) as free polyamines; (b) conjugates soluble in 5% trichloracetic acid (TCA); and (c) bound to the TCA-insoluble precipitate. On a fresh weight basis, total polyamines are most abundant in young leaves and buds, especially flower buds. Spermidine predominates in the free polyamine fractions, while spermine is dominant in the conjugated fraction. Transfer of vegetative plants from 16 h photoperiods to 1, 2, 3, or 4 inductive cycles (8 h light + 16 h uninterrupted dark) caused rapid and marked changes in the polyamine titer of the leaves and ultimately, floral initiation. The titer of free putrescine per mg protein declined progressively with induction in all leaf sizes, while the titers of free spermidine and spermine rose during days 2 and 3 in small and expanding leaves. Conjugated putrescine, spermidine and spermine rose sharply after only 1 inductive cycle, especially in small and expanding leaves, and maintained the higher level for at least several cycles. In plants given 4 inductive cycles, buds harvested after 4 additional days had sharply elevated levels of conjugated polyamines, especially spermine, on a protein basis.

Reduced expression of fumarate hydratase in clear cell renal cancer mediates HIF-2α accumulation and promotes migration and invasion.

PubMed

Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen

2011-01-01

Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.

Global Molecular Analyses of Methane Metabolism in Methanotrophic Alphaproteobacterium, Methylosinus trichosporium OB3b. Part I: Transcriptomic Study

PubMed Central

Matsen, Janet B.; Yang, Song; Stein, Lisa Y.; Beck, David; Kalyuzhnaya, Marina G.

2013-01-01

Methane utilizing bacteria (methanotrophs) are important in both environmental and biotechnological applications, due to their ability to convert methane to multicarbon compounds. However, systems-level studies of methane metabolism have not been carried out in methanotrophs. In this work we have integrated genomic and transcriptomic information to provide an overview of central metabolic pathways for methane utilization in Methylosinus trichosporium OB3b, a model alphaproteobacterial methanotroph. Particulate methane monooxygenase, PQQ-dependent methanol dehydrogenase, the H4MPT-pathway, and NAD-dependent formate dehydrogenase are involved in methane oxidation to CO2. All genes essential for operation of the serine cycle, the ethylmalonyl-CoA (EMC) pathway, and the citric acid (TCA) cycle were expressed. PEP-pyruvate-oxaloacetate interconversions may have a function in regulation and balancing carbon between the serine cycle and the EMC pathway. A set of transaminases may contribute to carbon partitioning between the pathways. Metabolic pathways for acquisition and/or assimilation of nitrogen and iron are discussed. PMID:23565111

Butyrate induces apoptosis by activating PDC and inhibiting complex I through SIRT3 inactivation.

PubMed

Xu, Sha; Liu, Cai-Xia; Xu, Wei; Huang, Lei; Zhao, Jian-Yuan; Zhao, Shi-Min

2017-01-01

The underlying anticancer effects of butyrate, an end-product of the intestinal microbial fermentation of dietary fiber, remain elusive. Here, we report that butyrate promotes cancer cell apoptosis by acting as a SIRT3 inhibitor. Butyrate inhibits SIRT3 both in cultured cells and in vitro . Butyrate-induced PDHA1 hyperacetylation relieves the inhibitory phosphorylation of PDHA1 at serine 293, thereby activating an influx of glycolytic intermediates into the tricarboxylic acid (TCA) cycle and reversing the Warburg effect. Meanwhile, butyrate-induced hyperacetylation inactivates complex I of the electron transfer chain and prevents the utilization of TCA cycle intermediates. These metabolic stresses promote apoptosis in hyperglycolytic cancer cells, such as HCT116 p53 -/- cells. SIRT3 deacetylates both PDHA1 and complex I. Genetic ablation of Sirt3 in mouse hepatocytes abrogated the ability of butyrate to induce apoptosis. Our results identify a butyrate-mediated anti-tumor mechanism and indicate that the combined activation of PDC and inhibition of complex I is a novel tumor treatment strategy.

SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less

Potential hepatic toxicity of buprofezin at sublethal concentrations: ROS-mediated conversion of energy metabolism.

PubMed

Ji, Xiaotong; Ku, Tingting; Zhu, Na; Ning, Xia; Wei, Wei; Li, Guangke; Sang, Nan

2016-12-15

Buprofezin is known for its broad-spectrum action and environmental safety. The popularity of buprofezin has raised concerns about its potentially adverse effects on human health and risk to the environment. In this study, we first identified the liver as one of the major organs in which buprofezin accumulated, and we detected a severe oxidative stress response. Next, we demonstrated that sublethal concentrations of buprofezin promoted the conversion of energy metabolism from the aerobic tricarboxylic acid (TCA) cycle and oxidative phosphorylation to anaerobic glycolysis. Importantly, reactive oxygen species (ROS) generation partially accounted for the shunting of the energy metabolism through the buprofezin-mediated inhibition of cytochrome c oxidase activity. ROS directly perturbed the activities of several key TCA cycle enzymes, stimulated glycolysis, and indirectly disturbed the activity of the respiratory chain complex by altering mitochondrial DNA (mtDNA). These findings clarify the potential mechanisms of buprofezin toxicity and provide biomarkers for buprofezin-mediated hepatotoxicity at sublethal concentrations. Copyright © 2016 Elsevier B.V. All rights reserved.

Index markers of chronic fatigue syndrome with dysfunction of TCA and urea cycles

PubMed Central

Yamano, Emi; Sugimoto, Masahiro; Hirayama, Akiyoshi; Kume, Satoshi; Yamato, Masanori; Jin, Guanghua; Tajima, Seiki; Goda, Nobuhito; Iwai, Kazuhiro; Fukuda, Sanae; Yamaguti, Kouzi; Kuratsune, Hirohiko; Soga, Tomoyoshi; Watanabe, Yasuyoshi; Kataoka, Yosky

2016-01-01

Chronic fatigue syndrome (CFS) is a persistent and unexplained pathological state characterized by exertional and severely debilitating fatigue, with/without infectious or neuropsychiatric symptoms, lasting at least 6 consecutive months. Its pathogenesis remains incompletely understood. Here, we performed comprehensive metabolomic analyses of 133 plasma samples obtained from CFS patients and healthy controls to establish an objective diagnosis of CFS. CFS patients exhibited significant differences in intermediate metabolite concentrations in the tricarboxylic acid (TCA) and urea cycles. The combination of ornithine/citrulline and pyruvate/isocitrate ratios discriminated CFS patients from healthy controls, yielding area under the receiver operating characteristic curve values of 0.801 (95% confidential interval [CI]: 0.711–0.890, P < 0.0001) and 0.750 (95% CI: 0.584–0.916, P = 0.0069) for training (n = 93) and validation (n = 40) datasets, respectively. These findings provide compelling evidence that a clinical diagnostic tool could be developed for CFS based on the ratios of metabolites in plasma. PMID:27725700

Excessive Hepatic Mitochondrial TCA Cycle and Gluconeogenesis in Humans with Nonalcoholic Fatty Liver Disease

PubMed Central

Sunny, Nishanth E.; Parks, Elizabeth J.; Browning, Jeffrey D.; Burgess, Shawn C.

2013-01-01

Summary Approximately one-third of the U.S. population has nonalcoholic fatty liver disease (NAFLD), a condition closely associated with insulin resistance and increased risk of liver injury. Dysregulated mitochondrial metabolism is central in these disorders, but the manner and degree of dysregulation are disputed. This study tested whether humans with NAFLD have abnormal in vivo hepatic mitochondrial metabolism. Subjects with low (3.0%) and high (17%) intrahepatic triglyceride (IHTG) were studied using 2H and 13C tracers to evaluate systemic lipolysis, hepatic glucose production, and mitochondrial pathways (TCA cycle, anaplerosis, and ketogenesis). Individuals with NAFLD had 50% higher rates of lipolysis and 30% higher rates of gluconeogenesis. There was a positive correlation between IHTG content and both mitochondrial oxidative and anaplerotic fluxes. These data indicate that mitochondrial oxidative metabolism is ∼2-fold greater in those with NAFLD, providing a potential link between IHTG content, oxidative stress, and liver damage. PMID:22152305

SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme

DOE PAGES

Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; ...

2014-10-21

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less

SbnG, a citrate synthase in Staphylococcus aureus: a new fold on an old enzyme.

PubMed

Kobylarz, Marek J; Grigg, Jason C; Sheldon, Jessica R; Heinrichs, David E; Murphy, Michael E P

2014-12-05

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

The problem of 2,4,6-trichloroanisole in cork planks studied by attenuated total reflection infrared spectroscopy: proof of concept.

PubMed

Garcia, Ana R; Lopes, Luís F; Brito de Barros, Ricardo; Ilharco, Laura M

2015-01-14

Attenuated total reflection infrared spectroscopy (ATR-IR) proved to be a promising detection technique for 2,4,6-trichloroanisole (TCA), which confers organoleptic defects to bottled alcoholic beverages, allowing the proposal of a criterion for cork plank acceptance when meant for stopper production. By analysis of a significant number of samples, it was proved that the presence of TCA, even in very low concentrations, imparts subtle changes to the cork spectra, namely, the growth of two new bands at ∼1417 (νC═C of TCA ring) and 1314 cm–1 (a shifted νCC of TCA) and an increase in the relative intensities of the bands at ∼1039 cm–1 (δCO of polysaccharides) and ∼813 cm–1 (τCH of suberin), the latter by overlapping with intense bands of TCA. These relative intensities were evaluated in comparison to a fingerprint of suberin (νasC–O–C), at 1161 cm–1. On the basis of those spectral variables, a multivariate statistics linear analysis (LDA) was performed to obtain a discriminant function that allows classifying the samples according to whether they contain or not TCA. The methodology proposed consists of a demanding acceptance criterion for cork planks destined for stopper production (with the guarantee of nonexistence of TCA) that results from combining the quantitative results with the absence of the two TCA correlated bands. ATR infrared spectroscopy is a nondestructive and easy to apply technique, both on cork planks and on stoppers, and has proven more restrictive than other techniques used in the cork industry that analyze the cleaning solutions. At the level of proof of concept, the method here proposed is appealing for high-value stopper applications.

Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.

PubMed

Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P

2016-03-23

Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.

Effects of argan oil on the mitochondrial function, antioxidant system and the activity of NADPH- generating enzymes in acrylamide treated rat brain.

PubMed

Aydın, Birsen

2017-03-01

Argan oil (AO) is rich in minor compounds such as polyphenols and tocopherols which are powerful antioxidants. Acrylamide (ACR) has been classified as a neurotoxic agent in animals and humans. Mitochondrial oxidative stress and dysfunction is one of the most probable molecular mechanisms of neurodegenerative diseases. Female Sprague Dawley rats were exposed to ACR (50mg/kg i.p. three times a week), AO (6ml/kg,o.p, per day) or together for 30days. The activities of cytosolic enzymes such as xanthine oxidase (XO), glucose 6-phosphate dehydrogenase (G6PDH), glutathione-S-transferase (GST), mitochondrial oxidative stress, oxidative phosphorylation (OXPHOS) and tricarboxylic acid cycle (TCA) enzymes, mitochondrial metabolic function, adenosine triphosphate (ATP) level and acetylcholinesterase (AChE) activity were assessed in rat brain. Cytosolic and mitochondrial antioxidant enzymes were significantly diminished in the brains of rats treated with ACR compared to those in control. Besides, ACR treatment resulted in a significant reduction in brain ATP level, mitochondrial metabolic function, OXPHOS and TCA enzymes. Administration of AO restored both the cytosolic and mitochondrial oxidative stress by normalizing nicotinamide adenine dinucleotide phosphate (NADPH) generating enzymes. In addition, improved mitochondrial function primarily enhancing nicotinamide adenine dinucleotide (NADH) generated enzymes activities and ATP level in the mitochondria. The reason for AO's obvious beneficial effects in this study may be due to synergistic effects of its different bioactive compounds which is especially effective on mitochondria. Modulation of the brain mitochondrial functions and antioxidant systems by AO may lead to the development of new mitochondria-targeted antioxidants in the future. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity

DTIC Science & Technology

2012-03-01

mitochondrial OAA measurement is performed by a commercial kit from Biovision . Briefly, whole cell lysates or mitochondria fraction were obtained from... Biovision based on the manufacturer protocols. 2) Cellular oxygen consumption and reactive oxygen (ROS) production. One of the metabolic consequences of

Correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis

PubMed Central

Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin

2017-01-01

The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis. Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis. Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis. However, these results require verification in further studies. PMID:28962162

Correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis.

PubMed

Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin

2017-09-01

The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis . Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis . Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis . However, these results require verification in further studies.

Combined NMR and GC-MS analyses revealed dynamic metabolic changes associated with the carrageenan-induced rat pleurisy.

PubMed

Li, Huihui; An, Yanpeng; Zhang, Lulu; Lei, Hehua; Zhang, Limin; Wang, Yulan; Tang, Huiru

2013-12-06

Inflammation is closely associated with pathogenesis of various metabolic disorders, cardiovascular diseases, and cancers. To understand the systems responses to localized inflammation, we analyzed the dynamic metabolic changes in rat plasma and urine associated with the carrageenan-induced self-limiting pleurisy using NMR spectroscopy in conjunction with multivariate data analysis. Fatty acids in plasma were also analyzed using GC-FID/MS with the data from clinical chemistry and histopathology as complementary information. We found that in the acute phase of inflammation rats with pleurisy had significantly lower levels in serum albumin, fatty acids, and lipoproteins but higher globulin level and larger quantity of pleural exudate than controls. The carrageenan-induced inflammation was accompanied by significant metabolic alterations involving TCA cycle, glycolysis, biosyntheses of acute phase proteins, and metabolisms of amino acids, fatty acids, ketone bodies, and choline in acute phase. The resolution process of pleurisy was heterogeneous, and two subgroups were observed for the inflammatory rats at day-6 post treatment with different metabolic features together with the quantity of pleural exudate and weights of thymus and spleen. The metabolic differences between these subgroups were reflected in the levels of albumin and acute-phase proteins, the degree of returning to normality for multiple metabolic pathways including glycolysis, TCA cycle, gut microbiota functions, and metabolisms of lipids, choline and vitamin B3. These findings provided some essential details for the dynamic metabolic changes associated with the carrageenan-induced self-limiting inflammation and demonstrated the combined NMR and GC-FID/MS analysis as a powerful approach for understanding biochemical aspects of inflammation.

Role of Pterocarpus santalinus against mitochondrial dysfunction and membrane lipid changes induced by ulcerogens in rat gastric mucosa.

PubMed

Narayan, Shoba; Devi, R S; Devi, C S Shyamala

2007-11-20

Free radicals produced by ulcerogenic agents affect the TCA cycle enzymes located in the outer membrane of the mitochondria. Upon induction with ulcerogens, peroxidation of membrane lipids bring about alterations in the mitochondrial enzyme activity. This indicates an increase in the permeability levels of the mitochondrial membrane. The ability of PSE to scavenge the reactive oxygen species results in restoration of activities of TCA cycle enzymes. NSAIDs interfere with the mitochondrial beta-oxidation of fatty acids in vitro and in vivo, resulting in uncoupling of mitochondrial oxidative phosphorylation process. This usually results in diminished cellular ATP production. The recovery of gastric mucosal barrier function through maintenance of energy metabolism results in maintenance of ATP levels, as observed in this study upon treatment with PSE. Membrane integrity altered by peroxidation is known to have a modified fatty acid composition, a disruption of permeability, a decrease in electrical resistance, and increase in flip-flopping between monolayers and inactivated cross-linked proteins. The severe depletion of arachidonic acid in ulcer induced groups was prevented upon treatment with PSE. The acid inhibitory property of the herbal extract enables the maintenance of GL activity upon treatment with PSE. The ability to prevent membrane peroxidation has been traced to the presence of active constituents in the PSE. In essence, PSE has been found to prevent mitochondrial dysfunction, provide mitochondrial cell integrity, through the maintenance of lipid bilayer by its ability to provide a hydrophobic character to the gastric mucosa, further indicating its ability to reverse the action of NSAIDs and mast cell degranulators in gastric mucosa.

Inducible Glutamate Oxaloacetate Transaminase as a Therapeutic Target Against Ischemic Stroke

PubMed Central

Khanna, Savita; Briggs, Zachary

2015-01-01

Abstract Significance: Glutamate serves multi-faceted (patho)physiological functions in the central nervous system as the most abundant excitatory neurotransmitter and under pathological conditions as a potent neurotoxin. Regarding the latter, elevated extracellular glutamate is known to play a central role in ischemic stroke brain injury. Recent Advances: Glutamate oxaloacetate transaminase (GOT) has emerged as a new therapeutic target in protecting against ischemic stroke injury. Oxygen-sensitive induction of GOT expression and activity during ischemic stroke lowers glutamate levels at the stroke site while sustaining adenosine triphosphate levels in brain. The energy demands of the brain are among the highest of all organs underscoring the need to quickly mobilize alternative carbon skeletons for metabolism in the absence of glucose during ischemic stroke. Recent work builds on the important observation of Hans Krebs that GOT-mediated metabolism of glutamate generates tri-carboxylic acid (TCA) cycle intermediates in brain tissue. Taken together, outcomes suggest GOT may enable the transformative switch of otherwise excitotoxic glutamate into life-sustaining TCA cycle intermediates during ischemic stroke. Critical Issues: Neuroprotective strategies that focus solely on blocking mechanisms of glutamate-mediated excitotoxicity have historically failed in clinical trials. That GOT can enable glutamate to assume the role of a survival factor represents a paradigm shift necessary to develop the overall significance of glutamate in stroke biology. Future Directions: Ongoing efforts are focused to develop the therapeutic significance of GOT in stroke-affected brain. Small molecules that target induction of GOT expression and activity in the ischemic penumbra are the focus of ongoing studies. Antioxid. Redox Signal. 22, 175–186. PMID:25343301

Structural properties, vibrational spectra and surface-enhanced Raman scattering of 2,4,6-trichloro- and tribromoanilines: A comparative study

NASA Astrophysics Data System (ADS)

Haruna, Kabiru; Saleh, Tawfik A.; Al Thagfi, Jameel; Al-Saadi, Abdulaziz A.

2016-10-01

A comparative electronic and spectroscopic analysis of 2,4,6-trichloroaniline (TCA) and 2,4,6-tribromoaniline (TBA) was carried out by theoretical and experimental techniques. The NH2 inversion barrier in TCA and TBA molecules was predicted to be three times less than that in aniline and 2,4,6-trifluoroaniline. The size of the halogen substituents in the ortho positions is shown by density functional theory to play an important role in determining the electronic and structural properties of the amino group in the investigated haloaniline derivatives. A thorough interpretation of the infrared and Raman spectra has been performed on the basis of the observed and calculated infrared and Raman spectra as well as calculated potential energy distribution values. In addition, the SERS spectra for both trihaloanilines were successfully collected up to a concentration of 10-6 M using aged hydroxylamine-reduced silver colloid as an active substrate for TCA and TBA. SERS intensities of several peaks were found to linearly change with concentration allowing quantitative analyses of TCA and TBA. A relatively stronger interaction in the case of TBA-silver colloids is predicted compared to the TCA analogue.

Effects of diabetes on brain metabolism--is brain glycogen a significant player?

PubMed

Sickmann, Helle M; Waagepetersen, Helle S

2015-02-01

Brain glycogen, being an intracellular glucose reservoir, contributes to maintain energy and neurotransmitter homeostasis under physiological as well as pathological conditions. Under conditions with a disturbance in systemic glucose metabolism such as in diabetes, the supply of glucose to the brain may be affected and have important impacts on brain metabolism and neurotransmission. This also implies that brain glycogen may serve an essential role in the diabetic state to sustain appropriate brain function. There are two main types of diabetes; type 1 and type 2 diabetes and both types may be associated with brain impairments e.g. cognitive decline and dementia. It is however, not clear how these impairments on brain function are linked to alterations in brain energy and neurotransmitter metabolism. In this review, we will illuminate how rodent diabetes models have contributed to a better understanding of how brain energy and neurotransmitter metabolism is affected in diabetes. There will be a particular focus on the role of brain glycogen to support glycolytic and TCA cycle activity as well as glutamate-glutamine cycle in type 1 and type 2 diabetes.

Bcl-2 inhibitors potentiate the cytotoxic effects of radiation in Bcl-2 overexpressing radioresistant tumor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara, Takamitsu; Omura-Minamisawa, Motoko; Chao Cheng

Purpose: Bcl-2, an inhibitor of apoptosis frequently shows elevated expression in human tumors, thus resulting in resistance to radiation therapy. Therefore, inhibiting Bcl-2 function may enhance the radiosensitivity of tumor cells. Tetrocarcin A (TC-A) and bcl-2 antisense oligonucleotides exhibit antitumor activity by inhibiting Bcl-2 function and transcription, respectively. We investigated whether these antitumor agents would enhance the cytotoxic effects of radiation in tumor cells overexpressing Bcl-2. Methods and materials: We used HeLa/bcl-2 cells, a stable Bcl-2-expressing cell line derived from wild-type HeLa (HeLa/wt) cells. Cells were incubated with TC-A and bcl-2 antisense oligonucleotides for 24 h after irradiation, and cellmore » viability was then determined. Apoptotic cells were quantified by flow cytometric assay. Results: The HeLa/bcl-2 cells were more resistant to radiation than HeLa/wt cells. At concentrations that are not inherently cytotoxic, both TC-A and bcl-2 antisense oligonucleotides increased the cytotoxic effects of radiation in HeLa/bcl-2 cells, but not in HeLa/wt cells. However, in HeLa/bcl-2 cells, additional treatment with TC-A in combination with radiation did not significantly increase apoptosis. Conclusions: The present results suggest that TC-A and bcl-2 antisense oligonucleotides reduce radioresistance of tumor cells overexpressing Bcl-2. Therefore, a combination of radiotherapy and Bcl-2 inhibitors may prove to be a useful therapeutic approach for treating tumors that overexpress Bcl-2.« less

Agreement between total corneal astigmatism calculated by vector summation and total corneal astigmatism measured by ray tracing using Galilei double Scheimpflug analyzer.

PubMed

Feizi, Sepehr; Delfazayebaher, Siamak; Ownagh, Vahid; Sadeghpour, Fatemeh

To evaluate the agreement between total corneal astigmatism calculated by vector summation of anterior and posterior corneal astigmatism (TCA Vec ) and total corneal astigmatism measured by ray tracing (TCA Ray ). This study enrolled a total of 204 right eyes of 204 normal subjects. The eyes were measured using a Galilei double Scheimpflug analyzer. The measured parameters included simulated keratometric astigmatism using the keratometric index, anterior corneal astigmatism using the corneal refractive index, posterior corneal astigmatism, and TCA Ray . TCA Vec was derived by vector summation of the astigmatism on the anterior and posterior corneal surfaces. The magnitudes and axes of TCA Vec and TCA Ray were compared. The Pearson correlation coefficient and Bland-Altman plots were used to assess the relationship and agreement between TCA Vec and TCA Ray , respectively. The mean TCA Vec and TCA Ray magnitudes were 0.76±0.57D and 1.00±0.78D, respectively (P<0.001). The mean axis orientations were 85.12±30.26° and 89.67±36.76°, respectively (P=0.02). Strong correlations were found between the TCA Vec and TCA Ray magnitudes (r=0.96, P<0.001). Moderate associations were observed between the TCA Vec and TCA Ray axes (r=0.75, P<0.001). Bland-Altman plots produced the 95% limits of agreement for the TCA Vec and TCA Ray magnitudes from -0.33 to 0.82D. The 95% limits of agreement between the TCA Vec and TCA Ray axes was -43.0 to 52.1°. The magnitudes and axes of astigmatisms measured by the vector summation and ray tracing methods cannot be used interchangeably. There was a systematic error between the TCA Vec and TCA Ray magnitudes. Copyright © 2017 Spanish General Council of Optometry. Published by Elsevier España, S.L.U. All rights reserved.

Stage-Specific Changes in Plasmodium Metabolism Required for Differentiation and Adaptation to Different Host and Vector Environments.

PubMed

Srivastava, Anubhav; Philip, Nisha; Hughes, Katie R; Georgiou, Konstantina; MacRae, James I; Barrett, Michael P; Creek, Darren J; McConville, Malcolm J; Waters, Andrew P

2016-12-01

Malaria parasites (Plasmodium spp.) encounter markedly different (nutritional) environments during their complex life cycles in the mosquito and human hosts. Adaptation to these different host niches is associated with a dramatic rewiring of metabolism, from a highly glycolytic metabolism in the asexual blood stages to increased dependence on tricarboxylic acid (TCA) metabolism in mosquito stages. Here we have used stable isotope labelling, targeted metabolomics and reverse genetics to map stage-specific changes in Plasmodium berghei carbon metabolism and determine the functional significance of these changes on parasite survival in the blood and mosquito stages. We show that glutamine serves as the predominant input into TCA metabolism in both asexual and sexual blood stages and is important for complete male gametogenesis. Glutamine catabolism, as well as key reactions in intermediary metabolism and CoA synthesis are also essential for ookinete to oocyst transition in the mosquito. These data extend our knowledge of Plasmodium metabolism and point towards possible targets for transmission-blocking intervention strategies. Furthermore, they highlight significant metabolic differences between Plasmodium species which are not easily anticipated based on genomics or transcriptomics studies and underline the importance of integration of metabolomics data with other platforms in order to better inform drug discovery and design.

Stage-Specific Changes in Plasmodium Metabolism Required for Differentiation and Adaptation to Different Host and Vector Environments

PubMed Central

Srivastava, Anubhav; Philip, Nisha; Hughes, Katie R.; Georgiou, Konstantina; MacRae, James I.; Barrett, Michael P.; McConville, Malcolm J.

2016-01-01

Malaria parasites (Plasmodium spp.) encounter markedly different (nutritional) environments during their complex life cycles in the mosquito and human hosts. Adaptation to these different host niches is associated with a dramatic rewiring of metabolism, from a highly glycolytic metabolism in the asexual blood stages to increased dependence on tricarboxylic acid (TCA) metabolism in mosquito stages. Here we have used stable isotope labelling, targeted metabolomics and reverse genetics to map stage-specific changes in Plasmodium berghei carbon metabolism and determine the functional significance of these changes on parasite survival in the blood and mosquito stages. We show that glutamine serves as the predominant input into TCA metabolism in both asexual and sexual blood stages and is important for complete male gametogenesis. Glutamine catabolism, as well as key reactions in intermediary metabolism and CoA synthesis are also essential for ookinete to oocyst transition in the mosquito. These data extend our knowledge of Plasmodium metabolism and point towards possible targets for transmission-blocking intervention strategies. Furthermore, they highlight significant metabolic differences between Plasmodium species which are not easily anticipated based on genomics or transcriptomics studies and underline the importance of integration of metabolomics data with other platforms in order to better inform drug discovery and design. PMID:28027318

History of Late-Notice HIEs

NASA Technical Reports Server (NTRS)

Frakes, P.

2016-01-01

Question was raised: are we seeing more late-notice events in recent months? Two definitions oflate-notice used to compare data: Event has at least one data point between TCA-4 days and TCA-2 days where the Pcwas below 1E-7, OR there were no data points in that timeframe. Event has at least one data point between TCA-2days and TCA where the Pc was at least 1E-4Event has at least one data point between TCA-4 days and TCA-2 dayswhere the Pc was below 1E-5, OR there were no data points in that timeframe. Event has at least one data pointbetween TCA-2 days and TCA where the Pc was at least 1E-4. The case studies that were examined all fall within criteriafor both definitions Terra vs 38192; TCA 24 JUN 2015Aura vs 89477; TCA 29 AUG 2015Terra vs 37131; TCA 19 DEC2015GPM vs 28685; TCA 5 SEP 2015.

Simulating Metabolism with Statistical Thermodynamics

PubMed Central

Cannon, William R.

2014-01-01

New methods are needed for large scale modeling of metabolism that predict metabolite levels and characterize the thermodynamics of individual reactions and pathways. Current approaches use either kinetic simulations, which are difficult to extend to large networks of reactions because of the need for rate constants, or flux-based methods, which have a large number of feasible solutions because they are unconstrained by the law of mass action. This report presents an alternative modeling approach based on statistical thermodynamics. The principles of this approach are demonstrated using a simple set of coupled reactions, and then the system is characterized with respect to the changes in energy, entropy, free energy, and entropy production. Finally, the physical and biochemical insights that this approach can provide for metabolism are demonstrated by application to the tricarboxylic acid (TCA) cycle of Escherichia coli. The reaction and pathway thermodynamics are evaluated and predictions are made regarding changes in concentration of TCA cycle intermediates due to 10- and 100-fold changes in the ratio of NAD+:NADH concentrations. Finally, the assumptions and caveats regarding the use of statistical thermodynamics to model non-equilibrium reactions are discussed. PMID:25089525

Simulating metabolism with statistical thermodynamics.

PubMed

Cannon, William R

2014-01-01

New methods are needed for large scale modeling of metabolism that predict metabolite levels and characterize the thermodynamics of individual reactions and pathways. Current approaches use either kinetic simulations, which are difficult to extend to large networks of reactions because of the need for rate constants, or flux-based methods, which have a large number of feasible solutions because they are unconstrained by the law of mass action. This report presents an alternative modeling approach based on statistical thermodynamics. The principles of this approach are demonstrated using a simple set of coupled reactions, and then the system is characterized with respect to the changes in energy, entropy, free energy, and entropy production. Finally, the physical and biochemical insights that this approach can provide for metabolism are demonstrated by application to the tricarboxylic acid (TCA) cycle of Escherichia coli. The reaction and pathway thermodynamics are evaluated and predictions are made regarding changes in concentration of TCA cycle intermediates due to 10- and 100-fold changes in the ratio of NAD+:NADH concentrations. Finally, the assumptions and caveats regarding the use of statistical thermodynamics to model non-equilibrium reactions are discussed.

Enhancement of ε-poly-L-lysine (ε-PL) production by a novel producer Bacillus cereus using metabolic precursors and glucose feeding.

PubMed

Chheda, Anuj H; Vernekar, Madhavi R

2015-10-01

Epsilon poly-L-lysine (ε-PL) is a homo-biopolymer with approximately 25-30 L-lysine residues. It is a promising natural biopolymer widely used in food and pharmaceutical industry. The present work reports enhanced production of ε-PL with a novel producer Bacillus cereus using amino acids and TCA cycle intermediates in the fermentation medium. Among the various amino acids and TCA cycle intermediates tested 2 mM L-aspartic acid and 5 mM citric acid gave ε-PL yield of 145.5 and 230 mg/L, respectively. A combination of citric acid after 24 h and L-aspartic acid after 36 h improved ε-PL yield from 85 mg/L (control) to 335 mg/L. Glucose feeding strategy along with metabolic precursors was employed which further enhanced ε-PL yield to 565 mg/L. Thus, more than sixfold increase in ε-PL yield was achieved suggesting the potential of Bacillus cereus as a novel ε-PL producer.

Artificial Autopolyploidization Modifies the Tricarboxylic Acid Cycle and GABA Shunt in Arabidopsis thaliana Col-0

NASA Astrophysics Data System (ADS)

Vergara, Fredd; Kikuchi, Jun; Breuer, Christian

2016-05-01

Autopolyploidy is a process whereby the chromosome set is multiplied and it is a common phenomenon in angiosperms. Autopolyploidy is thought to be an important evolutionary force that has led to the formation of new plant species. Despite its relevance, the consequences of autopolyploidy in plant metabolism are poorly understood. This study compares the metabolic profiles of natural diploids and artificial autotetraploids of Arabidopsis thaliana Col-0. Different physiological parameters are compared between diploids and autotetraploids using nuclear magnetic resonance (NMR), elemental analysis (carbon:nitrogen balance) and quantitative real-time PCR (qRT-PCR). The main difference between diploid and autotetraploid A. thaliana Col-0 is observed in the concentration of metabolites related to the tricarboxylic acid cycle (TCA) and γ-amino butyric acid (GABA) shunt, as shown by multivariate statistical analysis of NMR spectra. qRT-PCR shows that genes related to the TCA and GABA shunt are also differentially expressed between diploids and autotetraploids following similar trends as their corresponding metabolites. Solid evidence is presented to demonstrate that autopolyploidy influences core plant metabolic processes.

Overexpression of the NADP+-specific isocitrate dehydrogenase gene (icdA) in citric acid-producing Aspergillus niger WU-2223L.

PubMed

Kobayashi, Keiichi; Hattori, Takasumi; Hayashi, Rie; Kirimura, Kohtaro

2014-01-01

In the tricarboxylic acid (TCA) cycle, NADP(+)-specific isocitrate dehydrogenase (NADP(+)-ICDH) catalyzes oxidative decarboxylation of isocitric acid to form α-ketoglutaric acid with NADP(+) as a cofactor. We constructed an NADP(+)-ICDH gene (icdA)-overexpressing strain (OPI-1) using Aspergillus niger WU-2223L as a host and examined the effects of increase in NADP(+)-ICDH activity on citric acid production. Under citric acid-producing conditions with glucose as the carbon source, the amounts of citric acid produced and glucose consumed by OPI-1 for the 12-d cultivation period decreased by 18.7 and 10.5%, respectively, compared with those by WU-2223L. These results indicate that the amount of citric acid produced by A. niger can be altered with the NADP(+)-ICDH activity. Therefore, NADP(+)-ICDH is an important regulator of citric acid production in the TCA cycle of A. niger. Thus, we propose that the icdA gene is a potentially valuable tool for modulating citric acid production by metabolic engineering.

Cigarette smoke induces mitochondrial metabolic reprogramming in lung cells.

PubMed

Solanki, Hitendra S; Babu, Niraj; Jain, Ankit P; Bhat, Mohd Younis; Puttamallesh, Vinuth N; Advani, Jayshree; Raja, Remya; Mangalaparthi, Kiran K; Kumar, Mahesh M; Prasad, T S Keshava; Mathur, Premendu Prakash; Sidransky, David; Gowda, Harsha; Chatterjee, Aditi

2018-05-01

Cellular transformation owing to cigarette smoking is due to chronic exposure and not acute. However, systematic studies to understand the molecular alterations in lung cells due to cigarette smoke are lacking. To understand these molecular alterations induced by chronic cigarette smoke exposure, we carried out tandem mass tag (TMT) based temporal proteomic profiling of lung cells exposed to cigarette smoke for upto 12months. We identified 2620 proteins in total, of which 671 proteins were differentially expressed (1.5-fold) after 12months of exposure. Prolonged exposure of lung cells to smoke for 12months revealed dysregulation of oxidative phosphorylation and overexpression of enzymes involved in TCA cycle. In addition, we also observed overexpression of enzymes involved in glutamine metabolism, fatty acid degradation and lactate synthesis. This could possibly explain the availability of alternative source of carbon to TCA cycle apart from glycolytic pyruvate. Our data indicates that chronic exposure to cigarette smoke induces mitochondrial metabolic reprogramming in cells to support growth and survival. Copyright © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

Studies of yeast cell oxygenation and energetics by laser fluorometry of reduced nicotinamide adenine dinucleotide

NASA Astrophysics Data System (ADS)

Pan, Fu-shih; Chen, Stephen; Mintzer, Robert A.; Chen, Chin-Tu; Schumacker, Paul

1991-03-01

It is of fundamental importance for biological scientists to assess cellular energetics. Under aerobic conditions, the tricarboxylic acid cycle (TCA cycle) is coupled with the mitochondrial electron cascade pathway to provide the cell with energy. The nicotinamide adenine dinucleotide-conjugated pair (NAD and NADH) is the coenzyme in numerous important biomedical reactions which include several important dehydrogenase reactions in the TCA cycle. Based on Le Chatelier's principle, NADH will accumulate when this energy production mechanism is impaired. The relative amounts of NAD and NADH in a cell are defined as the redox state of the cell (Williamson et.al. 1967) which provides a valuable index of cellular energetics. The sum of the amounts of NAD and NADH in a cell may be assumed to be constant during a finite time; therefore, a reliable means of measuring the NADH concentration would provide us with a useful indicator of tissue viability. Traditionally, the quantities of NADH and NAD may be measured by chemical assay methods. We can avoid these tediois analyses by exploiting the significant difference between the ultraviolet absorption spectra of this redox pair. However, because of the opacity of biological samples and the interference of other biochemicals that also absorb ultraviolet radiation, measurement of NADH and NAD+ concentrations in vivo by absorption spectroscopy is not feasible.

Poly(3-hydroxybutyrate) fuels the tricarboxylic acid cycle and de novo lipid biosynthesis during Bacillus anthracis sporulation.

PubMed

Sadykov, Marat R; Ahn, Jong-Sam; Widhelm, Todd J; Eckrich, Valerie M; Endres, Jennifer L; Driks, Adam; Rutkowski, Gregory E; Wingerd, Kevin L; Bayles, Kenneth W

2017-06-01

Numerous bacteria accumulate poly(3-hydroxybutyrate) (PHB) as an intracellular reservoir of carbon and energy in response to imbalanced nutritional conditions. In Bacillus spp., where PHB biosynthesis precedes the formation of the dormant cell type called the spore (sporulation), the direct link between PHB accumulation and efficiency of sporulation was observed in multiple studies. Although the idea of PHB as an intracellular carbon and energy source fueling sporulation was proposed several decades ago, the mechanisms underlying PHB contribution to sporulation have not been defined. Here, we demonstrate that PHB deficiency impairs Bacillus anthracis sporulation through diminishing the energy status of the cells and by reducing carbon flux into the tricarboxylic acid (TCA) cycle and de novo lipid biosynthesis. Consequently, this metabolic imbalance decreased biosynthesis of the critical components required for spore integrity and resistance, such as dipicolinic acid (DPA) and the spore's inner membrane. Supplementation of the PHB deficient mutant with exogenous fatty acids overcame these sporulation defects, highlighting the importance of the TCA cycle and lipid biosynthesis during sporulation. Combined, the results of this work reveal the molecular mechanisms of PHB contribution to B. anthracis sporulation and provide valuable insight into the metabolic requirements for this developmental process in Bacillus species. © 2017 John Wiley & Sons Ltd.

Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells

PubMed Central

Janzer, Andreas; German, Natalie J.; Gonzalez-Herrera, Karina N.; Asara, John M.; Haigis, Marcia C.; Struhl, Kevin

2014-01-01

Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation. PMID:25002509

Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells.

PubMed

Janzer, Andreas; German, Natalie J; Gonzalez-Herrera, Karina N; Asara, John M; Haigis, Marcia C; Struhl, Kevin

2014-07-22

Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation.

In vivo carbon-edited detection with proton echo-planar spectroscopic imaging (ICED PEPSI): [3,4-(13)CH(2)]glutamate/glutamine tomography in rat brain.

PubMed

Hyder, F; Renken, R; Rothman, D L

1999-12-01

A method for in vivo carbon-edited detection with proton echo-planar spectroscopic imaging (ICED PEPSI) is described. This method is composed of an echo-planar based acquisition implemented with (13)C-(1)H J editing spectroscopy and is intended for high temporal and spatial resolution in vivo spectroscopic imaging of (13)C turnover, from D-[1,6-(13)C]glucose to glutamate and glutamine, in the brain. At a static magnetic field strength of 7 T, both in vitro and in vivo chemical shift imaging data are presented with a spatial resolution of 8 microL (i.e., 1.25 x 1.25 x 5.00 mm(3)) and a maximum spectral bandwidth of 5.2 ppm in (1)H. Chemical shift imaging data acquired every 11 minutes allowed detection of regional [4-(13)CH(2)]glutamate turnover in rat brain. The [4-(13)CH(2)]glutamate turnover curves, which can be converted to tricarboxylic acid cycle fluxes, showed that the tricarboxylic acid cycle flux (V(TCA)) in pure gray and white matter can range from 1.2 +/- 0.2 to 0.5 +/- 0.1 micromol/g/min, respectively, for morphine-anesthetized rats. The mean cortical V(TCA) from 32 voxels of 1.0 +/- 0.3 micromol/g/min (N = 3) is in excellent agreement with previous localized measurements that have demonstrated that V(TCA) can range from 0.9-1.1 micromol/g/min under identical anesthetized conditions. Magn Reson Med 42:997-1003, 1999. Copyright 1999 Wiley-Liss, Inc.

Differential Mechanism of Escherichia coli Inactivation by (+)-Limonene as a Function of Cell Physiological State and Drug's Concentration

PubMed Central

Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego

2014-01-01

(+)-limonene is a lipophilic antimicrobial compound, extracted from citrus fruits' essential oils, that is used as a flavouring agent and organic solvent by the food industry. A recent study has proposed a common and controversial mechanism of cell death for bactericidal antibiotics, in which hydroxyl radicals ultimately inactivated cells. Our objective was to determine whether the mechanism of Escherichia coli MG1655 inactivation by (+)-limonene follows that of bactericidal antibiotics. A treatment with 2,000 μL/L (+)-limonene inactivated 4 log10 cycles of exponentially growing E. coli cells in 3 hours. On one hand, an increase of cell survival in the ΔacnB mutant (deficient in a TCA cycle enzyme), or in the presence of 2,2′-dipyridyl (inhibitor of Fenton reaction by iron chelation), thiourea, or cysteamine (hydroxyl radical scavengers) was observed. Moreover, the ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) was more sensitive to (+)-limonene. Thus, this indirect evidence indicates that the mechanism of exponentially growing E. coli cells inactivation by 2,000 μL/L (+)-limonene is due to the TCA cycle and Fenton-mediated hydroxyl radical formation that caused oxidative DNA damage, as observed for bactericidal drugs. However, several differences have been observed between the proposed mechanism for bactericidal drugs and for (+)-limonene. In this regard, our results demonstrated that E. coli inactivation was influenced by its physiological state and the drug's concentration: experiments with stationary-phase cells or 4,000 μL/L (+)-limonene uncovered a different mechanism of cell death, likely unrelated to hydroxyl radicals. Our research has also shown that drug's concentration is an important factor influencing the mechanism of bacterial inactivation by antibiotics, such as kanamycin. These results might help in improving and spreading the use of (+)-limonene as an antimicrobial compound, and in clarifying the controversy about the mechanism of inactivation by bactericidal antibiotics. PMID:24705541

Differential mechanism of Escherichia coli Inactivation by (+)-limonene as a function of cell physiological state and drug's concentration.

PubMed

Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego

2014-01-01

(+)-limonene is a lipophilic antimicrobial compound, extracted from citrus fruits' essential oils, that is used as a flavouring agent and organic solvent by the food industry. A recent study has proposed a common and controversial mechanism of cell death for bactericidal antibiotics, in which hydroxyl radicals ultimately inactivated cells. Our objective was to determine whether the mechanism of Escherichia coli MG1655 inactivation by (+)-limonene follows that of bactericidal antibiotics. A treatment with 2,000 μL/L (+)-limonene inactivated 4 log10 cycles of exponentially growing E. coli cells in 3 hours. On one hand, an increase of cell survival in the ΔacnB mutant (deficient in a TCA cycle enzyme), or in the presence of 2,2'-dipyridyl (inhibitor of Fenton reaction by iron chelation), thiourea, or cysteamine (hydroxyl radical scavengers) was observed. Moreover, the ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) was more sensitive to (+)-limonene. Thus, this indirect evidence indicates that the mechanism of exponentially growing E. coli cells inactivation by 2,000 μL/L (+)-limonene is due to the TCA cycle and Fenton-mediated hydroxyl radical formation that caused oxidative DNA damage, as observed for bactericidal drugs. However, several differences have been observed between the proposed mechanism for bactericidal drugs and for (+)-limonene. In this regard, our results demonstrated that E. coli inactivation was influenced by its physiological state and the drug's concentration: experiments with stationary-phase cells or 4,000 μL/L (+)-limonene uncovered a different mechanism of cell death, likely unrelated to hydroxyl radicals. Our research has also shown that drug's concentration is an important factor influencing the mechanism of bacterial inactivation by antibiotics, such as kanamycin. These results might help in improving and spreading the use of (+)-limonene as an antimicrobial compound, and in clarifying the controversy about the mechanism of inactivation by bactericidal antibiotics.

Rates of insulin secretion in INS-1 cells are enhanced by coupling to anaplerosis and Kreb's cycle flux independent of ATP synthesis.

PubMed

Cline, Gary W; Pongratz, Rebecca L; Zhao, Xiaojian; Papas, Klearchos K

2011-11-11

Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with (31)P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by (13)C NMR isotopomer analysis of the fate of [U-(13)C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media. Copyright © 2011 Elsevier Inc. All rights reserved.

Long-chain fatty acid combustion rate is associated with unique metabolite profiles in skeletal muscle mitochondria.

PubMed

Seifert, Erin L; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R; Wohlgemuth, Gert; Adams, Sean H; Harper, Mary-Ellen

2010-03-24

Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA beta-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 microM; corresponding to low, intermediate and high oxidation rates) and 9 microM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies should focus on the fate of effluxed TCA cycle intermediates and on mechanisms ensuring their replenishment during LCFA metabolism in skeletal muscle.

Long-Chain Fatty Acid Combustion Rate Is Associated with Unique Metabolite Profiles in Skeletal Muscle Mitochondria

PubMed Central

Seifert, Erin L.; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R.; Wohlgemuth, Gert; Adams, Sean H.; Harper, Mary-Ellen

2010-01-01

Background/Aim Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA β-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Methodology/Principal Findings Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 µM; corresponding to low, intermediate and high oxidation rates) and 9 µM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. Conclusions/Significance This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies should focus on the fate of effluxed TCA cycle intermediates and on mechanisms ensuring their replenishment during LCFA metabolism in skeletal muscle. PMID:20352092

Shaofu Zhuyu decoction ameliorates obesity-mediated hepatic steatosis and systemic inflammation by regulating metabolic pathways

PubMed Central

Park, Hee-Sook; Lee, So Min; Jeong, Nam-Joo; Kim, Soon-Hee; Lee, Kyoung-Won; Lee, Ju-A

2017-01-01

Shaofu Zhuyu decoction (SFZYD, also known as Sobokchugeo-tang), a classical prescription drug in traditional East Asian medicine, has been used to treat blood stasis syndrome (BSS). Hepatic steatosis is the result of excess caloric intake, and its pathogenesis involves internal retention of phlegm and dampness, blood stasis, and liver Qi stagnation. To evaluate the effects of treatment with SFZYD on obesity-induced inflammation and hepatic steatosis, we fed male C57BL/6N mice a high fat diet (HFD) for 8 weeks and then treated them with SFZYD by oral gavage for an additional 4 weeks. The results of histological and biochemical examinations indicated that SFZYD treatment ameliorates systemic inflammation and hepatic steatosis. A partial least squares-discriminant analysis (PLS-DA) scores plot of serum metabolites showed that HFD mice began to produce metabolites similar to those of normal chow (NC) mice after SFZYD administration. We noted significant alterations in the levels of twenty-seven metabolites, alterations indicating that SFZYD regulates the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. Increases in the levels of TCA cycle intermediate metabolites, such as 2-oxoglutaric acid, isocitric acid, and malic acid, in the serum of obese mice were significantly reversed after SFZYD treatment. In addition to inducing changes in the above metabolites, treatment with SFZYD also recovered the expression of genes related to hepatic mitochondrial dysfunction, including Ucp2, Cpt1α, and Ppargc1α, as well as the expression of genes involved in lipid metabolism and inflammation, without affecting glucose uptake or insulin signaling. Taken together, these findings suggest that treatment with SFZYD ameliorated obesity-induced systemic inflammation and hepatic steatosis by regulating inflammatory cytokine and adipokine levels in the circulation and various tissues. Moreover, treatment with SFZYD also reversed alterations in the levels of metabolites of the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. PMID:28570676

Effects of visceral adiposity on glycerol pathways in gluconeogenesis.

PubMed

Neeland, Ian J; Hughes, Connor; Ayers, Colby R; Malloy, Craig R; Jin, Eunsook S

2017-02-01

To determine the feasibility of using oral 13 C labeled glycerol to assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Obese (BMI ≥30kg/m 2 ) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U- 13 C 3 ] glycerol and blood samples were subsequently analyzed at multiple time points over 3h by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U- 13 C 3 ] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13 C NMR analysis of glucose. Mixed linear models were used to compare 13 C enrichment in glucose between groups. Mean age, BMI, and baseline glucose were 49years, 40.1kg/m 2 , and 98mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13 C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13 C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2- 13 C 2 ] (via PPP) and [5,6- 13 C 2 ]/[4,5,6- 13 C 3 ] (via TCA cycle) glucose in high VAT versus low VAT groups. We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. Copyright © 2016 Elsevier Inc. All rights reserved.

Effects of Visceral Adiposity on Glycerol Pathways in Gluconeogenesis

PubMed Central

Neeland, Ian J.; Hughes, Connor; Ayers, Colby R.; Malloy, Craig R.; Jin, Eunsook S.

2016-01-01

Objective To determine the feasibility of using oral 13C labeled glycerol at assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Research Design and Methods Obese (BMI ≥30 kg/m2) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U-13C3] glycerol and blood samples were subsequently analyzed at multiple time points over 3 hours by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U-13C3] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13C NMR analysis of glucose. Mixed linear models were used to compare 13C enrichment in glucose between groups. Results Mean age, BMI, and baseline glucose were 49 years, 40.1 kg/m2, and 98 mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2-13C2] (via PPP) and [5,6-13C2]/[4,5,6-13C3] (via TCA cycle) glucose in high VAT versus low VAT groups. Conclusions We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. PMID:28081781

Use of a Bacterial Luciferase Monitoring System To Estimate Real-Time Dynamics of Intracellular Metabolism in Escherichia coli.

PubMed

Shimada, Tomohiro; Tanaka, Kan

2016-10-01

Regulation of central carbon metabolism has long been an important research subject in every organism. While the dynamics of metabolic flows during changes in available carbon sources have been estimated based on changes in metabolism-related gene expression, as well as on changes in the metabolome, the flux change itself has scarcely been measured because of technical difficulty, which has made conclusions elusive in many cases. Here, we used a monitoring system employing Vibrio fischeri luciferase to probe the intracellular metabolic condition in Escherichia coli Using a batch culture provided with a limited amount of glucose, we performed a time course analysis, where the predominant carbon source shifts from glucose to acetate, and identified a series of sequential peaks in the luciferase activity (peaks 1 to 4). Two major peaks, peaks 1 and 3, were considered to correspond to the glucose and acetate consuming phases, respectively, based on the glucose, acetate, and dissolved oxygen concentrations in the medium. The pattern of these peaks was changed by the addition of a different carbon source or by an increasing concentration of glucose, which was consistent with the present model. Genetically, mutations involved in glycolysis or the tricarboxylic acid (TCA) cycle/gluconeogenesis specifically affected peak 1 or peak 3, respectively, as expected from the corresponding metabolic phase. Intriguingly, mutants for the acetate excretion pathway showed a phenotype of extended peak 2 and delayed transition to the TCA cycle/gluconeogenesis phase, which suggests that peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Intracellular metabolic flows dynamically change during shifts in available carbon sources. However, because of technical difficulty, the flux change has scarcely been measured in living cells. Here, we used a Vibrio fischeri luciferase monitoring system to probe the intracellular metabolic condition in Escherichia coli Using a limited amount of glucose batch culture, a series of sequential peaks (peaks 1 to 4) in the luciferase activity was observed. Changes in the pattern of these peaks by the addition of extra carbon sources and in mutant strains involved in glycolysis or the TCA cycle/gluconeogenesis gene assigned the metabolic phase corresponding to peak 1 as the glycolysis phase and peak 3 as the TCA cycle/gluconeogenesis phase. Intriguingly, the acetate excretion pathway engaged in peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Differential effects of safflower oil versus fish oil feeding on insulin-stimulated glycogen synthesis, glycolysis, and pyruvate dehydrogenase flux in skeletal muscle: a 13C nuclear magnetic resonance study.

PubMed

Jucker, B M; Cline, G W; Barucci, N; Shulman, G I

1999-01-01

To examine the effects of safflower oil versus fish oil feeding on in vivo intramuscular glucose metabolism and relative pyruvate dehydrogenase (PDH) versus tricarboxylic acid (TCA) cycle flux, rats were pair-fed on diets consisting of 1) 59% safflower oil, 2) 59% menhaden fish oil, or 3) 59% carbohydrate (control) in calories. Rates of glycolysis and glycogen synthesis were assessed by monitoring [1-(13)C]glucose label incorporation into [1-(13)C]glycogen, [3-(13)C]lactate, and [3-(13)C]alanine in the hindlimb of awake rats via 13C nuclear magnetic resonance (NMR) spectroscopy during a euglycemic (approximately 6 mmol/l) hyperinsulinemic (approximately 180 microU/ml) clamp. A steady-state isotopic analysis of lactate, alanine, and glutamate was used to determine the relative PDH versus TCA cycle flux present in muscle under these conditions. The safflower oil-fed rats were insulin resistant compared with control and fish oil-fed rats, as reflected by a markedly reduced glucose infusion rate (Ginf) during the clamp (21.4 +/- 2.3 vs. 31.6 +/- 2.8 and 31.7 +/- 1.9 mg x kg(-1) x min(-1) in safflower oil versus control and fish oil groups, respectively, P < 0.006). This decrease in insulin-stimulated glucose disposal in the safflower oil group was associated with a lower rate of glycolysis (21.7 +/- 2.2 nmol x g(-1) x min(-1)) versus control (62.1 +/- 10.3 nmol x g(-1) x min(-1), P < 0.001) and versus fish oil (45.7 +/- 6.7 nmol x g(-1) x min(-1), P < 0.04), as no change in glycogen synthesis (103 +/- 15, 133 +/- 19, and 125 +/- 14 nmol x g(-1) x min(-1) in safflower oil, fish oil, and control, respectively) was detected. The intramuscular triglyceride (TG) content was increased in the safflower oil group (7.3 +/- 0.8 micromol/g) compared with the control group (5.2 +/- 0.8 micromol/g, P < 0.05) and the fish oil group (3.6 +/- 1.1 micromol/g, P < 0.01). Conversely, the percent PDH versus TCA cycle flux was decreased in the safflower oil (43 +/- 8%) versus the control (73 +/- 8%, P < 0.01) and fish oil (64 +/- 6%, P < 0.05) groups. These data suggest that the reduced insulin-stimulated glucose disposal attributed to safflower oil feeding was a consequence of reduced glycolytic flux associated with an increase in relative free fatty acid/ketone oxidation versus TCA cycle flux, whereas fish oil feeding did not alter glucose metabolism and may in part be protective of insulin-stimulated glucose disposal by limiting intramuscular TG deposition.

Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats☆

PubMed Central

Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.; Ward, William O.; Vallanat, Beena D.; Andrews, Debora L.; Schladweiler, Mette C.; Snow, Samantha J.; Bass, Virginia L.; Richards, Judy E.; Ghio, Andrew J.; Cascio, Wayne E.; Ledbetter, Allen D.; Kodavanti, Urmila P.

2016-01-01

Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0 ppm O3, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. PMID:25838073

Inhibition of akt phosphorylation diminishes mitochondrial biogenesis regulators, tricarboxylic acid cycle activity and exacerbates recognition memory deficit in rat model of Alzheimer's disease.

PubMed

Shaerzadeh, Fatemeh; Motamedi, Fereshteh; Khodagholi, Fariba

2014-11-01

3-Methyladenine (3-MA), as a PI3K inhibitor, is widely used for inhibition of autophagy. Inhibition of PI3K class I leads to inhibition of Akt phosphorylation, a central molecule involved in diverse arrays of intracellular cascades in nervous system. Accordingly, in the present study, we aimed to determine the alterations of specific mitochondrial biogenesis markers and mitochondrial function in 3-MA-injected rats following amyloid beta (Aβ) insult. Our data revealed that inhibition of Akt phosphorylation downregulates master regulator of mitochondrial biogenesis, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α). Our data also showed that decrease in PGC-1α level presumably is due to decrease in the phosphorylation of cAMP-response element binding and AMP-activated kinase, two upstream activators of PGC-1α. As a consequence, the level of some mitochondrial biogenesis factors including nuclear respiratory factor-1, mitochondrial transcription factor A, and Cytochrome c decreased significantly. Also, activities of tricarboxylic acid cycle (TCA) enzymes such as Aconitase, a-ketoglutarate dehydrogenase, and malate dehydrogenase reduced in the presence of 3-MA with or without Aβ insult. Decrease in mitochondrial biogenesis factors and TCA enzyme activity in the rats receiving 3-MA and Aβ were more compared to the rats that received either alone; indicating the additive destructive effects of these two agents. In agreement with our molecular results, data obtained from behavioral test (using novel objective recognition test) indicated that inhibition of Akt phosphorylation with or without Aβ injection impaired novel recognition (non-spatial) memory. Our results suggest that 3-MA amplified deleterious effects of Aβ by targeting central molecule Akt.

Differential expression of glucose-metabolizing enzymes in multiple sclerosis lesions.

PubMed

Nijland, Philip G; Molenaar, Remco J; van der Pol, Susanne M A; van der Valk, Paul; van Noorden, Cornelis J F; de Vries, Helga E; van Horssen, Jack

2015-12-04

Demyelinated axons in multiple sclerosis (MS) lesions have an increased energy demand in order to maintain conduction. However, oxidative stress-induced mitochondrial dysfunction likely alters glucose metabolism and consequently impairs neuronal function in MS. Imaging and pathological studies indicate that glucose metabolism is altered in MS, although the underlying mechanisms and its role in neurodegeneration remain elusive. We investigated expression patterns of key enzymes involved in glycolysis, tricarboxylic acid (TCA) cycle and lactate metabolism in well-characterized MS tissue to establish which regulators of glucose metabolism are involved in MS and to identify underlying mechanisms. Expression levels of glycolytic enzymes were increased in active and inactive MS lesions, whereas expression levels of enzymes involved in the TCA cycle were upregulated in active MS lesions, but not in inactive MS lesions. We observed reduced expression and production capacity of mitochondrial α-ketoglutarate dehydrogenase (αKGDH) in demyelinated axons, which correlated with signs of axonal dysfunction. In inactive lesions, increased expression of lactate-producing enzymes was observed in astrocytes, whereas lactate-catabolising enzymes were mainly detected in axons. Our results demonstrate that the expression of various enzymes involved in glucose metabolism is increased in both astrocytes and axons in active MS lesions. In inactive MS lesions, we provide evidence that astrocytes undergo a glycolytic shift resulting in enhanced astrocyte-axon lactate shuttling, which may be pivotal for the survival of demyelinated axons. In conclusion, we show that key enzymes involved in energy metabolism are differentially expressed in active and inactive MS lesions. Our findings imply that, in addition to reduced oxidative phosphorylation activity, other bioenergetic pathways are affected as well, which may contribute to ongoing axonal degeneration in MS.

A diet rich in high-glucoraphanin broccoli interacts with genotype to reduce discordance in plasma metabolite profiles by modulating mitochondrial function123

PubMed Central

Armah, Charlotte N; Traka, Maria H; Dainty, Jack R; Defernez, Marianne; Janssens, Astrid; Leung, Wing; Doleman, Joanne F; Potter, John F

2013-01-01

Background: Observational and experimental studies suggest that diets rich in cruciferous vegetables and glucosinolates may reduce the risk of cancer and cardiovascular disease (CVD). Objective: We tested the hypothesis that a 12-wk dietary intervention with high-glucoraphanin (HG) broccoli would modify biomarkers of CVD risk and plasma metabolite profiles to a greater extent than interventions with standard broccoli or peas. Design: Subjects were randomly assigned to consume 400 g standard broccoli, 400 g HG broccoli, or 400 g peas each week for 12 wk, with no other dietary restrictions. Biomarkers of CVD risk and 347 plasma metabolites were quantified before and after the intervention. Results: No significant differences in the effects of the diets on biomarkers of CVD risk were found. Multivariate analyses of plasma metabolites identified 2 discrete phenotypic responses to diet in individuals within the HG broccoli arm, differentiated by single nucleotide polymorphisms associated with the PAPOLG gene. Univariate analysis showed effects of sex (P < 0.001), PAPOLG genotype (P < 0.001), and PAPOLG genotype × diet (P < 0.001) on the plasma metabolic profile. In the HG broccoli arm, the consequence of the intervention was to reduce variation in lipid and amino acid metabolites, tricarboxylic acid (TCA) cycle intermediates, and acylcarnitines between the 2 PAPOLG genotypes. Conclusions: The metabolic changes observed with the HG broccoli diet are consistent with a rebalancing of anaplerotic and cataplerotic reactions and enhanced integration of fatty acid β-oxidation with TCA cycle activity. These modifications may contribute to the reduction in cancer risk associated with diets that are rich in cruciferous vegetables. This trial was registered at clinicaltrials.gov as NCT01114399. PMID:23964055

Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats.

PubMed

Miller, Desinia B; Karoly, Edward D; Jones, Jan C; Ward, William O; Vallanat, Beena D; Andrews, Debora L; Schladweiler, Mette C; Snow, Samantha J; Bass, Virginia L; Richards, Judy E; Ghio, Andrew J; Cascio, Wayne E; Ledbetter, Allen D; Kodavanti, Urmila P

2015-07-15

Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0ppm, 6h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0ppm O3, 6h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress-response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. Published by Elsevier Inc.

Low-temperature Storage of Cucumbers Induces Changes in the Organic Acid Content and in Citrate Synthase Activity

USDA-ARS?s Scientific Manuscript database

To elucidate the cause of reported pyruvate accumulation in chilled stored cucumbers (Cucumis sativus L.) cv. ‘Toppugurin’, we have examined differences in the extent of incorporation of acetate-1,2-14C into the tricarboxylic acid (TCA) cycle and the specific activity of the enzyme citrate synthase ...

A Comparison of Protein Extraction Methods Suitable for Gel-Based Proteomic Studies of Aphid Proteins

PubMed Central

Cilia, M.; Fish, T.; Yang, X.; Mclaughlin, M.; Thannhauser, T. W.

2009-01-01

Protein extraction methods can vary widely in reproducibility and in representation of the total proteome, yet there are limited data comparing protein isolation methods. The methodical comparison of protein isolation methods is the first critical step for proteomic studies. To address this, we compared three methods for isolation, purification, and solubilization of insect proteins. The aphid Schizaphis graminum, an agricultural pest, was the source of insect tissue. Proteins were extracted using TCA in acetone (TCA-acetone), phenol, or multi-detergents in a chaotrope solution. Extracted proteins were solubilized in a multiple chaotrope solution and examined using 1-D and 2-D electrophoresis and compared directly using 2-D Difference Gel Electrophoresis (2-D DIGE). Mass spectrometry was used to identify proteins from each extraction type. We were unable to ascribe the differences in the proteins extracted to particular physical characteristics, cell location, or biological function. The TCA-acetone extraction yielded the greatest amount of protein from aphid tissues. Each extraction method isolated a unique subset of the aphid proteome. The TCA-acetone method was explored further for its quantitative reliability using 2-D DIGE. Principal component analysis showed that little of the variation in the data was a result of technical issues, thus demonstrating that the TCA-acetone extraction is a reliable method for preparing aphid proteins for a quantitative proteomics experiment. These data suggest that although the TCA-acetone method is a suitable method for quantitative aphid proteomics, a combination of extraction approaches is recommended for increasing proteome coverage when using gel-based separation techniques. PMID:19721822

Statistical distribution of foveal transverse chromatic aberration, pupil centration, and angle psi in a population of young adult eyes

NASA Astrophysics Data System (ADS)

Rynders, Maurice; Lidkea, Bruce; Chisholm, William; Thibos, Larry N.

1995-10-01

Subjective transverse chromatic aberration (sTCA) manifest at the fovea was determined for a population of 85 young adults (19-38 years old) by means of a two-dimensional, two-color, vernier alignment technique. The statistical distribution of sTCA was well fitted by a bivariate Gaussian function with mean values that were not significantly different from zero in either the horizontal or the vertical direction. We conclude from this result that a hypothetical, average eye representing the population mean of human eyes with medium-sized pupils is free of foveal sTCA. However, the absolute magnitude of sTCA for any given individual was often significantly greater than zero and ranged from 0.05 to 2.67 arcmin for the red and the blue lights of a computer monitor (mean wavelengths, 605 and 497 nm, respectively). The statistical distribution of the absolute magnitude of sTCA was well described by a Rayleigh probability distribution with a mean of 0.8 arcmin. A simple device useful for population screening in a clinical setting was also tested and gave concordant results. Assuming that sTCA at the fovea is due to decentering of the pupil with respect to the visual axis, we infer from these results that the pupil is, on average, well centered in human eyes. The average magnitude of pupil decentration in individual eyes is less than 0.5 mm, which corresponds to psi =3 deg for the angle between the achromatic and the visual axes of the eye.

Flux Balance Analysis of Cyanobacterial Metabolism: The Metabolic Network of Synechocystis sp. PCC 6803

PubMed Central

Knoop, Henning; Gründel, Marianne; Zilliges, Yvonne; Lehmann, Robert; Hoffmann, Sabrina; Lockau, Wolfgang; Steuer, Ralf

2013-01-01

Cyanobacteria are versatile unicellular phototrophic microorganisms that are highly abundant in many environments. Owing to their capability to utilize solar energy and atmospheric carbon dioxide for growth, cyanobacteria are increasingly recognized as a prolific resource for the synthesis of valuable chemicals and various biofuels. To fully harness the metabolic capabilities of cyanobacteria necessitates an in-depth understanding of the metabolic interconversions taking place during phototrophic growth, as provided by genome-scale reconstructions of microbial organisms. Here we present an extended reconstruction and analysis of the metabolic network of the unicellular cyanobacterium Synechocystis sp. PCC 6803. Building upon several recent reconstructions of cyanobacterial metabolism, unclear reaction steps are experimentally validated and the functional consequences of unknown or dissenting pathway topologies are discussed. The updated model integrates novel results with respect to the cyanobacterial TCA cycle, an alleged glyoxylate shunt, and the role of photorespiration in cellular growth. Going beyond conventional flux-balance analysis, we extend the computational analysis to diurnal light/dark cycles of cyanobacterial metabolism. PMID:23843751

In silico gene expression analysis reveals glycolysis and acetate anaplerosis in IDH1 wild-type glioma and lactate and glutamate anaplerosis in IDH1-mutated glioma.

PubMed

Khurshed, Mohammed; Molenaar, Remco J; Lenting, Krissie; Leenders, William P; van Noorden, Cornelis J F

2017-07-25

Hotspot mutations in isocitrate dehydrogenase 1 (IDH1) initiate low-grade glioma and secondary glioblastoma and induce a neomorphic activity that converts α-ketoglutarate (α-KG) to the oncometabolite D-2-hydroxyglutarate (D-2-HG). It causes metabolic rewiring that is not fully understood. We investigated the effects of IDH1 mutations (IDH1MUT) on expression of genes that encode for metabolic enzymes by data mining The Cancer Genome Atlas. We analyzed 112 IDH1 wild-type (IDH1WT) versus 399 IDH1MUT low-grade glioma and 157 IDH1WT versus 9 IDH1MUT glioblastoma samples. In both glioma types, IDH1WT was associated with high expression levels of genes encoding enzymes that are involved in glycolysis and acetate anaplerosis, whereas IDH1MUT glioma overexpress genes encoding enzymes that are involved in the oxidative tricarboxylic acid (TCA) cycle. In vitro, we observed that IDH1MUT cancer cells have a higher basal respiration compared to IDH1WT cancer cells and inhibition of the IDH1MUT shifts the metabolism by decreasing oxygen consumption and increasing glycolysis. Our findings indicate that IDH1WT glioma have a typical Warburg phenotype whereas in IDH1MUT glioma the TCA cycle, rather than glycolytic lactate production, is the predominant metabolic pathway. Our data further suggest that the TCA in IDH1MUT glioma is driven by lactate and glutamate anaplerosis to facilitate production of α-KG, and ultimately D-2-HG. This metabolic rewiring may be a basis for novel therapies for IDH1MUT and IDH1WT glioma.

Metabolite profiling of human colon carcinoma--deregulation of TCA cycle and amino acid turnover.

PubMed

Denkert, Carsten; Budczies, Jan; Weichert, Wilko; Wohlgemuth, Gert; Scholz, Martin; Kind, Tobias; Niesporek, Silvia; Noske, Aurelia; Buckendahl, Anna; Dietel, Manfred; Fiehn, Oliver

2008-09-18

Apart from genetic alterations, development and progression of colorectal cancer has been linked to influences from nutritional intake, hyperalimentation, and cellular metabolic changes that may be the basis for new diagnostic and therapeutic approaches. However, in contrast to genomics and proteomics, comprehensive metabolomic investigations of alterations in malignant tumors have rarely been conducted. In this study we investigated a set of paired samples of normal colon tissue and colorectal cancer tissue with gas-chromatography time-of-flight mass-spectrometry, which resulted in robust detection of a total of 206 metabolites. Metabolic phenotypes of colon cancer and normal tissues were different at a Bonferroni corrected significance level of p=0.00170 and p=0.00005 for the first two components of an unsupervised PCA analysis. Subsequent supervised analysis found 82 metabolites to be significantly different at p<0.01. Metabolites were connected to abnormalities in metabolic pathways by a new approach that calculates the distance of each pair of metabolites in the KEGG database interaction lattice. Intermediates of the TCA cycle and lipids were found down-regulated in cancer, whereas urea cycle metabolites, purines, pyrimidines and amino acids were generally found at higher levels compared to normal colon mucosa. This study demonstrates that metabolic profiling facilitates biochemical phenotyping of normal and neoplastic colon tissue at high significance levels and points to GC-TOF-based metabolomics as a new method for molecular pathology investigations.

Metabolites Identified during Varied Doses of Aspergillus Species in Zea mays Grains, and Their Correlation with Aflatoxin Levels

PubMed Central

Chrysanthopoulos, Panagiotis K.; Hodson, Mark P.; Darnell, Ross; Korie, Sam

2018-01-01

Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol (R = 0.48) and turanose and (R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity. PMID:29735944

Urinary Loss of Tricarboxylic Acid Cycle Intermediates As Revealed by Metabolomics Studies: An Underlying Mechanism to Reduce Lipid Accretion by Whey Protein Ingestion?

PubMed Central

2015-01-01

Whey protein intake is associated with the modulation of energy metabolism and altered body composition both in human subjects and in animals, but the underlying mechanisms are not yet elucidated. We fed obesity-prone C57BL/6J mice high-fat diets with either casein (HF casein) or whey (HF whey) for 6 weeks. At equal energy intake and apparent fat and nitrogen digestibility, mice fed HF whey stored less energy as lipids, evident both as lower white adipose tissue mass and as reduced liver lipids, compared with HF-casein-fed mice. Explorative analyses of 48 h urine, both by 1H NMR and LC–MS metabolomic platforms, demonstrated higher urinary excretion of tricarboxylic acid (TCA) cycle intermediates citric acid and succinic acid (identified by both platforms), and cis-aconitic acid and isocitric acid (identified by LC–MS platform) in the HF whey, relative to in the HF-casein-fed mice. Targeted LC–MS analyses revealed higher citric acid and cis-aconitic acid concentrations in fed state plasma, but not in liver of HF-whey-fed mice. We propose that enhanced urinary loss of TCA cycle metabolites drain available substrates for anabolic processes, such as lipogenesis, thereby leading to reduced lipid accretion in HF-whey-fed compared to HF-casein-fed mice. PMID:24702026

A reverse glyoxylate shunt to build a non-native route from C-4 to C-2 in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mainguet, SE; Gronenberg, LS; Wong, SS

2013-09-01

Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C-4 carboxylates into two molecules of acetyl-CoA without loss of CO2.more » Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. (C) 2013 Elsevier Inc. All rights reserved.« less

A reverse glyoxylate shunt to build a non-native route from C4 to C2 in Escherichia coli.

PubMed

Mainguet, Samuel E; Gronenberg, Luisa S; Wong, Sio Si; Liao, James C

2013-09-01

Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C4 carboxylates into two molecules of acetyl-CoA without loss of CO2. Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. © 2013 Elsevier Inc. All rights reserved.

Renewable Bio-Solar Hydrogen Production: The Second Generation (Part B)

DTIC Science & Technology

2015-03-20

SUBJECT TERMS Biohydrogen, biofuels, cyanobacteria, photosynthesis, fermentation , transcription profiling, metabolic engineering, TCA cycle... fermentation in the cyanobacterium Arthrospira (Spirulina) maxima CS-328. Appl. Environ. Microbiol., 77: 7185-7194. 5. Zhang, S. and Bryant, D. A...glycogen is the preferred substrate during auto- fermentation . J. Biotech. 166: 65-75. 10. Kumaraswamy, G. K., Guerra, T., Qian, X., Zhang, S., Bryant

(13)C heteronuclear NMR studies of the interaction of cultured neurons and astrocytes and aluminum blockade of the preferential release of citrate from astrocytes.

PubMed

Meshitsuka, Shunsuke; Aremu, David A

2008-02-01

Citrate has been identified as a major tricarboxylic acid (TCA) cycle constituent preferentially released by astrocytes. We undertook the present study to examine further the nature of metabolic compartmentation in central nervous system tissues using (13)C-labeled glucose and to provide new information on the influence of aluminum on the metabolic interaction between neurons and astrocytes. Metabolites released into the culture medium from astrocytes and neuron-astrocyte coculture, as well as the perchloric acid extracts of the cells were analyzed using 2D (1)H and (13)C NMR spectroscopy. Astrocytes released citrate into the culture medium and the released citrate was consumed by neurons in coculture. Citrate release by astrocytes was blocked in the presence of aluminum, with progressive accumulation of citrate within the cells. We propose citrate supply is a more efficient energy source than lactate for neurons to produce ATP, especially in the hypoglycemic state on account of it being a direct component of the TCA cycle. Astrocytes may be the cellular compartment for aluminum accumulation as a citrate complex in the brain.

Streptomyces clavuligerus shows a strong association between TCA cycle intermediate accumulation and clavulanic acid biosynthesis.

PubMed

Ramirez-Malule, Howard; Junne, Stefan; Nicolás Cruz-Bournazou, Mariano; Neubauer, Peter; Ríos-Estepa, Rigoberto

2018-05-01

Clavulanic acid (CA) is produced by Streptomyces clavuligerus (S. clavuligerus) as a secondary metabolite. Knowledge about the carbon flux distribution along the various routes that supply CA precursors would certainly provide insights about metabolic performance. In order to evaluate metabolic patterns and the possible accumulation of tricarboxylic acid (TCA) cycle intermediates during CA biosynthesis, batch and subsequent continuous cultures with steadily declining feed rates were performed with glycerol as the main substrate. The data were used to in silico explore the metabolic capabilities and the accumulation of metabolic intermediates in S. clavuligerus. While clavulanic acid accumulated at glycerol excess, it steadily decreased at declining dilution rates; CA synthesis stopped when glycerol became the limiting substrate. A strong association of succinate, oxaloacetate, malate, and acetate accumulation with CA production in S. clavuligerus was observed, and flux balance analysis (FBA) was used to describe the carbon flux distribution in the network. This combined experimental and numerical approach also identified bottlenecks during the synthesis of CA in a batch and subsequent continuous cultivation and demonstrated the importance of this type of methodologies for a more advanced understanding of metabolism; this potentially derives valuable insights for future successful metabolic engineering studies in S. clavuligerus.

(13)C-metabolic flux analysis in S-adenosyl-L-methionine production by Saccharomyces cerevisiae.

PubMed

Hayakawa, Kenshi; Kajihata, Shuichi; Matsuda, Fumio; Shimizu, Hiroshi

2015-11-01

S-Adenosyl-L-methionine (SAM) is a major biological methyl group donor, and is used as a nutritional supplement and prescription drug. Yeast is used for the industrial production of SAM owing to its high intracellular SAM concentrations. To determine the regulation mechanisms responsible for such high SAM production, (13)C-metabolic flux analysis ((13)C-MFA) was conducted to compare the flux distributions in the central metabolism between Kyokai no. 6 (high SAM-producing) and S288C (control) strains. (13)C-MFA showed that the levels of tricarboxylic acid (TCA) cycle flux in SAM-overproducing strain were considerably increased compared to those in the S228C strain. Analysis of ATP balance also showed that a larger amount of excess ATP was produced in the Kyokai 6 strain because of increased oxidative phosphorylation. These results suggest that high SAM production in Kyokai 6 strains could be attributed to enhanced ATP regeneration with high TCA cycle fluxes and respiration activity. Thus, maintaining high respiration efficiency during cultivation is important for improving SAM production. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

The cellular and compartmental profile of mouse retinal glycolysis, tricarboxylic acid cycle, oxidative phosphorylation, and ~P transferring kinases

PubMed Central

Rueda, Elda M.; Johnson, Jerry E.; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J.; Sigel, Irena; Chaney, Shawnta Y.

2016-01-01

Purpose The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. Methods mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. Results The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The combined results indicate that glycolysis is regulated by the compartmental expression of hexokinase 2, pyruvate kinase M1, and pyruvate kinase M2 in photoreceptors, whereas the inner retinal neurons exhibit a lower capacity for glycolysis and aerobic glycolysis. Expression of nucleoside diphosphate kinase, mitochondria-associated adenylate kinase, and several mitochondria-associated creatine kinase isozymes was highest in the outer retina, whereas expression of cytosolic adenylate kinase and brain creatine kinase was higher in the cones, horizontal cells, and amacrine cells indicating the diversity of ATP-buffering strategies among retinal neurons. Based on the antibody intensities and the COX and LDH activity, Müller glial cells (MGCs) had the lowest capacity for glycolysis, aerobic glycolysis, and OXPHOS. However, they showed high expression of glutamate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate thiokinase, GABA transaminase, and ~P transferring kinases. This suggests that MGCs utilize TCA cycle anaplerosis and cataplerosis to generate GTP and ~P transferring kinases to produce ATP that supports MGC energy requirements. Conclusions Our comprehensive and integrated results reveal that the adult mouse retina expresses numerous isoforms of ATP synthesizing, regulating, and buffering genes; expresses differential cellular and compartmental levels of glycolytic, OXPHOS, TCA cycle, and ~P transferring kinase proteins; and exhibits differential layer-by-layer LDH and COX activity. New insights into cell-specific and compartmental ATP and GTP production, as well as utilization and buffering strategies and their relationship with known retinal and cellular functions, are discussed. Developing therapeutic strategies for neuroprotection and treating retinal deficits and degeneration in a cell-specific manner will require such knowledge. This work provides a platform for future research directed at identifying the molecular targets and proteins that regulate these processes. PMID:27499608

The cellular and compartmental profile of mouse retinal glycolysis, tricarboxylic acid cycle, oxidative phosphorylation, and ~P transferring kinases.

PubMed

Rueda, Elda M; Johnson, Jerry E; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J; Sigel, Irena; Chaney, Shawnta Y; Fox, Donald A

2016-01-01

The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The combined results indicate that glycolysis is regulated by the compartmental expression of hexokinase 2, pyruvate kinase M1, and pyruvate kinase M2 in photoreceptors, whereas the inner retinal neurons exhibit a lower capacity for glycolysis and aerobic glycolysis. Expression of nucleoside diphosphate kinase, mitochondria-associated adenylate kinase, and several mitochondria-associated creatine kinase isozymes was highest in the outer retina, whereas expression of cytosolic adenylate kinase and brain creatine kinase was higher in the cones, horizontal cells, and amacrine cells indicating the diversity of ATP-buffering strategies among retinal neurons. Based on the antibody intensities and the COX and LDH activity, Müller glial cells (MGCs) had the lowest capacity for glycolysis, aerobic glycolysis, and OXPHOS. However, they showed high expression of glutamate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate thiokinase, GABA transaminase, and ~P transferring kinases. This suggests that MGCs utilize TCA cycle anaplerosis and cataplerosis to generate GTP and ~P transferring kinases to produce ATP that supports MGC energy requirements. Our comprehensive and integrated results reveal that the adult mouse retina expresses numerous isoforms of ATP synthesizing, regulating, and buffering genes; expresses differential cellular and compartmental levels of glycolytic, OXPHOS, TCA cycle, and ~P transferring kinase proteins; and exhibits differential layer-by-layer LDH and COX activity. New insights into cell-specific and compartmental ATP and GTP production, as well as utilization and buffering strategies and their relationship with known retinal and cellular functions, are discussed. Developing therapeutic strategies for neuroprotection and treating retinal deficits and degeneration in a cell-specific manner will require such knowledge. This work provides a platform for future research directed at identifying the molecular targets and proteins that regulate these processes.

Cloning and Characterization of the Tetrocarcin A Gene Cluster from Micromonospora chalcea NRRL 11289 Reveals a Highly Conserved Strategy for Tetronate Biosynthesis in Spirotetronate Antibiotics▿ †

PubMed Central

Fang, Jie; Zhang, Yiping; Huang, Lijuan; Jia, Xinying; Zhang, Qi; Zhang, Xu; Tang, Gongli; Liu, Wen

2008-01-01

Tetrocarcin A (TCA), produced by Micromonospora chalcea NRRL 11289, is a spirotetronate antibiotic with potent antitumor activity and versatile modes of action. In this study, the biosynthetic gene cluster of TCA was cloned and localized to a 108-kb contiguous DNA region. In silico sequence analysis revealed 36 putative genes that constitute this cluster (including 11 for unusual sugar biosynthesis, 13 for aglycone formation, and 4 for glycosylations) and allowed us to propose the biosynthetic pathway of TCA. The formation of d-tetronitrose, l-amicetose, and l-digitoxose may begin with d-glucose-1-phosphate, share early enzymatic steps, and branch into different pathways by competitive actions of specific enzymes. Tetronolide biosynthesis involves the incorporation of a 3-C unit with a polyketide intermediate to form the characteristic spirotetronate moiety and trans-decalin system. Further substitution of tetronolide with five deoxysugars (one being a deoxynitrosugar) was likely due to the activities of four glycosyltransferases. In vitro characterization of the first enzymatic step by utilization of 1,3-biphosphoglycerate as the substrate and in vivo cross-complementation of the bifunctional fused gene tcaD3 (with the functions of chlD3 and chlD4) to ΔchlD3 and ΔchlD4 in chlorothricin biosynthesis supported the highly conserved tetronate biosynthetic strategy in the spirotetronate family. Deletion of a large DNA fragment encoding polyketide synthases resulted in a non-TCA-producing strain, providing a clear background for the identification of novel analogs. These findings provide insights into spirotetronate biosynthesis and demonstrate that combinatorial-biosynthesis methods can be applied to the TCA biosynthetic machinery to generate structural diversity. PMID:18586939

Contribution of filamentous fungi to the musty odorant 2,4,6-trichloroanisole in water supply reservoirs and associated drinking water treatment plants.

PubMed

Bai, Xiuzhi; Zhang, Ting; Qu, Zhipeng; Li, Haipu; Yang, Zhaoguang

2017-09-01

In this study, the distribution of 2,4,6-trichloroanisole (2,4,6-TCA) in two water supply reservoirs and four associated drinking water treatment plants (DWTPs) were investigated. The 2,4,6-TCA concentrations were in the range of 1.53-2.36 ng L -1 in water supply reservoirs and 0.76-6.58 ng L -1 at DWTPs. To determine the contribution of filamentous fungi to 2,4,6-TCA in a full-scale treatment process, the concentrations of 2,4,6-TCA in raw water, settled water, post-filtration water, and finished water were measured. The results showed that 2,4,6-TCA levels continuously increased until chlorination, suggesting that 2,4,6-TCA could form without a chlorination reaction and fungi might be the major contributor to the 2,4,6-TCA formation. Meanwhile, twenty-nine fungal strains were isolated and identified by morphological and molecular biological methods. Of the seventeen isolated fungal species, eleven showed the capability to convert 2,4,6-trichlorophenol (2,4,6-TCP) to 2,4,6-TCA. The highest level of 2,4,6-TCA formation was carried out by Aspergillus versicolor voucher BJ1-3: 40.5% of the original 2,4,6-TCP was converted to 2,4,6-TCA. There was a significant variation in the capability of different species to generate 2,4,6-TCA. The results from the proportions of cell-free, cell-attached, and cell-bound 2,4,6-TCA suggested that 2,4,6-TCA generated by fungi was mainly distributed in their extracellular environment. In addition to 2,4,6-TCA, five putative volatile by-products were also identified by gas chromatography and mass spectrometry. These findings increase our understanding on the mechanisms involved in the formation of 2,4,6-TCA and provide insights into managing and controlling 2,4,6-TCA-related problems in drinking water. Copyright © 2017 Elsevier Ltd. All rights reserved.

Metabolic changes associated with tumor metastasis, part 2: Mitochondria, lipid and amino acid metabolism.

PubMed

Porporato, Paolo E; Payen, Valéry L; Baselet, Bjorn; Sonveaux, Pierre

2016-04-01

Metabolic alterations are a hallmark of cancer controlling tumor progression and metastasis. Among the various metabolic phenotypes encountered in tumors, this review focuses on the contributions of mitochondria, lipid and amino acid metabolism to the metastatic process. Tumor cells require functional mitochondria to grow, proliferate and metastasize, but shifts in mitochondrial activities confer pro-metastatic traits encompassing increased production of mitochondrial reactive oxygen species (mtROS), enhanced resistance to apoptosis and the increased or de novo production of metabolic intermediates of the TCA cycle behaving as oncometabolites, including succinate, fumarate, and D-2-hydroxyglutarate that control energy production, biosynthesis and the redox state. Lipid metabolism and the metabolism of amino acids, such as glutamine, glutamate and proline are also currently emerging as focal control points of cancer metastasis.

An Integrated Multi-Omics Study Revealed Metabolic Alterations Underlying the Effects of Coffee Consumption

PubMed Central

Takahashi, Shoko; Saito, Kenji; Jia, Huijuan; Kato, Hisanori

2014-01-01

Many epidemiological studies have indicated that coffee consumption may reduce the risks of developing obesity and diabetes, but the underlying mechanisms of these effects are poorly understood. Our previous study revealed the changes on gene expression profiles in the livers of C57BL/6J mice fed a high-fat diet containing three types of coffee (caffeinated, decaffeinated and green unroasted coffee), using DNA microarrays. The results revealed remarkable alterations in lipid metabolism-related molecules which may be involved in the anti-obesity effects of coffee. We conducted the present study to further elucidate the metabolic alterations underlying the effects of coffee consumption through comprehensive proteomic and metabolomic analyses. Proteomics revealed an up-regulation of isocitrate dehydrogenase (a key enzyme in the TCA cycle) and its related proteins, suggesting increased energy generation. The metabolomics showed an up-regulation of metabolites involved in the urea cycle, with which the transcriptome data were highly consistent, indicating accelerated energy expenditure. The TCA cycle and the urea cycle are likely be accelerated in a concerted manner, since they are directly connected by mutually providing each other's intermediates. The up-regulation of these pathways might result in a metabolic shift causing increased ATP turnover, which is related to the alterations of lipid metabolism. This mechanism may play an important part in the suppressive effects of coffee consumption on obesity, inflammation, and hepatosteatosis. This study newly revealed global metabolic alterations induced by coffee intake, providing significant insights into the association between coffee intake and the prevention of type 2 diabetes, utilizing the benefits of multi-omics analyses. PMID:24618914

TCA High Lift Preliminary Assessment

NASA Technical Reports Server (NTRS)

Wyatt, G. H.; Polito, R. C.; Yeh, D. T.; Elzey, M. E.; Tran, J. T.; Meredith, Paul T.

1999-01-01

This paper presents a TCA (Technology Concept Airplane) High lift Preliminary Assessment. The topics discussed are: 1) Model Description; 2) Data Repeatability; 3) Effect of Inboard L.E. (Leading Edge) Flap Span; 4) Comparison of 14'x22' TCA-1 With NTF (National Transonic Facility) Modified Ref. H; 5) Comparison of 14'x22' and NTF Ref. H Results; 6) Effect of Outboard Sealed Slat on TCA; 7) TCA Full Scale Build-ups; 8) Full Scale L/D Comparisons; 9) TCA Full Scale; and 10) Touchdown Lift Curves. This paper is in viewgraph form.

The NASA Constellation University Institutes Project: Thrust Chamber Assembly Virtual Institute

NASA Technical Reports Server (NTRS)

Tucker, P. Kevin; Rybak, Jeffry A.; Hulka, James R.; Jones, Gregg W.; Nesman, Tomas; West, Jeffrey S.

2006-01-01

This paper documents key aspects of the Constellation University Institutes Project (CUIP) Thrust Chamber Assembly (TCA) Virtual Institute (VI). Specifically, the paper details the TCA VI organizational and functional aspects relative to providing support for Constellation Systems. The TCA VI vision is put forth and discussed in detail. The vision provides the objective and approach for improving thrust chamber assembly design methodologies by replacing the current empirical tools with verified and validated CFD codes. The vision also sets out ignition, performance, thermal environments and combustion stability as focus areas where application of these improved tools is required. Flow physics and a study of the Space Shuttle Main Engine development program are used to conclude that the injector is the key to robust TCA design. Requirements are set out in terms of fidelity, robustness and demonstrated accuracy of the design tool. Lack of demonstrated accuracy is noted as the most significant obstacle to realizing the potential of CFD to be widely used as an injector design tool. A hierarchical decomposition process is outlined to facilitate the validation process. A simulation readiness level tool used to gauge progress toward the goal is described. Finally, there is a description of the current efforts in each focus area. The background of each focus area is discussed. The state of the art in each focus area is noted along with the TCA VI research focus in the area. Brief highlights of work in the area are also included.

Acclimation to Chronic O3 in Field-grown Soybean is Characterized by Increased Levels of TCA Cycle Transcripts and ROS Scavenging Compounds in Addition to Decreased Photosynthetic Capacity

USDA-ARS?s Scientific Manuscript database

Tropospheric ozone (O3) is a pollutant that is generated by volatile organic compounds, nitrogen oxides and sunlight. When plants take in O3 through stomata, harmful reactive oxygen species (ROS) are produced that induce the production of ROS scavenging antioxidants. Climate change predictions indic...

U.S. Army Research Laboratory Annual Review 2011

DTIC Science & Technology

2011-12-01

pioneered a defect reduction process using thermal cycle annealing (TCA) for improving mercury cadmium telluride ( MCT ) grown on scalable silicon (Si...substrates. Currently, the use of MCT -- a mainstay material for Army infrared (IR) systems -- is limited due to high levels of dislocations when...grown on scalable substrates such as Si (an inexpensive substrate material). These dislocations increase pixel noise and limit IR focal plane array

Improving intestinal absorption and oral bioavailability of curcumin via taurocholic acid-modified nanostructured lipid carriers.

PubMed

Tian, Cihui; Asghar, Sajid; Wu, Yifan; Chen, Zhipeng; Jin, Xin; Yin, Lining; Huang, Lin; Ping, Qineng; Xiao, Yanyu

2017-01-01

The expression of multiple receptors on intestinal epithelial cells enables an actively targeted carrier to significantly enhance the oral delivery of payloads. Conjugating the receptors' ligands on the surfaces of a particulate-delivery system allows site-specific targeting. Here, we used taurocholic acid (TCA) as a ligand for uptake of nanostructured lipid carriers (NLCs) mediated by a bile-acid transporter to improve oral bioavailability of curcumin (Cur). First, synthesis of TCA-polyethylene glycol 100-monostearate (S100-TCA) was carried out. Then, the physical and chemical properties of S100-TCA-modified Cur-loaded NLCs (Cur-TCA NLCs) with varying levels of S100-TCA modifications were investigated. Small particle size (<150 nm), high drug encapsulation (>90%), drug loading (about 3%), negative ζ-potential (-7 to -3 mV), and sustained release were obtained. In situ intestinal perfusion studies demonstrated improved absorption rate and permeability coefficient of Cur-TCA NLCs. Depending on the degree of modification, Cur-TCA NLCs displayed about a five- to 15-fold higher area under the curve in rats after oral administration than unmodified Cur NLCs, which established that the addition of S100-TCA to the NLCs boosted absorption of Cur. Further investigations of TCA NLCs might reveal a bright future for effective oral delivery of poorly bioavailable drugs.

New Method for the Approximation of Corrected Calcium Concentrations in Chronic Kidney Disease Patients.

PubMed

Kaku, Yoshio; Ookawara, Susumu; Miyazawa, Haruhisa; Ito, Kiyonori; Ueda, Yuichirou; Hirai, Keiji; Hoshino, Taro; Mori, Honami; Yoshida, Izumi; Morishita, Yoshiyuki; Tabei, Kaoru

2016-02-01

The following conventional calcium correction formula (Payne) is broadly applied for serum calcium estimation: corrected total calcium (TCa) (mg/dL) = TCa (mg/dL) + (4 - albumin (g/dL)); however, it is inapplicable to chronic kidney disease (CKD) patients. A total of 2503 venous samples were collected from 942 all-stage CKD patients, and levels of TCa (mg/dL), ionized calcium ([iCa(2+) ] mmol/L), phosphate (mg/dL), albumin (g/dL), and pH, and other clinical parameters were measured. We assumed corrected TCa (the gold standard) to be equal to eight times the iCa(2+) value (measured corrected TCa). Then, we performed stepwise multiple linear regression analysis by using the clinical parameters and derived a simple formula for corrected TCa approximation. The following formula was devised from multiple linear regression analysis: Approximated  corrected TCa (mg/dL) = TCa + 0.25 × (4 - albumin) + 4 × (7.4 - p H) + 0.1 × (6 - phosphate) + 0.3. Receiver operating characteristic curves analysis illustrated that area under the curve of approximated corrected TCa for detection of measured corrected TCa ≥ 8.4 mg/dL and ≤ 10.4 mg/dL were 0.994 and 0.919, respectively. The intraclass correlation coefficient demonstrated superior agreement using this new formula compared to other formulas (new formula: 0.826, Payne: 0.537, Jain: 0.312, Portale: 0.582, Ferrari: 0.362). In CKD patients, TCa correction should include not only albumin but also pH and phosphate. The approximated corrected TCa from this formula demonstrates superior agreement with the measured corrected TCa in comparison to other formulas. © 2016 International Society for Apheresis, Japanese Society for Apheresis, and Japanese Society for Dialysis Therapy.

Fungal strains isolated from cork stoppers and the formation of 2,4,6-trichloroanisole involved in the cork taint of wine.

PubMed

Prak, Sina; Gunata, Ziya; Guiraud, Joseph-Pierre; Schorr-Galindo, Sabine

2007-05-01

Cork taint is mainly due to 2,4,6-trichloroanisole (TCA) produced through the activity of undesirable fungal strains. We observed that CFU mould number in TCA-containing stoppers was not quantitatively different to that of the stoppers not containing TCA (ca. 10(5)CFU/g). In contrast more fungi diversity was observed in TCA-containing stoppers. Penicillium spp (Penicillium chrysogenum, Penicillium glabrum), Aspergillus spp (Aspergillus niger and Aspergillus oryzae), Chrysonilia sitophila, Mucor racemosus, Paecilomyces sp. and Trichoderma viride were found in TCA-containing stoppers, while C. sitophila and Penicillium sp. were the main fungi in the stoppers devoid of TCA. Conidia were numerous close to the lenticels and present from the lateral surface through to the centre of the stoppers. Strains of Aspergillus, Mucor, Paecilomyces, Penicillium and Trichoderma isolated from TCA-containing stoppers were able to convert 2,4,6-trichlorophenol (TCP) in TCA in resting cell or growing conditions. The best yields of conversion were obtained by green fungi Paecilomyces sp. and P. chrysogenum, 17% and 20%, respectively. Chysonilia sitophila and Penicillium sp. did not produce TCA from TCP in our conditions.

Tyrosine phosphorylation of dihydrolipoamide dehydrogenase as a potential cadmium target and its inhibitory role in regulating mouse sperm motility.

PubMed

Li, Xinhong; Wang, Lirui; Li, Yuhua; Fu, Jieli; Zhen, Linqing; Yang, Qiangzhen; Li, Sisi; Zhang, Yukun

2016-05-16

Cadmium (Cd) is reported to reduce sperm motility and functions. However, the molecular mechanisms of Cd-induced toxicity remain largely unknown, presenting a major knowledge gap in research on reproductive toxicology. In the present study, we identified a candidate protein, dihydrolipoamide dehydrogenase (DLD), which is a post-pyruvate metabolic enzyme, exhibiting tyrosine phosphorylation in mouse sperm exposed to Cd both in vivo and in vitro. Immunoprecipitation assay demonstrated DLD was phosphorylated in tyrosine residues without altered expression after Cd treatment, which further confirmed our identified result. However, the tyrosine phosphorylation of DLD did not participate in mouse sperm capacitation and Bovine Serum Albumin (BSA) effectively prevented the tyrosine phosphorylation of DLD. Moreover, Cd-induced tyrosine phosphorylation of DLD lowered its dehydrogenase activity and meanwhile, Nicotinamide Adenine Dinucleotide Hydrogen (NADH) content, Adenosine Triphosphate (ATP) production and sperm motility were all inhibited by Cd. Interestingly, when the tyrosine phosphorylation of DLD was blocked by BSA, the decrease of DLD activity, NADH and ATP content as well as sperm motility was also suppressed simultaneously. These results suggested that Cd-induced tyrosine phosphorylation of DLD inhibited its activity and thus suppressed the tricarboxylic acid (TCA) cycle, which resulted in the reduction of NADH and hence the ATP production generated through oxidative phosphorylation (OPHOXS). Taken together, our results revealed that Cd induced DLD tyrosine phosphorylation, in response to regulate TCA metabolic pathway, which reduced ATP levels and these negative effects led to decreased sperm motility. This study provided new understanding of the mechanisms contributing to the harmful effects of Cd on the motility and function of spermatozoa. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Metabolomics approach reveals metabolic disorders and potential biomarkers associated with the developmental toxicity of tetrabromobisphenol A and tetrachlorobisphenol A

NASA Astrophysics Data System (ADS)

Ye, Guozhu; Chen, Yajie; Wang, Hong-Ou; Ye, Ting; Lin, Yi; Huang, Qiansheng; Chi, Yulang; Dong, Sijun

2016-10-01

Tetrabromobisphenol A and tetrachlorobisphenol A are halogenated bisphenol A (H-BPA), and has raised concerns about their adverse effects on the development of fetuses and infants, however, the molecular mechanisms are unclear, and related metabolomics studies are limited. Accordingly, a metabolomics study based on gas chromatography-mass spectrometry was employed to elucidate the molecular developmental toxicology of H-BPA using the marine medaka (Oryzias melastigmas) embryo model. Here, we revealed decreased synthesis of nucleosides, amino acids and lipids, and disruptions in the TCA (tricarboxylic acid) cycle, glycolysis and lipid metabolism, thus inhibiting the developmental processes of embryos exposed to H-BPA. Unexpectedly, we observed enhanced neural activity accompanied by lactate accumulation and accelerated heart rates due to an increase in dopamine pathway and a decrease in inhibitory neurotransmitters following H-BPA exposure. Notably, disorders of the neural system, and disruptions in glycolysis, the TCA cycle, nucleoside metabolism, lipid metabolism, glutamate and aspartate metabolism induced by H-BPA exposure were heritable. Furthermore, lactate and dopa were identified as potential biomarkers of the developmental toxicity of H-BPA and related genetic effects. This study has demonstrated that the metabolomics approach is a useful tool for obtaining comprehensive and novel insights into the molecular developmental toxicity of environmental pollutants.

Cellular metabolic energy modulation by tangeretin in 7,12-dimethylbenz(a) anthracene-induced breast cancer.

PubMed

Periyasamy, Kuppusamy; Sivabalan, Venkatachalam; Baskaran, Kuppusamy; Kasthuri, Kannayiram; Sakthisekaran, Dhanapal

2016-03-01

Breast cancer is the leading cause of death among women worldwide. Chemoprevention and chemotherapy play beneficial roles in reducing the incidence and mortality of cancer. Epidemiological and experimental studies showed that naturally-occurring antioxidants present in the diet may act as anticancer agents. Identifying the abnormalities of cellular energy metabolism facilitates early detection and management of breast cancer. The present study evaluated the effect of tangeretin on cellular metabolic energy fluxes in 7,12-dimethylbenz(a) anthracene (DMBA)-induced proliferative breast cancer. The results showed that the activities of glycolytic enzymes significantly increased in mammary tissues of DMBA-induced breast cancer bearing rats. The gluconeogenic tricarboxylic acid (TCA) cycle and respiratory chain enzyme activities significantly decreased in breast cancer-bearing rats. In addition, proliferating cell nuclear antigen (PCNA) was highly expressed in breast cancer tissues. However, the activities of glycolytic enzymes were significantly normalized in the tangeretin pre- and post-treated rats and the TCA cycle and respiratory chain enzyme activities were significantly increased in tangeretin treated rats. Furthermore, tangeretin down-regulated PCNA expression on breast cancer-bearing rats. Our study demonstrates that tangeretin specifically regulates cellular metabolic energy fluxes in DMBA-induced breast cancer-bearing rats. © 2016 by the Journal of Biomedical Research. All rights reserved.

IKKβ promotes metabolic adaptation to glutamine deprivation via phosphorylation and inhibition of PFKFB3

PubMed Central

Reid, Michael A.; Lowman, Xazmin H.; Pan, Min; Tran, Thai Q.; Warmoes, Marc O.; Ishak Gabra, Mari B.; Yang, Ying; Locasale, Jason W.; Kong, Mei

2016-01-01

Glutamine is an essential nutrient for cancer cell survival and proliferation. Enhanced utilization of glutamine often depletes its local supply, yet how cancer cells adapt to low glutamine conditions is largely unknown. Here, we report that IκB kinase β (IKKβ) is activated upon glutamine deprivation and is required for cell survival independently of NF-κB transcription. We demonstrate that IKKβ directly interacts with and phosphorylates 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase isoform 3 (PFKFB3), a major driver of aerobic glycolysis, at Ser269 upon glutamine deprivation to inhibit its activity, thereby down-regulating aerobic glycolysis when glutamine levels are low. Thus, due to lack of inhibition of PFKFB3, IKKβ-deficient cells exhibit elevated aerobic glycolysis and lactate production, leading to less glucose carbons contributing to tricarboxylic acid (TCA) cycle intermediates and the pentose phosphate pathway, which results in increased glutamine dependence for both TCA cycle intermediates and reactive oxygen species suppression. Therefore, coinhibition of IKKβ and glutamine metabolism results in dramatic synergistic killing of cancer cells both in vitro and in vivo. In all, our results uncover a previously unidentified role of IKKβ in regulating glycolysis, sensing low-glutamine-induced metabolic stress, and promoting cellular adaptation to nutrient availability. PMID:27585591

Metabolic Profiling in Association with Vascular Endothelial Cell Dysfunction Following Non-Toxic Cadmium Exposure

PubMed Central

Li, Xiaofei; Nong, Qingjiao; Mao, Baoyu; Pan, Xue

2017-01-01

This study aimed to determine the metabolic profile of non-toxic cadmium (Cd)-induced dysfunctional endothelial cells using human umbilical vein endothelial cells (HUVECs). HUVECs (n = 6 per group) were treated with 0, 1, 5, or 10 μM cadmium chloride (CdCl2) for 48 h. Cell phenotypes, including nitric oxide (NO) production, the inflammatory response, and oxidative stress, were evaluated in Cd-exposed and control HUVECs. Cd-exposed and control HUVECs were analysed using gas chromatography time-of-flight/mass spectrometry. Compared to control HUVECs, Cd-exposed HUVECs were dysfunctional, exhibiting decreased NO production, a proinflammatory state, and non-significant oxidative stress. Further metabolic profiling revealed 24 significantly-altered metabolites in the dysfunctional endothelial cells. The significantly-altered metabolites were involved in the impaired tricarboxylic acid (TCA) cycle, activated pyruvate metabolism, up-regulated glucogenic amino acid metabolism, and increased pyrimidine metabolism. The current metabolic findings further suggest that the metabolic changes linked to TCA cycle dysfunction, glycosylation of the hexosamine biosynthesis pathway (HBP), and compensatory responses to genomic instability and energy deficiency may be generally associated with dysfunctional phenotypes, characterized by decreased NO production, a proinflammatory state, and non-significant oxidative stress, in endothelial cells following non-toxic Cd exposure. PMID:28872622

Metabolic flux analysis of the halophilic archaeon Haladaptatus paucihalophilus.

PubMed

Liu, Guangxiu; Zhang, Manxiao; Mo, Tianlu; He, Lian; Zhang, Wei; Yu, Yi; Zhang, Qi; Ding, Wei

2015-11-27

This work reports the (13)C-assisted metabolic flux analysis of Haladaptatus paucihalophilus, a halophilic archaeon possessing an intriguing osmoadaption mechanism. We showed that the carbon flow is through the oxidative tricarboxylic acid (TCA) cycle whereas the reductive TCA cycle is not operative in H. paucihalophilus. In addition, both threonine and the citramalate pathways contribute to isoleucine biosynthesis, whereas lysine is synthesized through the diaminopimelate pathway and not through the α-aminoadipate pathway. Unexpected, the labeling patterns of glycine from the cells grown on [1-(13)C]pyruvate and [2-(13)C]pyruvate suggest that, unlike all the organisms investigated so far, in which glycine is produced exclusively from the serine hydroxymethyltransferase (SHMT) pathway, glycine biosynthesis in H. paucihalophilus involves different pathways including SHMT, threonine aldolase (TA) and the reverse reaction of glycine cleavage system (GCS), demonstrating for the first time that other pathways instead of SHMT can also make a significant contribution to the cellular glycine pool. Transcriptional analysis confirmed that both TA and GCS genes were transcribed in H. paucihalophilus, and the transcriptional level is independent of salt concentrations in the culture media. This study expands our understanding of amino acid biosynthesis and provides valuable insights into the metabolism of halophilic archaea. Copyright © 2015 Elsevier Inc. All rights reserved.

Cortex and hippocampus DNA epigenetic response to a long-term arsenic exposure via drinking water.

PubMed

Du, Xiaoyan; Tian, Meiping; Wang, Xiaoxue; Zhang, Jie; Huang, Qingyu; Liu, Liangpo; Shen, Heqing

2018-03-01

The neurotoxicity of arsenic is a serious health problem, especially for children. DNA epigenetic change may be an important pathogenic mechanism, but the molecular pathway remains obscure. In this study, the weaned male Sprague-Dawly (SD) rats were treated with arsenic trioxide via drinking water for 6 months, simulating real developmental exposure situation of children. Arsenic exposure impaired the cognitive abilities, and altered the expression of neuronal activity-regulated genes. Total arsenic concentrations of cortex and hippocampus tissues were significantly increased in a dose-dependent manner. The reduction in 5-methylcytosine (5 mC) and 5-hydroxymethylcytosine (5hmC) levels as well as the down-regulation of DNA methyltransferases (DNMTs) and ten-eleven translocations (TETs) expression suggested that DNA methylation/demethylation processes were significantly suppressed in brain tissues. S-adenosylmethionine (SAM) level wasn't changed, but the expression of the important indicators of oxidative/anti-oxidative balance and tricarboxylic acid (TCA) cycle was significantly deregulated. Overall, arsenic can disrupt oxidative/anti-oxidative balance, further inhibit TETs expression through TCA cycle and alpha-ketoglutarate (α-KG) pathway, and consequently cause DNA methylation/demethylation disruption. The present study implies oxidative stress but not SAM depletion may lead to DNA epigenetic alteration and arsenic neurotoxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Functional laser speckle imaging of cerebral blood flow under hypothermia

NASA Astrophysics Data System (ADS)

Li, Minheng; Miao, Peng; Zhu, Yisheng; Tong, Shanbao

2011-08-01

Hypothermia can unintentionally occur in daily life, e.g., in cardiovascular surgery or applied as therapeutics in the neurosciences critical care unit. So far, the temperature-induced spatiotemporal responses of the neural function have not been fully understood. In this study, we investigated the functional change in cerebral blood flow (CBF), accompanied with neuronal activation, by laser speckle imaging (LSI) during hypothermia. Laser speckle images from Sprague-Dawley rats (n = 8, male) were acquired under normothermia (37°C) and moderate hypothermia (32°C). For each animal, 10 trials of electrical hindpaw stimulation were delivered under both temperatures. Using registered laser speckle contrast analysis and temporal clustering analysis (TCA), we found a delayed response peak and a prolonged response window under hypothermia. Hypothermia also decreased the activation area and the amplitude of the peak CBF. The combination of LSI and TCA is a high-resolution functional imaging method to investigate the spatiotemporal neurovascular coupling in both normal and pathological brain functions.

Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.

PubMed

Michalik, Stephan; Bernhardt, Jörg; Otto, Andreas; Moche, Martin; Becher, Dörte; Meyer, Hanna; Lalk, Michael; Schurmann, Claudia; Schlüter, Rabea; Kock, Holger; Gerth, Ulf; Hecker, Michael

2012-09-01

The cellular amount of proteins not only depends on synthesis but also on degradation. Here, we expand the understanding of differential protein levels by complementing synthesis data with a proteome-wide, mass spectrometry-based stable isotope labeling with amino acids in cell culture analysis of protein degradation in the human pathogen Staphylococcus aureus during glucose starvation. Monitoring protein stability profiles in a wild type and an isogenic clpP protease mutant revealed that 1) proteolysis mainly affected proteins with vegetative functions, anabolic and selected catabolic enzymes, whereas the expression of TCA cycle and gluconeogenesis enzymes increased; 2) most proteins were prone to aggregation in the clpP mutant; 3) the absence of ClpP correlated with protein denaturation and oxidative stress responses, deregulation of virulence factors and a CodY repression. We suggest that degradation of redundant, inactive proteins disintegrated from functional complexes and thereby amenable to proteolytic attack is a fundamental cellular process in all organisms to regain nutrients and guarantee protein homeostasis.

Life and Death of Proteins: A Case Study of Glucose-starved Staphylococcus aureus*

PubMed Central

Michalik, Stephan; Bernhardt, Jörg; Otto, Andreas; Moche, Martin; Becher, Dörte; Meyer, Hanna; Lalk, Michael; Schurmann, Claudia; Schlüter, Rabea; Kock, Holger; Gerth, Ulf; Hecker, Michael

2012-01-01

The cellular amount of proteins not only depends on synthesis but also on degradation. Here, we expand the understanding of differential protein levels by complementing synthesis data with a proteome-wide, mass spectrometry-based stable isotope labeling with amino acids in cell culture analysis of protein degradation in the human pathogen Staphylococcus aureus during glucose starvation. Monitoring protein stability profiles in a wild type and an isogenic clpP protease mutant revealed that 1) proteolysis mainly affected proteins with vegetative functions, anabolic and selected catabolic enzymes, whereas the expression of TCA cycle and gluconeogenesis enzymes increased; 2) most proteins were prone to aggregation in the clpP mutant; 3) the absence of ClpP correlated with protein denaturation and oxidative stress responses, deregulation of virulence factors and a CodY repression. We suggest that degradation of redundant, inactive proteins disintegrated from functional complexes and thereby amenable to proteolytic attack is a fundamental cellular process in all organisms to regain nutrients and guarantee protein homeostasis. PMID:22556279

Mitochondrial protein hyperacetylation in the failing heart

PubMed Central

Horton, Julie L.; Martin, Ola J.; Lai, Ling; Richards, Alicia L.; Vega, Rick B.; Leone, Teresa C.; Pagliarini, David J.; Muoio, Deborah M.; Bedi, Kenneth C.; Coon, Joshua J.

2016-01-01

Myocardial fuel and energy metabolic derangements contribute to the pathogenesis of heart failure. Recent evidence implicates posttranslational mechanisms in the energy metabolic disturbances that contribute to the pathogenesis of heart failure. We hypothesized that accumulation of metabolite intermediates of fuel oxidation pathways drives posttranslational modifications of mitochondrial proteins during the development of heart failure. Myocardial acetylproteomics demonstrated extensive mitochondrial protein lysine hyperacetylation in the early stages of heart failure in well-defined mouse models and the in end-stage failing human heart. To determine the functional impact of increased mitochondrial protein acetylation, we focused on succinate dehydrogenase A (SDHA), a critical component of both the tricarboxylic acid (TCA) cycle and respiratory complex II. An acetyl-mimetic mutation targeting an SDHA lysine residue shown to be hyperacetylated in the failing human heart reduced catalytic function and reduced complex II–driven respiration. These results identify alterations in mitochondrial acetyl-CoA homeostasis as a potential driver of the development of energy metabolic derangements that contribute to heart failure. PMID:26998524

Mitochondrial protein hyperacetylation in the failing heart.

PubMed

Horton, Julie L; Martin, Ola J; Lai, Ling; Riley, Nicholas M; Richards, Alicia L; Vega, Rick B; Leone, Teresa C; Pagliarini, David J; Muoio, Deborah M; Bedi, Kenneth C; Margulies, Kenneth B; Coon, Joshua J; Kelly, Daniel P

2016-02-01

Myocardial fuel and energy metabolic derangements contribute to the pathogenesis of heart failure. Recent evidence implicates posttranslational mechanisms in the energy metabolic disturbances that contribute to the pathogenesis of heart failure. We hypothesized that accumulation of metabolite intermediates of fuel oxidation pathways drives posttranslational modifications of mitochondrial proteins during the development of heart failure. Myocardial acetylproteomics demonstrated extensive mitochondrial protein lysine hyperacetylation in the early stages of heart failure in well-defined mouse models and the in end-stage failing human heart. To determine the functional impact of increased mitochondrial protein acetylation, we focused on succinate dehydrogenase A (SDHA), a critical component of both the tricarboxylic acid (TCA) cycle and respiratory complex II. An acetyl-mimetic mutation targeting an SDHA lysine residue shown to be hyperacetylated in the failing human heart reduced catalytic function and reduced complex II-driven respiration. These results identify alterations in mitochondrial acetyl-CoA homeostasis as a potential driver of the development of energy metabolic derangements that contribute to heart failure.

Proteome map of Aspergillus nidulans during osmoadaptation.

PubMed

Kim, Yonghyun; Nandakumar, M P; Marten, Mark R

2007-09-01

The model filamentous fungus Aspergillus nidulans, when grown in a moderate level of osmolyte (+0.6M KCl), was previously found to have a significantly reduced cell wall elasticity (Biotech Prog, 21:292, 2005). In this study, comparative proteomic analysis via two-dimensional gel electrophoresis (2de) and matrix-assisted laser desorption ionization/time-of-flight (MALDI-TOF) mass spectrometry was used to assess molecular level events associated with this phenomenon. Thirty of 90 differentially expressed proteins were identified. Sequence homology and conserved domains were used to assign probable function to twenty-one proteins currently annotated as "hypothetical." In osmoadapted cells, there was an increased expression of glyceraldehyde-3-phosphate dehydrogenase and aldehyde dehydrogenase, as well as a decreased expression of enolase, suggesting an increased glycerol biosynthesis and decreased use of the TCA cycle. There also was an increased expression of heat shock proteins and Shp1-like protein degradation protein, implicating increased protein turnover. Five novel osmoadaptation proteins of unknown functions were also identified.

Effects of tretinoin pretreatment on TCA chemical peel in guinea pig skin.

PubMed Central

Kim, I. H.; Kim, H. K.; Kye, Y. C.

1996-01-01

This study was done to characterize the structural changes in the tretinoin pretreatment on trichloroacetic acid(TCA) chemical peel. In guinea pigs, the right halves pretreated with tretinoin and the left halves treated nothing were compared in their structural changes after TCA chemical peel. Epidermal thickness in the tretinoin pretreated group was almost the same in the first and second week. But epidermis of the TCA group increased continuously. In the first week, mitotic figures in the epidermis were more increased in the TCA group, but those in hair follicles were more increased in the tretinoin pretreated group. In the second week, mitotic figures in the epidermis were almost same in both group, but in hair follicles of the tretinoin pretreated group, mitotic figures were much more increased. In alcian blue staining, glycosaminoglycan was stained much more strongly in dermis of the TCA group in first week, but was more strongly stained in the tretinoin pretreated group in second week. On electron microscopic findings, the fibroblasts in upper dermis were larger and had plentier cytoplasm with more organelles in the tretinoin pretreated group. Conclusively, tretinoin pretreatment on TCA chemical peel sustained the effects of TCA longer and showed synergistic effects of TCA and induced enhanced wound healing. PMID:8878803

Combined effects of a high-fat diet and chronic valproic acid treatment on hepatic steatosis and hepatotoxicity in rats

PubMed Central

Zhang, Li-fang; Liu, Ling-sheng; Chu, Xiao-man; Xie, Hao; Cao, Li-juan; Guo, Cen; A, Ji-ye; Cao, Bei; Li, Meng-jie; Wang, Guang-ji; Hao, Hai-ping

2014-01-01

Aim: To investigate the potential interactive effects of a high-fat diet (HFD) and valproic acid (VPA) on hepatic steatosis and hepatotoxicity in rats. Methods: Male SD rats were orally administered VPA (100 or 500 mg·kg−1·d−1) combined with HFD or a standard diet for 8 weeks. Blood and liver samples were analyzed to determine lipid levels and hepatic function biomarkers using commercial kit assays. Low-molecular-weight compounds in serum, urine and bile samples were analyzed using a metabonomic approach based on GC/TOF-MS. Results: HFD alone induced extensive hepatocyte steatosis and edema in rats, while VPA alone did not cause significant liver lesions. VPA significantly aggravated HFD-induced accumulation of liver lipids, and caused additional spotty or piecemeal necrosis, accompanied by moderate infiltration of inflammatory cells in the liver. Metabonomic analysis of serum, urine and bile samples revealed that HFD significantly increased the levels of amino acids, free fatty acids (FFAs) and 3-hydroxy-butanoic acid, whereas VPA markedly decreased the levels of amino acids, FFAs and the intermediate products of the tricarboxylic acid cycle (TCA) compared with the control group. HFD aggravated VPA-induced inhibition on lipid and amino acid metabolism. Conclusion: HFD magnifies VPA-induced impairment of mitochondrial β-oxidation of FFAs and TCA, thereby increases hepatic steatosis and hepatotoxicity. The results suggest the patients receiving VPA treatment should be advised to avoid eating HFD. PMID:24442146

Nature's inordinate fondness for metabolic enzymes: why metabolic enzyme loci are so frequently targets of selection.

PubMed

Marden, James H

2013-12-01

Metabolic enzyme loci were some of the first genes accessible for molecular evolution and ecology research. New technologies now make the whole genome, transcriptome or proteome readily accessible, allowing unbiased scans for loci exhibiting significant differences in allele frequency or expression level and associated with phenotypes and/or responses to natural selection. With surprising frequency and in many cases in proportions greater than chance relative to other genes, glycolysis and TCA cycle enzyme loci appear among the genes with significant associations in these studies. Hence, there is an ongoing need to understand the basis for fitness effects of metabolic enzyme polymorphisms. Allele-specific effects on the binding affinity and catalytic rate of individual enzymes are well known, but often of uncertain significance because metabolic control theory and in vivo studies indicate that many individual metabolic enzymes do not affect pathway flux rate. I review research, so far little used in evolutionary biology, showing that metabolic enzyme substrates affect signalling pathways that regulate cell and organismal biology, and that these enzymes have moonlighting functions. To date there is little knowledge of how alleles in natural populations affect these phenotypes. I discuss an example in which alleles of a TCA enzyme locus associate with differences in a signalling pathway and development, organismal performance, and ecological dynamics. Ultimately, understanding how metabolic enzyme polymorphisms map to phenotypes and fitness remains a compelling and ongoing need for gaining robust knowledge of ecological and evolutionary processes. © 2013 John Wiley & Sons Ltd.

Development of a microwave assisted extraction method for the analysis of 2,4,6-trichloroanisole in cork stoppers by SIDA-SBSE-GC-MS.

PubMed

Vestner, Jochen; Fritsch, Stefanie; Rauhut, Doris

2010-02-15

The aim of this research work was focused on the replacement of the time-consuming soaking of cork stoppers which is mainly used as screening method for cork lots in connection with sensory analysis and/or analytical methods to detect releasable 2,4,6-trichloroanisole (TCA) of natural cork stoppers. Releasable TCA from whole cork stoppers was analysed with the application of a microwave assisted extraction method (MAE) in combination with stir bar sorptive extraction (SBSE). The soaking of corks (SOAK) was used as a reference method to optimise MAE parameters. Cork lots of different quality and TCA contamination levels were used to adapt MAE. Pre-tests indicated that an MAE at 40 degrees C for 120 min with 90 min of cooling time are suitable conditions to avoid an over-extraction of TCA of low and medium tainted cork stoppers in comparison to SOAK. These MAE parameters allow the measuring of almost the same amounts of releasable TCA as with the application of the soaking procedure in the relevant range (<25 ng L(-1) releasable TCA from one cork) to evaluate the TCA level of cork stoppers. Stable isotope dilution assay (SIDA) was applied to optimise quantification of the released TCA with deuterium-labelled TCA (TCA-d(5)) using a time-saving GC-MS technique in single ion monitoring (SIM) mode. The developed MAE method allows the measuring of releasable TCA from the whole cork stopper under improved conditions and in connection with a low use of solvent and a higher sample throughput. Copyright 2009 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ruvindy, Rendy; White III, Richard Allen; Neilan, Brett Anthony

Modern microbial mats are potential analogues of some of Earth’s earliest ecosystems. Excellent examples can be found in Shark Bay, Australia, with mats of various morphologies. To further our understanding of the functional genetic potential of these complex microbial ecosystems, we conducted for the first time shotgun metagenomic analyses. We assembled metagenomic nextgeneration sequencing data to classify the taxonomic and metabolic potential across diverse morphologies of marine mats in Shark Bay. The microbial community across taxonomic classifications using protein-coding and small subunit rRNA genes directly extracted from the metagenomes suggests that three phyla Proteobacteria, Cyanobacteria and Bacteriodetes dominate all marinemore » mats. However, the microbial community structure between Shark Bay and Highbourne Cay (Bahamas) marine systems appears to be distinct from each other. The metabolic potential (based on SEED subsystem classifications) of the Shark Bay and Highbourne Cay microbial communities were also distinct. Shark Bay metagenomes have a metabolic pathway profile consisting of both heterotrophic and photosynthetic pathways, whereas Highbourne Cay appears to be dominated almost exclusively by photosynthetic pathways. Alternative non-rubisco-based carbon metabolism including reductive TCA cycle and 3-hydroxypropionate/4-hydroxybutyrate pathways is highly represented in Shark Bay metagenomes while not represented in Highbourne Cay microbial mats or any other mat forming ecosystems investigated to date. Potentially novel aspects of nitrogen cycling were also observed, as well as putative heavy metal cycling (arsenic, mercury, copper and cadmium). Finally, archaea are highly represented in Shark Bay and may have critical roles in overall ecosystem function in these modern microbial mats.« less

Cellular responses in Bacillus thuringiensis CS33 during bacteriophage BtCS33 infection.

PubMed

Wu, Dandan; Yuan, Yihui; Liu, Pengming; Wu, Yan; Gao, Meiying

2014-04-14

Bacillus thuringiensis (Bt) has been widely used for 50years as a biopesticide for controlling insect pests. However, bacteriophage infection can cause failures in 50%-80% of the batches during Bt fermentation, resulting in severe losses. In the present work, the physiological and biochemical impacts of Bt strain CS33 have been studied during bacteriophage infection. This study adopted a gel-based proteomics approach to probe the sequential changed proteins in phage-infected Bt cells. To phage, it depressed the host energy metabolism by suppressing the respiration chain, the TCA cycle, and the utilization of PHB on one hand; on the other hand, it hijacked the host translational machine for its own macromolecular synthesis. To host, superinfection exclusion might be triggered by the changes of S-layer protein and flagella related proteins, which were located on the cell surface and might play as the candidates for the phage recognition. More importantly, the growth rate, cell mass, and ICPs yield were significantly decreased. The low yield of ICPs was mainly due to the suppressed utilization of PHB granules. Further functional study on these altered proteins may lead to a better understanding of the pathogenic mechanisms and the identification of new targets for phage control. B. thuringiensis (Bt) has been widely used for 50years as a safe biopesticide for controlling agricultural and sanitary insect pests. However, bacteriophage infection can cause severe losses during B. thuringiensis fermentation. The processes and consequences of interactions between bacteriophage and Bt were still poorly understood, and the molecular mechanisms involved were more unknown. This study adopted a gel-based proteomics approach to probe the physiological and biochemical impacts of Bt strain CS33 after phage-infection. The interactions between phage BtCS33 and its host Bt strain CS33 occurred mainly on four aspects. First, phage synthesized its nucleic acids through metabolic regulation by increasing the amount of NDK. Second, it is reasonable to infer that a phage resistance or superinfection exclusion was triggered by several increased or decreased proteins (SLP, FliD, FlaB), which were located on the cell surface and might play as candidates for the phage recognition. Third, combining the decreased flavoproteins (SdhA and EtfB) and the down regulated Fe-S cluster biosynthesis pathway together, it can be suggested that the respiration chain was weakened after phage infection. Additionally, three key enzymes (AcnB, FumC and AdhA) involved in the TCA cycle were all decreased, indicating the TCA cycle was seriously inhibited after infection. Fourth, the growth rate, cell mass and ICPs yield of the host were significantly decreased. To the best of our knowledge, this work represents the first systematic study on the interactions of an insecticidal bacterium with its phage, and has contributed novel information to understand the molecular events in the important biological pesticide producer, B. thuringiensis, in response to phage challenge. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of antibacterial and high light transmittance bulk materials: Incorporation and sustained release of hydrophobic or hydrophilic antibiotics.

PubMed

Wang, Bailiang; Liu, Huihua; Zhang, Binjun; Han, Yuemei; Shen, Chenghui; Lin, Quankui; Chen, Hao

2016-05-01

Infection associated with medical devices is one of the most frequent complications of modern medical biomaterials. Bacteria have a strong ability to attach on solid surfaces, forming colonies and subsequently biofilms. In this work, a novel antibacterial bulk material was prepared through combining poly(dimethyl siloxane) (PDMS) with either hydrophobic or hydrophilic antibiotics (0.1-0.2 wt%). Scanning electron microscopy, water contact angle and UV-vis spectrophotometer were used to measure the changes of surface topography, wettability and optical transmission. For both gentamicin sulfate (GS) and triclosan (TCA), the optical transmission of the PDMS-GS and PDMS-TCA blend films was higher than 90%. Drug release studies showed initial rapid release and later sustained release of GS or TCA under aqueous physiological conditions. The blend films demonstrated excellent bactericidal and sufficient biofilm inhibition functions against Gram-positive bacteria (Staphylococcus aureus, S. aureus) measured by LIVE/DEAD bacterial viability kit staining method. Kirby-Bauer method showed that there was obvious zone of inhibition (7.5-12.5mm). Cytocompatibility assessment against human lens epithelial cells (HLECs) revealed that the PDMS-GS blend films had good cytocompatibility. However, the PDMS-TCA blend films showed certain cytotoxicity against HLECs. The PDMS-0.2 wt% GS blend films were compared to native PDMS in the rabbit subcutaneous S. aureus infection model. The blend films yielded a significantly lower degree of infection than native PDMS at day 7. The achievement of the PDMS-drug bulk materials with high light transmittance, excellent bactericidal function and good cytocompatibility can potentially be widely used as bio-optical materials. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Tsunami detection by high-frequency radar in British Columbia: performance assessment of the time-correlation algorithm for synthetic and real events

NASA Astrophysics Data System (ADS)

Guérin, Charles-Antoine; Grilli, Stéphan T.; Moran, Patrick; Grilli, Annette R.; Insua, Tania L.

2018-05-01

The authors recently proposed a new method for detecting tsunamis using high-frequency (HF) radar observations, referred to as "time-correlation algorithm" (TCA; Grilli et al. Pure Appl Geophys 173(12):3895-3934, 2016a, 174(1): 3003-3028, 2017). Unlike standard algorithms that detect surface current patterns, the TCA is based on analyzing space-time correlations of radar signal time series in pairs of radar cells, which does not require inverting radial surface currents. This was done by calculating a contrast function, which quantifies the change in pattern of the mean correlation between pairs of neighboring cells upon tsunami arrival, with respect to a reference correlation computed in the recent past. In earlier work, the TCA was successfully validated based on realistic numerical simulations of both the radar signal and tsunami wave trains. Here, this algorithm is adapted to apply to actual data from a HF radar installed in Tofino, BC, for three test cases: (1) a simulated far-field tsunami generated in the Semidi Subduction Zone in the Aleutian Arc; (2) a simulated near-field tsunami from a submarine mass failure on the continental slope off of Tofino; and (3) an event believed to be a meteotsunami, which occurred on October 14th, 2016, off of the Pacific West Coast and was measured by the radar. In the first two cases, the synthetic tsunami signal is superimposed onto the radar signal by way of a current memory term; in the third case, the tsunami signature is present within the radar data. In light of these test cases, we develop a detection methodology based on the TCA, using a correlation contrast function, and show that in all three cases the algorithm is able to trigger a timely early warning.

Coordinated metabolic transitions during Drosophila embryogenesis and the onset of aerobic glycolysis.

PubMed

Tennessen, Jason M; Bertagnolli, Nicolas M; Evans, Janelle; Sieber, Matt H; Cox, James; Thummel, Carl S

2014-03-12

Rapidly proliferating cells such as cancer cells and embryonic stem cells rely on a specialized metabolic program known as aerobic glycolysis, which supports biomass production from carbohydrates. The fruit fly Drosophila melanogaster also utilizes aerobic glycolysis to support the rapid growth that occurs during larval development. Here we use singular value decomposition analysis of modENCODE RNA-seq data combined with GC-MS-based metabolomic analysis to analyze the changes in gene expression and metabolism that occur during Drosophila embryogenesis, spanning the onset of aerobic glycolysis. Unexpectedly, we find that the most common pattern of co-expressed genes in embryos includes the global switch to glycolytic gene expression that occurs midway through embryogenesis. In contrast to the canonical aerobic glycolytic pathway, however, which is accompanied by reduced mitochondrial oxidative metabolism, the expression of genes involved in the tricarboxylic cycle (TCA cycle) and the electron transport chain are also upregulated at this time. Mitochondrial activity, however, appears to be attenuated, as embryos exhibit a block in the TCA cycle that results in elevated levels of citrate, isocitrate, and α-ketoglutarate. We also find that genes involved in lipid breakdown and β-oxidation are upregulated prior to the transcriptional initiation of glycolysis, but are downregulated before the onset of larval development, revealing coordinated use of lipids and carbohydrates during development. These observations demonstrate the efficient use of nutrient stores to support embryonic development, define sequential metabolic transitions during this stage, and demonstrate striking similarities between the metabolic state of late-stage fly embryos and tumor cells. Copyright © 2014 Tennessen et al.

Salmonella enterica serovar Typhimurium mutants unable to convert malate to pyruvate and oxaloacetate are avirulent and immunogenic in BALB/c mice.

PubMed

Mercado-Lubo, Regino; Leatham, Mary P; Conway, Tyrrell; Cohen, Paul S

2009-04-01

Previously, we showed that the Salmonella enterica serovar Typhimurium SR-11 tricarboxylic acid (TCA) cycle must operate as a complete cycle for full virulence after oral infection of BALB/c mice (M. Tchawa Yimga, M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen, Infect. Immun. 74:1130-1140, 2006). In the same study, we showed that for full virulence, malate must be converted to both oxaloacetate and pyruvate. Moreover, it was recently demonstrated that blocking conversion of succinyl-coenzyme A to succinate attenuates serovar Typhimurium SR-11 but does not make it avirulent; however, blocking conversion of succinate to fumarate renders it completely avirulent and protective against subsequent oral infection with the virulent serovar Typhimurium SR-11 wild-type strain (R. Mercado-Lubo, E. J. Gauger, M. P. Leatham, T. Conway, and P. S. Cohen, Infect. Immun. 76:1128-1134, 2008). Furthermore, the ability to convert succinate to fumarate appeared to be required only after serovar Typhimurium SR-11 became systemic. In the present study, evidence is presented that serovar Typhimurium SR-11 mutants that cannot convert fumarate to malate or that cannot convert malate to both oxaloacetate and pyruvate are also avirulent and protective in BALB/c mice. These results suggest that in BALB/c mice, the malate that is removed from the TCA cycle in serovar Typhimurium SR-11 for conversion to pyruvate must be replenished by succinate or one of its precursors, e.g., arginine or ornithine, which might be available in mouse phagocytes.

Effects of ocular transverse chromatic aberration on peripheral word identification.

PubMed

Yang, Shun-Nan; Tai, Yu-chi; Laukkanen, Hannu; Sheedy, James E

2011-11-01

Transverse chromatic aberration (TCA) smears the retinal image of peripheral stimuli. We previously found that TCA significantly reduces the ability to recognize letters presented in the near fovea by degrading image quality and exacerbating crowding effect from adjacent letters. The present study examined whether TCA has a significant effect on near foveal and peripheral word identification, and whether within-word orthographic facilitation interacts with TCA effect to affect word identification. Subjects were briefly presented a 6- to 7-letter word of high or low frequency in each trial. Target words were generated with weak or strong horizontal color fringe to attenuate the TCA in the right periphery and exacerbate it in the left. The center of the target word was 1°, 2°, 4°, and 6° to the left or right of a fixation point. Subject's eye position was monitored with an eye-tracker to ensure proper fixation before target presentation. They were required to report the identity of the target word as soon and accurately as possible. Results show significant effect of color fringe on the latency and accuracy of word recognition, indicating existing TCA effect. Observed TCA effect was more salient in the right periphery, and was affected by word frequency more there. Individuals' subjective preference of color-fringed text was correlated to the TCA effect in the near periphery. Our results suggest that TCA significantly affects peripheral word identification, especially when it is located in the right periphery. Contextual facilitation such as word frequency interacts with TCA to influence the accuracy and latency of word recognition. Copyright © 2011 Elsevier Ltd. All rights reserved.

In vivo cardiac glucose metabolism in the high-fat fed mouse: Comparison of euglycemic–hyperinsulinemic clamp derived measures of glucose uptake with a dynamic metabolomic flux profiling approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Risis, Steve

Rationale: Cardiac metabolism is thought to be altered in insulin resistance and type 2 diabetes (T2D). Our understanding of the regulation of cardiac substrate metabolism and insulin sensitivity has largely been derived from ex vivo preparations which are not subject to the same metabolic regulation as in the intact heart in vivo. Studies are therefore required to examine in vivo cardiac glucose metabolism under physiologically relevant conditions. Objective: To determine the temporal pattern of the development of cardiac insulin resistance and to compare with dynamic approaches to interrogate cardiac glucose and intermediary metabolism in vivo. Methods and results: Studies were conducted to determine themore » evolution of cardiac insulin resistance in C57Bl/6 mice fed a high-fat diet (HFD) for between 1 and 16 weeks. Dynamic in vivo cardiac glucose metabolism was determined following oral administration of [U-{sup 13}C] glucose. Hearts were collected after 15 and 60 min and flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates. Cardiac insulin resistance, determined by euglycemic–hyperinsulinemic clamp, was evident after 3 weeks of HFD. Despite the presence of insulin resistance, in vivo cardiac glucose metabolism following oral glucose administration was not compromised in HFD mice. This contrasts our recent findings in skeletal muscle, where TCA cycle activity was reduced in mice fed a HFD. Similar to our report in muscle, glucose derived pyruvate entry into the TCA cycle in the heart was almost exclusively via pyruvate dehydrogenase, with pyruvate carboxylase mediated anaplerosis being negligible after oral glucose administration. Conclusions: Under experimental conditions which closely mimic the postprandial state, the insulin resistant mouse heart retains the ability to stimulate glucose metabolism. - Highlights: • Insulin clamp was used to determine the evolution of cardiac insulin resistance. • Clamp measures were compared to a dynamic metabolomics approach. • The clamp revealed the presence of cardiac insulin resistance after 3 weeks of HFD. • Cardiac glucose metabolism was not affected by HFD during an oral glucose challenge.« less

Use of calcitriol to maintain postpartum blood calcium and improve immune function in dairy cows.

PubMed

Vieira-Neto, A; Lima, I R P; Lopes, F; Lopera, C; Zimpel, R; Sinedino, L D P; Jeong, K C; Galvão, K; Thatcher, W W; Nelson, C D; Santos, J E P

2017-07-01

Our objectives were to determine the effects of an injectable formulation of calcitriol on mineral metabolism and immune function in postpartum Holstein cows that received an acidogenic diet prepartum to minimize hypocalcemia. In experiment 1, cows within 6 h of calving received calcitriol (0, 200, or 300 μg) to determine the dose needed to increase plasma concentrations of Ca; 300 μg was sufficient to sustain Ca for at least 3 d. In experiment 2, multiparous cows were assigned randomly to receive only vehicle (control, n = 25) or 300 μg of calcitriol (n = 25) subcutaneously within the first 6 h after calving. Blood was sampled before treatment and 12 h later, then daily until 15 d in milk (DIM), and analyzed for concentrations of ionized Ca (iCa), total Ca (tCa), total Mg (tMg), and total P (tP), metabolites, and hormones. Urine was sampled in the first 7 DIM and analyzed for concentrations of tCa, tMg, and creatinine. Neutrophil function was evaluated in the first week postpartum. Dry matter intake and production performance were evaluated for the first 36 DIM. Calcitriol administration increased concentrations of calcitriol in plasma within 12 h of application from 51 to 427 pg/mL, which returned to baseline within 5 d. Concentrations of iCa and tCa increased 24 h after treatment with calcitriol. Concentrations of iCa (control = 1.08 vs. calcitriol = 1.20 mM), tCa (control = 2.23 vs. calcitriol = 2.33 mM), and tP (control = 1.47 vs. calcitriol = 1.81 mM) remained elevated in cows treated with calcitriol until 3, 5, and 7 DIM, respectively, whereas concentration of tMg (control = 0.76 vs. calcitriol = 0.67 mM) was less in calcitriol cows than control cows until 3 DIM. Concentrations of parathyroid hormone decreased in calcitriol cows compared with control cows (control = 441 vs. calcitriol = 336 pg/mL). Calcitriol tended to increase plasma concentrations of β-hydroxybutyrate and serotonin, but concentrations of glucose, nonesterified fatty acids, and C-telopeptide of type I collagen in plasma did not differ between treatments. Cows treated with calcitriol excreted more urinary tCa (control = 0.5 vs. calcitriol = 2.1 g/d) and tMg (control = 4.5 vs. calcitriol = 5.0 g/d) in the first 7 and 2 DIM, respectively, than control cows. Compared with control, calcitriol improved the proportion of neutrophils with oxidative burst (control = 31.9 vs. calcitriol = 40.6%), mean fluorescence intensity for oxidative burst (control = 90,900 vs. calcitriol = 99,746), and mean fluorescence intensity for phagocytosis (control = 23,887 vs. calcitriol = 28,080). Dry matter intake, yields of milk, and milk components did not differ between treatments. Administration of 300 μg of calcitriol at calving was safe and effective in increasing blood concentration of iCa and plasma concentrations of calcitriol, tCa, and tP for the first 6 d after treatment, and improved measures of innate immune function in early-lactation Holstein cows. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Exploring mitochondrial evolution and metabolism organization principles by comparative analysis of metabolic networks.

PubMed

Chang, Xiao; Wang, Zhuo; Hao, Pei; Li, Yuan-Yuan; Li, Yi-Xue

2010-06-01

The endosymbiotic theory proposed that mitochondrial genomes are derived from an alpha-proteobacterium-like endosymbiont, which was concluded from sequence analysis. We rebuilt the metabolic networks of mitochondria and 22 relative species, and studied the evolution of mitochondrial metabolism at the level of enzyme content and network topology. Our phylogenetic results based on network alignment and motif identification supported the endosymbiotic theory from the point of view of systems biology for the first time. It was found that the mitochondrial metabolic network were much more compact than the relative species, probably related to the higher efficiency of oxidative phosphorylation of the specialized organelle, and the network is highly clustered around the TCA cycle. Moreover, the mitochondrial metabolic network exhibited high functional specificity to the modules. This work provided insight to the understanding of mitochondria evolution, and the organization principle of mitochondrial metabolic network at the network level. Copyright 2010 Elsevier Inc. All rights reserved.

Determining Multiple Responses of Pseudomonas aeruginosa PAO1 to an Antimicrobial Agent, Free Nitrous Acid.

PubMed

Gao, Shu-Hong; Fan, Lu; Peng, Lai; Guo, Jianhua; Agulló-Barceló, Míriam; Yuan, Zhiguo; Bond, Philip L

2016-05-17

Free nitrous acid (FNA) has recently been demonstrated as an antimicrobial agent on a range of micro-organisms, especially in wastewater-treatment systems. However, the antimicrobial mechanism of FNA is largely unknown. Here, we report that the antimicrobial effects of FNA are multitargeted. The response of a model denitrifier, Pseudomnas aeruginosa PAO1 (PAO1), common in wastewater treatment, was investigated in the absence and presence of inhibitory level of FNA (0.1 mg N/L) under anaerobic denitrifying conditions. This was achieved through coupling gene expression analysis, by RNA sequencing, and with a suite of physiological analyses. Various transcripts exhibited significant changes in abundance in the presence of FNA. Respiration was likely inhibited because denitrification activity was severely depleted, and decreased transcript levels of most denitrification genes occurred. As a consequence, the tricarboxylic acid (TCA) cycle was inhibited due to the lowered cellular redox state in the FNA-exposed cultures. Meanwhile, during FNA exposure, PAO1 rerouted its carbon metabolic pathway from the TCA cycle to pyruvate fermentation with acetate as the end product as a possible survival mechanism. Additionally, protein synthesis was significantly decreased, and ribosome preservation was evident. These findings improve our understanding of PAO1 in response to FNA and contribute toward the potential application for use of FNA as an antimicrobial agent.

Metabolomic analysis reveals altered skeletal muscle amino acid and fatty acid handling in obese humans.

PubMed

Baker, Peter R; Boyle, Kristen E; Koves, Timothy R; Ilkayeva, Olga R; Muoio, Deborah M; Houmard, Joseph A; Friedman, Jacob E

2015-05-01

Investigate the effects of obesity and high-fat diet (HFD) exposure on fatty acid oxidation and TCA cycle intermediates and amino acids in skeletal muscle to better characterize energy metabolism. Plasma and skeletal muscle metabolomic profiles were measured from lean and obese males before and after a 5-day HFD in the 4 h postprandial condition. At both time points, plasma short-chain acylcarnitine species (SCAC) were higher in the obese subjects, while the amino acids glycine, histidine, methionine, and citrulline were lower in skeletal muscle of obese subjects. Skeletal muscle medium-chain acylcarnitines (MCAC) C6, C8, C10:2, C10:1, C10, and C12:1 increased in obese subjects, but decreased in lean subjects, from pre- to post-HFD. Plasma content of C10:1 was also decreased in the lean but increased in the obese subjects from pre- to post-HFD. CD36 increased from pre- to post-HFD in obese but not lean subjects. Lower skeletal muscle amino acid content and accumulation of plasma SCAC in obese subjects could reflect increased anaplerosis for TCA cycle intermediates, while accumulation of MCAC suggests limitations in β-oxidation. These measures may be important markers of or contributors to dysregulated metabolism observed in skeletal muscle of obese humans. © 2015 The Obesity Society.

13C-labelled microdialysis studies of cerebral metabolism in TBI patients☆

PubMed Central

Carpenter, Keri L.H.; Jalloh, Ibrahim; Gallagher, Clare N.; Grice, Peter; Howe, Duncan J.; Mason, Andrew; Timofeev, Ivan; Helmy, Adel; Murphy, Michael P.; Menon, David K.; Kirkpatrick, Peter J.; Carpenter, T. Adrian; Sutherland, Garnette R.; Pickard, John D.; Hutchinson, Peter J.

2014-01-01

Human brain chemistry is incompletely understood and better methodologies are needed. Traumatic brain injury (TBI) causes metabolic perturbations, one result of which includes increased brain lactate levels. Attention has largely focussed on glycolysis, whereby glucose is converted to pyruvate and lactate, and is proposed to act as an energy source by feeding into neurons’ tricarboxylic acid (TCA) cycle, generating ATP. Also reportedly upregulated by TBI is the pentose phosphate pathway (PPP) that does not generate ATP but produces various molecules that are putatively neuroprotective, antioxidant and reparative, in addition to lactate among the end products. We have developed a novel combination of 13C-labelled cerebral microdialysis both to deliver 13C-labelled substrates into brains of TBI patients and recover the 13C-labelled metabolites, with high-resolution 13C NMR analysis of the microdialysates. This methodology has enabled us to achieve the first direct demonstration in humans that the brain can utilise lactate via the TCA cycle. We are currently using this methodology to make the first direct comparison of glycolysis and the PPP in human brain. In this article, we consider the application of 13C-labelled cerebral microdialysis for studying brain energy metabolism in patients. We set this methodology within the context of metabolic pathways in the brain, and 13C research modalities addressing them. PMID:24361470

Mycobacterium avium Genes Associated with the Ability To Form a Biofilm

PubMed Central

Yamazaki, Yoshitaka; Danelishvili, Lia; Wu, Martin; MacNab, Molly; Bermudez, Luiz E.

2006-01-01

Mycobacterium avium is widely distributed in the environment, and it is chiefly found in water and soil. M. avium, as well as Mycobacterium smegmatis, has been recognized to produce a biofilm or biofilm-like structure. We screened an M. avium green fluorescent protein (GFP) promoter library in M. smegmatis for genes involved in biofilm formation on polyvinyl chloride (PVC) plates. Clones associated with increased GFP expression ≥2.0-fold over the baseline were sequenced. Seventeen genes, most encoding proteins of the tricarboxylic acid (TCA) cycle and GDP-mannose and fatty acid biosynthesis, were identified. Their regulation in M. avium was confirmed by examining the expression of a set of genes by real-time PCR after incubation on PVC plates. In addition, screening of 2,000 clones of a transposon mutant bank constructed using M. avium strain A5, a mycobacterial strain with the ability to produce large amounts of biofilm, revealed four mutants with an impaired ability to form biofilm. Genes interrupted by transposons were homologues of M. tuberculosis 6-oxodehydrogenase (sucA), enzymes of the TCA cycle, protein synthetase (pstB), enzymes of glycopeptidolipid (GPL) synthesis, and Rv1565c (a hypothetical membrane protein). In conclusion, it appears that GPL biosynthesis, including the GDP-mannose biosynthesis pathway, is the most important pathway involved in the production of M. avium biofilm. PMID:16391123

Biotin deficiency inhibits heme synthesis and impairs mitochondria in human lung fibroblasts.

PubMed

Atamna, Hani; Newberry, Justin; Erlitzki, Ronit; Schultz, Carla S; Ames, Bruce N

2007-01-01

Four of the 5 biotin-dependent carboxylases (BDC) are in the mitochondria. BDC replace intermediates in the Krebs [tricarboxylic acid (TCA)] cycle that are regularly removed for the synthesis of key metabolites such as heme or amino acids. Heme, unlike amino acids, is not recycled to regenerate these intermediates, is not utilized from the diet, and must be synthesized in situ. We studied whether biotin deficiency (BD) lowers heme synthesis and whether mitochondria would be disrupted. Biotin-deficient medium was prepared by using bovine serum stripped of biotin with charcoal/dextran or avidin. Biotin-deficient primary human lung fibroblasts (IMR90) lost their BDC and senesced before biotin-sufficient cells. BD caused heme deficiency; there was a decrease in heme content and heme synthesis, and biotin-deficient cells selectively lost mitochondrial complex IV, which contains heme-a. Loss of complex IV, which is part of the electron transport chain, triggered oxidant release and oxidative damage, hallmarks of heme deficiency. Restoring biotin to the biotin-deficient medium prevented the above changes. Old cells were more susceptible to biotin shortage than young cells. These findings highlight the biochemical connection among biotin, heme, and iron metabolism, and the mitochondria, due to the role of biotin in maintaining the biochemical integrity of the TCA cycle. The findings are discussed in relation to aging and birth defects in humans.

Bactericidal peptidoglycan recognition protein induces oxidative stress in Escherichia coli through a block in respiratory chain and increase in central carbon catabolism.

PubMed

Kashyap, Des R; Kuzma, Marcin; Kowalczyk, Dominik A; Gupta, Dipika; Dziarski, Roman

2017-09-01

Mammalian Peptidoglycan Recognition Proteins (PGRPs) kill both Gram-positive and Gram-negative bacteria through simultaneous induction of oxidative, thiol and metal stress responses in bacteria. However, metabolic pathways through which PGRPs induce these bactericidal stress responses are unknown. We screened Keio collection of Escherichia coli deletion mutants and revealed that deleting genes for respiratory chain flavoproteins or for tricarboxylic acid (TCA) cycle resulted in increased resistance of E. coli to PGRP killing. PGRP-induced killing depended on the production of hydrogen peroxide, which required increased supply of NADH for respiratory chain oxidoreductases from central carbon catabolism (glycolysis and TCA cycle), and was controlled by cAMP-Crp. Bactericidal PGRP induced a rapid decrease in respiration, which suggested that the main source of increased production of hydrogen peroxide was a block in respiratory chain and diversion of electrons from NADH oxidoreductases to oxygen. CpxRA two-component system was a negative regulator of PGRP-induced oxidative stress. By contrast, PGRP-induced thiol stress (depletion of thiols) and metal stress (increase in intracellular free Zn 2+ through influx of extracellular Zn 2+ ) were mostly independent of oxidative stress. Thus, manipulating pathways that induce oxidative, thiol and metal stress in bacteria could be a useful strategy to design new approaches to antibacterial therapy. © 2017 John Wiley & Sons Ltd.

Glutamine-derived 2-hydroxyglutarate is associated with disease progression in plasma cell malignancies

PubMed Central

Gonsalves, Wilson I.; Hitosugi, Taro; Ghosh, Toshi; Jevremovic, Dragan; Petterson, Xuan-Mai; Wellik, Linda; Kumar, Shaji K.; Nair, K. Sreekumaran

2018-01-01

The production of the oncometabolite 2-hydroxyglutarate (2-HG) has been associated with c-MYC overexpression. c-MYC also regulates glutamine metabolism and drives progression of asymptomatic precursor plasma cell (PC) malignancies to symptomatic multiple myeloma (MM). However, the presence of 2-HG and its clinical significance in PC malignancies is unknown. By performing 13C stable isotope resolved metabolomics (SIRM) using U[13C6]Glucose and U[13C5]Glutamine in human myeloma cell lines (HMCLs), we show that 2-HG is produced in clonal PCs and is derived predominantly from glutamine anaplerosis into the TCA cycle. Furthermore, the 13C SIRM studies in HMCLs also demonstrate that glutamine is preferentially utilized by the TCA cycle compared with glucose. Finally, measuring the levels of 2-HG in the BM supernatant and peripheral blood plasma from patients with precursor PC malignancies such as smoldering MM (SMM) demonstrates that relatively elevated levels of 2-HG are associated with higher levels of c-MYC expression in the BM clonal PCs and with a subsequent shorter time to progression (TTP) to MM. Thus, measuring 2-HG levels in BM supernatant or peripheral blood plasma of SMM patients offers potential early identification of those patients at high risk of progression to MM, who could benefit from early therapeutic intervention. PMID:29321378

Characterization of HgCdTe and Related Materials For Third Generation Infrared Detectors

NASA Astrophysics Data System (ADS)

Vaghayenegar, Majid

Hg1-xCdxTe (MCT) has historically been the primary material used for infrared detectors. Recently, alternative substrates for MCT growth such as Si, as well as alternative infrared materials such as Hg1-xCdxSe, have been explored. This dissertation involves characterization of Hg-based infrared materials for third generation infrared detectors using a wide range of transmission electron microscopy (TEM) techniques. A microstructural study on HgCdTe/CdTe heterostructures grown by MBE on Si (211) substrates showed a thin ZnTe layer grown between CdTe and Si to mediate the large lattice mismatch of 19.5%. Observations showed large dislocation densities at the CdTe/ZnTe/Si (211) interfaces, which dropped off rapidly away from the interface. Growth of a thin HgTe buffer layer between HgCdTe and CdTe layers seemed to improve the HgCdTe layer quality by blocking some defects. A second study investigated the correlation of etch pits and dislocations in as-grown and thermal-cycle-annealed (TCA) HgCdTe (211) films. For as-grown samples, pits with triangular and fish-eye shapes were associated with Frank partial and perfect dislocations, respectively. Skew pits were determined to have a more complex nature. TCA reduced the etch-pit density by 72%. Although TCA processing eliminated the fish-eye pits, dislocations reappeared in shorter segments in the TCA samples. Large pits were observed in both as-grown and TCA samples, but the nature of any defects associated with these pits in the as-grown samples is unclear. Microstructural studies of HgCdSe revealed large dislocation density at ZnTe/Si(211) interfaces, which dropped off markedly with ZnTe thickness. Atomic-resolution STEM images showed that the large lattice mismatch at the ZnTe/Si interface was accommodated through {111}-type stacking faults. A detailed analysis showed that the stacking faults were inclined at angles of 19.5 and 90 degrees at both ZnTe/Si and HgCdSe/ZnTe interfaces. These stacking faults were associated with Shockley and Frank partial dislocations, respectively. Initial attempts to delineate individual dislocations by chemical etching revealed that while the etchants successfully attacked defective areas, many defects in close proximity to the pits were unaffected.

The endoscopic endonasal approach is not superior to the microscopic transcranial approach for anterior skull base meningiomas-a meta-analysis.

PubMed

Muskens, Ivo S; Briceno, Vanessa; Ouwehand, Tom L; Castlen, Joseph P; Gormley, William B; Aglio, Linda S; Zamanipoor Najafabadi, Amir H; van Furth, Wouter R; Smith, Timothy R; Mekary, Rania A; Broekman, Marike L D

2018-01-01

In the past decade, the endonasal transsphenoidal approach (eTSA) has become an alternative to the microsurgical transcranial approach (mTCA) for tuberculum sellae meningiomas (TSMs) and olfactory groove meningiomas (OGMs). The aim of this meta-analysis was to evaluate which approach offered the best surgical outcomes. A systematic review of the literature from 2004 and meta-analysis were conducted in accordance with the PRISMA guidelines. Pooled incidence was calculated for gross total resection (GTR), visual improvement, cerebrospinal fluid (CSF) leak, intraoperative arterial injury, and mortality, comparing eTSA and mTCA, with p-interaction values. Of 1684 studies, 64 case series were included in the meta-analysis. Using the fixed-effects model, the GTR rate was significantly higher among mTCA patients for OGM (eTSA: 70.9% vs. mTCA: 88.5%, p-interaction < 0.01), but not significantly higher for TSM (eTSA: 83.0% vs. mTCA: 85.8%, p-interaction = 0.34). Despite considerable heterogeneity, visual improvement was higher for eTSA than mTCA for TSM (p-interaction < 0.01), but not for OGM (p-interaction = 0.33). CSF leak was significantly higher among eTSA patients for both OGM (eTSA: 25.1% vs. mTCA: 10.5%, p-interaction < 0.01) and TSM (eTSA: 19.3%, vs. mTCA: 5.81%, p-interaction < 0.01). Intraoperative arterial injury was higher among eTSA (4.89%) than mTCA patients (1.86%) for TSM (p-interaction = 0.03), but not for OGM resection (p-interaction = 0.10). Mortality was not significantly different between eTSA and mTCA patients for both TSM (p-interaction = 0.14) and OGM resection (p-interaction = 0.88). Random-effect models yielded similar results. In this meta-analysis, eTSA was not shown to be superior to mTCA for resection of both OGMs and TSMs.

The reductive degradation of 1,1,1-trichloroethane by Fe(0) in a soil slurry system.

PubMed

Wu, Xiaoliang; Lu, Shuguang; Qiu, Zhaofu; Sui, Qian; Lin, Kuangfei; Du, Xiaoming; Luo, Qishi

2014-01-01

Most studies on the treatment of chlorinated contaminants by Fe(0) focus on aqueous system tests. However, few is known about the effectiveness of these tests for degrading chlorinated contaminants such as 1,1,1-trichloroethane (TCA) in soil. In this work, the reductive degradation performance of 1,1,1-TCA by Fe(0) was thoroughly investigated in a soil slurry system. The effects of various factors including acid-washed iron, the initial 1,1,1-TCA concentration, Fe(0) dosage, slurry pH, and common constituents in groundwater and soil such as Cl(-), HCO3 (-), SO4 (2-), and NO3 (-) anions and humic acid (HA) were evaluated. The experimental results showed that 1,1,1-TCA could be effectively degraded in 12 h for an initial Fe(0) dosage of 10 g L(-1) and a soil/water mass ratio of 1:5. The soil slurry experiments showed two-stage degradation kinetics: a slow reaction in the first stage and a fast reductive degradation of 1,1,1-TCA in the second stage. The reductive degradation of 1,1,1-TCA was expedited as the mass concentration of Fe(0) increased. In addition, high pHs adversely affected the degradation of 1,1,1-TCA over a pH range of 5.4-8.0 and the reductive degradation efficiency decreased with increasing slurry pH. The initial 1,1,1-TCA concentration and the presence of Cl(-) and SO4(2-) anions had negligible effects. HCO3(-) anions had a accelerative effect on 1,1,1-TCA removal, and both NO3(-) and HA had inhibitory effects. A Cl(-) mass balance showed that the amount of Cl(-) ions released into the soil slurry system during the 1,1,1-TCA degradation increased with increasing reaction time, suggesting that the main degradation mechanism of 1,1,1-TCA by Fe(0) in a soil slurry system was reductive dechlorination with 1,1-DCA as the main intermediate. In conclusion, this study provides a theoretical basis for the practical application of the remediation of contaminated sites containing chlorinated solvent.

Cis-Natural Antisense Transcripts Are Mainly Co-expressed with Their Sense Transcripts and Primarily Related to Energy Metabolic Pathways during Muscle Development.

PubMed

Zhao, Yunxia; Hou, Ye; Zhao, Changzhi; Liu, Fei; Luan, Yu; Jing, Lu; Li, Xinyun; Zhu, Mengjin; Zhao, Shuhong

2016-01-01

Cis-natural antisense transcripts (cis-NATs) are a new class of RNAs identified in various species. However, the biological functions of cis-NATs are largely unknown. In this study, we investigated the transcriptional characteristics and functions of cis-NATs in the muscle tissue of lean Landrace and indigenous fatty Lantang pigs. In total, 3,306 cis-NATs of 2,469 annotated genes were identified in the muscle tissue of pigs. More than 1,300 cis-NATs correlated with their sense genes at the transcriptional level, and approximately 80% of them were co-expressed in the two breeds. Furthermore, over 1,200 differentially expressed cis-NATs were identified during muscle development. Function annotation showed that the cis-NATs participated in muscle development mainly by co-expressing with genes involved in energy metabolic pathways, including citrate cycle (TCA cycle), glycolysis or gluconeogenesis, mitochondrial activation and so on. Moreover, these cis-NATs and their sense genes abruptly increased at the transition from the late fetal stages to the early postnatal stages and then decreased along with muscle development. In conclusion, the cis-NATs in the muscle tissue of pigs were identified and determined to be mainly co-expressed with their sense genes. The co-expressed cis-NATs and their sense gene were primarily related to energy metabolic pathways during muscle development in pigs. Our results offered novel evidence on the roles of cis-NATs during the muscle development of pigs.

Acetate and succinate production in amoebae, helminths, diplomonads, trichomonads and trypanosomatids: common and diverse metabolic strategies used by parasitic lower eukaryotes.

PubMed

Bringaud, F; Ebikeme, C; Boshart, M

2010-08-01

Parasites that often grow anaerobically in their hosts have adopted a fermentative strategy relying on the production of partially oxidized end products, including lactate, glycerol, ethanol, succinate and acetate. This review focuses on recent progress in understanding acetate production in protist parasites, such as amoebae, diplomonads, trichomonads, trypanosomatids and in the metazoan parasites helminths, as well as the succinate production pathway(s) present in some of them. We also describe the unconventional organisation of the tricarboxylic acid cycle associated with the fermentative strategy adopted by the procyclic trypanosomes, which may resemble the probable structure of the primordial TCA cycle in prokaryotes.

Analysis of metabolomic profile of fermented Orostachys japonicus A. Berger by capillary electrophoresis time of flight mass spectrometry

PubMed Central

Das, Gitishree; Patra, Jayanta Kumar; Lee, Sun-Young; Kim, Changgeon; Park, Jae Gyu

2017-01-01

Microbial cell performance in food biotechnological processes has become an important concern for improving human health worldwide. Lactobacillus plantarum, which is widely distributed in nature, is a lactic acid bacterium with many industrial applications for fermented foods or functional foods (e.g., probiotics). In the present study, using capillary electrophoresis time of flight mass spectrometry, the metabolomic profile of dried Orostachys japonicus A. Berger, a perennial medicinal herb with L. plantarum was compared with that of O. japonicus fermented with L. plantarum to elucidate the metabolomic changes induced by the fermentation process. The levels of several metabolites were changed by the fermentation process, indicating their involvement in microbial performance. For example, glycolysis, the pentose phosphate pathway, the TCA cycle, the urea cycle-related metabolism, nucleotide metabolism, and lipid and amino acid metabolism were altered significantly by the fermentation process. Although the fermented metabolites were not tested using in vivo studies to increase human health benefits, our findings provide an insight into the alteration of metabolites induced by fermentation, and indicated that the metabolomic analysis for the process should be accompanied by fermenting strains and conditions. PMID:28704842

Mitochondrial Proteome Studies in Seeds during Germination

PubMed Central

Czarna, Malgorzata; Kolodziejczak, Marta; Janska, Hanna

2016-01-01

Seed germination is considered to be one of the most critical phases in the plant life cycle, establishing the next generation of a plant species. It is an energy-demanding process that requires functioning mitochondria. One of the earliest events of seed germination is progressive development of structurally simple and metabolically quiescent promitochondria into fully active and cristae-containing mitochondria, known as mitochondrial biogenesis. This is a complex and tightly regulated process, which is accompanied by sequential and dynamic gene expression, protein synthesis, and post-translational modifications. The aim of this review is to give a comprehensive summary of seed mitochondrial proteome studies during germination of various plant model organisms. We describe different gel-based and gel-free proteomic approaches used to characterize mitochondrial proteomes of germinating seeds as well as challenges and limitations of these proteomic studies. Furthermore, the dynamic changes in the abundance of the mitochondrial proteomes of germinating seeds are illustrated, highlighting numerous mitochondrial proteins involved in respiration, tricarboxycylic acid (TCA) cycle, metabolism, import, and stress response as potentially important for seed germination. We then review seed mitochondrial protein carbonylation, phosphorylation, and S-nitrosylation as well as discuss the possible link between these post-translational modifications (PTMs) and the regulation of seed germination. PMID:28248229

Arsenic metabolism in high altitude modern stromatolites revealed by metagenomic analysis.

PubMed

Kurth, Daniel; Amadio, Ariel; Ordoñez, Omar F; Albarracín, Virginia H; Gärtner, Wolfgang; Farías, María E

2017-04-21

Modern stromatolites thrive only in selected locations in the world. Socompa Lake, located in the Andean plateau at 3570 masl, is one of the numerous extreme Andean microbial ecosystems described over recent years. Extreme environmental conditions include hypersalinity, high UV incidence, and high arsenic content, among others. After Socompa's stromatolite microbial communities were analysed by metagenomic DNA sequencing, taxonomic classification showed dominance of Proteobacteria, Bacteroidetes and Firmicutes, and a remarkably high number of unclassified sequences. A functional analysis indicated that carbon fixation might occur not only by the Calvin-Benson cycle, but also through alternative pathways such as the reverse TCA cycle, and the reductive acetyl-CoA pathway. Deltaproteobacteria were involved both in sulfate reduction and nitrogen fixation. Significant differences were found when comparing the Socompa stromatolite metagenome to the Shark Bay (Australia) smooth mat metagenome: namely, those involving stress related processes, particularly, arsenic resistance. An in-depth analysis revealed a surprisingly diverse metabolism comprising all known types of As resistance and energy generating pathways. While the ars operon was the main mechanism, an important abundance of arsM genes was observed in selected phyla. The data resulting from this work will prove a cornerstone for further studies on this rare microbial community.

Analysis of metabolomic profile of fermented Orostachys japonicus A. Berger by capillary electrophoresis time of flight mass spectrometry.

PubMed

Das, Gitishree; Patra, Jayanta Kumar; Lee, Sun-Young; Kim, Changgeon; Park, Jae Gyu; Baek, Kwang-Hyun

2017-01-01

Microbial cell performance in food biotechnological processes has become an important concern for improving human health worldwide. Lactobacillus plantarum, which is widely distributed in nature, is a lactic acid bacterium with many industrial applications for fermented foods or functional foods (e.g., probiotics). In the present study, using capillary electrophoresis time of flight mass spectrometry, the metabolomic profile of dried Orostachys japonicus A. Berger, a perennial medicinal herb with L. plantarum was compared with that of O. japonicus fermented with L. plantarum to elucidate the metabolomic changes induced by the fermentation process. The levels of several metabolites were changed by the fermentation process, indicating their involvement in microbial performance. For example, glycolysis, the pentose phosphate pathway, the TCA cycle, the urea cycle-related metabolism, nucleotide metabolism, and lipid and amino acid metabolism were altered significantly by the fermentation process. Although the fermented metabolites were not tested using in vivo studies to increase human health benefits, our findings provide an insight into the alteration of metabolites induced by fermentation, and indicated that the metabolomic analysis for the process should be accompanied by fermenting strains and conditions.

2D phase sensitive inversion recovery imaging to measure in-vivo spinal cord gray and white matter areas in clinically feasible acquisition times

PubMed Central

Papinutto, N.; Schlaeger, R.; Panara, V.; Caverzasi, E.; Ahn, S.; Johnson, K.J.; Zhu, A.H.; Stern, W.A.; Laub, G.; Hauser, S.L.; Henry, R.G.

2018-01-01

PURPOSE In-vivo assessment of spinal cord gray matter (GM) and white matter (WM) could become pivotal to study various neurological diseases, but it is challenging because of insufficient GM/WM contrast provided by conventional MRI. Here we present and assess a procedure for measurement of spinal cord total cross-sectional area (TCA) and GM areas based on phase sensitive inversion recovery imaging (PSIR). MATERIALS AND METHODS We acquired 2D PSIR images at 3T at each disc level of the spinal axis on 10 healthy subjects and measured TCA, cord diameters, WM and GM area, and GM area/TCA ratio. We secondly investigated 32 healthy subjects at 4 selected levels (C2–C3, C3–C4, T8–T9, T9–T10, total acquisition time <8 minutes) and generated normative reference values of TCA and GM areas. We assessed test-retest, intra- and inter-operator reliability of the acquisition strategy and measurement steps. RESULTS The measurement procedure based on 2D PSIR imaging allowed TCA and GM area assessments along the entire spinal cord axis. The tests we performed revealed high test-retest/intra-operator reliability (mean coefficient of variation (COV) at C2–C3: TCA=0.41%, GM area=2.75%) and inter-operator reliability of the measurements (mean COV on the 4 levels: TCA=0.44%, GM area= 4.20%; mean intra-class correlation coefficient: TCA=0.998, GM area=0.906). CONCLUSION 2D PSIR allows reliable in-vivo assessment of spinal cord TCA, GM and WM areas in clinically feasible acquisition times. The area measurements presented here are in agreement with previous MRI and post-mortem studies. PMID:25483607

Effects of 1,1,1-Trichloroethane and Triclocarban on Reductive Dechlorination of Trichloroethene in a TCE-Reducing Culture.

PubMed

Wen, Li-Lian; Chen, Jia-Xian; Fang, Jia-Yi; Li, Ang; Zhao, He-Ping

2017-01-01

Chlorinated compounds were generally present in the environment due to widespread use in the industry. A short-term study was performed to evaluate the effects of 1,1,1- trichloroethane (TCA) and triclocarban (TCC) on trichloroethene (TCE) removal in a reactor fed with lactate as the sole electron donor. Both TCA and TCC inhibited TCE reduction, but the TCC had a more pronounced effect compared to TCA. The TCE-reducing culture, which had never been exposed to TCA before, reductively dechlorinated TCA to 1,1-dichloroethane (DCA). Below 15 μM, TCA had little effect on the transformation of TCE to cis -dichloroethene (DCE); however, the reduction of cis -DCE and vinyl chloride (VC) were more sensitive to TCA, and ethene production was completely inhibited when the concentration of TCA was above 15 μM. In cultures amended with TCC, the reduction of TCE was severely affected, even at concentrations as low as 0.3 μM; all the cultures stalled at VC, and no ethene was detected. The cultures that fully transformed TCE to ethene contained 5.2-8.1% Dehalococcoides . Geobacter and Desulfovibrio , the bacteria capable of partially reducing TCE to DCE, were detected in all cultures, but both represented a larger proportion of the community in TCC-amended cultures. All cultures were dominated by Clostridium _sensu_stricto_7, a genus that belongs to Firmicutes with proportions ranging from 40.9% (in a high TCC (15 μM) culture) to 88.2%. Methanobacteria was detected at levels of 1.1-12.7%, except in cultures added with 15 and 30 μM TCA, in which they only accounted for ∼0.4%. This study implies further environmental factors needed to be considered in the successful bioremediation of TCE in contaminated sites.

Unravelling core microbial metabolisms in the hypersaline microbial mats of Shark Bay using high-throughput metagenomics

PubMed Central

Ruvindy, Rendy; White III, Richard Allen; Neilan, Brett Anthony; Burns, Brendan Paul

2016-01-01

Modern microbial mats are potential analogues of some of Earth's earliest ecosystems. Excellent examples can be found in Shark Bay, Australia, with mats of various morphologies. To further our understanding of the functional genetic potential of these complex microbial ecosystems, we conducted for the first time shotgun metagenomic analyses. We assembled metagenomic next-generation sequencing data to classify the taxonomic and metabolic potential across diverse morphologies of marine mats in Shark Bay. The microbial community across taxonomic classifications using protein-coding and small subunit rRNA genes directly extracted from the metagenomes suggests that three phyla Proteobacteria, Cyanobacteria and Bacteriodetes dominate all marine mats. However, the microbial community structure between Shark Bay and Highbourne Cay (Bahamas) marine systems appears to be distinct from each other. The metabolic potential (based on SEED subsystem classifications) of the Shark Bay and Highbourne Cay microbial communities were also distinct. Shark Bay metagenomes have a metabolic pathway profile consisting of both heterotrophic and photosynthetic pathways, whereas Highbourne Cay appears to be dominated almost exclusively by photosynthetic pathways. Alternative non-rubisco-based carbon metabolism including reductive TCA cycle and 3-hydroxypropionate/4-hydroxybutyrate pathways is highly represented in Shark Bay metagenomes while not represented in Highbourne Cay microbial mats or any other mat forming ecosystems investigated to date. Potentially novel aspects of nitrogen cycling were also observed, as well as putative heavy metal cycling (arsenic, mercury, copper and cadmium). Finally, archaea are highly represented in Shark Bay and may have critical roles in overall ecosystem function in these modern microbial mats. PMID:26023869

Biochemistry and control of the reductive tricarboxylic acid pathway of CO 2 fixation and physiological role of the Rubis CO-like protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tabita, F. Robert

2008-12-04

During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO 2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris.

Synthesis of the 1-Monoester of 2-Ketoalkanedioic Acids, e.g., Octyl α-Ketoglutarate

PubMed Central

Jung, Michael E.; Deng, Gang

2012-01-01

Oxidative cleavage of cycloalkene-1-carboxylates, made from the corresponding carboxylic acids, and subsequent oxidation of the resulting ketoaldehyde afforded the important 1-monoesters of 2-ketoalkanedioic acids. Thus ozonolysis of octyl cyclobutene-1-carboxylate followed by sodium chlorite oxidation afforded the 1-monooctyl 2-ketoglutarate. This is a cell-permeable prodrug form of α-ketoglutarate, an important intermediate in the tricarboxylic acid (TCA, Krebs) cycle and a promising therapeutic agent in its own right. PMID:23163977

The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity

DTIC Science & Technology

2014-03-01

phosphorylation, Nat Rev Genet 2, 342-352. 17. Higgins , L. H., Withers, H. G., Garbens, A., Love, H. D., Magnoni, L., Hayward, S. W., and Moyes, C. D. (2009...MalateDehydrogenase 2ConfersDocetaxel Resistancevia Regulations of JNKSignaling andOxidativeMetabolism Qiong Liu, Chris T. Harvey, Hao Geng, Changhui...1036 Liuet al. The Prostate 40. Higgins LH, Withers HG, Garbens A, Love HD, Magnoni L, Hayward SW, Moyes CD. Hypoxia and the metabolic pheno- type of

Sulfide oxidation, nitrate respiration, carbon acquisition, and electron transport pathways suggested by the draft genome of a single orange Guaymas Basin Beggiatoa (Cand. Maribeggiatoa) sp. filament.

PubMed

MacGregor, Barbara J; Biddle, Jennifer F; Harbort, Christopher; Matthysse, Ann G; Teske, Andreas

2013-09-01

A near-complete draft genome has been obtained for a single vacuolated orange Beggiatoa (Cand. Maribeggiatoa) filament from a Guaymas Basin seafloor microbial mat, the third relatively complete sequence for the Beggiatoaceae. Possible pathways for sulfide oxidation; nitrate respiration; inorganic carbon fixation by both Type II RuBisCO and the reductive tricarboxylic acid cycle; acetate and possibly formate uptake; and energy-generating electron transport via both oxidative phosphorylation and the Rnf complex are discussed here. A role in nitrite reduction is suggested for an abundant orange cytochrome produced by the Guaymas strain; this has a possible homolog in Beggiatoa (Cand. Isobeggiatoa) sp. PS, isolated from marine harbor sediment, but not Beggiatoa alba B18LD, isolated from a freshwater rice field ditch. Inferred phylogenies for the Calvin-Benson-Bassham (CBB) cycle and the reductive (rTCA) and oxidative (TCA) tricarboxylic acid cycles suggest that genes encoding succinate dehydrogenase and enzymes for carboxylation and/or decarboxylation steps (including RuBisCO) may have been introduced to (or exported from) one or more of the three genomes by horizontal transfer, sometimes by different routes. Sequences from the two marine strains are generally more similar to each other than to sequences from the freshwater strain, except in the case of RuBisCO: only the Guaymas strain encodes a Type II enzyme, which (where studied) discriminates less against oxygen than do Type I RuBisCOs. Genes subject to horizontal transfer may represent key steps for adaptation to factors such as oxygen and carbon dioxide concentration, organic carbon availability, and environmental variability. © 2013.

Alterations in Krebs cycle enzyme activities and carbohydrate catabolism in two strains of Trypanosoma brucei during in vitro differentiation of their bloodstream to procyclic stages.

PubMed

Durieux, P O; Schütz, P; Brun, R; Köhler, P

1991-03-01

A rapid switch from a fermentative to a primarily oxidative type of glucose utilization was observed during in vitro differentiation of Trypanosoma brucei STIB348 and EATRO1244 bloodstream to procyclic trypomastigotes. In accordance with previously published reports bloodstream populations produced pyruvate as the major end product of glucose catabolism, together with very small amounts of CO2, succinate and glycerol. During differentiation pyruvate excretion decreased within 48 h to the low levels produced by 28-day procyclic stages. Concomitant with the decline in pyruvate formation, acetate appeared as a new product and the rates of respiratory CO2 increased considerably. The amount of carbon released with these compounds could account for nearly all of the glucose carbon consumed. Rates of glucose utilization and formation of acetate and CO2 in cells differentiated for 48 h were essentially the same as those found in 28-day procyclics. Succinate and glycerol excretion remained low during the entire transformation process, and no significant difference in the pattern and quantities of end products were found between the two trypanosome strains. During trypanosome differentiation the changes in metabolism were associated with marked alterations in enzyme activity levels. Activities of the tricarboxylic acid (TCA) cycle enzymes citrate synthase, isocitrate dehydrogenase (NAD+), succinate dehydrogenase and fumarase were not detectable in bloodstream trypomastigotes but appeared upon differentiation for 24 h. An exception was citrate synthase whose activity was not demonstrable until 48 h postinoculation into culture. After 48 h the majority of the TCA cycle enzyme activities continued to increase steadily until day 28. Pyruvate kinase activity decreased in differentiating cells after 48 h to about 25% of the level found in bloodstream trypomastigotes.(ABSTRACT TRUNCATED AT 250 WORDS)

Selective modification of the pyruvate dehydrogenase kinase isoform profile in skeletal muscle in hyperthyroidism: implications for the regulatory impact of glucose on fatty acid oxidation.

PubMed

Sugden, M C; Lall, H S; Harris, R A; Holness, M J

2000-11-01

The pyruvate dehydrogenase kinases (PDK1-4) regulate glucose oxidation through inhibitory phosphorylation of the pyruvate dehydrogenase complex (PDC). Immunoblot analysis with antibodies raised against recombinant PDK isoforms demonstrated changes in PDK isoform expression in response to experimental hyperthyroidism (100 microg/100 g body weight; 3 days) that was selective for fast-twitch vs slow-twitch skeletal muscle in that PDK2 expression was increased in the fast-twitch skeletal muscle (the anterior tibialis) (by 1. 6-fold; P<0.05) but not in the slow-twitch muscle (the soleus). PDK4 protein expression was increased by experimental hyperthyroidism in both muscle types, there being a greater response in the anterior tibialis (4.2-fold increase; P<0.05) than in the soleus (3.2-fold increase; P<0.05). The hyperthyroidism-associated up-regulation of PDK4 expression was observed in conjunction with suppression of skeletal-muscle PDC activity, but not suppression of glucose uptake/phosphorylation, as measured in vivo in conscious unrestrained rats (using the 2-[(3)H]deoxyglucose technique). We propose that increased PDK isoform expression contributes to the pathology of hyperthyroidism and to PDC inactivation by facilitating the operation of the glucose --> lactate --> glucose (Cori) and glucose --> alanine --> glucose cycles. We also propose that enhanced relative expression of the pyruvate-insensitive PDK isoform (PDK4) in skeletal muscle in hyperthyroidism uncouples glycolytic flux from pyruvate oxidation, sparing pyruvate for non-oxidative entry into the tricarboxylic acid (TCA) cycle, and thereby supporting entry of acetyl-CoA (derived from fatty acid oxidation) into the TCA cycle.

The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows

PubMed Central

White, Heather M.

2015-01-01

The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows. PMID:26479386

The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows.

PubMed

White, Heather M

2015-08-18

The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows.

Transcriptional response to petiole heat girdling in cassava.

PubMed

Zhang, Yang; Ding, Zehong; Ma, Fangfang; Chauhan, Raj Deepika; Allen, Doug K; Brutnell, Thomas P; Wang, Wenquan; Peng, Ming; Li, Pinghua

2015-02-12

To examine the interactions of starch and sugar metabolism on photosynthesis in cassava, a heat-girdling treatment was applied to petioles of cassava leaves at the end of the light cycle to inhibit starch remobilization during the night. The inhibition of starch remobilization caused significant starch accumulation at the beginning of the light cycle, inhibited photosynthesis, and affected intracellular sugar levels. RNA-seq analysis of heat-treated and control plants revealed significantly decreased expression of genes related to photosynthesis, as well as N-metabolism and chlorophyll biosynthesis. However, expression of genes encoding TCA cycle enzymes and mitochondria electron transport components, and flavonoid biosynthetic pathway enzymes were induced. These studies reveal a dynamic transcriptional response to perturbation of sink demand in a single leaf, and provide useful information for understanding the regulations of cassava under sink or source limitation.

Transcriptional response to petiole heat girdling in cassava

PubMed Central

Zhang, Yang; Ding, Zehong; Ma, Fangfang; Chauhan, Raj Deepika; Allen, Doug K.; Brutnell, Thomas P.; Wang, Wenquan; Peng, Ming; Li, Pinghua

2015-01-01

To examine the interactions of starch and sugar metabolism on photosynthesis in cassava, a heat-girdling treatment was applied to petioles of cassava leaves at the end of the light cycle to inhibit starch remobilization during the night. The inhibition of starch remobilization caused significant starch accumulation at the beginning of the light cycle, inhibited photosynthesis, and affected intracellular sugar levels. RNA-seq analysis of heat-treated and control plants revealed significantly decreased expression of genes related to photosynthesis, as well as N-metabolism and chlorophyll biosynthesis. However, expression of genes encoding TCA cycle enzymes and mitochondria electron transport components, and flavonoid biosynthetic pathway enzymes were induced. These studies reveal a dynamic transcriptional response to perturbation of sink demand in a single leaf, and provide useful information for understanding the regulations of cassava under sink or source limitation. PMID:25672661

Trichloroacetic acid in the environment.

PubMed

McCulloch, A

2002-05-01

Suppositions that the trichloroacetic acid (TCA, CCl3C(O)OH) found in nature was a consequence solely of the use of chlorinated hydrocarbon solvents prompted this critical review of the literature on its environmental fluxes and occurrences. TCA is widely distributed in forest soils (where it was rarely used as an herbicide) and measurements suggest a soil flux of 160 000 tonnes yr(-1) in European forests alone. TCA is also produced during oxidative water treatment and the global flux could amount to 55 000 tonnes yr(-1) (from pulp and paper manufacture, potable water and cooling water treatments). By contrast, the yields of TCA from chlorinated hydrocarbon solvents are small: from tetrachloroethene 13 600 tonnes yr(-1) and from 1,1,1-trichloroethane 4300 tonnes yr(-1) on a global basis, at the atmospheric burdens and removal rates typical of the late 1990s. TCA is ubiquitous in rainwater and snow. Its concentrations are highly variable and the variations cannot be connected with location or date. However, there is no significant difference between the concentrations found in Chile and in eastern Canada (by the same analysts), or between Malawi and western Canada, or between Antarctica and Switzerland, nor any significant difference globally between the concentrations in cloud, rain and snow (although local enhancement in fog water has been shown). TCA is present in old ice and firn. At the deepest levels, the firn was deposited early in the 19th century, well before the possibility of contamination by industrial production of reactive chlorine, implying a non-industrial background. This proposition is supported by plume measurements from pulp mills in Finland. TCA is ubiquitous in soils; concentrations are very variable but there are some indications that soils under coniferous trees contain higher amounts. The concentrations of TCA found in plant tissue are region-specific and may also be plant-specific, to the extent that conifers seem to contain more than other species. TCA is removed from the environment naturally. There is abundant evidence that soil microorganisms dehalogenate TCA and it is lost from within spruce needles with a half-life of 10 days. There is also recent evidence of an abiotic aqueous decarboxylation mechanism with a half-life of 22 days. The supposedly widespread effects of TCA in conifer needles are not shown in controlled experiments. At concentrations in the needles of Scots pine similar to those observed in needles in forest trees, changes consequent on TCA treatment of field laboratory specimens were almost all insignificant.

Interaction between hormonal and mitochondrial signalling during growth, development and in plant defence responses.

PubMed

Berkowitz, Oliver; De Clercq, Inge; Van Breusegem, Frank; Whelan, James

2016-05-01

Mitochondria play a central role in plant metabolism as they are a major source of ATP through synthesis by the oxidative phosphorylation pathway and harbour key metabolic reactions such as the TCA cycle. The energy and building blocks produced by mitochondria are essential to drive plant growth and development as well as to provide fuel for responses to abiotic and biotic stresses. The majority of mitochondrial proteins are encoded in the nuclear genome and have to be imported into the organelle. For the regulation of the corresponding genes intricate signalling pathways exist to adjust their expression. Signals directly regulate nuclear gene expression (anterograde signalling) to adjust the protein composition of the mitochondria to the needs of the cell. In parallel, mitochondria communicate back their functional status to the nucleus (retrograde signalling) to prompt transcriptional regulation of responsive genes via largely unknown signalling mechanisms. Plant hormones are the major signalling components regulating all layers of plant development and cellular functions. Increasing evidence is now becoming available that plant hormones are also part of signalling networks controlling mitochondrial function and their biogenesis. This review summarizes recent advances in understanding the interaction of mitochondrial and hormonal signalling pathways. © 2016 John Wiley & Sons Ltd.

Targeting PRMT5 as a Novel Radiosensitization Approach for Primary and Recurrent Prostate Cancer Treatment

DTIC Science & Technology

2013-08-01

CCT G-30; KLK2 F: 50- TGG CTG TGT ACA GTC ATG GA-30; KLK2 R: 50- CCT GTG TCT TCA GGC TCA AA-30; TMPRSS2 F: 50-AGG TGC ATC CGG CTC AGT A-30; TMPRSS2 R...50-GGG TCA AGG TGA TGC ACA GT-30; PCDH11 F: 50-GCG TTT CTG ACT GTG GCT ATC-30; PCDH11 R: 50-GGA AGG GGA ATG GAA TTT TG-30; UGT2B15 F: 50-TCA AATc-Jun...GAPDH F: 50-CTG ACT TCA ACA GCG ACA CC-30; GAPDH R: 50-CCC TGT TGC TGT AGC CAA AT-30; AR F: 50- GTG GAA GCT GCA AGG TCT TC-30; AR R 50-CGA AGA CGA

Ozonation catalyzed by the raw bauxite for the degradation of 2,4,6-trichloroanisole in drinking water.

PubMed

Qi, Fei; Xu, Bingbing; Chen, Zhonglin; Ma, Jun; Sun, Dezhi; Zhang, Liqiu; Wu, Fengchang

2009-08-30

A kind of inexpensive and environmental friendly mineral, the raw bauxite has been used successfully as a catalyst combined with ozonation in the degradation of 2,4,6-trichloroanisole (TCA). The catalyst was characterized by using various analytical techniques. X-ray powder diffraction (XRD) characterization showed that the raw bauxite containing boehmite (gamma-AlOOH), kaolinite (Al(2)Si(2)O(5)(OH)(4)) and quartz (SiO(2)), and gamma-AlOOH was the major composition. The catalytic ozonation removal effectiveness of TCA was investigated under various physicochemical conditions. Both the adsorption and the single ozonation were not effective for the degradation of TCA, and the presence of the raw bauxite in ozonation enhanced the TCA removal effectiveness. Both the hydroxyl radicals (OH) scavenging experiment and R(ct) characterization confirmed that the generation of OH was accounted for the enhancement of the degradation of TCA. The generation of OH was inhibited faintly by the presence of both natural organic matters (NOMs) and alkalinity in the natural water during catalyzed ozonation with the raw bauxite. The increasing of both the bauxite dosage and the ozone dosage enhanced the removal effectiveness of TCA. The raw bauxite was an efficient green catalyst for TCA degradation in drinking water.

A novel rapid access testicular cancer clinic: prospective evaluation after one year.

PubMed

Carey, K; Davis, N F; Elamin, S; Ahern, P; Brady, C M; Sweeney, P

2016-02-01

Our institution has recently developed a rapid access outpatient clinic to investigate men with testicular lumps and/or pain suspicious for testicular cancer (TCa). To present our experience after 12 months. All referrals to the rapid access testicular clinic (RATC) clinic were prospectively analysed from 01/01/2013 to 01/01/2014. The primary outcome variable was incidence of TCa in the referred patient cohort. Secondary outcome variables were waiting times prior to clinical review and waiting times prior to radical orchidectomy in patients diagnosed with TCa. Seventy-four new patients were referred to the RATC during the 1-year period and the mean age was 34 (range 15-81 years). TCa was the most common diagnosis and was found in 18 (25 %) patients. Patients diagnosed with TCa underwent radical orchidectomy, a median of 3 (range 1-5) days after their initial GP referral. Patients requiring surgical intervention for benign scrotal pathology underwent their procedure a median of 32 (range 3-61) days after their initial referral. Of the 18 patients diagnosed with TCa, 9 (50 %) were diagnosed with a seminomatous germ cell tumour on histopathology. The RATC is a new initiative in Ireland that provides expedient and definitive treatment of patients with newly diagnosed TCa. Early treatment will ultimately improve long-term prognosis in this patient cohort.

Diversity and Contributions to Nitrogen Cycling and Carbon Fixation of Soil Salinity Shaped Microbial Communities in Tarim Basin

PubMed Central

Ren, Min; Zhang, Zhufeng; Wang, Xuelian; Zhou, Zhiwei; Chen, Dong; Zeng, Hui; Zhao, Shumiao; Chen, Lingling; Hu, Yuanliang; Zhang, Changyi; Liang, Yunxiang; She, Qunxin; Zhang, Yi; Peng, Nan

2018-01-01

Arid and semi-arid regions comprise nearly one-fifth of the earth's terrestrial surface. However, the diversities and functions of their soil microbial communities are not well understood, despite microbial ecological importance in driving biogeochemical cycling. Here, we analyzed the geochemistry and microbial communities of the desert soils from Tarim Basin, northwestern China. Our geochemical data indicated half of these soils are saline. Metagenomic analysis showed that bacterial phylotypes (89.72% on average) dominated the community, with relatively small proportions of Archaea (7.36%) and Eukaryota (2.21%). Proteobacteria, Firmicutes, Actinobacteria, and Euryarchaeota were most abundant based on metagenomic data, whereas genes attributed to Proteobacteria, Actinobacteria, Euryarchaeota, and Thaumarchaeota most actively transcribed. The most abundant phylotypes (Halobacterium, Halomonas, Burkholderia, Lactococcus, Clavibacter, Cellulomonas, Actinomycetospora, Beutenbergia, Pseudomonas, and Marinobacter) in each soil sample, based on metagenomic data, contributed marginally to the population of all microbial communities, whereas the putative halophiles, which contributed the most abundant transcripts, were in the majority of the active microbial population and is consistent with the soil salinity. Sample correlation analyses according to the detected and active genotypes showed significant differences, indicating high diversity of microbial communities among the Tarim soil samples. Regarding ecological functions based on the metatranscriptomic data, transcription of genes involved in various steps of nitrogen cycling, as well as carbon fixation, were observed in the tested soil samples. Metatranscriptomic data also indicated that Thaumarchaeota are crucial for ammonia oxidation and Proteobacteria play the most important role in other steps of nitrogen cycle. The reductive TCA pathway and dicarboxylate-hydroxybutyrate cycle attributed to Proteobacteria and Crenarchaeota, respectively, were highly represented in carbon fixation. Our study reveals that the microbial communities could provide carbon and nitrogen nutrients for higher plants in the sandy saline soils of Tarim Basin. PMID:29593680

Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter

PubMed Central

Yu, Dongke; Zhang, Han; Lionarons, Daniel A.; Boyer, James L.

2017-01-01

The Na+-dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na+-dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea. The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [3H]TCA uptake assay revealed that skSlc10a1 functioned as a Na+-dependent transporter, but with low affinity for TCA (Km = 92.4 µM) and scymnol sulfate (Ki = 31 µM), compared with hNTCP (TCA, Km = 5.4 µM; Scymnol sulfate, Ki = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na+-dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. PMID:28077388

Transcriptome changes favoring intramuscular fat deposition in the longissimus muscle following castration of bulls.

PubMed

Jeong, J; Bong, J; Kim, G D; Joo, S T; Lee, H-J; Baik, M

2013-10-01

Castration increases intramuscular fat (IMF) deposition, improving beef quality in cattle. The present study was performed to determine the global transcriptome changes following castration of bulls and to identify genes associated with IMF deposition in the longissimus dorsi (LM) of Korean cattle. A customized bovine CombiMatrix oligonucleotide microarray was constructed, and transcriptome changes following castration were determined by microarray hybridization. Transcriptome comparison between bulls and steers indicated that 428 of 8,407 genes were differentially expressed in the LM by greater than two fold (P < 0.05). Gene expression profiling indicated alterations in several pathways, including adipogenesis, fatty acid oxidation, tricarboxylic acid (TCA) cycle, and oxidative phosphorylation (OP), following castration. Castration upregulated transcription of adipogenic perilipin 2 (PLIN2) and visfatin, lipogenic fatty acid synthase, fatty acid esterification 1-acylglycerol-3-phosphate O-acyltransferase 5, and many fatty acid oxidation-related genes. Many TCA cycle and OP genes were also transcriptionally upregulated. Correlation analysis indicated that the IMF content in the LM was highly correlated with mRNA levels of PLIN2 (r = 0.70, P < 0.001), adenosine triphosphatase (ATPase), H(+)-transporting, lysosomal 42 kDa, V1 subunit C1 (ATP6V1C1: r = 0.66, P < 0.001), and cytochrome c oxidase assembly homolog 11 (COX11: r = 0.72, P < 0.001) genes in a pooled animal group of steers plus bulls, and significant correlations in the steer-alone group were maintained in the 3 genes, PLIN2 (r = 0.47, P < 0.05), ATP6V1C1 (r = 0.50, P < 0.05), and COX11 (r = 0.60, P < 0.01). In conclusion, our study provided evidence that castration shifts transcription of lipid metabolism genes, favoring IMF deposition by increasing adipogenesis, lipogenesis, and triglyceride synthesis. This study also indicated that castration increases transcription of genes involved in fatty acid oxidation and subsequent energy production (TCA and OP genes). Our microarray analysis provided novel information that castration alters the transcriptome associated with lipid/energy metabolism, favoring IMF deposition in the LM.

Evaluation of different methods of protein extraction and identification of differentially expressed proteins upon ethylene-induced early-ripening in banana peels.

PubMed

Zhang, Li-Li; Feng, Ren-Jun; Zhang, Yin-Dong

2012-08-15

Banana peels (Musa spp.) are a good example of a plant tissue where protein extraction is challenging due to the abundance of interfering metabolites. Sample preparation is a critical step in proteomic research and is critical for good results. We sought to evaluate three methods of protein extraction: trichloroacetic acid (TCA)-acetone precipitation, phenol extraction, and TCA precipitation. We found that a modified phenol extraction protocol was the most optimal method. SDS-PAGE and two-dimensional gel electrophoresis (2-DE) demonstrated good protein separation and distinct spots of high quality protein. Approximately 300 and 550 protein spots were detected on 2-DE gels at pH values of 3-10 and 4-7, respectively. Several spots were excised from the 2-DE gels and identified by mass spectrometry. The protein spots identified were found to be involved in glycolysis, the tricarboxylic acid cycle, and the biosynthesis of ethylene. Several of the identified proteins may play important roles in banana ripening. Copyright © 2012 Society of Chemical Industry.

Inhibition of histone deacetylases by trans-cinnamic acid and its antitumor effect against colon cancer xenografts in athymic mice

PubMed Central

ZHU, BINGYAN; SHANG, BOYANG; LI, YI; ZHEN, YONGSU

2016-01-01

Previous studies have shown that trans-cinnamic acid (tCA) has a broad spectrum of biological activities, and exhibits antioxidant, anti-inflammatory and anticancer properties. In addition, tCA and a variety of its analogs have been detected as gut microbe-derived metabolites exerting various biological effects in the colon. The aim of this study was to assess the antitumor activity of tCA in vitro and in vivo, in particular its therapeutic efficacy against colon cancer xenografts in athymic mice. Furthermore, it aimed to examine the effects of tCA on histone deacetylases (HDACs) and to identify the underlying molecular mechanisms. Using an MTT assay, tCA was observed to inhibit the proliferation of several cancer cell lines, and the half maximal inhibitory concentration (IC50) in HT29 colon carcinoma cells was ~1 mM. Western blot analysis demonstrated that tCA upregulated the expression of acetyl-H3 and acetyl-H4 proteins, which was consistent with the effects of the HDAC inhibitor, trichostatin A (TSA). Furthermore, expression of Bcl-2 (a marker of cell proliferation) was reduced, and apoptosis was induced. Apoptosis was shown by the activation of cleavage of poly ADP ribose polymerase and the increased expression of Bax. Apoptosis was also confirmed using APC Annexin V and SYTOX Green Nucleic Acid Stain. In addition, the tCA-induced inhibition of the expression of HDAC markers and activation of apoptosis in tumor tissues were further confirmed by immunohistochemistry. Intragastric administration of tCA at doses of 1.0 and 1.5 mmol/kg body weight suppressed the growth of HT29 human colon carcinoma xenografts in athymic mice at well-tolerated doses. No toxic changes were found in the heart, lung, liver, kidney, colon or bone marrow following histopathological examination. This study indicated that tCA is effective against colon cancer xenograft in nude mice. The antitumor mechanism of tCA was mediated, at least in part, by inhibition of HDACs in cancer cells. As an endogenous microbial metabolite predominantly produced in the colon, tCA is an agent of interest for further evaluation. PMID:27035417

Mediterranean dryland Mosaic: The effect of scale on core area metrics

NASA Astrophysics Data System (ADS)

Alhamad, Mohammad Noor; Alrababah, Mohammad

2014-05-01

Quantifying landscape spatial pattern is essential to understanding the relationship between landscape structure and ecological functions and process. Many landscape metrics have been developed to quantify spatial heterogeneity. Landscape metrics have been employed to measure the impact of humans on landscapes. We examined the response of four core areas metrics to a large range of grain sizes in Mediterranean dryland landscapes. The investigated metrics were (1) mean core area (CORE-MN), (2) area weighted mean core area (CORE-AM) , (3) total core area (TCA) and (4) core area percentage of landscape (CPLAND) within six land use types (urban, agriculture, olive orchids, forestry, shrubland and rangeland). Agriculture areas showed the highest value for minimum TCA (2779.4 ha) within the tested grain sizes, followed by rangeland (1778.3 ha) and Forest (1488.5 ha). On the other hand, shrubland showed the lowest TCA (8.0 ha). The minimum CPLAND values were ranged from 0.002 for shrubland to 0.682 for agriculture land use. The maximum CORE-MN among the tested land use type at all levels of grain sizes was exhibited by agriculture land use type (519.759 ha). The core area metrics showed three types of behavior in response to changing grain size in all landuse types. CORE-MN showed predictable relationship, best explained by non-linear responses to changing grain size (R2=0.99). Both TCA and CPLAND exhibited domain of scale effect in response to changing grain size. The threshold behavior for TCA and CPLAND was at the 4 x 4 grain size (about 1.3 ha). However, CORE-AM exhibited erratic behavior. The unique domain of scale-like behavior may be attributed to the unique characteristics of dryland Mediterranean landscapes; where both natural processes and ancient human activities play a great role in shaping the apparent pattern of the landscape

Trichloroacetic acid fate and toxicity to the macrophytes Myriophyllum spicatum and Myriophyllum sibiricum under field conditions.

PubMed

Hanson, Mark L; Sibley, Paul K; Ellis, David A; Fineberg, Neil A; Mabury, Scott A; Solomon, Keith R; Muir, Derek C

2002-03-01

Trichloroacetic acid (TCA) has been detected in rain, snow, and river samples throughout the world. It may enter into natural water systems via herbicide use, as a by-product of water disinfection, from emissions of spent bleach liquor of kraft pulp mills, and as a natural fungal product. This compound is phytotoxic and likely to accumulate in aquatic environments. A study to assess the fate of TCA in semi-natural aquatic environments and the toxicity of TCA to rooted aquatic macrophytes was conducted. The experiment involved exposing three replicate 12000 l aquatic microcosms at the University of Guelph Microcosm Facility to 0.05, 0.5, 3, and 10 mg/l of TCA for 35 days in a one-way analysis of variance design. Each microcosm was stocked with 14 individual 5 cm apical shoots of Myriophyllum spicatum and M. sibiricum. The plants were sampled at regular intervals and assessed for the somatic endpoints of plant length, root growth, number of nodes and wet and dry mass and the biochemical endpoints of chlorophyll-a and chlorophyll-b, carotenoid content, and citric acid levels. TCA half-lives in the microcosms ranged from 190 to 296 h depending on the initial concentration of TCA. Myriophyllum spp. results indicate that while there were some statistically significant differences from controls, there were no biologically significant effects of TCA for any of the endpoints examined. These data suggest that TCA does not pose a significant risk to these macrophytes up to 10 mg/l, which typically exceeds environmentally relevant concentrations by several orders of magnitude.

Computerized Design and Generation of Low-Noise Gears with Localized Bearing Contact

NASA Technical Reports Server (NTRS)

Litvin, Faydor L.; Chen, Ningxin; Chen, Jui-Sheng; Lu, Jian; Handschuh, Robert F.

1995-01-01

The results of research projects directed at the reduction of noise caused by misalignment of the following gear drives: double-circular arc helical gears, modified involute helical gears, face-milled spiral bevel gears, and face-milled formate cut hypoid gears are presented. Misalignment in these types of gear drives causes periodic, almost linear discontinuous functions of transmission errors. The period of such functions is the cycle of meshing when one pair of teeth is changed for the next. Due to the discontinuity of such functions of transmission errors high vibration and noise are inevitable. A predesigned parabolic function of transmission errors that is able to absorb linear discontinuous functions of transmission errors and change the resulting function of transmission errors into a continuous one is proposed. The proposed idea was successfully tested using spiral bevel gears and the noise was reduced a substantial amount in comparison with the existing design. The idea of a predesigned parabolic function is applied for the reduction of noise of helical and hypoid gears. The effectiveness of the proposed approach has been investigated by developed TCA (tooth contact analysis) programs. The bearing contact for the mentioned gears is localized. Conditions that avoid edge contact for the gear drives have been determined. Manufacturing of helical gears with new topology by hobs and grinding worms has been investigated.

Role of Central Metabolism in the Osmoadaptation of the Halophilic Bacterium Chromohalobacter salexigens*

PubMed Central

Pastor, José M.; Bernal, Vicente; Salvador, Manuel; Argandoña, Montserrat; Vargas, Carmen; Csonka, Laszlo; Sevilla, Ángel; Iborra, José L.; Nieto, Joaquín J.; Cánovas, Manuel

2013-01-01

Bacterial osmoadaptation involves the cytoplasmic accumulation of compatible solutes to counteract extracellular osmolarity. The halophilic and highly halotolerant bacterium Chromohalobacter salexigens is able to grow up to 3 m NaCl in a minimal medium due to the de novo synthesis of ectoines. This is an osmoregulated pathway that burdens central metabolic routes by quantitatively drawing off TCA cycle intermediaries. Consequently, metabolism in C. salexigens has adapted to support this biosynthetic route. Metabolism of C. salexigens is more efficient at high salinity than at low salinity, as reflected by lower glucose consumption, lower metabolite overflow, and higher biomass yield. At low salinity, by-products (mainly gluconate, pyruvate, and acetate) accumulate extracellularly. Using [1-13C]-, [2-13C]-, [6-13C]-, and [U-13C6]glucose as carbon sources, we were able to determine the main central metabolic pathways involved in ectoines biosynthesis from glucose. C. salexigens uses the Entner-Doudoroff pathway rather than the standard glycolytic pathway for glucose catabolism, and anaplerotic activity is high to replenish the TCA cycle with the intermediaries withdrawn for ectoines biosynthesis. Metabolic flux ratios at low and high salinity were similar, revealing a certain metabolic rigidity, probably due to its specialization to support high biosynthetic fluxes and partially explaining why metabolic yields are so highly affected by salinity. This work represents an important contribution to the elucidation of specific metabolic adaptations in compatible solute-accumulating halophilic bacteria. PMID:23615905

Early metabolic adaptation in C57BL/6 mice resistant to high fat diet induced weight gain involves an activation of mitochondrial oxidative pathways.

PubMed

Boulangé, Claire L; Claus, Sandrine P; Chou, Chieh J; Collino, Sebastiano; Montoliu, Ivan; Kochhar, Sunil; Holmes, Elaine; Rezzi, Serge; Nicholson, Jeremy K; Dumas, Marc E; Martin, François-Pierre J

2013-04-05

We investigated the short-term (7 days) and long-term (60 days) metabolic effect of high fat diet induced obesity (DIO) and weight gain in isogenic C57BL/6 mice and examined the specific metabolic differentiation between mice that were either strong-responders (SR), or non-responders (NR) to weight gain. Mice (n = 80) were fed a standard chow diet for 7 days prior to randomization into a high-fat (HF) (n = 56) or a low-fat (LF) (n = 24) diet group. The (1)H NMR urinary metabolic profiles of LF and HF mice were recorded 7 and 60 days after the diet switch. On the basis of the body weight gain (BWG) distribution of HF group, we identified NR mice (n = 10) and SR mice (n = 14) to DIO. Compared with LF, HF feeding increased urinary excretion of glycine conjugates of β-oxidation intermediate (hexanoylglycine), branched chain amino acid (BCAA) catabolism intermediates (isovalerylglycine, α-keto-β-methylvalerate and α-ketoisovalerate) and end-products of nicotinamide adenine dinucleotide (NAD) metabolism (N1-methyl-2-pyridone-5-carboxamide, N1-methyl-4-pyridone-3-carboxamide) suggesting up-regulation of mitochondrial oxidative pathways. In the HF group, NR mice excreted relatively more hexanoylglycine, isovalerylglycine, and fewer tricarboxylic acid (TCA) cycle intermediate (succinate) in comparison to SR mice. Thus, subtle regulation of ketogenic pathways in DIO may alleviate the saturation of the TCA cycle and mitochondrial oxidative metabolism.

Oxidation of [U-13 C]glucose in the human brain at 7T under steady state conditions.

PubMed

Cheshkov, Sergey; Dimitrov, Ivan E; Jakkamsetti, Vikram; Good, Levi; Kelly, Dorothy; Rajasekaran, Karthik; DeBerardinis, Ralph J; Pascual, Juan M; Sherry, A Dean; Malloy, Craig R

2017-12-01

Disorders of brain energy metabolism and neurotransmitter recycling have been implicated in multiple neurological conditions. 13 C magnetic resonance spectroscopy ( 13 C MRS) during intravenous administration of 13 C-labeled compounds has been used to measure turnover rates of brain metabolites. This approach, however, requires prolonged infusion inside the magnet. Proton decoupling is typically required but may be difficult to implement with standard equipment. We examined an alternative approach to monitor glucose metabolism in the human brain. 13 C-enriched glucose was infused in healthy subjects outside the magnet to a steady-state level of 13 C enrichment. Subsequently, the subjects were scanned at 7T for 60 min without 1 H decoupling. Metabolic modeling was used to calculate anaplerosis. Biomarkers of energy metabolism and anaplerosis were detected. The glutamate C5 doublet provided information about glucose-derived acetyl-coenzyme A flux into the tricarboxylic acid (TCA) cycle via pyruvate dehydrogenase, and the bicarbonate signal reflected overall TCA cycle activity. The glutamate C1/C5 ratio is sensitive to anaplerosis. Brain 13 C MRS at 7T provides information about glucose oxidation and anaplerosis without the need of prolonged 13 C infusions inside the scanner and without technical challenges of 1 H decoupling, making it a feasible approach for clinical research. Magn Reson Med 78:2065-2071, 2017. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

Reversal of metabolic deficits by lipoic acid in a triple transgenic mouse model of Alzheimer's disease: a 13C NMR study

PubMed Central

Sancheti, Harsh; Kanamori, Keiko; Patil, Ishan; Díaz Brinton, Roberta; Ross, Brian D; Cadenas, Enrique

2014-01-01

Alzheimer's disease is an age-related neurodegenerative disease characterized by deterioration of cognition and loss of memory. Several clinical studies have shown Alzheimer's disease to be associated with disturbances in glucose metabolism and the subsequent tricarboxylic acid (TCA) cycle-related metabolites like glutamate (Glu), glutamine (Gln), and N-acetylaspartate (NAA). These metabolites have been viewed as biomarkers by (a) assisting early diagnosis of Alzheimer's disease and (b) evaluating the efficacy of a treatment regimen. In this study, 13-month-old triple transgenic mice (a mouse model of Alzheimer's disease (3xTg-AD)) were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C NMR to determine the concentrations of 13C-labeled isotopomers of Glu, Gln, aspartate (Asp), GABA, myo-inositol, and NAA. Total (12C+13C) Glu, Gln, and Asp were quantified by high-performance liquid chromatography to calculate enrichment. Furthermore, we examined the effects of lipoic acid in modulating these metabolites, based on its previously established insulin mimetic effects. Total 13C labeling and percent enrichment decreased by ∼50% in the 3xTg-AD mice. This hypometabolism was partially or completely restored by lipoic acid feeding. The ability of lipoic acid to restore glucose metabolism and subsequent TCA cycle-related metabolites further substantiates its role in overcoming the hypometabolic state inherent in early stages of Alzheimer's disease. PMID:24220168

Metabolic sensor governing bacterial virulence in Staphylococcus aureus.

PubMed

Ding, Yue; Liu, Xing; Chen, Feifei; Di, Hongxia; Xu, Bin; Zhou, Lu; Deng, Xin; Wu, Min; Yang, Cai-Guang; Lan, Lefu

2014-11-18

An effective metabolism is essential to all living organisms, including the important human pathogen Staphylococcus aureus. To establish successful infection, S. aureus must scavenge nutrients and coordinate its metabolism for proliferation. Meanwhile, it also must produce an array of virulence factors to interfere with host defenses. However, the ways in which S. aureus ties its metabolic state to its virulence regulation remain largely unknown. Here we show that citrate, the first intermediate of the tricarboxylic acid (TCA) cycle, binds to and activates the catabolite control protein E (CcpE) of S. aureus. Using structural and site-directed mutagenesis studies, we demonstrate that two arginine residues (Arg145 and Arg256) within the putative inducer-binding cavity of CcpE are important for its allosteric activation by citrate. Microarray analysis reveals that CcpE tunes the expression of 126 genes that comprise about 4.7% of the S. aureus genome. Intriguingly, although CcpE is a major positive regulator of the TCA-cycle activity, its regulon consists predominantly of genes involved in the pathogenesis of S. aureus. Moreover, inactivation of CcpE results in increased staphyloxanthin production, improved ability to acquire iron, increased resistance to whole-blood-mediated killing, and enhanced bacterial virulence in a mouse model of systemic infection. This study reveals CcpE as an important metabolic sensor that allows S. aureus to sense and adjust its metabolic state and subsequently to coordinate the expression of virulence factors and bacterial virulence.

Fur-dependent detoxification of organic acids by rpoS mutants during prolonged incubation under aerobic, phosphate starvation conditions.

PubMed

Guillemet, Mélanie L; Moreau, Patrice L

2008-08-01

The activity of amino acid-dependent acid resistance systems allows Escherichia coli to survive during prolonged incubation under phosphate (P(i)) starvation conditions. We show in this work that rpoS-null mutants incubated in the absence of any amino acid survived during prolonged incubation under aerobic, P(i) starvation conditions. Whereas rpoS(+) cells incubated with glutamate excreted high levels of acetate, rpoS mutants grew on acetic acid. The characteristic metabolism of rpoS mutants required the activity of Fur (ferric uptake regulator) in order to decrease the synthesis of the small RNA RyhB that might otherwise inhibit the synthesis of iron-rich proteins. We propose that RpoS (sigma(S)) and the small RNA RyhB contribute to decrease the synthesis of iron-rich proteins required for the activity of the tricarboxylic acid (TCA) cycle, which redirects the metabolic flux toward the production of acetic acid at the onset of stationary phase in rpoS(+) cells. In contrast, Fur activity, which represses ryhB, and the lack of RpoS activity allow a substantial activity of the TCA cycle to continue in stationary phase in rpoS mutants, which decreases the production of acetic acid and, eventually, allows growth on acetic acid and P(i) excreted into the medium. These data may help explain the fact that a high frequency of E. coli rpoS mutants is found in nature.

General Overview of the ODC Elimination Effort of the RSRM Program

NASA Technical Reports Server (NTRS)

Evans, Kurt; Golde, Rick; McCool, Alex (Technical Monitor)

2001-01-01

The purpose of the ODC Elimination Program of the Space Shuttle RSRM Program is to eliminate the usage of 1, 1, 1 trichloroethane (TCA) in all RSRM (Reusable Solid Rocket Motor) manufacturing processes. This program consists of the following phases and objectives: Phase 0 - Convert to greaseless shipping of metal components. Phase 1 - Eliminate TCA vapor degreasing and usage in propellant cleaning operations. Phase 2 - Eliminate TCA usage for hand cleaning operations. Each phase reduces peak TCA consumption (about 1.4 million pounds in 1989) by about 29, 61, and 10 percent, respectively. Phase 0 was completed in 1992, Phase 1 in 1997, and Phase 2 is in progress (about 75% complete). TCA replacement objectives are accomplished by are a series of subscale, full-scale, and static testing outlined by the NASA-funded, ODC Elimination Program.

Oxygenated monoterpenes citral and carvacrol cause oxidative damage in Escherichia coli without the involvement of tricarboxylic acid cycle and Fenton reaction.

PubMed

Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego

2014-10-17

Oxygenated monoterpenes citral and carvacrol are common constituents of many essential oils (EOs) that have been extensively studied as antimicrobial agents but whose mechanisms of microbial inactivation have not been totally elucidated. A recent study described a mechanism of Escherichia coli death for (+)-limonene, a hydrocarbon monoterpene also frequently present in EOs, similar to the common mechanism proposed for bactericidal antibiotics. This mechanism involves the formation of Fenton-mediated hydroxyl radical, a reactive oxygen species (ROS), via tricarboxylic acid (TCA) cycle, which would ultimately inactivate cells. Our objective was to determine whether E. coli MG1655 inactivation by citral and carvacrol follows a similar mechanism of cell death. Challenging experiments with 300μL/L citral and 100μL/L carvacrol inactivated at least 2.5log10cycles of exponentially growing cells in 3h under aerobic conditions. The presence of thiourea (an ROS scavenger) reduced cell inactivation in 2log10cycles, demonstrating the role of ROS in cell death. Decreased resistance of a ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) indicated that citral and carvacrol caused oxidative damage to DNA. Although the mechanism of E. coli inactivation by carvacrol and citral was similarly mediated by ROS, their formation did not follow the same pathways described for (+)-limonene and bactericidal drugs because neither Fenton reaction nor NADH production via the TCA cycle was involved in cell death. Moreover, further experiments demonstrated antimicrobial activity of citral and carvacrol in anaerobic environments without the involvement of ROS. As a consequence, cell death by carvacrol and citral in anaerobiosis follows a different mechanism than that observed under aerobic conditions. These results demonstrated a different mechanism of inactivation by citral and carvacrol with regard to (+)-limonene and bactericidal antibiotics, indicating the complexity of the mechanisms of bacterial inactivation among EO constituents. Advancements in the description of these mechanisms will help in extending and improving the use of these compounds as natural antimicrobials. Copyright © 2014 Elsevier B.V. All rights reserved.

Effect of pre-treatment with dichloroacetic or trichloroacetic acid in drinking water on the pharmacokinetics of a subsequent challenge dose in B6C3F1 mice.

PubMed

Gonzalez-Leon, A; Merdink, J L; Bull, R J; Schultz, I R

1999-12-15

Dichloroacetate (DCA) and trichloroacetate (TCA) are prominent by-products of chlorination of drinking water. Both chemicals have been shown to be hepatic carcinogens in mice. Prior work has demonstrated that DCA inhibits its own metabolism in rats and humans. This study focuses on the effect of prior administration of DCA or TCA in drinking water on the pharmacokinetics of a subsequent challenge dose of DCA or TCA in male B6C3F1 mice. Mice were provided with DCA or TCA in their drinking water at 2 g/l for 14 days and then challenged with a 100 mg/kg i.v. (non-labeled) or gavage (14C-labeled) dose of DCA or TCA. The challenge dose was administered after 16 h fasting and removal of the haloacetate pre-treatment. The haloacetate blood concentration-time profile and the disposition of 14C were characterized and compared with controls. The effect of pre-treatment on the in vitro metabolism of DCA in hepatic S9 was also evaluated. Pre-treatment with DCA caused a significant increase in the blood concentration-time profiles of the challenge dose of DCA. No effect on the blood concentration-time profile of DCA was observed after pre-treatment with TCA. Pre-treatment with TCA had no effect on subsequent doses of DCA. Pre-treatment with DCA did not have a significant effect on the formation of 14CO2 from radiolabeled DCA. In vitro experiments with liver S9 from DCA-pre-treated mice demonstrated that DCA inhibits it own metabolism. These results indicate that DCA metabolism in mice is also susceptible to inhibition by prior treatment with DCA, however the impact on clearance is less marked in mice than in F344 rats. In contrast, the metabolism and pharmacokinetics of TCA is not affected by pre-treatment with either DCA or TCA.

Descriptive Quantitative Analysis of Rearfoot Alignment Radiographic Parameters.

PubMed

Meyr, Andrew J; Wagoner, Matthew R

2015-01-01

Although the radiographic parameters of the transverse talocalcaneal angle (tTCA), calcaneocuboid angle (CCA), talar head uncovering (THU), calcaneal inclination angle (CIA), talar declination angle (TDA), lateral talar-first metatarsal angle (lTFA), and lateral talocalcaneal angle (lTCA) form the basis of the preoperative evaluation and procedure selection for pes planovalgus deformity, the so-called normal values of these measurements are not well-established. The objectives of the present study were to retrospectively evaluate the descriptive statistics of these radiographic parameters (tTCA, CCA, THU, CIA, TDA, lTFA, and lTCA) in a large population, and, second, to determine an objective basis for defining "normal" versus "abnormal" measurements. As a secondary outcome, the relationship of these variables to the body mass index was assessed. Anteroposterior and lateral foot radiographs from 250 consecutive patients without a history of previous foot and ankle surgery and/or trauma were evaluated. The results revealed a mean measurement of 24.12°, 13.20°, 74.32%, 16.41°, 26.64°, 8.37°, and 43.41° for the tTCA, CCA, THU, CIA, TDA, lTFA, and lTCA, respectively. These were generally in line with the reported historical normal values. Descriptive statistical analysis demonstrated that the tTCA, THU, and TDA met the standards to be considered normally distributed but that the CCA, CIA, lTFA, and lTCA demonstrated data characteristics of both parametric and nonparametric distributions. Furthermore, only the CIA (R = -0.2428) and lTCA (R = -0.2449) demonstrated substantial correlation with the body mass index. No differentiations in deformity progression were observed when the radiographic parameters were plotted against each other to lead to a quantitative basis for defining "normal" versus "abnormal" measurements. Copyright © 2015 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Distinguishing solid bitumens formed by thermochemical sulfate reduction and thermal chemical alteration

USGS Publications Warehouse

Kelemen, S.R.; Walters, C.C.; Kwiatek, P.J.; Afeworki, M.; Sansone, M.; Freund, H.; Pottorf, R.J.; Machel, H.G.; Zhang, T.; Ellis, G.S.; Tang, Y.; Peters, K.E.

2008-01-01

Insoluble solid bitumens are organic residues that can form by the thermal chemical alteration (TCA) or thermochemical sulfate reduction (TSR) of migrated petroleum. TCA may actually encompass several low temperature processes, such as biodegradation and asphaltene precipitation, followed by thermal alteration. TSR is an abiotic redox reaction where petroleum is oxidized by sulfate. It is difficult to distinguish solid bitumens associated with TCA of petroleum from those associated with TSR when both processes occur at relatively high temperature. The focus of the present work was to characterize solid bitumen samples associated with TCA or TSR using X-ray photoelectron spectroscopy (XPS). XPS is a surface analysis conducted on either isolated or in situ (>25 ??m diameter) solid bitumen that can provide the relative abundance and chemical speciation of carbon, organic and inorganic heteroatoms (NSO). In this study, naturally occurring solid bitumens from three locations, Nisku Fm. Brazeau River area (TSR-related), LaBarge Field Madison Fm. (TSR-related), and the Alaskan Brooks range (TCA-related), are compared to organic solids generated during laboratory simulation of the TSR and TCA processes. The abundance and chemical nature of organic nitrogen and sulfur in solid bitumens can be understood in terms of the nature of (1) petroleum precursor molecules, (2) the concentration of nitrogen by way of thermal stress and (3) the mode of sulfur incorporation. TCA solid bitumens originate from polar materials that are initially rich in sulfur and nitrogen. Aromaticity and nitrogen increase as thermal stress cleaves aliphatic moieties and condensation reactions take place. Organic sulfur in TCA organic solids remains fairly constant with increasing maturation (3.5 to ???17 sulfur per 100 carbons) into aromatic structures and to the low levels of nitrogen in their hydrocarbon precursors. Hence, XPS results provide organic chemical composition information that helps to distinguish whether solid bitumen, either in situ or removed and concentrated from the rock matrix, was formed via the TCA or TRS process. ?? 2008 Elsevier Ltd.

Effects of 1,1,1-Trichloroethane and Triclocarban on Reductive Dechlorination of Trichloroethene in a TCE-Reducing Culture

PubMed Central

Wen, Li-Lian; Chen, Jia-Xian; Fang, Jia-Yi; Li, Ang; Zhao, He-Ping

2017-01-01

Chlorinated compounds were generally present in the environment due to widespread use in the industry. A short-term study was performed to evaluate the effects of 1,1,1- trichloroethane (TCA) and triclocarban (TCC) on trichloroethene (TCE) removal in a reactor fed with lactate as the sole electron donor. Both TCA and TCC inhibited TCE reduction, but the TCC had a more pronounced effect compared to TCA. The TCE-reducing culture, which had never been exposed to TCA before, reductively dechlorinated TCA to 1,1-dichloroethane (DCA). Below 15 μM, TCA had little effect on the transformation of TCE to cis-dichloroethene (DCE); however, the reduction of cis-DCE and vinyl chloride (VC) were more sensitive to TCA, and ethene production was completely inhibited when the concentration of TCA was above 15 μM. In cultures amended with TCC, the reduction of TCE was severely affected, even at concentrations as low as 0.3 μM; all the cultures stalled at VC, and no ethene was detected. The cultures that fully transformed TCE to ethene contained 5.2–8.1% Dehalococcoides. Geobacter and Desulfovibrio, the bacteria capable of partially reducing TCE to DCE, were detected in all cultures, but both represented a larger proportion of the community in TCC-amended cultures. All cultures were dominated by Clostridium_sensu_stricto_7, a genus that belongs to Firmicutes with proportions ranging from 40.9% (in a high TCC (15 μM) culture) to 88.2%. Methanobacteria was detected at levels of 1.1–12.7%, except in cultures added with 15 and 30 μM TCA, in which they only accounted for ∼0.4%. This study implies further environmental factors needed to be considered in the successful bioremediation of TCE in contaminated sites. PMID:28824572

Limitations of the endonasal endoscopic approach in treating olfactory groove meningiomas. A systematic review.

PubMed

Shetty, Sathwik Raviraj; Ruiz-Treviño, Armando S; Omay, Sacit Bulent; Almeida, Joao Paulo; Liang, Buqing; Chen, Yu-Ning; Singh, Harminder; Schwartz, Theodore H

2017-10-01

To review current management strategies for olfactory groove meningioma (OGM)s and the recent literature comparing endoscopic endonasal (EEA) with traditional transcranial (TCA) approaches. A PubMed search of the recent literature (2011-2016) was performed to examine outcomes following EEA and TCA for OGM. The extent of resection, visual outcome, postoperative complications and recurrence rates were analyzed using percentages and proportions, the Fischer exact test and the Student's t-test using Graphpad PRISM 7.0Aa (San Diego, CA) software. There were 444 patients in the TCA group with a mean diameter of 4.61 (±1.17) cm and 101 patients in the EEA group with a mean diameter of 3.55 (± 0.58) cm (p = 0.0589). GTR was achieved in 90.9% (404/444) in the TCA group and 70.2% (71/101) in the EEA group (p < 0.0001). Of the patients with preoperative visual disturbances, 80.7% (21/26) of patients in the EEA cohort had an improvement in vision compared to 12.83%(29/226) in the TCA group (p < 0.0001). Olfaction was lost in 61% of TCA and in 100% of EEA patients. CSF leaks and meningitis occurred in 25.7% and 4.95% of EEA patients and 6.3% and 1.12% of TCA patients, respectively (p < 0.0001; p = 0.023). Our updated literature review demonstrates that despite more experience with endoscopic resection and skull base reconstruction, the literature still supports TCA over EEA with respect to the extent of resection and complications. EEA may be an option in selected cases where visual improvement is the main goal of surgery and postoperative anosmia is acceptable to the patient or in medium-sized tumors with existing preoperative anosmia. Nevertheless, based on our results, it seems more prudent at this time to use TCA for the majority of OGMs.

Inactivation of CYP2A6 by the Dietary Phenylpropanoid trans-Cinnamic Aldehyde (Cinnamaldehyde) and Estimation of Interactions with Nicotine and Letrozole

PubMed Central

Chan, Jeannine; Oshiro, Tyler; Thomas, Sarah; Higa, Allyson; Black, Stephen; Todorovic, Aleksandar; Elbarbry, Fawzy

2016-01-01

Human exposure to trans-cinnamic aldehyde [t-CA; cinnamaldehyde; cinnamal; (E)-3-phenylprop-2-enal] is common through diet and through the use of cinnamon powder for diabetes and to provide flavor and scent in commercial products. We evaluated the likelihood of t-CA to influence metabolism by inhibition of P450 enzymes. IC50 values from recombinant enzymes indicated that an interaction is most probable for CYP2A6 (IC50 = 6.1 µM). t-CA was 10.5-fold more selective for human CYP2A6 than for CYP2E1; IC50 values for P450s 1A2, 2B6, 2C9, 2C19, 2D6, and 3A4 were 15.8-fold higher or more. t-CA is a type I ligand for CYP2A6 (KS = 14.9 µM). Inhibition of CYP2A6 by t-CA was metabolism-dependent; inhibition required NADPH and increased with time. Glutathione lessened the extent of inhibition modestly and statistically significantly. The carbon monoxide binding spectrum was dramatically diminished after exposure to NADPH and t-CA, suggesting degradation of the heme or CYP2A6 apoprotein. Using a static model and mechanism-based inhibition parameters (KI = 18.0 µM; kinact = 0.056 minute−1), changes in the area under the concentration-time curve (AUC) for nicotine and letrozole were predicted in the presence of t-CA (0.1 and 1 µM). The AUC fold-change ranged from 1.1 to 3.6. In summary, t-CA is a potential source of pharmacokinetic variability for CYP2A6 substrates due to metabolism-dependent inhibition, especially in scenarios when exposure to t-CA is elevated due to high dietary exposure, or when cinnamon is used as a treatment of specific disease states (e.g., diabetes). PMID:26851241

Inhaled ozone (O{sub 3})-induces changes in serum metabolomic and liver transcriptomic profiles in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.

Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O{sub 3}) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O{sub 3} exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O{sub 3} at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a secondmore » experiment, rats were exposed to FA or 1.0 ppm O{sub 3}, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O{sub 3} increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O{sub 3} increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O{sub 3}. In conclusion, short-term O{sub 3} exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. - Highlights: • Ozone, an ubiquitous air pollutant induces acute systemic metabolic derangement. • Serum metabolomic approach provides novel insights in ozone-induced changes. • Ozone exposure induces leptinemia, hyperglycemia, and glucose intolerance. • Ozone increases serum free fatty acids, branched chain amino acids, cholesterols. • Ozone metabolic derangement is likely mediated by neuronal stress response pathway.« less

Evaluation results of xTCA equipment for HEP experiments at CERN

NASA Astrophysics Data System (ADS)

Di Cosmo, M.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.; Vichoudis, P.

2013-12-01

The MicroTCA and AdvancedTCA industry standards are candidate modular electronic platforms for the upgrade of the current generation of high energy physics experiments. The PH-ESE group at CERN launched in 2011 the xTCA evaluation project with the aim of performing technical evaluations and eventually providing support for commercially available components. Different devices from different vendors have been acquired, evaluated and interoperability tests have been performed. This paper presents the test procedures and facilities that have been developed and focuses on the evaluation results including electrical, thermal and interoperability aspects.

Human factors in aviation: Terminal control area boundary conflicts

NASA Technical Reports Server (NTRS)

Monan, William P.

1989-01-01

Air-to-air conflicts in the vicinity of Terminal Control Area (TCA) boundaries were studied to obtain a better understanding of the causal dynamics of these events with particular focus on human factor issues. The study dataset consisted of 381 Instrument Flight Rules/Visual Flight Rules (IFR/VFR) traffic conflicts in airspace layers above TCA ceiling and below TCA floors; 213 reports of incursions in TCA terminal airspace by VFR aircraft, of which 123 resulted in conflicts; and an additional set of reports describing problems with Air Traffic Control (ATC) services in and around TCAs. Results and conclusions are detailed.

Nuclear Cytoplasmic Trafficking of Proteins is a Major Response of Human Fibroblasts to Oxidative Stress

PubMed Central

Baqader, Noor O.; Radulovic, Marko; Crawford, Mark; Stoeber, Kai; Godovac-Zimmermann, Jasminka

2014-01-01

We have used a subcellular spatial razor approach based on LC–MS/MS-based proteomics with SILAC isotope labeling to determine changes in protein abundances in the nuclear and cytoplasmic compartments of human IMR90 fibroblasts subjected to mild oxidative stress. We show that response to mild tert-butyl hydrogen peroxide treatment includes redistribution between the nucleus and cytoplasm of numerous proteins not previously associated with oxidative stress. The 121 proteins with the most significant changes encompass proteins with known functions in a wide variety of subcellular locations and of cellular functional processes (transcription, signal transduction, autophagy, iron metabolism, TCA cycle, ATP synthesis) and are consistent with functional networks that are spatially dispersed across the cell. Both nuclear respiratory factor 2 and the proline regulatory axis appear to contribute to the cellular metabolic response. Proteins involved in iron metabolism or with iron/heme as a cofactor as well as mitochondrial proteins are prominent in the response. Evidence suggesting that nuclear import/export and vesicle-mediated protein transport contribute to the cellular response was obtained. We suggest that measurements of global changes in total cellular protein abundances need to be complemented with measurements of the dynamic subcellular spatial redistribution of proteins to obtain comprehensive pictures of cellular function. PMID:25133973

[Preliminary proteomics analysis of the total proteins of HL Type cytoplasmic male sterility rice anther].

PubMed

Wen, Li; Liu, Gai; Zhang, Zai-Jun; Tao, Jun; Wan, Cui-Xiang; Zhu, Ying-Guo

2006-03-01

The proteins of HL type cytoplasmic male sterility rice anther of YTA (CMS) and YTB (maintenance line) were separated by two-dimensional electrophoresis with immobilized ph (3-10 non-linear) gradients as the first dimension and SDS-PAGE as the second. The silver-stained proteins spots were analyzed using Image Master 2D software, there were about 1800 detectable spots on each 2D-gel, and about 85 spots were differential expressed. With direct MALDI-TOF mass spectrometry analysis and protein database searching, 9 protein spots out of 16 were identified. Among those proteins, there were Putative nucleic acid binding protein, glucose-1-phosphate adenylyltransferase (ADP-glucose pyrophosphorylase, AGPase) (EC: 2.7.7.27) large chain, UDP-glucuronic acid decarboxylase, putative calcium-binding protein annexin, putative acetyl-CoA synthetase and putative lipoamide dehydrogenase etc. They were closely associated with metabolism, protein biosynthesis, transcription, signal transduction and so on, all of which are cell activities that are essential to pollen development. Some of the identified proteins, i.e. AGPase, putative lipoamide dehydrogenase and putative acetyl-CoA synthetase were deeply discussed on the relationship to CMS. AGPase catalyzes a very important step in the biosynthesis of alpha 1,4-glucans (glycogen or starch) in bacteria and plants: synthesis of the activated glucosyl donor, ADP-glucose, from glucose-1-phosphate and ATP. The lack of the AGPase in male sterile line might directly result in the reduction of starch, and the synthesis of starch was the most important processes during the development of pollen. In present research, the descent or reduction of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase seemed involved in pollen sterility in rice. The degeneration and formation of various tissues during pollen development may impose high demands for energy and key biosynthetic intermediates. Under such conditions, the TCA cycle needs to operate fully, because the TCA cycle is an important source for many intermediates required for biosynthetic pathways, in addition to performing an oxidative, energy-producing role. Thus, it seemed reasonable to infer that the decrease of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase in anther might prevent the conversion of pyruvate into acetyl-CoA, and as a result, the TCA cycle could no longer operate at a sufficient rate to meet all requirements in anther cells, leading to pollen sterility. This study gave new insights into the mechanism of CMS in rice and demonstrated the power of the proteomic approach in plant biology studies.

Taxicab Correspondence Analysis of Contingency Tables with One Heavyweight Column

ERIC Educational Resources Information Center

Choulakian, V.

2008-01-01

The aim of this paper is to study the analysis of contingency tables with one heavyweight column or one heavyweight entry by taxicab correspondence analysis (TCA). Given that the mathematics of TCA is simpler than the mathematics of correspondence analysis (CA), the influence of one heavyweight column on the outputs of TCA is studied explicitly…

Development of an updated PBPK model for trichloroethylene and metabolites in mice, and its application to discern the role of oxidative metabolism in TCE-induced hepatomegaly.

PubMed

Evans, M V; Chiu, W A; Okino, M S; Caldwell, J C

2009-05-01

Trichloroethylene (TCE) is a lipophilic solvent rapidly absorbed and metabolized via oxidation and conjugation to a variety of metabolites that cause toxicity to several internal targets. Increases in liver weight (hepatomegaly) have been reported to occur quickly in rodents after TCE exposure, with liver tumor induction reported in mice after long-term exposure. An integrated dataset for gavage and inhalation TCE exposure and oral data for exposure to two of its oxidative metabolites (TCA and DCA) was used, in combination with an updated and more accurate physiologically-based pharmacokinetic (PBPK) model, to examine the question as to whether the presence of TCA in the liver is responsible for TCE-induced hepatomegaly in mice. The updated PBPK model was used to help discern the quantitative contribution of metabolites to this effect. The update of the model was based on a detailed evaluation of predictions from previously published models and additional preliminary analyses based on gas uptake inhalation data in mice. The parameters of the updated model were calibrated using Bayesian methods with an expanded pharmacokinetic database consisting of oral, inhalation, and iv studies of TCE administration as well as studies of TCE metabolites in mice. The dose-response relationships for hepatomegaly derived from the multi-study database showed that the proportionality of dose to response for TCE- and DCA-induced hepatomegaly is not observed for administered doses of TCA in the studied range. The updated PBPK model was used to make a quantitative comparison of internal dose of metabolized and administered TCA. While the internal dose of TCA predicted by modeling of TCE exposure (i.e., mg TCA/kg-d) showed a linear relationship with hepatomegaly, the slope of the relationship was much greater than that for directly administered TCA. Thus, the degree of hepatomegaly induced per unit of TCA produced through TCE oxidation is greater than that expected per unit of TCA administered directly, which is inconsistent with the hypothesis that TCA alone accounts for TCE-induced hepatomegaly. In addition, TCE-induced hepatomegaly showed a much more consistent relationship with PBPK model predictions of total oxidative metabolism than with predictions of TCE area-under-the-curve in blood, consistent with toxicity being induced by oxidative metabolites rather than the parent compound. Therefore, these results strongly suggest that oxidative metabolites in addition to TCA are necessary contributors to TCE-induced liver weight changes in mice.

Influence of Posterior Corneal Astigmatism on Total Corneal Astigmatism in Eyes With Keratoconus.

PubMed

Savini, Giacomo; Næser, Kristian; Schiano-Lomoriello, Domenico; Mularoni, Alessandro

2016-11-01

To measure posterior corneal astigmatism (PCA) and investigate its influence on total corneal astigmatism (TCA) in eyes with keratoconus. Keratometric astigmatism (KA), PCA, and TCA were investigated by means of a dual Scheimpflug analyzer in patients with keratoconus. Vector analysis was carried out with the Næser polar value method. We enrolled 119 eyes. PCA magnitude averaged 0.77 ± 0.43 diopters (D) and exceeded 0.50, 1.00, and 2.00 D in 73.9%, 21.8%, and 16.8% of eyes, respectively. PCA averaged 0.95 ± 0.48, 0.55 ± 0.28, and 0.70 ± 0.35 D in eyes with with-the-rule (WTR), against-the-rule (ATR), and oblique astigmatism. The steepest posterior meridian was oriented vertically (between 61 and 119 degrees) in 55.5% of eyes, thus generating ATR astigmatism. The difference between the location of the steepest meridian of KA and that of TCA was >10 degrees in 8.4% of eyes. On average, KA overestimated TCA in eyes with WTR astigmatism by 0.16 D and underestimated TCA in eyes with ATR astigmatism by 0.22 D. The PCA power oriented along the steeper anterior corneal meridian averaged -0.83 ± 0.40, -0.40 ± 0.37, and -0.53 ± 0.43 D for WTR, ATR, and obliquely astigmatic eyes, respectively. Linear regression disclosed a statistically significant correlation (P < 0.0001, r = 0.16) between the meridional powers of TCA and PCA. In eyes with keratoconus, PCA displays large, variable values and is correlated to TCA. The influence of PCA on TCA cannot be disregarded when planning astigmatism correction by toric intraocular lenses.

A Randomized Controlled Trial of Acupuncture for Osteoarthritis of the Knee: Effects of Patient-Provider Communication

PubMed Central

Suarez-Almazor, Maria E.; Looney, Carol; Liu, YanFang; Cox, Vanessa; Pietz, Kenneth; Marcus, Donald M.; Street, Richard L.

2012-01-01

Objectives There is conflicting evidence on the efficacy of Traditional Chinese Acupuncture (TCA), and the role of placebo effects elicited by acupuncturists’ behavior has not been elucidated. We conducted a 3-month randomized clinical trial in patients with knee osteoarthritis to compare the efficacy of TCA to sham acupuncture, and examine the effects of acupuncturists’ communication style. Methods Acupuncturists were trained to interact in one of two communication styles: ‘high’ or ‘neutral’ expectations. Patients were randomized to one of 3 groups: waiting list, ‘high’ or ‘neutral’, and nested within style, TCA or sham acupuncture over 6 weeks. Sham acupuncture was performed in non-meridian points, with shallow needles and minimal stimulation. Primary outcome measures were: Joint-specific Multidimensional Assessment of Pain (J-MAP), Western Ontario McMaster Osteoarthritis Index (WOMAC), and satisfaction. Results 455 patients who received treatment (TCA or sham) and 72 controls were included. No statistically significant differences were observed between TCA or sham acupuncture, but both groups had significant reductions in J-MAP and WOMAC pain compared to the waiting group (-1.1, -1.0, and -0.1, p<0.001; -13.7, -14, -1.7, p<0.001). Statistically significant differences were observed in J-MAP pain reduction and satisfaction, favoring the ‘high’ expectations group. Fifty-two percent and 43% in the TCA and sham groups thought they had received TCA (kappa=0.05), suggesting successful blinding. Conclusion TCA was not superior to sham acupuncture. However, acupuncturists’ style had significant effects on pain reduction and satisfaction, suggesting that the analgesic benefits of acupuncture can be partially mediated through placebo effects related to the acupuncturist's behavior. PMID:20506122

Destruction of chloroanisoles by using a hydrogen peroxide activated method and its application to remove chloroanisoles from cork stoppers.

PubMed

Recio, Eliseo; Alvarez-Rodríguez, María Luisa; Rumbero, Angel; Garzón, Enrique; Coque, Juan José R

2011-12-14

A chemical method for the efficient destruction of 2,4,6-trichloroanisole (TCA) and pentachloroanisole (PCA) in aqueous solutions by using hydrogen peroxide as an oxidant catalyzed by molybdate ions in alkaline conditions was developed. Under optimal conditions, more than 80.0% TCA and 75.8% PCA were degraded within the first 60 min of reaction. Chloroanisoles destruction was followed by a concomitant release of up to 2.9 chloride ions per TCA molecule and 4.6 chloride ions per PCA molecule, indicating an almost complete dehalogenation of chloroanisoles. This method was modified to be adapted to chloroanisoles removal from the surface of cork materials including natural cork stoppers (86.0% decrease in releasable TCA content), agglomerated corks (78.2%), and granulated cork (51.3%). This method has proved to be efficient and inexpensive with practical application in the cork industry to lower TCA levels in cork materials.

Novel function of N,N-bis(2-chloroethyl)docos-13-enamide for reversal of multidrug resistance in tongue cancer.

PubMed

Qin, Qing; Ma, Peng-Fei; Kuang, Xiao-Cong; Gao, Ming-Xing; Mo, De-Huan; Xia, Shuang; Jin, Ning; Xia, Jun-Jie; Qi, Zhong-Quan; Lin, Cui-Wu

2013-12-05

Multidrug resistance (MDR) is a key element in the failure of chemotherapies, and development of agents to overcome MDR is crucial to improving cancer treatments. The overexpression of glutathione-S-transferases (GSTs) is one of the major mechanisms of MDR. Because some agents used in traditional Chinese medicine have strong antitumor effects coupled with low toxicity; we investigated the ability of N,N-bis(2-chloroethyl)docos-13-enamide (compound J), the synthesized analog of a highly unsaturated fatty acid from Isatis tinctoria L., to reverse the MDR induced by adriamycin (ADM) in TCA8113/ADM cells. We found that compound J significantly increased the cytotoxicity of ADM in TCA8113/ADM cells, with a reversal fold of 2.461. Analysis of the mechanisms through which compound J reversed MDR indicated that compound J significantly decreased the activity of GSTs and enhanced the depletion of GSH in TCA8113/ADM cells, but did not affect the P-glycoprotein (P-gp) efflux. Taken together, our data suggested that compound J was an excellent candidate for reversing MDR in cancer therapy. © 2013 Published by Elsevier B.V.

Substrate interactions in dehalogenation of 1,2-dichloroethane, 1,2-dichloropropane, and 1,1,2-trichloroethane mixtures by Dehalogenimonas spp.

PubMed

Dillehay, Jacob L; Bowman, Kimberly S; Yan, Jun; Rainey, Fred A; Moe, William M

2014-04-01

When chlorinated alkanes are present as soil or groundwater pollutants, they often occur in mixtures. This study evaluated substrate interactions during the anaerobic reductive dehalogenation of chlorinated alkanes by the type strains of two Dehalogenimonas species, D. lykanthroporepellens and D. alkenigignens. Four contaminant mixtures comprised of combinations of the chlorinated solvents 1,2-dichloroethane (1,2-DCA), 1,2-dichloropropane (1,2-DCP), and 1,1,2-trichloroethane (1,1,2-TCA) were assessed for each species. Chlorinated solvent depletion and daughter product formation determined as a function of time following inoculation into anaerobic media revealed preferential dechlorination of 1,1,2-TCA over both 1,2-DCA and 1,2-DCP for both species. 1,2-DCA in particular was not dechlorinated until 1,1,2-TCA reached low concentrations. In contrast, both species concurrently dechlorinated 1,2-DCA and 1,2-DCP over a comparably large concentration range. This is the first report of substrate interactions during chlorinated alkane dehalogenation by pure cultures, and the results provide insights into the chlorinated alkane transformation processes that may be expected for contaminant mixtures in environments where Dehalogenimonas spp. are present.

Some dissociating factors in the analysis of structural and functional progressive damage in open-angle glaucoma.

PubMed

Hudson, C J W; Kim, L S; Hancock, S A; Cunliffe, I A; Wild, J M

2007-05-01

To identify the presence, and origin, of any "dissociating factors" inherent to the techniques for evaluating progression that mask the relationship between structural and functional progression in open-angle glaucoma (OAG). 23 patients (14 with OAG and 9 with ocular hypertension (OHT)) who had received serial Heidelberg Retina Tomograph (HRT II) and Humphrey Field Analyser (HFA) examinations for >or=5 years (mean 78.4 months (SD 9.5), range 60-101 months) were identified. Evidence of progressive disease was retrospectively evaluated in one eye of each patient using the Topographic Change Analysis (TCA) and Glaucoma Progression Analysis (GPA) for the HRT II and HFA, respectively. Six patients were stable by both techniques; four exhibited both structural and functional progression; seven exhibited structural progression, only, and six showed functional progression, only. Three types of dissociating factors were identified. TCA failed to identify progressive structural damage in the presence of advanced optic nerve head damage. GPA failed to identify progressive functional damage at stimulus locations, with sensitivities exhibiting test-retest variability beyond the maximum stimulus luminance of the perimeter, and where a perimetric learning effect was apparent. The three dissociating factors accounted for nine of the 13 patients who exhibited a lack of concordance between structural and functional progressive damage.

Detoxification of 1,1,2-trichloroethane to ethene in a bioreactor co-culture of Dehalogenimonas and Dehalococcoides mccartyi strains.

PubMed

Mortan, Siti Hatijah; Martín-González, Lucía; Vicent, Teresa; Caminal, Gloria; Nijenhuis, Ivonne; Adrian, Lorenz; Marco-Urrea, Ernest

2017-06-05

1,1,2-Trichloroethane (1,1,2-TCA) is a non-flammable organic solvent and common environmental contaminant in groundwater. Organohalide-respiring bacteria are key microorganisms to remediate 1,1,2-TCA because they can gain metabolic energy during its dechlorination under anaerobic conditions. However, all current isolates produce hazardous end products such as vinyl chloride, monochloroethane or 1,2-dichloroethane that accumulate in the medium. Here, we constructed a syntrophic co-culture of Dehalogenimonas and Dehalococcoides mccartyi strains to achieve complete detoxification of 1,1,2-TCA to ethene. In this co-culture, Dehalogenimonas transformed 1,1,2-TCA via dihaloelimination to vinyl chloride, whereas Dehalococcoides reduced vinyl chloride via hydrogenolysis to ethene. Molasses, pyruvate, and lactate supported full dechlorination of 1,1,2-TCA in serum bottle co-cultures. Scale up of the cultivation to a 5-L bioreactor operating for 76d in fed-batch mode was successful with pyruvate as substrate. This synthetic combination of bacteria with known complementary metabolic capabilities demonstrates the potential environmental relevance of microbial cooperation to detoxify 1,1,2-TCA. Copyright © 2017 Elsevier B.V. All rights reserved.

Electrically controllable twisted-coiled artificial muscle actuators using surface-modified polyester fibers

NASA Astrophysics Data System (ADS)

Park, Jungwoo; Yoo, Ji Wang; Seo, Hee Won; Lee, Youngkwan; Suhr, Jonghwan; Moon, Hyungpil; Koo, Ja Choon; Ryeol Choi, Hyouk; Hunt, Robert; Kim, Kwang Jin; Kim, Soo Hyun; Nam, Jae-Do

2017-03-01

As a new class of thermally activated actuators based on polymeric fibers, we investigated polyethylene terephthalate (PET) yarns for the development of a twisted-coiled polymer fiber actuator (TCA). The PET yarn TCA exhibited the maximum linear actuation up to 8.9% by external heating at above the glass transition temperature, 160 °C-180 °C. The payload of the actuator was successfully correlated with the preload and training-load conditions by an empirical equation. Furthermore, the PET-based TCA was electrically driven by Joule heating after the PET surface was metallization with silver. For the fast and precise control of PET yarn TCA, electroless silver plating was conducted to form electrical conductive layers on the PET fiber surface. The silver plated PET-based TCA was tested by Joule heating and the tensile actuation was increased up to 12.1% (6 V) due to the enhanced surface hardness and slippage of PET fibers. Overall, silver plating of the polymeric yarn provided a fast actuation speed and enhanced actuation performance of the TCA actuator by Joule heating, providing a great potential for being used in artificial muscle for biomimetic machines including robots, industrial actuators and powered exoskeletons.

Toxocara canis adult worm antigen induces proliferative response of healthy human peripheral blood mononuclear cells.

PubMed

Inuo, G; Akao, N; Kohsaka, H; Saito, I; Miyasaka, N; Fujita, K

1995-02-01

The proliferative response of human peripheral blood mononuclear cells (PBMC) from healthy donors to Toxocara canis adult worm antigens (TcA) was examined. PBMC from all donors examined (n = 7) strongly responded to TcA in a dose-dependent fashion after six days of culture, irrespective of their serological reactivity. In contrast, cord blood mononuclear cells did not react to TcA. The proliferation of PBMC in response to TcA was completely inhibited by anti-HLA-DR antibody. Purified CD4+ T cells reconstituted with autologous irradiated antigen presenting cells (APC) vigorously proliferated in response to TcA, but this was abrogated by pretreatment of APC with paraformaldehyde. Significant IL-2, IL-3, IL-4, IL-5 and IFN-gamma mRNA expression was detected in PBMC stimulated with TcA, with expression peaking at 72 h after stimulation. IL-1 beta, IL-6, IL-10 and GM-CSF mRNA expression was also upregulated, peaking at 24 h after stimulation. Taken together, these results suggest that adult T. canis-derived antigens have the ability to activate human PBMC as conventional antigens, possibly due to their cross-reactivity, which may be involved in the host defence against helminth infection.

Input of trichloroacetic acid into the vegetation of various climate zones--measurements on several continents.

PubMed

Weissflog, Ludwig; Krüger, Gert; Elansky, Nikolai; Putz, Erich; Pfennigsdorff, Andrea; Seyfarth, Klaus Ullrich; Nüchter, Matthias; Lange, Christian; Kotte, Karsten

2003-07-01

Trichloroacetic acid (TCA, CCl(3)COOH) is a phytotoxic chemical. Although TCA salts and derivates were once used as herbicides to combat perennial grasses and weeds, they have since been banned because of their indiscriminate herbicidal effects on woody plant species. However, TCA can also be formed in the atmosphere. For instance, the high-volatile C(2)-chlorohydrocarbons tetrachloroethene (TECE, C(2)Cl(4)) and 1,1,1-trichloroethane (TCE, CCl(3)CH(3)) can react under oxidative conditions in the atmosphere to form TCA and other substances. The ongoing industrialisation of Southeast Asia, South Africa and South America means that use of TECE as solvents in the metal and textile industries of these regions in the southern hemisphere can be expected to rise. The increasing emissions of this substance--together with the rise in the atmospheric oxidation potential caused by urban activities, slash and burn agriculture and forest fires in the southern hemisphere--could lead to a greater input/formation of TCA in the vegetation located in the lee of these emission sources. By means of biomonitoring studies, the input/formation of TCA in vegetation was detected at various locations in South America, North America, Africa, and Europe.

Quantum chemical study, spectroscopic investigations, NBO and HOMO-LUMO analyses of 3-aminoquinoline (3AQ) and [Ag(3AQ)2(TCA)] complex (TCA = Trichloroacetate)

NASA Astrophysics Data System (ADS)

Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abu Youssef, Morsy A.; Assem, Rania

2014-09-01

The new [Ag(3AQ)2(TCA)]; (3AQ = 3-aminoquinoline and TCA = Trichloroacetate) complex is synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry, vibrational frequencies, gauge-including atomic orbital (GIAO) 1H chemical shift values of the free and coordinated 3AQ in the ground state have been calculated by using DFT/B3LYP method. The TD-DFT results of the [Ag(3AQ)2(TCA)] complex showed a π-π* transition band at 240.3-242.6 nm (f = 0.1334-0.1348) which has longer wavelength and lower absorption intensity than that for the free 3AQ (233.2 nm, f = 0.3958). Dipole moment, polarizability and HOMO-LUMO gap values predicted better nonlinear optical properties (NLO) for the [Ag(3AQ)2(TCA)] than the 3AQ ligand. NBO analysis has been used to predict the most accurate Lewis structure of the studied molecules. The energies of the different intramolecular charge transfer (ICT) interactions within the studied molecules were estimated using second order perturbation theory.

Evaluation of 99mtechnetium-radiopharmaceutical binding to blood elements using different trichloroacetic acid concentrations.

PubMed

Freitas, R S; Gutfilen, B; da Fonseca, L M; Bernardo-Filho, M

1996-01-01

Secure determination of the binding of 99mTc-radiopharmaceuticals to plasma (P) and blood cell (BC) constituents can help to understand the biodistribution of radiophamaceuticals. The reported precipitation studies of blood with radiopharmaceuticals have shown that the results can not be easily compared between studies. We decided to determine the "gold standard" concentration of trichloroacetic acid (TCA) to evaluate the binding to blood elements for several radiopharmaceuticals used in routine nuclear medicine. We have studied phytic (99mTc-PHY), diethylenetriaminepentaacetic (99mTc-DTPA), glucoheptonic (99mTc-GHA) and dimercaptosuccinic (99mTc-DMSA) acids. Blood was incubated with radiopharmaceuticals, centrifuged and P and BC separated. Samples of P and BC were also precipitated with TCA concentrations (20.0, 10.0, 5.0, 1.0, 0.5 and 0.1 percent) and soluble (SF) and insoluble fractions (IF) were isolated. The percent radioactivity (percent rad) in IF-P depends on TCA concentration. It varied from 36.4 to 65.0 (99mTc-PHY), from 17.9 to 32.0 (99mTc-DTPA), from 11.5 to 38.8 (99mTc-GHA) and from 52.8 to 66.2 (99mTc-DMSA). The results for the binding of 99mTc-PHY to IF-P show that there was no differences in the percent rad when TCA concentrations of 0.1 to 1.0 percent were used. For 99mTc-DTPA, 5.0 percent is the best TCA concentration. For 99mTc-GHA, low values of percent rad bound to IF-P is found with TCA concentrations of 0.1, 0.5 and 1.0. Interestingly, with 99mTc-DMSA, high values of bound radioactivity are not dependent on TCA concentrations (0.1 to 10.0). Radioactivity in IF-BC depends on TCA concentration and it varied for 99mTc-PHY (80.1 to 54.1) and for 99mTc-GHA (85.5 to 61.7). With 99mTc-DTPA and with 99mTc-DMSA the percent rad in IF-BC seems independent of TCA concentration. We suggest that the evaluation of the binding of the various 99mTc-radiopharmaceuticals to blood constituents, using only one TCA concentration, should be avoided.

[Morphological changes in tongue cancer after cryosurgery].

PubMed

Zhou, X D; Mao, T Q

1993-01-01

Tca 8113 (human tongue cancer cell line) cell transplanted tumors in nude mice were treated with cryosurgery for three freeze-thaw cycles. Tumor samples were obtained by biopsies pre- and post-cryosurgery for morphological study. The results showed intercellular adhesion damage, nuclear pyknosis, cell death, etc. One week after, the deep parts of the frozen samples were similar to that of the untreated ones. Our study indicates the change of biomembrance may be also important as of nuclei in cell death and may play an important role in the treatment of cancer by cryochemistry.

NOK mediates glycolysis and nuclear PDC associated histone acetylation.

PubMed

Shi, Wei-Ye; Yang, Xiao; Huang, Bo; Shen, Wen H; Liu, Li

2017-06-01

NOK is a potent oncogene that can transform normal cells to cancer cells. We hypothesized that NOK might impact cancer cell metabolism and histone acetylation. We show that NOK localizes in the mitochondria, and while it minimally impacts tricarboxylic acid (TCA) cycle, it markedly inhibits the process of electron transport and oxidative phosphorylation processes and dramatically enhances aerobic glycolysis in cancer cells. NOK promotes the mitochondrial-nuclear translocation of pyruvate dehydrogenase complex (PDC), and enhances histone acetylation in the nucleus. Together, these findings show that NOK mediates glycolysis and nuclear PDC associated histone acetylation.

Bacterial supersystem for alginate import/metabolism and its environmental and bioenergy applications.

PubMed

Hashimoto, Wataru; Kawai, Shigeyuki; Murata, Kousaku

2010-01-01

Distinct from most alginate-assimilating bacteria that secrete polysaccharide lyases extracellularly, a gram-negative bacterium, Sphingomonas sp. A1 (strain A1), can directly incorporate alginate into its cytoplasm, without degradation, through a "superchannel" consisting of a mouth-like pit on the cell surface, periplasmic binding proteins, and a cytoplasmic membrane-bound ATP-binding cassette transporter. Flagellin homologues function as cell surface alginate receptors essential for expressing the superchannel. Cytoplasmic alginate lyases with different substrate specificities and action modes degrade the polysaccharide to its constituent monosaccharides. The resultant monosaccharides, α-keto acids, are converted to a reduced form by NADPH-dependent reductase, and are finally metabolized in the TCA cycle. Transplantation of the strain A1 superchannel to xenobiotic-degrading sphingomonads enhances bioremediation through the propagation of bacteria with an elevated transport activity. Furthermore, strain A1 cells transformed with Zymomonas mobilis genes for pyruvate decarboxylase and alcohol dehydrogenase II produce considerable amounts of biofuel ethanol from alginate when grown statically. © 2010 Landes Bioscience

Exogenous alanine and/or glucose plus kanamycin kills antibiotic-resistant bacteria.

PubMed

Peng, Bo; Su, Yu-Bin; Li, Hui; Han, Yi; Guo, Chang; Tian, Yao-Mei; Peng, Xuan-Xian

2015-02-03

Multidrug-resistant bacteria are an increasingly serious threat to human and animal health. However, novel drugs that can manage infections by multidrug-resistant bacteria have proved elusive. Here we show that glucose and alanine abundances are greatly suppressed in kanamycin-resistant Edwardsiella tarda by GC-MS-based metabolomics. Exogenous alanine or glucose restores susceptibility of multidrug-resistant E. tarda to killing by kanamycin, demonstrating an approach to killing multidrug-resistant bacteria. The mechanism underlying this approach is that exogenous glucose or alanine promotes the TCA cycle by substrate activation, which in turn increases production of NADH and proton motive force and stimulates uptake of antibiotic. Similar results are obtained with other Gram-negative bacteria (Vibrio parahaemolyticus, Klebsiella pneumoniae, Pseudomonas aeruginosa) and Gram-positive bacterium (Staphylococcus aureus), and the results are also reproduced in a mouse model for urinary tract infection. This study establishes a functional metabolomics-based strategy to manage infection by antibiotic-resistant bacteria. Copyright © 2015 Elsevier Inc. All rights reserved.

Newborn Urinary Metabolic Signatures of Prematurity and Other Disorders: A Case Control Study.

PubMed

Diaz, Sílvia O; Pinto, Joana; Barros, António S; Morais, Elisabete; Duarte, Daniela; Negrão, Fátima; Pita, Cristina; Almeida, Maria do Céu; Carreira, Isabel M; Spraul, Manfred; Gil, Ana M

2016-01-04

This work assesses the urinary metabolite signature of prematurity in newborns by nuclear magnetic resonance (NMR) spectroscopy, while establishing the role of possible confounders and signature specificity, through comparison to other disorders. Gender and delivery mode are shown to impact importantly on newborn urine composition, their analysis pointing out at specific metabolite variations requiring consideration in unmatched subject groups. Premature newborns are, however, characterized by a stronger signature of varying metabolites, suggestive of disturbances in nucleotide metabolism, lung surfactants biosynthesis and renal function, along with enhancement of tricarboxylic acid (TCA) cycle activity, fatty acids oxidation, and oxidative stress. Comparison with other abnormal conditions (respiratory depression episode, large for gestational age, malformations, jaundice and premature rupture of membranes) reveals that such signature seems to be largely specific of preterm newborns, showing that NMR metabolomics can retrieve particular disorder effects, as well as general stress effects. These results provide valuable novel information on the metabolic impact of prematurity, contributing to the better understanding of its effects on the newborn's state of health.

The First Complete Genome Sequence of the Class Fimbriimonadia in the Phylum Armatimonadetes

PubMed Central

Im, Wan-Taek; Wang, Sheng-Yue; Zhao, Guo-Ping; Zheng, Hua-Jun; Quan, Zhe-Xue

2014-01-01

In this study, we present the complete genome of Fimbriimonas ginsengisoli Gsoil 348T belonging to the class Fimbriimonadia of the phylum Armatimonadetes, formerly called as candidate phylum OP10. The complete genome contains a single circular chromosome of 5.23 Mb including a 45.5 kb prophage. Of the 4820 open reading frames (ORFs), 3,000 (62.2%) genes could be classified into Clusters of Orthologous Groups (COG) families. With the split of rRNA genes, strain Gsoil 348T had no typical 16S-23S-5S ribosomal RNA operon. In this genome, the GC skew inversion which was usually observed in archaea was found. The predicted gene functions suggest that the organism lacks the ability to synthesize histidine, and the TCA cycle is incomplete. Phylogenetic analyses based on ribosomal proteins indicated that strain Gsoil 348T represents a deeply branching lineage of sufficient divergence with other phyla, but also strongly involved in superphylum Terrabacteria. PMID:24967843

BCKDH: The Missing Link in Apicomplexan Mitochondrial Metabolism Is Required for Full Virulence of Toxoplasma gondii and Plasmodium berghei

PubMed Central

Oppenheim, Rebecca D.; Limenitakis, Julien; Polonais, Valerie; Seeber, Frank; Barrett, Michael P.; Billker, Oliver; McConville, Malcolm J.; Soldati-Favre, Dominique

2014-01-01

While the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii are thought to primarily depend on glycolysis for ATP synthesis, recent studies have shown that they can fully catabolize glucose in a canonical TCA cycle. However, these parasites lack a mitochondrial isoform of pyruvate dehydrogenase and the identity of the enzyme that catalyses the conversion of pyruvate to acetyl-CoA remains enigmatic. Here we demonstrate that the mitochondrial branched chain ketoacid dehydrogenase (BCKDH) complex is the missing link, functionally replacing mitochondrial PDH in both T. gondii and P. berghei. Deletion of the E1a subunit of T. gondii and P. berghei BCKDH significantly impacted on intracellular growth and virulence of both parasites. Interestingly, disruption of the P. berghei E1a restricted parasite development to reticulocytes only and completely prevented maturation of oocysts during mosquito transmission. Overall this study highlights the importance of the molecular adaptation of BCKDH in this important class of pathogens. PMID:25032958

TCA precipitation.

PubMed

Koontz, Laura

2014-01-01

Trichloroacetic acid (TCA) precipitation of proteins is commonly used to concentrate protein samples or remove contaminants, including salts and detergents, prior to downstream applications such as SDS-PAGE or 2D-gels. TCA precipitation denatures the protein, so it should not be used if the protein must remain in its folded state (e.g., if you want to measure a biochemical activity of the protein). © 2014 Elsevier Inc. All rights reserved.

Microbial communities and their predicted metabolic characteristics in deep fracture groundwaters of the crystalline bedrock at Olkiluoto, Finland

NASA Astrophysics Data System (ADS)

Bomberg, Malin; Lamminmäki, Tiina; Itävaara, Merja

2016-11-01

The microbial diversity in oligotrophic isolated crystalline Fennoscandian Shield bedrock fracture groundwaters is high, but the core community has not been identified. Here we characterized the bacterial and archaeal communities in 12 water conductive fractures situated at depths between 296 and 798 m by high throughput amplicon sequencing using the Illumina HiSeq platform. Between 1.7 × 104 and 1.2 × 106 bacterial or archaeal sequence reads per sample were obtained. These sequences revealed that up to 95 and 99 % of the bacterial and archaeal sequences obtained from the 12 samples, respectively, belonged to only a few common species, i.e. the core microbiome. However, the remaining rare microbiome contained over 3- and 6-fold more bacterial and archaeal taxa. The metabolic properties of the microbial communities were predicted using PICRUSt. The approximate estimation showed that the metabolic pathways commonly included fermentation, fatty acid oxidation, glycolysis/gluconeogenesis, oxidative phosphorylation, and methanogenesis/anaerobic methane oxidation, but carbon fixation through the Calvin cycle, reductive TCA cycle, and the Wood-Ljungdahl pathway was also predicted. The rare microbiome is an unlimited source of genomic functionality in all ecosystems. It may consist of remnants of microbial communities prevailing in earlier environmental conditions, but could also be induced again if changes in their living conditions occur.

Trade-off between taxon diversity and functional diversity in European lake ecosystems.

PubMed

Grossmann, Lars; Beisser, Daniela; Bock, Christina; Chatzinotas, Antonis; Jensen, Manfred; Preisfeld, Angelika; Psenner, Roland; Rahmann, Sven; Wodniok, Sabina; Boenigk, Jens

2016-12-01

Inferring ecosystem functioning and ecosystem services through inspections of the species inventory is a major aspect of ecological field studies. Ecosystem functions are often stable despite considerable species turnover. Using metatranscriptome analyses, we analyse a thus-far unparalleled freshwater data set which comprises 21 mainland European freshwater lakes from the Sierra Nevada (Spain) to the Carpathian Mountains (Romania) and from northern Germany to the Apennines (Italy) and covers an altitudinal range from 38 m above sea level (a.s.l) to 3110 m a.s.l. The dominant taxa were Chlorophyta and streptophytic algae, Ciliophora, Bacillariophyta and Chrysophyta. Metatranscriptomics provided insights into differences in community composition and into functional diversity via the relative share of taxa to the overall read abundance of distinct functional genes on the ecosystem level. The dominant metabolic pathways in terms of the fraction of expressed sequences in the cDNA libraries were affiliated with primary metabolism, specifically oxidative phosphorylation, photosynthesis and the TCA cycle. Our analyses indicate that community composition is a good first proxy for the analysis of ecosystem functions. However, differential gene regulation modifies the relative importance of taxa in distinct pathways. Whereas taxon composition varies considerably between lakes, the relative importance of distinct metabolic pathways is much more stable, indicating that ecosystem functioning is buffered against shifts in community composition through a functional redundancy of taxa. © 2016 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Using corona discharge-ion mobility spectrometry for detection of 2,4,6-Trichloroanisole.

PubMed

Lichvanová, Zuzana; Ilbeigi, Vahideh; Sabo, Martin; Tabrizchi, Mahmoud; Matejčík, Stefan

2014-09-01

In this work possible application of the corona discharge-ion mobility spectrometer (CD-IMS) for detection of 2,4,6-Trichloroanisole (TCA) has been investigated. We applied CD-IMS interfaced with orthogonal acceleration time of flight mass spectrometer (CD-IMS-oaTOF) to study the ion processes within the CD-IMS technique. The CD-IMS instrument was operated in two modes, (i) standard and (ii) reverse flow modes resulting in different chemical ionisation schemes by NO3(-)(HNO3)n (n=0,1,2) and O2(-)(H2O)n (n=0,1,2), respectively. The O2(-)(H2O)n ionisation was associated with formation of Cl(-) and (TCA-CH3)(-) ions from TCA. The NO3(-)(HNO3)n ionisation, resulted in formation of NO3(-)(HNO3)(TCA-Cl) adduct ions. Limit of detection (LOD) for TCA was determined in gas (100 ppb) and solid phases (150 ng). Copyright © 2014 Elsevier B.V. All rights reserved.

ODC-Free Solvent Implementation for Phenolics Cleaning

NASA Technical Reports Server (NTRS)

Wurth, Laura; Biegert, Lydia; Lamont, DT; McCool, Alex (Technical Monitor)

2001-01-01

During phenolic liner manufacture, resin-impregnated (pre-preg) bias tape of silica, glass, or carbon cloth is tape-wrapped, cured, machined, and then wiped with 1,1,1 tri-chloroethane (TCA) to remove contaminants that may have been introduced during machining and handling. Following the TCA wipe, the machined surface is given a resin wet-coat and over-wrapped with more prepreg and cured. A TCA replacement solvent for these wiping operations must effectively remove both surface contaminants, and sub-surface oils and greases while not compromising the integrity of this interface. Selection of a TCA replacement solvent for phenolic over-wrap interface cleaning began with sub-scale compatibility tests with cured phenolics. Additional compatibility tests included assessment of solvent retention in machined phenolic surfaces. Results from these tests showed that, while the candidate solvent did not degrade the cured phenolics, it was retained in higher concentrations than TCA in phenolic surfaces. This effect was most pronounced with glass and silica cloth phenolics with steep ply angles relative to the wiped surfaces.

Trichloroacetic acid in the vegetation of polluted and remote areas of both hemispheres—Part I. Its formation, uptake and geographical distribution

NASA Astrophysics Data System (ADS)

Weissflog, Ludwig; Pfennigsdorff, Andrea; Martinez-Pastur, Guillermo; Puliafito, Enrique; Figueroa, Dante; Elansky, Nikolai; Nikonov, Vyasheslav; Putz, Erich; Krüger, Gert; Kellner, Klaus

Trichloroacetic acid (TCA; CCl 3COOH) is a phytotoxic chemical. Although TCA salts and derivatives were once deployed as herbicides against perennial grasses and weeds, their use has since been banned because of their indiscriminate herbicidal effects on woody plant species. However, TCA can also be formed in the atmosphere. For instance, high-volatile C 2-chlorohydrocarbons tetrachloroethene (TECE, C 2Cl 4) and 1,1,1-trichloroethane (TCE, CCl 3CH 3) can react to TCA and other substances under oxidative conditions here. Owing to further industrialisation of Southeast Asia, South Africa and South America, a rise can be expected in the use of TECE as solvents in the metal and textile industries of these regions in the southern hemisphere (SH). The increasing emissions of this substance—together with the rise in the atmospheric oxidation potential caused by urban activities, slash and burn agriculture and forest fires in the SH—will result in the increased input/formation of TCA in the vegetation located on the lee side of these emission sources. By means of biomonitoring studies, inputs/formation of TCA related to the climatic conditions were detected at various locations in South America, Africa, and Europe.

Differences between biological and chronological age-at-death in human skeletal remains: A change of perspective.

PubMed

Couoh, Lourdes R

2017-08-01

This analysis seeks to determine whether differences between real and estimated chronological age (CA) with biological age (BA) in skeletal individuals reflect variability in aging. A total of 87 individuals of two samples, ranging from 20 to 94 years old, were analyzed. One, partially documented, belongs to a Mexican skeletal collection dating to the 20th century; the other is an assemblage of prehispanic individuals from different archaeological sites. In all specimens, the tooth annulation method (TCA) was applied to estimate CA, while-excluding individuals older than 80 years-auricular surface (AS) and pubic symphysis (PS) methods were used to estimate BA. Statistical analyses were conducted to identify correlations and significance of the differences between CA vs. TCA, CA vs. AS/PS, TCA vs. AS/PS. Sex of individuals was assessed for its influence in aging. The use of TCA to estimate CA was successful for most individuals. A strong correlation was found between CA vs. TCA, CA vs. AS/PS, TCA vs. AS/PS and their differences were significant but variation in these were found when assessed by separate age groups. Sex did not influence such differences. TCA can be used to estimate CA and its differences with BA, being less than 10 years, are similar to those found in living populations. Differences between CA and BA are due to intra-population variability, which could be the consequence of individual differences in aging. More research is needed to have confidence that under- and overestimations of BA are indicators of aging variability at the level of the individual. © 2017 Wiley Periodicals, Inc.

Trichloroacetic acid (TCA) and trifluoroacetic acid (TFA) mixture toxicity to the macrophytes Myriophyllum spicatum and Myriophyllum sibiricum in aquatic microcosms.

PubMed

Hanson, Mark L; Sibley, Paul K; Mabury, Scott A; Solomon, Keith R; Muir, Derek C G

2002-02-21

Trichloroacetic acid (TCA) and trifluoroacetic acid (TFA) have been detected together in environmental water samples throughout the world. TCA may enter into aquatic systems via rainout as the degradation product of chlorinated solvents, herbicide use, as a by-product of water disinfection and from emissions of spent bleach liquor of kraft pulp mills. Sources of TFA include degradation of hydrofluorocarbons (HFCs) refrigerants and pesticides. These substances are phytotoxic and widely distributed in aquatic environments. A study to assess the risk of a binary mixture of TCA and TFA to macrophytes in aquatic microcosms was conducted as part of a larger study on haloacetic acids. M. spicatum and M. sibiricum were exposed to 0.1, 1, 3 and 10 mg/l of both TCA and TFA (neutralized with sodium hydroxide) in replicate (n = 3) 12000 l aquatic microcosms for 49 days in an one-way analysis of variance design. Each microcosm was stocked with 14 individual apical shoots per species. The plants were sampled at regular intervals and assessed for the somatic endpoints of plant length, root growth, number of nodes and wet and dry mass and the biochemical endpoints of chlorophyll-a, chlorophyll-b, carotenoid content and citric acid levels. Results indicate that there were statistically significant effects of the TCA/TFA mixture on certain pigment concentrations immediately after the start of exposure (2-7 days), but the plants showed no signs of stress thereafter. These data suggest that TCA/TFA mixtures at environmentally relevant concentrations do not pose a significant risk to these aquatic macrophytes.

Extensive Metabolic Remodeling Differentiates Non-pathogenic and Pathogenic Growth Forms of the Dimorphic Pathogen Talaromyces marneffei

PubMed Central

Pasricha, Shivani; MacRae, James I.; Chua, Hwa H.; Chambers, Jenny; Boyce, Kylie J.; McConville, Malcolm J.; Andrianopoulos, Alex

2017-01-01

Fungal infections are an increasing public health problem, particularly in immunocompromised individuals. While these pathogenic fungi show polyphyletic origins with closely related non-pathogenic species, many undergo morphological transitions to produce pathogenic cell types that are associated with increased virulence. However, the characteristics of these pathogenic cells that contribute to virulence are poorly defined. Talaromyces marneffei grows as a non-pathogenic hyphal form at 25°C but undergoes a dimorphic transition to a pathogenic yeast form at 37°C in vitro and following inhalation of asexual conidia by a host. Here we show that this transition is associated with major changes in central carbon metabolism, and that these changes are correlated with increased virulence of the yeast form. Comprehensive metabolite profiling and 13C-labeling studies showed that hyphal cells exhibited very active glycolytic metabolism and contain low levels of internal carbohydrate reserves. In contrast, yeast cells fully catabolized glucose in the mitochondrial TCA cycle, and store excess glucose in large intracellular pools of trehalose and mannitol. Inhibition of the yeast TCA cycle inhibited replication in culture and in host cells. Yeast, but not hyphae, were also able to use myo-inositol and amino acids as secondary carbon sources, which may support their survival in host macrophages. These analyses suggest that T. marneffei yeast cells exhibit a more efficient oxidative metabolism and are capable of utilizing a diverse range of carbon sources, which contributes to their virulence in animal tissues, highlighting the importance of dimorphic switching in pathogenic yeast. PMID:28861398

Extensive Metabolic Remodeling Differentiates Non-pathogenic and Pathogenic Growth Forms of the Dimorphic Pathogen Talaromyces marneffei.

PubMed

Pasricha, Shivani; MacRae, James I; Chua, Hwa H; Chambers, Jenny; Boyce, Kylie J; McConville, Malcolm J; Andrianopoulos, Alex

2017-01-01

Fungal infections are an increasing public health problem, particularly in immunocompromised individuals. While these pathogenic fungi show polyphyletic origins with closely related non-pathogenic species, many undergo morphological transitions to produce pathogenic cell types that are associated with increased virulence. However, the characteristics of these pathogenic cells that contribute to virulence are poorly defined. Talaromyces marneffei grows as a non-pathogenic hyphal form at 25°C but undergoes a dimorphic transition to a pathogenic yeast form at 37°C in vitro and following inhalation of asexual conidia by a host. Here we show that this transition is associated with major changes in central carbon metabolism, and that these changes are correlated with increased virulence of the yeast form. Comprehensive metabolite profiling and 13 C-labeling studies showed that hyphal cells exhibited very active glycolytic metabolism and contain low levels of internal carbohydrate reserves. In contrast, yeast cells fully catabolized glucose in the mitochondrial TCA cycle, and store excess glucose in large intracellular pools of trehalose and mannitol. Inhibition of the yeast TCA cycle inhibited replication in culture and in host cells. Yeast, but not hyphae, were also able to use myo -inositol and amino acids as secondary carbon sources, which may support their survival in host macrophages. These analyses suggest that T. marneffei yeast cells exhibit a more efficient oxidative metabolism and are capable of utilizing a diverse range of carbon sources, which contributes to their virulence in animal tissues, highlighting the importance of dimorphic switching in pathogenic yeast.

Physiological and Proteomic Analysis of Escherichia coli Iron-Limited Chemostat Growth

PubMed Central

Folsom, James Patrick; Parker, Albert E.

2014-01-01

Iron bioavailability is a major limiter of bacterial growth in mammalian host tissue and thus represents an important area of study. Escherichia coli K-12 metabolism was studied at four levels of iron limitation in chemostats using physiological and proteomic analyses. The data documented an E. coli acclimation gradient where progressively more severe iron scarcity resulted in a larger percentage of substrate carbon being directed into an overflow metabolism accompanied by a decrease in biomass yield on glucose. Acetate was the primary secreted organic by-product for moderate levels of iron limitation, but as stress increased, the metabolism shifted to secrete primarily lactate (∼70% of catabolized glucose carbon). Proteomic analysis reinforced the physiological data and quantified relative increases in glycolysis enzyme abundance and decreases in tricarboxylic acid (TCA) cycle enzyme abundance with increasing iron limitation stress. The combined data indicated that E. coli responds to limiting iron by investing the scarce resource in essential enzymes, at the cost of catabolic efficiency (i.e., downregulating high-ATP-yielding pathways containing enzymes with large iron requirements, like the TCA cycle). Acclimation to iron-limited growth was contrasted experimentally with acclimation to glucose-limited growth to identify both general and nutrient-specific acclimation strategies. While the iron-limited cultures maximized biomass yields on iron and increased expression of iron acquisition strategies, the glucose-limited cultures maximized biomass yields on glucose and increased expression of carbon acquisition strategies. This study quantified ecologically competitive acclimations to nutrient limitations, yielding knowledge essential for understanding medically relevant bacterial responses to host and to developing intervention strategies. PMID:24837288

Metabolic and physiological adjustment of Suaeda maritima to combined salinity and hypoxia

PubMed Central

Behr, Jan H.; Bouchereau, Alain; Berardocco, Solenne; Seal, Charlotte E.; Flowers, Timothy J.

2017-01-01

Background and Aims Suaeda maritima is a halophyte commonly found on coastal wetlands in the intertidal zone. Due to its habitat S. maritima has evolved tolerance to high salt concentrations and hypoxic conditions in the soil caused by periodic flooding. In the present work, the adaptive mechanisms of S. maritima to salinity combined with hypoxia were investigated on a physiological and metabolic level. Methods To compare the adaptive mechanisms to deficient, optimal and stressful salt concentrations, S. maritima plants were grown in a hydroponic culture under low, medium and high salt concentrations. Additionally, hypoxic conditions were applied to investigate the impact of hypoxia combined with different salt concentrations. A non-targeted metabolic approach was used to clarify the biochemical pathways underlying the metabolic and physiological adaptation mechanisms of S. maritima. Key Results Roots exposed to hypoxic conditions showed an increased level of tricarboxylic acid (TCA)-cycle intermediates such as succinate, malate and citrate. During hypoxia, the concentration of free amino acids increased in shoots and roots. Osmoprotectants such as proline and glycine betaine increased in concentrations as the external salinity was increased under hypoxic conditions. Conclusions The combination of high salinity and hypoxia caused an ionic imbalance and an increase of metabolites associated with osmotic stress and photorespiration, indicating a severe physiological and metabolic response under these conditions. Disturbed proline degradation in the roots induced an enhanced proline accumulation under hypoxia. The enhanced alanine fermentation combined with a partial flux of the TCA cycle might contribute to the tolerance of S. maritima to hypoxic conditions. PMID:28110268

A Comparison of Oxidative Lactate Metabolism in Traumatically Injured Brain and Control Brain.

PubMed

Jalloh, Ibrahim; Helmy, Adel; Howe, Duncan J; Shannon, Richard J; Grice, Peter; Mason, Andrew; Gallagher, Clare N; Murphy, Michael P; Pickard, John D; Menon, David K; Carpenter, T Adrian; Hutchinson, Peter J; Carpenter, Keri L H

2018-05-18

Metabolic abnormalities occur after traumatic brain injury (TBI). Glucose is conventionally regarded as the major energy substrate, although lactate can also be an energy source. We compared 3- 13 C lactate metabolism in TBI with "normal" control brain and muscle, measuring 13 C-glutamine enrichment to assess tricarboxylic acid (TCA) cycle metabolism. Microdialysis catheters in brains of nine patients with severe TBI, five non-TBI brain surgical patients, and five resting muscle (non-TBI) patients were perfused (24 h in brain, 8 h in muscle) with 8 mmol/L sodium 3- 13 C lactate. Microdialysate analysis employed ISCUS and nuclear magnetic resonance. In TBI, with 3- 13 C lactate perfusion, microdialysate glucose concentration increased nonsignificantly (mean +11.9%, p = 0.463), with significant increases (p = 0.028) for lactate (+174%), pyruvate (+35.8%), and lactate/pyruvate ratio (+101.8%). Microdialysate 13 C-glutamine fractional enrichments (median, interquartile range) were: for C4 5.1 (0-11.1) % in TBI and 5.7 (4.6-6.8) % in control brain, for C3 0 (0-5.0) % in TBI and 0 (0-0) % in control brain, and for C2 2.9 (0-5.7) % in TBI and 1.8 (0-3.4) % in control brain. 13 C-enrichments were not statistically different between TBI and control brain, showing both metabolize 3- 13 C lactate via TCA cycle, in contrast to muscle. Several patients with TBI exhibited 13 C-glutamine enrichment above the non-TBI control range, suggesting lactate oxidative metabolism as a TBI "emergency option."

Isolation and characterization of a mutant defective in triacylglycerol accumulation in nitrogen-starved Chlamydomonas reinhardtii.

PubMed

Hung, Chun-Hsien; Kanehara, Kazue; Nakamura, Yuki

2016-09-01

Triacylglycerol (TAG), a major source of biodiesel production, accumulates in nitrogen-starved Chlamydomonas reinhardtii. However, the metabolic pathway of starch-to-TAG conversion remains elusive because an enzyme that affects the starch degradation is unknown. Here, we isolated a new class of mutant bgal1, which expressed an overaccumulation of starch granules and defective photosynthetic growth. The bgal1 was a null mutant of a previously uncharacterized β-galactosidase-like gene (Cre02.g119700), which decreased total β-galactosidase activity 40% of the wild type. Upon nitrogen starvation, the bgal1 mutant showed decreased TAG accumulation mainly due to the reduced flux of de novo TAG biosynthesis evidenced by increased unsaturation of fatty acid composition in TAG and reduced TAG accumulation by additional supplementation of acetate to the culture media. Metabolomic analysis of the bgal1 mutant showed significantly reduced levels of metabolites following the hydrolysis of starch and substrates for TAG accumulation, whereas metabolites in TCA cycle were unaffected. Upon nitrogen starvation, while levels of glucose 6-phosphate, fructose 6-phosphate and acetyl-CoA remained lower, most of the other metabolites in glycolysis were increased but those in the TCA cycle were decreased, supporting TAG accumulation. We suggest that BGAL1 may be involved in the degradation of starch, which affects TAG accumulation in nitrogen-starved C. reinhardtii. This article is part of a Special Issue entitled: Plant Lipid Biology edited by Kent D. Chapman and Ivo Feussner. Copyright © 2016 Elsevier B.V. All rights reserved.

Paediatric traumatic cardiac arrest: a Delphi study to establish consensus on definition and management.

PubMed

Rickard, Annette C; Vassallo, James; Nutbeam, Tim; Lyttle, Mark D; Maconochie, Ian K; Enki, Doyo G; Smith, Jason E

2018-04-28

Paediatric traumatic cardiac arrest (TCA) is associated with low survival and poor outcomes. The mechanisms that underlie TCA are different from medical cardiac arrest; the approach to treatment of TCA may therefore also need to differ to optimise outcomes. The aim of this study was to explore the opinion of subject matter experts regarding the diagnosis and treatment of paediatric TCA, and to reach consensus on how best to manage this group of patients. An online Delphi study was conducted over three rounds, with the aim of achieving consensus (defined as 70% agreement) on statements related to the diagnosis and management of paediatric TCA. Participants were invited from paediatric and adult emergency medicine, paediatric anaesthetics, paediatric ICU and paediatric surgery, as well as Paediatric Major Trauma Centre leads and representatives from the Resuscitation Council UK. Statements were informed by literature reviews and were based on elements of APLS resuscitation algorithms as well as some concepts used in the management of adult TCA; they ranged from confirmation of cardiac arrest to the indications for thoracotomy. 73 experts completed all three rounds between June and November 2016. Consensus was reached on 14 statements regarding the diagnosis and management of paediatric TCA; oxygenation and ventilatory support, along with rapid volume replacement with warmed blood, improve survival. The duration of cardiac arrest and the lack of a response to intervention, along with cardiac standstill on ultrasound, help to guide the decision to terminate resuscitation. This study has given a consensus-based framework to guide protocol development in the management of paediatric TCA, though further work is required in other key areas including its acceptability to clinicians. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Probing the genome-scale metabolic landscape of Bordetella pertussis, the causative agent of whooping cough.

PubMed

Branco Dos Santos, Filipe; Olivier, Brett G; Boele, Joost; Smessaert, Vincent; De Rop, Philippe; Krumpochova, Petra; Klau, Gunnar W; Giera, Martin; Dehottay, Philippe; Teusink, Bas; Goffin, Philippe

2017-08-25

Whooping cough is a highly-contagious respiratory disease caused by Bordetella pertussi s. Despite vaccination, its incidence has been rising alarmingly, and yet, the physiology of B. pertussis remains poorly understood. We combined genome-scale metabolic reconstruction, a novel optimization algorithm and experimental data to probe the full metabolic potential of this pathogen, using strain Tohama I as a reference. Experimental validation showed that B. pertussis secretes a significant proportion of nitrogen as arginine and purine nucleosides, which may contribute to modulation of the host response. We also found that B. pertussis can be unexpectedly versatile, being able to metabolize many compounds while displaying minimal nutrient requirements. It can grow without cysteine - using inorganic sulfur sources such as thiosulfate - and it can grow on organic acids such as citrate or lactate as sole carbon sources, providing in vivo demonstration that its TCA cycle is functional. Although the metabolic reconstruction of eight additional strains indicates that the structural genes underlying this metabolic flexibility are widespread, experimental validation suggests a role of strain-specific regulatory mechanisms in shaping metabolic capabilities. Among five alternative strains tested, three were shown to grow on substrate combinations requiring a functional TCA cycle, but only one could use thiosulfate. Finally, the metabolic model was used to rationally design growth media with over two-fold improvements in pertussis toxin production. This study thus provides novel insights into B. pertussis physiology, and highlights the potential, but also limitations of models solely based on metabolic gene content. IMPORTANCE The metabolic capabilities of Bordetella pertussis - the causative agent of whooping cough - were investigated from a systems-level perspective. We constructed a comprehensive genome-scale metabolic model for B. pertussis , and challenged its predictions experimentally. This systems approach shed light on new potential host-microbe interactions, and allowed to rationally design novel growth media with over two-fold improvements in pertussis toxin production. Most importantly, we also uncovered the potential for metabolic flexibility of B. pertussis (significantly larger range of substrates than previously alleged; novel active pathways allowing growth in minimal, nearly mineral nutrient combinations where only the carbon source must be organic), although our results also highlight the importance of strain-specific regulatory determinants in shaping metabolic capabilities. Deciphering the underlying regulatory mechanisms appears crucial for a comprehensive understanding of B. pertussis 's lifestyle and the epidemiology of whooping cough. The contribution of metabolic models in this context will require the extension of the genome-scale metabolic model to integrate this regulatory dimension. Copyright © 2017 Branco dos Santos et al.

Probing the Genome-Scale Metabolic Landscape of Bordetella pertussis, the Causative Agent of Whooping Cough

PubMed Central

Olivier, Brett G.; Boele, Joost; Smessaert, Vincent; De Rop, Philippe; Krumpochova, Petra; Klau, Gunnar W.; Giera, Martin; Dehottay, Philippe; Goffin, Philippe

2017-01-01

ABSTRACT Whooping cough is a highly contagious respiratory disease caused by Bordetella pertussis. Despite widespread vaccination, its incidence has been rising alarmingly, and yet, the physiology of B. pertussis remains poorly understood. We combined genome-scale metabolic reconstruction, a novel optimization algorithm, and experimental data to probe the full metabolic potential of this pathogen, using B. pertussis strain Tohama I as a reference. Experimental validation showed that B. pertussis secretes a significant proportion of nitrogen as arginine and purine nucleosides, which may contribute to modulation of the host response. We also found that B. pertussis can be unexpectedly versatile, being able to metabolize many compounds while displaying minimal nutrient requirements. It can grow without cysteine, using inorganic sulfur sources, such as thiosulfate, and it can grow on organic acids, such as citrate or lactate, as sole carbon sources, providing in vivo demonstration that its tricarboxylic acid (TCA) cycle is functional. Although the metabolic reconstruction of eight additional strains indicates that the structural genes underlying this metabolic flexibility are widespread, experimental validation suggests a role of strain-specific regulatory mechanisms in shaping metabolic capabilities. Among five alternative strains tested, three strains were shown to grow on substrate combinations requiring a functional TCA cycle, but only one strain could use thiosulfate. Finally, the metabolic model was used to rationally design growth media with >2-fold improvements in pertussis toxin production. This study thus provides novel insights into B. pertussis physiology and highlights the potential, but also the limitations, of models based solely on metabolic gene content. IMPORTANCE The metabolic capabilities of Bordetella pertussis, the causative agent of whooping cough, were investigated from a systems-level perspective. We constructed a comprehensive genome-scale metabolic model for B. pertussis and challenged its predictions experimentally. This systems approach shed light on new potential host-microbe interactions and allowed us to rationally design novel growth media with >2-fold improvements in pertussis toxin production. Most importantly, we also uncovered the potential for metabolic flexibility of B. pertussis (significantly larger range of substrates than previously alleged; novel active pathways allowing growth in minimal, nearly mineral nutrient combinations where only the carbon source must be organic), although our results also highlight the importance of strain-specific regulatory determinants in shaping metabolic capabilities. Deciphering the underlying regulatory mechanisms appears to be crucial for a comprehensive understanding of B. pertussis's lifestyle and the epidemiology of whooping cough. The contribution of metabolic models in this context will require the extension of the genome-scale metabolic model to integrate this regulatory dimension. PMID:28842544

Reduced cognitive function, increased blood-brain-barrier transport and inflammatory responses, and altered brain metabolites in LDLr -/-and C57BL/6 mice fed a western diet

PubMed Central

Lee, Linda L.; Puchowicz, Michelle; Golub, Mari S.; Befroy, Douglas E.; Wilson, Dennis W.; Anderson, Steven; Cline, Gary; Bini, Jason; Borkowski, Kamil; Knotts, Trina A.; Rutledge, John C.

2018-01-01

Recent work suggests that diet affects brain metabolism thereby impacting cognitive function. Our objective was to determine if a western diet altered brain metabolism, increased blood-brain barrier (BBB) transport and inflammation, and induced cognitive impairment in C57BL/6 (WT) mice and low-density lipoprotein receptor null (LDLr -/-) mice, a model of hyperlipidemia and cognitive decline. We show that a western diet and LDLr -/- moderately influence cognitive processes as assessed by Y-maze and radial arm water maze. Also, western diet significantly increased BBB transport, as well as microvessel factor VIII in LDLr -/- and microglia IBA1 staining in WT, both indicators of activation and neuroinflammation. Interestingly, LDLr -/- mice had a significant increase in 18F- fluorodeoxyglucose uptake irrespective of diet and brain 1H-magnetic resonance spectroscopy showed increased lactate and lipid moieties. Metabolic assessments of whole mouse brain by GC/MS and LC/MS/MS showed that a western diet altered brain TCA cycle and β-oxidation intermediates, levels of amino acids, and complex lipid levels and elevated proinflammatory lipid mediators. Our study reveals that the western diet has multiple impacts on brain metabolism, physiology, and altered cognitive function that likely manifest via multiple cellular pathways. PMID:29444171

Mechanism of Cisplatin-Induced Cytotoxicity Is Correlated to Impaired Metabolism Due to Mitochondrial ROS Generation.

PubMed

Choi, Yong-Min; Kim, Han-Kyul; Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun

2015-01-01

The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player.

Demonstration of neuron-glia transfer of precursors for GABA biosynthesis in a co-culture system of dissociated mouse cerebral cortex.

PubMed

Leke, Renata; Bak, Lasse K; Schousboe, Arne; Waagepetersen, Helle S

2008-12-01

Co-cultures of neurons and astrocytes were prepared from dissociated embryonic mouse cerebral cortex and cultured for 7 days. To investigate if these cultures may serve as a functional model system to study neuron-glia interaction with regard to GABA biosynthesis, the cells were incubated either in media containing [U-(13)C]glutamine (0.1, 0.3 and 0.5 mM) or 1 mM acetate plus 2.5 mM glucose plus 1 mM lactate. In the latter case one of the 3 substrates was uniformly (13)C labeled. Cellular contents and (13)C labeling of glutamate, GABA, aspartate and glutamine were determined in the cells after an incubation period of 2.5 h. The GABA biosynthetic machinery exhibited the expected complexity with regard to metabolic compartmentation and involvement of TCA cycle activity as seen in other culture systems containing GABAergic neurons. Metabolism of acetate clearly demonstrated glial synthesis of glutamine and its transfer to the neuronal compartment. It is concluded that this co-culture system serves as a reliable model in which functional and pharmacological aspects of GABA biosynthesis can be investigated.

Ketogenic diets, mitochondria, and neurological diseases

PubMed Central

Gano, Lindsey B.; Patel, Manisha; Rho, Jong M.

2014-01-01

The ketogenic diet (KD) is a broad-spectrum therapy for medically intractable epilepsy and is receiving growing attention as a potential treatment for neurological disorders arising in part from bioenergetic dysregulation. The high-fat/low-carbohydrate “classic KD”, as well as dietary variations such as the medium-chain triglyceride diet, the modified Atkins diet, the low-glycemic index treatment, and caloric restriction, enhance cellular metabolic and mitochondrial function. Hence, the broad neuroprotective properties of such therapies may stem from improved cellular metabolism. Data from clinical and preclinical studies indicate that these diets restrict glycolysis and increase fatty acid oxidation, actions which result in ketosis, replenishment of the TCA cycle (i.e., anaplerosis), restoration of neurotransmitter and ion channel function, and enhanced mitochondrial respiration. Further, there is mounting evidence that the KD and its variants can impact key signaling pathways that evolved to sense the energetic state of the cell, and that help maintain cellular homeostasis. These pathways, which include PPARs, AMP-activated kinase, mammalian target of rapamycin, and the sirtuins, have all been recently implicated in the neuroprotective effects of the KD. Further research in this area may lead to future therapeutic strategies aimed at mimicking the pleiotropic neuroprotective effects of the KD. PMID:24847102

Stiffness control of a nylon twisted coiled actuator for use in mechatronic rehabilitation devices.

PubMed

Edmonds, Brandon P R; Trejos, Ana Luisa

2017-07-01

Mechatronic rehabilitation devices, especially wearables, have been researched extensively and proven to be promising additions to physical therapy, but most designs utilize traditional actuators providing unnatural, robot-like movements. Therefore, many researchers have focused on the development of actuators that mimic biological properties to provide patients with improved results, safety, and comfort. Recently, a twisted-coiled actuator (TCA) made from nylon thread has been found to possess many of these important properties when heated, such as variable stiffness, flexibility, and high power density. So far, TCAs have been characterized in controlled environments to define their fundamental properties under simple loading configurations. However, for an actuator like this to be implemented in a biomimetic design such as an exoskeleton, it needs to be characterized and controlled as a biological muscle. One major control law that natural muscles exhibit is stiffness control, allowing humans to passively avoid injury from external forces, or move the limbs in a controlled or high impact motion. This type of control is created by the antagonistic muscle arrangement. In this paper, an antagonistic apparatus was developed to model the TCAs from a biological standpoint, the stiffness was characterized with respect to the TCA temperature, and a fully functional stiffness and position controller was implemented with an incorporated TCA thermal model. The stiffness was found to have a linear relationship to the TCA temperatures (R 2 =0.95). The controller performed with a stiffness accuracy of 98.95% and a position accuracy of 92.7%. A final trial with varying continuous position input and varying stepped stiffness input exhibited position control with R 2 =0.9638.

Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

PubMed

Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

2017-04-01

The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

ATCA/muTCA for Physics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jezynski, Tomasz; /DESY; Larsen, Raymond

ATCA/{mu}TCA platforms are attractive because of the modern serial link architecture, high availability features and many packaging options. Less-demanding availability applications can be met economically by scaling back speed and redundancy. The ATCA specification was originally targeted for the Telecom industry but has gained recently a much wider user audience. The purpose of this paper is to report on present hardware and software R and D efforts where ATCA and {mu}TCA are planned, already being used or in development using selected examples for accelerator and detectors in the Physics community. It will present also the status of a proposal formore » physics extensions to ATCA/{mu}TCA specifications to promote inter-operability of laboratory and industry designs for physics.« less

Updates to a 13C metabolic flux analysis model for evaluating energy metabolism in cultured cerebellar granule neurons from neonatal rats.

PubMed

Jekabsons, Mika B; Gebril, Hoda M; Wang, Yan-Hong; Avula, Bharathi; Khan, Ikhlas A

2017-10-01

A hexose phosphate recycling model previously developed to infer fluxes through the major glucose consuming pathways in cultured cerebellar granule neurons (CGNs) from neonatal rats metabolizing [1,2- 13 C 2 ]glucose was revised by considering reverse flux through the non-oxidative pentose phosphate pathway (PPP) and symmetrical succinate oxidation within the tricarboxylic acid (TCA) cycle. The model adjusts three flux ratios to effect 13 C distribution in the hexose, pentose, and triose phosphate pools, and in TCA cycle malate to minimize the error between predicted and measured 13 C labeling in exported lactate (i.e., unlabeled, single-, double-, and triple-labeled; M, M1, M2, and M3, respectively). Inclusion of reverse non-oxidative PPP flux substantially increased the number of calculations but ultimately had relatively minor effects on the labeling of glycolytic metabolites. From the error-minimized solution in which the predicted M-M3 lactate differed by 0.49% from that measured by liquid chromatography-triple quadrupole mass spectrometry, the neurons exhibited negligible forward non-oxidative PPP flux. Thus, no glucose was used by the pentose cycle despite explicit consideration of hexose phosphate recycling. Mitochondria consumed only 16% of glucose while 45% was exported as lactate by aerobic glycolysis. The remaining 39% of glucose was shunted to pentose phosphates presumably for de novo nucleotide synthesis, but the proportion metabolized through the oxidative PPP vs. the reverse non-oxidative PPP could not be determined. The lactate exported as M1 (2.5%) and M3 (1.2%) was attributed to malic enzyme, which was responsible for 7.8% of pyruvate production (vs. 92.2% by glycolysis). The updated model is more broadly applicable to different cell types by considering bi-directional flux through the non-oxidative PPP. Its application to cultured neurons utilizing glucose as the sole exogenous substrate has demonstrated substantial oxygen-independent glucose utilization by aerobic glycolysis as well as the oxidative PPP and/or reverse non-oxidative PPP, but negligible glucose consumption by the pentose cycle. Copyright © 2017 Elsevier Ltd. All rights reserved.

Metagenomic Analysis of a Biphenyl-Degrading Soil Bacterial Consortium Reveals the Metabolic Roles of Specific Populations

PubMed Central

Garrido-Sanz, Daniel; Manzano, Javier; Martín, Marta; Redondo-Nieto, Miguel; Rivilla, Rafael

2018-01-01

Polychlorinated biphenyls (PCBs) are widespread persistent pollutants that cause several adverse health effects. Aerobic bioremediation of PCBs involves the activity of either one bacterial species or a microbial consortium. Using multiple species will enhance the range of PCB congeners co-metabolized since different PCB-degrading microorganisms exhibit different substrate specificity. We have isolated a bacterial consortium by successive enrichment culture using biphenyl (analog of PCBs) as the sole carbon and energy source. This consortium is able to grow on biphenyl, benzoate, and protocatechuate. Whole-community DNA extracted from the consortium was used to analyze biodiversity by Illumina sequencing of a 16S rRNA gene amplicon library and to determine the metagenome by whole-genome shotgun Illumina sequencing. Biodiversity analysis shows that the consortium consists of 24 operational taxonomic units (≥97% identity). The consortium is dominated by strains belonging to the genus Pseudomonas, but also contains betaproteobacteria and Rhodococcus strains. whole-genome shotgun (WGS) analysis resulted in contigs containing 78.3 Mbp of sequenced DNA, representing around 65% of the expected DNA in the consortium. Bioinformatic analysis of this metagenome has identified the genes encoding the enzymes implicated in three pathways for the conversion of biphenyl to benzoate and five pathways from benzoate to tricarboxylic acid (TCA) cycle intermediates, allowing us to model the whole biodegradation network. By genus assignment of coding sequences, we have also been able to determine that the three biphenyl to benzoate pathways are carried out by Rhodococcus strains. In turn, strains belonging to Pseudomonas and Bordetella are the main responsible of three of the benzoate to TCA pathways while the benzoate conversion into TCA cycle intermediates via benzoyl-CoA and the catechol meta-cleavage pathways are carried out by beta proteobacteria belonging to genera such as Achromobacter and Variovorax. We have isolated a Rhodococcus strain WAY2 from the consortium which contains the genes encoding the three biphenyl to benzoate pathways indicating that this strain is responsible for all the biphenyl to benzoate transformations. The presented results show that metagenomic analysis of consortia allows the identification of bacteria active in biodegradation processes and the assignment of specific reactions and pathways to specific bacterial groups. PMID:29497412

Influence of trichloroacetic acid peeling on the skin stress response system.

PubMed

Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

2011-08-01

Although trichloroacetic acid (TCA) peeling is widely applied for cosmetic treatment of photodamaged skin, the entire biological mechanisms have yet to be determined. The skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) products that are locally-generated in response to locally-provided stressors or pro-inflammatory cytokines. This system would restrict tissue damage and restore local homeostasis. To determine the influence of TCA peeling on the SSRS in vitro and in vivo, expressions of POMC, melanocortin receptor 1 (MC1R), CRH and CRH receptor 1 (CRHR1) mRNA were examined by reverse transcription polymerase chain reaction in Pam212 murine keratinocytes, murine plantar and healthy human abdominal skin specimens after TCA treatment. In addition, their protein expressions as well as those of POMC-derived peptides were examined immunohistochemically. After TCA treatment, transient upregulation of POMC and MC1R mRNA expressions was observed in both murine and human skin, as well as in Pam212. Enhanced POMC protein, recovery of once-impaired MC1R protein, and no enhancement of POMC-derived peptide productions were revealed immunohistochemically in both murine and human epidermis. In contrast, neither expression levels of CRH and CRHR1 mRNA nor epidermal protein were enhanced after TCA application in murine and human skin, except for induction of human CRH mRNA expression. These results suggest that TCA activates the SSRS by inducing POMC and MC1R productions of keratinocytes in the CRH-independent manner, and that the biological effects of POMC itself are responsible for the TCA-induced epidermal SSRS activation. © 2010 Japanese Dermatological Association.

Amalaki rasayana, a traditional Indian drug enhances cardiac mitochondrial and contractile functions and improves cardiac function in rats with hypertrophy.

PubMed

Kumar, Vikas; Aneesh, Kumar A; Kshemada, K; Ajith, Kumar G S; Binil, Raj S S; Deora, Neha; Sanjay, G; Jaleel, A; Muraleedharan, T S; Anandan, E M; Mony, R S; Valiathan, M S; Santhosh, Kumar T R; Kartha, C C

2017-08-17

We evaluated the cardioprotective effect of Amalaki Rasayana (AR), a rejuvenating Ayurvedic drug prepared from Phyllanthus emblica fruits in the reversal of remodeling changes in pressure overload left ventricular cardiac hypertrophy (LVH) and age-associated cardiac dysfunction in male Wistar rats. Six groups (aging groups) of 3 months old animals were given either AR or ghee and honey (GH) orally; seventh group was untreated. Ascending aorta was constricted using titanium clips in 3 months old rats (N = 24; AC groups) and after 6 months, AR or GH was given for further 12 months to two groups; one group was untreated. Histology, gene and protein expression analysis were done in heart tissues. Chemical composition of AR was analyzed by HPLC, HPTLC and LC-MS. AR intake improved (P < 0.05) cardiac function in aging rats and decreased LVH (P < 0.05) in AC rats as well as increased (P < 0.05) fatigue time in treadmill exercise in both groups. In heart tissues of AR administered rats of both the groups, SERCA2, CaM, Myh11, antioxidant, autophagy, oxidative phosphorylation and TCA cycle proteins were up regulated. ADRB1/2 and pCREB expression were increased; pAMPK, NF-kB were decreased. AR has thus a beneficial effect on myocardial energetics, muscle contractile function and exercise tolerance capacity.

Heart rate variability in children with tricyclic antidepressant intoxication.

PubMed

Dinleyici, Ener Cagri; Kilic, Zubeyir; Sahin, Sabiha; Tutuncu-Toker, Rabia; Eren, Makbule; Yargic, Zeynel Abidin; Kosger, Pelin; Ucar, Birsen

2013-01-01

The aim of this study was to evaluate HRV in children requiring intensive care unit stays due to TCA poisoning between March 2009 and July 2010. In the time-domain nonspectral evaluation, the SDNN (P < 0.001), SDNNi (P < 0.05), RMSDD (P < 0.01), and pNN50 (P < 0.01) were found to be significantly lower in the TCA intoxication group. The spectral analysis of the data recorded during the first 5 minutes after intensive care unit admission showed that the values of the nLF (P < 0.05) and the LF/HF ratio (P = 0.001) were significantly higher in the TCA intoxication group, while the nHF (P = 0.001) values were significantly lower. The frequency-domain spectral analysis of the data recorded during the last 5 minutes showed a lower nHF (P = 0.001) in the TCA intoxication group than in the controls, and the LF/HF ratio was significantly higher (P < 0.05) in the intoxication group. The LF/HF ratio was higher in the seven children with seizures (P < 0.001). These findings provided us with a starting point for the value of HRV analysis in determining the risk of arrhythmia and convulsion in TCA poisoning patients. HRV can be used as a noninvasive testing method in determining the treatment and prognosis of TCA poisoning patients.

Natural attenuation model and biodegradation for 1,1,1-trichloroethane contaminant in shallow groundwater

PubMed Central

Lu, Qiang; Zhu, Rui-Li; Yang, Jie; Li, Hui; Liu, Yong-Di; Lu, Shu-Guang; Luo, Qi-Shi; Lin, Kuang-Fei

2015-01-01

Natural attenuation is an effective and feasible technology for controlling groundwater contamination. This study investigated the potential effectiveness and mechanisms of natural attenuation of 1,1,1-trichloroethane (TCA) contaminants in shallow groundwater in Shanghai by using a column simulation experiment, reactive transport model, and 16S rRNA gene clone library. The results indicated that the majority of the contaminant mass was present at 2–6 m in depth, the contaminated area was approximately 1000 m × 1000 m, and natural attenuation processes were occurring at the site. The effluent breakthrough curves from the column experiments demonstrated that the effectiveness of TCA natural attenuation in the groundwater accorded with the advection-dispersion-reaction equation. The kinetic parameter of adsorption and biotic dehydrochlorination of TCA was 0.068 m3/kg and 0.0045 d–1. The contamination plume was predicted to diminish and the maximum concentration of TCA decreased to 280 μg/L. The bacterial community during TCA degradation in groundwater belonged to Trichococcus, Geobacteraceae, Geobacter, Mucilaginibacter, and Arthrobacter. PMID:26379629

Study on the transverse chromatic aberration of the individual eye model after LASIK refractive surgery

NASA Astrophysics Data System (ADS)

Zhang, Mei; Wang, Zhao-Qi; Wang, Yan; Zuo, Tong

2010-10-01

The aim of this research is to study the properties of the transverse chromatic aberration (TCA) after the LASIK refractive surgery based on the individual eye model involving the angle between visual axis and optical axis. According to the measurements of the corneal surfaces, the optical axis lengths and the wavefront aberrations, the individual eye models before and after LASIK refractive surgery are constructed for 15 eyes by using ZEMAX optic design software, while the angle between the visual axis and optical axis is calculated from the data of the anterior corneal surface. The constructed eye models are then used to investigate the variation of the TCA after the surgery. The statistical distributions of the magnitude of the foveal TCA for 15 eyes over the visible spectrum are provided. Finally, we investigate the influence of the TCA on the visual quality and compare the results with previous research. The TCA is an indispensable criterion to evaluate the performance of the refractive surgery. This research is very meaningful for the studies of not only foveal vision but also the peripheral vision.

"Cork taint" responsible compounds. Determination of haloanisoles and halophenols in cork matrix: A review.

PubMed

Tarasov, Andrii; Rauhut, Doris; Jung, Rainer

2017-12-01

Analytical methods of haloanisoles and halophenols quantification in cork matrix are summarized in the current review. Sample-preparation and sample-treatment techniques have been compared and discussed from the perspective of their efficiency, time- and extractant-optimization, easiness of performance. Primary interest of these analyses usually addresses to 2,4,6-trichloroanisole (TCA), which is a major wine contaminant among haloanisoles. Two concepts of TCA determination are described in the review: releasable TCA and total TCA analyses. Chromatographic, bioanalytical and sensorial methods were compared according to their application in the cork industry and in scientific investigations. Finally, it was shown that modern analytical techniques are able to provide required sensitivity, selectivity and repeatability for haloanisoles and halophenols determination. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparative study of 15% TCA peel versus 35% glycolic acid peel for the treatment of melasma

PubMed Central

Puri, Neerja

2012-01-01

Background: Chemical peels are the mainstay of a cosmetic practitioner's armamentarium because they can be used to treat some skin disorders and can provide aesthetic benefit. Objectives: To compare 15% TCA peel and 35% glycolic acid peel for the treatment of melasma. Material and Methods: We selected 30 participants of melasma aged between 20 and 50 years from the dermatology outpatient department and treated equal numbers with 15% TCA and 35% glycolic acid. Results: Subjective response as graded by the patient showed good or very good response in 70% participants in the glycolic acid group and 64% in the TCA group. Conclusions: There was statistically insignificant difference in the efficacy between the two groups for the treatment of melasma. PMID:23130283

Proteome analysis to assess physiological changes in Escherichia coli grown under glucose-limited fed-batch conditions.

PubMed

Raman, Babu; Nandakumar, M P; Muthuvijayan, Vignesh; Marten, Mark R

2005-11-05

Proteome analysis was used to compare global protein expression changes in Escherichia coli fermentation between exponential and glucose-limited fed-batch phase. Two-dimensional gel electrophoresis and MALDI-TOF mass spectrometry were used to separate and identify 49 proteins showing >2-fold difference in expression. Proteins upregulated during exponential phase include ribonucleotide biosynthesis enzymes and ribosomal recycling factor. Proteins upregulated during fed-batch phase include those involved in high-affinity glucose uptake, transport and degradation of alternate carbon sources and TCA cycle, suggesting an enhanced role of the cycle under glucose- and energy-limited conditions. We report the upregulation of several putative proteins (ytfQ, ygiS, ynaF, yggX, yfeX), not identified in any previous study under carbon-limited conditions. Copyright (c) 2005 Wiley Periodicals, Inc.

Dwell Time and Surface Parameter Effects on Removal of Silicone Oil From D6ac Steel Using TCA

NASA Technical Reports Server (NTRS)

Boothe, R. E.

2003-01-01

This study was conducted to evaluate the impact of dwell time, surface roughness, and the surface activation state on 1,1,1-trichloroethane's (TCA's) effectiveness for removing silicone oil from D6ac steel. Silicone-contaminated test articles were washed with TCA solvent, and then the surfaces were analyzed for residue, using Fourier transform infrared spectroscopy. The predominant factor affecting the ability to remove the silicone oil was surface roughness.

Induction of Tca8113 tumor cell apoptosis by icotinib is associated with reactive oxygen species mediated p38-MAPK activation.

PubMed

Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang

2014-08-01

Icotinib, a selective EGFR tyrosine kinase inhibitor (EGFR-TKI), has been shown to exhibit anti-tumor activity against several tumor cell lines. However, the exact molecular mechanism of icotinib's anti-tumor effect remains unknown. This study aims to examine the zytotoxic effect of icotinib on Tca8113 cells and its potential molecular mechanism. Icotinib significantly resulted in dose-dependent cell death as determined by MTT assay, accompanied by increased levels of Bax and DNA fragmentation. Icotinib could also induce Reactive Oxygen Species (ROS) generation. Further studies confirmed that scavenging of reactive oxygen species by N-acetyl-L-cysteine (NAC), and pharmacological inhibition of MAPK reversed icotinib-induced apoptosis in Tca8113 cells. Our data provide evidence that icotinib induces apoptosis, possibly via ROS-mediated MAPK pathway in Tca8113 cells.

Reduction of halogenated ethanes by green rust.

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Loughlin, E. J.; Burris, D. R.; Environmental Research

Green rusts, mixed Fe{sup II}/Fe{sup III} hydroxide minerals present in many suboxic environments, have been shown to reduce a number of organic and inorganic contaminants. The reduction of halogenated ethanes was examined in aqueous suspensions of green rust, both alone and with the addition of Ag{sup I} (AgGR) and Cu{sup II} (CuGR). Hexachloroethane (HCA), pentachloroethane (PCA), 1,1,1,2-tetrachloroethane (1,1,1,2-TeCA), 1,1,2,2-tetrachloroethane (1,1,2,2-TeCA), 1,1,1-trichloroethane (1,1,1-TCA), 1,1,2-trichloroethane (1,1,2-TCA), 1,1-dichloroethane (1,1-DCA), and 1,2-dibromoethane were reduced in the presence of green rust alone, AgGR, or CuGR; only 1,2-dichloroethane and chloroethane were nonreactive. The reduction was generally more rapid for more highly substituted ethanes than for ethanesmore » having fewer halogen groups (HCA > PCA > 1,1,1,2-TeCA > 1,1,1-TCA > 1,1,2,2-TeCA > 1,1,2-TCA > 1,1-DCA), and isomers with the more asymmetric distributions of halogen groups were more rapidly reduced than the isomer with greater symmetry (e.g., 1,1,1-TCA > 1,1,2-TCA). The addition of Ag{sup I} or Cu{sup II} to green rust suspensions resulted in a substantial increase in the rate of halogenated ethane reduction as well as significant differences in the product distributions with respect to green rust alone.« less

Molecular Mechanisms of Increased Heart Rate in Shenxianshengmai-treated Bradycardia Rabbits.

PubMed

Liu, Zhou-Ying; Huang, Jian; Liu, Na-Na; Zheng, Min; Zhao, Tao; Zhao, Bu-Chang; Wang, Yi-Min; Pu, Jie-Lin

2017-01-20

The molecular mechanisms of Shenxianshengmai (SXSM), a traditional Chinese medicine, on bradycardia have been incompletely understood. The study tried to investigate the gene expression profile and proteomics of bradycardia rabbits' hearts after SXSM treatment. Twenty-four adult rabbits were randomly assigned in four groups: sham, model, model plus SXSM treatment, and sham plus SXSM treatment groups. Heart rate was recorded in all rabbits. Then, total RNA of atria and proteins of ventricle were isolated and quantified, respectively. Gene expression profiling was conducted by gene expression chip, and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the results of gene expression chip. We used isobaric tags for elative and absolute quantitation and Western blotting to identify altered proteins after SXSM treatment. There was a constant decrease in the mean heart rate (32%, from 238 ± 6 beats/min to 149 ± 12 beats/min) after six weeks in model compared with that in sham group. This effect was partially reversed by 4-week SXSM treatment. Complementary DNA microarray demonstrated that the increased acetylcholinesterase and reduced nicotinic receptor were take responsibility for the increased heart rate. In addition, proteins involved in calcium handling and signaling were affected by SXSM treatment. Real-time RT-PCR verified the results from gene chip. Results from proteomics demonstrated that SXSM enhanced oxidative phosphorylation and tricarboxylic acid (TCA) cycle in ventricular myocardium to improve ATP generation. Long-term SXSM stimulates sympathetic transmission by increasing the expression of acetylcholinesterase and reduces the expression of nicotinic receptor to increase heart rate. SXSM also restored the calcium handling genes and altered genes involved in signaling. In addition, SXSM improves the ATP supply of ventricular myocardium by increasing proteins involved in TCA cycle and oxidation-respiratory chain.

Molecular Mechanisms of Increased Heart Rate in Shenxianshengmai-treated Bradycardia Rabbits

PubMed Central

Liu, Zhou-Ying; Huang, Jian; Liu, Na-Na; Zheng, Min; Zhao, Tao; Zhao, Bu-Chang; Wang, Yi-Min; Pu, Jie-Lin

2017-01-01

Background: The molecular mechanisms of Shenxianshengmai (SXSM), a traditional Chinese medicine, on bradycardia have been incompletely understood. The study tried to investigate the gene expression profile and proteomics of bradycardia rabbits’ hearts after SXSM treatment. Methods: Twenty-four adult rabbits were randomly assigned in four groups: sham, model, model plus SXSM treatment, and sham plus SXSM treatment groups. Heart rate was recorded in all rabbits. Then, total RNA of atria and proteins of ventricle were isolated and quantified, respectively. Gene expression profiling was conducted by gene expression chip, and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the results of gene expression chip. We used isobaric tags for elative and absolute quantitation and Western blotting to identify altered proteins after SXSM treatment. Results: There was a constant decrease in the mean heart rate (32%, from 238 ± 6 beats/min to 149 ± 12 beats/min) after six weeks in model compared with that in sham group. This effect was partially reversed by 4-week SXSM treatment. Complementary DNA microarray demonstrated that the increased acetylcholinesterase and reduced nicotinic receptor were take responsibility for the increased heart rate. In addition, proteins involved in calcium handling and signaling were affected by SXSM treatment. Real-time RT-PCR verified the results from gene chip. Results from proteomics demonstrated that SXSM enhanced oxidative phosphorylation and tricarboxylic acid (TCA) cycle in ventricular myocardium to improve ATP generation. Conclusions: Long-term SXSM stimulates sympathetic transmission by increasing the expression of acetylcholinesterase and reduces the expression of nicotinic receptor to increase heart rate. SXSM also restored the calcium handling genes and altered genes involved in signaling. In addition, SXSM improves the ATP supply of ventricular myocardium by increasing proteins involved in TCA cycle and oxidation-respiratory chain. PMID:28091410

Synergy as design principle for metabolic engineering of 1-propanol production in Escherichia coli.

PubMed

Shen, Claire R; Liao, James C

2013-05-01

Synthesis of a desired product can often be achieved via more than one metabolic pathway. Whether naturally evolved or synthetically engineered, these pathways often exhibit specific properties that are suitable for production under distinct conditions and host organisms. Synergy between pathways arises when the underlying pathway characteristics, such as reducing equivalent demand, ATP requirement, intermediate utilization, and cofactor preferences, are complementary to each other. Utilization of such pathways in combination leads to an increased metabolite productivity and/or yield compared to using each pathway alone. This work illustrates the principle of synergy between two different pathways for 1-propanol production in Escherichia coli. A model-guided design based on maximum theoretical yield calculations identified synergy of the native threonine pathway and the heterologous citramalate pathway in terms of production yield across all flux ratios between the two pathways. Characterization of the individual pathways by host gene deletions demonstrates their distinct metabolic characteristics: the necessity of TCA cycle for threonine pathway and the independence of TCA cycle for the citramalate pathway. The two pathways are also complementary in driving force demands. Production experiments verified the synergistic effects predicted by the yield model, in which the platform with dual pathway for 2-ketobutyrate synthesis achieved higher yield (0.15g/g of glucose) and productivity (0.12g/L/h) of 1-propanol than individual ones alone: the threonine pathway (0.09g/g; 0.04g/L/h) or the citramalate pathway (0.11g/g; 0.04g/L/h). Thus, incorporation of synergy into the design principle of metabolic engineering may improve the production yield and rate of the desired compound. Copyright © 2013 Elsevier Inc. All rights reserved.

Physiological, biomass elemental composition and proteomic analyses of Escherichia coli ammonium-limited chemostat growth, and comparison with iron- and glucose-limited chemostat growth

PubMed Central

Folsom, James Patrick

2015-01-01

Escherichia coli physiological, biomass elemental composition and proteome acclimations to ammonium-limited chemostat growth were measured at four levels of nutrient scarcity controlled via chemostat dilution rate. These data were compared with published iron- and glucose-limited growth data collected from the same strain and at the same dilution rates to quantify general and nutrient-specific responses. Severe nutrient scarcity resulted in an overflow metabolism with differing organic byproduct profiles based on limiting nutrient and dilution rate. Ammonium-limited cultures secreted up to 35  % of the metabolized glucose carbon as organic byproducts with acetate representing the largest fraction; in comparison, iron-limited cultures secreted up to 70  % of the metabolized glucose carbon as lactate, and glucose-limited cultures secreted up to 4  % of the metabolized glucose carbon as formate. Biomass elemental composition differed with nutrient limitation; biomass from ammonium-limited cultures had a lower nitrogen content than biomass from either iron- or glucose-limited cultures. Proteomic analysis of central metabolism enzymes revealed that ammonium- and iron-limited cultures had a lower abundance of key tricarboxylic acid (TCA) cycle enzymes and higher abundance of key glycolysis enzymes compared with glucose-limited cultures. The overall results are largely consistent with cellular economics concepts, including metabolic tradeoff theory where the limiting nutrient is invested into essential pathways such as glycolysis instead of higher ATP-yielding, but non-essential, pathways such as the TCA cycle. The data provide a detailed insight into ecologically competitive metabolic strategies selected by evolution, templates for controlling metabolism for bioprocesses and a comprehensive dataset for validating in silico representations of metabolism. PMID:26018546

[Phenotypic properties of Sulfobacillus thermotolerans: comparative aspects].

PubMed

Tsaplina, I A; Krasil'nikova, E N; Zhuravleva, A E; Egorova, M A; Zakharchuk, L M; Suzina, N E; Duda, V I; Bogdanova, T I; Stadnichuk, I N; Kondrat'eva, T F

2008-01-01

The phenotypic characteristics of the species Sulfobacillus thermotolerans Kr1(T), as dependent on the cultivation conditions, are described in detail. High growth rates (0.22-0.30 h(-1)) and high oxidative activity were recorded under optimum mixotrophic conditions at 40 degrees C on medium with inorganic (Fe(II), S(0), or pyrite-arsenopyrite concentrate) and organic (glucose and/or yeast extract) substrates. In cells grown under optimum conditions on medium with iron, hemes a, b, and, most probably, c were present, indicating the presence of the corresponding cytochromes. Peculiar extended structures in the form of cylindrical cords, never observed previously, were revealed; a mucous matrix, likely of polysaccharide nature, occurred around the cells. In the cells of sulfobacilli grown litho-, organo-, and mixotrophically at 40 degrees C, the enzymes of the three main pathways of carbon utilization and some enzymes of the TCA cycle were revealed. The enzyme activity was maximum under mixotrophic growth conditions. The growth rate in the regions of limiting temperatures (55 degrees C and 12-14 degrees C) decreased two- and tenfold, respectively; no activity of 6-phosphogluconate dehydrogenase, one of the key enzymes of the oxidative pentose phosphate pathway, could be revealed; and a decrease in the activity of almost all enzymes of glucose metabolism and of the TCA cycle was observed. The rate of 14CO2 fixation by cells under auto-, mixo-, and heterotrophic conditions constituted 31.8, 23.3, and 10.3 nmol/(h mg protein), respectively. The activities of RuBP carboxylase (it peaked during lithotrophic growth) and of carboxylases of heterotrophic carbon dioxide fixation were recorded. The physiological and biochemical peculiarities of the thermotolerant sulfobacillus are compared versus moderately thermophilic sulfobacilli.

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Lian; Xiu, Yu; Jones, J. Andrew

Microbial fermentation conditions are dynamic, due to transcriptional induction, nutrient consumption, or changes to incubation conditions. In this paper, 13C-metabolic flux analysis was used to characterize two violacein-producing E. coli strains with vastly different productivities, and to profile their metabolic adjustments resulting from external perturbations during fermentation. The two strains were first grown at 37 °C in stage 1, and then the temperature was transitioned to 20 °C in stage 2 for the optimal expression of the violacein synthesis pathway. After induction, violacein production was minimal in stage 3, but accelerated in stage 4 (early production phase) and 5 (latemore » production phase) in the high producing strain, reaching a final concentration of 1.5 mmol/L. On the contrary, ~0.02 mmol/L of violacein was obtained from the low producing strain. To have a snapshot of the temporal metabolic changes in each stage, we performed 13C-MFA via isotopomer analysis of fast-turnover free metabolites. The results indicate strikingly stable flux ratios in the central metabolism throughout the early growth stages. In the late stages, however, the high producer rewired its flux distribution significantly, which featured an upregulated pentose phosphate pathway and TCA cycle, reflux from acetate utilization, negligible anabolic fluxes, and elevated maintenance loss, to compensate for nutrient depletion and drainage of some building blocks due to violacein overproduction. The low producer with stronger promoters shifted its relative fluxes in stage 5 by enhancing the flux through the TCA cycle and acetate overflow, while exhibiting a reduced biomass growth and a minimal flux towards violacein synthesis. Finally, interestingly, the addition of the violacein precursor (tryptophan) in the medium inhibited high producer but enhanced low producer's productivity, leading to hypotheses of unknown pathway regulations (such as metabolite channeling).« less

Common Motifs in the Response of Cereal Primary Metabolism to Fungal Pathogens are not Based on Similar Transcriptional Reprogramming

PubMed Central

Voll, Lars Matthias; Horst, Robin Jonathan; Voitsik, Anna-Maria; Zajic, Doreen; Samans, Birgit; Pons-Kühnemann, Jörn; Doehlemann, Gunther; Münch, Steffen; Wahl, Ramon; Molitor, Alexandra; Hofmann, Jörg; Schmiedl, Alfred; Waller, Frank; Deising, Holger Bruno; Kahmann, Regine; Kämper, Jörg; Kogel, Karl-Heinz; Sonnewald, Uwe

2011-01-01

During compatible interactions with their host plants, biotrophic plant–pathogens subvert host metabolism to ensure the sustained provision of nutrient assimilates by the colonized host cells. To investigate, whether common motifs can be revealed in the response of primary carbon and nitrogen metabolism toward colonization with biotrophic fungi in cereal leaves, we have conducted a combined metabolome and transcriptome study of three quite divergent pathosystems, the barley powdery mildew fungus (Blumeria graminis f.sp. hordei), the corn smut fungus Ustilago maydis, and the maize anthracnose fungus Colletotrichum graminicola, the latter being a hemibiotroph that only exhibits an initial biotrophic phase during its establishment. Based on the analysis of 42 water-soluble metabolites, we were able to separate early biotrophic from late biotrophic interactions by hierarchical cluster analysis and principal component analysis, irrespective of the plant host. Interestingly, the corresponding transcriptome dataset could not discriminate between these stages of biotrophy, irrespective, of whether transcript data for genes of central metabolism or the entire transcriptome dataset was used. Strong differences in the transcriptional regulation of photosynthesis, glycolysis, the TCA cycle, lipid biosynthesis, and cell wall metabolism were observed between the pathosystems. However, increased contents of Gln, Asn, and glucose as well as diminished contents of PEP and 3-PGA were common to early post-penetration stages of all interactions. On the transcriptional level, genes of the TCA cycle, nucleotide energy metabolism and amino acid biosynthesis exhibited consistent trends among the compared biotrophic interactions, identifying the requirement for metabolic energy and the rearrangement of amino acid pools as common transcriptional motifs during early biotrophy. Both metabolome and transcript data were employed to generate models of leaf primary metabolism during early biotrophy for the three investigated interactions. PMID:22645534

Understanding Strategy of Nitrate and Urea Assimilation in a Chinese Strain of Aureococcus anophagefferens through RNA-Seq Analysis

PubMed Central

Dong, Hong-Po; Huang, Kai-Xuan; Wang, Hua-Long; Lu, Song-Hui; Cen, Jing-Yi; Dong, Yue-Lei

2014-01-01

Aureococcus anophagefferens is a harmful alga that dominates plankton communities during brown tides in North America, Africa, and Asia. Here, RNA-seq technology was used to profile the transcriptome of a Chinese strain of A. anophagefferens that was grown on urea, nitrate, and a mixture of urea and nitrate, and that was under N-replete, limited and recovery conditions to understand the molecular mechanisms that underlie nitrate and urea utilization. The number of differentially expressed genes between urea-grown and mixture N-grown cells were much less than those between urea-grown and nitrate-grown cells. Compared with nitrate-grown cells, mixture N-grown cells contained much lower levels of transcripts encoding proteins that are involved in nitrate transport and assimilation. Together with profiles of nutrient changes in media, these results suggest that A. anophagefferens primarily feeds on urea instead of nitrate when urea and nitrate co-exist. Furthermore, we noted that transcripts upregulated by nitrate and N-limitation included those encoding proteins involved in amino acid and nucleotide transport, degradation of amides and cyanates, and nitrate assimilation pathway. The data suggest that A. anophagefferens possesses an ability to utilize a variety of dissolved organic nitrogen. Moreover, transcripts for synthesis of proteins, glutamate-derived amino acids, spermines and sterols were upregulated by urea. Transcripts encoding key enzymes that are involved in the ornithine-urea and TCA cycles were differentially regulated by urea and nitrogen concentration, which suggests that the OUC may be linked to the TCA cycle and involved in reallocation of intracellular carbon and nitrogen. These genes regulated by urea may be crucial for the rapid proliferation of A. anophagefferens when urea is provided as the N source. PMID:25338000

Studies of Secondary Melanoma on C57BL/6J Mouse Liver Using 1H NMR Metabolomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feng, Ju; Isern, Nancy G.; Burton, Sarah D.

2013-10-31

NMR metabolomics, consisting of solid state high resolution (hr) magic angle spinning (MAS) 1H NMR (1H hr-MAS), liquid state high resolution 1H-NMR, and principal components analysis (PCA) has been used to study secondary metastatic B16-F10 melanoma in C57BL/6J mouse liver . The melanoma group can be differentiated from its control group by PCA analysis of the absolute concentrations or by the absolute peak intensities of metabolites from either 1H hr-MAS NMR data on intact liver tissues or liquid state 1H-NMR spectra on liver tissue extracts. In particular, we found that the absolute concentrations of alanine, glutamate, creatine, creatinine, fumarate andmore » cholesterol are elevated in the melanoma group as compared to controls, while the absolute concentrations of succinate, glycine, glucose, and the family of linear lipids including long chain fatty acids, total choline and acylglycerol are decreased. The ratio of glycerophosphocholine to phosphocholine is increased by about 1.5 fold in the melanoma group, while the absolute concentration of total choline is actually lower in melanoma mice. These results suggest the following picture in secondary melanoma metastasis: Linear lipid levels are decreased by beta oxidation in the melanoma group, which contributes to an increase in the synthesis of cholesterol, and also provides an energy source input for TCA cycle. These findings suggest a link between lipid oxidation, the TCA cycle and the hypoxia-inducible factors (HIF) signal pathway in tumor metastases. Thus this study indicates that the metabolic profile derived from NMR analysis can provide a valuable bio-signature of malignancy and cell hypoxia in metastatic melanoma.« less

A plant pathogenic bacterium exploits the tricarboxylic acid cycle metabolic pathway of its insect vector

PubMed Central

Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I.

2018-01-01

ABSTRACT Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L-serine, L-threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L-proline, L-aspartic acid, and L-pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L-proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector. PMID:28594267

A plant pathogenic bacterium exploits the tricarboxylic acid cycle metabolic pathway of its insect vector.

PubMed

Killiny, Nabil; Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I

2018-01-01

Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L -serine, L -threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L -proline, L -aspartic acid, and L -pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L -proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector.

Lacking Ketohexokinase-A Exacerbates Renal Injury in Streptozotocin-induced Diabetic Mice.

PubMed

Doke, Tomohito; Ishimoto, Takuji; Hayasaki, Takahiro; Ikeda, Satsuki; Hasebe, Masako; Hirayama, Akiyoshi; Soga, Tomoyoshi; Kato, Noritoshi; Kosugi, Tomoki; Tsuboi, Naotake; Lanaspa, Miguel A; Johnson, Richard J; Kadomatsu, Kenji; Maruyama, Shoichi

2018-03-28

Ketohexokinase (KHK), a primary enzyme in fructose metabolism, has two isoforms, namely, KHK-A and KHK-C. Previously, we reported that renal injury was reduced in streptozotocin-induced diabetic mice which lacked both isoforms. Although both isoforms express in kidney, it has not been elucidated whether each isoform plays distinct roles in the development of diabetic kidney disease (DKD). The aim of the study is to elucidate the role of KHK-A for DKD progression. Diabetes was induced by five consecutive daily intraperitoneal injections of streptozotocin (50 mg/kg) in C57BL/6 J wild-type mice, mice lacking KHK-A alone (KHK-A KO), and mice lacking both KHK-A and KHK-C (KHK-A/C KO). At 35 weeks, renal injury, inflammation, hypoxia, and oxidative stress were examined. Metabolomic analysis including polyol pathway, fructose metabolism, glycolysis, TCA (tricarboxylic acid) cycle, and NAD (nicotinamide adenine dinucleotide) metabolism in kidney and urine was done. Diabetic KHK-A KO mice developed severe renal injury compared to diabetic wild-type mice, and this was associated with further increases of intrarenal fructose, dihydroxyacetone phosphate (DHAP), TCA cycle intermediates levels, and severe inflammation. In contrast, renal injury was prevented in diabetic KHK-A/C KO mice compared to both wild-type and KHK-A KO diabetic mice. Further, diabetic KHK-A KO mice contained decreased renal NAD + level with the increase of renal hypoxia-inducible factor 1-alpha expression despite having increased renal nicotinamide (NAM) level. These results suggest that KHK-C might play a deleterious role in DKD progression through endogenous fructose metabolism, and that KHK-A plays a unique protective role against the development of DKD. Copyright © 2018. Published by Elsevier Inc.

High-intensity exercise training increases the diversity and metabolic capacity of the mouse distal gut microbiota during diet-induced obesity

PubMed Central

Denou, Emmanuel; Marcinko, Katarina; Surette, Michael G.; Steinberg, Gregory R.

2016-01-01

Diet and exercise underpin the risk of obesity-related metabolic disease. Diet alters the gut microbiota, which contributes to aspects of metabolic disease during obesity. Repeated exercise provides metabolic benefits during obesity. We assessed whether exercise could oppose changes in the taxonomic and predicted metagenomic characteristics of the gut microbiota during diet-induced obesity. We hypothesized that high-intensity interval training (HIIT) would counteract high-fat diet (HFD)-induced changes in the microbiota without altering obesity in mice. Compared with chow-fed mice, an obesity-causing HFD decreased the Bacteroidetes-to-Firmicutes ratio and decreased the genetic capacity in the fecal microbiota for metabolic pathways such as the tricarboxylic acid (TCA) cycle. After HFD-induced obesity was established, a subset of mice were HIIT for 6 wk, which increased host aerobic capacity but did not alter body or adipose tissue mass. The effects of exercise training on the microbiota were gut segment dependent and more extensive in the distal gut. HIIT increased the alpha diversity and Bacteroidetes/Firmicutes ratio of the distal gut and fecal microbiota during diet-induced obesity. Exercise training increased the predicted genetic capacity related to the TCA cycle among other aspects of metabolism. Strikingly, the same microbial metabolism indexes that were increased by exercise were all decreased in HFD-fed vs. chow diet-fed mice. Therefore, exercise training directly opposed some of the obesity-related changes in gut microbiota, including lower metagenomic indexes of metabolism. Some host and microbial pathways appeared similarly affected by exercise. These exercise- and diet-induced microbiota interactions can be captured in feces. PMID:27117007

High-intensity exercise training increases the diversity and metabolic capacity of the mouse distal gut microbiota during diet-induced obesity.

PubMed

Denou, Emmanuel; Marcinko, Katarina; Surette, Michael G; Steinberg, Gregory R; Schertzer, Jonathan D

2016-06-01

Diet and exercise underpin the risk of obesity-related metabolic disease. Diet alters the gut microbiota, which contributes to aspects of metabolic disease during obesity. Repeated exercise provides metabolic benefits during obesity. We assessed whether exercise could oppose changes in the taxonomic and predicted metagenomic characteristics of the gut microbiota during diet-induced obesity. We hypothesized that high-intensity interval training (HIIT) would counteract high-fat diet (HFD)-induced changes in the microbiota without altering obesity in mice. Compared with chow-fed mice, an obesity-causing HFD decreased the Bacteroidetes-to-Firmicutes ratio and decreased the genetic capacity in the fecal microbiota for metabolic pathways such as the tricarboxylic acid (TCA) cycle. After HFD-induced obesity was established, a subset of mice were HIIT for 6 wk, which increased host aerobic capacity but did not alter body or adipose tissue mass. The effects of exercise training on the microbiota were gut segment dependent and more extensive in the distal gut. HIIT increased the alpha diversity and Bacteroidetes/Firmicutes ratio of the distal gut and fecal microbiota during diet-induced obesity. Exercise training increased the predicted genetic capacity related to the TCA cycle among other aspects of metabolism. Strikingly, the same microbial metabolism indexes that were increased by exercise were all decreased in HFD-fed vs. chow diet-fed mice. Therefore, exercise training directly opposed some of the obesity-related changes in gut microbiota, including lower metagenomic indexes of metabolism. Some host and microbial pathways appeared similarly affected by exercise. These exercise- and diet-induced microbiota interactions can be captured in feces. Copyright © 2016 the American Physiological Society.

Analysis of Metabolic Pathways and Fluxes in a Newly Discovered Thermophilic and Ethanol-Tolerant Geobacillus Strain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Yinjie J.; Sapra, Rajat; Joyner, Dominique

2009-01-20

A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and istolerant to high ethanol concentrations (10percent, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner?Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (includingmore » the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accuratelydetermined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)-1 h-1) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64+-3 to 25+-2 and from 30+-2 to 19+-2, respectively. The carbon flux under micro-aerobic growth was directed formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38+-0.07 mol mol-1 glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yieldby approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production.« less

Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates.

PubMed

Wang, Huicong; Ma, Fangfang; Cheng, Lailiang

2010-07-01

Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

Analysis of l-glutamic acid fermentation by using a dynamic metabolic simulation model of Escherichia coli

PubMed Central

2013-01-01

Background Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. Results We constructed an l-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for l-glutamic acid production; the results of this process corresponded with previous experimental data regarding l-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of l-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model l-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in l-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. Conclusions In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation. PMID:24053676

Analysis of L-glutamic acid fermentation by using a dynamic metabolic simulation model of Escherichia coli.

PubMed

Nishio, Yousuke; Ogishima, Soichi; Ichikawa, Masao; Yamada, Yohei; Usuda, Yoshihiro; Masuda, Tadashi; Tanaka, Hiroshi

2013-09-22

Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. We constructed an L-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for L-glutamic acid production; the results of this process corresponded with previous experimental data regarding L-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of L-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model L-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in L-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation.

Influence of Iron and Aeration on Staphylococcus aureus Growth, Metabolism, and Transcription

PubMed Central

Ledala, Nagender; Zhang, Bo; Seravalli, Javier; Powers, Robert

2014-01-01

Staphylococcus aureus is a prominent nosocomial pathogen and a major cause of biomaterial-associated infections. The success of S. aureus as a pathogen is due in part to its ability to adapt to stressful environments. As an example, the transition from residing in the nares to residing in the blood or deeper tissues is accompanied by changes in the availability of nutrients and elements such as oxygen and iron. As such, nutrients, oxygen, and iron are important determinants of virulence factor synthesis in S. aureus. In addition to influencing virulence factor synthesis, oxygen and iron are critical cofactors in enzymatic and electron transfer reactions; thus, a change in iron or oxygen availability alters the bacterial metabolome. Changes in metabolism create intracellular signals that alter the activity of metabolite-responsive regulators such as CodY, RpiRc, and CcpA. To assess the extent of metabolomic changes associated with oxygen and iron limitation, S. aureus cells were cultivated in iron-limited medium and/or with decreasing aeration, and the metabolomes were examined by nuclear magnetic resonance (NMR) spectroscopy. As expected, oxygen and iron limitation dramatically decreased tricarboxylic acid (TCA) cycle activity, creating a metabolic block and significantly altering the metabolome. These changes were most prominent during post-exponential-phase growth, when TCA cycle activity was maximal. Importantly, many of the effects of iron limitation were obscured by aeration limitation. Aeration limitation not only obscured the metabolic effects of iron limitation but also overrode the transcription of iron-regulated genes. Finally, in contrast to previous speculation, we confirmed that acidification of the culture medium occurs independent of the availability of iron. PMID:24706736

Increased heme synthesis in yeast induces a metabolic switch from fermentation to respiration even under conditions of glucose repression.

PubMed

Zhang, Tiantian; Bu, Pengli; Zeng, Joey; Vancura, Ales

2017-10-13

Regulation of mitochondrial biogenesis and respiration is a complex process that involves several signaling pathways and transcription factors as well as communication between the nuclear and mitochondrial genomes. Under aerobic conditions, the budding yeast Saccharomyces cerevisiae metabolizes glucose predominantly by glycolysis and fermentation. We have recently shown that altered chromatin structure in yeast induces respiration by a mechanism that requires transport and metabolism of pyruvate in mitochondria. However, how pyruvate controls the transcriptional responses underlying the metabolic switch from fermentation to respiration is unknown. Here, we report that this pyruvate effect involves heme. We found that heme induces transcription of HAP4 , the transcriptional activation subunit of the Hap2/3/4/5p complex, required for growth on nonfermentable carbon sources, in a Hap1p- and Hap2/3/4/5p-dependent manner. Increasing cellular heme levels by inactivating ROX1 , which encodes a repressor of many hypoxic genes, or by overexpressing HEM3 or HEM12 induced respiration and elevated ATP levels. Increased heme synthesis, even under conditions of glucose repression, activated Hap1p and the Hap2/3/4/5p complex and induced transcription of HAP4 and genes required for the tricarboxylic acid (TCA) cycle, electron transport chain, and oxidative phosphorylation, leading to a switch from fermentation to respiration. Conversely, inhibiting metabolic flux into the TCA cycle reduced cellular heme levels and HAP4 transcription. Together, our results indicate that the glucose-mediated repression of respiration in budding yeast is at least partly due to the low cellular heme level. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Differential susceptibility of mitochondrial complex II to inhibition by oxaloacetate in brain and heart.

PubMed

Stepanova, Anna; Shurubor, Yevgeniya; Valsecchi, Federica; Manfredi, Giovanni; Galkin, Alexander

2016-09-01

Mitochondrial Complex II is a key mitochondrial enzyme connecting the tricarboxylic acid (TCA) cycle and the electron transport chain. Studies of complex II are clinically important since new roles for this enzyme have recently emerged in cell signalling, cancer biology, immune response and neurodegeneration. Oxaloacetate (OAA) is an intermediate of the TCA cycle and at the same time is an inhibitor of complex II with high affinity (Kd~10(-8)M). Whether or not OAA inhibition of complex II is a physiologically relevant process is a significant, but still controversial topic. We found that complex II from mouse heart and brain tissue has similar affinity to OAA and that only a fraction of the enzyme in isolated mitochondrial membranes (30.2±6.0% and 56.4±5.6% in the heart and brain, respectively) is in the free, active form. Since OAA could bind to complex II during isolation, we established a novel approach to deplete OAA in the homogenates at the early stages of isolation. In heart, this treatment significantly increased the fraction of free enzyme, indicating that OAA binds to complex II during isolation. In brain the OAA-depleting system did not significantly change the amount of free enzyme, indicating that a large fraction of complex II is already in the OAA-bound inactive form. Furthermore, short-term ischemia resulted in a dramatic decline of OAA in tissues, but it did not change the amount of free complex II. Our data show that in brain OAA is an endogenous effector of complex II, potentially capable of modulating the activity of the enzyme. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

A STUDY COMPARING CHEMICAL PEELING USING MODIFIED JESSNER'S SOLUTION AND 15%TRICHLOROACETIC ACID VERSUS 15% TRICHLOROACETIC ACID IN THE TREATMENT OF MELASMA

PubMed Central

Safoury, Omar Soliman; Zaki, Nagla Mohamed; El Nabarawy, Eman Ahmad; Farag, Eman Abas

2009-01-01

Background: Melasma is a symmetric progressive hyperpigmentation of the facial skin that occurs in all races but has a predilection for darker skin phenotypes. Depigmenting agents, laser and chemical peeling as classic Jessner's solution, modified Jessner's solution and trichloroacetic acid have been used alone and in combination in the treatment of melasma. Objectives: The aim of the study was to compare the therapeutic effect of combined 15% Trichloroacetic acid (TCA) and modified Jessner's solution with 15% TCA on melasma. Materials and Methods: Twenty married females with melasma (epidermal type), with a mean age of 38.25 years, were included in this study. All were of skin type III or IV. Fifteen percent TCA was applied to the whole face, with the exception of the left malar area to which combined TCA 15% and modified Jessner's solution was applied. Results: Our results revealed statistically highly significant difference between MASI Score (Melasma Area and Severity Index) between the right malar area and the left malar area. Conclusion: Modified Jessner's solution proved to be useful as an adjuvant treatment with TCA in the treatment of melasma, improving the results and minimizing postinflammatory hyperpigmentation. PMID:20049268

Physical properties of ambient and laboratory-generated secondary organic aerosol

NASA Astrophysics Data System (ADS)

O'Brien, Rachel E.; Neu, Alexander; Epstein, Scott A.; MacMillan, Amanda C.; Wang, Bingbing; Kelly, Stephen T.; Nizkorodov, Sergey A.; Laskin, Alexander; Moffet, Ryan C.; Gilles, Mary K.

2014-06-01

The size and thickness of organic aerosol particles collected by impaction in five field campaigns were compared to those of laboratory-generated secondary organic aerosols (SOA). Scanning transmission X-ray microscopy was used to measure the total carbon absorbance (TCA) by individual particles as a function of their projection areas on the substrate. Particles with higher viscosity/surface tension can be identified by a steeper slope on a plot of TCA versus size because they flatten less upon impaction. The slopes of the ambient data are statistically similar indicating a small range of average viscosities/surface tensions across five field campaigns. Steeper slopes were observed for the plots corresponding to ambient particles, while smaller slopes were indicative of the laboratory-generated SOA. This comparison indicates that ambient organic particles have higher viscosities/surface tensions than those typically generated in laboratory SOA studies.

Metabolomic Fingerprinting in the Comprehensive Study of Liver Changes Associated with Onion Supplementation in Hypercholesterolemic Wistar Rats

PubMed Central

González-Peña, Diana; Dudzik, Danuta; García, Antonia; de Ancos, Begoña; Barbas, Coral; Sánchez-Moreno, Concepción

2017-01-01

The consumption of functional ingredients has been suggested to be a complementary tool for the prevention and management of liver disease. In this light, processed onion can be considered as a source of multiple bioactive compounds with hepatoprotective properties. The liver fingerprint of male Wistar rats (n = 24) fed with three experimental diets (control (C), high-cholesterol (HC), and high-cholesterol enriched with onion (HCO) diets) was obtained through a non-targeted, multiplatform metabolomics approach to produce broad metabolite coverage. LC-MS, CE-MS and GC-MS results were subjected to univariate and multivariate analyses, providing a list of significant metabolites. All data were merged in order to figure out the most relevant metabolites that were modified by the onion ingredient. Several relevant metabolic changes and related metabolic pathways were found to be impacted by both HC and HCO diet. The model highlighted several metabolites (such as hydroxybutyryl carnitine and palmitoyl carnitine) modified by the HCO diet. These findings could suggest potential impairments in the energy−lipid metabolism, perturbations in the tricarboxylic acid cycle (TCA) cycle and β-oxidation modulated by the onion supplementation in the core of hepatic dysfunction. Metabolomics shows to be a valuable tool to evaluate the effects of complementary dietetic approaches directed to hepatic damage amelioration or non-alcoholic fatty liver disease (NAFLD) prevention. PMID:28134852

Improved Proteomic Analysis Following Trichloroacetic Acid Extraction of Bacillus anthracis Spore Proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaiser, Brooke LD; Wunschel, David S.; Sydor, Michael A.

2015-08-07

Proteomic analysis of bacterial samples provides valuable information about cellular responses and functions under different environmental pressures. Proteomic analysis is dependent upon efficient extraction of proteins from bacterial samples without introducing bias toward extraction of particular protein classes. While no single method can recover 100% of the bacterial proteins, selected protocols can improve overall protein isolation, peptide recovery, or enrich for certain classes of proteins. The method presented here is technically simple and does not require specialized equipment such as a mechanical disrupter. Our data reveal that for particularly challenging samples, such as B. anthracis Sterne spores, trichloroacetic acid extractionmore » improved the number of proteins identified within a sample compared to bead beating (714 vs 660, respectively). Further, TCA extraction enriched for 103 known spore specific proteins whereas bead beating resulted in 49 unique proteins. Analysis of C. botulinum samples grown to 5 days, composed of vegetative biomass and spores, showed a similar trend with improved protein yields and identification using our method compared to bead beating. Interestingly, easily lysed samples, such as B. anthracis vegetative cells, were equally as effectively processed via TCA and bead beating, but TCA extraction remains the easiest and most cost effective option. As with all assays, supplemental methods such as implementation of an alternative preparation method may provide additional insight to the protein biology of the bacteria being studied.« less

Tricyclic antidepressants for management of residual symptoms in inflammatory bowel disease.

PubMed

Iskandar, Heba N; Cassell, Benjamin; Kanuri, Navya; Gyawali, C Prakash; Gutierrez, Alexandra; Dassopoulos, Themistocles; Ciorba, Matthew A; Sayuk, Gregory S

2014-01-01

Tricyclic antidepressants (TCAs) have efficacy in treating irritable bowel syndrome (IBS). Some clinicians use TCAs to treat residual symptoms in inflammatory bowel disease (IBD) patients already on decisive IBD therapy or with quiescent inflammation, although this strategy has not been formally studied. The aim of this study was to examine the efficacy of TCA therapy in IBD patients with residual symptoms, despite controlled inflammation, in a retrospective cohort study. Inclusion required initiation of TCA for persistent gastrointestinal symptoms. IBD patients had inactive or mildly active disease with persistent symptoms despite adequate IBD therapy as determined by their physician. Symptom response was compared with IBS patients. Established Likert scales were used to score baseline symptom severity (0=no symptoms, 3=severe symptoms) and TCA response (0=no improvement; 3=complete satisfaction). Eighty-one IBD [41.3±1.7 y, 56F; 58 Crohn's disease/23 ulcerative colitis (UC)] and 77 IBS (46.2±1.7 y, 60F) patients were initiated on a TCA therapy. Baseline symptom scores (IBD, 2.06±0.03; IBS, 2.12±0.04; P=0.15) and symptom response to TCA therapy (IBD, 1.46±0.09; IBS, 1.30±0.09; P=0.2) were similar in both the groups. At least moderate improvement (Likert score ≥2) on TCA was achieved by comparable proportions of patients (59.3% IBD vs. 46% IBS; P=0.09). Within IBD, response was better with UC than Crohn's disease (1.86±0.13 vs. 1.26±0.11, respectively, P=0.003). In a clinical practice setting, TCA use led to moderate improvement of residual gastrointestinal symptoms in IBD patients for whom escalation of IBD therapy was not planned. UC patients demonstrated higher therapeutic success. IBD symptom responses were similar to IBS patients.

Development and validation of a stability-indicating HPLC-UV method for the determination of triamcinolone acetonide and its degradation products in an ointment formulation.

PubMed

van Heugten, A J P; de Boer, W; de Vries, W S; Markesteijn, C M A; Vromans, H

2018-02-05

A stability indicating high performance liquid chromatography method has been developed for the determination of triamcinolone acetonide (TCA) and its main degradation products in ointment formulations. The method, based on extensive stress testing using metal salts, azobisisobutyronitrile, acid, base and peroxide, showed that TCA undergoes oxidative degradation. All degradation products were identified using HPLC mass spectrometry. Separation and quantification was achieved using an Altima C18 RP18 HP column (250×4.6mm 2 , with 5μm particles) using a mobile phase consisting of acetonitrile and water buffered at pH 7 using 10mM phosphate buffer. A gradient mode was operated at a flow rate of 1.5ml/min and detection was at 241nm. The method showed linearity for TCA and Impurity C in 0.02-125% of the workload, both square roots of the correlation coefficients were larger than 0.9999. Repeatability and intermediate precision were performed by six consecutive injections of both 1.25% and 125% of the work load for both TCA and Impurity C divided equally over two days. RSD were 0.6% and 0.7% for TCA and 0.5% and 0.1% for Impurity C respectively. Accuracy was determined as well, the average recoveries were 99.5% (±0.1%, n=3) for TCA and 96.9% (±1.3%, n=3) for impurity C respectively from spiked ointment samples. The robustness was also evaluated by variations of column (old vs new), mobile phase pH and filter retention. The applicability of the method was evaluated by analysis of a commercial ointment formulation. Interestingly, the extensive stress tests were able to predict all degradation products of TCA in a long term stability ointment sample. Copyright © 2017 Elsevier B.V. All rights reserved.

Parents' and primary healthcare practitioners' perspectives on the safety of honey and other traditional paediatric healthcare approaches.

PubMed

Kumar, Raekha; Lorenc, Ava; Robinson, Nicola; Blair, Mitch

2011-09-01

Traditional and complementary healthcare approaches (TCA) are widely used for children, often because of perceived safety. Honey is a traditional remedy for upper respiratory tract symptoms in infants. Health officials currently advise limiting honey use because of the risk of botulism. This paper discusses honey as a traditional healthcare approach for children in a multi-ethnic community, and parents' and primary healthcare practitioners' (PHPs) perceptions of its safety. As part of a larger study exploring beliefs about TCA, this paper focuses on perceived safety and use of honey, using data extracted for detailed analysis. Eleven parent focus groups (n= 92) and 30 interviews with PHPs were conducted. Qualitative data analysis used the Framework approach. London Boroughs of Brent and Harrow TCA, particularly home remedies, dietary and religious approaches were popular for children. Honey was a particularly common TCA, reportedly used by 27 (29%) parents for their children. Honey was believed to be traditional, acceptable, accessible, natural and safe. It was most commonly used for respiratory tract symptoms and administered with hot water and lemon juice. PHPs were more concerned about the safety of TCA than parents. Almost half (40%) of PHPs mentioned the use of honey for children, few perceived it as a 'treatment' or were concerned about botulism. Others were aware of the risks and some reported challenges in communicating risk to parents. TCA are commonly used for children, honey in particular for respiratory tract symptoms. Parents and some PHPs appear unaware of the risk of botulism from honey use in infants. Healthcare practitioners should ask routinely about the use of honey and other TCA, and consider different parental belief systems in ethnically diverse populations. Further research is required on the use and efficacy of honey for infants, to raise awareness of its benefits and risks. © 2010 Blackwell Publishing Ltd.

Methane utilization in Methylomicrobium alcaliphilum 20ZR: a systems approach.

PubMed

Akberdin, Ilya R; Thompson, Merlin; Hamilton, Richard; Desai, Nalini; Alexander, Danny; Henard, Calvin A; Guarnieri, Michael T; Kalyuzhnaya, Marina G

2018-02-06

Biological methane utilization, one of the main sinks of the greenhouse gas in nature, represents an attractive platform for production of fuels and value-added chemicals. Despite the progress made in our understanding of the individual parts of methane utilization, our knowledge of how the whole-cell metabolic network is organized and coordinated is limited. Attractive growth and methane-conversion rates, a complete and expert-annotated genome sequence, as well as large enzymatic, 13 C-labeling, and transcriptomic datasets make Methylomicrobium alcaliphilum 20Z R an exceptional model system for investigating methane utilization networks. Here we present a comprehensive metabolic framework of methane and methanol utilization in M. alcaliphilum 20Z R . A set of novel metabolic reactions governing carbon distribution across central pathways in methanotrophic bacteria was predicted by in-silico simulations and confirmed by global non-targeted metabolomics and enzymatic evidences. Our data highlight the importance of substitution of ATP-linked steps with PPi-dependent reactions and support the presence of a carbon shunt from acetyl-CoA to the pentose-phosphate pathway and highly branched TCA cycle. The diverged TCA reactions promote balance between anabolic reactions and redox demands. The computational framework of C 1 -metabolism in methanotrophic bacteria can represent an efficient tool for metabolic engineering or ecosystem modeling.

Sequence and transcriptional analysis of the genes responsible for curdlan biosynthesis in Agrobacterium sp. ATCC 31749 under simulated dissolved oxygen gradients conditions.

PubMed

Zhang, Hong-Tao; Zhan, Xiao-Bei; Zheng, Zhi-Yong; Wu, Jian-Rong; Yu, Xiao-Bin; Jiang, Yun; Lin, Chi-Chung

2011-07-01

Expression at the mRNA level of ten selected genes in Agrobacterium sp. ATCC 31749 under various dissolved oxygen (DO) levels during curdlan fermentation related to electron transfer chain (ETC), tricarboxylic acid (TCA) cycle, peptidoglycan/lipopolysaccharide biosynthesis, and uridine diphosphate (UDP)-glucose biosynthesis were determined by qRT-PCR. Experiments were performed at DO levels of 30%, 50%, and 75%, as well as under low-oxygen conditions. The effect of high cell density on transcriptional response of the above genes under low oxygen was also studied. Besides cytochrome d (cyd A), the transcription levels of all the other genes were increased at higher DO and reached maximum at 50% DO. Under 75% DO, the transcriptional levels of all the genes were repressed. In addition, transcription levels of icd, sdh, cyo A, and fix N genes did not exhibit significant fluctuation with high cell density culture under low oxygen. These results suggested a mechanism for DO regulation of curdlan synthesis through regulation of transcriptional levels of ETCs, TCA, and UDP-glucose synthesis genes during curdlan fermentation. To our knowledge, this is the first report that DO concentration apparently regulates curdlan biosynthesis in Agrobacterium sp. ATCC 31749 providing essential lead for the optimization of the fermentation at the industrial scale.

Mechanism of Cisplatin-Induced Cytotoxicity Is Correlated to Impaired Metabolism Due to Mitochondrial ROS Generation

PubMed Central

Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun

2015-01-01

The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player. PMID:26247588

N-acyl Taurines and Acylcarnitines Cause an Imbalance in Insulin Synthesis and Secretion Provoking β Cell Dysfunction in Type 2 Diabetes.

PubMed

Aichler, Michaela; Borgmann, Daniela; Krumsiek, Jan; Buck, Achim; MacDonald, Patrick E; Fox, Jocelyn E Manning; Lyon, James; Light, Peter E; Keipert, Susanne; Jastroch, Martin; Feuchtinger, Annette; Mueller, Nikola S; Sun, Na; Palmer, Andrew; Alexandrov, Theodore; Hrabe de Angelis, Martin; Neschen, Susanne; Tschöp, Matthias H; Walch, Axel

2017-06-06

The processes contributing to β cell dysfunction in type 2 diabetes (T2D) are uncertain, largely because it is difficult to access β cells in their intact immediate environment. We examined the pathophysiology of β cells under T2D progression directly in pancreatic tissues. We used MALDI imaging of Langerhans islets (LHIs) within mouse tissues or from human tissues to generate in situ-omics data, which we supported with in vitro experiments. Molecular interaction networks provided information on functional pathways and molecules. We found that stearoylcarnitine accumulated in β cells, leading to arrest of insulin synthesis and energy deficiency via excessive β-oxidation and depletion of TCA cycle and oxidative phosphorylation metabolites. Acetylcarnitine and an accumulation of N-acyl taurines, a group not previously detected in β cells, provoked insulin secretion. Thus, β cell dysfunction results from enhanced insulin secretion combined with an arrest of insulin synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.

Glutaminolysis is Essential for Energy Production and Ion Transport in Human Corneal Endothelium.

PubMed

Zhang, Wenlin; Li, Hongde; Ogando, Diego G; Li, Shimin; Feng, Matthew; Price, Francis W; Tennessen, Jason M; Bonanno, Joseph A

2017-02-01

Corneal endothelium (CE) is among the most metabolically active tissues in the body. This elevated metabolic rate helps the CE maintain corneal transparency by its ion and fluid transport properties, which when disrupted, leads to visual impairment. Here we demonstrate that glutamine catabolism (glutaminolysis) through TCA cycle generates a large fraction of the ATP needed to maintain CE function, and this glutaminolysis is severely disrupted in cells deficient in NH 3 :H + cotransporter Solute Carrier Family 4 Member 11 (SLC4A11). Considering SLC4A11 mutations leads to corneal endothelial dystrophy and sensorineural deafness, our results indicate that SLC4A11-associated developmental and degenerative disorders result from altered glutamine catabolism. Overall, our results describe an important metabolic mechanism that provides CE cells with the energy required to maintain high level transport activity, reveal a direct link between glutamine metabolism and developmental and degenerative neuronal diseases, and suggest an approach for protecting the CE during ophthalmic surgeries. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Community Response to a Heavy Precipitation Event in High Temperature, Chemosynthetic Biofilms and Sediments

NASA Astrophysics Data System (ADS)

Meyer-Dombard, D. R.; Loiacono, S. T.; Shock, E.

2012-12-01

Coordinated analysis of the "Bison Pool" (BP) Environmental Genome and a complementary contextual geochemical dataset of ~75 parameters revealed biogeochemical cycling and metabolic and microbial community shifts in a Yellowstone National Park hot spring ecosystem (1). The >22m outflow of BP is a gradient of decreasing temperature, increasing dissolved oxygen, and changing availability of nutrients. Microbial life at BP transitions from a 92°C chemosynthetic community in the BP source pool to a 56°C photosynthetic mat community. Metagenomic data at BP showed the potential for both heterotrophic and autotrophic carbon metabolism (rTCA and acetyl-CoA cycles) in the highest temperature, chemosynthetic regions (1). This region of the outflow is dominated by Aquificales and Pyrococcus relatives, with smaller contributions of heterotrophic Bacteria. Following a 2h heavy precipitation event we observed an influx of exogenous organic material into the source pool supplied from the meadow surrounding the BP area. We sampled biomass and fluid at several locations within the outflow immediately following the event, and on several occasions for the next eight days. Elemental analysis and carbon and nitrogen isotopic analyses were conducted on biomass and sediment, and dissolved organic and inorganic carbon content and δ13C of fluids were analyzed. DNA and RNA were extracted, and following RT-PCR, nitrogen cycle functional gene expression was evaluated. Previous work at BP has shown that chemosynthetic biomass may carry isotopic signatures of fractionation during carbon fixation, via the acetyl-CoA and rTCA cycles (2). However, the addition of exogenous organic carbon during the rain event had an immediate and dramatic effect on the sediments and biofilms in the chemosynthetic zone of the outflow. Dissolved organic carbon was the highest measured in six years. Chemosynthetic biomass responded by incorporating the organic carbon. Carbon isotopic signatures in chemosynthetic biomass at "Bison Pool" have been previously measured at ~ -4‰ (2). However, immediately following the event, carbon in biomass was measured at ~ -25‰ (values similar to local soil and bison excrement). Biomass closest to the source of "Bison Pool" returned to ~ -4‰ within a few days, but biomass ~ 3m downstream was still ~ -14‰ eight days after the event. Carbon isotopic signatures of the dissolved inorganic carbon (DIC) were depleted relative to values measured in 2005-2009, possibly a result of a combination of added DIC in rain and heterotrophic waste produced using the exogenous depleted carbon; this depleted DIC persisted for the full study period. These results suggest that a shift from autotrophic to heterotrophic metabolism may occur following every significant precipitation event at BP, and support previous observations concerning potential periodic eutrophic conditions in this ecosystem (3). 1 Swingley, W.D. et al., PLoS ONE, 7(6): e38108. 2 Havig et al., 2011. JGR Biogeosciences, 116, G01005. 3 Loiacono, S.T. et al., 2012. EM, 14(5): 1272-1283.

Construction of special eye models for investigation of chromatic and higher-order aberrations of eyes.

PubMed

Zhai, Yi; Wang, Yan; Wang, Zhaoqi; Liu, Yongji; Zhang, Lin; He, Yuanqing; Chang, Shengjiang

2014-01-01

An achromatic element eliminating only longitudinal chromatic aberration (LCA) while maintaining transverse chromatic aberration (TCA) is established for the eye model, which involves the angle formed by the visual and optical axis. To investigate the impacts of higher-order aberrations on vision, the actual data of higher-order aberrations of human eyes with three typical levels are introduced into the eye model along visual axis. Moreover, three kinds of individual eye models are established to investigate the impacts of higher-order aberrations, chromatic aberration (LCA+TCA), LCA and TCA on vision under the photopic condition, respectively. Results show that for most human eyes, the impact of chromatic aberration on vision is much stronger than that of higher-order aberrations, and the impact of LCA in chromatic aberration dominates. The impact of TCA is approximately equal to that of normal level higher-order aberrations and it can be ignored when LCA exists.

The evaluation of three treatments for plantar callus: a three-armed randomised, comparative trial using biophysical outcome measures.

PubMed

Hashmi, Farina; Nester, Christopher J; Wright, Ciaran R F; Lam, Sharon

2016-05-17

Callus is one of the most common foot skin complaints experienced by people of all ages. These painful and unsightly lesions often result in disability. The 'gold standard' of treatment is scalpel debridement by a trained specialist; however, people also seek over-the-counter remedies. There is a lack of clinical evidence for the efficacy of such products, which makes selection by patients and practitioners difficult. This randomised, three-armed, parallel, comparative trial aimed to test the efficacy of two home treatments for plantar callus using novel, objective outcome measures (skin hydration using the capacitance method; elasticity using negative pressure application; and surface texture using imaging). Additional outcome measures were: size of callus, quality of life (Foot Health Status Questionnaire) and self-reported participant satisfaction and compliance. The results were compared to a podiatry treatment. Participants were randomly allocated to one of three groups: potassium hydroxide (KOH, 40 %); trichloroacetic acid (TCA); and podiatry treatment. Participants were followed for 3 weeks after their initial intervention appointment (days 7, 14 and 21). The primary outcomes were the change from baseline in callus hydration, elasticity, texture, and size at each of the three time points. The secondary outcomes where: change in quality of life 21 days after treatment; resolution of calluses via visual inspection; and participant compliance and perception. Forty-six participants (61 ft) with plantar calluses were recruited. The podiatry treatment showed immediate and significant changes in all objective outcomes, associated foot pain and function (p <0.01). Lesser changes in skin quality and perceived pain and functional benefits occurred with TCA and KOH over 21 days. This is the first study where objective outcome measures have been used to measure changes in the nature of skin in response to callus treatments. We found significant differences in plantar callus in response to podiatry and two home treatments. The podiatry treatment showed immediate and significant changes in skin and associated foot pain and function. Lesser, but sometimes comparable, changes in skin and perceived pain and functional benefits occurred with TCA and KOH over 21 days. ISRCTN14751843 : date of registration: 30 April 2015.

Integration between Glycolysis and Glutamate-Glutamine Cycle Flux May Explain Preferential Glycolytic Increase during Brain Activation, Requiring Glutamate

PubMed Central

Hertz, Leif; Chen, Ye

2017-01-01

The 1988 observation by Fox et al. (1988) that brief intense brain activation increases glycolysis (pyruvate formation from glucose) much more than oxidative metabolism has been abundantly confirmed. Specifically glycolytic increase was unexpected because the amount of ATP it generates is much smaller than that formed by subsequent oxidative metabolism of pyruvate. The present article shows that preferential glycolysis can be explained by metabolic processes associated with activation of the glutamate-glutamine cycle. The flux in this cycle, which is essential for production of transmitter glutamate and GABA, equals 75% of brain glucose utilization and each turn is associated with utilization of ~1 glucose molecule. About one half of the association between cycle flux and glucose metabolism occurs during neuronal conversion of glutamine to glutamate in a process similar to the malate-aspartate shuttle (MAS) except that glutamate is supplied from glutamine, not formed from α-ketoglutarate (αKG) as during operation of conventional MAS. Regular MAS function is triggered by one oxidative process in the cytosol during glycolysis causing NAD+ reduction to NADH. Since NADH cannot cross the mitochondrial membrane (MEM) for oxidation NAD+ is re-generated by conversion of cytosolic oxaloacetate (OAA) to malate, which enters the mitochondria for oxidation and in a cyclic process regenerates cytosolic OAA. Therefore MAS as well as the “pseudo-MAS” necessary for neuronal glutamate formation can only operate together with cytosolic reduction of NAD+ to NADH. The major process causing NAD+ reduction is glycolysis which therefore also must occur during neuronal conversion of glutamine to glutamate and may energize vesicular glutamate uptake which preferentially uses glycolytically derived energy. Another major contributor to the association between glutamate-glutamine cycle and glucose utilization is the need for astrocytic pyruvate to generate glutamate. Although some oxidative metabolism occurs during glutamate formation it is only one half of that during normal tricarboxylic acid (TCA) cycle function. Glutamate’s receptor stimulation leads to potassium ion (K+) release and astrocytic uptake, preferentially fueled by glycolysis and followed by release and neuronal re-accumulation. The activation-induced preferential glycolysis diminishes with continued activation and is followed by an increased ratio between oxidative metabolism and glycolysis, reflecting oxidation of generated glutamate and accumulated lactate. PMID:28890689

Microbial and functional diversity of a subterrestrial high pH groundwater associated to serpentinization.

PubMed

Tiago, Igor; Veríssimo, António

2013-06-01

Microbial and functional diversity were assessed, from a serpentinization-driven subterrestrial alkaline aquifer - Cabeço de Vide Aquifer (CVA) in Portugal. DGGE analyses revealed the presence of a stable microbial community. By 16S rRNA gene libraries and pyrosequencing analyses, a diverse bacterial composition was determined, contrasting with low archaeal diversity. Within Bacteria the majority of the populations were related to organisms or sequences affiliated to class Clostridia, but members of classes Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, Deinococci, Gammaproteobacteria and of the phyla Bacteroidetes, Chloroflexi and Nitrospira were also detected. Domain Archaea encompassed mainly sequences affiliated to Euryarchaeota. Only form I RuBisCO - cbbL was detected. Autotrophic carbon fixation via the rTCA, 3-HP and 3-HP/4H-B cycles could not be confirmed. The detected APS reductase alpha subunit - aprA sequences were phylogenetically related to sequences of sulfate-reducing bacteria belonging to Clostridia, and also to sequences of chemolithoautothrophic sulfur-oxidizing bacteria belonging to Betaproteobacteria. Sequences of methyl coenzyme M reductase - mcrA were phylogenetically affiliated to sequences belonging to Anaerobic Methanotroph group 1 (ANME-1). The populations found and the functional key markers detected in CVA suggest that metabolisms related to H2 , methane and/or sulfur may be the major driving forces in this environment. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Roles of glucose in photoreceptor survival.

PubMed

Chertov, Andrei O; Holzhausen, Lars; Kuok, Iok Teng; Couron, Drew; Parker, Ed; Linton, Jonathan D; Sadilek, Martin; Sweet, Ian R; Hurley, James B

2011-10-07

Vertebrate photoreceptor neurons have a high demand for metabolic energy, and their viability is very sensitive to genetic and environmental perturbations. We investigated the relationship between energy metabolism and cell death by evaluating the metabolic effects of glucose deprivation on mouse photoreceptors. Oxygen consumption, lactate production, ATP, NADH/NAD(+), TCA cycle intermediates, morphological changes, autophagy, and viability were evaluated. We compared retinas incubated with glucose to retinas deprived of glucose or retinas treated with a mixture of mitochondrion-specific fuels. Rapid and slow phases of cell death were identified. The rapid phase is linked to reduced mitochondrial activity, and the slower phase reflects a need for substrates for cell maintenance and repair.

Intrauterine Growth Restriction Programs the Hypothalamus of Adult Male Rats: Integrated Analysis of Proteomic and Metabolomic Data.

PubMed

Pedroso, Amanda P; Souza, Adriana P; Dornellas, Ana P S; Oyama, Lila M; Nascimento, Cláudia M O; Santos, Gianni M S; Rosa, José C; Bertolla, Ricardo P; Klawitter, Jelena; Christians, Uwe; Tashima, Alexandre K; Ribeiro, Eliane B

2017-04-07

Programming of hypothalamic functions regulating energy homeostasis may play a role in intrauterine growth restriction (IUGR)-induced adulthood obesity. The present study investigated the effects of IUGR on the hypothalamus proteome and metabolome of adult rats submitted to 50% protein-energy restriction throughout pregnancy. Proteomic and metabolomic analyzes were performed by data independent acquisition mass spectrometry and multiple reaction monitoring, respectively. At age 4 months, the restricted rats showed elevated adiposity, increased leptin and signs of insulin resistance. 1356 proteins were identified and 348 quantified while 127 metabolites were quantified. The restricted hypothalamus showed down-regulation of 36 proteins and 5 metabolites and up-regulation of 21 proteins and 9 metabolites. Integrated pathway analysis of the proteomics and metabolomics data indicated impairment of hypothalamic glucose metabolism, increased flux through the hexosamine pathway, deregulation of TCA cycle and the respiratory chain, and alterations in glutathione metabolism. The data suggest IUGR modulation of energy metabolism and redox homeostasis in the hypothalamus of male adult rats. The present results indicated deleterious consequences of IUGR on hypothalamic pathways involved in pivotal physiological functions. These results provide guidance for future mechanistic studies assessing the role of intrauterine malnutrition in the development of metabolic diseases later in life.

Metabolic profiling indicates impaired pyruvate dehydrogenase function in myalgic encephalopathy/chronic fatigue syndrome

PubMed Central

Mella, Olav; Bruland, Ove; Risa, Kristin; Dyrstad, Sissel E.; Alme, Kine; Rekeland, Ingrid G.; Sapkota, Dipak; Røsland, Gro V.; Fosså, Alexander; Ktoridou-Valen, Irini; Lunde, Sigrid; Sørland, Kari; Lien, Katarina; Herder, Ingrid; Thürmer, Hanne; Gotaas, Merete E.; Baranowska, Katarzyna A.; Bohnen, Louis M.L.J.; Schäfer, Christoph; McCann, Adrian; Sommerfelt, Kristian; Helgeland, Lars; Ueland, Per M.; Dahl, Olav

2016-01-01

Myalgic encephalopathy/chronic fatigue syndrome (ME/CFS) is a debilitating disease of unknown etiology, with hallmark symptoms including postexertional malaise and poor recovery. Metabolic dysfunction is a plausible contributing factor. We hypothesized that changes in serum amino acids may disclose specific defects in energy metabolism in ME/CFS. Analysis in 200 ME/CFS patients and 102 healthy individuals showed a specific reduction of amino acids that fuel oxidative metabolism via the TCA cycle, mainly in female ME/CFS patients. Serum 3-methylhistidine, a marker of endogenous protein catabolism, was significantly increased in male patients. The amino acid pattern suggested functional impairment of pyruvate dehydrogenase (PDH), supported by increased mRNA expression of the inhibitory PDH kinases 1, 2, and 4; sirtuin 4; and PPARδ in peripheral blood mononuclear cells from both sexes. Myoblasts grown in presence of serum from patients with severe ME/CFS showed metabolic adaptations, including increased mitochondrial respiration and excessive lactate secretion. The amino acid changes could not be explained by symptom severity, disease duration, age, BMI, or physical activity level among patients. These findings are in agreement with the clinical disease presentation of ME/CFS, with inadequate ATP generation by oxidative phosphorylation and excessive lactate generation upon exertion. PMID:28018972

Metaproteomics Provides Functional Insight into Activated Sludge Wastewater Treatment

PubMed Central

Wilmes, Paul; Wexler, Margaret; Bond, Philip L.

2008-01-01

Background Through identification of highly expressed proteins from a mixed culture activated sludge system this study provides functional evidence of microbial transformations important for enhanced biological phosphorus removal (EBPR). Methodology/Principal Findings A laboratory-scale sequencing batch reactor was successfully operated for different levels of EBPR, removing around 25, 40 and 55 mg/l P. The microbial communities were dominated by the uncultured polyphosphate-accumulating organism “Candidatus Accumulibacter phosphatis”. When EBPR failed, the sludge was dominated by tetrad-forming α-Proteobacteria. Representative and reproducible 2D gel protein separations were obtained for all sludge samples. 638 protein spots were matched across gels generated from the phosphate removing sludges. 111 of these were excised and 46 proteins were identified using recently available sludge metagenomic sequences. Many of these closely match proteins from “Candidatus Accumulibacter phosphatis” and could be directly linked to the EBPR process. They included enzymes involved in energy generation, polyhydroxyalkanoate synthesis, glycolysis, gluconeogenesis, glycogen synthesis, glyoxylate/TCA cycle, fatty acid β oxidation, fatty acid synthesis and phosphate transport. Several proteins involved in cellular stress response were detected. Conclusions/Significance Importantly, this study provides direct evidence linking the metabolic activities of “Accumulibacter” to the chemical transformations observed in EBPR. Finally, the results are discussed in relation to current EBPR metabolic models. PMID:18392150

Glycation inhibits trichloroacetic acid (TCA)-induced whey protein precipitation

USDA-ARS?s Scientific Manuscript database

Four different WPI saccharide conjugates were successfully prepared to test whether glycation could inhibit WPI precipitation induced by trichloroacetic acid (TCA). Conjugates molecular weights after glycation were analyzed with SDS-PAGE. No significant secondary structure change due to glycation wa...

IRIS Toxicological Review of Trichloroacetic Acid (TCA) (External Review Draft)

EPA Science Inventory

EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database.

Design of an AdvancedTCA board management controller (IPMC)

NASA Astrophysics Data System (ADS)

Mendez, J.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.

2017-03-01

The AdvancedTCA (ATCA) standard has been selected as the hardware platform for the upgrade of the back-end electronics of the CMS and ATLAS experiments of the Large Hadron Collider (LHC) . In this context, the electronic systems for experiments group at CERN is running a project to evaluate, specify, design and support xTCA equipment. As part of this project, an Intelligent Platform Management Controller (IPMC) for ATCA blades, based on a commercial solution, has been designed to be used on existing and future ATCA blades. This paper reports on the status of this project presenting the hardware and software developments.

Oxidation of the odorous compound 2,4,6-trichloroanisole by UV activated persulfate: Kinetics, products, and pathways.

PubMed

Luo, Congwei; Jiang, Jin; Ma, Jun; Pang, Suyan; Liu, Yongze; Song, Yang; Guan, Chaoting; Li, Juan; Jin, Yixin; Wu, Daoji

2016-06-01

The transformation efficiency and products of an odorous compound 2,4,6-trichloroanisole (TCA) at the wavelength of 254 nm in the presence of persulfate were investigated for the first time. The effects of water matrix (i.e., natural organic matter (NOM), pH, carbonate/bicarbonate (HCO3(-)/CO3(2-)), and chloride ions (Cl(-))) were evaluated. The second order rate constant of TCA reacting with sulfate radical (SO4(-)) was determined to be (3.72 ± 0.10) × 10(9) M(-1) s(-1). Increasing dosage of persulfate increased the observed pseudo-first-order rate constant for TCA degradation (kobs), and the contribution of SO4(-) to TCA degradation was much higher than that of HO at each experimental condition. Degradation rate of TCA decreased with pH increasing from 4.0 to 9.0, which could be explained by the lower radical scavenging effect of dihydrogen phosphate than hydrogen phosphate in acidic condition (pH < 6). NOM significantly decreased kobs due to the effects of radical scavenging and UV absorption with the former one being dominant. kobs decreased from 2.32 × 10(-3) s(-1) to 0.92 × 10(-3) s(-1) with the CO3(2-)/HCO3(-) concentration increased from 0.5 mM to 10 mM in the UV/persulfate process, while kobs slightly decreased from 2.54 × 10(-3) s(-1) in the absence of Cl(-) to 2.10 × 10(-3) s(-1) in the presence of 10 mM Cl(-). Most of these kinetic results could be described by a steady-state kinetic model. Furthermore, liquid chromatography/electrospray ionization-triple quadrupole mass spectrometry at powerful precursor ion scan approach was used to selectively detect oxidation products of TCA. It was found that 2,4,6-trichorophenol (TCP) was the major oxidation product (i.e., the initial yield of TCP was above 90%). The second order rate constant between TCP and SO4(-) was estimated to be (4.16 ± 0.20) × 10(9) M(-1) s(-1). In addition, three products (i.e., 2,6-dichloro-1,4-benzoquinone and two aromatic ring-opening products) were detected in the reaction of TCP with SO4(-), which also appeared in the oxidation of TCA in the UV/persulfate process. A tentative pathway was proposed, where the initial one-electron oxidation of TCA by SO4(-) and further reactions (e.g., ipso-hydroxylation and aromatic ring-cleavage) of the formed cation intermediate TCA were involved. Copyright © 2016. Published by Elsevier Ltd.

Succinyl-proteome profiling of Dendrobium officinale, an important traditional Chinese orchid herb, revealed involvement of succinylation in the glycolysis pathway.

PubMed

Feng, Shangguo; Jiao, Kaili; Guo, Hong; Jiang, Mengyi; Hao, Juan; Wang, Huizhong; Shen, Chenjia

2017-08-10

Lysine succinylation is a ubiquitous and important protein post-translational modification in various eukaryotic and prokaryotic cells. However, its functions in Dendrobium officinale, an important traditional Chinese orchid herb with high polysaccharide contents, are largely unknown. In our study, LC-MS/MS was used to identify the peptides that were enriched by immune-purification with a high-efficiency succinyl-lysine antibody. In total, 314 lysine succinylation sites in 207 proteins were identified. A gene ontology analysis showed that these proteins are associated with a wide range of cellular functions, from metabolic processes to stimuli responses. Moreover, two types of conserved succinylation motifs, '***K suc ******K**' and '****EK suc ***', were identified. Our data showed that lysine succinylation occurred on five key enzymes in the glycolysis pathway. The numbers of average succinylation sites on these five enzymes in plants were lower than those in bacteria and mammals. Interestingly, two active site amino acids residues, K103 and K225, could be succinylated in fructose-bisphosphate aldolase, indicating a potential function of lysine succinylation in the regulation of glycolytic enzyme activities. Furthermore, the protein-protein interaction network for the succinylated proteins showed that several functional terms, such as glycolysis, TCA cycle, oxidative phosphorylation and ribosome, are consisted. Our results provide the first comprehensive view of the succinylome of D. officinale and may accelerate future biological investigations of succinylation in the synthesis of polysaccharides, which are major active ingredients.

Potential Inhibitors for Isocitrate Lyase of Mycobacterium tuberculosis and Non-M. tuberculosis: A Summary

PubMed Central

Lee, Yie-Vern; Wahab, Habibah A.

2015-01-01

Isocitrate lyase (ICL) is the first enzyme involved in glyoxylate cycle. Many plants and microorganisms are relying on glyoxylate cycle enzymes to survive upon downregulation of tricarboxylic acid cycle (TCA cycle), especially Mycobacterium tuberculosis (MTB). In fact, ICL is a potential drug target for MTB in dormancy. With the urge for new antitubercular drug to overcome tuberculosis treat such as multidrug resistant strain and HIV-coinfection, the pace of drug discovery has to be increased. There are many approaches to discovering potential inhibitor for MTB ICL and we hereby review the updated list of them. The potential inhibitors can be either a natural compound or synthetic compound. Moreover, these compounds are not necessary to be discovered only from MTB ICL, as it can also be discovered by a non-MTB ICL. Our review is categorized into four sections, namely, (a) MTB ICL with natural compounds; (b) MTB ICL with synthetic compounds; (c) non-MTB ICL with natural compounds; and (d) non-MTB ICL with synthetic compounds. Each of the approaches is capable of overcoming different challenges of inhibitor discovery. We hope that this paper will benefit the discovery of better inhibitor for ICL. PMID:25649791

Assessment of refractive astigmatism and simulated therapeutic refractive surgery strategies in coma-like-aberrations-dominant corneal optics.

PubMed

Zhou, Wen; Stojanovic, Aleksandar; Utheim, Tor Paaske

2016-01-01

The aim of the study is to raise the awareness of the influence of coma-like higher-order aberrations (HOAs) on power and orientation of refractive astigmatism (RA) and to explore how to account for that influence in the planning of topography-guided refractive surgery in eyes with coma-like-aberrations-dominant corneal optics. Eleven eyes with coma-like-aberrations-dominant corneal optics and with low lenticular astigmatism (LA) were selected for astigmatism analysis and for treatment simulations with topography-guided custom ablation. Vector analysis was used to evaluate the contribution of coma-like corneal HOAs to RA. Two different strategies were used for simulated treatments aiming to regularize irregular corneal optics: With both strategies correction of anterior corneal surface irregularities (corneal HOAs) were intended. Correction of total corneal astigmatism (TCA) and RA was intended as well with strategies 1 and 2, respectively. Axis of discrepant astigmatism (RA minus TCA minus LA) correlated strongly with axis of coma. Vertical coma influenced RA by canceling the effect of the with-the-rule astigmatism and increasing the effect of the against-the-rule astigmatism. After simulated correction of anterior corneal HOAs along with TCA and RA (strategies 1 and 2), only a small amount of anterior corneal astigmatism (ACA) and no TCA remained after strategy 1, while considerable amount of ACA and TCA remained after strategy 2. Coma-like corneal aberrations seem to contribute a considerable astigmatic component to RA in eyes with coma-like-aberrations dominant corneal optics. If topography-guided ablation is programmed to correct the corneal HOAs and RA, the astigmatic component caused by the coma-like corneal HOAs will be treated twice and will result in induced astigmatism. Disregarding RA and treating TCA along with the corneal HOAs is recommended instead.

Unstructured Grid Euler Method Assessment for Longitudinal and Lateral/Directional Aerodynamic Performance Analysis of the HSR Technology Concept Airplane at Supersonic Cruise Speed

NASA Technical Reports Server (NTRS)

Ghaffari, Farhad

1999-01-01

Unstructured grid Euler computations, performed at supersonic cruise speed, are presented for a High Speed Civil Transport (HSCT) configuration, designated as the Technology Concept Airplane (TCA) within the High Speed Research (HSR) Program. The numerical results are obtained for the complete TCA cruise configuration which includes the wing, fuselage, empennage, diverters, and flow through nacelles at M (sub infinity) = 2.4 for a range of angles-of-attack and sideslip. Although all the present computations are performed for the complete TCA configuration, appropriate assumptions derived from the fundamental supersonic aerodynamic principles have been made to extract aerodynamic predictions to complement the experimental data obtained from a 1.675%-scaled truncated (aft fuselage/empennage components removed) TCA model. The validity of the computational results, derived from the latter assumptions, are thoroughly addressed and discussed in detail. The computed surface and off-surface flow characteristics are analyzed and the pressure coefficient contours on the wing lower surface are shown to correlate reasonably well with the available pressure sensitive paint results, particularly, for the complex flow structures around the nacelles. The predicted longitudinal and lateral/directional performance characteristics for the truncated TCA configuration are shown to correlate very well with the corresponding wind-tunnel data across the examined range of angles-of-attack and sideslip. The complementary computational results for the longitudinal and lateral/directional performance characteristics for the complete TCA configuration are also presented along with the aerodynamic effects due to empennage components. Results are also presented to assess the computational method performance, solution sensitivity to grid refinement, and solution convergence characteristics.

Brown Pine Leaf Extract and Its Active Component Trans-Communic Acid Inhibit UVB-Induced MMP-1 Expression by Targeting PI3K

PubMed Central

Park, Gaeun; Lim, Tae-gyu; Kwon, Jung Yeon; Song, Da Som; Jeong, Eun Hee; Lee, Charles C.; Son, Joe Eun; Seo, Sang Gwon; Lee, Eunjung; Kim, Jong Rhan; Lee, Chang Yong; Park, Jun Seong; Lee, Ki Won

2015-01-01

Japanese red pine (Pinus densiflora) is widely present in China, Japan, and Korea. Its green pine leaves have traditionally been used as a food as well as a coloring agent. After being shed, pine leaves change their color from green to brown within two years, and although the brown pine leaves are abundantly available, their value has not been closely assessed. In this study, we investigated the potential anti-photoaging properties of brown pine leaves for skin. Brown pine leaf extract (BPLE) inhibited UVB-induced matrix metalloproteinase-1 (MMP-1) expression to a greater extent than pine leaf extract (PLE) in human keratinocytes and a human skin equivalent model. HPLC analysis revealed that the quantity of trans-communic acid (TCA) and dehydroabietic acid (DAA) significantly increases when the pine leaf color changes from green to brown. BPLE and TCA elicited reductions in UVB-induced MMP-1 mRNA expression and activator protein-1 (AP-1) transactivation by reducing DNA binding activity of phospho-c-Jun, c-fos and Fra-1. BPLE and TCA also inhibited UVB-induced Akt phosphorylation, but not mitogen activated protein kinase (MAPK), known regulators of AP-1 transactivation. We additionally found that BPLE and TCA inhibited phosphoinositide 3-kinase (PI3K), the upstream kinase of Akt, in vitro. In summary, both BPLE and its active component TCA exhibit protective effects against UVB-induced skin aging. Taken together, these findings underline the potential for BPLE and TCA to be utilized as anti-wrinkling agents and cosmetic ingredients, as they suppress UVB-induced MMP-1 expression. PMID:26066652

Tricyclic antidepressant poisoning: an evidence-based consensus guideline for out-of-hospital management.

PubMed

Woolf, Alan D; Erdman, Andrew R; Nelson, Lewis S; Caravati, E Martin; Cobaugh, Daniel J; Booze, Lisa L; Wax, Paul M; Manoguerra, Anthony S; Scharman, Elizabeth J; Olson, Kent R; Chyka, Peter A; Christianson, Gwenn; Troutman, William G

2007-01-01

A review of U.S. poison center data for 2004 showed over 12,000 exposures to tricyclic antidepressants (TCAs). A guideline that determines the conditions for emergency department referral and prehospital care could potentially optimize patient outcome, avoid unnecessary emergency department visits, reduce healthcare costs, and reduce life disruption for patients and caregivers. An evidence-based expert consensus process was used to create the guideline. Relevant articles were abstracted by a trained physician researcher. The first draft of the guideline was created by the lead author. The entire panel discussed and refined the guideline before distribution to secondary reviewers for comment. The panel then made changes based on the secondary review comments. The objective of this guideline is to assist poison center personnel in the appropriate prehospital triage and management of patients with suspected ingestions of TCAs by 1) describing the manner in which an ingestion of a TCA might be managed, 2) identifying the key decision elements in managing cases of TCA ingestion, 3) providing clear and practical recommendations that reflect the current state of knowledge, and 4) identifying needs for research. This guideline applies to ingestion of TCAs alone. Co-ingestion of additional substances could require different referral and management recommendations depending on their combined toxicities. This guideline is based on the assessment of current scientific and clinical information. The panel recognizes that specific patient care decisions may be at variance with this guideline and are the prerogative of the patient and the health professionals providing care, considering all the circumstances involved. This guideline does not substitute for clinical judgment. Recommendations are in chronological order of likely clinical use. The grade of recommendation is in parentheses. 1) Patients with suspected self-harm or who are the victims of malicious administration of a TCA should be referred to an emergency department immediately (Grade D). 2) Patients with acute TCA ingestions who are less than 6 years of age and other patients without evidence of self-harm should have further evaluation including standard history taking and determination of the presence of co-ingestants (especially other psychopharmaceutical agents) and underlying exacerbating conditions, such as convulsions or cardiac arrhythmias. Ingestion of a TCA in combination with other drugs might warrant referral to an emergency department. The ingestion of a TCA by a patient with significant underlying cardiovascular or neurological disease should cause referral to an emergency department at a lower dose than for other individuals. Because of the potential severity of TCA poisoning, transportation by EMS, with close monitoring of clinical status and vital signs en route, should be considered (Grade D). 3) Patients who are symptomatic (e.g., weak, drowsy, dizzy, tremulous, palpitations) after a TCA ingestion should be referred to an emergency department (Grade B). 4) Ingestion of either of the following amounts (whichever is lower) would warrant consideration of referral to an emergency department: an amount that exceeds the usual maximum single therapeutic dose or an amount equal to or greater than the lowest reported toxic dose. For all TCAs except desipramine, nortriptyline, trimipramine, and protriptyline, this dose is >5 mg/kg. For despiramine it is >2.5 mg/kg; for nortriptyline it is >2.5 mg/kg; for trimipramine it is >2.5 mg/kg; and for protriptyline it is >1 mg/kg. This recommendation applies to both patients who are naïve to the specific TCA and to patients currently taking cyclic antidepressants who take extra doses, in which case the extra doses should be added to the daily dose taken and then compared to the threshold dose for referral to an emergency department (Grades B/C). 5) Do not induce emesis (Grade D). 6) The risk-to-benefit ratio of prehospital activated charcoal for gastrointestinal decontamination in TCA poisoning is unknown. Prehospital activated charcoal administration, if available, should only be carried out by health professionals and only if no contraindications are present. Do not delay transportation in order to administer activated charcoal (Grades B/D). 7) For unintentional poisonings, asymptomatic patients are unlikely to develop symptoms if the interval between the ingestion and the initial call to a poison center is greater than 6 hours. These patients do not need referral to an emergency department facility (Grade C). 8) Follow-up calls to determine the outcome for a TCA ingestions ideally should be made within 4 hours of the initial call to a poison center and then at appropriate intervals thereafter based on the clinical judgment of the poison center staff (Grade D). 9) An ECG or rhythm strip, if available, should be checked during the prehospital assessment of a TCA overdose patient. A wide-complex arrhythmia with a QRS duration longer than 100 msec is an indicator that the patient should be immediately stabilized, given sodium bicarbonate if there is a protocol for its use, and transported to an emergency department (Grade B). 10) Symptomatic patients with TCA poisoning might require prehospital interventions, such as intravenous fluids, cardiovascular agents, and respiratory support, in accordance with standard ACLS guidelines (Grade D). 11) Administration of sodium bicarbonate might be beneficial for patients with severe or life-threatening TCA toxicity if there is a prehospital protocol for its use (Grades B/D). 12) For TCA-associated convulsions, benzodiazepines are recommended (Grade D). 13) Flumazenil is not recommended for patients with TCA poisoning (Grade D).

Loss of Mitochondrial Pyruvate Carrier 2 in the Liver Leads to Defects in Gluconeogenesis and Compensation via Pyruvate-Alanine Cycling.

PubMed

McCommis, Kyle S; Chen, Zhouji; Fu, Xiaorong; McDonald, William G; Colca, Jerry R; Kletzien, Rolf F; Burgess, Shawn C; Finck, Brian N

2015-10-06

Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite for gluconeogenesis in hepatocytes, which is important for the maintenance of normoglycemia during prolonged food deprivation but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2(-/-)) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte conversion of labeled pyruvate to TCA cycle intermediates and glucose. Unbiased metabolomic analyses of livers from fasted LS-Mpc2(-/-) mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for the loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2(-/-) hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. Copyright © 2015 Elsevier Inc. All rights reserved.

Loss of Mitochondrial Pyruvate Carrier 2 in Liver Leads to Defects in Gluconeogenesis and Compensation via Pyruvate-Alanine Cycling

PubMed Central

McCommis, Kyle S.; Chen, Zhouji; Fu, Xiaorong; McDonald, William G.; Colca, Jerry R.; Kletzien, Rolf F.; Burgess, Shawn C.; Finck, Brian N.

2015-01-01

SUMMARY Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite step for gluconeogenesis in hepatocytes, which is important for maintenance of normoglycemia during prolonged food deprivation, but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2−/−) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte pyruvate metabolism, labelled pyruvate conversion to TCA cycle intermediates and glucose, and glucose production from pyruvate. Unbiased metabolomic analyses of livers from fasted LS-Mpc2−/− mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2−/− hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. PMID:26344101

GENOTOXICITY STUDIES OF SODIUM DICHLOROACETATE AND SODIUM TRICHLOROACETATE

EPA Science Inventory

The genotoxic properties of sodium dichloroacetate (DCA) and sodium trichloroacetate (TCA)were evaluated in several short-term in vitro and in vivo assays. Neither compound was mutagenic in tester strain TA102 in the Salmonella mutagenicity assay. Both DCA and TCA were weak induc...

Infrared thermal imaging of the inner canthus of the eye as an estimator of body core temperature.

PubMed

Teunissen, L P J; Daanen, H A M

2011-01-01

Several studies suggest that the temperature of the inner canthus of the eye (T(ca)), determined with infrared thermal imaging, is an appropriate method for core temperature estimation in mass screening of fever. However, these studies used the error prone tympanic temperature as a reference. Therefore, we compared T(ca) to oesophageal temperature (T(es)) as gold standard in 10 subjects during four conditions: rest, exercise, recovery and passive heating. T(ca) and T(es) differed significantly during all conditions (mean ΔT(es) - T(ca) 1.80 ± 0.89°C) and their relationship was inconsistent between conditions. Also within the rest condition alone, intersubject variability was too large for a reliable estimation of core temperature. This poses doubts on the use of T(ca) as a technique for core temperature estimation, although generalization of these results to fever detection should be verified experimentally using febrile patients.

Age estimation using tooth cementum annulation.

PubMed

Wittwer-Backofen, Ursula

2012-01-01

In Forensic Anthropology age diagnosis of unidentified bodies significantly helps in the identification process. Among the set of established aging methods in anthropology tooth cementum annulation (TCA) is increasingly used due to its narrow error range which can reach 5 years of age in adult individuals at best. The rhythm of cementum appositions of seasonally different density provides a principal mechanism on which TCA is based. Using histological preparation techniques for hard tissues, transversal tooth root sections are produced which can be analyzed in transmitted light microscopy. Even though no standard TCA preparation protocol exists, several methodological validation studies recommend specific treatments depending on individual conditions of the teeth. Individual age is estimated by adding mean tooth eruption age to the number of microscopically detected dark layers which are separated by bright layers and stand for 1 year of age each. To assure a high reliability of the method, TCA age diagnosis has to be based on several teeth of one individual if possible and needs to be supported by different techniques in forensic cases.

Variations in iron and calcium abundances during solar flares

NASA Astrophysics Data System (ADS)

Antonucci, E.; Martin, R.

1995-07-01

Evidence for variations in iron and calcium abundances during the impulsive phase of solar flares has been obtained by analyzing the Ca XIX and Fe XXV spectra, detected with the Bent Crystal Spectrometer of the Solar Maximum Mission. The plasma thermal conditions have been investigated by considering different temperature indicators: namely, the temperatures TCa and TFe, derived from the intensity ratios of the dielectronic recombination satellites to the resonance line, and the temperature TCaFe, calculated from the ratio of the resonance lines of Ca XIX and Fe XXV, which is also depending on the Fe/Ca abundance ratio. The observed values of TCa and TFe can be ascribed to the specific characteristics of the plasma therma distribution, the corresponding values of TCaFe can be explained by allowing also for variations in the Fe/Ca abundance ratio relative to the photospheric ratio by a factor within 0.2 and 2.4. According to the observed abundance variations, the events analyzed can be divided in Ca-rich and Fe-rich flares.

Influence of chemical peeling on the skin stress response system.

PubMed

Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

2012-07-01

Skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC)-derived peptides, such as adrenocorticotropic hormone (ACTH), a-melanocyte-stimulating hormone (MSH) and b-endorphin that are locally generated in response to locally provided stressors or proinflammatory cytokines. This system would restrict tissue damage and restore local homoeostasis. Trichloroacetic acid (TCA) is one of the most widely used peeling agents and applied for cosmetic treatment of photodamaged skin. However, the biological mechanism responsible for TCA peeling has yet to be fully determined. While our investigation focused on the inflammation and wound healing pathways, in the recent study, we have examined involvement of the SSRS as the third pathway. Mostly depending on our findings that TCA peeling activates the SSRS by inducing the POMC expression of keratinocytes in the CRH-independent manner, together with the results reported by other researchers, we can say that the biological effect of POMC seems to be responsible for the TCA-induced epidermal SSRS activation. © 2012 John Wiley & Sons A/S.

Three coordination polymers based on a star-like geometry 4, 4', 4'' -nitrilotribenzoic acid ligand and their framework dependent luminescent properties

NASA Astrophysics Data System (ADS)

Hu, Zhiyong; Zhao, Meng; Su, Jian; Xu, Shasha; Hu, Lei; Liu, Hui; Zhang, Qiong; Zhang, Jun; Wu, Jieying; Tian, Yupeng

2018-02-01

Three novel coordination polymers, [Zn(μ2-HTCA)(Phen)]n (1), {[Cd(μ3-HTCA)(Phen)]·2H2O}n (2), [Mn(μ2-HTCA)(Phen)(H2O)]n (3) were prepared by hydrothermal synthesis from the 4, 4', 4''-nitrilotribenzoicacid (H3TCA) and 1, 10-phenanthroline monohydrate (Phen) with different transition metal salts, which were characterized by elemental analysis, IR spectra, powder and single-crystal X-ray diffraction and thermogravimetric analysis. The photophysical properties of the complexes were investigated by solid-state diffuse reflectance spectra, photoluminescent properties, lifetime and quantum yield. For these complexes, it was found that the band gaps follow the order: 3 ＜ 2 ＜ 1 ＜ 2.80 eV, fluorescence intensity order: 1 ＞ H3TCA ＞ 2 ＞ 3; quantum yield order: H3TCA ＞ 1 ＞ 2 ＞ 3; while the lifetime order: 1 ＞ 2 ＞ H3TCA ＞ 3.

Acidosis induces reprogramming of cellular metabolism to mitigate oxidative stress

PubMed Central

2013-01-01

Background A variety of oncogenic and environmental factors alter tumor metabolism to serve the distinct cellular biosynthetic and bioenergetic needs present during oncogenesis. Extracellular acidosis is a common microenvironmental stress in solid tumors, but little is known about its metabolic influence, particularly when present in the absence of hypoxia. In order to characterize the extent of tumor cell metabolic adaptations to acidosis, we employed stable isotope tracers to examine how acidosis impacts glucose, glutamine, and palmitate metabolism in breast cancer cells exposed to extracellular acidosis. Results Acidosis increased both glutaminolysis and fatty acid β-oxidation, which contribute metabolic intermediates to drive the tricarboxylic acid cycle (TCA cycle) and ATP generation. Acidosis also led to a decoupling of glutaminolysis and novel glutathione (GSH) synthesis by repressing GCLC/GCLM expression. We further found that acidosis redirects glucose away from lactate production and towards the oxidative branch of the pentose phosphate pathway (PPP). These changes all serve to increase nicotinamide adenine dinucleotide phosphate (NADPH) production and counter the increase in reactive oxygen species (ROS) present under acidosis. The reduced novel GSH synthesis under acidosis may explain the increased demand for NADPH to recycle existing pools of GSH. Interestingly, acidosis also disconnected novel ribose synthesis from the oxidative PPP, seemingly to reroute PPP metabolites to the TCA cycle. Finally, we found that acidosis activates p53, which contributes to both the enhanced PPP and increased glutaminolysis, at least in part, through the induction of G6PD and GLS2 genes. Conclusions Acidosis alters the cellular metabolism of several major metabolites, which induces a significant degree of metabolic inflexibility. Cells exposed to acidosis largely rely upon mitochondrial metabolism for energy generation to the extent that metabolic intermediates are redirected away from several other critical metabolic processes, including ribose and glutathione synthesis. These alterations lead to both a decrease in cellular proliferation and increased sensitivity to ROS. Collectively, these data reveal a role for p53 in cellular metabolic reprogramming under acidosis, in order to permit increased bioenergetic capacity and ROS neutralization. Understanding the metabolic adaptations that cancer cells make under acidosis may present opportunities to generate anti-tumor therapeutic agents that are more tumor-specific. PMID:24359630

Lack of formic acid production in rat hepatocytes and human renal proximal tubule cells exposed to chloral hydrate or trichloroacetic acid

PubMed Central

Lock, Edward A; Reed, Celia J; McMillan, JoEllyn M; Oatis, John R; Schnellmann, Rick G

2007-01-01

The industrial solvent trichloroethylene (TCE) and its major metabolites have been shown to cause formic aciduria in male rats. We have examined whether chloral hydrate (CH) and trichloroacetic acid (TCA), known metabolites of TCE, produce an increase in formic acid in vitro in cultures of rat hepatocytes or human renal proximal tubule cells (HRPTC). The metabolism and cytotoxicity of CH was also examined to establish that the cells were metabolically active and not compromised by toxicity. Rat hepatocytes and HRPTC were cultured in serum-free medium and then treated with 0.3–3mM CH for 3 days or 0.03–3mM CH for 10 days respectively and formic acid production, metabolism to trichloroethanol (TCE-OH) and TCA and cytotoxicity determined. No increase in formic acid production in rat hepatocytes or HRPTC exposed to CH was observed over and above that due to chemical degradation, neither was formic acid production observed in rat hepatocytes exposed to TCA. HRPTC metabolised CH to TCE-OH and TCA with a 12-fold greater capacity to form TCE-OH versus TCA. Rat hepatocytes exhibited a 1.6-fold and 3-fold greater capacity than HRPTC to form TCE-OH and TCA respectively. CH and TCA were not cytotoxic to rat hepatocytes at concentrations up to 3mM/day for 3 days. With HRPTC, one sample showed no cytotoxicity to CH at concentrations up to 3mM/day for 10 days, while in another cytotoxicity was seen at 1mM/day for 3 days. In summary, increased formic acid production was not observed in rat hepatocytes or HRPTC exposed to TCE metabolites, suggesting that the in vivo response cannot be modelled in vitro. CH was toxic to HRPTC at millimolar concentrations/day over 10 days, while glutathione derived metabolites of TCE were toxic at micromolar concentrations/day over 10 days (Lock et al., 2006) supporting the view that glutathione derived metabolites are likely to be responsible for nephrotoxicity. PMID:17161896

The Contribution of Peroxisome Proliferator-Activated Receptor Alpha to the Relationship Between Toxicokinetics and Toxicodynamics of Trichloroethylene

PubMed Central

Yoo, Hong Sik; Cichocki, Joseph A.; Kim, Sungkyoon; Venkatratnam, Abhishek; Iwata, Yasuhiro; Kosyk, Oksana; Bodnar, Wanda; Sweet, Stephen; Knap, Anthony; Wade, Terry; Campbell, Jerry; Clewell, Harvey J.; Melnyk, Stepan B.; Chiu, Weihsueh A.; Rusyn, Ivan

2015-01-01

Exposure to the ubiquitous environmental contaminant trichloroethylene (TCE) is associated with cancer and non-cancer toxicity in both humans and rodents. Peroxisome proliferator-activated receptor-alpha (PPARα) is thought to be playing a role in liver toxicity in rodents through activation of the receptor by the TCE metabolite trichloroacetic acid (TCA). However, most studies using genetically altered mice have not assessed the potential for PPARα to alter TCE toxicokinetics, which may lead to differences in TCA internal doses and hence confound inferences as to the role of PPARα in TCE toxicity. To address this gap, male and female wild type (129S1/SvImJ), Pparα-null, and humanized PPARα (hPPARα) mice were exposed intragastrically to 400 mg/kg TCE in single-dose (2, 5 and 12 h) and repeat-dose (5 days/week, 4 weeks) studies. Interestingly, following either a single- or repeat-dose exposure to TCE, levels of TCA in liver and kidney were lower in Pparα-null and hPPARα mice as compared with those in wild type mice. Levels of trichloroethanol (TCOH) were similar in all strains. TCE-exposed male mice consistently had higher levels of TCA and TCOH in all tissues compared with females. Additionally, in both single- and repeat-dose studies, a similar degree of induction of PPARα-responsive genes was observed in liver and kidney of hPPARα and wild type mice, despite the difference in hepatic and renal TCA levels. Additional sex- and strain-dependent effects were observed in the liver, including hepatocyte proliferation and oxidative stress, which were not dependent on TCA or TCOH levels. These data demonstrate that PPARα status affects the levels of the putative PPARα agonist TCA following TCE exposure. Therefore, interpretations of studies using Pparα-null and hPPARα mice need to consider the potential contribution of genotype-dependent toxicokinetics to observed differences in toxicity, rather than attributing such differences only to receptor-mediated toxicodynamic effects. PMID:26136231

The Contribution of Peroxisome Proliferator-Activated Receptor Alpha to the Relationship Between Toxicokinetics and Toxicodynamics of Trichloroethylene.

PubMed

Yoo, Hong Sik; Cichocki, Joseph A; Kim, Sungkyoon; Venkatratnam, Abhishek; Iwata, Yasuhiro; Kosyk, Oksana; Bodnar, Wanda; Sweet, Stephen; Knap, Anthony; Wade, Terry; Campbell, Jerry; Clewell, Harvey J; Melnyk, Stepan B; Chiu, Weihsueh A; Rusyn, Ivan

2015-10-01

Exposure to the ubiquitous environmental contaminant trichloroethylene (TCE) is associated with cancer and non-cancer toxicity in both humans and rodents. Peroxisome proliferator-activated receptor-alpha (PPARα) is thought to be playing a role in liver toxicity in rodents through activation of the receptor by the TCE metabolite trichloroacetic acid (TCA). However, most studies using genetically altered mice have not assessed the potential for PPARα to alter TCE toxicokinetics, which may lead to differences in TCA internal doses and hence confound inferences as to the role of PPARα in TCE toxicity. To address this gap, male and female wild type (129S1/SvImJ), Pparα-null, and humanized PPARα (hPPARα) mice were exposed intragastrically to 400 mg/kg TCE in single-dose (2, 5 and 12 h) and repeat-dose (5 days/week, 4 weeks) studies. Interestingly, following either a single- or repeat-dose exposure to TCE, levels of TCA in liver and kidney were lower in Pparα-null and hPPARα mice as compared with those in wild type mice. Levels of trichloroethanol (TCOH) were similar in all strains. TCE-exposed male mice consistently had higher levels of TCA and TCOH in all tissues compared with females. Additionally, in both single- and repeat-dose studies, a similar degree of induction of PPARα-responsive genes was observed in liver and kidney of hPPARα and wild type mice, despite the difference in hepatic and renal TCA levels. Additional sex- and strain-dependent effects were observed in the liver, including hepatocyte proliferation and oxidative stress, which were not dependent on TCA or TCOH levels. These data demonstrate that PPARα status affects the levels of the putative PPARα agonist TCA following TCE exposure. Therefore, interpretations of studies using Pparα-null and hPPARα mice need to consider the potential contribution of genotype-dependent toxicokinetics to observed differences in toxicity, rather than attributing such differences only to receptor-mediated toxicodynamic effects. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Comparison of efficacy of chemical peeling with 25% trichloroacetic acid and 0.1% retinoic acid for facial rejuvenation.

PubMed

Yildirim, Selda; Gurel, Mehmet Salih; Gungor, Sule; Tekeli, Omur; Canat, Dilek

2016-06-01

Skin aging is a problem which negatively affects the psyche of the person, social relations, as well as work life and health and which compels the patients to find appropriate treatment methods. Numerous treatment methods have been developed in order to delay aging and to reduce the aging effects in addition to having a younger, healthier and more beautiful facial appearance. To compare the efficiency, cosmetic results and possible adverse effects of the peeling treatment with 25% trichloroacetic acid (TCA) and 0.1% retinoic acid for facial rejuvenation in patients presenting with skin aging. Fifty female patients in total presenting with medium and advanced degree skin aging were subject to this study. Two separate treatment groups were formed; the first group underwent chemical skin treatment with 25% TCA while the other group was applied with 0.1% retinoic acid treatment. Following the 4 months' treatment the patients were controlled three times in total for post lesional hypopigmentation, hyperpigmentation, scars, skin irritation and other possible changes per month. The pretreatment and first follow-up visit, and final control images were comparatively evaluated by three observers via specific software. The healing rates of the group subject to retinoic acid were statistically higher (p < 0.05) compared to patients in the TCA group in the final follow-up visit following the treatment according to the first and second observers. On the other hand, according to the third observer, patients applied with retinoic acid presented with higher healing rates compared to those treated with TCA, however; this rate was not statistically significant (p > 0.05). The frequency of TCA- and retinoic acid-associated adverse effects was similar in both groups (p > 0.05). As a result of both treatments, a reduction in the quality of life scores as well as a pronounced recovery (p = 0.001) in the quality of life of those patients with skin aging was observed. The photo aging treatment option with 0.1% retinoic acid is cheaper and more feasible for patients compared to 25% TCA, and it is also as reliable and effective as TCA.

Comparison of efficacy of chemical peeling with 25% trichloroacetic acid and 0.1% retinoic acid for facial rejuvenation

PubMed Central

Gurel, Mehmet Salih; Gungor, Sule; Tekeli, Omur; Canat, Dilek

2016-01-01

Introduction Skin aging is a problem which negatively affects the psyche of the person, social relations, as well as work life and health and which compels the patients to find appropriate treatment methods. Numerous treatment methods have been developed in order to delay aging and to reduce the aging effects in addition to having a younger, healthier and more beautiful facial appearance. Aim To compare the efficiency, cosmetic results and possible adverse effects of the peeling treatment with 25% trichloroacetic acid (TCA) and 0.1% retinoic acid for facial rejuvenation in patients presenting with skin aging. Material and methods Fifty female patients in total presenting with medium and advanced degree skin aging were subject to this study. Two separate treatment groups were formed; the first group underwent chemical skin treatment with 25% TCA while the other group was applied with 0.1% retinoic acid treatment. Following the 4 months’ treatment the patients were controlled three times in total for post lesional hypopigmentation, hyperpigmentation, scars, skin irritation and other possible changes per month. The pretreatment and first follow-up visit, and final control images were comparatively evaluated by three observers via specific software. Results The healing rates of the group subject to retinoic acid were statistically higher (p < 0.05) compared to patients in the TCA group in the final follow-up visit following the treatment according to the first and second observers. On the other hand, according to the third observer, patients applied with retinoic acid presented with higher healing rates compared to those treated with TCA, however; this rate was not statistically significant (p > 0.05). The frequency of TCA- and retinoic acid-associated adverse effects was similar in both groups (p > 0.05). As a result of both treatments, a reduction in the quality of life scores as well as a pronounced recovery (p = 0.001) in the quality of life of those patients with skin aging was observed. Conclusions The photo aging treatment option with 0.1% retinoic acid is cheaper and more feasible for patients compared to 25% TCA, and it is also as reliable and effective as TCA. PMID:27512355

Use of dual carbon-chlorine isotope analysis to assess the degradation pathways of 1,1,1-trichloroethane in groundwater.

PubMed

Palau, Jordi; Jamin, Pierre; Badin, Alice; Vanhecke, Nicolas; Haerens, Bruno; Brouyère, Serge; Hunkeler, Daniel

2016-04-01

Compound-specific isotope analysis (CSIA) is a powerful tool to track contaminant fate in groundwater. However, the application of CSIA to chlorinated ethanes has received little attention so far. These compounds are toxic and prevalent groundwater contaminants of environmental concern. The high susceptibility of chlorinated ethanes like 1,1,1-trichloroethane (1,1,1-TCA) to be transformed via different competing pathways (biotic and abiotic) complicates the assessment of their fate in the subsurface. In this study, the use of a dual C-Cl isotope approach to identify the active degradation pathways of 1,1,1-TCA is evaluated for the first time in an aerobic aquifer impacted by 1,1,1-TCA and trichloroethylene (TCE) with concentrations of up to 20 mg/L and 3.4 mg/L, respectively. The reaction-specific dual carbon-chlorine (C-Cl) isotope trends determined in a recent laboratory study illustrated the potential of a dual isotope approach to identify contaminant degradation pathways of 1,1,1-TCA. Compared to the dual isotope slopes (Δδ(13)C/Δδ(37)Cl) previously determined in the laboratory for dehydrohalogenation/hydrolysis (DH/HY, 0.33 ± 0.04) and oxidation by persulfate (∞), the slope determined from field samples (0.6 ± 0.2, r(2) = 0.75) is closer to the one observed for DH/HY, pointing to DH/HY as the predominant degradation pathway of 1,1,1-TCA in the aquifer. The observed deviation could be explained by a minor contribution of additional degradation processes. This result, along with the little degradation of TCE determined from isotope measurements, confirmed that 1,1,1-TCA is the main source of the 1,1-dichlorethylene (1,1-DCE) detected in the aquifer with concentrations of up to 10 mg/L. This study demonstrates that a dual C-Cl isotope approach can strongly improve the qualitative and quantitative assessment of 1,1,1-TCA degradation processes in the field. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cork Taint of Wines: Role of the Filamentous Fungi Isolated from Cork in the Formation of 2,4,6-Trichloroanisole by O Methylation of 2,4,6-Trichlorophenol

PubMed Central

Álvarez-Rodríguez, María Luisa; López-Ocaña, Laura; López-Coronado, José Miguel; Rodríguez, Enrique; Martínez, María Jesús; Larriba, Germán; Coque, Juan-José R.

2002-01-01

Cork taint is a musty or moldy off-odor in wine mainly caused by 2,4,6-trichloroanisole (2,4,6-TCA). We examined the role of 14 fungal strains isolated from cork samples in the production of 2,4,6-TCA by O methylation of 2,4,6-trichlorophenol (2,4,6-TCP). The fungal strains isolated belong to the genera Penicillium (four isolates); Trichoderma (two isolates); and Acremonium, Chrysonilia, Cladosporium, Fusarium, Mortierella, Mucor, Paecilomyces, and Verticillium (one isolate each). Eleven of these strains could produce 2,4,6-TCA when they were grown directly on cork in the presence of 2,4,6-TCP. The highest levels of bioconversion were carried out by the Trichoderma and Fusarium strains. One strain of Trichoderma longibrachiatum could also efficiently produce 2,4,6-TCA in liquid medium. However, no detectable levels of 2,4,6-TCA production by this strain could be detected on cork when putative precursors other than 2,4,6-TCP, including several anisoles, dichlorophenols, trichlorophenols, or other highly chlorinated compounds, were tested. Time course expression studies with liquid cultures showed that the formation of 2,4,6-TCA was not affected by a high concentration of glucose (2% or 111 mM) or by ammonium salts at concentrations up to 60 mM. In T. longibrachiatum the O methylation of 2,4,6-TCP was catalyzed by a mycelium-associated S-adenosyl-l-methionine (SAM)-dependent methyltransferase that was strongly induced by 2,4,6-TCP. The reaction was inhibited by S-adenosyl-l-homocysteine, an inhibitor of SAM-dependent methylation, suggesting that SAM is the natural methyl donor. These findings increase our understanding of the mechanism underlying the origin of 2,4,6-TCA on cork, which is poorly understood despite its great economic importance for the wine industry, and they could also help us improve our knowledge about the biodegradation and detoxification processes associated with chlorinated phenols. PMID:12450804

Estimation of microbial metabolism and co-occurrence patterns in fracture groundwaters of deep crystalline bedrock at Olkiluoto, Finland

NASA Astrophysics Data System (ADS)

Bomberg, M.; Lamminmäki, T.; Itävaara, M.

2015-08-01

The microbial diversity in oligotrophic isolated crystalline Fennoscandian Shield bedrock fracture groundwaters is great but the core community has not been identified. Here we characterized the bacterial and archaeal communities in 12 water conductive fractures situated at depths between 296 and 798 m by high throughput amplicon sequencing using the Illumina HiSeq platform. The great sequencing depth revealed that up to 95 and 99 % of the bacterial and archaeal communities, respectively, were composed of only a few common species, i.e. the core microbiome. However, the remaining rare microbiome contained over 3 and 6 fold more bacterial and archaeal taxa. Several clusters of co-occurring rare taxa were identified, which correlated significantly with physicochemical parameters, such as salinity, concentration of inorganic or organic carbon, sulphur, pH and depth. The metabolic properties of the microbial communities were predicted using PICRUSt. The rough prediction showed that the metabolic pathways included commonly fermentation, fatty acid oxidation, glycolysis/gluconeogenesis, oxidative phosphorylation and methanogenesis/anaerobic methane oxidation, but carbon fixation through the Calvin cycle, reductive TCA cycle and the Wood-Ljungdahl pathway was also predicted. The rare microbiome is an unlimited source of genomic functionality in all ecosystems. It may consist of remnants of microbial communities prevailing in earlier conditions on Earth, but could also be induced again if changes in their living conditions occur. In this study only the rare taxa correlated with any physicochemical parameters. Thus these microorganisms can respond to environmental change caused by physical or biological factors that may lead to alterations in the diversity and function of the microbial communities in crystalline bedrock environments.

Identification and Characterization of Ovarian Carcinoma Peptide Epitopes Recognized by Cytotoxic T Lymphocytes

DTIC Science & Technology

2007-11-01

CCA CAG TGC CCC AGG TTA GAA CGG TCA GCA GAA TAG-2a 62 528 AGC GGC GGG CTG AAG GA GAG GGT AGG GTG GTC ATT GTG TCA TAG-2b 62 401 AGC GGC GGG CTG AAG...GGT AGG GTG GTC ATT GTG TCA TAG-2b 62 401 AGC GGC GGG CTG AAG GAC TC CAG CAC AAC AGG AAC ATT CAG TGG TAB-2c 62 536 AGC GGC GGG CTG AAG GA GGG GGA TTT...Makrigiannakis A, Gray H, Schlienger K, Liebman MN, Rubin SC, Coukos G (2003) Intratumoral T cells, recurrence, and survival in epithelial ovarian

IRIS Toxicological Review of Trichloroacetic Acid (TCA) (Interagency Science Discussion Draft)

EPA Science Inventory

EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development ...

Extraction-less, rapid assay for the direct detection of 2,4,6-trichloroanisole (TCA) in cork samples.

PubMed

Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon

2014-07-01

2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.

Dynamics and regulation of glycolysis-tricarboxylic acid metabolism in the midgut of Spodoptera litura during metamorphosis.

PubMed

Hu, D; Luo, W; Fan, L F; Liu, F L; Gu, J; Deng, H M; Zhang, C; Huang, L H; Feng, Q L

2016-04-01

Significant changes usually take place in the internal metabolism of insects during metamorphosis. The glycolysis-tricarboxylic acid (glycolysis-TCA) pathway is important for energy metabolism. To elucidate its dynamics, the mRNA levels of genes involved in this pathway were examined in the midgut of Spodoptera litura during metamorphosis, and the pyruvate content was quantified. The expression patterns of these genes in response to starvation were examined, and the interaction between protein phosphatase 1 (PP1) and phosphofructokinase (PFK) was studied. The results revealed that the expression or activities of most glycolytic enzymes was down-regulated in prepupae and then recovered in some degree in pupae, and all TCA-related genes were remarkably suppressed in both the prepupae and pupae. Pyruvate was enriched in the pupal midgut. Taken together, these results suggest that insects decrease both glycolysis and TCA in prepupae to save energy and then up-regulate glycolysis but down-regulate TCA in pupae to increase the supply of intermediates for construction of new organs. The expression of all these genes were down-regulated by starvation, indicating that non-feeding during metamorphosis may be a regulator of glycolysis-TCA pathway in the midgut. Importantly, interaction between PP1 and PFK was identified and is suggested to be involved in the regulation of glycolysis. © 2015 The Royal Entomological Society.

Development of the tongue coating analyzer based on concave grating monochrometer and virtual instrument

NASA Astrophysics Data System (ADS)

Ren, Zhong; Liu, Guodong; Zeng, Lvming; Huang, Zhen; Zeng, Wenping

2010-10-01

The tongue coating diagnosis is an important part in tongue diagnosis of traditional Chinese medicine (TCM).The change of the thickness and color of the tongue coating can reflect the pathological state for the patient. By observing the tongue coating, a Chinese doctor can determine the nature or severity of disease. Because some limitations existed in the tongue diagnosis method of TCM and the method based on the digital image processing, a novel tongue coating analyzer(TCA) based on the concave grating monochrometer and virtual instrument is developed in this paper. This analyzer consists of the light source system, check cavity, optical fiber probe, concave grating monochrometer, spectrum detector system based on CCD and data acquisition (DAQ) card, signal processing circuit system, computer and data analysis software based on LabVIEW, etc. Experimental results show that the novel TCA's spectral range can reach 300-1000 nm, its wavelength resolution can reach 1nm, and this TCA uses the back-split-light technology and multi-channel parallel analysis. Compared with the TCA based on the image processing technology, this TCA has many advantages, such as, compact volume, simpler algorithm, faster processing speed, higher accuracy, cheaper cost and real-time handle data and display the result, etc. Therefore, it has the greatly potential values in the fields of the tongue coating diagnosis for TCM.

Comparative Study of the Use of Trichloroacetic Acid and Phenolic Acid in the Treatment of Atrophic-Type Acne Scars.

PubMed

Dalpizzol, Mariana; Weber, Magda B; Mattiazzi, Anna Paula F; Manzoni, Ana Paula D

2016-03-01

Many therapies involving varying degrees of complexity have been used to treat acne scars, but none is considered the gold standard treatment. A comparative evaluation of 88% phenol and 90% trichloroacetic acid (TCA) applied using the chemical reconstruction of skin scars (CROSS) technique. A nonrandomized, single-blinded self-controlled clinical trial was conducted among patients with ice pick-type and boxcar-type atrophic acne scars. Using 88% phenol on the left hemiface and 90% TCA on the right hemiface was adopted as the standard practice of the CROSS technique. The dermatological quality of life index (DLQI) questionnaire, acne scar grading scale Échelle d´Evaluation Clinique des Cicatrices d'Acne (ECCA), and evaluation of improvement were performed pretreatment and post-treatment. Regarding ECCA, significant differences were found in pretreatment and post-treatment (p < .001). Regarding tolerance to pain, it was found that the discomfort felt with 90% TCA was significantly less than that felt with 88% phenol (p = .020). Regarding the quality of life measured with the DLQI, the results showed that the mean score in post-treatment assessment was significantly lower than that in the pretreatment assessment (p < .05). Hypochromia and enlargement scar were only seen after the use of 90% TCA. This study confirmed the efficacy of both TCA and phenol for treating such scars, with less severe complications from the use of phenol.

Methane utilization in Methylomicrobium alcaliphilum 20Z R: a systems approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akberdin, Ilya R.; Thompson, Merlin; Hamilton, Richard

Biological methane utilization, one of the main sinks of the greenhouse gas in nature, represents an attractive platform for production of fuels and value-added chemicals. Despite the progress made in our understanding of the individual parts of methane utilization, our knowledge of how the whole-cell metabolic network is organized and coordinated is limited. Attractive growth and methane-conversion rates, a complete and expert-annotated genome sequence, as well as large enzymatic, 13C-labeling, and transcriptomic datasets make Methylomicrobium alcaliphilum 20Z R an exceptional model system for investigating methane utilization networks. Here we present a comprehensive metabolic framework of methane and methanol utilization inmore » M. alcaliphilum 20Z R. A set of novel metabolic reactions governing carbon distribution across central pathways in methanotrophic bacteria was predicted by in-silico simulations and confirmed by global non-targeted metabolomics and enzymatic evidences. Our data highlight the importance of substitution of ATP-linked steps with PPi-dependent reactions and support the presence of a carbon shunt from acetyl-CoA to the pentose-phosphate pathway and highly branched TCA cycle. The diverged TCA reactions promote balance between anabolic reactions and redox demands. As a result, the computational framework of C 1-metabolism in methanotrophic bacteria can represent an efficient tool for metabolic engineering or ecosystem modeling.« less

Methane utilization in Methylomicrobium alcaliphilum 20Z R: a systems approach

DOE PAGES

Akberdin, Ilya R.; Thompson, Merlin; Hamilton, Richard; ...

2018-02-06

Biological methane utilization, one of the main sinks of the greenhouse gas in nature, represents an attractive platform for production of fuels and value-added chemicals. Despite the progress made in our understanding of the individual parts of methane utilization, our knowledge of how the whole-cell metabolic network is organized and coordinated is limited. Attractive growth and methane-conversion rates, a complete and expert-annotated genome sequence, as well as large enzymatic, 13C-labeling, and transcriptomic datasets make Methylomicrobium alcaliphilum 20Z R an exceptional model system for investigating methane utilization networks. Here we present a comprehensive metabolic framework of methane and methanol utilization inmore » M. alcaliphilum 20Z R. A set of novel metabolic reactions governing carbon distribution across central pathways in methanotrophic bacteria was predicted by in-silico simulations and confirmed by global non-targeted metabolomics and enzymatic evidences. Our data highlight the importance of substitution of ATP-linked steps with PPi-dependent reactions and support the presence of a carbon shunt from acetyl-CoA to the pentose-phosphate pathway and highly branched TCA cycle. The diverged TCA reactions promote balance between anabolic reactions and redox demands. As a result, the computational framework of C 1-metabolism in methanotrophic bacteria can represent an efficient tool for metabolic engineering or ecosystem modeling.« less

First Comparative Analysis of the Community Structures and Carbon Metabolic Pathways of the Bacteria Associated with Alvinocaris longirostris in a Hydrothermal Vent of Okinawa Trough.

PubMed

Sun, Qing-Lei; Zeng, Zhi-Gang; Chen, Shuai; Sun, Li

2016-01-01

Alvinocaris longirostris is a species of shrimp existing in the hydrothermal fields of Okinawa Trough. To date the structure and function of the microbial community associated with A. longirostris are essentially unknown. In this study, by employment of the techniques of high through-put sequencing and clone library construction and analysis, we compared for the first time the community structures and metabolic profiles of microbes associated with the gill and gut of A. longirostris in a hydrothermal field of Okinawa Trough. Fourteen phyla were detected in the gill and gut communities, of which 11 phyla were shared by both tissues. Proteobacteria made up a substantial proportion in both tissues, while Firmicutes was abundant only in gut. Although gill and gut communities were similar in bacterial diversities, the bacterial community structures in these two tissues were significantly different. Further, we discovered for the first time the existence in the gill and gut communities of A. longirostris the genes (cbbM and aclB) encoding the key enzymes of Calvin-Benson-Bassham (CBB) cycle and the reductive tricarboxylic acid (rTCA) cycle, and that both cbbM and aclB were significantly more abundant in gill than in gut. Taken together, these results provide the first evidence that at least two carbon fixation pathways are present in both the gill and the gut communities of A. longirostris, and that the communities in different tissues likely differ in autotrophic productivity.

The contribution of ketone bodies to basal and activity-dependent neuronal oxidation in vivo

PubMed Central

Chowdhury, Golam MI; Jiang, Lihong; Rothman, Douglas L; Behar, Kevin L

2014-01-01

The capacity of ketone bodies to replace glucose in support of neuronal function is unresolved. Here, we determined the contributions of glucose and ketone bodies to neocortical oxidative metabolism over a large range of brain activity in rats fasted 36 hours and infused intravenously with [2,4-13C2]-D-β-hydroxybutyrate (BHB). Three animal groups and conditions were studied: awake ex vivo, pentobarbital-induced isoelectricity ex vivo, and halothane-anesthetized in vivo, the latter data reanalyzed from a recent study. Rates of neuronal acetyl-CoA oxidation from ketone bodies (VacCoA-kbN) and pyruvate (VpdhN), and the glutamate-glutamine cycle (Vcyc) were determined by metabolic modeling of 13C label trapped in major brain amino acid pools. VacCoA-kbN increased gradually with increasing activity, as compared with the steeper change in tricarboxylic acid (TCA) cycle rate (VtcaN), supporting a decreasing percentage of neuronal ketone oxidation: ∼100% (isoelectricity), 56% (halothane anesthesia), 36% (awake) with the BHB plasma levels achieved in our experiments (6 to 13 mM). In awake animals ketone oxidation reached saturation for blood levels >17 mM, accounting for 62% of neuronal substrate oxidation, the remainder (38%) provided by glucose. We conclude that ketone bodies present at sufficient concentration to saturate metabolism provides full support of basal (housekeeping) energy needs and up to approximately half of the activity-dependent oxidative needs of neurons. PMID:24780902

Changes in the Functional Potential of Diverse and Active Bacterial Communities in Arctic Deep-Sea Sediments along a Water Depth Gradient

NASA Astrophysics Data System (ADS)

Rapp, J. Z.; Bienhold, C.; Offre, P.; Boetius, A.

2016-02-01

The deep sea covers approximately 70% of the Earth's surface and the majority of its seafloor is composed of fine-grained sediments. Bacteria are the dominant organisms in these sediments, accounting for up to 90% of total benthic biomass. Although benthic bacterial communities are assumed to play a central role in biogeochemical cycling at the seafloor, we still have very limited knowledge of their diversity, activity and ecological functions. We sampled Arctic deep-sea surface sediments from seven stations along a gradient from 1000 m to 5500 m water depth at the long-term ecological research station HAUSGARTEN in Fram Strait. Bacterial cell numbers decreased with depth from 3.8*108 to 1.3*108 cells per ml sediment. Illumina 16S rRNA gene surveys based on DNA and cDNA revealed substantial shifts in the structure of the total and active bacterial community along this gradient, which could be linked to environmental parameters, especially organic matter availability. The functional potential and actual activity of microbial communities was investigated using meta-genomic and -transcriptomic sequencing of four representative samples. Reconstruction of 16S rRNA genes from metagenomic data indicated a stronger contribution of certain groups at 1200-2500 m depth (e.g. OM190, Planctomycetacia, Betaproteobacteria) as compared to 3500-5500 m depth (e.g. SAR202 clade, Subgroup 22, Cytophagia). Analysis of orthologous gene clusters and protein families suggested that the genetic potential of microbial communities at the deepest station varied from that of communities at shallower depth, with higher representation of genes involved in the TCA cycle and in the biosynthesis of fatty acids, amino acids and vitamin biosynthesis at the deepest station. The observed variations may result from the accumulation of organic matter at the deepest station caused by the funnel-like topography at this site. The research contributes to European Research Council Advanced Investigator grant no. 294757.

Carbon isotope fractionation of 1,1,1-trichloroethane during base-catalyzed persulfate treatment.

PubMed

Marchesi, Massimo; Thomson, Neil R; Aravena, Ramon; Sra, Kanwartej S; Otero, Neus; Soler, Albert

2013-09-15

The extent of carbon isotope fractionation during degradation of 1,1,1-trichloroethane (1,1,1-TCA) by a base-catalyzed persulfate (S₂O₈(2-)) treatment system was investigated. Significant destruction of 1,1,1-TCA was observed at a pH of ∼12. An increase in the NaOH:S₂O₈(2-) molar ratio from 0.2:1 to 8:1 enhanced the reaction rate of 1,1,1-TCA by a factor of ∼5 to yield complete (>99.9%) destruction. An average carbon isotope enrichment fractionation factor which was independent of the NaOH:S₂O₈(2-) molar ratio of -7.0 ± 0.2‰ was obtained. This significant carbon isotope fractionation and the lack of dependence on changes in the NaOH:S₂O₈(2-) molar ratio demonstrates that carbon isotope analysis can potentially be used in situ as a performance assessment tool to estimate the degradation effectiveness of 1,1,1-TCA by a base-catalyzed persulfate system. Copyright © 2013 Elsevier B.V. All rights reserved.

Absence of Complex I Is Associated with Diminished Respiratory Chain Function in European Mistletoe.

PubMed

Maclean, Andrew E; Hertle, Alexander P; Ligas, Joanna; Bock, Ralph; Balk, Janneke; Meyer, Etienne H

2018-05-21

Parasitism is a life history strategy found across all domains of life whereby nutrition is obtained from a host. It is often associated with reductive evolution of the genome, including loss of genes from the organellar genomes [1, 2]. In some unicellular parasites, the mitochondrial genome (mitogenome) has been lost entirely, with far-reaching consequences for the physiology of the organism [3, 4]. Recently, mitogenome sequences of several species of the hemiparasitic plant mistletoe (Viscum sp.) have been reported [5, 6], revealing a striking loss of genes not seen in any other multicellular eukaryotes. In particular, the nad genes encoding subunits of respiratory complex I are all absent and other protein-coding genes are also lost or highly diverged in sequence, raising the question what remains of the respiratory complexes and mitochondrial functions. Here we show that oxidative phosphorylation (OXPHOS) in European mistletoe, Viscum album, is highly diminished. Complex I activity and protein subunits of complex I could not be detected. The levels of complex IV and ATP synthase were at least 5-fold lower than in the non-parasitic model plant Arabidopsis thaliana, whereas alternative dehydrogenases and oxidases were higher in abundance. Carbon flux analysis indicates that cytosolic reactions including glycolysis are greater contributors to ATP synthesis than the mitochondrial tricarboxylic acid (TCA) cycle. Our results describe the extreme adjustments in mitochondrial functions of the first reported multicellular eukaryote without complex I. Copyright © 2018 Elsevier Ltd. All rights reserved.

Uropathogenic Escherichia coli Metabolite-Dependent Quiescence and Persistence May Explain Antibiotic Tolerance during Urinary Tract Infection

PubMed Central

Leatham-Jensen, Mary P.; Mokszycki, Matthew E.; Rowley, David C.; Deering, Robert; Camberg, Jodi L.; Sokurenko, Evgeni V.; Tchesnokova, Veronika L.; Frimodt-Møller, Jakob; Leth Nielsen, Karen; Sun, Gongqin

2016-01-01

ABSTRACT In the present study, it is shown that although Escherichia coli CFT073, a human uropathogenic (UPEC) strain, grows in liquid glucose M9 minimal medium, it fails to grow on glucose M9 minimal medium agar plates seeded with ≤106 CFU. The cells on glucose plates appear to be in a “quiescent” state that can be prevented by various combinations of lysine, methionine, and tyrosine. Moreover, the quiescent state is characteristic of ~80% of E. coli phylogenetic group B2 multilocus sequence type 73 strains, as well as 22.5% of randomly selected UPEC strains isolated from community-acquired urinary tract infections in Denmark. In addition, E. coli CFT073 quiescence is not limited to glucose but occurs on agar plates containing a number of other sugars and acetate as sole carbon sources. It is also shown that a number of E. coli CFT073 mini-Tn5 metabolic mutants (gnd, gdhA, pykF, sdhA, and zwf) are nonquiescent on glucose M9 minimal agar plates and that quiescence requires a complete oxidative tricarboxylic acid (TCA) cycle. In addition, evidence is presented that, although E. coli CFT073 quiescence and persistence in the presence of ampicillin are alike in that both require a complete oxidative TCA cycle and each can be prevented by amino acids, E. coli CFT073 quiescence occurs in the presence or absence of a functional rpoS gene, whereas maximal persistence requires a nonfunctional rpoS. Our results suggest that interventions targeting specific central metabolic pathways may mitigate UPEC infections by interfering with quiescence and persistence. IMPORTANCE Recurrent urinary tract infections (UTIs) affect 10 to 40% of women. In up to 77% of those cases, the recurrent infections are caused by the same uropathogenic E. coli (UPEC) strain that caused the initial infection. Upon infection of urothelial transitional cells in the bladder, UPEC appear to enter a nongrowing quiescent intracellular state that is thought to serve as a reservoir responsible for recurrent UTIs. Here, we report that many UPEC strains enter a quiescent state when ≤106 CFU are seeded on glucose M9 minimal medium agar plates and show that mutations in several genes involved in central carbon metabolism prevent quiescence, as well as persistence, possibly identifying metabolic pathways involved in UPEC quiescence and persistence in vivo. PMID:27303698

Effects of carbonate species on the kinetics of dechlorination of 1,1,1-trichloroethane by zero-valent iron.

PubMed

Agrawal, Abinash; Ferguson, William J; Gardner, Bruce O; Christ, John A; Bandstra, Joel Z; Tratnyek, Paul G

2002-10-15

The effect of precipitates on the reactivity of iron metal (Fe0) with 1,1,1-trichloroethane (TCA) was studied in batch systems designed to model groundwaters that contain dissolved carbonate species (i.e., C(IV)). At representative concentrations for high-C(IV) groundwaters (approximately 10(-2) M), the pH in batch reactors containing Fe0 was effectively buffered until most of the aqueous C(IV) precipitated. The precipitate was mainly FeCO3 (siderite) but may also have included some carbonate green rust. Exposure of the Fe0 to dissolved C(IV) accelerated reduction of TCA, and the products formed under these conditions consisted mainly of ethane and ethene, with minor amounts of several butenes. The kinetics of TCA reduction were first-order when C(IV)-enhanced corrosion predominated but showed mixed-order kinetics (zero- and first-order) in experiments performed with passivated Fe0 (i.e., before the onset of pitting corrosion and after repassivation by precipitation of FeCO3). All these data were described by fitting a Michaelis-Menten-type kinetic model and approximating the first-order rate constant as the ratio of the maximum reaction rate (Vm) and the concentration of TCA at half of the maximum rate (K(1/2)). The decrease in Vm/K(1/2) with increasing C(IV) exposure time was fit to a heuristic model assuming proportionality between changes in TCA reduction rate and changes in surface coverage with FeCO3.

Kinetic characterization of bile salt transport by human NTCP (SLC10A1).

PubMed

Jani, Márton; Beéry, Erzsébet; Heslop, Teresa; Tóth, Beáta; Jagota, Bhavana; Kis, Emese; Kevin Park, B; Krajcsi, Peter; Weaver, Richard J

2018-02-01

The transport of bile acids facilitated by NTCP is an important factor in establishing bile flow. In this study, we examine the kinetics associated with human NTCP-dependent transport of two quantitatively important bile acids comprising the human bile acid pool, chenodeoxycholic acid and glycine-chenodeoxycholate, and secondary bile salt, 3-sulfo-glycolithocholate of potential toxicological significance. The study employed human NTCP overexpressing Chinese Hamster Ovary cells and results compared with taurocholate, a prototypical bile salt commonly used in transporter studies. GCDC and 3S-GLC but not CDCA were transported by NTCP. The efficient uptake of GCDC, TCA and 3S-GLC by NTCP enabled the determination of kinetics. GCDC displayed a lower K M (0.569±0.318μM) than TCA (6.44±3.83μM) and 3S-GLC (3.78±1.17μM). The apparent CL int value for GCDC was 20-fold greater (153±53μl/mg protein/min) than the apparent CL int for TCA (6.92±4.72μl/mg protein/min) and apparent CL int for 3S-GLC (8.05±1.33μl/mg protein/min). These kinetic results provide important complementary data on the substrate selectivity and specificity of NTCP to transport bile acids. NTCP transports GCDC with greater efficiency than TCA and has the same efficacy for 3S-GLC and TCA. Copyright © 2017. Published by Elsevier Ltd.

Localized Glaucomatous Change Detection within the Proper Orthogonal Decomposition Framework

PubMed Central

Balasubramanian, Madhusudhanan; Kriegman, David J.; Bowd, Christopher; Holst, Michael; Weinreb, Robert N.; Sample, Pamela A.; Zangwill, Linda M.

2012-01-01

Purpose. To detect localized glaucomatous structural changes using proper orthogonal decomposition (POD) framework with false-positive control that minimizes confirmatory follow-ups, and to compare the results to topographic change analysis (TCA). Methods. We included 167 participants (246 eyes) with ≥4 Heidelberg Retina Tomograph (HRT)-II exams from the Diagnostic Innovations in Glaucoma Study; 36 eyes progressed by stereo-photographs or visual fields. All other patient eyes (n = 210) were non-progressing. Specificities were evaluated using 21 normal eyes. Significance of change at each HRT superpixel between each follow-up and its nearest baseline (obtained using POD) was estimated using mixed-effects ANOVA. Locations with significant reduction in retinal height (red pixels) were determined using Bonferroni, Lehmann-Romano k-family-wise error rate (k-FWER), and Benjamini-Hochberg false discovery rate (FDR) type I error control procedures. Observed positive rate (OPR) in each follow-up was calculated as a ratio of number of red pixels within disk to disk size. Progression by POD was defined as one or more follow-ups with OPR greater than the anticipated false-positive rate. TCA was evaluated using the recently proposed liberal, moderate, and conservative progression criteria. Results. Sensitivity in progressors, specificity in normals, and specificity in non-progressors, respectively, were POD-Bonferroni = 100%, 0%, and 0%; POD k-FWER = 78%, 86%, and 43%; POD-FDR = 78%, 86%, and 43%; POD k-FWER with retinal height change ≥50 μm = 61%, 95%, and 60%; TCA-liberal = 86%, 62%, and 21%; TCA-moderate = 53%, 100%, and 70%; and TCA-conservative = 17%, 100%, and 84%. Conclusions. With a stronger control of type I errors, k-FWER in POD framework minimized confirmatory follow-ups while providing diagnostic accuracy comparable to TCA. Thus, POD with k-FWER shows promise to reduce the number of confirmatory follow-ups required for clinical care and studies evaluating new glaucoma treatments. (ClinicalTrials.gov number, NCT00221897.) PMID:22491406

miR-203 inhibits cell proliferation and promotes cisplatin induced cell death in tongue squamous cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Jiong; Lin, Yao; Fan, Li

Oral squamous cell carcinoma (OSCC) is one of the most common types of the head and neck cancer. Chemo resistance of OSCC has been identified as a substantial therapeutic hurdle. In this study, we analyzed the role of miR-203 in the OSCC and its effects on cisplatin-induced cell death in an OSCC cell line, Tca8113. There was a significant decrease of miR-203 expression in OSCC samples, compared with the adjacent normal, non-cancerous tissue. After 3 days cisplatin treatment, the survived Tca8113 cells had a lower expression of miR-203 than that in the untreated control group. In contrast, PIK3CA showed an inversemore » expression in cancer and cisplatin survived Tca8113 cells. Transfection of Tca8113 cells with miR-203 mimics greatly reduced PIK3CA expression and Akt activation. Furthermore, miR-203 repressed PIK3CA expression through targeting the 3′UTR. Restoration of miR-203 not only suppressed cell proliferation, but also sensitized cells to cisplatin induced cell apoptosis. This effect was absent in cells that were simultaneously treated with PIK3CA RNAi. In summary, these findings suggest miR-203 plays an important role in cisplatin resistance in OSCC, and furthermore delivery of miR-203 analogs may serve as an adjuvant therapy for OSCC. - Highlights: • Much lower miR-203 expression in cisplatin resistant Tca8113 cells is discovered. • Delivery of miR-203 can sensitize the Tca8113 cells to cisplatin induced cell death. • MiR-203 can downregulate PIK3CA through the 3′UTR. • The effects of miR-203 on cisplatin sensitivity is mainly through PIK3CA pathway.« less