Disruption of TCA Cycle and Glutamate Metabolism Identified by Metabolomics in an In Vitro Model of Amyotrophic Lateral Sclerosis.

PubMed

Veyrat-Durebex, Charlotte; Corcia, Philippe; Piver, Eric; Devos, David; Dangoumau, Audrey; Gouel, Flore; Vourc'h, Patrick; Emond, Patrick; Laumonnier, Frédéric; Nadal-Desbarats, Lydie; Gordon, Paul H; Andres, Christian R; Blasco, Hélène

2016-12-01

This study aims to develop a cellular metabolomics model that reproduces the pathophysiological conditions found in amyotrophic lateral sclerosis in order to improve knowledge of disease physiology. We used a co-culture model combining the motor neuron-like cell line NSC-34 and the astrocyte clone C8-D1A, with each over-expressing wild-type or G93C mutant human SOD1, to examine amyotrophic lateral sclerosis (ALS) physiology. We focused on the effects of mutant human SOD1 as well as oxidative stress induced by menadione on intracellular metabolism using a metabolomics approach through gas chromatography coupled with mass spectrometry (GC-MS) analysis. Preliminary non-supervised analysis by Principal Component Analysis (PCA) revealed that cell type, genetic environment, and time of culture influenced the metabolomics profiles. Supervised analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) on data from intracellular metabolomics profiles of SOD1 G93C co-cultures produced metabolites involved in glutamate metabolism and the tricarboxylic acid cycle (TCA) cycle. This study revealed the feasibility of using a metabolomics approach in a cellular model of ALS. We identified potential disruption of the TCA cycle and glutamate metabolism under oxidative stress, which is consistent with prior research in the disease. Analysis of metabolic alterations in an in vitro model is a novel approach to investigation of disease physiology.

TCA High Lift Preliminary Assessment

NASA Technical Reports Server (NTRS)

Wyatt, G. H.; Polito, R. C.; Yeh, D. T.; Elzey, M. E.; Tran, J. T.; Meredith, Paul T.

1999-01-01

This paper presents a TCA (Technology Concept Airplane) High lift Preliminary Assessment. The topics discussed are: 1) Model Description; 2) Data Repeatability; 3) Effect of Inboard L.E. (Leading Edge) Flap Span; 4) Comparison of 14'x22' TCA-1 With NTF (National Transonic Facility) Modified Ref. H; 5) Comparison of 14'x22' and NTF Ref. H Results; 6) Effect of Outboard Sealed Slat on TCA; 7) TCA Full Scale Build-ups; 8) Full Scale L/D Comparisons; 9) TCA Full Scale; and 10) Touchdown Lift Curves. This paper is in viewgraph form.

TCA precipitation.

PubMed

Koontz, Laura

2014-01-01

Trichloroacetic acid (TCA) precipitation of proteins is commonly used to concentrate protein samples or remove contaminants, including salts and detergents, prior to downstream applications such as SDS-PAGE or 2D-gels. TCA precipitation denatures the protein, so it should not be used if the protein must remain in its folded state (e.g., if you want to measure a biochemical activity of the protein). © 2014 Elsevier Inc. All rights reserved.

Index markers of chronic fatigue syndrome with dysfunction of TCA and urea cycles

PubMed Central

Yamano, Emi; Sugimoto, Masahiro; Hirayama, Akiyoshi; Kume, Satoshi; Yamato, Masanori; Jin, Guanghua; Tajima, Seiki; Goda, Nobuhito; Iwai, Kazuhiro; Fukuda, Sanae; Yamaguti, Kouzi; Kuratsune, Hirohiko; Soga, Tomoyoshi; Watanabe, Yasuyoshi; Kataoka, Yosky

2016-01-01

Chronic fatigue syndrome (CFS) is a persistent and unexplained pathological state characterized by exertional and severely debilitating fatigue, with/without infectious or neuropsychiatric symptoms, lasting at least 6 consecutive months. Its pathogenesis remains incompletely understood. Here, we performed comprehensive metabolomic analyses of 133 plasma samples obtained from CFS patients and healthy controls to establish an objective diagnosis of CFS. CFS patients exhibited significant differences in intermediate metabolite concentrations in the tricarboxylic acid (TCA) and urea cycles. The combination of ornithine/citrulline and pyruvate/isocitrate ratios discriminated CFS patients from healthy controls, yielding area under the receiver operating characteristic curve values of 0.801 (95% confidential interval [CI]: 0.711–0.890, P < 0.0001) and 0.750 (95% CI: 0.584–0.916, P = 0.0069) for training (n = 93) and validation (n = 40) datasets, respectively. These findings provide compelling evidence that a clinical diagnostic tool could be developed for CFS based on the ratios of metabolites in plasma. PMID:27725700

Excessive Hepatic Mitochondrial TCA Cycle and Gluconeogenesis in Humans with Nonalcoholic Fatty Liver Disease

PubMed Central

Sunny, Nishanth E.; Parks, Elizabeth J.; Browning, Jeffrey D.; Burgess, Shawn C.

2013-01-01

Summary Approximately one-third of the U.S. population has nonalcoholic fatty liver disease (NAFLD), a condition closely associated with insulin resistance and increased risk of liver injury. Dysregulated mitochondrial metabolism is central in these disorders, but the manner and degree of dysregulation are disputed. This study tested whether humans with NAFLD have abnormal in vivo hepatic mitochondrial metabolism. Subjects with low (3.0%) and high (17%) intrahepatic triglyceride (IHTG) were studied using 2H and 13C tracers to evaluate systemic lipolysis, hepatic glucose production, and mitochondrial pathways (TCA cycle, anaplerosis, and ketogenesis). Individuals with NAFLD had 50% higher rates of lipolysis and 30% higher rates of gluconeogenesis. There was a positive correlation between IHTG content and both mitochondrial oxidative and anaplerotic fluxes. These data indicate that mitochondrial oxidative metabolism is ∼2-fold greater in those with NAFLD, providing a potential link between IHTG content, oxidative stress, and liver damage. PMID:22152305

Quantitative importance of the pentose phosphate pathway determined by incorporation of 13C from [2-13C]- and [3-13C]glucose into TCA cycle intermediates and neurotransmitter amino acids in functionally intact neurons.

PubMed

Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

2012-09-01

The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of (13)C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ~6% of glucose metabolism in cortical neurons and ~4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that (13)C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons.

Neuronal glucose metabolism is impaired while astrocytic TCA cycling is unaffected at symptomatic stages in the hSOD1G93A mouse model of amyotrophic lateral sclerosis.

PubMed

Tefera, Tesfaye W; Borges, Karin

2018-01-01

Although alterations in energy metabolism are known in ALS, the specific mechanisms leading to energy deficit are not understood. We measured metabolite levels derived from injected [1- 13 C]glucose and [1,2- 13 C]acetate (i.p.) in cerebral cortex and spinal cord extracts of wild type and hSOD1 G93A mice at onset and mid disease stages using high-pressure liquid chromatography, 1 H and 13 C nuclear magnetic resonance spectroscopy. Levels of spinal and cortical CNS total lactate, [3- 13 C]lactate, total alanine and [3- 13 C]alanine, but not cortical glucose and [1- 13 C]glucose, were reduced mostly at mid stage indicating impaired glycolysis. The [1- 13 C]glucose-derived [4- 13 C]glutamate, [4- 13 C]glutamine and [2- 13 C]GABA amounts were diminished at mid stage in cortex and both time points in spinal cord, suggesting decreased [3- 13 C]pyruvate entry into the TCA cycle. Lack of changes in [1,2- 13 C]acetate-derived [4,5- 13 C]glutamate, [4,5- 13 C]glutamine and [1,2- 13 C]GABA levels indicate unchanged astrocytic 13 C-acetate metabolism. Reduced levels of leucine, isoleucine and valine in CNS suggest compensatory breakdown to refill TCA cycle intermediate levels. Unlabelled, [2- 13 C] and [4- 13 C]GABA concentrations were decreased in spinal cord indicating that impaired glucose metabolism contributes to hyperexcitability and supporting the use of treatments which increase GABA amounts. In conclusion, CNS glucose metabolism is compromised, while astrocytic TCA cycling appears to be normal in the hSOD1 G93A mouse model at symptomatic disease stages.

Quantitative importance of the pentose phosphate pathway determined by incorporation of 13C from [2-13C]- and [3-13C]glucose into TCA cycle intermediates and neurotransmitter amino acids in functionally intact neurons

PubMed Central

Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

2012-01-01

The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-13C]glucose or [3-13C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of 13C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ∼6% of glucose metabolism in cortical neurons and ∼4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that 13C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons. PMID:22714050

Metabolite profiling of human colon carcinoma--deregulation of TCA cycle and amino acid turnover.

PubMed

Denkert, Carsten; Budczies, Jan; Weichert, Wilko; Wohlgemuth, Gert; Scholz, Martin; Kind, Tobias; Niesporek, Silvia; Noske, Aurelia; Buckendahl, Anna; Dietel, Manfred; Fiehn, Oliver

2008-09-18

Apart from genetic alterations, development and progression of colorectal cancer has been linked to influences from nutritional intake, hyperalimentation, and cellular metabolic changes that may be the basis for new diagnostic and therapeutic approaches. However, in contrast to genomics and proteomics, comprehensive metabolomic investigations of alterations in malignant tumors have rarely been conducted. In this study we investigated a set of paired samples of normal colon tissue and colorectal cancer tissue with gas-chromatography time-of-flight mass-spectrometry, which resulted in robust detection of a total of 206 metabolites. Metabolic phenotypes of colon cancer and normal tissues were different at a Bonferroni corrected significance level of p=0.00170 and p=0.00005 for the first two components of an unsupervised PCA analysis. Subsequent supervised analysis found 82 metabolites to be significantly different at p<0.01. Metabolites were connected to abnormalities in metabolic pathways by a new approach that calculates the distance of each pair of metabolites in the KEGG database interaction lattice. Intermediates of the TCA cycle and lipids were found down-regulated in cancer, whereas urea cycle metabolites, purines, pyrimidines and amino acids were generally found at higher levels compared to normal colon mucosa. This study demonstrates that metabolic profiling facilitates biochemical phenotyping of normal and neoplastic colon tissue at high significance levels and points to GC-TOF-based metabolomics as a new method for molecular pathology investigations.

Contribution of the tricarboxylic acid (TCA) cycle and the glyoxylate shunt in Saccharomyces cerevisiae to succinic acid production during dough fermentation.

PubMed

Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M

2015-07-02

Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.

ATCA/muTCA for Physics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jezynski, Tomasz; /DESY; Larsen, Raymond

ATCA/{mu}TCA platforms are attractive because of the modern serial link architecture, high availability features and many packaging options. Less-demanding availability applications can be met economically by scaling back speed and redundancy. The ATCA specification was originally targeted for the Telecom industry but has gained recently a much wider user audience. The purpose of this paper is to report on present hardware and software R and D efforts where ATCA and {mu}TCA are planned, already being used or in development using selected examples for accelerator and detectors in the Physics community. It will present also the status of a proposal formore » physics extensions to ATCA/{mu}TCA specifications to promote inter-operability of laboratory and industry designs for physics.« less

In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance.

PubMed

Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf

2012-12-01

The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics.

In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance

PubMed Central

Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf

2012-01-01

The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics. PMID:22990416

Alternative reactions at the interface of glycolysis and citric acid cycle in Saccharomyces cerevisiae

PubMed Central

van Rossum, Harmen M.; Kozak, Barbara U.; Niemeijer, Matthijs S.; Duine, Hendrik J.; Luttik, Marijke A. H.; Boer, Viktor M.; Kötter, Peter; Daran, Jean-Marc G.; van Maris, Antonius J. A.

2016-01-01

Pyruvate and acetyl-coenzyme A, located at the interface between glycolysis and TCA cycle, are important intermediates in yeast metabolism and key precursors for industrially relevant products. Rational engineering of their supply requires knowledge of compensatory reactions that replace predominant pathways when these are inactivated. This study investigates effects of individual and combined mutations that inactivate the mitochondrial pyruvate-dehydrogenase (PDH) complex, extramitochondrial citrate synthase (Cit2) and mitochondrial CoA-transferase (Ach1) in Saccharomyces cerevisiae. Additionally, strains with a constitutively expressed carnitine shuttle were constructed and analyzed. A predominant role of the PDH complex in linking glycolysis and TCA cycle in glucose-grown batch cultures could be functionally replaced by the combined activity of the cytosolic PDH bypass and Cit2. Strongly impaired growth and a high incidence of respiratory deficiency in pda1Δ ach1Δ strains showed that synthesis of intramitochondrial acetyl-CoA as a metabolic precursor requires activity of either the PDH complex or Ach1. Constitutive overexpression of AGP2, HNM1, YAT2, YAT1, CRC1 and CAT2 enabled the carnitine shuttle to efficiently link glycolysis and TCA cycle in l-carnitine-supplemented, glucose-grown batch cultures. Strains in which all known reactions at the glycolysis-TCA cycle interface were inactivated still grew slowly on glucose, indicating additional flexibility at this key metabolic junction. PMID:26895788

Lipotoxicity in steatohepatitis occurs despite an increase in tricarboxylic acid cycle activity

PubMed Central

Patterson, Rainey E.; Kalavalapalli, Srilaxmi; Williams, Caroline M.; Nautiyal, Manisha; Mathew, Justin T.; Martinez, Janie; Reinhard, Mary K.; McDougall, Danielle J.; Rocca, James R.; Yost, Richard A.; Cusi, Kenneth; Garrett, Timothy J.

2016-01-01

The hepatic tricarboxylic acid (TCA) cycle is central to integrating macronutrient metabolism and is closely coupled to cellular respiration, free radical generation, and inflammation. Oxidative flux through the TCA cycle is induced during hepatic insulin resistance, in mice and humans with simple steatosis, reflecting early compensatory remodeling of mitochondrial energetics. We hypothesized that progressive severity of hepatic insulin resistance and the onset of nonalcoholic steatohepatitis (NASH) would impair oxidative flux through the hepatic TCA cycle. Mice (C57/BL6) were fed a high-trans-fat high-fructose diet (TFD) for 8 wk to induce simple steatosis and NASH by 24 wk. In vivo fasting hepatic mitochondrial fluxes were determined by 13C-nuclear magnetic resonance (NMR)-based isotopomer analysis. Hepatic metabolic intermediates were quantified using mass spectrometry-based targeted metabolomics. Hepatic triglyceride accumulation and insulin resistance preceded alterations in mitochondrial metabolism, since TCA cycle fluxes remained normal during simple steatosis. However, mice with NASH had a twofold induction (P < 0.05) of mitochondrial fluxes (μmol/min) through the TCA cycle (2.6 ± 0.5 vs. 5.4 ± 0.6), anaplerosis (9.1 ± 1.2 vs. 16.9 ± 2.2), and pyruvate cycling (4.9 ± 1.0 vs. 11.1 ± 1.9) compared with their age-matched controls. Induction of the TCA cycle activity during NASH was concurrent with blunted ketogenesis and accumulation of hepatic diacylglycerols (DAGs), ceramides (Cer), and long-chain acylcarnitines, suggesting inefficient oxidation and disposal of excess free fatty acids (FFA). Sustained induction of mitochondrial TCA cycle failed to prevent accretion of “lipotoxic” metabolites in the liver and could hasten inflammation and the metabolic transition to NASH. PMID:26814015

Streptomyces clavuligerus shows a strong association between TCA cycle intermediate accumulation and clavulanic acid biosynthesis.

PubMed

Ramirez-Malule, Howard; Junne, Stefan; Nicolás Cruz-Bournazou, Mariano; Neubauer, Peter; Ríos-Estepa, Rigoberto

2018-05-01

Clavulanic acid (CA) is produced by Streptomyces clavuligerus (S. clavuligerus) as a secondary metabolite. Knowledge about the carbon flux distribution along the various routes that supply CA precursors would certainly provide insights about metabolic performance. In order to evaluate metabolic patterns and the possible accumulation of tricarboxylic acid (TCA) cycle intermediates during CA biosynthesis, batch and subsequent continuous cultures with steadily declining feed rates were performed with glycerol as the main substrate. The data were used to in silico explore the metabolic capabilities and the accumulation of metabolic intermediates in S. clavuligerus. While clavulanic acid accumulated at glycerol excess, it steadily decreased at declining dilution rates; CA synthesis stopped when glycerol became the limiting substrate. A strong association of succinate, oxaloacetate, malate, and acetate accumulation with CA production in S. clavuligerus was observed, and flux balance analysis (FBA) was used to describe the carbon flux distribution in the network. This combined experimental and numerical approach also identified bottlenecks during the synthesis of CA in a batch and subsequent continuous cultivation and demonstrated the importance of this type of methodologies for a more advanced understanding of metabolism; this potentially derives valuable insights for future successful metabolic engineering studies in S. clavuligerus.

The Aurora kinase A inhibitor TC-A2317 disrupts mitotic progression and inhibits cancer cell proliferation

PubMed Central

Min, Yoo Hong; Kim, Wootae; Kim, Ja-Eun

2016-01-01

Mitotic progression is crucial for the maintenance of chromosomal stability. A proper progression is ensured by the activities of multiple kinases. One of these enzymes, the serine/threonine kinase Aurora A, is required for proper mitosis through the regulation of centrosome and spindle assembly. In this study, we functionally characterized a newly developed Aurora kinase A inhibitor, TC-A2317. In human lung cancer cells, TC-A2317 slowed proliferation by causing aberrant formation of centrosome and microtubule spindles and prolonging the duration of mitosis. Abnormal mitotic progression led to accumulation of cells containing micronuclei or multinuclei. Furthermore, TC-A2317–treated cells underwent apoptosis, autophagy or senescence depending on cell type. In addition, TC-A2317 inactivated the spindle assembly checkpoint triggered by paclitaxel, thereby exacerbating mitotic catastrophe. Consistent with this, the expression level of Aurora A in tumors was inversely correlated with survival in lung cancer patients. Collectively, these data suggest that inhibition of Aurora kinase A using TC-A2317 is a promising target for anti-cancer therapeutics. PMID:27713168

The Krebs Uric Acid Cycle: A Forgotten Krebs Cycle.

PubMed

Salway, Jack G

2018-05-25

Hans Kornberg wrote a paper entitled 'Krebs and his trinity of cycles' commenting that every school biology student knows of the Krebs cycle, but few know that Krebs discovered two other cycles. These are (i) the ornithine cycle (urea cycle), (ii) the citric acid cycle (tricarboxylic acid or TCA cycle), and (iii) the glyoxylate cycle that was described by Krebs and Kornberg. Ironically, Kornberg, codiscoverer of the 'glyoxylate cycle', overlooked a fourth Krebs cycle - (iv) the uric acid cycle. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effects of tretinoin pretreatment on TCA chemical peel in guinea pig skin.

PubMed Central

Kim, I. H.; Kim, H. K.; Kye, Y. C.

1996-01-01

This study was done to characterize the structural changes in the tretinoin pretreatment on trichloroacetic acid(TCA) chemical peel. In guinea pigs, the right halves pretreated with tretinoin and the left halves treated nothing were compared in their structural changes after TCA chemical peel. Epidermal thickness in the tretinoin pretreated group was almost the same in the first and second week. But epidermis of the TCA group increased continuously. In the first week, mitotic figures in the epidermis were more increased in the TCA group, but those in hair follicles were more increased in the tretinoin pretreated group. In the second week, mitotic figures in the epidermis were almost same in both group, but in hair follicles of the tretinoin pretreated group, mitotic figures were much more increased. In alcian blue staining, glycosaminoglycan was stained much more strongly in dermis of the TCA group in first week, but was more strongly stained in the tretinoin pretreated group in second week. On electron microscopic findings, the fibroblasts in upper dermis were larger and had plentier cytoplasm with more organelles in the tretinoin pretreated group. Conclusively, tretinoin pretreatment on TCA chemical peel sustained the effects of TCA longer and showed synergistic effects of TCA and induced enhanced wound healing. PMID:8878803

Teaching about citric acid cycle using plant mitochondrial preparations: Some assays for use in laboratory courses*.

PubMed

Vicente, Joaquim A F; Gomes-Santos, Carina S S; Sousa, Ana Paula M; Madeira, Vítor M C

2005-03-01

Potato tubers and turnip roots were used to prepare purified mitochondria for laboratory practical work in the teaching of the citric acid cycle (TCA cycle). Plant mitochondria are particularly advantageous over the animal fractions to demonstrate the TCA cycle enzymatic steps, by using simple techniques to measure O(2) consumption and transmembrane potential (ΔΨ). The several TCA cycle intermediates induce specific enzyme activities, which can be identified by respiratory parameters. Such a strategy is also used to evidence properties of the TCA cycle enzymes: ADP stimulation of isocitrate dehydrogenase and α-ketoglutarate dehydrogenase; activation by citrate of downstream oxidation steps, e.g. succinate dehydrogenase; and regulation of the activity of isocitrate dehydrogenase by citrate action on the citrate/isocitrate carrier. Furthermore, it has been demonstrated that, in the absence of exogenous Mg(2+) , isocitrate-dependent respiration favors the alternative oxidase pathway, as judged by changes of the ADP/O elicited by the inhibitor n-propyl galate. These are some examples of assays related with TCA cycle intermediates we can use in laboratory courses. Copyright © 2005 International Union of Biochemistry and Molecular Biology, Inc.

Viscous Design of TCA Configuration

NASA Technical Reports Server (NTRS)

Krist, Steven E.; Bauer, Steven X. S.; Campbell, Richard L.

1999-01-01

The goal in this effort is to redesign the baseline TCA configuration for improved performance at both supersonic and transonic cruise. Viscous analyses are conducted with OVERFLOW, a Navier-Stokes code for overset grids, using PEGSUS to compute the interpolations between overset grids. Viscous designs are conducted with OVERDISC, a script which couples OVERFLOW with the Constrained Direct Iterative Surface Curvature (CDISC) inverse design method. The successful execution of any computational fluid dynamics (CFD) based aerodynamic design method for complex configurations requires an efficient method for regenerating the computational grids to account for modifications to the configuration shape. The first section of this presentation deals with the automated regridding procedure used to generate overset grids for the fuselage/wing/diverter/nacelle configurations analysed in this effort. The second section outlines the procedures utilized to conduct OVERDISC inverse designs. The third section briefly covers the work conducted by Dick Campbell, in which a dual-point design at Mach 2.4 and 0.9 was attempted using OVERDISC; the initial configuration from which this design effort was started is an early version of the optimized shape for the TCA configuration developed by the Boeing Commercial Airplane Group (BCAG), which eventually evolved into the NCV design. The final section presents results from application of the Natural Flow Wing design philosophy to the TCA configuration.

Linked cycles of oxidative decarboxylation of glyoxylate as protometabolic analogs of the citric acid cycle.

PubMed

Springsteen, Greg; Yerabolu, Jayasudhan Reddy; Nelson, Julia; Rhea, Chandler Joel; Krishnamurthy, Ramanarayanan

2018-01-08

The development of metabolic approaches towards understanding the origins of life, which have focused mainly on the citric acid (TCA) cycle, have languished-primarily due to a lack of experimentally demonstrable and sustainable cycle(s) of reactions. We show here the existence of a protometabolic analog of the TCA involving two linked cycles, which convert glyoxylate into CO 2 and produce aspartic acid in the presence of ammonia. The reactions proceed from either pyruvate, oxaloacetate or malonate in the presence of glyoxylate as the carbon source and hydrogen peroxide as the oxidant under neutral aqueous conditions and at mild temperatures. The reaction pathway demonstrates turnover under controlled conditions. These results indicate that simpler versions of metabolic cycles could have emerged under potential prebiotic conditions, laying the foundation for the appearance of more sophisticated metabolic pathways once control by (polymeric) catalysts became available.

The antidiabetic drug metformin decreases mitochondrial respiration and tricarboxylic acid cycle activity in cultured primary rat astrocytes.

PubMed

Hohnholt, Michaela C; Blumrich, Eva-Maria; Waagepetersen, Helle S; Dringen, Ralf

2017-11-01

Metformin is an antidiabetic drug that is used daily by millions of patients worldwide. Metformin is able to cross the blood-brain barrier and has recently been shown to increase glucose consumption and lactate release in cultured astrocytes. However, potential effects of metformin on mitochondrial tricarboxylic acid (TCA) cycle metabolism in astrocytes are unknown. We investigated this by mapping 13 C labeling in TCA cycle intermediates and corresponding amino acids after incubation of primary rat astrocytes with [U- 13 C]glucose. The presence of metformin did not compromise the viability of cultured astrocytes during 4 hr of incubation, but almost doubled cellular glucose consumption and lactate release. Compared with control cells, the presence of metformin dramatically lowered the molecular 13 C carbon labeling (MCL) of the cellular TCA cycle intermediates citrate, α-ketoglutarate, succinate, fumarate, and malate, as well as the MCL of the TCA cycle intermediate-derived amino acids glutamate, glutamine, and aspartate. In addition to the total molecular 13 C labeling, analysis of the individual isotopomers of TCA cycle intermediates confirmed a severe decline in labeling and a significant lowering in TCA cycling ratio in metformin-treated astrocytes. Finally, the oxygen consumption of mitochondria isolated from metformin-treated astrocytes was drastically reduced in the presence of complex I substrates, but not of complex II substrates. These data demonstrate that exposure to metformin strongly impairs complex I-mediated mitochondrial respiration in astrocytes, which is likely to cause the observed decrease in labeling of mitochondrial TCA cycle intermediates and the stimulation of glycolytic lactate production. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Sulfate radicals enable a non-enzymatic Krebs cycle precursor

PubMed Central

Keller, Markus A.; Kampjut, Domen; Harrison, Stuart A.; Ralser, Markus

2017-01-01

The evolutionary origins of the tricarboxylic acid cycle (TCA), or Krebs cycle, are so far unclear. Despite a few years ago, the existence of a simple non-enzymatic Krebs-cycle catalyst has been dismissed ‘as an appeal to magic’, citrate and other intermediates have meanwhile been discovered on a carbonaceous meteorite and do interconvert non-enzymatically. To identify the non-enzymatic Krebs cycle catalyst, we used combinatorial, quantitative high-throughput metabolomics to systematically screen iron and sulfate reaction milieus that orient on Archean sediment constituents. TCA cycle intermediates are found stable in water and in the presence of most iron and sulfate species, including simple iron-sulfate minerals. However, we report that TCA intermediates undergo 24 interconversion reactions in the presence of sulfate radicals that form from peroxydisulfate. The non-enzymatic reactions critically cover a topology as present in the Krebs cycle, the glyoxylate shunt and the succinic semialdehyde pathways. Assembled in a chemical network, the reactions achieve more than ninety percent carbon recovery. Our results show that a non-enzymatic precursor for the Krebs cycle is biologically sensible, efficient, and forms spontaneously in the presence of sulfate radicals. PMID:28584880

Computational exploration of the chemical structure space of possible reverse tricarboxylic acid cycle constituents.

PubMed

Meringer, Markus; Cleaves, H James

2017-12-13

The reverse tricarboxylic acid (rTCA) cycle has been explored from various standpoints as an idealized primordial metabolic cycle. Its simplicity and apparent ubiquity in diverse organisms across the tree of life have been used to argue for its antiquity and its optimality. In 2000 it was proposed that chemoinformatics approaches support some of these views. Specifically, defined queries of the Beilstein database showed that the molecules of the rTCA are heavily represented in such compound databases. We explore here the chemical structure "space," e.g. the set of organic compounds which possesses some minimal set of defining characteristics, of the rTCA cycle's intermediates using an exhaustive structure generation method. The rTCA's chemical space as defined by the original criteria and explored by our method is some six to seven times larger than originally considered. Acknowledging that each assumption in what is a defining criterion making the rTCA cycle special limits possible generative outcomes, there are many unrealized compounds which fulfill these criteria. That these compounds are unrealized could be due to evolutionary frozen accidents or optimization, though this optimization may also be for systems-level reasons, e.g., the way the pathway and its elements interface with other aspects of metabolism.

Quantum chemical study, spectroscopic investigations, NBO and HOMO-LUMO analyses of 3-aminoquinoline (3AQ) and [Ag(3AQ)2(TCA)] complex (TCA = Trichloroacetate)

NASA Astrophysics Data System (ADS)

Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abu Youssef, Morsy A.; Assem, Rania

2014-09-01

The new [Ag(3AQ)2(TCA)]; (3AQ = 3-aminoquinoline and TCA = Trichloroacetate) complex is synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry, vibrational frequencies, gauge-including atomic orbital (GIAO) 1H chemical shift values of the free and coordinated 3AQ in the ground state have been calculated by using DFT/B3LYP method. The TD-DFT results of the [Ag(3AQ)2(TCA)] complex showed a π-π* transition band at 240.3-242.6 nm (f = 0.1334-0.1348) which has longer wavelength and lower absorption intensity than that for the free 3AQ (233.2 nm, f = 0.3958). Dipole moment, polarizability and HOMO-LUMO gap values predicted better nonlinear optical properties (NLO) for the [Ag(3AQ)2(TCA)] than the 3AQ ligand. NBO analysis has been used to predict the most accurate Lewis structure of the studied molecules. The energies of the different intramolecular charge transfer (ICT) interactions within the studied molecules were estimated using second order perturbation theory.

The Tricarboxylic Acid Cycle, an Ancient Metabolic Network with a Novel Twist

PubMed Central

Mailloux, Ryan J.; Bériault, Robin; Lemire, Joseph; Singh, Ranji; Chénier, Daniel R.; Hamel, Robert D.; Appanna, Vasu D.

2007-01-01

The tricarboxylic acid (TCA) cycle is an essential metabolic network in all oxidative organisms and provides precursors for anabolic processes and reducing factors (NADH and FADH2) that drive the generation of energy. Here, we show that this metabolic network is also an integral part of the oxidative defence machinery in living organisms and α-ketoglutarate (KG) is a key participant in the detoxification of reactive oxygen species (ROS). Its utilization as an anti-oxidant can effectively diminish ROS and curtail the formation of NADH, a situation that further impedes the release of ROS via oxidative phosphorylation. Thus, the increased production of KG mediated by NADP-dependent isocitrate dehydrogenase (NADP-ICDH) and its decreased utilization via the TCA cycle confer a unique strategy to modulate the cellular redox environment. Activities of α-ketoglutarate dehydrogenase (KGDH), NAD-dependent isocitrate dehydrogenase (NAD-ICDH), and succinate dehydrogenase (SDH) were sharply diminished in the cellular systems exposed to conditions conducive to oxidative stress. These findings uncover an intricate link between TCA cycle and ROS homeostasis and may help explain the ineffective TCA cycle that characterizes various pathological conditions and ageing. PMID:17668068

Aqueous Extract of Black Maca Prevents Metabolism Disorder via Regulating the Glycolysis/Gluconeogenesis-TCA Cycle and PPARα Signaling Activation in Golden Hamsters Fed a High-Fat, High-Fructose Diet.

PubMed

Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen

2018-01-01

Maca ( Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo . Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm . Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2 , Fh , and Mdh2 . In addition, the lipid

Aqueous Extract of Black Maca Prevents Metabolism Disorder via Regulating the Glycolysis/Gluconeogenesis-TCA Cycle and PPARα Signaling Activation in Golden Hamsters Fed a High-Fat, High-Fructose Diet

PubMed Central

Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen

2018-01-01

Maca (Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo. Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm. Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2, Fh, and Mdh2. In addition, the lipid

Evaluation results of xTCA equipment for HEP experiments at CERN

NASA Astrophysics Data System (ADS)

Di Cosmo, M.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.; Vichoudis, P.

2013-12-01

The MicroTCA and AdvancedTCA industry standards are candidate modular electronic platforms for the upgrade of the current generation of high energy physics experiments. The PH-ESE group at CERN launched in 2011 the xTCA evaluation project with the aim of performing technical evaluations and eventually providing support for commercially available components. Different devices from different vendors have been acquired, evaluated and interoperability tests have been performed. This paper presents the test procedures and facilities that have been developed and focuses on the evaluation results including electrical, thermal and interoperability aspects.

Pyruvate cycle increases aminoglycoside efficacy and provides respiratory energy in bacteria.

PubMed

Su, Yu-Bin; Peng, Bo; Li, Hui; Cheng, Zhi-Xue; Zhang, Tian-Tuo; Zhu, Jia-Xin; Li, Dan; Li, Min-Yi; Ye, Jin-Zhou; Du, Chao-Chao; Zhang, Song; Zhao, Xian-Liang; Yang, Man-Jun; Peng, Xuan-Xian

2018-02-13

The emergence and ongoing spread of multidrug-resistant bacteria puts humans and other species at risk for potentially lethal infections. Thus, novel antibiotics or alternative approaches are needed to target drug-resistant bacteria, and metabolic modulation has been documented to improve antibiotic efficacy, but the relevant metabolic mechanisms require more studies. Here, we show that glutamate potentiates aminoglycoside antibiotics, resulting in improved elimination of antibiotic-resistant pathogens. When exploring the metabolic flux of glutamate, it was found that the enzymes that link the phosphoenolpyruvate (PEP)-pyruvate-AcCoA pathway to the TCA cycle were key players in this increased efficacy. Together, the PEP-pyruvate-AcCoA pathway and TCA cycle can be considered the pyruvate cycle (P cycle). Our results show that inhibition or gene depletion of the enzymes in the P cycle shut down the TCA cycle even in the presence of excess carbon sources, and that the P cycle operates routinely as a general mechanism for energy production and regulation in Escherichia coli and Edwardsiella tarda These findings address metabolic mechanisms of metabolite-induced potentiation and fundamental questions about bacterial biochemistry and energy metabolism.

Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle

PubMed Central

Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro

2017-01-01

Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886

Inhibition of Pyruvate Dehydrogenase Kinase 2 Protects Against Hepatic Steatosis Through Modulation of Tricarboxylic Acid Cycle Anaplerosis and Ketogenesis.

PubMed

Go, Younghoon; Jeong, Ji Yun; Jeoung, Nam Ho; Jeon, Jae-Han; Park, Bo-Yoon; Kang, Hyeon-Ji; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Ham, Hye Jin; Kim, Byung-Gyu; Park, Keun-Gyu; Park, So Young; Lee, Chul-Ho; Choi, Cheol Soo; Park, Tae-Sik; Lee, W N Paul; Harris, Robert A; Lee, In-Kyu

2016-10-01

Hepatic steatosis is associated with increased insulin resistance and tricarboxylic acid (TCA) cycle flux, but decreased ketogenesis and pyruvate dehydrogenase complex (PDC) flux. This study examined whether hepatic PDC activation by inhibition of pyruvate dehydrogenase kinase 2 (PDK2) ameliorates these metabolic abnormalities. Wild-type mice fed a high-fat diet exhibited hepatic steatosis, insulin resistance, and increased levels of pyruvate, TCA cycle intermediates, and malonyl-CoA but reduced ketogenesis and PDC activity due to PDK2 induction. Hepatic PDC activation by PDK2 inhibition attenuated hepatic steatosis, improved hepatic insulin sensitivity, reduced hepatic glucose production, increased capacity for β-oxidation and ketogenesis, and decreased the capacity for lipogenesis. These results were attributed to altered enzymatic capacities and a reduction in TCA anaplerosis that limited the availability of oxaloacetate for the TCA cycle, which promoted ketogenesis. The current study reports that increasing hepatic PDC activity by inhibition of PDK2 ameliorates hepatic steatosis and insulin sensitivity by regulating TCA cycle anaplerosis and ketogenesis. The findings suggest PDK2 is a potential therapeutic target for nonalcoholic fatty liver disease. © 2016 by the American Diabetes Association.

Expression of long non-coding RNA-HOTAIR in oral squamous cell carcinoma Tca8113 cells and its associated biological behavior

PubMed Central

Liu, Huawei; Li, Zhiyong; Wang, Chao; Feng, Lin; Huang, Haitao; Liu, Changkui; Li, Fengxia

2016-01-01

As a long noncoding RNA, HOX transcript antisense intergenic RNA (HOTAIR) is highly expressed in many types of tumors. However, its expression and function in oral squamous cell carcinoma (OSCC) cells and tissues remains largely unknown. We herein studied the biological functions of HOTAIR in OSCC Tca8113 cells. Real-time quantitative PCR showed that HOTAIR, p21 and p53 mRNA expressions in doxorubicin (DOX)-treated or γ-ray-irradiated Tca8113 cells were up-regulated. Knockdown of p53 expression inhibited DOX-induced HOTAIR up-regulation, suggesting that DNA damage-induced HOTAIR expression may be associated with p53. Transfection and CCK-8 assays showed that compared with the control group, overexpression of HOTAIR promoted the proliferation of Tca8113 cells, while interfering with its expression played an opposite role. Flow cytometry exhibited that HOTAIR overexpression decreased the rate of DOX-induced apoptosis. When HOTAIR expression was inhibited by siRNA, the proportions of cells in G2/M and S phases increased and decreased respectively. Meanwhile, the rate of DOX-induced apoptosis rose. DNA damage-induced HOTAIR expression facilitated the proliferation of Tca8113 cells and decreased their apoptosis. However, whether the up-regulation depends on p53 still needs in-depth studies. PMID:27904675

Genetic investigation of tricarboxylic acid metabolism during the Plasmodium falciparum life cycle.

PubMed

Ke, Hangjun; Lewis, Ian A; Morrisey, Joanne M; McLean, Kyle J; Ganesan, Suresh M; Painter, Heather J; Mather, Michael W; Jacobs-Lorena, Marcelo; Llinás, Manuel; Vaidya, Akhil B

2015-04-07

New antimalarial drugs are urgently needed to control drug-resistant forms of the malaria parasite Plasmodium falciparum. Mitochondrial electron transport is the target of both existing and new antimalarials. Herein, we describe 11 genetic knockout (KO) lines that delete six of the eight mitochondrial tricarboxylic acid (TCA) cycle enzymes. Although all TCA KOs grew normally in asexual blood stages, these metabolic deficiencies halted life-cycle progression in later stages. Specifically, aconitase KO parasites arrested as late gametocytes, whereas α-ketoglutarate-dehydrogenase-deficient parasites failed to develop oocysts in the mosquitoes. Mass spectrometry analysis of (13)C-isotope-labeled TCA mutant parasites showed that P. falciparum has significant flexibility in TCA metabolism. This flexibility manifested itself through changes in pathway fluxes and through altered exchange of substrates between cytosolic and mitochondrial pools. Our findings suggest that mitochondrial metabolic plasticity is essential for parasite development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Design of an AdvancedTCA board management controller (IPMC)

NASA Astrophysics Data System (ADS)

Mendez, J.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.

2017-03-01

The AdvancedTCA (ATCA) standard has been selected as the hardware platform for the upgrade of the back-end electronics of the CMS and ATLAS experiments of the Large Hadron Collider (LHC) . In this context, the electronic systems for experiments group at CERN is running a project to evaluate, specify, design and support xTCA equipment. As part of this project, an Intelligent Platform Management Controller (IPMC) for ATCA blades, based on a commercial solution, has been designed to be used on existing and future ATCA blades. This paper reports on the status of this project presenting the hardware and software developments.

IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...

EPA Pesticide Factsheets

EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database. The draft Toxicological Review of trichloroacetic acid provides scientific support and rationale for the hazard and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.

Glycation inhibits trichloroacetic acid (TCA)-induced whey protein precipitation

USDA-ARS?s Scientific Manuscript database

Four different WPI saccharide conjugates were successfully prepared to test whether glycation could inhibit WPI precipitation induced by trichloroacetic acid (TCA). Conjugates molecular weights after glycation were analyzed with SDS-PAGE. No significant secondary structure change due to glycation wa...

IRIS Toxicological Review of Trichloroacetic Acid (TCA) (External Review Draft)

EPA Science Inventory

EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database.

Astrocytic and neuronal oxidative metabolism are coupled to the rate of glutamate-glutamine cycle in the tree shrew visual cortex.

PubMed

Sonnay, Sarah; Poirot, Jordan; Just, Nathalie; Clerc, Anne-Catherine; Gruetter, Rolf; Rainer, Gregor; Duarte, João M N

2018-03-01

Astrocytes play an important role in glutamatergic neurotransmission, namely by clearing synaptic glutamate and converting it into glutamine that is transferred back to neurons. The rate of this glutamate-glutamine cycle (V NT ) has been proposed to couple to that of glucose utilization and of neuronal tricarboxylic acid (TCA) cycle. In this study, we tested the hypothesis that glutamatergic neurotransmission is also coupled to the TCA cycle rate in astrocytes. For that we investigated energy metabolism by means of magnetic resonance spectroscopy (MRS) in the primary visual cortex of tree shrews (Tupaia belangeri) under light isoflurane anesthesia at rest and during continuous visual stimulation. After identifying the activated cortical volume by blood oxygenation level-dependent functional magnetic resonance imaging, 1 H MRS was performed to measure stimulation-induced variations in metabolite concentrations. Relative to baseline, stimulation of cortical activity for 20 min caused a reduction of glucose concentration by -0.34 ± 0.09 µmol/g (p < 0.001), as well as a -9% ± 1% decrease of the ratio of phosphocreatine-to-creatine (p < 0.05). Then 13 C MRS during [1,6- 13 C]glucose infusion was employed to measure fluxes of energy metabolism. Stimulation of glutamatergic activity, as indicated by a 20% increase of V NT , resulted in increased TCA cycle rates in neurons by 12% ( VTCAn, p < 0.001) and in astrocytes by 24% ( VTCAg, p = 0.007). We further observed linear relationships between V NT and both VTCAn and VTCAg. Altogether, these results suggest that in the tree shrew primary visual cortex glutamatergic neurotransmission is linked to overall glucose oxidation and to mitochondrial metabolism in both neurons and astrocytes. © 2017 Wiley Periodicals, Inc.

IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...

EPA Pesticide Factsheets

EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development Process. Comments received from other Federal agencies and White House Offices are provided below with external peer review panel comments. The draft Toxicological Review of Trichloroacetic Acid provides scientific support and rationale for the hazard identification and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.

Comparative study of 15% TCA peel versus 35% glycolic acid peel for the treatment of melasma

PubMed Central

Puri, Neerja

2012-01-01

Background: Chemical peels are the mainstay of a cosmetic practitioner's armamentarium because they can be used to treat some skin disorders and can provide aesthetic benefit. Objectives: To compare 15% TCA peel and 35% glycolic acid peel for the treatment of melasma. Material and Methods: We selected 30 participants of melasma aged between 20 and 50 years from the dermatology outpatient department and treated equal numbers with 15% TCA and 35% glycolic acid. Results: Subjective response as graded by the patient showed good or very good response in 70% participants in the glycolic acid group and 64% in the TCA group. Conclusions: There was statistically insignificant difference in the efficacy between the two groups for the treatment of melasma. PMID:23130283

Modelling urea-cycle disorder citrullinemia type 1 with disease-specific iPSCs.

PubMed

Yoshitoshi-Uebayashi, Elena Yukie; Toyoda, Taro; Yasuda, Katsutaro; Kotaka, Maki; Nomoto, Keiko; Okita, Keisuke; Yasuchika, Kentaro; Okamoto, Shinya; Takubo, Noriyuki; Nishikubo, Toshiya; Soga, Tomoyoshi; Uemoto, Shinji; Osafune, Kenji

2017-05-06

Citrullinemia type 1 (CTLN1) is a urea cycle disorder (UCD) caused by mutations of the ASS1 gene, which is responsible for production of the enzyme argininosuccinate synthetase (ASS), and classically presented as life-threatening hyperammonemia in newborns. Therapeutic options are limited, and neurological sequelae may persist. To understand the pathophysiology and find novel treatments, induced pluripotent stem cells (iPSCs) were generated from a CTLN1 patient and differentiated into hepatocyte-like cells (HLCs). CTLN1-HLCs have lower ureagenesis, recapitulating part of the patient's phenotype. l-arginine, an amino acid clinically used for UCD treatment, improved this phenotype in vitro. Metabolome analysis revealed an increase in tricarboxylic acid (TCA) cycle metabolites in CTLN1, suggesting a connection between CTLN1 and the TCA cycle. This CTLN1-iPSC model improves the understanding of CTLN1 pathophysiology and can be used to pursue new therapeutic approaches. Copyright © 2017 Elsevier Inc. All rights reserved.

In Folio Respiratory Fluxomics Revealed by 13C Isotopic Labeling and H/D Isotope Effects Highlight the Noncyclic Nature of the Tricarboxylic Acid “Cycle” in Illuminated Leaves1[W

PubMed Central

Tcherkez, Guillaume; Mahé, Aline; Gauthier, Paul; Mauve, Caroline; Gout, Elizabeth; Bligny, Richard; Cornic, Gabriel; Hodges, Michael

2009-01-01

While the possible importance of the tricarboxylic acid (TCA) cycle reactions for leaf photosynthesis operation has been recognized, many uncertainties remain on whether TCA cycle biochemistry is similar in the light compared with the dark. It is widely accepted that leaf day respiration and the metabolic commitment to TCA decarboxylation are down-regulated in illuminated leaves. However, the metabolic basis (i.e. the limiting steps involved in such a down-regulation) is not well known. Here, we investigated the in vivo metabolic fluxes of individual reactions of the TCA cycle by developing two isotopic methods, 13C tracing and fluxomics and the use of H/D isotope effects, with Xanthium strumarium leaves. We provide evidence that the TCA “cycle” does not work in the forward direction like a proper cycle but, rather, operates in both the reverse and forward directions to produce fumarate and glutamate, respectively. Such a functional division of the cycle plausibly reflects the compromise between two contrasted forces: (1) the feedback inhibition by NADH and ATP on TCA enzymes in the light, and (2) the need to provide pH-buffering organic acids and carbon skeletons for nitrate absorption and assimilation. PMID:19675152

Use of response surface methodology in a fed-batch process for optimization of tricarboxylic acid cycle intermediates to achieve high levels of canthaxanthin from Dietzia natronolimnaea HS-1.

PubMed

Nasri Nasrabadi, Mohammad Reza; Razavi, Seyed Hadi

2010-04-01

In this work, we applied statistical experimental design to a fed-batch process for optimization of tricarboxylic acid cycle (TCA) intermediates in order to achieve high-level production of canthaxanthin from Dietzia natronolimnaea HS-1 cultured in beet molasses. A fractional factorial design (screening test) was first conducted on five TCA cycle intermediates. Out of the five TCA cycle intermediates investigated via screening tests, alfaketoglutarate, oxaloacetate and succinate were selected based on their statistically significant (P<0.05) and positive effects on canthaxanthin production. These significant factors were optimized by means of response surface methodology (RSM) in order to achieve high-level production of canthaxanthin. The experimental results of the RSM were fitted with a second-order polynomial equation by means of a multiple regression technique to identify the relationship between canthaxanthin production and the three TCA cycle intermediates. By means of this statistical design under a fed-batch process, the optimum conditions required to achieve the highest level of canthaxanthin (13172 + or - 25 microg l(-1)) were determined as follows: alfaketoglutarate, 9.69 mM; oxaloacetate, 8.68 mM; succinate, 8.51 mM. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Performance improvement of GaN-based metal-semiconductor-metal photodiodes grown on Si(111) substrate by thermal cycle annealing process

NASA Astrophysics Data System (ADS)

Lin, Jyun-Hao; Huang, Shyh-Jer; Su, Yan-Kuin

2014-01-01

A simple thermal cycle annealing (TCA) process was used to improve the quality of GaN grown on a Si substrate. The X-ray diffraction (XRD) and etch pit density (EPD) results revealed that using more process cycles, the defect density cannot be further reduced. However, the performance of GaN-based metal-semiconductor-metal (MSM) photodiodes (PDs) prepared on Si substrates showed significant improvement. With a two-cycle TCA process, it is found that the dark current of the device was only 1.46 × 10-11 A, and the photo-to-dark-current contrast ratio was about 1.33 × 105 at 5 V. Also, the UV/visible rejection ratios can reach as high as 1077.

Molecular structure and spectral properties of ethyl 3-quinolinecarboxylate (E3Q) and [Ag(E3Q)2(TCA)] complex (TCA = Trichloroacetate)

NASA Astrophysics Data System (ADS)

Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abou Youssef, Morsy A.; Assem, Rania

2014-09-01

A new [Ag(E3Q)2(TCA)] complex; (E3Q = Ethyl 3-quinolinecarboxylate and TCA = Trichloroacetate) has been synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry and spectroscopic properties of the complex as well as the free ligand have been calculated using the hybrid B3LYP method. The calculations predicted a distorted tetrahedral arrangement around Ag(I) ion. The vibrational spectra of the studied compounds have been assigned using potential energy distribution (PED). TD-DFT method was used to predict the electronic absorption spectra. The most intense absorption band showed a bathochromic shift and lowering of intensity in case of the complex (233.7 nm, f = 0.5604) compared to E3Q (λmax = 228.0 nm, f = 0.9072). The calculated 1H NMR chemical shifts using GIAO method showed good correlations with the experimental data. The computed dipole moment, polarizability and HOMO-LUMO energy gap were used to predict the nonlinear optical (NLO) properties. It is found that Ag(I) enhances the NLO activity. The natural bond orbital (NBO) analyses were used to elucidate the intramolecular charge transfer interactions causing stabilization for the investigated systems.

Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.

PubMed

Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R

2017-03-06

Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.

IRIS Toxicological Review of Trichloroacetic Acid (TCA) (Interagency Science Discussion Draft)

EPA Science Inventory

EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development ...

In vitro anticancer effects of insect tea in TCA8113 cells.

PubMed

Qian, Yu; Li, Gui-Jie; Wang, Rui; Zhou, Ya-Lin; Sun, Peng; Zhao, Xin

2014-01-01

Insect tea is widely used a traditional drink or traditional Chinese medicine in China. This study was conducted with an aim to determine the in vitro anticancer effect of Insect tea in cancer cells. The anticancer effects of Insect tea were evaluated in human tongue carcinoma TCA8113 cells using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay, flow cytometry analysis, nuclear staining with 4,6-diamidino-2-phenylindole (DAPI), reverse transcription-polymerase chain reaction (RT-PCR) analysis, and western bolt assay. At 200 μg/mL, Insect tea inhibited the growth of TCA8113 cells by 80.7%, which was higher than the inhibition caused by 100 μg/mL Insect tea but lower than that of 200 μg/mL green tea. Compared to the control cancer cells, Insect tea significantly (P<0.05) induced apoptosis as determined by DAPI staining and flow cytometry analysis results. Insect tea significantly induced apoptosis in cancer cells by upregulating BAX, CASP3, CASP9 and downregulating BCL2. Genes encoding nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2) were significantly downregulated by Insect tea, demonstrating its anti-inflammatory properties. Insect tea also exerted a great anti-metastasis effect on cancer cells as demonstrated by decreased expression of matrix metalloproteinase (MMP) genes and increased expression of tissue inhibitors of metalloproteinases (TIMPs). The results showed that Insect tea has good in vitro anticancer effects in TCA8113 cells, like green tea.

Metabolomics and transcriptomics profiles reveal the dysregulation of the tricarboxylic acid cycle and related mechanisms in prostate cancer.

PubMed

Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang

2018-07-15

Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.

Trichloroacetic acid (TCA) and trifluoroacetic acid (TFA) mixture toxicity to the macrophytes Myriophyllum spicatum and Myriophyllum sibiricum in aquatic microcosms.

PubMed

Hanson, Mark L; Sibley, Paul K; Mabury, Scott A; Solomon, Keith R; Muir, Derek C G

2002-02-21

Trichloroacetic acid (TCA) and trifluoroacetic acid (TFA) have been detected together in environmental water samples throughout the world. TCA may enter into aquatic systems via rainout as the degradation product of chlorinated solvents, herbicide use, as a by-product of water disinfection and from emissions of spent bleach liquor of kraft pulp mills. Sources of TFA include degradation of hydrofluorocarbons (HFCs) refrigerants and pesticides. These substances are phytotoxic and widely distributed in aquatic environments. A study to assess the risk of a binary mixture of TCA and TFA to macrophytes in aquatic microcosms was conducted as part of a larger study on haloacetic acids. M. spicatum and M. sibiricum were exposed to 0.1, 1, 3 and 10 mg/l of both TCA and TFA (neutralized with sodium hydroxide) in replicate (n = 3) 12000 l aquatic microcosms for 49 days in an one-way analysis of variance design. Each microcosm was stocked with 14 individual apical shoots per species. The plants were sampled at regular intervals and assessed for the somatic endpoints of plant length, root growth, number of nodes and wet and dry mass and the biochemical endpoints of chlorophyll-a, chlorophyll-b, carotenoid content and citric acid levels. Results indicate that there were statistically significant effects of the TCA/TFA mixture on certain pigment concentrations immediately after the start of exposure (2-7 days), but the plants showed no signs of stress thereafter. These data suggest that TCA/TFA mixtures at environmentally relevant concentrations do not pose a significant risk to these aquatic macrophytes.

Spatial Distribution of Cellular Function: The Partitioning of Proteins between Mitochondria and the Nucleus in MCF7 Breast Cancer Cells

PubMed Central

Qattan, Amal T.; Radulovic, Marko; Crawford, Mark; Godovac-Zimmermann, Jasminka

2014-01-01

Concurrent proteomics analysis of the nuclei and mitochondria of MCF7 breast cancer cells identified 985 proteins (40% of all detected proteins) present in both organelles. Numerous proteins from all five complexes involved in oxidative phosphorylation (e.g., NDUFA5, NDUFB10, NDUFS1, NDUF2, SDHA, UQRB, UQRC2, UQCRH, COX5A, COX5B, MT-CO2, ATP5A1, ATP5B, ATP5H, etc.), from the TCA-cycle (DLST, IDH2, IDH3A, OGDH, SUCLAG2, etc.), and from glycolysis (ALDOA, ENO1, FBP1, GPI, PGK1, TALDO1, etc.) were distributed to both the nucleus and mitochondria. In contrast, proteins involved in nuclear/mitochondrial RNA processing/translation and Ras/Rab signaling showed different partitioning patterns. The identity of the OxPhos, TCA-cycle, and glycolysis proteins distributed to both the nucleus and mitochondria provides evidence for spatio-functional integration of these processes over the two different subcellular organelles. We suggest that there are unrecognized aspects of functional coordination between the nucleus and mitochondria, that integration of core functional processes via wide subcellular distribution of constituent proteins is a common characteristic of cells, and that subcellular spatial integration of function may be a vital aspect of cancer. PMID:23051583

Gluconeogenesis is associated with high rates of tricarboxylic acid and pyruvate cycling in fasting northern elephant seals.

PubMed

Champagne, Cory D; Houser, Dorian S; Fowler, Melinda A; Costa, Daniel P; Crocker, Daniel E

2012-08-01

Animals that endure prolonged periods of food deprivation preserve vital organ function by sparing protein from catabolism. Much of this protein sparing is achieved by reducing metabolic rate and suppressing gluconeogenesis while fasting. Northern elephant seals (Mirounga angustirostris) endure prolonged fasts of up to 3 mo at multiple life stages. During these fasts, elephant seals maintain high levels of activity and energy expenditure associated with breeding, reproduction, lactation, and development while maintaining rates of glucose production typical of a postabsorptive mammal. Therefore, we investigated how fasting elephant seals meet the requirements of glucose-dependent tissues while suppressing protein catabolism by measuring the contribution of glycogenolysis, glycerol, and phosphoenolpyruvate (PEP) to endogenous glucose production (EGP) during their natural 2-mo postweaning fast. Additionally, pathway flux rates associated with the tricarboxylic acid (TCA) cycle were measured specifically, flux through phosphoenolpyruvate carboxykinase (PEPCK) and pyruvate cycling. The rate of glucose production decreased during the fast (F(1,13) = 5.7, P = 0.04) but remained similar to that of postabsorptive mammals. The fractional contributions of glycogen, glycerol, and PEP did not change with fasting; PEP was the primary gluconeogenic precursor and accounted for ∼95% of EGP. This large contribution of PEP to glucose production occurred without substantial protein loss. Fluxes through the TCA cycle, PEPCK, and pyruvate cycling were higher than reported in other species and were the most energetically costly component of hepatic carbohydrate metabolism. The active pyruvate recycling fluxes detected in elephant seals may serve to rectify gluconeogeneic PEP production during restricted anaplerotic inflow in these fasting-adapted animals.

Metabolic engineering in the biotechnological production of organic acids in the tricarboxylic acid cycle of microorganisms: Advances and prospects.

PubMed

Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian

2015-11-01

Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.

Decreased glycolytic and tricarboxylic acid cycle intermediates coincide with peripheral nervous system oxidative stress in a murine model of type 2 diabetes.

PubMed

Hinder, Lucy M; Vivekanandan-Giri, Anuradha; McLean, Lisa L; Pennathur, Subramaniam; Feldman, Eva L

2013-01-01

Diabetic neuropathy (DN) is the most common complication of diabetes and is characterized by distal-to-proximal loss of peripheral nerve axons. The idea of tissue-specific pathological alterations in energy metabolism in diabetic complications-prone tissues is emerging. Altered nerve metabolism in type 1 diabetes models is observed; however, therapeutic strategies based on these models offer limited efficacy to type 2 diabetic patients with DN. Therefore, understanding how peripheral nerves metabolically adapt to the unique type 2 diabetic environment is critical to develop disease-modifying treatments. In the current study, we utilized targeted liquid chromatography-tandem mass spectrometry (LC/MS/MS) to characterize the glycolytic and tricarboxylic acid (TCA) cycle metabolomes in sural nerve, sciatic nerve, and dorsal root ganglia (DRG) from male type 2 diabetic mice (BKS.Cg-m+/+Lepr(db); db/db) and controls (db/+). We report depletion of glycolytic intermediates in diabetic sural nerve and sciatic nerve (glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate (sural nerve only), 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvate, and lactate), with no significant changes in DRG. Citrate and isocitrate TCA cycle intermediates were decreased in sural nerve, sciatic nerve, and DRG from diabetic mice. Utilizing LC/electrospray ionization/MS/MS and HPLC methods, we also observed increased protein and lipid oxidation (nitrotyrosine; hydroxyoctadecadienoic acids) in db/db tissue, with a proximal-to-distal increase in oxidative stress, with associated decreased aconitase enzyme activity. We propose a preliminary model, whereby the greater change in metabolomic profile, increase in oxidative stress, and decrease in TCA cycle enzyme activity may cause distal peripheral nerves to rely on truncated TCA cycle metabolism in the type 2 diabetes environment.

Dwell Time and Surface Parameter Effects on Removal of Silicone Oil From D6ac Steel Using TCA

NASA Technical Reports Server (NTRS)

Boothe, R. E.

2003-01-01

This study was conducted to evaluate the impact of dwell time, surface roughness, and the surface activation state on 1,1,1-trichloroethane's (TCA's) effectiveness for removing silicone oil from D6ac steel. Silicone-contaminated test articles were washed with TCA solvent, and then the surfaces were analyzed for residue, using Fourier transform infrared spectroscopy. The predominant factor affecting the ability to remove the silicone oil was surface roughness.

Extraction-less, rapid assay for the direct detection of 2,4,6-trichloroanisole (TCA) in cork samples.

PubMed

Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon

2014-07-01

2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.

Methylcitrate cycle defines the bactericidal essentiality of isocitrate lyase for survival of Mycobacterium tuberculosis on fatty acids

PubMed Central

Eoh, Hyungjin; Rhee, Kyu Y.

2014-01-01

Few mutations attenuate Mycobacterium tuberculosis (Mtb) more profoundly than deletion of its isocitrate lyases (ICLs). However, the basis for this attenuation remains incompletely defined. Mtb’s ICLs are catalytically bifunctional isocitrate and methylisocitrate lyases required for growth on even and odd chain fatty acids. Here, we report that Mtb’s ICLs are essential for survival on both acetate and propionate because of its methylisocitrate lyase (MCL) activity. Lack of MCL activity converts Mtb’s methylcitrate cycle into a “dead end” pathway that sequesters tricarboxylic acid (TCA) cycle intermediates into methylcitrate cycle intermediates, depletes gluconeogenic precursors, and results in defects of membrane potential and intrabacterial pH. Activation of an alternative vitamin B12-dependent pathway of propionate metabolism led to selective corrections of TCA cycle activity, membrane potential, and intrabacterial pH that specifically restored survival, but not growth, of ICL-deficient Mtb metabolizing acetate or propionate. These results thus resolve the biochemical basis of essentiality for Mtb’s ICLs and survival on fatty acids. PMID:24639517

Identification of fuel cycle simulator functionalities for analysis of transition to a new fuel cycle

DOE PAGES

Brown, Nicholas R.; Carlsen, Brett W.; Dixon, Brent W.; ...

2016-06-09

Dynamic fuel cycle simulation tools are intended to model holistic transient nuclear fuel cycle scenarios. As with all simulation tools, fuel cycle simulators require verification through unit tests, benchmark cases, and integral tests. Model validation is a vital aspect as well. Although compara-tive studies have been performed, there is no comprehensive unit test and benchmark library for fuel cycle simulator tools. The objective of this paper is to identify the must test functionalities of a fuel cycle simulator tool within the context of specific problems of interest to the Fuel Cycle Options Campaign within the U.S. Department of Energy smore » Office of Nuclear Energy. The approach in this paper identifies the features needed to cover the range of promising fuel cycle options identified in the DOE-NE Fuel Cycle Evaluation and Screening (E&S) and categorizes these features to facilitate prioritization. Features were categorized as essential functions, integrating features, and exemplary capabilities. One objective of this paper is to propose a library of unit tests applicable to each of the essential functions. Another underlying motivation for this paper is to encourage an international dialog on the functionalities and standard test methods for fuel cycle simulator tools.« less

Ames Optimized TCA Configuration

NASA Technical Reports Server (NTRS)

Cliff, Susan E.; Reuther, James J.; Hicks, Raymond M.

1999-01-01

Configuration design at Ames was carried out with the SYN87-SB (single block) Euler code using a 193 x 49 x 65 C-H grid. The Euler solver is coupled to the constrained (NPSOL) and the unconstrained (QNMDIF) optimization packages. Since the single block grid is able to model only wing-body configurations, the nacelle/diverter effects were included in the optimization process by SYN87's option to superimpose the nacelle/diverter interference pressures on the wing. These interference pressures were calculated using the AIRPLANE code. AIRPLANE is an Euler solver that uses a unstructured tetrahedral mesh and is capable of computations about arbitrary complete configurations. In addition, the buoyancy effects of the nacelle/diverters were also included in the design process by imposing the pressure field obtained during the design process onto the triangulated surfaces of the nacelle/diverter mesh generated by AIRPLANE. The interference pressures and nacelle buoyancy effects are added to the final forces after each flow field calculation. Full details of the (recently enhanced) ghost nacelle capability are given in a related talk. The pseudo nacelle corrections were greatly improved during this design cycle. During the Ref H and Cycle 1 design activities, the nacelles were only translated and pitched. In the cycle 2 design effort the nacelles can translate vertically, and pitch to accommodate the changes in the lower surface geometry. The diverter heights (between their leading and trailing edges) were modified during design as the shape of the lower wing changed, with the drag of the diverter changing accordingly. Both adjoint and finite difference gradients were used during optimization. The adjoint-based gradients were found to give good direction in the design space for configurations near the starting point, but as the design approached a minimum, the finite difference gradients were found to be more accurate. Use of finite difference gradients was limited by the

Induction of Tca8113 tumor cell apoptosis by icotinib is associated with reactive oxygen species mediated p38-MAPK activation.

PubMed

Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang

2014-08-01

Icotinib, a selective EGFR tyrosine kinase inhibitor (EGFR-TKI), has been shown to exhibit anti-tumor activity against several tumor cell lines. However, the exact molecular mechanism of icotinib's anti-tumor effect remains unknown. This study aims to examine the zytotoxic effect of icotinib on Tca8113 cells and its potential molecular mechanism. Icotinib significantly resulted in dose-dependent cell death as determined by MTT assay, accompanied by increased levels of Bax and DNA fragmentation. Icotinib could also induce Reactive Oxygen Species (ROS) generation. Further studies confirmed that scavenging of reactive oxygen species by N-acetyl-L-cysteine (NAC), and pharmacological inhibition of MAPK reversed icotinib-induced apoptosis in Tca8113 cells. Our data provide evidence that icotinib induces apoptosis, possibly via ROS-mediated MAPK pathway in Tca8113 cells.

Oxaloacetate-to-malate conversion by mineral photoelectrochemistry: implications for the viability of the reductive tricarboxylic acid cycle in prebiotic chemistry

NASA Astrophysics Data System (ADS)

Guzman, Marcelo I.; Martin, Scot T.

2008-10-01

The carboxylic acids produced by the reductive tricarboxylic acid (rTCA) cycle are possibly a biosynthetic core of initial life, although several steps such as the reductive kinetics of oxaloacetate (OAA) to malate (MA) are problematic by conventional chemical routes. In this context, we studied the kinetics of this reaction as promoted by ZnS mineral photoelectrochemistry. The quantum efficiency φMA of MA production from the photoelectrochemical reduction of OAA followed φMA=0.13 [OAA] (2.1×10-3+[OAA])-1 and was independent of temperature (5 to 50°C). To evaluate the importance of this forward rate under a prebiotic scenario, we also studied the temperature-dependent rate of the backward thermal decarboxylation of OAA to pyruvate (PA), which followed an Arrhenius behavior as log (k-2)=11.74 4956/T, where k-2 is in units of s-1. These measured rates were employed in conjunction with the indirectly estimated carboxylation rate of PA to OAA to assess the possible importance of mineral photoelectrochemistry in the conversion of OAA to MA under several scenarios of prebiotic conditions on early Earth. As an example, our analysis shows that there is 90% efficiency with a forward velocity of 3 yr/cycle for the OAA→MA step of the rTCA cycle at 280 K. Efficiency and velocity both decrease for increasing temperature. These results suggest high viability for mineral photoelectrochemistry as an enzyme-free engine to drive the rTCA cycle through the early aeons of early Earth, at least for the investigated OAA→MA step.

Glutamatergic and GABAergic neurotransmitter cycling and energy metabolism in rat cerebral cortex during postnatal development.

PubMed

Chowdhury, Golam M I; Patel, Anant B; Mason, Graeme F; Rothman, Douglas L; Behar, Kevin L

2007-12-01

The contribution of glutamatergic and gamma-aminobutyric acid (GABA)ergic neurons to oxidative energy metabolism and neurotransmission in the developing brain is not known. Glutamatergic and GABAergic fluxes were assessed in neocortex of postnatal day 10 (P10) and 30 (P30) urethane-anesthetized rats infused intravenously with [1,6-(13)C(2)]glucose for different time intervals (time course) or with [2-(13)C]acetate for 2 to 3 h (steady state). Amino acid levels and (13)C enrichments were determined in tissue extracts ex vivo using (1)H-[(13)C]-NMR spectroscopy. Metabolic fluxes were estimated from the best fits of a three-compartment metabolic model (glutamatergic neurons, GABAergic neurons, and astroglia) to the (13)C-enrichment time courses of amino acids from [1,6-(13)C(2)]glucose, constrained by the ratios of neurotransmitter cycling (V(cyc))-to-tricarboxylic acid (TCA) cycle flux (V(TCAn)) calculated from the steady-state [2-(13)C]acetate enrichment data. From P10 to P30 increases in total neuronal (glutamate plus GABA) TCA cycle flux (3 x ; 0.24+/-0.05 versus 0.71+/-0.07 micromol per g per min, P<0.0001) and total neurotransmitter cycling flux (3.1 to 5 x ; 0.07 to 0.11 (+/-0.03) versus 0.34+/-0.03 micromol per g per min, P<0.0001) were approximately proportional. Incremental changes in total cycling (DeltaV(cyc(tot))) and neuronal TCA cycle flux (DeltaV(TCAn(tot))) between P10 and P30 were 0.23 to 0.27 and 0.47 micromol per g per min, respectively, similar to the approximately 1:2 relationship previously reported for adult cortex. For the individual neurons, increases in V(TCAn) and V(cyc) were similar in magnitude (glutamatergic neurons, 2.7 x versus 2.8 to 4.6 x ; GABAergic neurons, approximately 5 x versus approximately 7 x), although GABAergic flux changes were larger. The findings show that glutamate and GABA neurons undergo large and approximately proportional increases in neurotransmitter cycling and oxidative energy metabolism during this major

Anaplerotic Triheptanoin Diet Enhances Mitochondrial Substrate Use to Remodel the Metabolome and Improve Lifespan, Motor Function, and Sociability in MeCP2-Null Mice

PubMed Central

Li, Qun; Degano, Alicia L.; Penati, Judith; Zhuo, Justin; Roe, Charles R.; Ronnett, Gabriele V.

2014-01-01

Rett syndrome (RTT) is an autism spectrum disorder (ASD) caused by mutations in the X-linked MECP2 gene that encodes methyl-CpG binding protein 2 (MeCP2). Symptoms range in severity and include psychomotor disabilities, seizures, ataxia, and intellectual disability. Symptom onset is between 6-18 months of age, a critical period of brain development that is highly energy-dependent. Notably, patients with RTT have evidence of mitochondrial dysfunction, as well as abnormal levels of the adipokines leptin and adiponectin, suggesting overall metabolic imbalance. We hypothesized that one contributor to RTT symptoms is energy deficiency due to defective nutrient substrate utilization by the TCA cycle. This energy deficit would lead to a metabolic imbalance, but would be treatable by providing anaplerotic substrates to the TCA cycle to enhance energy production. We show that dietary therapy with triheptanoin significantly increased longevity and improved motor function and social interaction in male mice hemizygous for Mecp2 knockout. Anaplerotic therapy in Mecp2 knockout mice also improved indicators of impaired substrate utilization, decreased adiposity, increased glucose tolerance and insulin sensitivity, decreased serum leptin and insulin, and improved mitochondrial morphology in skeletal muscle. Untargeted metabolomics of liver and skeletal muscle revealed increases in levels of TCA cycle intermediates with triheptanoin diet, as well as normalizations of glucose and fatty acid biochemical pathways consistent with the improved metabolic phenotype in Mecp2 knockout mice on triheptanoin. These results suggest that an approach using dietary supplementation with anaplerotic substrate is effective in improving symptoms and metabolic health in RTT. PMID:25299635

IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...

EPA Pesticide Factsheets

On September 24, 2009, the Toxicological Review of Trichloroacetic Acid (TCA) and the charge to external peer reviewers were released for external peer review and public comment. The Toxicological Review and charge were reviewed internally by EPA and by other federal agencies and White House Offices before public release. In the new IRIS process, introduced by the EPA Administrator, all written comments on IRIS assessments submitted by other federal agencies and White House Offices will be made publicly available. Accordingly, interagency comments and the interagency science consultation draft of the IRIS Toxicological Review of Trichloroacetic Acid and the charge to external peer reviewers are posted on this site. The draft Toxicological Review of Trichloroacetic Acid provides scientific support and rationale for the hazard identification and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.

Topology of modified helical gears and Tooth Contact Analysis (TCA) program

NASA Technical Reports Server (NTRS)

Litvin, Faydor L.; Zhang, Jiao

1989-01-01

The contents of this report covers: (1) development of optimal geometries for crowned helical gears; (2) a method for their generation; (3) tooth contact analysis (TCA) computer programs for the analysis of meshing and bearing contact of the crowned helical gears; and (4) modelling and simulation of gear shaft deflection. The developed method for synthesis was used to determine the optimal geometry for a crowned helical pinion surface and was directed to localize the bearing contact and guarantee favorable shape and a low level of transmission errors. Two new methods for generation of the crowned helical pinion surface are proposed. One is based on the application of a tool with a surface of revolution that slightly deviates from a regular cone surface. The tool can be used as a grinding wheel or as a shaver. The other is based on a crowning pinion tooth surface with predesigned transmission errors. The pinion tooth surface can be generated by a computer-controlled automatic grinding machine. The TCA program simulates the meshing and bearing contact of the misaligned gears. The transmission errors are also determined. The gear shaft deformation was modelled and investigated. It was found that the deflection of gear shafts has the same effect as gear misalignment.

Citral exerts its antifungal activity against Penicillium digitatum by affecting the mitochondrial morphology and function.

PubMed

Zheng, Shiju; Jing, Guoxing; Wang, Xiao; Ouyang, Qiuli; Jia, Lei; Tao, Nengguo

2015-07-01

This work investigated the effect of citral on the mitochondrial morphology and function of Penicillium digitatum. Citral at concentrations of 2.0 or 4.0 μL/mL strongly damaged mitochondria of test pathogen by causing the loss of matrix and increase of irregular mitochondria. The deformation extent of the mitochondria of P. digitatum enhanced with increasing concentrations of citral, as evidenced by a decrease in intracellular ATP content and an increase in extracellular ATP content of P. digitatum cells. Oxygen consumption showed that citral resulted in an inhibition in the tricarboxylic acid cycle (TCA) pathway of P. digitatum cells, induced a decrease in activities of citrate synthetase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, succinodehydrogenase and the content of citric acid, while enhancing the activity of malic dehydrogenase in P. digitatum cells. Our present results indicated that citral could damage the mitochondrial membrane permeability and disrupt the TCA pathway of P. digitatum. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of tricarboxylic acid cycle regulator on carbon retention and organic component transformation during food waste composting.

PubMed

Lu, Qian; Zhao, Yue; Gao, Xintong; Wu, Junqiu; Zhou, Haixuan; Tang, Pengfei; Wei, Qingbin; Wei, Zimin

2018-05-01

Composting is an environment friendly method to recycling organic waste. However, with the increasing concern about greenhouse gases generated in global atmosphere, it is significant to reduce the emission of carbon dioxide (CO 2 ). This study analyzes tricarboxylic acid (TCA) cycle regulators on the effect of reducing CO 2 emission, and the relationship among organic component (OC) degradation and transformation and microorganism during composting. The results showed that adding adenosine tri-phosphate (ATP) and nicotinamide adenine dinucleotide (NADH) could enhance the transformation of OC and increase the diversity of microorganism community. Malonic acid (MA) as a competitive inhibitor could decrease the emission of CO 2 by inhibiting the TCA cycle. A structural equation model was established to explore effects of different OC and microorganism on humic acid (HA) concentration during composting. Furthermore, added MA provided an environmental benefit in reducing the greenhouse gas emission for manufacture sustainable products. Copyright © 2018 Elsevier Ltd. All rights reserved.

Delineating potential epileptogenic areas utilizing resting functional magnetic resonance imaging (fMRI) in epilepsy patients.

PubMed

Pizarro, Ricardo; Nair, Veena; Meier, Timothy; Holdsworth, Ryan; Tunnell, Evelyn; Rutecki, Paul; Sillay, Karl; Meyerand, Mary E; Prabhakaran, Vivek

2016-08-01

Seizure localization includes neuroimaging like electroencephalogram, and magnetic resonance imaging (MRI) with limited ability to characterize the epileptogenic network. Temporal clustering analysis (TCA) characterizes epileptogenic network congruent with interictal epileptiform discharges by clustering together voxels with transient signals. We generated epileptogenic areas for 12 of 13 epilepsy patients with TCA, congruent with different areas of seizure onset. Resting functional MRI (fMRI) scans are noninvasive, and can be acquired quickly, in patients with different levels of severity and function. Analyzing resting fMRI data using TCA is quick and can complement clinical methods to characterize the epileptogenic network.

Dislocation Density Reduction in Cadmium Telluride and Mercury Cadmium Telluride Grown on Silicon Using Thermal Cycle Annealing

NASA Astrophysics Data System (ADS)

Farrell, Stuart Bennett

resulted in almost a two order of magnitude reduction in the dislocation density, and factor of two reduction in the full width at half maximum of the x-ray rocking curves. Photoluminescence also suggested a decrease in the number of dislocations present in the material. This decrease is attributed to the movement of the dislocations during the annealing cycles and their subsequent interaction and annihilation. To decrease the dislocation density in HgCdTe layers grown on CdTe/Si composite substrates, ex situ TCA has been performed in a sealed quartz ampoule under a mercury overpressure in a conventional clam-shell furnace. The reduction in the dislocation density has been studied as a function of growth/annealing parameters such as the initial (as grown) dislocation density, buffer layer quality, Hg overpressure, annealing temperature, annealing duration, and the number of annealing cycles. It was found that the primary parameters that affect dislocation density reduction are the annealing temperature and the number of annealing cycles. Some secondary affects were observed by varying the duration spent at the maximum annealing temperature. Parameters such as the initial dislocation density and buffer layer quality did not play a significant role in dislocation reduction. Though no correlation between Hg overpressure and dislocation density was found, it did play a vital role in maintaining the quality of the surface. By using the ex situ TCA, a dislocation density of 1 x 106 cm-2 could be reliably and consistently achieved in HgCdTe layers that had a starting density ranging from 0.5 -- 3 x 107 cm-2. Examination of the annealing parameters revealed an exponential decay in the dislocation density as a function of increasing number of annealing cycles. In addition, a similar exponential decay was observed between the dislocation density and the annealing temperature. The decrease in the dislocation density is once again attributed to moving dislocations that interact and

Renal function and plasma volume following ultramarathon cycling.

PubMed

Neumayr, G; Pfister, R; Hoertnagl, H; Mitterbauer, G; Prokop, W; Joannidis, M

2005-01-01

In recreational cyclists marathon cycling influences renal function only on a minimal scale. Respective information on extreme ultramarathon cycling in better trained athletes is not available. The objective was to evaluate the renal and haematological effects of ultraendurance cycling in the world's best ultramarathon cyclists. Creatinine (CR), urea, haemoglobin (Hb), haematocrit (Hct) and plasma volume (PV) were investigated in 16 male ultramarathon cyclists during the 1st Race Across the Alps in 2001 (distance: 525 km; cumulative altitude difference: 12,600 m). All renal functional parameters were normal pre-exercise. During the race serum CR, urea and uric acid rose significantly by 33, 97 % and 18 % (p <0.001 respectively) and nearly normalised again on the following day. The decline in calculated CR clearance was 25 %. There was a negative correlation (r=- 0.575, p=0.02) between the rise in serum CR and the athlete's training kilometers. The serum urea/CR ratio rose above 40 in 12 athletes (75 %). Mean fractional sodium excretion and fractional uric acid excretion fell below 0.5 % (p <0.001) and 7 %, indicating reduced renal perfusion. The deflection of the renal functional parameters was temporary and nearly gone after 24 hours of recovery. Hct declined during the race from 0.44 to 0.42, and continued falling on the next day (0.42 --> 0.40; p <0.001). The corresponding rises in calculated PV were + 8 % and + 22 %. The study affirms that in world class cyclists the enormous strains of ultramarathon cycling influence renal function only on a minimal scale. The impact on the PV, however, is pronounced leading to marked haemodilution post-exercise. This very temporary "impairment of renal function" seems to be the physiological response to ultramarathon cycling and may be attenuated to some extent by preceding high-volume training.

Fiat lux! Phylogeny and bioinformatics shed light on GABA functions in plants.

PubMed

Renault, Hugues

2013-06-01

The non-protein amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to a wide variety of environmental cues. Recent data point toward an involvement of GABA in tricarboxylic acid (TCA) cycle activity and respiration, especially in stressed roots. To gain further insights into potential GABA functions in plants, phylogenetic and bioinformatic approaches were undertaken. Phylogenetic reconstruction of the GABA transaminase (GABA-T) protein family revealed the monophyletic nature of plant GABA-Ts. However, this analysis also pointed to the common origin of several plant aminotransferases families, which were found more similar to plant GABA-Ts than yeast and human GABA-Ts. A computational analysis of AtGABA-T co-expressed genes was performed in roots and in stress conditions. This second approach uncovered a strong connection between GABA metabolism and glyoxylate cycle during stress. Both in silico analyses open new perspectives and hypotheses for GABA metabolic functions in plants.

Treatment of Functional Abdominal Pain With Antidepressants: Benefits, Adverse Effects, and the Gastroenterologist's Role.

PubMed

Zar-Kessler, Claire A M; Belkind-Gerson, Jaime; Bender, Suzanne; Kuo, Braden M

2017-07-01

Pediatric functional abdominal pain is often treated with tricyclic antidepressants (TCAs) and selective serotonin reuptake inhibitors (SSRIs). The aim is investigating antidepressant use for treatment efficacy, correlation of response to psychiatric factors, and impact of adverse effects in regard to physicians' prescribing patterns. Retrospective review (2005-2013) children (5-21 years old) with functional abdominal pain treated with SSRI or TCA. Of the 531 cases with functional abdominal pain, 192 initiated SSRIs or TCAs while followed by gastroenterology. Charts reviewed for symptoms, adverse effects, and response: decreased pain or increased daily functioning. Sixty-three of 84 (75%) SSRI patients improved, 56 of 92 (61%) TCA patients improved (P = 0.03). Logistic regression controlling for psychiatric factors: SSRI remained significant over TCA (P = 0.04). Thirty-two of 67 (48%) patients with constipation received TCAs and 26 of 45 (58%) patients with diarrhea received SSRIs (P = 0.64). Three SSRI patients reported gastrointestinal effects, all diarrheal-type symptoms, and 2 TCA patients reported gastrointestinal effects, both constipation, in all it led to discontinuation. Thirteen (29%) of diarrheal-type patients reported adverse effects causing discontinuation as compared to 7 (8%) in the constipation group (P = .01). Twenty-one (25%) SSRI patients reported adverse effects with 5 (6%) mood disturbances. Twenty (22%) TCA patients reported adverse effects, 13 (14%) with mood disturbances (P = .07). Overall, 12 (14%) SSRI patients discontinued medication due to adverse effects, whereas 16 (17%) TCA patients (P = 0.24) did. Patients had significantly greater response to SSRIs than TCAs, remaining significant after controlling for psychiatric factors. Little significance is given to patient's associated gastrointestinal symptoms, frequently resulting in adverse effects and termination of medication.

Comparison of Optimal Thermodynamic Models of the Tricarboxylic Acid Cycle from Heterotrophs, Cyanobacteria, and Green Sulfur Bacteria.

PubMed

Thomas, Dennis G; Jaramillo-Riveri, Sebastian; Baxter, Douglas J; Cannon, William R

2014-12-26

We have applied a new stochastic simulation approach to predict the metabolite levels, material flux, and thermodynamic profiles of the oxidative TCA cycles found in E. coli and Synechococcus sp. PCC 7002, and in the reductive TCA cycle typical of chemolithoautotrophs and phototrophic green sulfur bacteria such as Chlorobaculum tepidum. The simulation approach is based on modeling states using statistical thermodynamics and employs an assumption similar to that used in transition state theory. The ability to evaluate the thermodynamics of metabolic pathways allows one to understand the relationship between coupling of energy and material gradients in the environment and the self-organization of stable biological systems, and it is shown that each cycle operates in the direction expected due to its environmental niche. The simulations predict changes in metabolite levels and flux in response to changes in cofactor concentrations that would be hard to predict without an elaborate model based on the law of mass action. In fact, we show that a thermodynamically unfavorable reaction can still have flux in the forward direction when it is part of a reaction network. The ability to predict metabolite levels, energy flow, and material flux should be significant for understanding the dynamics of natural systems and for understanding principles for engineering organisms for production of specialty chemicals.

Shortening tobacco life cycle accelerates functional gene identification in genomic research.

PubMed

Ning, G; Xiao, X; Lv, H; Li, X; Zuo, Y; Bao, M

2012-11-01

Definitive allocation of function requires the introduction of genetic mutations and analysis of their phenotypic consequences. Novel, rapid and convenient techniques or materials are very important and useful to accelerate gene identification in functional genomics research. Here, over-expression of PmFT (Prunus mume), a novel FT orthologue, and PtFT (Populus tremula) lead to shortening of the tobacco life cycle. A series of novel short life cycle stable tobacco lines (30-50 days) were developed through repeated self-crossing selection breeding. Based on the second transformation via a gusA reporter gene, the promoter from BpFULL1 in silver birch (Betula pendula) and the gene (CPC) from Arabidopsis thaliana were effectively tested using short life cycle tobacco lines. Comparative analysis among wild type, short life cycle tobacco and Arabidopsis transformation system verified that it is optional to accelerate functional gene studies by shortening host plant material life cycle, at least in these short life cycle tobacco lines. The results verified that the novel short life cycle transgenic tobacco lines not only combine the advantages of economic nursery requirements and a simple transformation system, but also provide a robust, effective and stable host system to accelerate gene analysis. Thus, shortening tobacco life cycle strategy is feasible to accelerate heterologous or homologous functional gene identification in genomic research. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

Catabolism of α-Ketoglutarate by a sucA Mutant of Bradyrhizobium japonicum: Evidence for an Alternative Tricarboxylic Acid Cycle

PubMed Central

Green, Laura S.; Li, Youzhong; Emerich, David W.; Bergersen, Fraser J.; Day, David A.

2000-01-01

A complete tricarboxylic acid (TCA) cycle is generally considered necessary for energy production from the dicarboxylic acid substrates malate, succinate, and fumarate. However, a Bradyrhizobium japonicum sucA mutant that is missing α-ketoglutarate dehydrogenase is able to grow on malate as its sole source of carbon. This mutant also fixes nitrogen in symbiosis with soybean, where dicarboxylic acids are its principal carbon substrate. Using a flow chamber system to make direct measurements of oxygen consumption and ammonium excretion, we confirmed that bacteroids formed by the sucA mutant displayed wild-type rates of respiration and nitrogen fixation. Despite the absence of α-ketoglutarate dehydrogenase activity, whole cells of the mutant were able to decarboxylate α-[U-14C]ketoglutarate and [U-14C]glutamate at rates similar to those of wild-type B. japonicum, indicating that there was an alternative route for α-ketoglutarate catabolism. Because cell extracts from B. japonicum decarboxylated [U-14C]glutamate very slowly, the γ-aminobutyrate shunt is unlikely to be the pathway responsible for α-ketoglutarate catabolism in the mutant. In contrast, cell extracts from both the wild type and mutant showed a coenzyme A (CoA)-independent α-ketoglutarate decarboxylation activity. This activity was independent of pyridine nucleotides and was stimulated by thiamine PPi. Thin-layer chromatography showed that the product of α-ketoglutarate decarboxylation was succinic semialdehyde. The CoA-independent α-ketoglutarate decarboxylase, along with succinate semialdehyde dehydrogenase, may form an alternative pathway for α-ketoglutarate catabolism, and this pathway may enhance TCA cycle function during symbiotic nitrogen fixation. PMID:10781553

Integrated, Step-Wise, Mass-Isotopomeric Flux Analysis of the TCA Cycle.

PubMed

Alves, Tiago C; Pongratz, Rebecca L; Zhao, Xiaojian; Yarborough, Orlando; Sereda, Sam; Shirihai, Orian; Cline, Gary W; Mason, Graeme; Kibbey, Richard G

2015-11-03

Mass isotopomer multi-ordinate spectral analysis (MIMOSA) is a step-wise flux analysis platform to measure discrete glycolytic and mitochondrial metabolic rates. Importantly, direct citrate synthesis rates were obtained by deconvolving the mass spectra generated from [U-(13)C6]-D-glucose labeling for position-specific enrichments of mitochondrial acetyl-CoA, oxaloacetate, and citrate. Comprehensive steady-state and dynamic analyses of key metabolic rates (pyruvate dehydrogenase, β-oxidation, pyruvate carboxylase, isocitrate dehydrogenase, and PEP/pyruvate cycling) were calculated from the position-specific transfer of (13)C from sequential precursors to their products. Important limitations of previous techniques were identified. In INS-1 cells, citrate synthase rates correlated with both insulin secretion and oxygen consumption. Pyruvate carboxylase rates were substantially lower than previously reported but showed the highest fold change in response to glucose stimulation. In conclusion, MIMOSA measures key metabolic rates from the precursor/product position-specific transfer of (13)C-label between metabolites and has broad applicability to any glucose-oxidizing cell. Copyright © 2015 Elsevier Inc. All rights reserved.

TLNS3D/CDISC Multipoint Design of the TCA Concept

NASA Technical Reports Server (NTRS)

Campbell, Richard L.; Mann, Michael J.

1999-01-01

This paper presents the work done to date by the authors on developing an efficient approach to multipoint design and applying it to the design of the HSR TCA (High Speed Research Technology Concept Aircraft) configuration. While the title indicates that this exploratory study has been performed using the TLNS3DMB flow solver and the CDISC (Constrained Direct Iterative Surface Curvature) design method, the CDISC method could have been used with any flow solver, and the multipoint design approach does not require the use of CDISC. The goal of the study was to develop a multipoint design method that could achieve a design in about the same time as 10 analysis runs.

Methicillin-Susceptible Teicoplanin-Resistant Staphylococcus haemolyticus Isolate from a Bloodstream Infection with Novel Mutations in the tcaRAB Teicoplanin Resistance Operon.

PubMed

Bakthavatchalam, Yamuna Devi; Sudarsanam, Thambu David; Babu, Priyanka; Munuswamy, Elakkiya; Muthuirulandi Sethuvel, Dhiviya Prabaa; Devanga Ragupathi, Naveen Kumar; Veeraraghavan, Balaji

2017-07-24

Staphylococcus haemolyticus is a coagulase-negative staphylococcus that is frequently isolated from blood cultures. Here, we report a case of methicillin-susceptible S. haemolyticus that is resistant to teicoplanin (TEC) and heteroresistant to vancomycin (VAN). The isolate was susceptible to cefoxitin and resistant to TEC by Etest. Population analysis profile-area under the curve analysis confirmed the presence of a VAN heteroresistant subpopulation. Next-generation sequencing analysis of the genome revealed the presence of blaZ and msr(A), which encode cross-resistance to macrolide, lincosamide, and streptogramin B, and the quinolone resistance-conferring gene norA. In addition, several amino acid substitutions were observed in the TEC resistance operon tcaRAB, including I3N, I390N, and L450I in tcaA and L44V, G52V, and S87P in tcaR, as well as in the transpeptidase encoding gene walK (D336Y, R375L, and V404A) and L315 and P316 in graS. We hypothesized that this combination of mutations could confer TEC resistance and reduced VAN susceptibility.

Glutamate is the major anaplerotic substrate in the tricarboxylic acid cycle of isolated rumen epithelial and duodenal mucosal cells from beef cattle

USDA-ARS?s Scientific Manuscript database

This study aimed to determine the contribution of substrates to tricarboxylic acid (TCA) cycle fluxes in rumen epithelial (REC) and duodenal mucosal (DMC) cells isolated from bulls (n = 6) fed either a 75% forage (HF) or 75% concentrate (HC) diet. In separate incubations, [13C6]glucose, [13C5]glutam...

Deletion of the transcriptional coactivator PGC1α in skeletal muscles is associated with reduced expression of genes related to oxidative muscle function.

PubMed

Hatazawa, Yukino; Minami, Kimiko; Yoshimura, Ryoji; Onishi, Takumi; Manio, Mark Christian; Inoue, Kazuo; Sawada, Naoki; Suzuki, Osamu; Miura, Shinji; Kamei, Yasutomi

2016-12-09

The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared with that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α's function in the oxidative energy metabolism of skeletal muscles. Copyright © 2016 Elsevier Inc. All rights reserved.

Central metabolism controls transcription of a virulence gene regulator in Vibrio cholerae

PubMed Central

Minato, Yusuke; Fassio, Sara R.; Wolfe, Alan J.

2013-01-01

ToxT is the central regulatory protein involved in activation of the main virulence genes in Vibrio cholerae. We have identified transposon insertions in central metabolism genes, whose disruption increases toxT transcription. These disrupted genes encode the primary respiration-linked sodium pump (NADH : ubiquinone oxidoreductase or NQR) and certain tricarboxylic acid (TCA) cycle enzymes. Observations made following stimulation of respiration in the nqr mutant or chemical inhibition of NQR activity in the TCA cycle mutants led to the hypothesis that NQR affects toxT transcription via the TCA cycle. That toxT transcription increased when the growth medium was supplemented with citrate, but decreased with oxaloacetate, focused our attention on the TCA cycle substrate acetyl-CoA and its non-TCA cycle metabolism. Indeed, both the nqr and the TCA cycle mutants increased acetate excretion. A similar correlation between acetate excretion and toxT transcription was observed in a tolC mutant and upon amino acid (NRES) supplementation. As acetate and its tendency to decrease pH exerted no strong effect on toxT transcription, and because disruption of the major acetate excretion pathway increased toxT transcription, we propose that toxT transcription is regulated by either acetyl-CoA or some close derivative. PMID:23429745

The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows

PubMed Central

White, Heather M.

2015-01-01

The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows. PMID:26479386

The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows.

PubMed

White, Heather M

2015-08-18

The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows.

Metabonomics Indicates Inhibition of Fatty Acid Synthesis, β-Oxidation, and Tricarboxylic Acid Cycle in Triclocarban-Induced Cardiac Metabolic Alterations in Male Mice.

PubMed

Xie, Wenping; Zhang, Wenpeng; Ren, Juan; Li, Wentao; Zhou, Lili; Cui, Yuan; Chen, Huiming; Yu, Wenlian; Zhuang, Xiaomei; Zhang, Zhenqing; Shen, Guolin; Li, Haishan

2018-02-14

Triclocarban (TCC) has been identified as a new environmental pollutant that is potentially hazardous to human health; however, the effects of short-term TCC exposure on cardiac function are not known. The aim of this study was to use metabonomics and molecular biology techniques to systematically elucidate the molecular mechanisms of TCC-induced effects on cardiac function in mice. Our results show that TCC inhibited the uptake, synthesis, and oxidation of fatty acids, suppressed the tricarboxylic acid (TCA) cycle, and increased aerobic glycolysis levels in heart tissue after short-term TCC exposure. TCC also inhibited the nuclear peroxisome proliferator-activated receptor α (PPARα), confirming its inhibitory effects on fatty acid uptake and oxidation. Histopathology and other analyses further confirm that TCC altered mouse cardiac physiology and pathology, ultimately affecting normal cardiac metabolic function. We elucidate the molecular mechanisms of TCC-induced harmful effects on mouse cardiac metabolism and function from a new perspective, using metabonomics and bioinformatics analysis data.

MicroTCA-based Global Trigger Upgrade project for the CMS experiment at LHC

NASA Astrophysics Data System (ADS)

Rahbaran, B.; Arnold, B.; Bergauer, H.; Eichberger, M.; Rabady, D.

2011-12-01

The electronics of the first Level Global Trigger (GT) of CMS is the last stage of the Level-1 trigger system [1]. At LHC up to 40 million collisions of proton bunches occur every second, resulting in about 800 million proton collisions. The CMS Level-1 Global Trigger [1], a custom designed electronics system based on FPGA technology and the VMEbus system, performs a quick on-line analysis of each collision every 25 ns and decides whether to reject or to accept it for further analysis. The CMS trigger group of the Institute of High Energy Physics in Vienna (HEPHY) is involved in the Level-1 trigger of the CMS experiment at CERN. As part of the Trigger Upgrade, the Level-1 Global Trigger will be redesigned and implemented in MicroTCA based technology, which allows engineers to detect all possible faults on plug-in boards, in the power supply and in the cooling system. The upgraded Global Trigger will be designed to have the same basic categories of functions as the present GT, but will have more algorithms and more possibilities for combining trigger candidates. Additionally, reconfigurability and testability will be supported based on the next system generation.

PEPCK-M expression in mouse liver potentiates, not replaces, PEPCK-C mediated gluconeogenesis

PubMed Central

Méndez-Lucas, Andrés; Duarte, João; Sunny, Nishanth E.; Satapati, Santhosh; He, TianTeng; Fu, Xiaorong; Bermúdez, Jordi; Burgess, Shawn C.; Perales, Jose C.

2013-01-01

Background & Aims Hepatic gluconeogenesis helps maintain systemic energy homeostasis by compensating for discontinuities in nutrient supply. Liver specific deletion of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) abolishes gluconeogenesis from mitochondrial substrates, deregulates lipid metabolism and affects TCA cycle. While, mouse liver almost exclusively expresses PEPCK-C, humans equally present a mitochondrial isozyme (PEPCK-M). Despite clear relevance to human physiology, the role of PEPCK-M and its gluconeogenic potential remain unknown. Here, we test the significance of PEPCK-M in gluconeogenesis and TCA cycle function in liver-specific PEPCK-C knockout and WT mice. Methods The effects of the overexpression of PEPCK-M were examined by a combination of tracer studies and molecular biology techniques. Partial PEPCK-C re-expression was used as a positive control. Metabolic fluxes were evaluated in isolated livers by NMR using 2H and 13C tracers. Gluconeogenic potential, together with metabolic profiling, were investigated in vivo and in primary hepatocytes. Results PEPCK-M expression partially rescued defects in lipid metabolism, gluconeogenesis and TCA cycle function impaired by PEPCK-C deletion, while ~10% re-expression of PEPCK-C normalized most parameters. When PEPCK-M was expressed in the presence of PEPCK-C, the mitochondrial isozyme amplified total gluconeogenic capacity, suggesting autonomous regulation of oxaloacetate to phosphoenolpyruvate fluxes by the individual isoforms. Conclusions We conclude that PEPCK-M has gluconeogenic potential per se, and cooperates with PEPCK-C to adjust gluconeogenic/TCA flux to changes in substrate or energy availability, hinting at a role in the regulation of glucose and lipid metabolism in human liver. PMID:23466304

Dynamic changes in functional cerebral connectivity of spatial cognition during the menstrual cycle.

PubMed

Weis, Susanne; Hausmann, Markus; Stoffers, Barbara; Sturm, Walter

2011-10-01

Functional cerebral asymmetries (FCAs) in women have been shown to vary with changing levels of sex hormones during the menstrual cycle. Previous studies have suggested that interhemispheric interaction forms a key component in generating FCAs and it has been shown behaviorally and by functional imaging that interhemispheric interaction changes during the menstrual cycle, at least for a left hemisphere dominant task. We used functional MRI and an analysis of functional connectivity to examine whether changes in right hemisphere advantage for a figure comparison task as found in behavioral studies, are based on comparable mechanisms like those identified for the verbal task. Women were examined three times during the menstrual cycle, during the menstrual, follicular and luteal phases. The behavioral data confirmed the right hemisphere advantage for the figure comparison task as well as changes of the right hemisphere advantage during the menstrual cycle. Imaging data showed cycle phase-related changes in lateralized brain activation within the task-dominant hemisphere and changes in connectivity between nonhomotopic areas of both hemispheres, suggesting that changes in functional brain organization in women during the menstrual cycle are not only restricted to hormone-related changes of interhemispheric inhibition between homotopic areas, as has been proposed earlier, but might additionally apply to changes of neuronal processes within the hemispheres which seem to be modulated by heterotopic functional connectivity between hemispheres. Copyright © 2010 Wiley-Liss, Inc.

Chlorination by-products in drinking water and menstrual cycle function.

PubMed

Windham, Gayle C; Waller, Kirsten; Anderson, Meredith; Fenster, Laura; Mendola, Pauline; Swan, Shanna

2003-06-01

We analyzed data from a prospective study of menstrual cycle function and early pregnancy loss to explore further the effects of trihalomethanes (THM) on reproductive end points. Premenopausal women ((italic)n(/italic) = 403) collected urine samples daily during an average of 5.6 cycles for measurement of steroid metabolites that were used to define menstrual parameters such as cycle and phase length. Women were asked about consumption of various types of water as well as other habits and demographics. A THM level was estimated for each cycle based on residence and quarterly measurements made by water utilities during a 90-day period beginning 60 days before the cycle start date. We found a monotonic decrease in mean cycle length with increasing total THM (TTHM) level; at > 60 microg/L, the adjusted decrement was 1.1 days [95% confidence interval (CI), -1.8 to -0.40], compared with less than or equal to 40 microg/L. This finding was also reflected as a reduced follicular phase length (difference -0.94 day; 95% CI, -1.6 to -0.24). A decrement in cycle and follicular phase length of 0.18 days (95% CI, -0.29 to -0.07) per 10 microg/L unit increase in TTHM concentration was found. There was little association with luteal phase length, menses length, or cycle variability. Examining the individual THMs by quartile, we found the greatest association with chlorodibromomethane or the sum of the brominated compounds. Incorporating tap water consumption showed a similar pattern of reduced cycle length with increasing TTHM exposure. These findings suggest that THM exposure may affect ovarian function and should be confirmed in other studies.

Poly(3-hydroxybutyrate) fuels the tricarboxylic acid cycle and de novo lipid biosynthesis during Bacillus anthracis sporulation.

PubMed

Sadykov, Marat R; Ahn, Jong-Sam; Widhelm, Todd J; Eckrich, Valerie M; Endres, Jennifer L; Driks, Adam; Rutkowski, Gregory E; Wingerd, Kevin L; Bayles, Kenneth W

2017-06-01

Numerous bacteria accumulate poly(3-hydroxybutyrate) (PHB) as an intracellular reservoir of carbon and energy in response to imbalanced nutritional conditions. In Bacillus spp., where PHB biosynthesis precedes the formation of the dormant cell type called the spore (sporulation), the direct link between PHB accumulation and efficiency of sporulation was observed in multiple studies. Although the idea of PHB as an intracellular carbon and energy source fueling sporulation was proposed several decades ago, the mechanisms underlying PHB contribution to sporulation have not been defined. Here, we demonstrate that PHB deficiency impairs Bacillus anthracis sporulation through diminishing the energy status of the cells and by reducing carbon flux into the tricarboxylic acid (TCA) cycle and de novo lipid biosynthesis. Consequently, this metabolic imbalance decreased biosynthesis of the critical components required for spore integrity and resistance, such as dipicolinic acid (DPA) and the spore's inner membrane. Supplementation of the PHB deficient mutant with exogenous fatty acids overcame these sporulation defects, highlighting the importance of the TCA cycle and lipid biosynthesis during sporulation. Combined, the results of this work reveal the molecular mechanisms of PHB contribution to B. anthracis sporulation and provide valuable insight into the metabolic requirements for this developmental process in Bacillus species. © 2017 John Wiley & Sons Ltd.

Achromobacter denitrificans Strain YD35 Pyruvate Dehydrogenase Controls NADH Production To Allow Tolerance to Extremely High Nitrite Levels

PubMed Central

Doi, Yuki; Shimizu, Motoyuki; Fujita, Tomoya; Nakamura, Akira; Takizawa, Noboru

2014-01-01

We identified the extremely nitrite-tolerant bacterium Achromobacter denitrificans YD35 that can grow in complex medium containing 100 mM nitrite (NO2−) under aerobic conditions. Nitrite induced global proteomic changes and upregulated tricarboxylate (TCA) cycle enzymes as well as antioxidant proteins in YD35. Transposon mutagenesis generated NO2−-hypersensitive mutants of YD35 that had mutations at genes for aconitate hydratase and α-ketoglutarate dehydrogenase in the TCA cycle and a pyruvate dehydrogenase (Pdh) E1 component, indicating the importance of TCA cycle metabolism to NO2− tolerance. A mutant in which the pdh gene cluster was disrupted (Δpdh mutant) could not grow in the presence of 100 mM NO2−. Nitrite decreased the cellular NADH/NAD+ ratio and the cellular ATP level. These defects were more severe in the Δpdh mutant, indicating that Pdh contributes to upregulating cellular NADH and ATP and NO2−-tolerant growth. Exogenous acetate, which generates acetyl coenzyme A and then is metabolized by the TCA cycle, compensated for these defects caused by disruption of the pdh gene cluster and those caused by NO2−. These findings demonstrate a link between NO2− tolerance and pyruvate/acetate metabolism through the TCA cycle. The TCA cycle mechanism in YD35 enhances NADH production, and we consider that this contributes to a novel NO2−-tolerating mechanism in this strain. PMID:24413603

Alternative Fuels in Epilepsy and Amyotrophic Lateral Sclerosis.

PubMed

Tefera, Tesfaye W; Tan, Kah Ni; McDonald, Tanya S; Borges, Karin

2017-06-01

This review summarises the recent findings on metabolic treatments for epilepsy and Amyotrophic Lateral Sclerosis (ALS) in honour of Professor Ursula Sonnewald. The metabolic impairments in rodent models of these disorders as well as affected patients are being discussed. In both epilepsy and ALS, there are defects in glucose uptake and reduced tricarboxylic acid (TCA) cycling, at least in part due to reduced amounts of C4 TCA cycle intermediates. In addition there are impairments in glycolysis in ALS. A reduction in glucose uptake can be addressed by providing the brain with alternative fuels, such as ketones or medium-chain triglycerides. As anaplerotic fuels, such as the triglyceride of heptanoate, triheptanoin, refill the TCA cycle C4/C5 intermediate pool that is deficient, they are ideal to boost TCA cycling and thus the oxidative metabolism of all fuels.

Icotinib inhibits the invasion of Tca8113 cells via downregulation of nuclear factor κB-mediated matrix metalloproteinase expression

PubMed Central

YANG, CAILING; YAN, JIANGUO; YUAN, GUOYAN; ZHANG, YINGHUA; LU, DERONG; REN, MINGXIN; CUI, WEIGANG

2014-01-01

Icotinib is an epidermal growth factor receptor tyrosine kinase inhibitor, which has been revealed to inhibit proliferation in tumor cells. However, the effect of icotinib on cancer cell metastasis remains to be explained. This study examines the effect of icotinib on the migration and invasion of squamous cells of tongue carcinoma (Tca8113 cells) in vitro. The results of the Boyden chamber invasion assay demonstrated that icotinib reduced cell invasion, suppressed the protein levels of matrix metalloproteinases (MMPs), MMP-2 and MMP-9, and increased the expression of tissue inhibitor of metalloproteinase-1. In addition, icotinib was found to significantly decrease the protein levels of nuclear factor κB (NF-κB) p65, which suggested that icotinib inhibits NF-κB activity. Furthermore, treatment with the NF-κB inhibitor, pyrrolidine dithiocarbamate, suppressed cell invasion and MMP-2 expression. These results suggested that icotinib inhibits the invasion of Tca8113 cells by downregulating MMP via the inactivation of the NF-κB signaling pathways. PMID:25120710

Icotinib inhibits the invasion of Tca8113 cells via downregulation of nuclear factor κB-mediated matrix metalloproteinase expression.

PubMed

Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang

2014-09-01

Icotinib is an epidermal growth factor receptor tyrosine kinase inhibitor, which has been revealed to inhibit proliferation in tumor cells. However, the effect of icotinib on cancer cell metastasis remains to be explained. This study examines the effect of icotinib on the migration and invasion of squamous cells of tongue carcinoma (Tca8113 cells) in vitro . The results of the Boyden chamber invasion assay demonstrated that icotinib reduced cell invasion, suppressed the protein levels of matrix metalloproteinases (MMPs), MMP-2 and MMP-9, and increased the expression of tissue inhibitor of metalloproteinase-1. In addition, icotinib was found to significantly decrease the protein levels of nuclear factor κB (NF-κB) p65, which suggested that icotinib inhibits NF-κB activity. Furthermore, treatment with the NF-κB inhibitor, pyrrolidine dithiocarbamate, suppressed cell invasion and MMP-2 expression. These results suggested that icotinib inhibits the invasion of Tca8113 cells by downregulating MMP via the inactivation of the NF-κB signaling pathways.

Changes in executive function after acute bouts of passive cycling in Parkinson's disease.

PubMed

Ridgel, Angela L; Kim, Chul-Ho; Fickes, Emily J; Muller, Matthew D; Alberts, Jay L

2011-04-01

Individuals with Parkinson's disease (PD) often experience cognitive declines. Although pharmacologic therapies are helpful in treating motor deficits in PD, they do not appear to be effective for cognitive complications. Acute bouts of moderate aerobic exercise have been shown to improve cognitive function in healthy adults. However, individuals with PD often have difficulty with exercise. This study examined the effects of passive leg cycling on executive function in PD. Executive function was assessed with Trail-Making Test (TMT) A and B before and after passive leg cycling. Significant improvements on the TMT-B test occurred after passive leg cycling. Furthermore, the difference between times to complete the TMT-B and TMT-A significantly decreased from precycling to postcycling. Improved executive function after passive cycling may be a result of increases in cerebral blood flow. These findings suggest that passive exercise could be a concurrent therapy for cognitive decline in PD.

Configurable Crossbar Switch for Deterministic, Low-latency Inter-blade Communications in a MicroTCA Platform

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karamooz, Saeed; Breeding, John Eric; Justice, T Alan

As MicroTCA expands into applications beyond the telecommunications industry from which it originated, it faces new challenges in the area of inter-blade communications. The ability to achieve deterministic, low-latency communications between blades is critical to realizing a scalable architecture. In the past, legacy bus architectures accomplished inter-blade communications using dedicated parallel buses across the backplane. Because of limited fabric resources on its backplane, MicroTCA uses the carrier hub (MCH) for this purpose. Unfortunately, MCH products from commercial vendors are limited to standard bus protocols such as PCI Express, Serial Rapid IO and 10/40GbE. While these protocols have exceptional throughput capability,more » they are neither deterministic nor necessarily low-latency. To overcome this limitation, an MCH has been developed based on the Xilinx Virtex-7 690T FPGA. This MCH provides the system architect/developer complete flexibility in both the interface protocol and routing of information between blades. In this paper, we present the application of this configurable MCH concept to the Machine Protection System under development for the Spallation Neutron Sources's proton accelerator. Specifically, we demonstrate the use of the configurable MCH as a 12x4-lane crossbar switch using the Aurora protocol to achieve a deterministic, low-latency data link. In this configuration, the crossbar has an aggregate bandwidth of 48 GB/s.« less

Collagen Matrix Density Drives the Metabolic Shift in Breast Cancer Cells.

PubMed

Morris, Brett A; Burkel, Brian; Ponik, Suzanne M; Fan, Jing; Condeelis, John S; Aguirre-Ghiso, Julio A; Castracane, James; Denu, John M; Keely, Patricia J

2016-11-01

Increased breast density attributed to collagen I deposition is associated with a 4-6 fold increased risk of developing breast cancer. Here, we assessed cellular metabolic reprogramming of mammary carcinoma cells in response to increased collagen matrix density using an in vitro 3D model. Our initial observations demonstrated changes in functional metabolism in both normal mammary epithelial cells and mammary carcinoma cells in response to changes in matrix density. Further, mammary carcinoma cells grown in high density collagen matrices displayed decreased oxygen consumption and glucose metabolism via the tricarboxylic acid (TCA) cycle compared to cells cultured in low density matrices. Despite decreased glucose entry into the TCA cycle, levels of glucose uptake, cell viability, and ROS were not different between high and low density matrices. Interestingly, under high density conditions the contribution of glutamine as a fuel source to drive the TCA cycle was significantly enhanced. These alterations in functional metabolism mirrored significant changes in the expression of metabolic genes involved in glycolysis, oxidative phosphorylation, and the serine synthesis pathway. This study highlights the broad importance of the collagen microenvironment to cellular expression profiles, and shows that changes in density of the collagen microenvironment can modulate metabolic shifts of cancer cells. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Soil Functional Mapping: A Geospatial Framework for Scaling Soil Carbon Cycling

NASA Astrophysics Data System (ADS)

Lawrence, C. R.

2017-12-01

Climate change is dramatically altering biogeochemical cycles in most terrestrial ecosystems, particularly the cycles of water and carbon (C). These changes will affect myriad ecosystem processes of importance, including plant productivity, C exports to aquatic systems, and terrestrial C storage. Soil C storage represents a critical feedback to climate change as soils store more C than the atmosphere and aboveground plant biomass combined. While we know plant and soil C cycling are strongly coupled with soil moisture, substantial unknowns remain regarding how these relationships can be scaled up from soil profiles to ecosystems. This greatly limits our ability to build a process-based understanding of the controls on and consequences of climate change at regional scales. In an effort to address this limitation we: (1) describe an approach to classifying soils that is based on underlying differences in soil functional characteristics and (2) examine the utility of this approach as a scaling tool that honors the underlying soil processes. First, geospatial datasets are analyzed in the context of our current understanding of soil C and water cycling in order to predict soil functional units that can be mapped at the scale of ecosystems or watersheds. Next, the integrity of each soil functional unit is evaluated using available soil C data and mapping units are refined as needed. Finally, targeted sampling is conducted to further differentiate functional units or fill in any data gaps that are identified. Completion of this workflow provides new geospatial datasets that are based on specific soil functions, in this case the coupling of soil C and water cycling, and are well suited for integration with regional-scale soil models. Preliminary results from this effort highlight the advantages of a scaling approach that balances theory, measurement, and modeling.

FES-assisted Cycling Improves Aerobic Capacity and Locomotor Function Postcerebrovascular Accident.

PubMed

Aaron, Stacey E; Vanderwerker, Catherine J; Embry, Aaron E; Newton, Jennifer H; Lee, Samuel C K; Gregory, Chris M

2018-03-01

After a cerebrovascular accident (CVA) aerobic deconditioning contributes to diminished physical function. Functional electrical stimulation (FES)-assisted cycling is a promising exercise paradigm designed to target both aerobic capacity and locomotor function. This pilot study aimed to evaluate the effects of an FES-assisted cycling intervention on aerobic capacity and locomotor function in individuals post-CVA. Eleven individuals with chronic (>6 months) post-CVA hemiparesis completed an 8-wk (three times per week; 24 sessions) progressive FES-assisted cycling intervention. V˙O2peak, self-selected, and fastest comfortable walking speeds, gait, and pedaling symmetry, 6-min walk test (6MWT), balance, dynamic gait movements, and health status were measured at baseline and posttraining. Functional electrical stimulation-assisted cycling significantly improved V˙O2peak (12%, P = 0.006), self-selected walking speed (SSWS, 0.05 ± 0.1 m·s, P = 0.04), Activities-specific Balance Confidence scale score (12.75 ± 17.4, P = 0.04), Berg Balance Scale score (3.91 ± 4.2, P = 0.016), Dynamic Gait Index score (1.64 ± 1.4, P = 0.016), and Stroke Impact Scale participation/role domain score (12.74 ± 16.7, P = 0.027). Additionally, pedal symmetry, represented by the paretic limb contribution to pedaling (paretic pedaling ratio [PPR]) significantly improved (10.09% ± 9.0%, P = 0.016). Although step length symmetry (paretic step ratio [PSR]) did improve, these changes were not statistically significant (-0.05% ± 0.1%, P = 0.09). Exploratory correlations showed moderate association between change in SSWS and 6-min walk test (r = 0.74), and moderate/strong negative association between change in PPR and PSR. These results support FES-assisted cycling as a means to improve both aerobic capacity and locomotor function. Improvements in SSWS, balance, dynamic walking movements, and participation in familial and societal roles are important targets for rehabilitation of individuals

Evaluation of extraction methods for the identification of proteins from date palm (Phoenix dactylifera L.) seed and flesh.

PubMed

Lee, Hooi Xian; Ahmad, Fisal; Saad, Bahruddin; Ismail, Mohd Nazri

2017-11-26

Date fruits are well known to be very nutritious. Nevertheless, the protein contents of the fruit, particularly the seed and flesh, are still understudied, largely due to their difficult physical characteristics. This study was conducted to compare three different protein extraction methods which were the trichloroacetic acid (TCA)-acetone (TCA-A), phenol (Phe), and TCA-acetone-phenol (TCA-A-Phe), and to perform proteomic analysis on date palm seed and flesh. Phe extraction method showed the highest protein yields for both seed (8.26 mg/g) and flesh (1.57 mg/g). Through sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Phe, and TCA-A-Phe extraction methods were shown to be efficient in removing interfering compounds and gave well-resolved bands over a wide range of molecular weights. Following liquid chromatography-tandem mass spectrometry analysis, about 50-64% of extracted proteins were identified with known functions including those involved in glycolysis, Krebs cycle, defense, and storage. Phe protein extraction method was proven to be the optimal method for date flesh and seed.

Fumarate Reductase Activity Maintains an Energized Membrane in Anaerobic Mycobacterium tuberculosis

PubMed Central

Watanabe, Shinya; Zimmermann, Michael; Goodwin, Michael B.; Sauer, Uwe; Barry, Clifton E.; Boshoff, Helena I.

2011-01-01

Oxygen depletion of Mycobacterium tuberculosis engages the DosR regulon that coordinates an overall down-regulation of metabolism while up-regulating specific genes involved in respiration and central metabolism. We have developed a chemostat model of M. tuberculosis where growth rate was a function of dissolved oxygen concentration to analyze metabolic adaptation to hypoxia. A drop in dissolved oxygen concentration from 50 mmHg to 0.42 mmHg led to a 2.3 fold decrease in intracellular ATP levels with an almost 70-fold increase in the ratio of NADH/NAD+. This suggests that re-oxidation of this co-factor becomes limiting in the absence of a terminal electron acceptor. Upon oxygen limitation genes involved in the reverse TCA cycle were upregulated and this upregulation was associated with a significant accumulation of succinate in the extracellular milieu. We confirmed that this succinate was produced by a reversal of the TCA cycle towards the non-oxidative direction with net CO2 incorporation by analysis of the isotopomers of secreted succinate after feeding stable isotope (13C) labeled precursors. This showed that the resulting succinate retained both carbons lost during oxidative operation of the TCA cycle. Metabolomic analyses of all glycolytic and TCA cycle intermediates from 13C-glucose fed cells under aerobic and anaerobic conditions showed a clear reversal of isotope labeling patterns accompanying the switch from normoxic to anoxic conditions. M. tuberculosis encodes three potential succinate-producing enzymes including a canonical fumarate reductase which was highly upregulated under hypoxia. Knockout of frd, however, failed to reduce succinate accumulation and gene expression studies revealed a compensatory upregulation of two homologous enzymes. These major realignments of central metabolism are consistent with a model of oxygen-induced stasis in which an energized membrane is maintained by coupling the reductive branch of the TCA cycle to succinate

Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells

PubMed Central

Janzer, Andreas; German, Natalie J.; Gonzalez-Herrera, Karina N.; Asara, John M.; Haigis, Marcia C.; Struhl, Kevin

2014-01-01

Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation. PMID:25002509

Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells.

PubMed

Janzer, Andreas; German, Natalie J; Gonzalez-Herrera, Karina N; Asara, John M; Haigis, Marcia C; Struhl, Kevin

2014-07-22

Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation.

Artificial Autopolyploidization Modifies the Tricarboxylic Acid Cycle and GABA Shunt in Arabidopsis thaliana Col-0

NASA Astrophysics Data System (ADS)

Vergara, Fredd; Kikuchi, Jun; Breuer, Christian

2016-05-01

Autopolyploidy is a process whereby the chromosome set is multiplied and it is a common phenomenon in angiosperms. Autopolyploidy is thought to be an important evolutionary force that has led to the formation of new plant species. Despite its relevance, the consequences of autopolyploidy in plant metabolism are poorly understood. This study compares the metabolic profiles of natural diploids and artificial autotetraploids of Arabidopsis thaliana Col-0. Different physiological parameters are compared between diploids and autotetraploids using nuclear magnetic resonance (NMR), elemental analysis (carbon:nitrogen balance) and quantitative real-time PCR (qRT-PCR). The main difference between diploid and autotetraploid A. thaliana Col-0 is observed in the concentration of metabolites related to the tricarboxylic acid cycle (TCA) and γ-amino butyric acid (GABA) shunt, as shown by multivariate statistical analysis of NMR spectra. qRT-PCR shows that genes related to the TCA and GABA shunt are also differentially expressed between diploids and autotetraploids following similar trends as their corresponding metabolites. Solid evidence is presented to demonstrate that autopolyploidy influences core plant metabolic processes.

Mitochondrial Respiration Can Support NO(3) and NO(2) Reduction during Photosynthesis : Interactions between Photosynthesis, Respiration, and N Assimilation in the N-Limited Green Alga Selenastrum minutum.

PubMed

Weger, H G; Turpin, D H

1989-02-01

Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH(4) (+), NO(2) (-), NO(3) (-)) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO(2) release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH(4) (+) assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O(2) consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO(3) (-) and NO(2) (-) assimilation resulted in a larger stimulation of TCA cycle CO(2) release than did NH(4) (+), but a much smaller stimulation of mitochondrial O(2) consumption. NH(4) (+) assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO(3) (-) and NO(2) (-) assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH(4) (+), NO(3) (-) and NO(2) (-) assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO(3) (-) and NO(2) (-) assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O(2) consumption during NO(3) (-) and NO(2) (-) assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO(3) (-) and NO(2) (-) reduction.

Deletion of the transcriptional coactivator PGC1α in skeletal muscles is associated with reduced expression of genes related to oxidative muscle function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hatazawa, Yukino; Research Fellow of Japan Society for the Promotion of Science, Tokyo; Minami, Kimiko

The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared withmore » that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α’s function in the oxidative energy metabolism of skeletal muscles. - Highlights: • Microarray analysis was performed in the skeletal muscle of PGC1α KO mice. • Expression of genes in the oxidative energy metabolism was decreased. • Bioinformatic analysis of promoter region of the genes predicted involvement of ERR. • PGC1α KO microarray data in this study show the mirror image of transgenic data.« less

Isomerization of α-pinene in the terpentin oil with TCA/Natural Zeolite using microwave irradiation

NASA Astrophysics Data System (ADS)

Wijayati, N.; Supartono; Kusumastuti, E.

2018-04-01

The catalytic potensial of trichloroacetic acid (TCA)//Natural Zeolite in the isomerization of α-pinene in the terpentin oil was investigated. The purpose of this study is to investigate the influence of the power of microvawe on activity and selectivity of catalyst. The main product were champhene, terpinene, limonene, p-cymene, and terpinolene. The highest selectivity was 28.26% with a conversion of 23.25%, whereas the higher conversion was 98.99% with selectivity of 16.90% at room temperature using power of microwave 640 W.

Imaging Prostate Cancer (PCa) Phenotype and Evolution

DTIC Science & Technology

2015-10-01

has two isoforms: m-Acon (mitochondrial aconitase) and c-Acon ( cytoplasmic ; additionally functions as iron regulatory protein 1, when the iron levels...migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity, glycolysis and lactate, and increase

Viral affects on metabolism: changes in glucose and glutamine utilization during human cytomegalovirus infection

PubMed Central

Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.

2011-01-01

Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293

Asparagine plays a critical role in regulating cellular adaptation to glutamine depletion.

PubMed

Zhang, Ji; Fan, Jing; Venneti, Sriram; Cross, Justin R; Takagi, Toshimitsu; Bhinder, Bhavneet; Djaballah, Hakim; Kanai, Masayuki; Cheng, Emily H; Judkins, Alexander R; Pawel, Bruce; Baggs, Julie; Cherry, Sara; Rabinowitz, Joshua D; Thompson, Craig B

2014-10-23

Many cancer cells consume large quantities of glutamine to maintain TCA cycle anaplerosis and support cell survival. It was therefore surprising when RNAi screening revealed that suppression of citrate synthase (CS), the first TCA cycle enzyme, prevented glutamine-withdrawal-induced apoptosis. CS suppression reduced TCA cycle activity and diverted oxaloacetate, the substrate of CS, into production of the nonessential amino acids aspartate and asparagine. We found that asparagine was necessary and sufficient to suppress glutamine-withdrawal-induced apoptosis without restoring the levels of other nonessential amino acids or TCA cycle intermediates. In complete medium, tumor cells exhibiting high rates of glutamine consumption underwent rapid apoptosis when glutamine-dependent asparagine synthesis was suppressed, and expression of asparagine synthetase was statistically correlated with poor prognosis in human tumors. Coupled with the success of L-asparaginase as a therapy for childhood leukemia, the data suggest that intracellular asparagine is a critical suppressor of apoptosis in many human tumors.

Functional Interaction between Phosducin-like Protein 2 and Cytosolic Chaperonin Is Essential for Cytoskeletal Protein Function and Cell Cycle Progression

PubMed Central

Stirling, Peter C.; Srayko, Martin; Takhar, Karam S.; Pozniakovsky, Andrei; Hyman, Anthony A.

2007-01-01

The C haperonin Containing Tcp1 (CCT) maintains cellular protein folding homeostasis in the eukaryotic cytosol by assisting the biogenesis of many proteins, including actins, tubulins, and regulators of the cell cycle. Here, we demonstrate that the essential and conserved eukaryotic phosducin-like protein 2 (PhLP2/PLP2) physically interacts with CCT and modulates its folding activity. Consistent with this functional interaction, temperature-sensitive alleles of Saccharomyces cerevisiae PLP2 exhibit cytoskeletal and cell cycle defects. We uncovered several high-copy suppressors of the plp2 alleles, all of which are associated with G1/S cell cycle progression but which do not appreciably affect cytoskeletal protein function or fully rescue the growth defects. Our data support a model in which Plp2p modulates the biogenesis of several CCT substrates relating to cell cycle and cytoskeletal function, which together contribute to the essential function of PLP2. PMID:17429077

Functional laser speckle imaging of cerebral blood flow under hypothermia

NASA Astrophysics Data System (ADS)

Li, Minheng; Miao, Peng; Zhu, Yisheng; Tong, Shanbao

2011-08-01

Hypothermia can unintentionally occur in daily life, e.g., in cardiovascular surgery or applied as therapeutics in the neurosciences critical care unit. So far, the temperature-induced spatiotemporal responses of the neural function have not been fully understood. In this study, we investigated the functional change in cerebral blood flow (CBF), accompanied with neuronal activation, by laser speckle imaging (LSI) during hypothermia. Laser speckle images from Sprague-Dawley rats (n = 8, male) were acquired under normothermia (37°C) and moderate hypothermia (32°C). For each animal, 10 trials of electrical hindpaw stimulation were delivered under both temperatures. Using registered laser speckle contrast analysis and temporal clustering analysis (TCA), we found a delayed response peak and a prolonged response window under hypothermia. Hypothermia also decreased the activation area and the amplitude of the peak CBF. The combination of LSI and TCA is a high-resolution functional imaging method to investigate the spatiotemporal neurovascular coupling in both normal and pathological brain functions.

Mitochondrial Respiration Can Support NO3− and NO2− Reduction during Photosynthesis 1

PubMed Central

Weger, Harold G.; Turpin, David H.

1989-01-01

Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH4+, NO2−, NO3−) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO2 release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH4+ assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O2 consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO3− and NO2− assimilation resulted in a larger stimulation of TCA cycle CO2 release than did NH4+, but a much smaller stimulation of mitochondrial O2 consumption. NH4+ assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO3− and NO2− assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH4+, NO3− and NO2− assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO3− and NO2− assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O2 consumption during NO3− and NO2− assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO3− and NO2− reduction. PMID:16666557

Menstrual cycle-related changes of functional cerebral asymmetries in fine motor coordination.

PubMed

Bayer, Ulrike; Hausmann, Markus

2012-06-01

Fluctuating sex hormone levels during the menstrual cycle have been shown to affect functional cerebral asymmetries in cognitive domains. These effects seem to result from the neuromodulatory properties of sex hormones and their metabolites on interhemispheric processing. The present study was carried out to investigate whether functional cerebral asymmetries in fine motor coordination as reflected by manual asymmetries are also susceptible to natural sex hormonal variations during the menstrual cycle. Sixteen right-handed women with a regular menstrual cycle performed a finger tapping paradigm consisting of two conditions (simple, sequential) during the low hormone menstrual phase and the high estrogen and progesterone luteal phase. To validate the luteal phase, saliva levels of free progesterone (P) were analysed using chemiluminescence assays. As expected, normally cycling women showed a substantial decrease in manual asymmetries in a more demanding sequential tapping condition involving four fingers compared with simple (repetitive) finger tapping. This reduction in the degree of dominant (right) hand manual asymmetries was evident during the luteal phase. During the menstrual phase, however, manual asymmetries were even reversed in direction, indicating a slight advantage in favour of the non-dominant (left) hand. These findings suggest that functional cerebral asymmetries in fine motor coordination are affected by sex hormonal changes during the menstrual cycle, probably via hormonal modulations of interhemispheric interaction. © 2012 Elsevier Inc. All rights reserved.

13C-MFA delineates the photomixotrophic metabolism of Synechocystis sp. PCC 6803 under light- and carbon-sufficient conditions.

PubMed

You, Le; Berla, Bert; He, Lian; Pakrasi, Himadri B; Tang, Yinjie J

2014-05-01

The central carbon metabolism of cyanobacteria is under debate. For over 50 years, the lack of α-ketoglutarate dehydrogenase has led to the belief that cyanobacteria have an incomplete TCA cycle. Recent in vitro enzymatic experiments suggest that this cycle may in fact be closed. The current study employed (13) C isotopomers to delineate pathways in the cyanobacterium Synechocystis sp. PCC 6803. By tracing the incorporation of supplemented glutamate into the downstream metabolites in the TCA cycle, we observed a direct in vivo transformation of α-ketoglutarate to succinate. Additionally, isotopic tracing of glyoxylate did not show a functional glyoxylate shunt and glyoxylate was used for glycine synthesis. The photomixotrophic carbon metabolism was then profiled with (13) C-MFA under light and carbon-sufficient conditions. We observed that: (i) the in vivo flux through the TCA cycle reactions (α-ketoglutarate → succinate) was minimal (<2%); (ii) the flux ratio of CO2 fixation was six times higher than that of glucose utilization; (iii) the relative flux through the oxidative pentose phosphate pathway was low (<2%); (iv) high flux through malic enzyme served as a main route for pyruvate synthesis. Our results improve the understanding of the versatile metabolism in cyanobacteria and shed light on their application for photo-biorefineries. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mechanisms of Mitochondrial Defects in Gulf War Syndrome

DTIC Science & Technology

2012-08-01

oxidized; POR: porin; TCA: Tricarboxylic acid cycle ( Kreb cycle ). Page 2 Body: YEAR 1 of research (10/13/2009-7/14/2010) (9 months): Human... mitochondria , fatigue, myalgias 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON...abnormalities in genes that are related to mitochondrial function. Hence, investigation of mitochondrial dysfunction in GWS is a priority. Mitochondria

Molecular regulation of urea cycle function by the liver glucocorticoid receptor.

PubMed

Okun, Jürgen G; Conway, Sean; Schmidt, Kathrin V; Schumacher, Jonas; Wang, Xiaoyue; de Guia, Roldan; Zota, Annika; Klement, Johanna; Seibert, Oksana; Peters, Achim; Maida, Adriano; Herzig, Stephan; Rose, Adam J

2015-10-01

One of the major side effects of glucocorticoid (GC) treatment is lean tissue wasting, indicating a prominent role in systemic amino acid metabolism. In order to uncover a novel aspect of GCs and their intracellular-receptor, the glucocorticoid receptor (GR), on metabolic control, we conducted amino acid and acylcarnitine profiling in human and mouse models of GC/GR gain- and loss-of-function. Blood serum and tissue metabolite levels were determined in Human Addison's disease (AD) patients as well as in mouse models of systemic and liver-specific GR loss-of-function (AAV-miR-GR) with or without dexamethasone (DEX) treatments. Body composition and neuromuscular and metabolic function tests were conducted in vivo and ex vivo, the latter using precision cut liver slices. A serum metabolite signature of impaired urea cycle function (i.e. higher [ARG]:[ORN + CIT]) was observed in human (CTRL: 0.45 ± 0.03, AD: 1.29 ± 0.04; p < 0.001) and mouse (AAV-miR-NC: 0.97 ± 0.13, AAV-miR-GR: 2.20 ± 0.19; p < 0.001) GC/GR loss-of-function, with similar patterns also observed in liver. Serum urea levels were consistently affected by GC/GR gain- (∼+32%) and loss (∼-30%) -of-function. Combined liver-specific GR loss-of-function with DEX treatment revealed a tissue-autonomous role for the GR to coordinate an upregulation of liver urea production rate in vivo and ex vivo, and prevent hyperammonaemia and associated neuromuscular dysfunction in vivo. Liver mRNA expression profiling and GR-cistrome mining identified Arginase I (ARG1) a urea cycle gene targeted by the liver GR. The liver GR controls systemic and liver urea cycle function by transcriptional regulation of ARG1 expression.

Biochemical consequences of alginate encapsulation: a NMR study of insulin-secreting cells.

PubMed

Simpson, Nicholas E; Grant, Samuel C; Gustavsson, Lenita; Peltonen, Vilje-Mia; Blackband, Stephen J; Constantinidis, Ioannis

2006-04-01

In this study we explore the biochemical consequences of alginate encapsulation on betaTC3 cells. (13)C NMR spectroscopy and isotopomer analysis were used to investigate the effects of encapsulation on several enzymatic processes associated with the TCA cycle. Our data show statistically significant differences in various enzymatic fluxes related to the TCA cycle and insulin secretion between monolayer and alginate-encapsulated cultures. The principal cause for these effects was the process of trypsinization. Embedding the trypsinized cells in alginate beads did not have a compounded effect on the enzymatic fluxes of entrapped cells. However, an additional small but statistically significant decrease in insulin secretion was measured in encapsulated cells. Finally, differences in either enzymatic fluxes or glucose consumption as a function of bead diameter were not observed. However, differences in T(2), assessed by (1)H NMR microimaging, were observed as a function of bead diameter, suggesting that smaller beads became more organized with time in culture, while larger beads displayed a looser organization.

Urinary Loss of Tricarboxylic Acid Cycle Intermediates As Revealed by Metabolomics Studies: An Underlying Mechanism to Reduce Lipid Accretion by Whey Protein Ingestion?

PubMed Central

2015-01-01

Whey protein intake is associated with the modulation of energy metabolism and altered body composition both in human subjects and in animals, but the underlying mechanisms are not yet elucidated. We fed obesity-prone C57BL/6J mice high-fat diets with either casein (HF casein) or whey (HF whey) for 6 weeks. At equal energy intake and apparent fat and nitrogen digestibility, mice fed HF whey stored less energy as lipids, evident both as lower white adipose tissue mass and as reduced liver lipids, compared with HF-casein-fed mice. Explorative analyses of 48 h urine, both by 1H NMR and LC–MS metabolomic platforms, demonstrated higher urinary excretion of tricarboxylic acid (TCA) cycle intermediates citric acid and succinic acid (identified by both platforms), and cis-aconitic acid and isocitric acid (identified by LC–MS platform) in the HF whey, relative to in the HF-casein-fed mice. Targeted LC–MS analyses revealed higher citric acid and cis-aconitic acid concentrations in fed state plasma, but not in liver of HF-whey-fed mice. We propose that enhanced urinary loss of TCA cycle metabolites drain available substrates for anabolic processes, such as lipogenesis, thereby leading to reduced lipid accretion in HF-whey-fed compared to HF-casein-fed mice. PMID:24702026

Animal Models for Studying the In Vivo Functions of Cell Cycle CDKs.

PubMed

Risal, Sanjiv; Adhikari, Deepak; Liu, Kui

2016-01-01

Multiple Cdks (Cdk4, Cdk6, and Cdk2) and a mitotic Cdk (Cdk1) are involved in cell cycle progression in mammals. Cyclins, Cdk inhibitors, and phosphorylations (both activating and inhibitory) at different cellular levels tightly modulate the activities of these kinases. Based on the results of biochemical studies, it was long believed that different Cdks functioned at specific stages during cell cycle progression. However, deletion of all three interphase Cdks in mice affected cell cycle entry and progression only in certain specialized cells such as hematopoietic cells, beta cells of the pancreas, pituitary lactotrophs, and cardiomyocytes. These genetic experiments challenged the prevailing biochemical model and established that Cdks function in a cell-specific, but not a stage-specific, manner during cell cycle entry and the progression of mitosis. Recent in vivo studies have further established that Cdk1 is the only Cdk that is both essential and sufficient for driving the resumption of meiosis during mouse oocyte maturation. These genetic studies suggest a minimal-essential cell cycle model in which Cdk1 is the central regulator of cell cycle progression. Cdk1 can compensate for the loss of the interphase Cdks by forming active complexes with A-, B-, E-, and D-type Cyclins in a stepwise manner. Thus, Cdk1 plays an essential role in both mitosis and meiosis in mammals, whereas interphase Cdks are dispensable.

Differential Editosome Protein Function between Life Cycle Stages of Trypanosoma brucei *

PubMed Central

McDermott, Suzanne M.; Guo, Xuemin; Carnes, Jason; Stuart, Kenneth

2015-01-01

Uridine insertion and deletion RNA editing generates functional mitochondrial mRNAs in Trypanosoma brucei. The mRNAs are differentially edited in bloodstream form (BF) and procyclic form (PF) life cycle stages, and this correlates with the differential utilization of glycolysis and oxidative phosphorylation between the stages. The mechanism that controls this differential editing is unknown. Editing is catalyzed by multiprotein ∼20S editosomes that contain endonuclease, 3′-terminal uridylyltransferase, exonuclease, and ligase activities. These editosomes also contain KREPB5 and KREPA3 proteins, which have no functional catalytic motifs, but they are essential for parasite viability, editing, and editosome integrity in BF cells. We show here that repression of KREPB5 or KREPA3 is also lethal in PF, but the effects on editosome structure differ from those in BF. In addition, we found that point mutations in KREPB5 or KREPA3 differentially affect cell growth, editosome integrity, and RNA editing between BF and PF stages. These results indicate that the functions of KREPB5 and KREPA3 editosome proteins are adjusted between the life cycle stages. This implies that these proteins are involved in the processes that control differential editing and that the 20S editosomes differ between the life cycle stages. PMID:26304125

Diversity and Contributions to Nitrogen Cycling and Carbon Fixation of Soil Salinity Shaped Microbial Communities in Tarim Basin

PubMed Central

Ren, Min; Zhang, Zhufeng; Wang, Xuelian; Zhou, Zhiwei; Chen, Dong; Zeng, Hui; Zhao, Shumiao; Chen, Lingling; Hu, Yuanliang; Zhang, Changyi; Liang, Yunxiang; She, Qunxin; Zhang, Yi; Peng, Nan

2018-01-01

Arid and semi-arid regions comprise nearly one-fifth of the earth's terrestrial surface. However, the diversities and functions of their soil microbial communities are not well understood, despite microbial ecological importance in driving biogeochemical cycling. Here, we analyzed the geochemistry and microbial communities of the desert soils from Tarim Basin, northwestern China. Our geochemical data indicated half of these soils are saline. Metagenomic analysis showed that bacterial phylotypes (89.72% on average) dominated the community, with relatively small proportions of Archaea (7.36%) and Eukaryota (2.21%). Proteobacteria, Firmicutes, Actinobacteria, and Euryarchaeota were most abundant based on metagenomic data, whereas genes attributed to Proteobacteria, Actinobacteria, Euryarchaeota, and Thaumarchaeota most actively transcribed. The most abundant phylotypes (Halobacterium, Halomonas, Burkholderia, Lactococcus, Clavibacter, Cellulomonas, Actinomycetospora, Beutenbergia, Pseudomonas, and Marinobacter) in each soil sample, based on metagenomic data, contributed marginally to the population of all microbial communities, whereas the putative halophiles, which contributed the most abundant transcripts, were in the majority of the active microbial population and is consistent with the soil salinity. Sample correlation analyses according to the detected and active genotypes showed significant differences, indicating high diversity of microbial communities among the Tarim soil samples. Regarding ecological functions based on the metatranscriptomic data, transcription of genes involved in various steps of nitrogen cycling, as well as carbon fixation, were observed in the tested soil samples. Metatranscriptomic data also indicated that Thaumarchaeota are crucial for ammonia oxidation and Proteobacteria play the most important role in other steps of nitrogen cycle. The reductive TCA pathway and dicarboxylate-hydroxybutyrate cycle attributed to Proteobacteria and

The cellular and compartmental profile of mouse retinal glycolysis, tricarboxylic acid cycle, oxidative phosphorylation, and ~P transferring kinases

PubMed Central

Rueda, Elda M.; Johnson, Jerry E.; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J.; Sigel, Irena; Chaney, Shawnta Y.

2016-01-01

Purpose The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. Methods mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. Results The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor

The cellular and compartmental profile of mouse retinal glycolysis, tricarboxylic acid cycle, oxidative phosphorylation, and ~P transferring kinases.

PubMed

Rueda, Elda M; Johnson, Jerry E; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J; Sigel, Irena; Chaney, Shawnta Y; Fox, Donald A

2016-01-01

The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The

Effects of pentylenetetrazole and glutamate on metabolism of [U-(13)C]glucose in cultured cerebellar granule neurons.

PubMed

Eloqayli, Haytham; Qu, Hong; Unsgård, Geirmund; Sletvold, Olav; Hadidi, Hakam; Sonnewald, Ursula

2002-02-01

This study was performed to analyze the effects of glutamate and the epileptogenic agent pentylenetetrazole (PTZ) on neuronal glucose metabolism. Cerebellar granule neurons were incubated for 2 h in medium containing 3 mM [U-(13)C]glucose, with and without 0.25 mM glutamate and/or 10 mM PTZ. In the presence of PTZ, decreased glucose consumption with unchanged lactate release was observed, indicating decreased glucose oxidation. PTZ also slowed down tricarboxylic acid (TCA) cycle activity as evidenced by the decreased amounts of labeled aspartate and [1,2-(13)C]glutamate. When glutamate was present, glucose consumption was also decreased. However, the amount of glutamate, derived from [U-(13)C]glucose via the first turn of the TCA cycle, was increased. The decreased amount of [1,2-(13)C]glutamate, derived from the second turn in the TCA cycle, and increased amount of aspartate indicated the dilution of label due to the entrance of unlabeled glutamate into TCA cycle. In the presence of glutamate plus PTZ, the effect of PTZ was enhanced by glutamate. Labeled alanine was detected only in the presence of glutamate plus PTZ, which indicated that oxaloacetate was a better amino acid acceptor than pyruvate. Furthermore, there was also evidence for intracellular compartmentation of oxaloacetate metabolism. Glutamate and PTZ caused similar metabolic changes, however, via different mechanisms. Glutamate substituted for glucose as energy substrate in the TCA cycle, whereas, PTZ appeared to decrease mitochondrial activity.

Cross-talk between branched-chain amino acids and hepatic mitochondria is compromised in nonalcoholic fatty liver disease.

PubMed

Sunny, Nishanth E; Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J; Nautiyal, Manisha; Mathew, Justin T; Williams, Caroline M; Cusi, Kenneth

2015-08-15

Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD.

Imaging Prostate Cancer (PCa) Phenotype and Evolution

DTIC Science & Technology

2016-10-01

inhibit growth of some but not all cell lines. 2. Keywords: Deferiprone, aconitase, metabolism, tricarboxylic acid cycle , magnetic resonance 3...TRAMP C2 and MycCaP cell proliferation, migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity...migration and inhibits TCA cycle (metabolism). Similarly in vivo (Aim 2), we 6 Fig. 2: Effect of DFP on in vivo growth of MycCaP (left) and TRAMP C2

Functionalization of carbon nanotubes with water-insoluble porphyrin in ionic liquid: direct electrochemistry and highly sensitive amperometric biosensing for trichloroacetic acid.

PubMed

Tu, Wenwen; Lei, Jianping; Ju, Huangxian

2009-01-01

A functional composite of single-walled carbon nanotubes (SWNTs) with hematin, a water-insoluble porphyrin, was first prepared in 1-butyl-3-methylimidazolium hexafluorophosphate ([BMIM][PF(6)]) ionic liquid. The novel composite in ionic liquid was characterized by scanning electron microscopy, ultraviolet absorption spectroscopy, and electrochemical impedance spectroscopy, and showed a pair of direct redox peaks of the Fe(III)/Fe(II) couple. The composite-[BMIM][PF(6)]-modified glassy carbon electrode showed excellent electrocatalytic activity toward the reduction of trichloroacetic acid (TCA) in neutral media due to the synergic effect among SWNTs, [BMIM][PF(6)], and porphyrin, which led to a highly sensitive and stable amperometric biosensor for TCA with a linear range from 9.0x10(-7) to 1.4x10(-4) M. The detection limit was 3.8x10(-7) M at a signal-to-noise ratio of 3. The TCA biosensor had good analytical performance, such as rapid response, good reproducibility, and acceptable accuracy, and could be successfully used for the detection of residual TCA in polluted water. The functional composite in ionic liquid provides a facile way to not only obtain the direct electrochemistry of water-insoluble porphyrin, but also construct novel biosensors for monitoring analytes in real environmental samples.

A synthetic biology approach to engineer a functional reversal of the β-oxidation cycle.

PubMed

Clomburg, James M; Vick, Jacob E; Blankschien, Matthew D; Rodríguez-Moyá, María; Gonzalez, Ramon

2012-11-16

While we have recently constructed a functional reversal of the β-oxidation cycle as a platform for the production of fuels and chemicals by engineering global regulators and eliminating native fermentative pathways, the system-level approach used makes it difficult to determine which of the many deregulated enzymes are responsible for product synthesis. This, in turn, limits efforts to fine-tune the synthesis of specific products and prevents the transfer of the engineered pathway to other organisms. In the work reported here, we overcome the aforementioned limitations by using a synthetic biology approach to construct and functionally characterize a reversal of the β-oxidation cycle. This was achieved through the in vitro kinetic characterization of each functional unit of the core and termination pathways, followed by their in vivo assembly and functional characterization. With this approach, the four functional units of the core pathway, thiolase, 3-hydroxyacyl-CoA dehydrogenase, enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydratase, and acyl-CoA dehydrogenase/trans-enoyl-CoA reductase, were purified and kinetically characterized in vitro. When these four functional units were assembled in vivo in combination with thioesterases as the termination pathway, the synthesis of a variety of 4-C carboxylic acids from a one-turn functional reversal of the β-oxidation cycle was realized. The individual expression and modular construction of these well-defined core components exerted the majority of control over product formation, with only highly selective termination pathways resulting in shifts in product formation. Further control over product synthesis was demonstrated by overexpressing a long-chain thiolase that enables the operation of multiple turns of the reversal of the β-oxidation cycle and hence the synthesis of longer-chain carboxylic acids. The well-defined and self-contained nature of each functional unit makes the engineered reversal of the �

Effects of argan oil on the mitochondrial function, antioxidant system and the activity of NADPH- generating enzymes in acrylamide treated rat brain.

PubMed

Aydın, Birsen

2017-03-01

Argan oil (AO) is rich in minor compounds such as polyphenols and tocopherols which are powerful antioxidants. Acrylamide (ACR) has been classified as a neurotoxic agent in animals and humans. Mitochondrial oxidative stress and dysfunction is one of the most probable molecular mechanisms of neurodegenerative diseases. Female Sprague Dawley rats were exposed to ACR (50mg/kg i.p. three times a week), AO (6ml/kg,o.p, per day) or together for 30days. The activities of cytosolic enzymes such as xanthine oxidase (XO), glucose 6-phosphate dehydrogenase (G6PDH), glutathione-S-transferase (GST), mitochondrial oxidative stress, oxidative phosphorylation (OXPHOS) and tricarboxylic acid cycle (TCA) enzymes, mitochondrial metabolic function, adenosine triphosphate (ATP) level and acetylcholinesterase (AChE) activity were assessed in rat brain. Cytosolic and mitochondrial antioxidant enzymes were significantly diminished in the brains of rats treated with ACR compared to those in control. Besides, ACR treatment resulted in a significant reduction in brain ATP level, mitochondrial metabolic function, OXPHOS and TCA enzymes. Administration of AO restored both the cytosolic and mitochondrial oxidative stress by normalizing nicotinamide adenine dinucleotide phosphate (NADPH) generating enzymes. In addition, improved mitochondrial function primarily enhancing nicotinamide adenine dinucleotide (NADH) generated enzymes activities and ATP level in the mitochondria. The reason for AO's obvious beneficial effects in this study may be due to synergistic effects of its different bioactive compounds which is especially effective on mitochondria. Modulation of the brain mitochondrial functions and antioxidant systems by AO may lead to the development of new mitochondria-targeted antioxidants in the future. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Application of dynamic metabolomics to examine in vivo skeletal muscle glucose metabolism in the chronically high-fat fed mouse

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Burch, Micah L.

Rationale: Defects in muscle glucose metabolism are linked to type 2 diabetes. Mechanistic studies examining these defects rely on the use of high fat-fed rodent models and typically involve the determination of muscle glucose uptake under insulin-stimulated conditions. While insightful, they do not necessarily reflect the physiology of the postprandial state. In addition, most studies do not examine aspects of glucose metabolism beyond the uptake process. Here we present an approach to study rodent muscle glucose and intermediary metabolism under the dynamic and physiologically relevant setting of the oral glucose tolerance test (OGTT). Methods and results: In vivo muscle glucose andmore » intermediary metabolism was investigated following oral administration of [U-{sup 13}C] glucose. Quadriceps muscles were collected 15 and 60 min after glucose administration and metabolite flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates via gas chromatography–mass spectrometry. While no dietary effects were noted in the glycolytic pathway, muscle from mice fed a high fat diet (HFD) exhibited a reduction in labelling in TCA intermediates. Interestingly, this appeared to be independent of alterations in flux through pyruvate dehydrogenase. In addition, our findings suggest that TCA cycle anaplerosis is negligible in muscle during an OGTT. Conclusions: Under the dynamic physiologically relevant conditions of the OGTT, skeletal muscle from HFD fed mice exhibits alterations in glucose metabolism at the level of the TCA cycle. - Highlights: • Dynamic metabolomics was used to investigate muscle glucose metabolism in vivo. • Mitochondrial TCA cycle metabolism is altered in muscle of HFD mice. • This defect was not pyruvate dehydrogenase mediated, as has been previously thought. • Mitochondrial TCA cycle anaplerosis in muscle is virtually absent during the OGTT.« less

CHLORINATION BY-PRODUCTS IN DRINKING WATER AND MENSTRUAL CYCLE FUNCTION

EPA Science Inventory

Chlorination by-Products in Drinking Water and Menstrual Cycle Function

Gayle C. Windham1, Kirsten Waller2, Meredith Anderson2, Laura Fenster1, Pauline Mendola3, Shanna Swan4

1California Department of Health Services, Division of Environmental and Occupational Disea...

Effects of Swimming and Cycling Exercise Intervention on Vascular Function in Patients With Osteoarthritis.

PubMed

Alkatan, Mohammed; Machin, Daniel R; Baker, Jeffrey R; Akkari, Amanda S; Park, Wonil; Tanaka, Hirofumi

2016-01-01

Swimming exercise is an ideal and excellent form of exercise for patients with osteoarthritis (OA). However, there is no scientific evidence that regular swimming reduces vascular dysfunction and inflammation and elicits similar benefits compared with land-based exercises such as cycling in terms of reducing vascular dysfunction and inflammation in patients with OA. Forty-eight middle-aged and older patients with OA were randomly assigned to swimming or cycling training groups. Cycling training was included as a non-weight-bearing land-based comparison group. After 12 weeks of supervised exercise training, central arterial stiffness, as determined by carotid-femoral pulse wave velocity, and carotid artery stiffness, through simultaneous ultrasound and applanation tonometry, decreased significantly after both swimming and cycling training. Vascular endothelial function, as determined by brachial flow-mediated dilation, increased significantly after swimming but not after cycling training. Both swimming and cycling interventions reduced interleukin-6 levels, whereas no changes were observed in other inflammatory markers. In conclusion, these results indicate that regular swimming exercise can exert similar or even superior effects on vascular function and inflammatory markers compared with land-based cycling exercise in patients with OA who often has an increased risk of developing cardiovascular disease. Copyright © 2016 Elsevier Inc. All rights reserved.

Embryonic Lethality of Mitochondrial Pyruvate Carrier 1 Deficient Mouse Can Be Rescued by a Ketogenic Diet

PubMed Central

Krznar, Petra; Hörl, Manuel; Ammar, Zeinab; Montessuit, Sylvie; Pierredon, Sandra; Zamboni, Nicola; Martinou, Jean-Claude

2016-01-01

Mitochondrial import of pyruvate by the mitochondrial pyruvate carrier (MPC) is a central step which links cytosolic and mitochondrial intermediary metabolism. To investigate the role of the MPC in mammalian physiology and development, we generated a mouse strain with complete loss of MPC1 expression. This resulted in embryonic lethality at around E13.5. Mouse embryonic fibroblasts (MEFs) derived from mutant mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, and both defects could be restored by reexpression of MPC1. Labeling experiments using 13C-labeled glucose and glutamine demonstrated that MPC deficiency causes increased glutaminolysis and reduced contribution of glucose-derived pyruvate to the TCA cycle. Morphological defects were observed in mutant embryonic brains, together with major alterations of their metabolome including lactic acidosis, diminished TCA cycle intermediates, energy deficit and a perturbed balance of neurotransmitters. Strikingly, these changes were reversed when the pregnant dams were fed a ketogenic diet, which provides acetyl-CoA directly to the TCA cycle and bypasses the need for a functional MPC. This allowed the normal gestation and development of MPC deficient pups, even though they all died within a few minutes post-delivery. This study establishes the MPC as a key player in regulating the metabolic state necessary for embryonic development, neurotransmitter balance and post-natal survival. PMID:27176894

Acute impact of conventional and eccentric cycling on platelet and vascular function in patients with chronic heart failure.

PubMed

Haynes, Andrew; Linden, Matthew D; Chasland, Lauren C; Nosaka, Kazunori; Maiorana, Andrew; Dawson, Ellen A; Dembo, Lawrence H; Naylor, Louise H; Green, Daniel J

2017-06-01

Evidence-based guidelines recommend exercise therapy for patients with chronic heart failure (CHF). Such patients have increased atherothrombotic risk. Exercise can transiently increase platelet activation and reactivity and decrease vascular function in healthy participants, although data in CHF are scant. Eccentric (ECC) cycling is a novel exercise modality that may be particularly suited to patients with CHF, but the acute impacts of ECC cycling on platelet and vascular function are currently unknown. Our null hypothesis was that ECC and concentric (CON) cycling, performed at matched external workloads, would not induce changes in platelet or vascular function in patients with CHF. Eleven patients with heart failure with reduced ejection fraction (HFrEF) took part in discrete bouts of ECC and CON cycling. Before and immediately after exercise, vascular function was assessed by measuring diameter and flow-mediated dilation (FMD) of the brachial artery. Platelet function was measured by the flow cytometric determination of glycoprotein IIb/IIIa activation and granule exocytosis in the presence and absence of platelet agonists. ECC cycling increased baseline artery diameter (pre: 4.0 ± 0.8 mm vs. post: 4.2 ± 0.7 mm; P = 0.04) and decreased FMD%. When changes in baseline artery diameter were accounted for, the decrease in FMD post-ECC cycling was no longer significant. No changes were apparent after CON. Neither ECC nor CON cycling resulted in changes to any platelet-function measures (all P > 0.05). These results suggest that both ECC and CON cycling, at a moderate intensity and short duration, can be performed by patients with HFrEF without detrimental impacts on vascular or platelet function. NEW & NOTEWORTHY This is the first evidence to indicate that eccentric (ECC) cycling can be performed relatively safely by patients with chronic heart failure (CHF), as it did not result in impaired vascular or platelet function compared with conventional cycling

Menstrual Cycle-Related Changes of Functional Cerebral Asymmetries in Fine Motor Coordination

ERIC Educational Resources Information Center

Bayer, Ulrike; Hausmann, Markus

2012-01-01

Fluctuating sex hormone levels during the menstrual cycle have been shown to affect functional cerebral asymmetries in cognitive domains. These effects seem to result from the neuromodulatory properties of sex hormones and their metabolites on interhemispheric processing. The present study was carried out to investigate whether functional cerebral…

Functional Study of the Vitamin K Cycle Enzymes in Live Cells

PubMed Central

Tie, J.-K.; Stafford, D.W.

2018-01-01

Vitamin K-dependent carboxylation, an essential posttranslational modification catalyzed by gamma-glutamyl carboxylase, is required for the biological functions of proteins that control blood coagulation, vascular calcification, bone metabolism, and other important physiological processes. Concomitant with carboxylation, reduced vitamin K (KH2) is oxidized to vitamin K epoxide (KO). KO must be recycled back to KH2 by the enzymes vitamin K epoxide reductase and vitamin K reductase in a pathway known as the vitamin K cycle. Our current knowledge about the enzymes of the vitamin K cycle is mainly based on in vitro studies of each individual enzymes under artificial conditions, which are of limited usefulness in understanding how the complex carboxylation process is carried out in the physiological environment. In this chapter, we review the current in vitro activity assays for vitamin K cycle enzymes. We describe the rationale, establishment, and application of cell-based assays for the functional study of these enzymes in the native cellular milieu. In these cell-based assays, different vitamin K-dependent proteins were designed and stably expressed in mammalian cells as reporter proteins to accommodate the readily used enzyme-linked immunosorbent assay for carboxylation efficiency evaluation. Additionally, recently emerged genome-editing techniques TALENs and CRISPR-Cas9 were used to knock out the endogenous enzymes in the reporter cell lines to eliminate the background. These cell-based assays are easy to scale up for high-throughput screening of inhibitors of vitamin K cycle enzymes and have been successfully used to clarify the genotypes and their clinical phenotypes of enzymes of the vitamin K cycle. PMID:28065270

Cross-talk between branched-chain amino acids and hepatic mitochondria is compromised in nonalcoholic fatty liver disease

PubMed Central

Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J.; Nautiyal, Manisha; Mathew, Justin T.; Williams, Caroline M.; Cusi, Kenneth

2015-01-01

Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD. PMID:26058864

Alterations in Hepatic Glucose and Energy Metabolism as a Result of Calorie and Carbohydrate Restriction

PubMed Central

Browning, Jeffrey D.; Weis, Brian; Davis, Jeannie; Satapati, Santhosh; Merritt, Matthew; Malloy, Craig R.; Burgess, Shawn C.

2009-01-01

Carbohydrate-restriction is a common weight-loss approach that modifies hepatic metabolism by increasing gluconeogenesis and ketosis. Because little is known regarding the effect of carbohydrate-restriction on the origin of gluconeogenic precursors (gluconeogenesis from glycerol (GNGglycerol) and lactate/amino acids (GNGPEP)) or its consequence to hepatic energy homeostasis, we studied these parameters in a group of overweight/obese subjects undergoing weight-loss via dietary restriction. We used 2H and 13C tracers and nuclear magnetic resonance spectroscopy to measure the sources of hepatic glucose and TCA cycle flux in weight-stable subjects(n=7) and subjects following carbohydrate-(n=7) or calorie-restriction(n=7). The majority of hepatic glucose production in carbohydrate-restricted subjects came from GNGPEP. The contribution of glycerol to gluconeogenesis was similar in all groups despite evidence of increased fat oxidation in carbohydrate-restricted subjects. A strong correlation between TCA cycle flux and GNGPEP was found, though the reliance on TCA cycle energy production for gluconeogenesis was attenuated in subjects undergoing carbohydrate restriction. Together, these data imply that the TCA cycle is the energetic patron of gluconeogenesis. However, the relationship between these two pathways is modified by carbohydrate restriction, suggesting an increased reliance of the hepatocyte on energy generated outside of the TCA cycle when GNGPEP is maximal. In conclusion, carbohydrate-restriction modifies hepatic gluconeogenesis by increasing reliance on substrates like lactate or amino acids but not glycerol. This modification is associated with a reorganization of hepatic energy metabolism suggestive of enhanced hepatic β-oxidation. PMID:18925642

Intellectual Performance as a Function of Repression and Menstrual Cycle.

ERIC Educational Resources Information Center

Englander-Golden, Paula; And Others

Performance on complex (Space Relations and Verbal Reasoning) and simple (Digit Symbol) tests was investigated as a function of Byrne's Repression-Sensitization (RS) dimension, phase of menstrual cycle and premenstrual-menstrual (PM) symptomatology in a group of females not taking oral contraceptives. Two control groups, consisting of males and…

Nutrient cycling Microbial Ecosystems: Assembly, Function and Targeted Design

DTIC Science & Technology

2017-05-05

different chemical transformations, converting potentially harmful chemicals via a series of intermediates, to harmless waste products. This shuttling of...Report: Nutrient-cycling Microbial Ecosystems: Assembly, Function and Targeted Design The views, opinions and/or findings contained in this report...are those of the author(s) and should not contrued as an official Department of the Army position, policy or decision, unless so designated by other

Rates of insulin secretion in INS-1 cells are enhanced by coupling to anaplerosis and Kreb's cycle flux independent of ATP synthesis.

PubMed

Cline, Gary W; Pongratz, Rebecca L; Zhao, Xiaojian; Papas, Klearchos K

2011-11-11

Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with (31)P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by (13)C NMR isotopomer analysis of the fate of [U-(13)C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media. Copyright © 2011 Elsevier Inc. All

Annealing cycles and the self-organization of functionalized colloids

NASA Astrophysics Data System (ADS)

Dias, Cristóvão S.; Araújo, Nuno A. M.; Telo da Gama, Margarida M.

2018-01-01

The self-assembly of functionalized (patchy) particles with directional interactions into target structures is still a challenge, despite the significant experimental advances in their synthesis. Self-assembly pathways are typically characterized by high energy barriers that hinder access to stable (equilibrium) structures. A possible strategy to tackle this challenge is to perform annealing cycles. By periodically switching on and off the inter-particle bonds, one expects to smooth-out the kinetic pathways and favor the assembly of targeted structures. Preliminary results have shown that the efficiency of annealing cycles depends strongly on their frequency. Here, we study numerically how this frequency-dependence scales with the strength of the directional interactions (size of the patch σ). We use analytical arguments to show that the scaling results from the statistics of a random walk in configurational space.

Cycling induced by functional electrical stimulation in children affected by cerebral palsy: case report.

PubMed

Trevisi, E; Gualdi, S; De Conti, C; Salghetti, A; Martinuzzi, A; Pedrocchi, A; Ferrante, S

2012-03-01

Recently, the efficacy of functional electrical stimulation (FES) cycling have been demonstrated on the improvement of strength and motor control in adults with stroke. FES-cycling, providing a repetitive goal-oriented task, could facilitate cortical reorganization and utilization of residual cortico-spinal pathways. These benefits could be more enhanced in children because of the greater plasticity and flexibility of their central nervous system. The aim of the present case report study was to explore the feasibility of FES-cycling in children with cerebral palsy (CP) and to provide a set of instrumental measures able to evaluate the effects of this novel treatment on cycling and walking ability. Interventional study. Two ambulant outpatient children with diplegic CP were recruited by the "E. Medea" Scientific Institute. Patients followed a FES-cycling treatment for 30 minutes a day, 3 days a week for 7 weeks. Pre and post treatment tests were performed, namely clinical measures and electromyographic, kinematic and oxygen expenditure analysis during gait and cycling. The treatment was safe, feasible and well accepted by the 2 children. After treatment both patients achieved a more symmetrical muscular strategy during voluntary cycling and gait and a significant reduction of muscle co-contractions during cycling. These improvements were corroborated by a decrease in oxygen expenditure during the post test for one of the two children, the less impaired, implying a better exploiting of bi-articular muscles. FES-cycling is feasible and safe and it may be an alternative rehabilitation method for diplegic CP patients. The set of instrumental measurements proposed seems to be a valuable tool for functional assessment to identify subclinical anomalies and improvements on cycling and gait in CP patients.

Midkine-A functions upstream of Id2a to regulate cell cycle kinetics in the developing vertebrate retina

PubMed Central

2012-01-01

Background Midkine is a small heparin binding growth factor expressed in numerous tissues during development. The unique midkine gene in mammals has two paralogs in zebrafish: midkine-a (mdka) and midkine-b (mdkb). In the zebrafish retina, during both larval development and adult photoreceptor regeneration, mdka is expressed in retinal stem and progenitor cells and functions as a molecular component of the retina’s stem cell niche. In this study, loss-of-function and conditional overexpression were used to investigate the function of Mdka in the retina of the embryonic zebrafish. Results The results show that during early retinal development Mdka functions to regulate cell cycle kinetics. Following targeted knockdown of Mdka synthesis, retinal progenitors cycle more slowly, and this results in microphthalmia, a diminished rate of cell cycle exit and a temporal delay of cell cycle exit and neuronal differentiation. In contrast, Mdka overexpression results in acceleration of the cell cycle and retinal overgrowth. Mdka gain-of-function, however, does not temporally advance cell cycle exit. Experiments to identify a potential Mdka signaling pathway show that Mdka functions upstream of the HLH regulatory protein, Id2a. Gene expression analysis shows Mdka regulates id2a expression, and co-injection of Mdka morpholinos and id2a mRNA rescues the Mdka loss-of-function phenotype. Conclusions These data show that in zebrafish, Mdka resides in a shared Id2a pathway to regulate cell cycle kinetics in retinal progenitors. This is the first study to demonstrate the function of Midkine during retinal development and adds Midkine to the list of growth factors that transcriptionally regulate Id proteins. PMID:23111152

Midkine-A functions upstream of Id2a to regulate cell cycle kinetics in the developing vertebrate retina.

PubMed

Luo, Jing; Uribe, Rosa A; Hayton, Sarah; Calinescu, Anda-Alexandra; Gross, Jeffrey M; Hitchcock, Peter F

2012-10-30

Midkine is a small heparin binding growth factor expressed in numerous tissues during development. The unique midkine gene in mammals has two paralogs in zebrafish: midkine-a (mdka) and midkine-b (mdkb). In the zebrafish retina, during both larval development and adult photoreceptor regeneration, mdka is expressed in retinal stem and progenitor cells and functions as a molecular component of the retina's stem cell niche. In this study, loss-of-function and conditional overexpression were used to investigate the function of Mdka in the retina of the embryonic zebrafish. The results show that during early retinal development Mdka functions to regulate cell cycle kinetics. Following targeted knockdown of Mdka synthesis, retinal progenitors cycle more slowly, and this results in microphthalmia, a diminished rate of cell cycle exit and a temporal delay of cell cycle exit and neuronal differentiation. In contrast, Mdka overexpression results in acceleration of the cell cycle and retinal overgrowth. Mdka gain-of-function, however, does not temporally advance cell cycle exit. Experiments to identify a potential Mdka signaling pathway show that Mdka functions upstream of the HLH regulatory protein, Id2a. Gene expression analysis shows Mdka regulates id2a expression, and co-injection of Mdka morpholinos and id2a mRNA rescues the Mdka loss-of-function phenotype. These data show that in zebrafish, Mdka resides in a shared Id2a pathway to regulate cell cycle kinetics in retinal progenitors. This is the first study to demonstrate the function of Midkine during retinal development and adds Midkine to the list of growth factors that transcriptionally regulate Id proteins.

Soil phosphorus - new insights into a critical cycle across many soil functions

NASA Astrophysics Data System (ADS)

Leinweber, Peter; Zimmer, Dana

2017-04-01

The fate of phosphorus (P-) compounds in the soil - plant - water - system is linked with most soil functions such as productivity for agricultural crops, reactor for nutrient cycling, filter and buffer for water, and biodiversity. The P-compounds, mostly phosphates in a multitude of chemical bonds, may have contradicting influences on soil functions. For instance, P-concentrations may be suboptimal for crop yields but at the same time exceeding the soil filter/buffer capacity for water resources. Modern agriculture has increased this misbalance. Therefore, a better soil P management that balances all soil functions requires a deeper understanding of the P-cycling in the environment. The collaborative project "InnoSoilPhos" in the frame of the BonaRes-program of the German Federal Ministry of Education and Research (BMBF) aims at disclosing the chemical composition, biogeochemical transformations and microbiological fundamentals of P-cycling and P-transport processes across all relevant scales from atomic to catchment and landscapes. The contribution will give an overview on the project and some examples for the latest findings on P-reactions at mineral surfaces (experimental and theoretical), microorganism diversity involved in soil P-transformations, crop yield responses to P-fertilizer regimes (including new P-recycling products) and, finally, hot spots and hot moments of P-release from soils into adjoining freshwater systems. These findings allow some preliminary demands and frame conditions for an improved soil P management to better balance the soil functions and safe the global mineable P resources.

High-density natural luffa sponge as anaerobic microorganisms carrier for degrading 1,1,1-TCA in groundwater.

PubMed

Wang, Wenbing; Wu, Yanqing; Zhang, Chi

2017-03-01

Anaerobic microorganisms were applied to degrade organic contaminants in groundwater with permeable reactive barriers (PRBs). However, anaerobic microorganisms need to select optimal immobilizing material as carrier. The potential of high-density natural luffa sponge (HDLS) (a new variety of luffa) for the immobilization and protection of anaerobic microorganisms was investigated. The HDLS has a dense structure composed of a complicated interwoven fibrous network. Therefore, the abrasion rate of HDLS (0.0068 g s -1 ) was the smallest among the four carriers [HDLS, ordinary natural luffa sponge (OLS), polyurethane sponge (PS), and gel carrier AQUAPOROUSGEL (APG)]. The results suggest that it also had the greatest water retention (10.26 H 2 O-g dry carrier-g -1 ) and SS retention (0.21 g dry carrier-g -1 ). In comparison to well-established commercialized gel carrier APG, HDLS was of much better mechanical strength, hydrophilicity and stability. Microbial-immobilized HDLS also had the best performance for the remediation of 1,1,1-TCA simulated groundwater. Analysis of the clone libraries from microorganism-immobilized HDLS showed the HDLS could protect microorganisms from the toxicity of 1,1,1-TCA and maintain the stability of microbial community diversity. The mechanism of HDLS immobilizing and protecting microorganisms was proposed as follows. The HDLS had a micron-scale honeycomb structure (30-40 μm) and an irregular ravine structure (4-20 μm), which facilitate the immobilization of anaerobic microorganisms and protect the anaerobic microorganisms.

Interactive Effects of Dopamine Baseline Levels and Cycle Phase on Executive Functions: The Role of Progesterone.

PubMed

Hidalgo-Lopez, Esmeralda; Pletzer, Belinda

2017-01-01

Estradiol and progesterone levels vary along the menstrual cycle and have multiple neuroactive effects, including on the dopaminergic system. Dopamine relates to executive functions in an "inverted U-shaped" manner and its levels are increased by estradiol. Accordingly, dopamine dependent changes in executive functions along the menstrual cycle have been previously studied in the pre-ovulatory phase, when estradiol levels peak. Specifically it has been demonstrated that working memory is enhanced during the pre-ovulatory phase in women with low dopamine baseline levels, but impaired in women with high dopamine baseline levels. However, the role of progesterone, which peaks in the luteal cycle phase, has not been taken into account previously. Therefore, the main goals of the present study were to extend these findings (i) to the luteal cycle phase and (ii) to other executive functions. Furthermore, the usefulness of the eye blink rate (EBR) as an indicator of dopamine baseline levels in menstrual cycle research was explored. 36 naturally cycling women were tested during three cycle phases (menses-low sex hormones; pre-ovulatory-high estradiol; luteal-high progesterone and estradiol). During each session, women performed a verbal N-back task, as measure of working memory, and a single trial version of the Stroop task, as measure of response inhibition and cognitive flexibility. Hormone levels were assessed from saliva samples and spontaneous eye blink rate was recorded during menses. In the N-back task, women were faster during the luteal phase the higher their progesterone levels, irrespective of their dopamine baseline levels. In the Stroop task, we found a dopamine-cycle interaction, which was also driven by the luteal phase and progesterone levels. For women with higher EBR performance decreased during the luteal phase, whereas for women with lower EBR performance improved during the luteal phase. These findings suggest an important role of progesterone in

Metrological characterization of a cycle-ergometer to optimize the cycling induced by functional electrical stimulation on patients with stroke.

PubMed

Comolli, Lorenzo; Ferrante, Simona; Pedrocchi, Alessandra; Bocciolone, Marco; Ferrigno, Giancarlo; Molteni, Franco

2010-05-01

Functional electrical stimulation (FES) is a well established method in the rehabilitation of stroke patients. Indeed, a bilateral movement such as cycling induced by FES would be crucial for these patients who had an unilateral motor impairment and had to recover an equivalent use of limbs. The aim of this study was to develop a low-cost meteorologically qualified cycle-ergometer, optimized for patients with stroke. A commercial ergometer was instrumented with resistive strain gauges and was able to provide the torque produced at the right and left crank, independently. The developed system was integrated with a stimulator, obtaining a novel FES cycling device able to control in real-time the movement unbalance. A dynamic calibration of the sensors was performed and a total torque uncertainty was computed. The system was tested on a healthy subject and on a stroke patient. Results demonstrated that the proposed sensors could be successfully used during FES cycling sessions where the maximum torque produced is about 9Nm, an order of magnitude less than the torque produced during voluntary cycling. This FES cycling system will assist in future investigations on stroke rehabilitation by means of FES and in new exercise regimes designed specifically for patients with unilateral impairments.

Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage.

PubMed

Karimian, Ansar; Ahmadi, Yasin; Yousefi, Bahman

2016-06-01

An appropriate control over cell cycle progression depends on many factors. Cyclin-dependent kinase (CDK) inhibitor p21 (also known as p21(WAF1/Cip1)) is one of these factors that promote cell cycle arrest in response to a variety of stimuli. The inhibitory effect of P21 on cell cycle progression correlates with its nuclear localization. P21 can be induced by both p53-dependent and p53-independent mechanisms. Some other important functions attributed to p21 include transcriptional regulation, modulation or inhibition of apoptosis. These functions are largely dependent on direct p21/protein interactions and also on p21 subcellular localizations. In addition, p21 can play a role in DNA repair by interacting with proliferating cell nuclear antigen (PCNA). In this review, we will focus on the multiple functions of p21 in cell cycle regulation, apoptosis and gene transcription after DNA damage and briefly discuss the pathways and factors that have critical roles in p21 expression and activity. Copyright © 2016 Elsevier B.V. All rights reserved.

Precision control of soil N cycling via soil functional zone management

USDA-ARS?s Scientific Manuscript database

Managing the soil nitrogen (N) cycle is a major component of agricultural sustainability. Soil functional zone management (SFZM), a novel framework of agroecosystem management, may improve soil N management compared with conventional and no-tillage approaches by focusing on the timing and location (...

Estradiol modulates functional brain organization during the menstrual cycle: an analysis of interhemispheric inhibition.

PubMed

Weis, Susanne; Hausmann, Markus; Stoffers, Barbara; Vohn, René; Kellermann, Thilo; Sturm, Walter

2008-12-10

According to the hypothesis of progesterone-mediated interhemispheric decoupling (Hausmann and Güntürkün, 2000), functional cerebral asymmetries (FCAs), which are stable in men and change during the menstrual cycle in women, are generated by interhemispheric inhibition of the dominant on the nondominant hemisphere. The change of lateralization during the menstrual cycle in women might indicate that sex hormones play an important role in modulating FCAs. We used functional magnetic resonance imaging to examine the role of estradiol in determining cyclic changes of interhemispheric inhibition. Women performed a word-matching task, while they were scanned twice during the cycle, once during the menstrual and once during the follicular phase. By use of a connectivity analysis we found that the inhibitory influence of left-hemispheric language areas on homotopic areas of the right hemisphere is strongest during the menses, resulting in a pronounced lateralization. During the follicular phase, due to rising estradiol levels, inhibition and thus functional cerebral asymmetries are reduced. These results reveal a powerful neuromodulatory action of estradiol on the dynamics of functional brain organization in the female brain. They may further contribute to the ongoing discussion of sex differences in brain function in that they help explain the dynamic part of functional brain organization in which the female differs from the male brain.

Menstrual cycle influence on cognitive function and emotion processing-from a reproductive perspective.

PubMed

Sundström Poromaa, Inger; Gingnell, Malin

2014-01-01

The menstrual cycle has attracted research interest ever since the 1930s. For many researchers the menstrual cycle is an excellent model of ovarian steroid influence on emotion, behavior, and cognition. Over the past years methodological improvements in menstrual cycle studies have been noted, and this review summarizes the findings of methodologically sound menstrual cycle studies in healthy women. Whereas the predominant hypotheses of the cognitive field state that sexually dimorphic cognitive skills that favor men are improved during menstrual cycle phases with low estrogen and that cognitive skills that favor women are improved during cycle phases with increased estrogen and/or progesterone, this review has not found sufficient evidence to support any of these hypotheses. Mental rotation has gained specific interest in this aspect, but a meta-analysis yielded a standardized mean difference in error rate of 1.61 (95% CI -0.35 to 3.57), suggesting, at present, no favor of an early follicular phase improvement in mental rotation performance. Besides the sexually dimorphic cognitive skills, studies exploring menstrual cycle effects on tasks that probe prefrontal cortex function, for instance verbal or spatial working memory, have also been reviewed. While studies thus far are few, results at hand suggest improved performance at times of high estradiol levels. Menstrual cycle studies on emotional processing, on the other hand, tap into the emotional disorders of the luteal phase, and may be of relevance for women with premenstrual disorders. Although evidence at present is limited, it is suggested that emotion recognition, consolidation of emotional memories, and fear extinction is modulated by the menstrual cycle in women. With the use of functional magnetic resonance imaging, several studies report changes in brain reactivity across the menstrual cycle, most notably increased amygdala reactivity in the luteal phase. Thus, to the extent that behavioral changes have

Menstrual cycle influence on cognitive function and emotion processing—from a reproductive perspective

PubMed Central

Sundström Poromaa, Inger; Gingnell, Malin

2014-01-01

The menstrual cycle has attracted research interest ever since the 1930s. For many researchers the menstrual cycle is an excellent model of ovarian steroid influence on emotion, behavior, and cognition. Over the past years methodological improvements in menstrual cycle studies have been noted, and this review summarizes the findings of methodologically sound menstrual cycle studies in healthy women. Whereas the predominant hypotheses of the cognitive field state that sexually dimorphic cognitive skills that favor men are improved during menstrual cycle phases with low estrogen and that cognitive skills that favor women are improved during cycle phases with increased estrogen and/or progesterone, this review has not found sufficient evidence to support any of these hypotheses. Mental rotation has gained specific interest in this aspect, but a meta-analysis yielded a standardized mean difference in error rate of 1.61 (95% CI −0.35 to 3.57), suggesting, at present, no favor of an early follicular phase improvement in mental rotation performance. Besides the sexually dimorphic cognitive skills, studies exploring menstrual cycle effects on tasks that probe prefrontal cortex function, for instance verbal or spatial working memory, have also been reviewed. While studies thus far are few, results at hand suggest improved performance at times of high estradiol levels. Menstrual cycle studies on emotional processing, on the other hand, tap into the emotional disorders of the luteal phase, and may be of relevance for women with premenstrual disorders. Although evidence at present is limited, it is suggested that emotion recognition, consolidation of emotional memories, and fear extinction is modulated by the menstrual cycle in women. With the use of functional magnetic resonance imaging, several studies report changes in brain reactivity across the menstrual cycle, most notably increased amygdala reactivity in the luteal phase. Thus, to the extent that behavioral changes

The effect of functional electrical stimulation cycling on late functional improvement in patients with chronic incomplete spinal cord injury.

PubMed

Yaşar, E; Yılmaz, B; Göktepe, S; Kesikburun, S

2015-12-01

Prospective single-arm study. To investigate the effect of functional electrical stimulation (FES) cycling on late functional recovery, spasticity, gait parameters and oxygen consumption during walking in patients with chronic incomplete spinal cord injury (SCI). Turkish Armed Forces Rehabilitation Center, Ankara, Turkey. Ten patients with chronic (duration of more than 2 years) incomplete SCI who could ambulate at least 10 m independently or with the assistance of a cane or walker, but no hip-knee-ankle-foot orthosis. The subjects underwent 1-h FES cycling sessions three times a week for 16 weeks. Outcome measures including the total motor score, the Functional Independence Measure (FIM) score, the Modified Ashworth Scale for knee spasticity, temporal spatial gait parameters and oxygen consumption rate during walking were assessed at baseline, 3 and 6 months after the baseline. There were statistically significant improvements in total motor scores, the FIM scores and spasticity level at the 6-month follow-up (P<0.01). The changes in gait parameters reached no significant level (P>0.05). Oxygen consumption rate of the patients showed significant reduction at only 6 months compared with baseline (P<0.01). The results suggest that FES cycling may provide some functional improvements in the late period of SCI. The study was supported by The Scientific and Technological Research Council of Turkey (TUBITAK).

Genetic variations in IDH gene as prognosis predictors in TACE-treated hepatocellular carcinoma patients.

PubMed

Zhang, Huiqing; Guo, Xu; Dai, Jingyao; Wu, Yousheng; Ge, Naijian; Yang, Yefa; Ji, Jiansong; Zhang, Hongxin

2014-11-01

Metabolic reprogramming is an important hallmark of cancer cells, including the alterations of activity and expression in tricarboxylic acid (TCA) cycle key enzymes. Previous studies have reported the associations between tumor formation and three core enzymes involved in the TCA cycle. However, the association between functional single nucleotide polymorphisms (SNPs) in one of TCA cycle key gene isocitrate dehydrogenase (IDH) and the overall survival of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) has never been investigated. Five functional SNPs in IDH1 and IDH2 genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 419 unresectable Chinese HCC patients treated with TACE. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. We found that SNPs rs12478635 in IDH1 and rs11632348 in IDH2 gene exhibited significant associations with death risk in HCC patients in the dominant model (HR 1.33; 95 % CI 1.02-1.73; P = 0.037) and in recessive model (HR 1.87; 95 % CI 1.27-2.75; P = 0.001), respectively. Moreover, we observed a cumulative effect of these two SNPs on HCC overall survival, indicating a significant trend of death risk increase with increasing number of unfavorable genotypes (P for trend = 0.001). Additionally, our data suggest that unfavorable genotypes of two SNPs may be used as an independent prognostic marker in those with advanced stage and patients with serum AFP <200 μg/L. Our results for the first time suggest that IDH gene polymorphisms may serve as an independent prognostic marker for HCC patients treated with TACE.

TCA precipitation and ethanol/HCl single-step purification evaluation: One-dimensional gel electrophoresis, bradford assays, spectrofluorometry and Raman spectroscopy data on HSA, Rnase, lysozyme - Mascots and Skyline data.

PubMed

Eddhif, Balkis; Guignard, Nadia; Batonneau, Yann; Clarhaut, Jonathan; Papot, Sébastien; Geffroy-Rodier, Claude; Poinot, Pauline

2018-04-01

The data presented here are related to the research paper entitled "Study of a Novel Agent for TCA Precipitated Proteins Washing - Comprehensive Insights into the Role of Ethanol/HCl on Molten Globule State by Multi-Spectroscopic Analyses" (Eddhif et al., submitted for publication) [1]. The suitability of ethanol/HCl for the washing of TCA-precipitated proteins was first investigated on standard solution of HSA, cellulase, ribonuclease and lysozyme. Recoveries were assessed by one-dimensional gel electrophoresis, Bradford assays and UPLC-HRMS. The mechanistic that triggers protein conformational changes at each purification stage was then investigated by Raman spectroscopy and spectrofluorometry. Finally, the efficiency of the method was evaluated on three different complex samples (mouse liver, river biofilm, loamy soil surface). Proteins profiling was assessed by gel electrophoresis and by UPLC-HRMS.

Exercise-induced menstrual cycle changes. A functional, temporary adaptation to metabolic stress.

PubMed

Bonen, A

1994-06-01

Chronic exercise is now known to alter the menstrual cycle. Yet, we do not yet know the true incidence of menstrual cycle alterations in athletes, because good normative data do not exist and the metabolic cost of training has not been considered in many studies. Secondary amenorrhoea is not easily induced by exercise training alone but seems to require additional metabolic stressors. Induction of secondary amenorrhoea in prospective exercise studies has not occurred, although the onset of short luteal or inadequate luteal phase cycles may occur in women even when running distances are not extensive. Such menstrual cycles may cause infertility, but this is only a temporary phenomenon since pregnancy, if desired, will usually occur upon cessation of training. Exercise-related changes in the menstrual cycle can be viewed as a functionally adaptive rather than a maladaptive dysfunction. A strong case can be made that the changes in the menstrual cycle as a result of exercise are an energy conserving strategy to protect more important biological processes. This hypothesis is consistent with the theory of metabolic arrest that has been identified in lower organisms and hibernating mammals.

Adaptation of oxidative phosphorylation to photoperiod-induced seasonal metabolic states in migratory songbirds.

PubMed

Trivedi, Amit Kumar; Malik, Shalie; Rani, Sangeeta; Kumar, Vinod

2015-06-01

Eukaryotic cells produce chemical energy in the form of ATP by oxidative phosphorylation of metabolic fuels via a series of enzyme mediated biochemical reactions. We propose that the rates of these reactions are altered, as per energy needs of the seasonal metabolic states in avian migrants. To investigate this, blackheaded buntings were photoperiodically induced with non-migratory, premigratory, migratory and post-migratory phenotypes. High plasma levels of free fatty acids, citrate (an intermediate that begins the TCA cycle) and malate dehydrogenase (mdh, an enzyme involved at the end of the TCA cycle) confirmed increased availability of metabolic reserves and substrates to the TCA cycle during the premigratory and migratory states, respectively. Further, daily expression pattern of genes coding for enzymes involved in the oxidative decarboxylation of pyruvate to acetyl-CoA (pdc and pdk) and oxidative phosphorylation in the TCA cycle (cs, odgh, sdhd and mdh) was monitored in the hypothalamus and liver. Reciprocal relationship between pdc and pdk expressions conformed with the altered requirements of acetyl-CoA for the TCA cycle in different metabolic states. Except for pdk, all genes had a daily expression pattern, with high mRNA expression during the day in the premigratory/migratory phenotypes, and at night (cs, odhg, sdhd and mdh) in the nonmigratory phenotype. Differences in mRNA expression patterns of pdc, sdhd and mdh, but not of pdk, cs and odgh, between the hypothalamus and liver indicated a tissue dependent metabolism in buntings. These results suggest the adaptation of oxidative phosphorylation pathway(s) at gene levels to the seasonal alternations in metabolism in migratory songbirds. Copyright © 2015 Elsevier Inc. All rights reserved.

Levels of Ycg1 Limit Condensin Function during the Cell Cycle

PubMed Central

Arsenault, Heather E.; Benanti, Jennifer A.

2016-01-01

During mitosis chromosomes are condensed to facilitate their segregation, through a process mediated by the condensin complex. Although several factors that promote maximal condensin activity during mitosis have been identified, the mechanisms that downregulate condensin activity during interphase are largely unknown. Here, we demonstrate that Ycg1, the Cap-G subunit of budding yeast condensin, is cell cycle-regulated with levels peaking in mitosis and decreasing as cells enter G1 phase. This cyclical expression pattern is established by a combination of cell cycle-regulated transcription and constitutive degradation. Interestingly, overexpression of YCG1 and mutations that stabilize Ycg1 each result in delayed cell-cycle entry and an overall proliferation defect. Overexpression of no other condensin subunit impacts the cell cycle, suggesting that Ycg1 is limiting for condensin complex formation. Consistent with this possibility, we find that levels of intact condensin complex are reduced in G1 phase compared to mitosis, and that increased Ycg1 expression leads to increases in both levels of condensin complex and binding to chromatin in G1. Together, these results demonstrate that Ycg1 levels limit condensin function in interphase cells, and suggest that the association of condensin with chromosomes must be reduced following mitosis to enable efficient progression through the cell cycle. PMID:27463097

Menstrual cycle-related changes in circulating androgens in healthy women with self-reported normal sexual function.

PubMed

Salonia, Andrea; Pontillo, Marina; Nappi, Rossella E; Zanni, Giuseppe; Fabbri, Fabio; Scavini, Marina; Daverio, Rita; Gallina, Andrea; Rigatti, Patrizio; Bosi, Emanuele; Bonini, Pier Angelo; Montorsi, Francesco

2008-04-01

There is currently neither a clinically useful, reliable and inexpensive assay to measure circulating levels of free testosterone (T) in the range observed in women, nor is there agreement on the serum free T threshold defining hypoandrogenism that is associated with female-impaired sexual function. Following the Clinical and Laboratory Standards Institute guidelines, we generated clinically applicable ranges for circulating androgens during specific phases of the menstrual cycle in a convenience sample of 120 reproductive-aged, regularly cycling healthy European Caucasian women with self-reported normal sexual function. All participants were asked to complete a semistructured interview and fill out a set of validated questionnaires, including the Female Sexual Function Index, the Female Sexual Distress Scale, and the 21-item Beck's Inventory for Depression. Between 8 am and 10 am, a venous blood sample was drawn from each participant during the midfollicular (day 5 to 8), the ovulatory (day 13 to 15), and the midluteal phase (day 19 to 22) of the same menstrual cycle. Serum levels of total and free testosterone, Delta(4)-androstenedione, dehydroepiandrosterone sulphate and sex hormone-binding globulin during the midfollicular, ovulatory and midluteal phase of the same menstrual cycle. Total and free T levels showed significant fluctuations, peaking during the ovulatory phase. No significant variation during the menstrual cycle were observed for Delta(4)-androstenedione and dehydroepiandrosterone sulphate. Despite the careful selection of participants that yielded an homogeneous group of women without sexual disorders, we observed a wide range of distribution for each of the circulating androgens measured in this study. This report provides clinically applicable ranges for androgens throughout the menstrual cycle in reproductive-aged, regularly cycling, young healthy Caucasian European women with self-reported normal sexual function.

A new MicroTCA-based waveform digitizer for the Muon g-2 experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sweigart, David A.

We present the design of a newmore » $$\\mu$$TCA-based waveform digitizer, which will be deployed in the Muon g-2 experiment at Fermilab and will allow our pileup identification requirement to be met. This digitizer features five independent channels, each with 12-bit, 800-MSPS digitization and a 1-Gbit memory buffer. The data storage and readout along with configuration are handled by six Xilinx Kintex-7 FPGAs. In addition, the digitizer is equipped with a mezzanine card for analog signal conditioning prior to digitization, further widening its range of possible applications. The performance results of this design are also presented, highlighting its $$0.51 \\pm 0.13$$ mV intrinsic noise level and $< 22$ ps intrinsic timing resolution between channels. We believe that its performance, together with its flexible design, could be of interest to future experiments in search of a cost-effective waveform digitizer.« less

Oxygenated monoterpenes citral and carvacrol cause oxidative damage in Escherichia coli without the involvement of tricarboxylic acid cycle and Fenton reaction.

PubMed

Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego

2014-10-17

Oxygenated monoterpenes citral and carvacrol are common constituents of many essential oils (EOs) that have been extensively studied as antimicrobial agents but whose mechanisms of microbial inactivation have not been totally elucidated. A recent study described a mechanism of Escherichia coli death for (+)-limonene, a hydrocarbon monoterpene also frequently present in EOs, similar to the common mechanism proposed for bactericidal antibiotics. This mechanism involves the formation of Fenton-mediated hydroxyl radical, a reactive oxygen species (ROS), via tricarboxylic acid (TCA) cycle, which would ultimately inactivate cells. Our objective was to determine whether E. coli MG1655 inactivation by citral and carvacrol follows a similar mechanism of cell death. Challenging experiments with 300μL/L citral and 100μL/L carvacrol inactivated at least 2.5log10cycles of exponentially growing cells in 3h under aerobic conditions. The presence of thiourea (an ROS scavenger) reduced cell inactivation in 2log10cycles, demonstrating the role of ROS in cell death. Decreased resistance of a ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) indicated that citral and carvacrol caused oxidative damage to DNA. Although the mechanism of E. coli inactivation by carvacrol and citral was similarly mediated by ROS, their formation did not follow the same pathways described for (+)-limonene and bactericidal drugs because neither Fenton reaction nor NADH production via the TCA cycle was involved in cell death. Moreover, further experiments demonstrated antimicrobial activity of citral and carvacrol in anaerobic environments without the involvement of ROS. As a consequence, cell death by carvacrol and citral in anaerobiosis follows a different mechanism than that observed under aerobic conditions. These results demonstrated a different mechanism of inactivation by citral and carvacrol with regard to (+)-limonene and bactericidal antibiotics, indicating the

Activity-Based Protein Profiling Reveals Mitochondrial Oxidative Enzyme Impairment and Restoration in Diet-Induced Obese Mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sadler, Natalie C.; Angel, Thomas E.; Lewis, Michael P.

High-fat diet (HFD) induced obesity and concomitant development of insulin resistance (IR) and type 2 diabetes mellitus have been linked to mitochondrial dysfunction. However, it is not clear whether mitochondrial dysfunction is a direct effect of a HFD or if the mitochondrial function is reduced with increased HFD duration. We hypothesized that the function of mitochondrial oxidative and lipid metabolism functions in skeletal muscle mitochondria for HFD mice are similar or elevated relative to standard diet (SD) mice, thereby IR is neither cause nor consequence of mitochondrial dysfunction. We applied a chemical probe approach to identify functionally reactive ATPases andmore » nucleotide-binding proteins in mitochondria isolated from skeletal muscle of C57Bl/6J mice fed HFD or SD chow for 2-, 8-, or 16-weeks; feeding time points known to induce IR. A total of 293 probe-labeled proteins were identified by mass spectrometry-based proteomics, of which 54 differed in abundance between HFD and SD mice. We found proteins associated with the TCA cycle, oxidative phosphorylation (OXPHOS), and lipid metabolism were altered in function when comparing SD to HFD fed mice at 2-weeks, however by 16-weeks HFD mice had TCA cycle, β-oxidation, and respiratory chain function at levels similar to or higher than SD mice.« less

Effect of fluid ingestion on neuromuscular function during prolonged cycling exercise.

PubMed

Vallier, J-M; Grego, F; Basset, F; Lepers, R; Bernard, T; Brisswalter, J

2005-04-01

To investigate the effects of fluid ingestion on neuromuscular function during prolonged cycling exercise. Eight well trained subjects exercised for 180 minutes in a moderate environment at a workload requiring approximately 60% maximal oxygen uptake. Two conditions, fluid (F) and no fluid (NF) ingestion, were investigated. During maximal voluntary isometric contraction (MVC), prolonged cycling exercise reduced (p<0.05) the maximal force generating capacity of quadriceps muscles (after three hours of cycling) and root mean square (RMS) values (after two hours of cycling) with no difference between the two conditions despite greater body weight loss (p<0.05) in NF. The mean power frequency (MPF) for vastus lateralis muscle was reduced (p<0.05) and the rate of force development (RFD) was increased (p<0.05) only during NF. During cycling exercise, integrated electromyographic activity and perceived exertion were increased in both conditions (p<0.05) with no significant effect of fluid ingestion. The results suggest that fluid ingestion did not prevent the previously reported decrease in maximal force with exercise duration, but seems to have a positive effect on some indicators of neuromuscular fatigue such as mean power frequency and rate of force development during maximal voluntary contraction. Further investigations are needed to assess the effect of change in hydration on neural mechanisms linked to the development of muscular fatigue during prolonged exercise.

Atherosclerosis and cardiac function assessment in low-density lipoprotein receptor-deficient mice undergoing body weight cycling.

PubMed

McMillen, T S; Minami, E; Leboeuf, R C

2013-06-24

Obesity has become an epidemic in many countries and is supporting a billion dollar industry involved in promoting weight loss through diet, exercise and surgical procedures. Because of difficulties in maintaining body weight reduction, a pattern of weight cycling often occurs (so called 'yo-yo' dieting) that may result in deleterious outcomes to health. There is controversy about cardiovascular benefits of yo-yo dieting, and an animal model is needed to better understand the contributions of major diet and body weight changes on heart and vascular functions. Our purpose is to determine the effects of weight cycling on cardiac function and atherosclerosis development in a mouse model. We used low-density lipoprotein receptor-deficient mice due to their sensitivity to metabolic syndrome and cardiovascular diseases when fed high-fat diets. Alternating ad libitum feeding of high-fat and low-fat (rodent chow) diets was used to instigate weight cycling during a 29-week period. Glucose tolerance and insulin sensitivity tests were done at 22 and 24 weeks, echocardiograms at 25 weeks and atherosclerosis and plasma lipoproteins assessed at 29 weeks. Mice subjected to weight cycling showed improvements in glucose homeostasis during the weight loss cycle. Weight-cycled mice showed a reduction in the severity of atherosclerosis as compared with high-fat diet-fed mice. However, atherosclerosis still persisted in weight-cycled mice as compared with mice fed rodent chow. Cardiac function was impaired in weight-cycled mice and matched with that of mice fed only the high-fat diet. This model provides an initial structure in which to begin detailed studies of diet, calorie restriction and surgical modifications on energy balance and metabolic diseases. This model also shows differential effects of yo-yo dieting on metabolic syndrome and cardiovascular diseases.

Inhibition of akt phosphorylation diminishes mitochondrial biogenesis regulators, tricarboxylic acid cycle activity and exacerbates recognition memory deficit in rat model of Alzheimer's disease.

PubMed

Shaerzadeh, Fatemeh; Motamedi, Fereshteh; Khodagholi, Fariba

2014-11-01

3-Methyladenine (3-MA), as a PI3K inhibitor, is widely used for inhibition of autophagy. Inhibition of PI3K class I leads to inhibition of Akt phosphorylation, a central molecule involved in diverse arrays of intracellular cascades in nervous system. Accordingly, in the present study, we aimed to determine the alterations of specific mitochondrial biogenesis markers and mitochondrial function in 3-MA-injected rats following amyloid beta (Aβ) insult. Our data revealed that inhibition of Akt phosphorylation downregulates master regulator of mitochondrial biogenesis, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α). Our data also showed that decrease in PGC-1α level presumably is due to decrease in the phosphorylation of cAMP-response element binding and AMP-activated kinase, two upstream activators of PGC-1α. As a consequence, the level of some mitochondrial biogenesis factors including nuclear respiratory factor-1, mitochondrial transcription factor A, and Cytochrome c decreased significantly. Also, activities of tricarboxylic acid cycle (TCA) enzymes such as Aconitase, a-ketoglutarate dehydrogenase, and malate dehydrogenase reduced in the presence of 3-MA with or without Aβ insult. Decrease in mitochondrial biogenesis factors and TCA enzyme activity in the rats receiving 3-MA and Aβ were more compared to the rats that received either alone; indicating the additive destructive effects of these two agents. In agreement with our molecular results, data obtained from behavioral test (using novel objective recognition test) indicated that inhibition of Akt phosphorylation with or without Aβ injection impaired novel recognition (non-spatial) memory. Our results suggest that 3-MA amplified deleterious effects of Aβ by targeting central molecule Akt.

Biochemical Validation of the Glyoxylate Cycle in the Cyanobacterium Chlorogloeopsis fritschii Strain PCC 9212.

PubMed

Zhang, Shuyi; Bryant, Donald A

2015-05-29

Cyanobacteria are important photoautotrophic bacteria with extensive but variable metabolic capacities. The existence of the glyoxylate cycle, a variant of the TCA cycle, is still poorly documented in cyanobacteria. Previous studies reported the activities of isocitrate lyase and malate synthase, the key enzymes of the glyoxylate cycle in some cyanobacteria, but other studies concluded that these enzymes are missing. In this study the genes encoding isocitrate lyase and malate synthase from Chlorogloeopsis fritschii PCC 9212 were identified, and the recombinant enzymes were biochemically characterized. Consistent with the presence of the enzymes of the glyoxylate cycle, C. fritschii could assimilate acetate under both light and dark growth conditions. Transcript abundances for isocitrate lyase and malate synthase increased, and C. fritschii grew faster, when the growth medium was supplemented with acetate. Adding acetate to the growth medium also increased the yield of poly-3-hydroxybutyrate. When the genes encoding isocitrate lyase and malate synthase were expressed in Synechococcus sp. PCC 7002, the acetate assimilation capacity of the resulting strain was greater than that of wild type. Database searches showed that the genes for the glyoxylate cycle exist in only a few other cyanobacteria, all of which are able to fix nitrogen. This study demonstrates that the glyoxylate cycle exists in a few cyanobacteria, and that this pathway plays an important role in the assimilation of acetate for growth in one of those organisms. The glyoxylate cycle might play a role in coordinating carbon and nitrogen metabolism under conditions of nitrogen fixation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Biochemical markers and neuropsychological functioning in distal urea cycle disorders.

PubMed

Waisbren, Susan E; Cuthbertson, David; Burgard, Peter; Holbert, Amy; McCarter, Robert; Cederbaum, Stephen

2018-02-08

Urea cycle disorders often present as devastating metabolic conditions, resulting in high mortality and significant neuropsychological damage, despite treatment. The Urea Cycle Disorders Longitudinal Study is a natural history study that collects data from regular clinical follow-up and neuropsychological testing. This report examines links between biochemical markers (ammonia, glutamine, arginine, citrulline) and primary neuropsychological endpoints in three distal disorders, argininosuccinic acid synthetase deficiency (ASD or citrullinemia type I), argininosuccinic acid lyase deficiency (ASA or ALD), and arginase deficiency (ARGD). Laboratory results and test scores from neuropsychological evaluations were assessed in 145 study participants, ages 3 years and older, with ASD (n = 64), ASA (n = 65) and ARGD (n = 16). Mean full scale IQ was below the population mean of 100 ± 15 for all groups: (ASD = 79 ± 24; ASA = 71 ± 21; ARGD = 65 ± 19). The greatest deficits were noted in visual performance and motor skills for all groups. While ammonia levels remain prominent as prognostic biomarkers, other biomarkers may be equally valuable as correlates of neuropsychological functioning. Cumulative exposure to the biomarkers included in the study proved to be highly sensitive indicators of neuropsychological outcomes, even when below the cut-off levels generally considered toxic. Blood levels of biomarkers obtained on the day of neuropsychological evaluations were not correlated with measures of functioning for any disorder in any domain. The importance of cumulative exposure supports early identification and confirms the need for well-controlled management of all biochemical abnormalities (and not just ammonia) that occur in urea cycle disorders.

Integration between Glycolysis and Glutamate-Glutamine Cycle Flux May Explain Preferential Glycolytic Increase during Brain Activation, Requiring Glutamate

PubMed Central

Hertz, Leif; Chen, Ye

2017-01-01

oxidative metabolism occurs during glutamate formation it is only one half of that during normal tricarboxylic acid (TCA) cycle function. Glutamate’s receptor stimulation leads to potassium ion (K+) release and astrocytic uptake, preferentially fueled by glycolysis and followed by release and neuronal re-accumulation. The activation-induced preferential glycolysis diminishes with continued activation and is followed by an increased ratio between oxidative metabolism and glycolysis, reflecting oxidation of generated glutamate and accumulated lactate. PMID:28890689

Trade-off between taxon diversity and functional diversity in European lake ecosystems.

PubMed

Grossmann, Lars; Beisser, Daniela; Bock, Christina; Chatzinotas, Antonis; Jensen, Manfred; Preisfeld, Angelika; Psenner, Roland; Rahmann, Sven; Wodniok, Sabina; Boenigk, Jens

2016-12-01

Inferring ecosystem functioning and ecosystem services through inspections of the species inventory is a major aspect of ecological field studies. Ecosystem functions are often stable despite considerable species turnover. Using metatranscriptome analyses, we analyse a thus-far unparalleled freshwater data set which comprises 21 mainland European freshwater lakes from the Sierra Nevada (Spain) to the Carpathian Mountains (Romania) and from northern Germany to the Apennines (Italy) and covers an altitudinal range from 38 m above sea level (a.s.l) to 3110 m a.s.l. The dominant taxa were Chlorophyta and streptophytic algae, Ciliophora, Bacillariophyta and Chrysophyta. Metatranscriptomics provided insights into differences in community composition and into functional diversity via the relative share of taxa to the overall read abundance of distinct functional genes on the ecosystem level. The dominant metabolic pathways in terms of the fraction of expressed sequences in the cDNA libraries were affiliated with primary metabolism, specifically oxidative phosphorylation, photosynthesis and the TCA cycle. Our analyses indicate that community composition is a good first proxy for the analysis of ecosystem functions. However, differential gene regulation modifies the relative importance of taxa in distinct pathways. Whereas taxon composition varies considerably between lakes, the relative importance of distinct metabolic pathways is much more stable, indicating that ecosystem functioning is buffered against shifts in community composition through a functional redundancy of taxa. © 2016 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Protein precipitation of diluted samples in SDS-containing buffer with acetone leads to higher protein recovery and reproducibility in comparison with TCA/acetone approach.

PubMed

Santa, Cátia; Anjo, Sandra I; Manadas, Bruno

2016-07-01

Proteomic approaches are extremely valuable in many fields of research, where mass spectrometry methods have gained an increasing interest, especially because of the ability to perform quantitative analysis. Nonetheless, sample preparation prior to mass spectrometry analysis is of the utmost importance. In this work, two protein precipitation approaches, widely used for cleaning and concentrating protein samples, were tested and compared in very diluted samples solubilized in a strong buffer (containing SDS). The amount of protein recovered after acetone and TCA/acetone precipitation was assessed, as well as the protein identification and relative quantification by SWATH-MS yields were compared with the results from the same sample without precipitation. From this study, it was possible to conclude that in the case of diluted samples in denaturing buffers, the use of cold acetone as precipitation protocol is more favourable than the use of TCA/acetone in terms of reproducibility in protein recovery and number of identified and quantified proteins. Furthermore, the reproducibility in relative quantification of the proteins is even higher in samples precipitated with acetone compared with the original sample. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Influence of menstrual cycle phase on pulmonary function in asthmatic athletes.

PubMed

Stanford, Kristin I; Mickleborough, Timothy D; Ray, Shahla; Lindley, Martin R; Koceja, David M; Stager, Joel M

2006-04-01

The main aim of this study was to investigate whether there is a relationship between menstrual cycle phase and exercise-induced bronchoconstriction (EIB) in female athletes with mild atopic asthma. Seven eumenorrheic subjects with regular 28-day menstrual cycles were exercised to volitional exhaustion on day 5 [mid-follicular (FOL)] and day 21 [mid-luteal (LUT)] of their menstrual cycle. Pulmonary function tests were conducted pre- and post-exercise. The maximal percentage decline in post-exercise forced expiratory volume in 1 s (FEV(1)) and forced expiratory flow from 25 to 75% of forced vital capacity (FEF(25-75%)) was significantly greater (P<0.05) on day 21 (mid-LUT phase) (-17.35+/-2.32 and -26.28+/-6.04%, respectively), when salivary progesterone concentration was highest, compared to day 5 (mid-FOL phase) (-12.81+/-3.35 and -17.23+/-8.20%, respectively), when salivary progesterone concentration was lowest. The deterioration in the severity of EIB during the mid-LUT phase was accompanied by worsening asthma symptoms and increased bronchodilator use. There was a negative correlation between the percent change in pre- to post-exercise FEV(1) and salivary progesterone concentration. However, no such correlation was found between salivary estradiol and the percentage change in pre- to post-exercise FEV(1). This study has shown for the first time that menstrual cycle phase is an important determinant of the severity of EIB in female athletes with mild atopic asthma. Female asthmatic athletes may need to adjust their training and competition schedules to their menstrual cycle and to consider the potential negative effects of the LUT phase of the menstrual cycle on exercise performance.

Sexual dimorphism in immune function changes during the annual cycle in house sparrows

NASA Astrophysics Data System (ADS)

Pap, Péter László; Czirják, Gábor Árpád; Vágási, Csongor István; Barta, Zoltán; Hasselquist, Dennis

2010-10-01

Difference between sexes in parasitism is a common phenomenon among birds, which may be related to differences between males and females in their investment into immune functions or as a consequence of differential exposure to parasites. Because life-history strategies change sex specifically during the annual cycle, immunological responses of the host aiming to reduce the impact of parasites may be sexually dimorphic. Despite the great complexity of the immune system, studies on immunoecology generally characterise the immune status through a few variables, often overlooking potentially important seasonal and gender effects. However, because of the differences in physiological and defence mechanisms among different arms of the immune system, we expect divergent responses of immune components to environmental seasonality. In male and female house sparrows ( Passer domesticus), we measured the major components of the immune system (innate, acquired, cellular and humoral) during four important life-history stages across the year: (1) mating, (2) breeding, (3) moulting and (4) during the winter capture and also following introduction to captivity in aviary. Different individuals were sampled from the same population during the four life cycle stages. We found that three out of eight immune variables showed a significant life cycle stage × sex interaction. The difference in immune response between the sexes was significant in five immune variables during the mating stage, when females had consistently stronger immune function than males, while variables varied generally non-significantly with sex during the remaining three life cycle stages. Our results show that the immune system is highly variable between life cycle stages and sexes, highlighting the potential fine tuning of the immune system to specific physiological states and environmental conditions.

New roles for p21 and p27 cell-cycle inhibitors: a function for each cell compartment?

PubMed

Coqueret, Olivier

2003-02-01

Cell division relies on the activation of cyclins, which bind to cyclin-dependent kinases (CDKs) to induce cell-cycle progression towards S phase and later to initiate mitosis. Since uncontrolled cyclin-dependent kinase activity is often the cause of human cancer, their function is tightly regulated by cell-cycle inhibitors such as the p21 and p27 Cip/Kip proteins. Following anti-mitogenic signals or DNA damage, p21 and p27 bind to cyclin-CDK complexes to inhibit their catalytic activity and induce cell-cycle arrest. Interestingly, recent discoveries suggest that p21 and p27 might have new activities that are unrelated to their function as CDK inhibitors. The identification of new targets of Cip/Kip proteins as well as evidence of Cip/Kip cytoplasmic relocalization have revealed unexpected functions for these proteins in the control of CDK activation, in the regulation of apoptosis and in transcriptional activation. This article discusses recent insights into these possible additional functions of p21 and p27.

PEPCK Coordinates the Regulation of Central Carbon Metabolism to Promote Cancer Cell Growth.

PubMed

Montal, Emily D; Dewi, Ruby; Bhalla, Kavita; Ou, Lihui; Hwang, Bor Jang; Ropell, Ashley E; Gordon, Chris; Liu, Wan-Ju; DeBerardinis, Ralph J; Sudderth, Jessica; Twaddel, William; Boros, Laszlo G; Shroyer, Kenneth R; Duraisamy, Sekhar; Drapkin, Ronny; Powers, R Scott; Rohde, Jason M; Boxer, Matthew B; Wong, Kwok-Kin; Girnun, Geoffrey D

2015-11-19

Phosphoenolpyruvate carboxykinase (PEPCK) is well known for its role in gluconeogenesis. However, PEPCK is also a key regulator of TCA cycle flux. The TCA cycle integrates glucose, amino acid, and lipid metabolism depending on cellular needs. In addition, biosynthetic pathways crucial to tumor growth require the TCA cycle for the processing of glucose and glutamine derived carbons. We show here an unexpected role for PEPCK in promoting cancer cell proliferation in vitro and in vivo by increasing glucose and glutamine utilization toward anabolic metabolism. Unexpectedly, PEPCK also increased the synthesis of ribose from non-carbohydrate sources, such as glutamine, a phenomenon not previously described. Finally, we show that the effects of PEPCK on glucose metabolism and cell proliferation are in part mediated via activation of mTORC1. Taken together, these data demonstrate a role for PEPCK that links metabolic flux and anabolic pathways to cancer cell proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

Glutamate and asparagine cataplerosis underlie glutamine addiction in melanoma

PubMed Central

Ratnikov, Boris; Aza-Blanc, Pedro; Ronai, Ze'ev A.; Smith, Jeffrey W.; Osterman, Andrei L.; Scott, David A.

2015-01-01

Glutamine dependence is a prominent feature of cancer metabolism, and here we show that melanoma cells, irrespective of their oncogenic background, depend on glutamine for growth. A quantitative audit of how carbon from glutamine is used showed that TCA-cycle-derived glutamate is, in most melanoma cells, the major glutamine-derived cataplerotic output and product of glutaminolysis. In the absence of glutamine, TCA cycle metabolites were liable to depletion through aminotransferase-mediated α-ketoglutarate-to-glutamate conversion and glutamate secretion. Aspartate was an essential cataplerotic output, as melanoma cells demonstrated a limited capacity to salvage external aspartate. Also, the absence of asparagine increased the glutamine requirement, pointing to vulnerability in the aspartate-asparagine biosynthetic pathway within melanoma metabolism. In contrast to melanoma cells, melanocytes could grow in the absence of glutamine. Melanocytes use more glutamine for protein synthesis rather than secreting it as glutamate and are less prone to loss of glutamate and TCA cycle metabolites when starved of glutamine. PMID:25749035

Environment impacts the metabolic dependencies of Ras-driven non-small cell lung cancer

PubMed Central

Davidson, Shawn M.; Papagiannakopoulos, Thales; Olenchock, Benjamin A.; Heyman, Julia E.; Keibler, Mark A.; Luengo, Alba; Bauer, Matthew R.; Jha, Abhishek K.; O’Brien, James P.; Pierce, Kerry A.; Gui, Dan Y.; Sullivan, Lucas B.; Wasylenko, Thomas M.; Subbaraj, Lakshmipriya; Chin, Christopher R.; Stephanopolous, Gregory; Mott, Bryan T.; Jacks, Tyler; Clish, Clary B.; Vander Heiden, Matthew G.

2016-01-01

SUMMARY Cultured cells convert glucose to lactate and glutamine is the major source of tricarboxylic acid (TCA) cycle carbon, but whether the same metabolic phenotype is found in tumors is less studied. We infused mice with lung cancers with isotope-labeled glucose or glutamine and compared the fate of these nutrients in tumor and normal tissue. As expected, lung tumors exhibit increased lactate production from glucose. However, glutamine utilization by both lung tumors and normal lung was minimal, with lung tumors showing increased glucose contribution to the TCA cycle relative to normal lung tissue. Deletion of enzymes involved in glucose oxidation demonstrates that glucose carbon contribution to the TCA cycle is required for tumor formation. These data suggest that understanding nutrient utilization by tumors can predict metabolic dependencies of cancers in vivo. Furthermore, these data argue that the in vivo environment is an important determinant of the metabolic phenotype of cancer cells. PMID:26853747

Functional unit, technological dynamics, and scaling properties for the life cycle energy of residences.

PubMed

Frijia, Stephane; Guhathakurta, Subhrajit; Williams, Eric

2012-02-07

Prior LCA studies take the operational phase to include all energy use within a residence, implying a functional unit of all household activities, but then exclude related supply chains such as production of food, appliances, and household chemicals. We argue that bounding the functional unit to provision of a climate controlled space better focuses the LCA on the building, rather than activities that occur within a building. The second issue explored in this article is how technological change in the operational phase affects life cycle energy. Heating and cooling equipment is replaced at least several times over the lifetime of a residence; improved efficiency of newer equipment affects life cycle energy use. The third objective is to construct parametric models to describe LCA results for a family of related products. We explore these three issues through a case study of energy use of residences: one-story and two-story detached homes, 1,500-3,500 square feet in area, located in Phoenix, Arizona, built in 2002 and retired in 2051. With a restricted functional unit and accounting for technological progress, approximately 30% of a building's life cycle energy can be attributed to materials and construction, compared to 0.4-11% in previous studies.

Vx-770 potentiates CFTR function by promoting decoupling between the gating cycle and ATP hydrolysis cycle.

PubMed

Jih, Kang-Yang; Hwang, Tzyh-Chang

2013-03-12

Vx-770 (Ivacaftor), a Food and Drug Administration (FDA)-approved drug for clinical application to patients with cystic fibrosis (CF), shifts the paradigm from conventional symptomatic treatments to therapeutics directly tackling the root of the disease: functional defects of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel caused by pathogenic mutations. The underlying mechanism for the action of Vx-770 remains elusive partly because this compound not only increases the activity of wild-type (WT) channels whose gating is primarily controlled by ATP binding/hydrolysis, but also improves the function of G551D-CFTR, a disease-associated mutation that abolishes CFTR's responsiveness to ATP. Here we provide a unified theory to account for this dual effect of Vx-770. We found that Vx-770 enhances spontaneous, ATP-independent activity of WT-CFTR to a similar magnitude as its effects on G551D channels, a result essentially explaining Vx-770's effect on G551D-CFTR. Furthermore, Vx-770 increases the open time of WT-CFTR in an [ATP]-dependent manner. This distinct kinetic effect is accountable with a newly proposed CFTR gating model depicting an [ATP]-dependent "reentry" mechanism that allows CFTR shuffling among different open states by undergoing multiple rounds of ATP hydrolysis. We further examined the effect of Vx-770 on R352C-CFTR, a unique mutant that allows direct observation of hydrolysis-triggered gating events. Our data corroborate that Vx-770 increases the open time of WT-CFTR by stabilizing a posthydrolytic open state and thereby fosters decoupling between the gating cycle and ATP hydrolysis cycle. The current study also suggests that this unique mechanism of drug action can be further exploited to develop strategies that enhance the function of CFTR.

Vx-770 potentiates CFTR function by promoting decoupling between the gating cycle and ATP hydrolysis cycle

PubMed Central

Jih, Kang-Yang; Hwang, Tzyh-Chang

2013-01-01

Vx-770 (Ivacaftor), a Food and Drug Administration (FDA)-approved drug for clinical application to patients with cystic fibrosis (CF), shifts the paradigm from conventional symptomatic treatments to therapeutics directly tackling the root of the disease: functional defects of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel caused by pathogenic mutations. The underlying mechanism for the action of Vx-770 remains elusive partly because this compound not only increases the activity of wild-type (WT) channels whose gating is primarily controlled by ATP binding/hydrolysis, but also improves the function of G551D-CFTR, a disease-associated mutation that abolishes CFTR’s responsiveness to ATP. Here we provide a unified theory to account for this dual effect of Vx-770. We found that Vx-770 enhances spontaneous, ATP-independent activity of WT-CFTR to a similar magnitude as its effects on G551D channels, a result essentially explaining Vx-770’s effect on G551D-CFTR. Furthermore, Vx-770 increases the open time of WT-CFTR in an [ATP]-dependent manner. This distinct kinetic effect is accountable with a newly proposed CFTR gating model depicting an [ATP]-dependent “reentry” mechanism that allows CFTR shuffling among different open states by undergoing multiple rounds of ATP hydrolysis. We further examined the effect of Vx-770 on R352C-CFTR, a unique mutant that allows direct observation of hydrolysis-triggered gating events. Our data corroborate that Vx-770 increases the open time of WT-CFTR by stabilizing a posthydrolytic open state and thereby fosters decoupling between the gating cycle and ATP hydrolysis cycle. The current study also suggests that this unique mechanism of drug action can be further exploited to develop strategies that enhance the function of CFTR. PMID:23440202

Highly selective solid-phase extraction and large volume injection for the robust gas chromatography-mass spectrometric analysis of TCA and TBA in wines.

PubMed

Insa, S; Anticó, E; Ferreira, V

2005-09-30

A reliable solid-phase extraction (SPE) method for the simultaneous determination of 2,4,6-trichloroanisole (TCA) and 2,4,6-tribromoanisole (TBA) in wines has been developed. In the proposed procedure 50 mL of wine are extracted in a 1 mL cartridge filled with 50 mg of LiChrolut EN resins. Most wine volatiles are washed up with 12.5 mL of a water:methanol solution (70%, v/v) containing 1% of NaHCO3. Analytes are further eluted with 0.6 mL of dichloromethane. A 40 microL aliquot of this extract is directly injected into a PTV injector operated in the solvent split mode, and analysed by gas chromatography (GC)-ion trap mass spectrometry using the selected ion storage mode. The solid-phase extraction, including sample volume and rinsing and elution solvents, and the large volume GC injection have been carefully evaluated and optimized. The resulting method is precise (RSD (%) < 6% at 100 ng L(-1)), sensitive (LOD were 0.2 and 0.4 ng/L for TCA and TBA, respectively), robust (the absolute recoveries of both analytes are higher than 80% and consistent wine to wine) and friendly to the GC-MS system (the extract is clean, simple and free from non-volatiles).

Abrupt shifts in ecosystem function and intensification of global biogeochemical cycle driven by hydroclimatic extremes

NASA Astrophysics Data System (ADS)

Ma, Xuanlong; Huete, Alfredo; Ponce-Campos, Guillermo; Zhang, Yongguang; Xie, Zunyi; Giovannini, Leandro; Cleverly, James; Eamus, Derek

2016-04-01

Amplification of the hydrologic cycle as a consequence of global warming is increasing the frequency, intensity, and spatial extent of extreme climate events globally. The potential influences resulting from amplification of the hydro-climatic cycle, coupled with an accelerating warming trend, pose great concerns on the sustainability of terrestrial ecosystems to sequester carbon, maintain biodiversity, provide ecosystem services, food security, and support human livelihood. Despite the great implications, the magnitude, direction, and carry-over effect of these extreme climate events on ecosystem function, remain largely uncertain. To address these pressing issues, we conducted an observational, interdisciplinary study using satellite retrievals of atmospheric CO2 and photosynthesis (chlorophyll fluorescence), and in-situ flux tower measures of ecosystem-atmosphere carbon exchange, to reveal the shifts in ecosystem function across extreme drought and wet periods. We further determine the factors that govern ecosystem sensitivity to hydroclimatic extremes. We focus on Australia but extended our analyses to other global dryland regions due to their significant role in global biogeochemical cycles. Our results revealed dramatic impacts of drought and wet hydroclimatic extremes on ecosystem function, with abrupt changes in vegetation productivity, carbon uptake, and water-use-efficiency between years. Drought resulted in widespread reductions or collapse in the normal patterns of vegetation growth seasonality such that in many cases there was no detectable phenological cycle during extreme drought years. We further identified a significant increasing trend (p < 0.001) in extreme wet year precipitation amounts over Australia and many other global regions, resulting in an increasing trend in magnitude of the episodic carbon sink pulses coupled to each La Niña-induced wet years. This finding is of global biogeochemical significance, with the consequence of amplifying

Integrated Analysis of the Transcriptome and Metabolome of Corynebacterium glutamicum during Penicillin-Induced Glutamic Acid Production.

PubMed

Hirasawa, Takashi; Saito, Masaki; Yoshikawa, Katsunori; Furusawa, Chikara; Shmizu, Hiroshi

2018-05-01

Corynebacterium glutamicum is known for its ability to produce glutamic acid and has been utilized for the fermentative production of various amino acids. Glutamic acid production in C. glutamicum is induced by penicillin. In this study, the transcriptome and metabolome of C. glutamicum is analyzed to understand the mechanism of penicillin-induced glutamic acid production. Transcriptomic analysis with DNA microarray revealed that expression of some glycolysis- and TCA cycle-related genes, which include those encoding the enzymes involved in conversion of glucose to 2-oxoglutaric acid, is upregulated after penicillin addition. Meanwhile, expression of some TCA cycle-related genes, encoding the enzymes for conversion of 2-oxoglutaric acid to oxaloacetic acid, and the anaplerotic reactions decreased. In addition, expression of NCgl1221 and odhI, encoding proteins involved in glutamic acid excretion and inhibition of the 2-oxoglutarate dehydrogenase, respectively, is upregulated. Functional category enrichment analysis of genes upregulated and downregulated after penicillin addition revealed that genes for signal transduction systems are enriched among upregulated genes, whereas those for energy production and carbohydrate and amino acid metabolisms are enriched among the downregulated genes. As for the metabolomic analysis using capillary electrophoresis time-of-flight mass spectrometry, the intracellular content of most metabolites of the glycolysis and the TCA cycle decreased dramatically after penicillin addition. Overall, these results indicate that the cellular metabolism and glutamic acid excretion are mainly optimized at the transcription level during penicillin-induced glutamic acid production by C. glutamicum. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cycling Power Outputs Predict Functional Threshold Power And Maximum Oxygen Uptake.

PubMed

Denham, Joshua; Scott-Hamilton, John; Hagstrom, Amanda D; Gray, Adrian J

2017-09-11

Functional threshold power (FTP) has emerged as a correlate of lactate threshold and is commonly assessed by recreational and professional cyclists for tailored exercise programing. To identify whether results from traditional aerobic and anaerobic cycling tests could predict FTP and V˙ O2max, we analysed the association between estimated FTP, maximum oxygen uptake (V˙ O2max [mlkgmin]) and power outputs obtained from a maximal cycle ergometry cardiopulmonary exercise test (CPET) and a 30-s Wingate test in a heterogeneous cohort of cycle-trained and untrained individuals (N=40, mean±SD; age: 32.6±10.6 y; relative V˙ O2max: 46.8±9.1 mlkgmin). The accuracy and sensitivity of the prediction equations was also assessed in young men (N=11) before and after a 6-wk sprint interval training intervention.Moderate to strong positive correlations were observed between FTP, relative V˙ O2max and power outputs achieved during incremental and 30-s Wingate cycling tests (r=.39-.965, all P<.05). While maximum power achieved during incremental cycle testing (Pmax) and relative V˙ O2max were predictors of FTP (r =.93), age and FTP (Wkg) estimated relative V˙ O2max (r=.80). Our findings confirm that FTP predominantly relies on aerobic metabolism and indicate both prediction models are sensitive enough to detect meaningful exercise-induced changes in FTP and V˙ O2max. Thus, coaches should consider limiting the time and load demands placed on athletes by conducting a maximal cycle ergometry CPET to estimate FTP. Additionally, a 20-min FTP test is a convenient method to assess V˙ O2max and is particularly relevant for exercise professionals without access to expensive CPET equipment.

Amalaki rasayana, a traditional Indian drug enhances cardiac mitochondrial and contractile functions and improves cardiac function in rats with hypertrophy.

PubMed

Kumar, Vikas; Aneesh, Kumar A; Kshemada, K; Ajith, Kumar G S; Binil, Raj S S; Deora, Neha; Sanjay, G; Jaleel, A; Muraleedharan, T S; Anandan, E M; Mony, R S; Valiathan, M S; Santhosh, Kumar T R; Kartha, C C

2017-08-17

We evaluated the cardioprotective effect of Amalaki Rasayana (AR), a rejuvenating Ayurvedic drug prepared from Phyllanthus emblica fruits in the reversal of remodeling changes in pressure overload left ventricular cardiac hypertrophy (LVH) and age-associated cardiac dysfunction in male Wistar rats. Six groups (aging groups) of 3 months old animals were given either AR or ghee and honey (GH) orally; seventh group was untreated. Ascending aorta was constricted using titanium clips in 3 months old rats (N = 24; AC groups) and after 6 months, AR or GH was given for further 12 months to two groups; one group was untreated. Histology, gene and protein expression analysis were done in heart tissues. Chemical composition of AR was analyzed by HPLC, HPTLC and LC-MS. AR intake improved (P < 0.05) cardiac function in aging rats and decreased LVH (P < 0.05) in AC rats as well as increased (P < 0.05) fatigue time in treadmill exercise in both groups. In heart tissues of AR administered rats of both the groups, SERCA2, CaM, Myh11, antioxidant, autophagy, oxidative phosphorylation and TCA cycle proteins were up regulated. ADRB1/2 and pCREB expression were increased; pAMPK, NF-kB were decreased. AR has thus a beneficial effect on myocardial energetics, muscle contractile function and exercise tolerance capacity.

Evaluation of Functional Electrical Stimulation to Assist Cycling in Four Adolescents with Spastic Cerebral Palsy

PubMed Central

Harrington, Ann Tokay; McRae, Calum G. A.; Lee, Samuel C. K.

2012-01-01

Introduction. Adolescents with cerebral palsy (CP) often have difficulty participating in exercise at intensities necessary to improve cardiovascular fitness. Functional electrical stimulation- (FES-) assisted cycling is proposed as a form of exercise for adolescents with CP. The aims of this paper were to adapt methods and assess the feasibility of applying FES cycling technology in adolescents with CP, determine methods of performing cycling tests in adolescents with CP, and evaluate the immediate effects of FES assistance on cycling performance. Materials/Methods. Four participants (12–14 years old; GMFCS levels III-IV) participated in a case-based pilot study of FES-assisted cycling in which bilateral quadriceps muscles were activated using surface electrodes. Cycling cadence, power output, and heart rate were collected. Results. FES-assisted cycling was well tolerated (n = 4) and cases are presented demonstrating increased cadence (2–43 rpm), power output (19–70%), and heart rates (4-5%) and decreased variability (8–13%) in cycling performance when FES was applied, compared to volitional cycling without FES assistance. Some participants (n = 2) required the use of an auxiliary hub motor for assistance. Conclusions. FES-assisted cycling is feasible for individuals with CP and may lead to immediate improvements in cycling performance. Future work will examine the potential for long-term fitness gains using this intervention. PMID:22685479

Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids.

PubMed

Terpolilli, Jason J; Masakapalli, Shyam K; Karunakaran, Ramakrishnan; Webb, Isabel U C; Green, Rob; Watmough, Nicholas J; Kruger, Nicholas J; Ratcliffe, R George; Poole, Philip S

2016-10-15

Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2 Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [(13)C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2 However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox

Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids

PubMed Central

Terpolilli, Jason J.; Masakapalli, Shyam K.; Karunakaran, Ramakrishnan; Webb, Isabel U. C.; Green, Rob; Watmough, Nicholas J.; Kruger, Nicholas J.; Ratcliffe, R. George

2016-01-01

ABSTRACT Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2. Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [13C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. IMPORTANCE Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2. However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent

Gluconeogenesis from labeled carbon: estimating isotope dilution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kelleher, J.K.

1986-03-01

To estimate the rate of gluconeogenesis from steady-state incorporation of labeled 3-carbon precursors into glucose, isotope dilution must be considered so that the rate of labeling of glucose can be quantitatively converted to the rate of gluconeogenesis. An expression for the value of this isotope dilution can be derived using mathematical techniques and a model of the tricarboxylic acid (TCA) cycle. The present investigation employs a more complex model than that used in previous studies. This model includes the following pathways that may affect the correction for isotope dilution: 1) flux of 3-carbon precursor to the oxaloacetate pool via acetyl-CoAmore » and the TCA cycle; 2) flux of 4- or 5-carbon compounds into the TCA cycle; 3) reversible flux between oxaloacetate (OAA) and pyruvate and between OAA and fumarate; 4) incomplete equilibrium between OAA pools; and 5) isotope dilution of 3-carbon tracers between the experimentally measured pool and the precursor for the TCA-cycle OAA pool. Experimental tests are outlined which investigators can use to determine whether these pathways are significant in a specific steady-state system. The study indicated that flux through these five pathways can significantly affect the correction for isotope dilution. To correct for the effects of these pathways an alternative method for calculating isotope dilution is proposed using citrate to relate the specific activities of acetyl-CoA and OAA.« less

Cell cycle progression is required for zebrafish somite morphogenesis but not segmentation clock function

PubMed Central

Zhang, Lixia; Kendrick, Christina; Jülich, Dörthe; Holley, Scott A.

2010-01-01

Summary Cell division, differentiation and morphogenesis are coordinated during embryonic development and frequently in disarray in pathologies such as cancer. Here, we present a zebrafish mutant that ceases mitosis at the beginning of gastrulation, but undergoes axis elongation and develops blood, muscle and a beating heart. We identify the mutation as being in early mitotic inhibitor 1 (emi1), a negative regulator of the Anaphase Promoting Complex, and utilize the mutant to examine the role of the cell cycle in somitogenesis. The mutant phenotype indicates that axis elongation during the segmentation period is substantially driven by cell migration. We find that the segmentation clock, which regulates somitogenesis, functions normally in the absence of cell cycle progression and observe that mitosis is a modest source of noise for the clock. Somite morphogenesis involves the epithelialization of the somite border cells around a core of mesenchyme. As in wild-type embryos, somite boundary cells are polarized along a Fibronectin matrix in emi1−/−. The mutants also display evidence of segment polarity. However, in the absence of a normal cell cycle, somites appear to hyper-epithelialize as the internal mesenchymal cells exit the core of the somite after initial boundary formation. Thus, cell cycle progression is not required during the segmentation period for segmentation clock function but is necessary for normal segmental arrangement of epithelial borders and internal mesenchymal cells. PMID:18480162

Thyroid hormones and menstrual cycle function in a longitudinal cohort of premenopausal women.

PubMed

Jacobson, Melanie H; Howards, Penelope P; Darrow, Lyndsey A; Meadows, Juliana W; Kesner, James S; Spencer, Jessica B; Terrell, Metrecia L; Marcus, Michele

2018-05-01

Previous studies have reported that hyperthyroid and hypothyroid women experience menstrual irregularities more often compared with euthyroid women, but reasons for this are not well-understood and studies on thyroid hormones among euthyroid women are lacking. In a prospective cohort study of euthyroid women, this study characterised the relationship between thyroid hormone concentrations and prospectively collected menstrual function outcomes. Between 2004-2014, 86 euthyroid premenopausal women not lactating or taking hormonal medications participated in a study measuring menstrual function. Serum thyroid hormones were measured before the menstrual function study began. Women then collected first morning urine voids and completed daily bleeding diaries every day for three cycles. Urinary oestrogen and progesterone metabolites (estrone 3-glucuronide (E 1 3G) and pregnanediol 3-glucuronide (Pd3G)) and follicle-stimulating hormone were measured and adjusted for creatinine (Cr). Total thyroxine (T 4 ) concentrations were positively associated with Pd3G and E 1 3G. Women with higher (vs lower) T 4 had greater luteal phase maximum Pd3G (Pd3G = 11.7 μg/mg Cr for women with high T 4 vs Pd3G = 9.5 and 8.1 μg/mg Cr for women with medium and low T 4 , respectively) and greater follicular phase maximum E 1 3G (E 1 3G = 41.7 ng/mg Cr for women with high T 4 vs E 1 3G = 34.3 and 33.7 ng/mg Cr for women with medium and low T 4 , respectively). Circulating thyroid hormone concentrations were associated with subtle differences in menstrual cycle function outcomes, particularly sex steroid hormone levels in healthy women. Results contribute to the understanding of the relationship between thyroid function and the menstrual cycle, and may have implications for fertility and chronic disease. © 2018 John Wiley & Sons Ltd.

Recovery of functionally-active protein from inclusion bodies using a thermal-cycling method.

PubMed

Sadavarte, Rahul; Filipe, Carlos D M; Ghosh, Raja

2017-01-01

Heterologous overexpression of genes in Escherichia coli has made it possible to obtain high titers of recombinant proteins. However, this can result in the formation of aggregated protein particles known as 'inclusion bodies'. Protein sequestered as inclusion body is inactive and needs to be converted back to its functional form by refolding using appropriate techniques. In the current study inclusion bodies of the enzyme aminoglycoside nucleotidyl transferase (or ANT(2″)-Ia) were first solubilized in urea and subsequently subjected to thermal cycling under controlled conditions as part of the refolding strategy. Thermal cycling led to disaggregation of the individual protein chains and simultaneously refolding the released protein molecules to their native state. The optimum condition was identified as 10-80°C thermal cycling at 3°C s -1 for 2 h. Enzyme activity measurements showed that thermal cycling under optimized conditions resulted in 257% activity recovery when compared with nonrefolded protein. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 33:133-139, 2017. © 2016 American Institute of Chemical Engineers.

Differential effects of ethanol on regional glutamatergic and GABAergic neurotransmitter pathways in mouse brain.

PubMed

Tiwari, Vivek; Veeraiah, Pandichelvam; Subramaniam, Vaidyanathan; Patel, Anant Bahadur

2014-03-01

This study investigates the effects of ethanol on neuronal and astroglial metabolism using (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of [1,6-(13)C2]/[1-(13)C]glucose or [2-(13)C]acetate, respectively. A three-compartment metabolic model was fitted to the (13)C turnover of GluC3 , GluC4, GABAC 2, GABAC 3, AspC3 , and GlnC4 from [1,6-(13)C2 ]glucose to determine the rates of tricarboxylic acid (TCA) and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The ratio of neurotransmitter cycle to TCA cycle fluxes for glutamatergic and GABAegic neurons was obtained from the steady-state [2-(13)C]acetate experiment and used as constraints during the metabolic model fitting. (1)H MRS measurement suggests that depletion of ethanol from cerebral cortex follows zero order kinetics with rate 0.18 ± 0.04 μmol/g/min. Acute exposure of ethanol reduces the level of glutamate and aspartate in cortical region. GlnC4 labeling was found to be unchanged from a 15 min infusion of [2-(13)C]acetate suggesting that acute ethanol exposure does not affect astroglial metabolism in naive mice. Rates of TCA and neurotransmitter cycle associated with glutamatergic and GABAergic neurons were found to be significantly reduced in cortical and subcortical regions. Acute exposure of ethanol perturbs the level of neurometabolites and decreases the excitatory and inhibitory activity differentially across the regions of brain. Depletion of ethanol and its effect on brain functions were measured using (1)H and (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of (13)C-labeled substrates. Ethanol depletion from brain follows zero order kinetics. Ethanol perturbs level of glutamate, and the excitatory and inhibitory activity in mice brain. © 2013 International Society for Neurochemistry.

Functional Differentiation of SWI/SNF Remodelers in Transcription and Cell Cycle Control▿ †

PubMed Central

Moshkin, Yuri M.; Mohrmann, Lisette; van Ijcken, Wilfred F. J.; Verrijzer, C. Peter

2007-01-01

Drosophila BAP and PBAP represent two evolutionarily conserved subclasses of SWI/SNF chromatin remodelers. The two complexes share the same core subunits, including the BRM ATPase, but differ in a few signature subunits: OSA defines BAP, whereas Polybromo (PB) and BAP170 specify PBAP. Here, we present a comprehensive structure-function analysis of BAP and PBAP. An RNA interference knockdown survey revealed that the core subunits BRM and MOR are critical for the structural integrity of both complexes. Whole-genome expression profiling suggested that the SWI/SNF core complex is largely dysfunctional in cells. Regulation of the majority of target genes required the signature subunit OSA, PB, or BAP170, suggesting that SWI/SNF remodelers function mostly as holoenzymes. BAP and PBAP execute similar, independent, or antagonistic functions in transcription control and appear to direct mostly distinct biological processes. BAP, but not PBAP, is required for cell cycle progression through mitosis. Because in yeast the PBAP-homologous complex, RSC, controls cell cycle progression, our finding reveals a functional switch during evolution. BAP mediates G2/M transition through direct regulation of string/cdc25. Its signature subunit, OSA, is required for directing BAP to the string/cdc25 promoter. Our results suggest that the core subunits play architectural and enzymatic roles but that the signature subunits determine most of the functional specificity of SWI/SNF holoenzymes in general gene control. PMID:17101803

Use of calcitriol to maintain postpartum blood calcium and improve immune function in dairy cows.

PubMed

Vieira-Neto, A; Lima, I R P; Lopes, F; Lopera, C; Zimpel, R; Sinedino, L D P; Jeong, K C; Galvão, K; Thatcher, W W; Nelson, C D; Santos, J E P

2017-07-01

Our objectives were to determine the effects of an injectable formulation of calcitriol on mineral metabolism and immune function in postpartum Holstein cows that received an acidogenic diet prepartum to minimize hypocalcemia. In experiment 1, cows within 6 h of calving received calcitriol (0, 200, or 300 μg) to determine the dose needed to increase plasma concentrations of Ca; 300 μg was sufficient to sustain Ca for at least 3 d. In experiment 2, multiparous cows were assigned randomly to receive only vehicle (control, n = 25) or 300 μg of calcitriol (n = 25) subcutaneously within the first 6 h after calving. Blood was sampled before treatment and 12 h later, then daily until 15 d in milk (DIM), and analyzed for concentrations of ionized Ca (iCa), total Ca (tCa), total Mg (tMg), and total P (tP), metabolites, and hormones. Urine was sampled in the first 7 DIM and analyzed for concentrations of tCa, tMg, and creatinine. Neutrophil function was evaluated in the first week postpartum. Dry matter intake and production performance were evaluated for the first 36 DIM. Calcitriol administration increased concentrations of calcitriol in plasma within 12 h of application from 51 to 427 pg/mL, which returned to baseline within 5 d. Concentrations of iCa and tCa increased 24 h after treatment with calcitriol. Concentrations of iCa (control = 1.08 vs. calcitriol = 1.20 mM), tCa (control = 2.23 vs. calcitriol = 2.33 mM), and tP (control = 1.47 vs. calcitriol = 1.81 mM) remained elevated in cows treated with calcitriol until 3, 5, and 7 DIM, respectively, whereas concentration of tMg (control = 0.76 vs. calcitriol = 0.67 mM) was less in calcitriol cows than control cows until 3 DIM. Concentrations of parathyroid hormone decreased in calcitriol cows compared with control cows (control = 441 vs. calcitriol = 336 pg/mL). Calcitriol tended to increase plasma concentrations of β-hydroxybutyrate and serotonin, but concentrations of glucose, nonesterified fatty acids, and C

Fresh insight to functioning of selected enzymes of the nitrogen cycle.

PubMed

Eady, Robert R; Antonyuk, Svetlana V; Hasnain, S Samar

2016-04-01

The global nitrogen cycle is the process in which different forms of environmental N are interconverted by microorganisms either for assimilation into biomass or in respiratory energy-generating pathways. This short review highlights developments over the last 5 years in our understanding of functionality of nitrogenase, Cu-nitrite reductase, NO reductase and N2O reductase, complex metalloenzymes that catalyze electron/proton-coupled substrate reduction reactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Some dissociating factors in the analysis of structural and functional progressive damage in open-angle glaucoma.

PubMed

Hudson, C J W; Kim, L S; Hancock, S A; Cunliffe, I A; Wild, J M

2007-05-01

To identify the presence, and origin, of any "dissociating factors" inherent to the techniques for evaluating progression that mask the relationship between structural and functional progression in open-angle glaucoma (OAG). 23 patients (14 with OAG and 9 with ocular hypertension (OHT)) who had received serial Heidelberg Retina Tomograph (HRT II) and Humphrey Field Analyser (HFA) examinations for >or=5 years (mean 78.4 months (SD 9.5), range 60-101 months) were identified. Evidence of progressive disease was retrospectively evaluated in one eye of each patient using the Topographic Change Analysis (TCA) and Glaucoma Progression Analysis (GPA) for the HRT II and HFA, respectively. Six patients were stable by both techniques; four exhibited both structural and functional progression; seven exhibited structural progression, only, and six showed functional progression, only. Three types of dissociating factors were identified. TCA failed to identify progressive structural damage in the presence of advanced optic nerve head damage. GPA failed to identify progressive functional damage at stimulus locations, with sensitivities exhibiting test-retest variability beyond the maximum stimulus luminance of the perimeter, and where a perimetric learning effect was apparent. The three dissociating factors accounted for nine of the 13 patients who exhibited a lack of concordance between structural and functional progressive damage.

Acute Bouts of Assisted Cycling Improves Cognitive and Upper Extremity Movement Functions in Adolescents with Down Syndrome

ERIC Educational Resources Information Center

Ringenbach, Shannon D. R; Albert, Andrew R.; Chen, Chih-Chia; Alberts, Jay L.

2014-01-01

The aim of this study was to examine the effectiveness of 2 modes of exercise on cognitive and upper extremity movement functioning in adolescents with Down syndrome (DS). Nine participants randomly completed 3 interventions over 3 consecutive weeks. The interventions were: (a) voluntary cycling (VC), in which participants cycled at their…

Cyanobacterial carbon metabolism: Fluxome plasticity and oxygen dependence: Cyanobacterial Carbon Metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wan, Ni; DeLorenzo, Drew M.; He, Lian

Synechocystis sp. strain PCC 6803 has been widely used as a photo-biorefinery chassis. Based on its genome annotation, this species contains a complete TCA cycle, an Embden-Meyerhof-Parnas pathway (EMPP), an oxidative pentose phosphate pathway (OPPP), and an Entner–Doudoroff pathway (EDP). To evaluate how Synechocystis 6803 catabolizes glucose under heterotrophic conditions, we performed 13C metabolic flux analysis, metabolite pool size analysis, gene knockouts, and heterologous expressions. The results revealed a cyclic mode of flux through the OPPP. Small, but non-zero, fluxes were observed through the TCA cycle and the malic shunt. Independent knockouts of 6-phosphogluconate dehydrogenase (gnd) and malic enzyme (me)more » corroborated these results, as neither mutant could grow under dark heterotrophic conditions. Our data also indicate that Synechocystis 6803 metabolism relies upon oxidative phosphorylation to generate ATP from NADPH under dark or insufficient light conditions. The pool sizes of intermediates in the TCA cycle, particularly acetyl-CoA, were found to be several fold lower in Synechocystis 6803 (compared to E. coli metabolite pool sizes), while its sugar phosphate intermediates were several-fold higher. Moreover, negligible flux was detected through the native, or heterologous, EDP in the wild type or Δgnd strains under heterotrophic conditions. Comparing photoautotrophic, photomixotrophic, and heterotrophic conditions, the Calvin cycle, OPPP, and EMPP in Synechocystis 6803 possess the ability to regulate their fluxes under various growth conditions (plastic), whereas its TCA cycle always maintains at low levels (rigid). This work also demonstrates how genetic profiles do not always reflect actual metabolic flux through native or heterologous pathways. Biotechnol. Bioeng. 2017;114: 1593–1602. © 2017 Wiley Periodicals, Inc.« less

Loss of Mitochondrial Pyruvate Carrier 2 in the Liver Leads to Defects in Gluconeogenesis and Compensation via Pyruvate-Alanine Cycling.

PubMed

McCommis, Kyle S; Chen, Zhouji; Fu, Xiaorong; McDonald, William G; Colca, Jerry R; Kletzien, Rolf F; Burgess, Shawn C; Finck, Brian N

2015-10-06

Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite for gluconeogenesis in hepatocytes, which is important for the maintenance of normoglycemia during prolonged food deprivation but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2(-/-)) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte conversion of labeled pyruvate to TCA cycle intermediates and glucose. Unbiased metabolomic analyses of livers from fasted LS-Mpc2(-/-) mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for the loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2(-/-) hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. Copyright © 2015 Elsevier Inc. All rights reserved.

Erythrocytes Functional Features in the 11-YEAR Solar Cycle

NASA Astrophysics Data System (ADS)

Parshina, S. S.; Tokayeva, L. K.; Dolgova, E. M.; Afanas'yeva, T. N.; Samsonov, S. N.; Petrova, V. D.; Vodolagina, E. S.; Kaplanova, T. I.; Potapova, M. V.

There had been studied features of rheological blood failures in patients with unstable angina (UA) in periods of the high (HSA) and low solar activity (LSA) in the 23rd 11-year solar cycle. This category of patients is characterized by prethrombotic blood state, although they don't have coronary thrombosis. The research aimed to study compensatory mechanisms which block thrombosis development at the solar activity increase. There had been established that the period of the solar activity increasing in the 11-year solar cycle is characterized by an increase of a blood viscosity, comparing with the period of a low solar activity. Though, erythrocytes functional features in this case are compensatory mechanisms - erythrocyte aggregation paradoxically reduced and their deformability increases. It is probably connected with the revealed fibrinogen decrease in the period of the high solar activity. We can see that the change of a solar activity is accompanied not only by the progressing of pathologic processes, but also by an activation of adaptive changes in erythrocyte membrane so0 as to prevent thrombosis. Though, the required compensatory mechanisms were found invalid, which were shown in the decrease of an oxygen delivery to tissues, and the effectiveness decrease of the medical treatment in the period of a HSA.

Alterations in Cytosolic and Mitochondrial [U-13C]Glucose Metabolism in a Chronic Epilepsy Mouse Model

PubMed Central

Carrasco-Pozo, Catalina

2017-01-01

Abstract Temporal lobe epilepsy is a common form of adult epilepsy and shows high resistance to treatment. Increasing evidence has suggested that metabolic dysfunction contributes to the development of seizures, with previous studies indicating impairments in brain glucose metabolism. Here we aim to elucidate which pathways involved in glucose metabolism are impaired, by tracing the hippocampal metabolism of injected [U-13C]glucose (i.p.) during the chronic stage of the pilocarpine-status epilepticus mouse model of epilepsy. The enrichment of 13C in the intermediates of glycolysis and the TCA cycle were quantified in hippocampal extracts using liquid chromatography–tandem mass spectroscopy, along with the measurement of the activities of enzymes in each pathway. We show that there is reduced incorporation of 13C in the intermediates of glycolysis, with the percentage enrichment of all downstream intermediates being highly correlated with those of glucose 6-phosphate. Furthermore, the activities of all enzymes in this pathway including hexokinase and phosphofructokinase were unaltered, suggesting that glucose uptake is reduced in this model without further impairments in glycolysis itself. The key findings were 33% and 55% losses in the activities of pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase, respectively, along with reduced 13C enrichment in TCA cycle intermediates. This lower 13C enrichment is best explained in part by the reduced enrichment in glycolytic intermediates, whereas the reduction of key TCA cycle enzyme activity indicates that TCA cycling is also impaired in the hippocampal formation. Together, these data suggest that multitarget approaches may be necessary to restore metabolism in the epileptic brain. PMID:28303258

Ornithine transcarbamylase and arginase I deficiency are responsible for diminished urea cycle function in the human hepatoblastoma cell line HepG2.

PubMed

Mavri-Damelin, Demetra; Eaton, Simon; Damelin, Leonard H; Rees, Myrddin; Hodgson, Humphrey J F; Selden, Clare

2007-01-01

A possible cell source for a bio-artificial liver is the human hepatblastoma-derived cell line HepG2 as it confers many hepatocyte functions, however, the urea cycle is not maintained resulting in the lack of ammonia detoxification via this cycle. We investigated urea cycle activity in HepG2 cells at both a molecular and biochemical level to determine the causes for the lack of urea cycle expression, and subsequently addressed reinstatement of the cycle by gene transfer. Metabolic labelling studies showed that urea production from 15N-ammonium chloride was not detectable in HepG2 conditioned medium, nor could 14C-labelled urea cycle intermediates be detected. Gene expression data from HepG2 cells revealed that although expression of three urea cycle genes Carbamoyl Phosphate Synthase I, Arginosuccinate Synthetase and Arginosuccinate Lyase was evident, Ornithine Transcarbamylase and Arginase I expression were completely absent. These results were confirmed by Western blot for arginase I, where no protein was detected. Radiolabelled enzyme assays showed that Ornithine Transcarbamylase functional activity was missing but that Carbamoyl Phosphate Synthase I, Arginosuccinate Synthetase and Arginosuccinate Lyase were functionally expressed at levels comparable to cultured primary human hepatocytes. To restore the urea cycle, HepG2 cells were transfected with full length Ornithine Transcarbamylase and Arginase I cDNA constructs under a CMV promoter. Co-transfected HepG2 cells displayed complete urea cycle activity, producing both labelled urea and urea cycle intermediates. This strategy could provide a cell source capable of urea synthesis, and hence ammonia detoxificatory function, which would be useful in a bio-artificial liver.

Muscle function during brief maximal exercise: accurate measurements on a friction-loaded cycle ergometer.

PubMed

Arsac, L M; Belli, A; Lacour, J R

1996-01-01

A friction loaded cycle ergometer was instrumented with a strain gauge and an incremental encoder to obtain accurate measurement of human mechanical work output during the acceleration phase of a cycling sprint. This device was used to characterise muscle function in a group of 15 well-trained male subjects, asked to perform six short maximal sprints on the cycle against a constant friction load. Friction loads were successively set at 0.25, 0.35, 0.45, 0.55, 0.65 and 0.75 N.kg-1 body mass. Since the sprints were performed from a standing start, and since the acceleration was not restricted, the greatest attention was paid to the measurement of the acceleration balancing load due to flywheel inertia. Instantaneous pedalling velocity (v) and power output (P) were calculated each 5 ms and then averaged over each downstroke period so that each pedal downstroke provided a combination of v, force and P. Since an 8-s acceleration phase was composed of about 21 to 34 pedal downstrokes, this many v-P combinations were obtained amounting to 137-180 v-P combinations for all six friction loads in one individual, over the widest functional range of pedalling velocities (17-214 rpm). Thus, the individual's muscle function was characterised by the v-P relationships obtained during the six acceleration phases of the six sprints. An important finding of the present study was a strong linear relationship between individual optimal velocity (vopt) and individual maximal power output (Pmax) (n = 15, r = 0.95, P < 0.001) which has never been observed before. Since vopt has been demonstrated to be related to human fibre type composition both vopt, Pmax and their inter-relationship could represent a major feature in characterising muscle function in maximal unrestricted exercise. It is suggested that the present method is well suited to such analyses.

Functional profiles of orphan membrane transporters in the life cycle of the malaria parasite

PubMed Central

Kenthirapalan, Sanketha; Waters, Andrew P.; Matuschewski, Kai; Kooij, Taco W. A.

2016-01-01

Assigning function to orphan membrane transport proteins and prioritizing candidates for detailed biochemical characterization remain fundamental challenges and are particularly important for medically relevant pathogens, such as malaria parasites. Here we present a comprehensive genetic analysis of 35 orphan transport proteins of Plasmodium berghei during its life cycle in mice and Anopheles mosquitoes. Six genes, including four candidate aminophospholipid transporters, are refractory to gene deletion, indicative of essential functions. We generate and phenotypically characterize 29 mutant strains with deletions of individual transporter genes. Whereas seven genes appear to be dispensable under the experimental conditions tested, deletion of any of the 22 other genes leads to specific defects in life cycle progression in vivo and/or host transition. Our study provides growing support for a potential link between heavy metal homeostasis and host switching and reveals potential targets for rational design of new intervention strategies against malaria. PMID:26796412

Improved Function and Reduced Pain after Swimming and Cycling Training in Patients with Osteoarthritis.

PubMed

Alkatan, Mohammed; Baker, Jeffrey R; Machin, Daniel R; Park, Wonil; Akkari, Amanda S; Pasha, Evan P; Tanaka, Hirofumi

2016-03-01

Arthritis and its associated joint pain act as significant barriers for adults attempting to perform land-based physical activity. Swimming can be an ideal form of exercise for patients with arthritis. Yet there is no information on the efficacy of regular swimming exercise involving patients with arthritis. The effect of a swimming exercise intervention on joint pain, stiffness, and physical function was evaluated in patients with osteoarthritis (OA). Using a randomized study design, 48 sedentary middle-aged and older adults with OA underwent 3 months of either swimming or cycling exercise training. Supervised exercise training was performed for 45 min/day, 3 days/week at 60-70% heart rate reserve for 12 weeks. The Western Ontario and McMaster Universities Arthritis Index was used to measure joint pain, stiffness, and physical limitation. After the exercise interventions, there were significant reductions in joint pain, stiffness, and physical limitation accompanied by increases in quality of life in both groups (all p < 0.05). Functional capacity as assessed by maximal handgrip strength, isokinetic knee extension and flexion power (15-30% increases), and the distance covered in the 6-min walk test increased (all p < 0.05) in both exercise groups. No differences were observed in the magnitude of improvements between swimming and cycling training. Regular swimming exercise reduced joint pain and stiffness associated with OA and improved muscle strength and functional capacity in middle-aged and older adults with OA. Additionally, the benefits of swimming exercise were similar to the more frequently prescribed land-based cycling training. clinicaltrials.gov NCT01836380.

Diversity of Total Bacterial Communities and Chemoautotrophic Populations in Sulfur-Rich Sediments of Shallow-Water Hydrothermal Vents off Kueishan Island, Taiwan.

PubMed

Wang, Li; Cheung, Man Kit; Liu, Rulong; Wong, Chong Kim; Kwan, Hoi Shan; Hwang, Jiang-Shiou

2017-04-01

Shallow-water hydrothermal vents (HTVs) are an ecologically important habitat with a geographic origin similar to that of deep-sea HTVs. Studies on shallow-water HTVs have not only facilitated understanding of the influences of vents on local ecosystems but also helped to extend the knowledge on deep-sea vents. In this study, the diversity of bacterial communities in the sediments of shallow-water HTVs off Kueishan Island, Taiwan, was investigated by examining the 16S ribosomal RNA gene as well as key functional genes involved in chemoautotrophic carbon fixation (aclB, cbbL and cbbM). In the vent area, Sulfurovum and Sulfurimonas of Epsilonproteobacteria appeared to dominate the benthic bacterial community. Results of aclB gene analysis also suggested involvement of these bacteria in carbon fixation using the reductive tricarboxylic acid (rTCA) cycle. Analysis of the cbbM gene showed that Alphaproteobacterial members such as the purple non-sulfur bacteria were the major chemoautotrophic bacteria involving in carbon fixation via the Calvin-Benson-Bassham (CBB) cycle. However, they only accounted for <2% of the total bacterial community in the vent area. These findings suggest that the rTCA cycle is the major chemoautotrophic carbon fixation pathway in sediments of the shallow-water HTVs off Kueishan Island.

Aircraft Emission Scenarios Projected in Year 2015 for the NASA Technology Concept Aircraft (TCA) High Speed Civil Transport

NASA Technical Reports Server (NTRS)

Baughcum, Steven L.; Henderson, Stephen C.

1998-01-01

This report describes the development of a three-dimensional database of aircraft fuel burn and emissions (fuel burned, NOx, CO, and hydrocarbons) from projected fleets of high speed civil transports (HSCTs) on a universal airline network. Inventories for 500 and 1000 HSCT fleets, as well as the concurrent subsonic fleets, were calculated. The HSCT scenarios are calculated using the NASA technology concept airplane (TCA) and update an earlier report. These emissions inventories are available for use by atmospheric scientists conducting the Atmospheric Effects of Stratospheric Aircraft (AESA) modeling studies. Fuel burned and emissions of nitrogen oxides (NOx as NO2), carbon monoxide, and hydrocarbons have been calculated on a 1 degree latitude x 1 degree longitude x 1 kilometer pressure altitude grid and delivered to NASA as electronic files.

Hyperammonaemia‐induced skeletal muscle mitochondrial dysfunction results in cataplerosis and oxidative stress

PubMed Central

Davuluri, Gangarao; Allawy, Allawy; Thapaliya, Samjhana; Rennison, Julie H.; Singh, Dharmvir; Kumar, Avinash; Sandlers, Yana; Van Wagoner, David R.; Flask, Chris A.; Hoppel, Charles; Kasumov, Takhar

2016-01-01

Key points Hyperammonaemia occurs in hepatic, cardiac and pulmonary diseases with increased muscle concentration of ammonia.We found that ammonia results in reduced skeletal muscle mitochondrial respiration, electron transport chain complex I dysfunction, as well as lower NAD+/NADH ratio and ATP content.During hyperammonaemia, leak of electrons from complex III results in oxidative modification of proteins and lipids.Tricarboxylic acid cycle intermediates are decreased during hyperammonaemia, and providing a cell‐permeable ester of αKG reversed the lower TCA cycle intermediate concentrations and increased ATP content.Our observations have high clinical relevance given the potential for novel approaches to reverse skeletal muscle ammonia toxicity by targeting the TCA cycle intermediates and mitochondrial ROS. Abstract Ammonia is a cytotoxic metabolite that is removed primarily by hepatic ureagenesis in humans. Hyperammonaemia occurs in advanced hepatic, cardiac and pulmonary disease, and in urea cycle enzyme deficiencies. Increased skeletal muscle ammonia uptake and metabolism are the major mechanism of non‐hepatic ammonia disposal. Non‐hepatic ammonia disposal occurs in the mitochondria via glutamate synthesis from α‐ketoglutarate resulting in cataplerosis. We show skeletal muscle mitochondrial dysfunction during hyperammonaemia in a comprehensive array of human, rodent and cellular models. ATP synthesis, oxygen consumption, generation of reactive oxygen species with oxidative stress, and tricarboxylic acid (TCA) cycle intermediates were quantified. ATP content was lower in the skeletal muscle from cirrhotic patients, hyperammonaemic portacaval anastomosis rat, and C2C12 myotubes compared to appropriate controls. Hyperammonaemia in C2C12 myotubes resulted in impaired intact cell respiration, reduced complex I/NADH oxidase activity and electron leak occurring at complex III of the electron transport chain. Consistently, lower NAD+/NADH ratio was observed

Periodicities in solar wind-magnetosphere coupling functions and geomagnetic activity during the past solar cycles

NASA Astrophysics Data System (ADS)

Andriyas, T.; Andriyas, S.

2017-09-01

In this paper, we study the solar-terrestrial relation through the wavelet analysis. We report periodicities common between multiple solar wind coupling functions and geomagnetic indices during five solar cycles and also and the strength of this correspondence. The Dst (found to be most predictable in Newell et al., J. Geophys. Res. Space Phys. 112(A1):A01206, 2007) and AL (least predictable in Newell et al., J. Geophys. Res. Space Phys. 112(A1):A01206, 2007) indices are used for this purpose. During the years 1966-2016 (which includes five solar cycles 20, 21, 22, 23, and 24), prominent periodicities ≤720 days with power above 95% confidence level were found to occur around 27, 182, 385, and 648 days in the Dst index while those in the AL index were found in bands around 27, 187, and 472 days. Ten solar wind coupling functions were then used to find periodicities common with the indices. All the coupling functions had significant power in bands centered around 27, 280, and 648 days while powers in fluctuations around 182, 385, and 472 days were only found in some coupling functions. All the drivers and their variants had power above the significant level in the 280-288 days band, which was absent in the Dst and AL indices. The normalized scale averaged spectral power around the common periods in the coupling functions and the indices indicated that the coupling functions most correlated with the Dst index were the Newell (27 and 385 days), Wygant (182 days), and Scurry-Russell and Boynton (648 days) functions. An absence of common power between the coupling functions and the Dst index around the annual periodicity was noted during the even solar cycles. A similar analysis for the AL index indicated that Newell (27 days), Rectified (187 days), and Boynton (472 days) were the most correlated functions. It was also found that the correlation numbers were relatively weaker for the AL index, specially for the 187 day periodicity. It is concluded that as the two

Direct isolation of a functional violaxanthin cycle domain from thylakoid membranes of higher plants.

PubMed

Goss, Reimund; Greifenhagen, Anne; Bergner, Juliane; Volke, Daniela; Hoffmann, Ralf; Wilhelm, Christian; Schaller-Laudel, Susann

2017-04-01

A special domain of the thylakoid membrane of higher plants has been isolated which carries out the de-epoxidation of the xanthophyll cycle pigment violaxanthin to zeaxanthin. Recent models indicate that in the chloroplast of higher plants, the violaxanthin (V) cycle takes place within specialized domains in the thylakoid membrane. Here, we describe a new procedure to directly isolate such a domain in functional state. The procedure consists of a thylakoid membrane isolation at a pH value of 5.2 which realizes the binding of the enzyme V de-epoxidase (VDE) to the membrane throughout the preparation process. Isolated thylakoid membranes are then solubilized with the very mild detergent n-dodecyl α-D-maltoside and the pigment-protein complexes are separated by sucrose gradient ultracentrifugation. The upper main fraction of the sucrose gradient represents a V cycle domain which consists of the major light-harvesting complex of photosystem II (LHCII), a special lipid composition with an enrichment of the galactolipid monogalactosyldiacylglycerol (MGDG) and the VDE. The domain is isolated in functional state as evidenced by the ability to convert the LHCII-associated V to zeaxanthin. The direct isolation of a V cycle domain proves the most important hypotheses concerning the de-epoxidation reaction in intact thylakoid membranes. It shows that the VDE binds to the thylakoid membrane at low pH values of the thylakoid lumen, that it binds to membrane regions enriched in LHCII, and that the domain contains high amounts of MGDG. The last point is in line with the importance of the galactolipid for V solubilisation and, by providing inverted hexagonal lipid structures, for VDE activity.

The Effects of Assisted Cycling Therapy (Act) and Voluntary Cycling on Reaction Time and Measures of Executive Function in Adolescents with Down Syndrome

ERIC Educational Resources Information Center

Ringenbach, S. D. R.; Holzapfel, S. D.; Mulvey, G. M.; Jimenez, A.; Benson, A.; Richter, M.

2016-01-01

Background: Reports of positive effects of aerobic exercise on cognitive function in persons with Down syndrome are extremely limited. However, a novel exercise intervention, termed assisted cycling therapy (ACT), has resulted in acutely improved cognitive planning ability and reaction times as well as improved cognitive planning after 8 weeks of…

Po2 cycling protects diaphragm function during reoxygenation via ROS, Akt, ERK, and mitochondrial channels.

PubMed

Zuo, Li; Pannell, Benjamin K; Re, Anthony T; Best, Thomas M; Wagner, Peter D

2015-12-01

Po2 cycling, often referred to as intermittent hypoxia, involves exposing tissues to brief cycles of low oxygen environments immediately followed by hyperoxic conditions. After experiencing long-term hypoxia, muscle can be damaged during the subsequent reintroduction of oxygen, which leads to muscle dysfunction via reperfusion injury. The protective effect and mechanism behind Po2 cycling in skeletal muscle during reoxygenation have yet to be fully elucidated. We hypothesize that Po2 cycling effectively increases muscle fatigue resistance through reactive oxygen species (ROS), protein kinase B (Akt), extracellular signal-regulated kinase (ERK), and certain mitochondrial channels during reoxygenation. Using a dihydrofluorescein fluorescent probe, we detected the production of ROS in mouse diaphragmatic skeletal muscle in real time under confocal microscopy. Muscles treated with Po2 cycling displayed significantly attenuated ROS levels (n = 5; P < 0.001) as well as enhanced force generation compared with controls during reperfusion (n = 7; P < 0.05). We also used inhibitors for signaling molecules or membrane channels such as ROS, Akt, ERK, as well as chemical stimulators to close mitochondrial ATP-sensitive potassium channel (KATP) or open mitochondrial permeability transition pore (mPTP). All these blockers or stimulators abolished improved muscle function with Po2 cycling treatment. This current investigation has discovered a correlation between KATP and mPTP and the Po2 cycling pathway in diaphragmatic skeletal muscle. Thus we have identified a unique signaling pathway that may involve ROS, Akt, ERK, and mitochondrial channels responsible for Po2 cycling protection during reoxygenation conditions in the diaphragm. Copyright © 2015 the American Physiological Society.

Nitrogen Cycle Evaluation (NiCE) Chip for the Simultaneous Analysis of Multiple N-Cycle Associated Genes.

PubMed

Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi

2018-02-02

Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene

Global Regulatory Mutations in csrA and rpoS Cause Severe Central Carbon Stress in Escherichia coli in the Presence of Acetate

PubMed Central

Wei, Bangdong; Shin, Sooan; LaPorte, David; Wolfe, Alan J.; Romeo, Tony

2000-01-01

The csrA gene encodes a small RNA-binding protein, which acts as a global regulator in Escherichia coli and other bacteria (T. Romeo, Mol. Microbiol. 29:1321–1330, 1998). Its key regulatory role in central carbon metabolism, both as an activator of glycolysis and as a potent repressor of glycogen biosynthesis and gluconeogenesis, prompted us to examine the involvement of csrA in acetate metabolism and the tricarboxylic acid (TCA) cycle. We found that growth of csrA rpoS mutant strains was very poor on acetate as a sole carbon source. Surprisingly, growth also was inhibited specifically by the addition of modest amounts of acetate to rich media (e.g., tryptone broth). Cultures grown in the presence of ≥25 mM acetate consisted substantially of glycogen biosynthesis (glg) mutants, which were no longer inhibited by acetate. Several classes of glg mutations were mapped to known and novel loci. Several hypotheses were examined to provide further insight into the effects of acetate on growth and metabolism in these strains. We determined that csrA positively regulates acs (acetyl-coenzyme A synthetase; Acs) expression and isocitrate lyase activity without affecting key TCA cycle enzymes or phosphotransacetylase. TCA cycle intermediates or pyruvate, but not glucose, galactose, or glycerol, restored growth and prevented the glg mutations in the presence of acetate. Furthermore, amino acid uptake was inhibited by acetate specifically in the csrA rpoS strain. We conclude that central carbon flux imbalance, inhibition of amino acid uptake, and a deficiency in acetate metabolism apparently are combined to cause metabolic stress by depleting the TCA cycle. PMID:10692369

Sometimes "Newton's Method" Always "Cycles"

ERIC Educational Resources Information Center

Latulippe, Joe; Switkes, Jennifer

2012-01-01

Are there functions for which Newton's method cycles for all non-trivial initial guesses? We construct and solve a differential equation whose solution is a real-valued function that two-cycles under Newton iteration. Higher-order cycles of Newton's method iterates are explored in the complex plane using complex powers of "x." We find a class of…

Loss of Mitochondrial Pyruvate Carrier 2 in Liver Leads to Defects in Gluconeogenesis and Compensation via Pyruvate-Alanine Cycling

PubMed Central

McCommis, Kyle S.; Chen, Zhouji; Fu, Xiaorong; McDonald, William G.; Colca, Jerry R.; Kletzien, Rolf F.; Burgess, Shawn C.; Finck, Brian N.

2015-01-01

SUMMARY Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite step for gluconeogenesis in hepatocytes, which is important for maintenance of normoglycemia during prolonged food deprivation, but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2−/−) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte pyruvate metabolism, labelled pyruvate conversion to TCA cycle intermediates and glucose, and glucose production from pyruvate. Unbiased metabolomic analyses of livers from fasted LS-Mpc2−/− mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2−/− hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. PMID:26344101

Detoxification of ammonia in mouse cortical GABAergic cell cultures increases neuronal oxidative metabolism and reveals an emerging role for release of glucose-derived alanine.

PubMed

Leke, Renata; Bak, Lasse K; Anker, Malene; Melø, Torun M; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Ott, Peter; Portela, Luis V; Sonnewald, Ursula; Schousboe, Arne; Waagepetersen, Helle S

2011-04-01

Cerebral hyperammonemia is believed to play a pivotal role in the development of hepatic encephalopathy (HE), a debilitating condition arising due to acute or chronic liver disease. In the brain, ammonia is thought to be detoxified via the activity of glutamine synthetase, an astrocytic enzyme. Moreover, it has been suggested that cerebral tricarboxylic acid (TCA) cycle metabolism is inhibited and glycolysis enhanced during hyperammonemia. The aim of this study was to characterize the ammonia-detoxifying mechanisms as well as the effects of ammonia on energy-generating metabolic pathways in a mouse neuronal-astrocytic co-culture model of the GABAergic system. We found that 5 mM ammonium chloride affected energy metabolism by increasing the neuronal TCA cycle activity and switching the astrocytic TCA cycle toward synthesis of substrate for glutamine synthesis. Furthermore, ammonia exposure enhanced the synthesis and release of alanine. Collectively, our results demonstrate that (1) formation of glutamine is seminal for detoxification of ammonia; (2) neuronal oxidative metabolism is increased in the presence of ammonia; and (3) synthesis and release of alanine is likely to be important for ammonia detoxification as a supplement to formation of glutamine.

Proteomics and genetic analyses reveal the effects of arsenite oxidation on metabolic pathways and the roles of AioR in Agrobacterium tumefaciens GW4.

PubMed

Shi, Kaixiang; Wang, Qian; Fan, Xia; Wang, Gejiao

2018-04-01

A heterotrophic arsenite [As(III)]-oxidizing bacterium Agrobacterium tumefaciens GW4 isolated from As(III)-rich groundwater sediment showed high As(III) resistance and could oxidize As(III) to As(V). The As(III) oxidation could generate energy and enhance growth, and AioR was the regulator for As(III) oxidase. To determine the related metabolic pathways mediated by As(III) oxidation and whether AioR regulated other cellular responses to As(III), isobaric tags for relative and absolute quantitation (iTRAQ) was performed in four treatments, GW4 (+AsIII)/GW4 (-AsIII), GW4-ΔaioR (+AsIII)/GW4-ΔaioR (-AsIII), GW4-ΔaioR (-AsIII)/GW4 (-AsIII) and GW4-ΔaioR (+AsIII)/GW4 (+AsIII). A total of 41, 71, 82 and 168 differentially expressed proteins were identified, respectively. Using electrophoretic mobility shift assay (EMSA) and qRT-PCR, 12 genes/operons were found to interact with AioR. These results indicate that As(III) oxidation alters several cellular processes related to arsenite, such as As resistance (ars operon), phosphate (Pi) metabolism (pst/pho system), TCA cycle, cell wall/membrane, amino acid metabolism and motility/chemotaxis. In the wild type with As(III), TCA cycle flow is perturbed, and As(III) oxidation and fermentation are the main energy resources. However, when strain GW4-ΔaioR lost the ability of As(III) oxidation, the TCA cycle is the main way to generate energy. A regulatory cellular network controlled by AioR is constructed and shows that AioR is the main regulator for As(III) oxidation, besides, several other functions related to As(III) are regulated by AioR in parallel. Copyright © 2018 Elsevier Ltd. All rights reserved.

Systemic Activin signaling independently regulates sugar homeostasis, cellular metabolism, and pH balance in Drosophila melanogaster

PubMed Central

Ghosh, Arpan C.; O’Connor, Michael B.

2014-01-01

The ability to maintain cellular and physiological metabolic homeostasis is key for the survival of multicellular organisms in changing environmental conditions. However, our understanding of extracellular signaling pathways that modulate metabolic processes remains limited. In this study we show that the Activin-like ligand Dawdle (Daw) is a major regulator of systemic metabolic homeostasis and cellular metabolism in Drosophila. We find that loss of canonical Smad signaling downstream of Daw leads to defects in sugar and systemic pH homeostasis. Although Daw regulates sugar homeostasis by positively influencing insulin release, we find that the effect of Daw on pH balance is independent of its role in insulin signaling and is caused by accumulation of organic acids that are primarily tricarboxylic acid (TCA) cycle intermediates. RNA sequencing reveals that a number of TCA cycle enzymes and nuclear-encoded mitochondrial genes including genes involved in oxidative phosphorylation and β-oxidation are up-regulated in the daw mutants, indicating either a direct or indirect role of Daw in regulating these genes. These findings establish Activin signaling as a major metabolic regulator and uncover a functional link between TGF-β signaling, insulin signaling, and metabolism in Drosophila. PMID:24706779

An Estimate of the Size and Shape of Sunspot Cycle 24 Based on its Early Cycle Behavior using the Hathaway-Wilson-Reichmann Shape-Fitting Function

NASA Technical Reports Server (NTRS)

Wilson, Robert M.

2011-01-01

On the basis of 12-month moving averages (12-mma) of monthly mean sunspot number (R), sunspot cycle 24 had its minimum amplitude (Rm = 1.7) in December 2008. At 12 mo past minimum, R measured 8.3, and at 18 mo past minimum, it measured 16.4. Thus far, the maximum month-to-month rate of rise in 12-mma values of monthly mean sunspot number (AR(t) max) has been 1.7, having occurred at elapsed times past minimum amplitude (t) of 14 and 15 mo. Compared to other sunspot cycles of the modern era, cycle 24?s Rm and AR(t) max (as observed so far) are the smallest on record, suggesting that it likely will be a slow-rising, long-period sunspot cycle of below average maximum amplitude (RM). Supporting this view is the now observed relative strength of cycle 24?s geomagnetic minimum amplitude as measured using the 12-mma value of the aa-geomagnetic index (aam = 8.4), which also is the smallest on record, having occurred at t equals 8 and 9 mo. From the method of Ohl (the inferred preferential association between RM and aam), one predicts RM = 55 +/- 17 (the ?1 se prediction interval) for cycle 24. Furthermore, from the Waldmeier effect (the inferred preferential association between the ascent duration (ASC) and RM) one predicts an ASC longer than 48 mo for cycle 24; hence, maximum amplitude occurrence should be after December 2012. Application of the Hathaway-Wilson-Reichmann shape-fitting function, using an RM = 70 and ASC = 56 mo, is found to adequately fit the early sunspot number growth of cycle 24.

Impact of SCBA size and firefighting work cycle on firefighter functional balance.

PubMed

Kesler, Richard M; Deetjen, Grace S; Bradley, Faith F; Angelini, Michael J; Petrucci, Matthew N; Rosengren, Karl S; Horn, Gavin P; Hsiao-Wecksler, Elizabeth T

2018-05-01

Slips, trips and falls are leading causes of fireground injuries. A functional balance test (FBT) was used to investigate the effects of self-contained breathing apparatus (SCBA) size and design, plus firefighting work cycle. During the FBT, subjects walked along a narrow platform and turned in defined spaces, with and without an overhead obstacle. Thirty firefighters wore three varying-sized standard SCBAs and a low-profile prototype SCBA during three simulated firefighting work/rest cycles. Firefighters were tested pre- and post-firefighting activity (one bout, two bouts with a 5-min break, or back-to-back bouts with no break). Subjects committed more errors and required longer completion times with larger SCBAs. Use of the prototype SCBA lead to lower times and fewer errors. Performing a second bout of firefighting increased completion time. Firefighters need to consider how SCBA and amount of physical activity on the fireground may influence balance in order to reduce the risk of injury. Copyright © 2018 Elsevier Ltd. All rights reserved.

Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis

PubMed Central

Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F.; Lane, Andrew N.; Romick-Rosendale, Lindsey E.; Wells, Susanne I.

2017-01-01

The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth. PMID:28558019

Systems responses of rats to aflatoxin B1 exposure revealed with metabonomic changes in multiple biological matrices.

PubMed

Zhang, Limin; Ye, Yangfang; An, Yanpeng; Tian, Yuan; Wang, Yulan; Tang, Huiru

2011-02-04

Exposure to aflatoxins causes liver fibrosis and hepatocellular carcinoma posing a significant health risk for human populations and livestock. To understand the mammalian systems responses to aflatoxin-B1 (AFB1) exposure, we analyzed the AFB1-induced metabonomic changes in multiple biological matrices (plasma, urine, and liver) of rats using (1)H NMR spectroscopy together with clinical biochemistry and histopathologic assessments. We found that AFB1 exposure caused significant elevation of glucose, amino acids, and choline metabolites (choline, phosphocholine, and glycerophosphocholine) in plasma but reduction of plasma lipids. AFB1 also induced elevation of liver lipids, amino acids (tyrosine, histidine, phenylalanine, leucine, isoleucine, and valine), choline, and nucleic acid metabolites (inosine, adenosine, and uridine) together with reduction of hepatic glycogen and glucose. AFB1 further caused decreases in urinary TCA cycle intermediates (2-oxoglutarate and citrate) and elevation of gut microbiota cometabolites (phenylacetylglycine and hippurate). These indicated that AFB1 exposure caused hepatic steatosis accompanied with widespread metabolic changes including lipid and cell membrane metabolisms, protein biosynthesis, glycolysis, TCA cycle, and gut microbiota functions. This implied that AFB1 exposure probably caused oxidative-stress-mediated impairments of mitochondria functions. These findings provide an overview of biochemical consequences of AFB1 exposure and comprehensive insights into the metabolic aspects of AFB1-induced hepatotoxicity in rats.

Dysfunctional BMPR2 signaling drives an abnormal endothelial requirement for glutamine in pulmonary arterial hypertension.

PubMed

Egnatchik, Robert A; Brittain, Evan L; Shah, Amy T; Fares, Wassim H; Ford, H James; Monahan, Ken; Kang, Christie J; Kocurek, Emily G; Zhu, Shijun; Luong, Thong; Nguyen, Thuy T; Hysinger, Erik; Austin, Eric D; Skala, Melissa C; Young, Jamey D; Roberts, L Jackson; Hemnes, Anna R; West, James; Fessel, Joshua P

2017-03-01

Pulmonary arterial hypertension (PAH) is increasingly recognized as a systemic disease driven by alteration in the normal functioning of multiple metabolic pathways affecting all of the major carbon substrates, including amino acids. We found that human pulmonary hypertension patients (WHO Group I, PAH) exhibit systemic and pulmonary-specific alterations in glutamine metabolism, with the diseased pulmonary vasculature taking up significantly more glutamine than that of controls. Using cell culture models and transgenic mice expressing PAH-causing BMPR2 mutations, we found that the pulmonary endothelium in PAH shunts significantly more glutamine carbon into the tricarboxylic acid (TCA) cycle than wild-type endothelium. Increased glutamine metabolism through the TCA cycle is required by the endothelium in PAH to survive, to sustain normal energetics, and to manifest the hyperproliferative phenotype characteristic of disease. The strict requirement for glutamine is driven by loss of sirtuin-3 (SIRT3) activity through covalent modification by reactive products of lipid peroxidation. Using 2-hydroxybenzylamine, a scavenger of reactive lipid peroxidation products, we were able to preserve SIRT3 function, to normalize glutamine metabolism, and to prevent the development of PAH in BMPR2 mutant mice. In PAH, targeting glutamine metabolism and the mechanisms that underlie glutamine-driven metabolic reprogramming represent a viable novel avenue for the development of potentially disease-modifying therapeutics that could be rapidly translated to human studies.

Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis.

PubMed

Matrka, Marie C; Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F; Lane, Andrew N; Romick-Rosendale, Lindsey E; Wells, Susanne I

2017-01-01

The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth.

The influence of alternative pathways of respiration that utilize branched-chain amino acids following water shortage in Arabidopsis.

PubMed

Pires, Marcel V; Pereira Júnior, Adilson A; Medeiros, David B; Daloso, Danilo M; Pham, Phuong Anh; Barros, Kallyne A; Engqvist, Martin K M; Florian, Alexandra; Krahnert, Ina; Maurino, Veronica G; Araújo, Wagner L; Fernie, Alisdair R

2016-06-01

During dark-induced senescence isovaleryl-CoA dehydrogenase (IVDH) and D-2-hydroxyglutarate dehydrogenase (D-2HGDH) act as alternate electron donors to the ubiquinol pool via the electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO) pathway. However, the role of this pathway in response to other stresses still remains unclear. Here, we demonstrated that this alternative pathway is associated with tolerance to drought in Arabidopsis. In comparison with wild type (WT) and lines overexpressing D-2GHDH, loss-of-function etfqo-1, d2hgdh-2 and ivdh-1 mutants displayed compromised respiration rates and were more sensitive to drought. Our results demonstrated that an operational ETF/ETFQO pathway is associated with plants' ability to withstand drought and to recover growth once water becomes replete. Drought-induced metabolic reprogramming resulted in an increase in tricarboxylic acid (TCA) cycle intermediates and total amino acid levels, as well as decreases in protein, starch and nitrate contents. The enhanced levels of the branched-chain amino acids in loss-of-function mutants appear to be related to their increased utilization as substrates for the TCA cycle under water stress. Our results thus show that mitochondrial metabolism is highly active during drought stress responses and provide support for a role of alternative respiratory pathways within this response. © 2015 John Wiley & Sons Ltd.

Effective Trapping of Lithium Polysulfides Using a Functionalized Carbon Nanotube-Coated Separator for Lithium-Sulfur Cells with Enhanced Cycling Stability.

PubMed

Ponraj, Rubha; Kannan, Aravindaraj G; Ahn, Jun Hwan; Lee, Jae Hee; Kang, Joonhee; Han, Byungchan; Kim, Dong-Won

2017-11-08

The critical issues that hinder the practical applications of lithium-sulfur batteries, such as dissolution and migration of lithium polysulfides, poor electronic conductivity of sulfur and its discharge products, and low loading of sulfur, have been addressed by designing a functional separator modified using hydroxyl-functionalized carbon nanotubes (CNTOH). Density functional theory calculations and experimental results demonstrate that the hydroxyl groups in the CNTOH provoked strong interaction with lithium polysulfides and resulted in effective trapping of lithium polysulfides within the sulfur cathode side. The reduction in migration of lithium polysulfides to the lithium anode resulted in enhanced stability of the lithium electrode. The conductive nature of CNTOH also aided to efficiently reutilize the adsorbed reaction intermediates for subsequent cycling. As a result, the lithium-sulfur cell assembled with a functional separator exhibited a high initial discharge capacity of 1056 mAh g -1 (corresponding to an areal capacity of 3.2 mAh cm -2 ) with a capacity fading rate of 0.11% per cycle over 400 cycles at 0.5 C rate.

Energy-containing beverages: reproductive hormones and ovarian function in the BioCycle Study.

PubMed

Schliep, Karen C; Schisterman, Enrique F; Mumford, Sunni L; Pollack, Anna Z; Perkins, Neil J; Ye, Aijun; Zhang, Cuilin J; Stanford, Joseph B; Porucznik, Christina A; Hammoud, Ahmad O; Wactawski-Wende, Jean

2013-03-01

Energy-containing beverages are widely consumed among premenopausal women, but their association with reproductive hormones is not well understood. The objective was to assess the association of energy-containing beverages, added sugars, and total fructose intake with reproductive hormones among ovulatory cycles and sporadic anovulation in healthy premenopausal women. Women (n = 259) in the BioCycle Study were followed for up to 2 menstrual cycles; they provided fasting blood specimens during up to 8 visits/cycle and four 24-h dietary recalls/cycle. Women who consumed ≥1 cup (1 cup = 237 mL) sweetened soda/d had 16.3% higher estradiol concentrations compared with women who consumed less sweetened soda (86.5 pg/mL compared with 74.4 pg/mL, P = 0.01) after adjustment for age, BMI, race, dietary factors, and physical activity. Similarly elevated estradiol concentrations were found for ≥1 cup cola/d and noncola soda intake. Neither artificially sweetened soda nor fruit juice intake ≥1 cup/d was significantly associated with reproductive hormones. Added sugar above the average US woman's intake (≥73.2 g/d) or above the 66th percentile in total fructose intake (≥41.5 g/d) was associated with significantly elevated estradiol but not consistently across all models. No associations were found between beverages, added sugars, or total fructose intake and anovulation after multivariate adjustment. Even at moderate consumption amounts, sweetened soda is associated with elevated follicular estradiol concentrations among premenopausal women but does not appear to affect ovulatory function. Further research into the mechanism driving the association between energy-containing beverages and reproductive hormones, and its potential implications for women's health, is warranted.

Alterations in Krebs cycle enzyme activities and carbohydrate catabolism in two strains of Trypanosoma brucei during in vitro differentiation of their bloodstream to procyclic stages.

PubMed

Durieux, P O; Schütz, P; Brun, R; Köhler, P

1991-03-01

A rapid switch from a fermentative to a primarily oxidative type of glucose utilization was observed during in vitro differentiation of Trypanosoma brucei STIB348 and EATRO1244 bloodstream to procyclic trypomastigotes. In accordance with previously published reports bloodstream populations produced pyruvate as the major end product of glucose catabolism, together with very small amounts of CO2, succinate and glycerol. During differentiation pyruvate excretion decreased within 48 h to the low levels produced by 28-day procyclic stages. Concomitant with the decline in pyruvate formation, acetate appeared as a new product and the rates of respiratory CO2 increased considerably. The amount of carbon released with these compounds could account for nearly all of the glucose carbon consumed. Rates of glucose utilization and formation of acetate and CO2 in cells differentiated for 48 h were essentially the same as those found in 28-day procyclics. Succinate and glycerol excretion remained low during the entire transformation process, and no significant difference in the pattern and quantities of end products were found between the two trypanosome strains. During trypanosome differentiation the changes in metabolism were associated with marked alterations in enzyme activity levels. Activities of the tricarboxylic acid (TCA) cycle enzymes citrate synthase, isocitrate dehydrogenase (NAD+), succinate dehydrogenase and fumarase were not detectable in bloodstream trypomastigotes but appeared upon differentiation for 24 h. An exception was citrate synthase whose activity was not demonstrable until 48 h postinoculation into culture. After 48 h the majority of the TCA cycle enzyme activities continued to increase steadily until day 28. Pyruvate kinase activity decreased in differentiating cells after 48 h to about 25% of the level found in bloodstream trypomastigotes.(ABSTRACT TRUNCATED AT 250 WORDS)

Mesenchymal stem cells inhibit dendritic cell differentiation and function by preventing entry into the cell cycle.

PubMed

Ramasamy, Rajesh; Fazekasova, Henrietta; Lam, Eric W-F; Soeiro, Inês; Lombardi, Giovanna; Dazzi, Francesco

2007-01-15

Mesenchymal stem cells (MSCs) play a crucial role in hematopoietic development and have been shown to exert a powerful immunosuppressive effect. In this study, we investigated the effect of bone marrow MSC on the differentiation and function of peripheral blood monocytes into dendritic cells (DCs). Human MSCs, generated from normal bone marrow, were added to peripheral blood monocytes stimulated in vitro with granulocyte-macrophage colony stimulating factor and interleukin-4 to become DCs. Monocytes were then examined for the expression of markers characteristic of DCs and their ability to stimulate allogeneic T cells. In addition, the effect of MSCs on the cell cycle of monocyte-derived DCs and the expression of various cell cycle proteins were analyzed by cytometric analysis and Western blotting with specific antibodies. MSCs blocked the differentiation of monocytes into DCs and impaired their antigen-presenting ability. This resulted from a block of monocytes from entering the G1 phase of the cell cycle with a progressive number of cells accumulating in the G0 phase. Cyclin D2 was downregulated. However, differently from what was observed in T-cells stimulated in the presence of MSCs, the expression of p27 was found decreased, suggesting the involvement of similar but not identical pathways. We conclude that MSCs impair monocyte differentiation and function by interfering with the cell cycle. These findings imply that MSC-induced immunosuppression might be a side product of a more general antiproliferative effect.

A comprehensive analysis of myocardial substrate preference emphasizes the need for a synchronized fluxomic/metabolomic research design.

PubMed

Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E

2017-06-01

The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.

Alternative electron flows (water-water cycle and cyclic electron flow around PSI) in photosynthesis: molecular mechanisms and physiological functions.

PubMed

Miyake, Chikahiro

2010-12-01

An electron flow in addition to the major electron sinks in C(3) plants [both photosynthetic carbon reduction (PCR) and photorespiratory carbon oxidation (PCO) cycles] is termed an alternative electron flow (AEF) and functions in the chloroplasts of leaves. The water-water cycle (WWC; Mehler-ascorbate peroxidase pathway) and cyclic electron flow around PSI (CEF-PSI) have been studied as the main AEFs in chloroplasts and are proposed to play a physiologically important role in both the regulation of photosynthesis and the alleviation of photoinhibition. In the present review, I discuss the molecular mechanisms of both AEFs and their functions in vivo. To determine their physiological function, accurate measurement of the electron flux of AEFs in vivo are required. Methods to assay electron flux in CEF-PSI have been developed recently and their problematic points are discussed. The common physiological function of both the WWC and CEF-PSI is the supply of ATP to drive net CO(2) assimilation. The requirement for ATP depends on the activities of both PCR and PCO cycles, and changes in both WWC and CEF-PSI were compared with the data obtained in intact leaves. Furthermore, the fact that CEF-PSI cannot function independently has been demonstrated. I propose a model for the regulation of CEF-PSI by WWC, in which WWC is indispensable as an electron sink for the expression of CEF-PSI activity.

Tonic-Clonic Activity at Subarachnoid Hemorrhage Onset: Impact on Complications and Outcome

PubMed Central

De Marchis, Gian Marco; Pugin, Deborah; Lantigua, Hector; Zammit, Christopher; Tadi, Prasanna; Schmidt, J. Michael; Falo, M. Cristina; Agarwal, Sachin; Mayer, Stephan A.; Claassen, Jan

2013-01-01

Objective Tonic-clonic activity (TCA) at onset complicates 3% to 21% of cases of subarachnoid hemorrhage (SAH). The impact of onset TCA on in-hospital complications, including seizures, remains unclear. One study associated onset TCA with poor clinical outcome at 6 weeks after SAH, but to our knowledge no other studies have confirmed this relationship. This study aims to assess the impact of onset TCA on in-hospital complications, poor functional outcome, mortality, and epilepsy at 3 months. Methods Analysis of a prospective study cohort of 1479 SAH patients admitted to Columbia University Medical Center between 1996 and 2012. TCA within 6 hours of hemorrhage onset was identified based on accounts of emergency care providers or family witnesses. Results TCA at onset was described in 170 patients (11%). Patients with onset TCA were younger (P = 0.002), presented more often with poor clinical grade (55% vs. 26%, P<0.001) and had larger amounts of cisternal, intraventricular, and intracerebral blood than those without onset TCA (all, P<0.001). After adjusting for known confounders, onset TCA was significantly associated with in-hospital seizures (OR 3.80, 95%-CI: 2.43–5.96, P<0.001), in-hospital pneumonia (OR 1.56, 95%-CI: 1.06–2.31, p = 0.02), and delayed cerebral ischemia (OR 1.77, 95%-CI: 1.21–2.58, P = 0.003). At 3 months, however, onset TCA was not associated with poor functional outcome, mortality, and epilepsy after adjusting for age, admission clinical grade, and cisternal blood volume. Conclusions Onset TCA is not a rare event as it complicates 11% of cases of SAH. New and clinically relevant findings are the association of onset TCA with in-hospital seizures, pneumonia and delayed cerebral ischemia. Despite the increased risk of in-hospital complications, onset TCA is not associated with disability, mortality, and epilepsy at 3 months. PMID:23951155

Environmental and human health assessment of life cycle of nanoTiO2 functionalized porcelain stoneware tile.

PubMed

Pini, Martina; Bondioli, Federica; Montecchi, Rita; Neri, Paolo; Ferrari, Anna Maria

2017-01-15

Recently, there has been a rise in the interest in nanotechnology due to its enormous potential for the development of new products and applications with higher performance and new functionalities. However, while nanotechnology might revolutionize a number of industrial and consumer sectors, there are uncertainties and knowledge gaps regarding toxicological effects of this emerging science. The goal of this research concerns the implementation into Life Cycle Assessment (LCA) of preliminary frameworks developed to evaluate human toxicity and exposure factors related to the potential nanoparticle releases that could occur during the life cycle steps of a functionalized building material. The present LCA case study examines the ecodesign of nanoTiO 2 functionalized porcelain stoneware tile production. The aim of this investigation is to manufacture new eco-friendly products in order to protect human health and ecosystem quality and to offer the market, materials with higher technological properties obtained by the addition of specific nanomaterials. Copyright © 2016 Elsevier B.V. All rights reserved.

Inflammation and ER Stress Regulate Branched-Chain Amino Acid Uptake and Metabolism in Adipocytes

PubMed Central

Burrill, Joel S.; Long, Eric K.; Reilly, Brian; Deng, Yingfeng; Armitage, Ian M.; Scherer, Philipp E.

2015-01-01

Inflammation plays a critical role in the pathology of obesity-linked insulin resistance and is mechanistically linked to the effects of macrophage-derived cytokines on adipocyte energy metabolism, particularly that of the mitochondrial branched-chain amino acid (BCAA) and tricarboxylic acid (TCA) pathways. To address the role of inflammation on energy metabolism in adipocytes, we used high fat-fed C57BL/6J mice and lean controls and measured the down-regulation of genes linked to BCAA and TCA cycle metabolism selectively in visceral but not in subcutaneous adipose tissue, brown fat, liver, or muscle. Using 3T3-L1 cells, TNFα, and other proinflammatory cytokine treatments reduced the expression of the genes linked to BCAA transport and oxidation. Consistent with this, [14C]-leucine uptake and conversion to triglycerides was markedly attenuated in TNFα-treated adipocytes, whereas the conversion to protein was relatively unaffected. Because inflammatory cytokines lead to the induction of endoplasmic reticulum stress, we evaluated the effects of tunicamycin or thapsigargin treatment of 3T3-L1 cells and measured a similar down-regulation in the BCAA/TCA cycle pathway. Moreover, transgenic mice overexpressing X-box binding protein 1 in adipocytes similarly down-regulated genes of BCAA and TCA metabolism in vivo. These results indicate that inflammation and endoplasmic reticulum stress attenuate lipogenesis in visceral adipose depots by down-regulating the BCAA/TCA metabolism pathway and are consistent with a model whereby the accumulation of serum BCAA in the obese insulin-resistant state is linked to adipose inflammation. PMID:25635940

Environmental drivers of heterogeneity in the trophic-functional structure of protozoan communities during an annual cycle in a coastal ecosystem.

PubMed

Xu, Guangjian; Yang, Eun Jin; Xu, Henglong

2017-08-15

Trophic-functional groupings are an important biological trait to summarize community structure in functional space. The heterogeneity of the tropic-functional pattern of protozoan communities and its environmental drivers were studied in coastal waters of the Yellow Sea during a 1-year cycle. Samples were collected using the glass slide method at four stations within a water pollution gradient. A second-stage matrix-based analysis was used to summarize spatial variation in the annual pattern of the functional structure. A clustering analysis revealed significant variability in the trophic-functional pattern among the four stations during the 1-year cycle. The heterogeneity in the trophic-functional pattern of the communities was significantly related to changes in environmental variables, particularly ammonium-nitrogen and nitrates, alone or in combination with dissolved oxygen. These results suggest that the heterogeneity in annual patterns of protozoan trophic-functional structure may reflect water quality status in coastal ecosystems. Copyright © 2017. Published by Elsevier Ltd.

PDF cycling in the dorsal protocerebrum of the Drosophila brain is not necessary for circadian clock function.

PubMed

Kula, Elzbieta; Levitan, Edwin S; Pyza, Elzbieta; Rosbash, Michael

2006-04-01

In Drosophila, the neuropeptide pigment-dispersing factor (PDF) is a likely circadian molecule, secreted by central pacemaker neurons (LNvs). PDF is expressed in both small and large LNvs (sLNvs and lLNvs), and there are striking circadian oscillations of PDF staining intensity in the small cell termini, which require a functional molecular clock. This cycling may be relevant to the proposed role of PDF as a synchronizer of the clock system or as an output signal connecting pacemaker cells to locomotor activity centers. In this study, the authors use a generic neuropeptide fusion protein (atrial natriuretic factor-green fluorescent protein [ANF-GFP]) and show that it can be expressed in the same neurons as PDF itself. Yet, ANF-GFP as well as PDF itself does not manifest any cyclical accumulation in sLNv termini in adult transgenic flies. Surprisingly, the absence of detectable PDF cycling is not accompanied by any detectable behavioral pheno-type, since these transgenic flies have normal morning and evening anticipation in a light-dark cycle (LD) and are fully rhythmic in constant darkness (DD). The molecular clock is also not compromised. The results suggest that robust PDF cycling in sLNv termini plays no more than a minor role in the Drosophila circadian system and is apparently not even necessary for clock output function.

An integrated model of cardiac mitochondrial energy metabolism and calcium dynamics.

PubMed

Cortassa, Sonia; Aon, Miguel A; Marbán, Eduardo; Winslow, Raimond L; O'Rourke, Brian

2003-04-01

We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca(2+) handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH(2), which in turn are used by the electron transport chain to establish a proton motive force (Delta mu(H)), driving the F(1)F(0)-ATPase. In addition, mitochondrial matrix Ca(2+), determined by Ca(2+) uniporter and Na(+)/Ca(2+) exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (Delta Psi(m)), and matrix concentrations of Ca(2+), NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca(2+). The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca(2+) dynamics, and respiratory control. Significant increases in oxygen consumption (V(O(2))), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca(2+), are obtained when the Ca(2+)-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca(2+) plays an

An Integrated Model of Cardiac Mitochondrial Energy Metabolism and Calcium Dynamics

PubMed Central

Cortassa, Sonia; Aon, Miguel A.; Marbán, Eduardo; Winslow, Raimond L.; O'Rourke, Brian

2003-01-01

We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca2+ handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH2, which in turn are used by the electron transport chain to establish a proton motive force (ΔμH), driving the F1F0-ATPase. In addition, mitochondrial matrix Ca2+, determined by Ca2+ uniporter and Na+/Ca2+ exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and α-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (ΔΨm), and matrix concentrations of Ca2+, NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca2+. The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca2+ dynamics, and respiratory control. Significant increases in oxygen consumption (VO2), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca2+, are obtained when the Ca2+-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca2+ plays an important role in matching energy supply with demand in

Glutaric aciduria type 1 metabolites impair the succinate transport from astrocytic to neuronal cells.

PubMed

Lamp, Jessica; Keyser, Britta; Koeller, David M; Ullrich, Kurt; Braulke, Thomas; Mühlhausen, Chris

2011-05-20

The inherited neurodegenerative disorder glutaric aciduria type 1 (GA1) results from mutations in the gene for the mitochondrial matrix enzyme glutaryl-CoA dehydrogenase (GCDH), which leads to elevations of the dicarboxylates glutaric acid (GA) and 3-hydroxyglutaric acid (3OHGA) in brain and blood. The characteristic clinical presentation of GA1 is a sudden onset of dystonia during catabolic situations, resulting from acute striatal injury. The underlying mechanisms are poorly understood, but the high levels of GA and 3OHGA that accumulate during catabolic illnesses are believed to play a primary role. Both GA and 3OHGA are known to be substrates for Na(+)-coupled dicarboxylate transporters, which are required for the anaplerotic transfer of the tricarboxylic acid cycle (TCA) intermediate succinate between astrocytes and neurons. We hypothesized that GA and 3OHGA inhibit the transfer of succinate from astrocytes to neurons, leading to reduced TCA cycle activity and cellular injury. Here, we show that both GA and 3OHGA inhibit the uptake of [(14)C]succinate by Na(+)-coupled dicarboxylate transporters in cultured astrocytic and neuronal cells of wild-type and Gcdh(-/-) mice. In addition, we demonstrate that the efflux of [(14)C]succinate from Gcdh(-/-) astrocytic cells mediated by a not yet identified transporter is strongly reduced. This is the first experimental evidence that GA and 3OHGA interfere with two essential anaplerotic transport processes: astrocytic efflux and neuronal uptake of TCA cycle intermediates, which occur between neurons and astrocytes. These results suggest that elevated levels of GA and 3OHGA may lead to neuronal injury and cell death via disruption of TCA cycle activity. © 2011 by The American Society for Biochemistry and Molecular Biology, Inc.

Culture in cycles: considering H.T. Odum's 'information cycle'

NASA Astrophysics Data System (ADS)

Abel, Thomas

2014-01-01

'Culture' remains a conundrum in anthropology. When recast in the mold of 'information cycles,' culture is transformed. New fault lines appear. Information is splintered into parallel or nested forms. Dynamics becomes cycling. Energy is essential. And culture has function in a directional universe. The 'information cycle' is the crowning component of H.T. Odum's theory of general systems. What follows is an application of the information cycle to the cultural domains of discourse, social media, ritual, education, journalism, technology, academia, and law, which were never attempted by Odum. In information cycles, cultural information is perpetuated - maintained against Second Law depreciation. Conclusions are that culture is in fact a nested hierarchy of cultural forms. Each scale of information production is semi-autonomous, with its own evolutionary dynamics of production and selection in an information cycle. Simultaneously, each information cycle is channeled or entrained by its larger scale of information and ultimately human-ecosystem structuring.

Stereometric parameters change vs. Topographic Change Analysis (TCA) agreement in Heidelberg Retina Tomography III (HRT-3) early detection of clinical significant glaucoma progression.

PubMed

Dascalu, A M; Cherecheanu, A P; Stana, D; Voinea, L; Ciuluvica, R; Savlovschi, C; Serban, D

2014-01-01

to investigate the sensitivity and specificity of the stereometric parameters change analysis vs. Topographic Change Analysis in early detection of glaucoma progression. 81 patients with POAG were monitored for 4 years (GAT monthly, SAP at every 6 months, optic disc photographs and HRT3 yearly). The exclusion criteria were other optic disc or retinal pathology; topographic standard deviation (TSD>30; inter-test variation of reference height>25 μm. The criterion for structural progression was the following: at least 20 adjacent super-pixels with a clinically significant decrease in height (>5%). 16 patients of the total 81 presented structural progression on TCA. The most useful stereometric parameters for the early detection of glaucoma progression were the following: Rim Area change (sensitivity 100%, specificity 74.2% for a "cut-off " value of -0.05), C/D Area change (sensitivity 85.7%, specificity 71.5% for a "cut off " value of 0.02), C/D linear change (sensitivity 85.7%, specificity 71.5% for a "cut-off " value of 0.02), Rim Volume change (sensitivity 71.4%, specificity 88.8% for a "cut-off " value of -0.04). RNFL Thickness change (<0) was highly sensitive (82%), but less specific for glaucoma progression (45,2%). Changes of the other stereometric parameters have a limited diagnostic value for the early detection of glaucoma progression. TCA is a valuable tool for the assessment of the structural progression in glaucoma patients and its inter-test variability is low. On long-term, the quantitative analysis according to stereometric parameters change is also very important. The most relevant parameters to detect progression are RA, C/D Area, Linear C/D and RV.

The cell cycle.

PubMed

Singh, N; Lim, R B; Sawyer, M A

2000-07-01

The cell cycle and the cell cycle control system are the engines that drive life. They allow for the processes of cell renewal and the growth of organisms, under controlled conditions. The control system is essential for the monitoring of normal cell growth and replication of genetic material and to ensure that normal, functional daughter cells are produced at completion of each cell cycle. Although certain clinical applications exist which take advantage of the events of the cell cycle, our understanding of its mechanisms and how to manipulate them is infantile. The next decades will continue to see the effort of many researchers focused upon unlocking the mysteries of the cell cycle and the cell cycle control system.

Functional roles of the major chloroplast lipids in the violaxanthin cycle.

PubMed

Yamamoto, Harry Y

2006-08-01

Monogalactosyldiacylglyceride (MGDG) and digalactosyldiacylglyceride (DGDG) are the major membrane lipids of chloroplasts. The question of the specialized functions of these unique lipids has received limited attention. One function is to support violaxanthin de-epoxidase (VDE) activity, an enzyme of the violaxanthin cycle. To understand better the properties of this system, the effects of galactolipids and phosphatidylcholines on VDE activity were examined by two independent methods. The results show that the micelle-forming lipid (MGDG) and bilayer forming lipids (DGDG and phosphatidylcholines) support VDE activity differently. MGDG supported rapid and complete de-epoxidation starting at a threshold lipid concentration (10 microM) coincident with complete solubilization of violaxanthin. In contrast, DGDG supported slow but nevertheless complete to nearly complete de-epoxidation at a lower lipid concentration (6.7 microM) that did not completely solubilize violaxanthin. Phosphotidylcholines showed similar effects as DGDG except that de-epoxidation was incomplete. Since VDE requires solubilized violaxanthin, aggregated violaxanthin in DGDG at low concentration must become solubilized as de-epoxidation proceeds. High lipid concentrations had lower activity possibly due to formation of multilayered structures (liposomes) that restrict accessibility of violaxanthin to VDE. MGDG micelles do not present such restrictions. The results indicate VDE operates throughout the lipid phase of the single bilayer thylakoid membrane and is not limited to putative MGDG micelle domains. Additionally, the results also explain the differential partitioning of violaxanthin between the envelope and thylakoid as due to the relative solubilities of violaxanthin and zeaxanthin in MGDG, DGDG and phospholipids. The violaxanthin cycle is hypothesized to be a linked system of the thylakoid and envelope for signal transduction of light stress.

The functional role for condensin in the regulation of chromosomal organization during the cell cycle.

PubMed

Kagami, Yuya; Yoshida, Kiyotsugu

2016-12-01

In all organisms, the control of cell cycle progression is a fundamental process that is essential for cell growth, development, and survival. Through each cell cycle phase, the regulation of chromatin organization is essential for natural cell proliferation and maintaining cellular homeostasis. During mitosis, the chromatin morphology is dramatically changed to have a "thread-like" shape and the condensed chromosomes are segregated equally into two daughter cells. Disruption of the mitotic chromosome architecture physically impedes chromosomal behaviors, such as chromosome alignment and chromosome segregation; therefore, the proper mitotic chromosome structure is required to maintain chromosomal stability. Accumulating evidence has demonstrated that mitotic chromosome condensation is induced by condensin complexes. Moreover, recent studies have shown that condensin also modulates interphase chromatin and regulates gene expression. This review mainly focuses on the molecular mechanisms that condensin uses to exert its functions during the cell cycle progression. Moreover, we discuss the condensin-mediated chromosomal organization in cancer cells.

Characterization and functional analysis of a slow-cycling subpopulation in colorectal cancer enriched by cell cycle inducer combined chemotherapy.

PubMed

Wu, Feng-Hua; Mu, Lei; Li, Xiao-Lan; Hu, Yi-Bing; Liu, Hui; Han, Lin-Tao; Gong, Jian-Ping

2017-10-03

The concept of cancer stem cells has been proposed in various malignancies including colorectal cancer. Recent studies show direct evidence for quiescence slow-cycling cells playing a role in cancer stem cells. There exists an urgent need to isolate and better characterize these slow-cycling cells. In this study, we developed a new model to enrich slow-cycling tumor cells using cell-cycle inducer combined with cell cycle-dependent chemotherapy in vitro and in vivo . Our results show that Short-term exposure of colorectal cancer cells to chemotherapy combined with cell-cycle inducer enriches for a cell-cycle quiescent tumor cell population. Specifically, these slow-cycling tumor cells exhibit increased chemotherapy resistance in vitro and tumorigenicity in vivo . Notably, these cells are stem-cell like and participate in metastatic dormancy. Further exploration indicates that slow-cycling colorectal cancer cells in our model are less sensitive to cytokine-induced-killer cell mediated cytotoxic killing in vivo and in vitro . Collectively, our cell cycle inducer combined chemotherapy exposure model enriches for a slow-cycling, dormant, chemo-resistant tumor cell sub-population that are resistant to cytokine induced killer cell based immunotherapy. Studying unique signaling pathways in dormant tumor cells enriched by cell cycle inducer combined chemotherapy treatment is expected to identify novel therapeutic targets for preventing tumor recurrence.

Characterization and functional analysis of a slow-cycling subpopulation in colorectal cancer enriched by cell cycle inducer combined chemotherapy

PubMed Central

Wu, Feng-Hua; Mu, Lei; Li, Xiao-Lan; Hu, Yi-Bing; Liu, Hui; Han, Lin-Tao; Gong, Jian-Ping

2017-01-01

The concept of cancer stem cells has been proposed in various malignancies including colorectal cancer. Recent studies show direct evidence for quiescence slow-cycling cells playing a role in cancer stem cells. There exists an urgent need to isolate and better characterize these slow-cycling cells. In this study, we developed a new model to enrich slow-cycling tumor cells using cell-cycle inducer combined with cell cycle-dependent chemotherapy in vitro and in vivo. Our results show that Short-term exposure of colorectal cancer cells to chemotherapy combined with cell-cycle inducer enriches for a cell-cycle quiescent tumor cell population. Specifically, these slow-cycling tumor cells exhibit increased chemotherapy resistance in vitro and tumorigenicity in vivo. Notably, these cells are stem-cell like and participate in metastatic dormancy. Further exploration indicates that slow-cycling colorectal cancer cells in our model are less sensitive to cytokine-induced-killer cell mediated cytotoxic killing in vivo and in vitro. Collectively, our cell cycle inducer combined chemotherapy exposure model enriches for a slow-cycling, dormant, chemo-resistant tumor cell sub-population that are resistant to cytokine induced killer cell based immunotherapy. Studying unique signaling pathways in dormant tumor cells enriched by cell cycle inducer combined chemotherapy treatment is expected to identify novel therapeutic targets for preventing tumor recurrence. PMID:29108242

Microbial and functional diversity of a subterrestrial high pH groundwater associated to serpentinization.

PubMed

Tiago, Igor; Veríssimo, António

2013-06-01

Microbial and functional diversity were assessed, from a serpentinization-driven subterrestrial alkaline aquifer - Cabeço de Vide Aquifer (CVA) in Portugal. DGGE analyses revealed the presence of a stable microbial community. By 16S rRNA gene libraries and pyrosequencing analyses, a diverse bacterial composition was determined, contrasting with low archaeal diversity. Within Bacteria the majority of the populations were related to organisms or sequences affiliated to class Clostridia, but members of classes Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, Deinococci, Gammaproteobacteria and of the phyla Bacteroidetes, Chloroflexi and Nitrospira were also detected. Domain Archaea encompassed mainly sequences affiliated to Euryarchaeota. Only form I RuBisCO - cbbL was detected. Autotrophic carbon fixation via the rTCA, 3-HP and 3-HP/4H-B cycles could not be confirmed. The detected APS reductase alpha subunit - aprA sequences were phylogenetically related to sequences of sulfate-reducing bacteria belonging to Clostridia, and also to sequences of chemolithoautothrophic sulfur-oxidizing bacteria belonging to Betaproteobacteria. Sequences of methyl coenzyme M reductase - mcrA were phylogenetically affiliated to sequences belonging to Anaerobic Methanotroph group 1 (ANME-1). The populations found and the functional key markers detected in CVA suggest that metabolisms related to H2 , methane and/or sulfur may be the major driving forces in this environment. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

A plant pathogenic bacterium exploits the tricarboxylic acid cycle metabolic pathway of its insect vector

PubMed Central

Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I.

2018-01-01

ABSTRACT Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L-serine, L-threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L-proline, L-aspartic acid, and L-pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L-proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector. PMID:28594267

A plant pathogenic bacterium exploits the tricarboxylic acid cycle metabolic pathway of its insect vector.

PubMed

Killiny, Nabil; Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I

2018-01-01

Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L -serine, L -threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L -proline, L -aspartic acid, and L -pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L -proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector.

Metabolites Identified during Varied Doses of Aspergillus Species in Zea mays Grains, and Their Correlation with Aflatoxin Levels.

PubMed

Falade, Titilayo D O; Chrysanthopoulos, Panagiotis K; Hodson, Mark P; Sultanbawa, Yasmina; Fletcher, Mary; Darnell, Ross; Korie, Sam; Fox, Glen

2018-05-07

Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol ( R = 0.48) and turanose and ( R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity.

Antisense Inhibition of the Iron-Sulphur Subunit of Succinate Dehydrogenase Enhances Photosynthesis and Growth in Tomato via an Organic Acid–Mediated Effect on Stomatal Aperture[W][OA

PubMed Central

Araújo, Wagner L.; Nunes-Nesi, Adriano; Osorio, Sonia; Usadel, Björn; Fuentes, Daniela; Nagy, Réka; Balbo, Ilse; Lehmann, Martin; Studart-Witkowski, Claudia; Tohge, Takayuki; Martinoia, Enrico; Jordana, Xavier; DaMatta, Fábio M.; Fernie, Alisdair R.

2011-01-01

Transgenic tomato (Solanum lycopersicum) plants expressing a fragment of the Sl SDH2-2 gene encoding the iron sulfur subunit of the succinate dehydrogenase protein complex in the antisense orientation under the control of the 35S promoter exhibit an enhanced rate of photosynthesis. The rate of the tricarboxylic acid (TCA) cycle was reduced in these transformants, and there were changes in the levels of metabolites associated with the TCA cycle. Furthermore, in comparison to wild-type plants, carbon dioxide assimilation was enhanced by up to 25% in the transgenic plants under ambient conditions, and mature plants were characterized by an increased biomass. Analysis of additional photosynthetic parameters revealed that the rate of transpiration and stomatal conductance were markedly elevated in the transgenic plants. The transformants displayed a strongly enhanced assimilation rate under both ambient and suboptimal environmental conditions, as well as an elevated maximal stomatal aperture. By contrast, when the Sl SDH2-2 gene was repressed by antisense RNA in a guard cell–specific manner, changes in neither stomatal aperture nor photosynthesis were observed. The data obtained are discussed in the context of the role of TCA cycle intermediates both generally with respect to photosynthetic metabolism and specifically with respect to their role in the regulation of stomatal aperture. PMID:21307286

Skeletal muscle adaptation to fatty acid depends on coordinated actions of the PPARs and PGC1 alpha: implications for metabolic disease.

PubMed

Muoio, Deborah M; Koves, Timothy R

2007-10-01

Dyslipidemia and intramuscular accumulation of fatty acid metabolites are increasingly recognized as core features of obesity and type 2 diabetes. Emerging evidence suggests that normal physiological adaptations to a heavy lipid load depend on the coordinated actions of broad transcriptional regulators such as the peroxisome proliferator activated receptors (PPARs) and PPAR gamma coactivator 1 alpha (PGC1 alpha). The application of transcriptomics and targeted metabolic profiling tools based on mass spectrometry has led to our finding that lipid-induced insulin resistance is a condition in which upregulation of PPAR-targeted genes and high rates of beta-oxidation are not supported by a commensurate upregulation of tricarboxylic acid (TCA) cycle activity. In contrast, exercise training enhances mitochondrial performance, favoring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high-fat diet. The exercise-activated transcriptional coactivator, PGC1 alpha, plays a key role in coordinating metabolic flux through these 2 intersecting metabolic pathways, and its suppression by overfeeding may contribute to diet-induced mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from a mitochondrial disconnect between beta-oxidation and TCA cycle activity. Understanding of this "disconnect" and its molecular basis may lead to new therapeutic approaches to combatting metabolic disease.

Ammonium Assimilation Requires Mitochondrial Respiration in the Light : A Study with the Green Alga Selenastrum minutum.

PubMed

Weger, H G; Birch, D G; Elrifi, I R; Turpin, D H

1988-03-01

Mass spectrometric analysis of O(2) and CO(2) exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH(4)Cl resulted in nearly a 250% increase in the rate of TCA cycle CO(2) efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O(2) consumption in both light and dark. Anaerobiosis inhibited the CO(2) release caused by NH(4)Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O(2) consumption in the light. This implied that the Mehler reaction did not play a significant role in O(2) consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions.

Ammonium Assimilation Requires Mitochondrial Respiration in the Light 1

PubMed Central

Weger, Harold G.; Birch, Douglas G.; Elrifi, Ivor R.; Turpin, David H.

1988-01-01

Mass spectrometric analysis of O2 and CO2 exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH4Cl resulted in nearly a 250% increase in the rate of TCA cycle CO2 efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O2 consumption in both light and dark. Anaerobiosis inhibited the CO2 release caused by NH4Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O2 consumption in the light. This implied that the Mehler reaction did not play a significant role in O2 consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions. PMID:16665971

Adenosine kinase deficiency disrupts the methionine cycle and causes hypermethioninemia, encephalopathy, and abnormal liver function.

PubMed

Bjursell, Magnus K; Blom, Henk J; Cayuela, Jordi Asin; Engvall, Martin L; Lesko, Nicole; Balasubramaniam, Shanti; Brandberg, Göran; Halldin, Maria; Falkenberg, Maria; Jakobs, Cornelis; Smith, Desiree; Struys, Eduard; von Döbeln, Ulrika; Gustafsson, Claes M; Lundeberg, Joakim; Wedell, Anna

2011-10-07

Four inborn errors of metabolism (IEMs) are known to cause hypermethioninemia by directly interfering with the methionine cycle. Hypermethioninemia is occasionally discovered incidentally, but it is often disregarded as an unspecific finding, particularly if liver disease is involved. In many individuals the hypermethioninemia resolves without further deterioration, but it can also represent an early sign of a severe, progressive neurodevelopmental disorder. Further investigation of unclear hypermethioninemia is therefore important. We studied two siblings affected by severe developmental delay and liver dysfunction. Biochemical analysis revealed increased plasma levels of methionine, S-adenosylmethionine (AdoMet), and S-adenosylhomocysteine (AdoHcy) but normal or mildly elevated homocysteine (Hcy) levels, indicating a block in the methionine cycle. We excluded S-adenosylhomocysteine hydrolase (SAHH) deficiency, which causes a similar biochemical phenotype, by using genetic and biochemical techniques and hypothesized that there was a functional block in the SAHH enzyme as a result of a recessive mutation in a different gene. Using exome sequencing, we identified a homozygous c.902C>A (p.Ala301Glu) missense mutation in the adenosine kinase gene (ADK), the function of which fits perfectly with this hypothesis. Increased urinary adenosine excretion confirmed ADK deficiency in the siblings. Four additional individuals from two unrelated families with a similar presentation were identified and shown to have a homozygous c.653A>C (p.Asp218Ala) and c.38G>A (p.Gly13Glu) mutation, respectively, in the same gene. All three missense mutations were deleterious, as shown by activity measurements on recombinant enzymes. ADK deficiency is a previously undescribed, severe IEM shedding light on a functional link between the methionine cycle and adenosine metabolism. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Modeling the High Speed Research Cycle 2B Longitudinal Aerodynamic Database Using Multivariate Orthogonal Functions

NASA Technical Reports Server (NTRS)

Morelli, E. A.; Proffitt, M. S.

1999-01-01

The data for longitudinal non-dimensional, aerodynamic coefficients in the High Speed Research Cycle 2B aerodynamic database were modeled using polynomial expressions identified with an orthogonal function modeling technique. The discrepancy between the tabular aerodynamic data and the polynomial models was tested and shown to be less than 15 percent for drag, lift, and pitching moment coefficients over the entire flight envelope. Most of this discrepancy was traced to smoothing local measurement noise and to the omission of mass case 5 data in the modeling process. A simulation check case showed that the polynomial models provided a compact and accurate representation of the nonlinear aerodynamic dependencies contained in the HSR Cycle 2B tabular aerodynamic database.

Ecotypic variability in the metabolic response of seeds to diurnal hydration-dehydration cycles and its relationship to seed vigor.

PubMed

Bai, Bing; Sikron, Noga; Gendler, Tanya; Kazachkova, Yana; Barak, Simon; Grafi, Gideon; Khozin-Goldberg, Inna; Fait, Aaron

2012-01-01

Seeds in the seed bank experience diurnal cycles of imbibition followed by complete dehydration. These conditions pose a challenge to the regulation of germination. The effect of recurring hydration-dehydration (Hy-Dh) cycles were tested on seeds from four Arabidopsis thaliana accessions [Col-0, Cvi, C24 and Ler]. Diurnal Hy-Dh cycles had a detrimental effect on the germination rate and on the final percentage of germination in Col-0, Cvi and C24 ecotypes, but not in the Ler ecotype, which showed improved vigor following the treatments. Membrane permeability measured by ion conductivity was generally increased following each Hy-Dh cycle and was correlated with changes in the redox status represented by the GSSG/GSH (oxidized/reduced glutathione) ratio. Among the ecotypes, Col-0 seeds displayed the highest membrane permeability, whilst Ler was characterized by the greatest increase in electrical conductivity following Hy-Dh cycles. Following Dh 2 and Dh 3, the respiratory activity of Ler seeds significantly increased, in contrast to the other ecotypes, indicative of a dramatic shift in metabolism. These differences were associated with accession-specific content and patterns of change of (i) cell wall-related laminaribiose and mannose; (ii) fatty acid composition, specifically of the unsaturated oleic acid and α-linoleic acid; and (iii) asparagine, ornithine and the related polyamine putrescine. Furthermore, in the Ler ecotype the content of the tricarboxylic acid (TCA) cycle intermediates fumarate, succinate and malate increased in response to dehydration, in contrast to a decrease in the other three ecotypes. These findings provide a link between seed respiration, energy metabolism, fatty acid β-oxidation, nitrogen mobilization and membrane permeability and the improved germination of Ler seeds following Hy-Dh cycles.

Repeated cycles of 5-fluorouracil chemotherapy impaired anti-tumor functions of cytotoxic T cells in a CT26 tumor-bearing mouse model.

PubMed

Wu, Yanhong; Deng, Zhenling; Wang, Huiru; Ma, Wenbo; Zhou, Chunxia; Zhang, Shuren

2016-09-20

Recently, the immunostimulatory roles of chemotherapeutics have been increasingly revealed, although bone marrow suppression is still a common toxicity of chemotherapy. While the numbers and ratios of different immune subpopulations are analyzed after chemotherapy, changes to immune status after each cycle of treatment are less studied and remain unclear. To determine the tumor-specific immune status and functions after different cycles of chemotherapy, we treated CT26 tumor-bearing mice with one to four cycles of 5-fluorouracil (5-FU). Overall survival was not improved when more than one cycle of 5-FU was administered. Here we present data concerning the immune statuses after one and three cycles of chemotherapy. We analyzed the amount of spleen cells from mice treated with one and three cycles of 5-FU as well as assayed their proliferation and cytotoxicity against the CT26 tumor cell line. We found that the absolute numbers of CD8 T-cells and NK cells were not influenced significantly after either one or three cycles of chemotherapy. However, after three cycles of 5-FU, proliferated CD8 T-cells were decreased, and CT26-specific cytotoxicity and IFN-γ secretion of spleen cells were impaired in vitro. After one cycle of 5-FU, there was a greater percentage of tumor infiltrating CD8 T-cells. In addition, more proliferated CD8 T-cells, enhanced tumor-specific cytotoxicity as well as IFN-γ secretion of spleen cells against CT26 in vitro were observed. Given the increased expression of immunosuppressive factors, such as PD-L1 and TGF-β, we assessed the effect of early introduction of immunotherapy in combination with chemotherapy. We found that mice treated with cytokine induced killer cells and PD-L1 monoclonal antibodies after one cycle of 5-FU had a better anti-tumor performance than those treated with chemotherapy or immunotherapy alone. These data suggest that a single cycle of 5-FU treatment promoted an anti-tumor immune response, whereas repeated chemotherapy

Differential Mechanism of Escherichia coli Inactivation by (+)-Limonene as a Function of Cell Physiological State and Drug's Concentration

PubMed Central

Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego

2014-01-01

(+)-limonene is a lipophilic antimicrobial compound, extracted from citrus fruits' essential oils, that is used as a flavouring agent and organic solvent by the food industry. A recent study has proposed a common and controversial mechanism of cell death for bactericidal antibiotics, in which hydroxyl radicals ultimately inactivated cells. Our objective was to determine whether the mechanism of Escherichia coli MG1655 inactivation by (+)-limonene follows that of bactericidal antibiotics. A treatment with 2,000 μL/L (+)-limonene inactivated 4 log10 cycles of exponentially growing E. coli cells in 3 hours. On one hand, an increase of cell survival in the ΔacnB mutant (deficient in a TCA cycle enzyme), or in the presence of 2,2′-dipyridyl (inhibitor of Fenton reaction by iron chelation), thiourea, or cysteamine (hydroxyl radical scavengers) was observed. Moreover, the ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) was more sensitive to (+)-limonene. Thus, this indirect evidence indicates that the mechanism of exponentially growing E. coli cells inactivation by 2,000 μL/L (+)-limonene is due to the TCA cycle and Fenton-mediated hydroxyl radical formation that caused oxidative DNA damage, as observed for bactericidal drugs. However, several differences have been observed between the proposed mechanism for bactericidal drugs and for (+)-limonene. In this regard, our results demonstrated that E. coli inactivation was influenced by its physiological state and the drug's concentration: experiments with stationary-phase cells or 4,000 μL/L (+)-limonene uncovered a different mechanism of cell death, likely unrelated to hydroxyl radicals. Our research has also shown that drug's concentration is an important factor influencing the mechanism of bacterial inactivation by antibiotics, such as kanamycin. These results might help in improving and spreading the use of (+)-limonene as an antimicrobial compound, and in clarifying the controversy

Differential mechanism of Escherichia coli Inactivation by (+)-limonene as a function of cell physiological state and drug's concentration.

PubMed

Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego

2014-01-01

(+)-limonene is a lipophilic antimicrobial compound, extracted from citrus fruits' essential oils, that is used as a flavouring agent and organic solvent by the food industry. A recent study has proposed a common and controversial mechanism of cell death for bactericidal antibiotics, in which hydroxyl radicals ultimately inactivated cells. Our objective was to determine whether the mechanism of Escherichia coli MG1655 inactivation by (+)-limonene follows that of bactericidal antibiotics. A treatment with 2,000 μL/L (+)-limonene inactivated 4 log10 cycles of exponentially growing E. coli cells in 3 hours. On one hand, an increase of cell survival in the ΔacnB mutant (deficient in a TCA cycle enzyme), or in the presence of 2,2'-dipyridyl (inhibitor of Fenton reaction by iron chelation), thiourea, or cysteamine (hydroxyl radical scavengers) was observed. Moreover, the ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) was more sensitive to (+)-limonene. Thus, this indirect evidence indicates that the mechanism of exponentially growing E. coli cells inactivation by 2,000 μL/L (+)-limonene is due to the TCA cycle and Fenton-mediated hydroxyl radical formation that caused oxidative DNA damage, as observed for bactericidal drugs. However, several differences have been observed between the proposed mechanism for bactericidal drugs and for (+)-limonene. In this regard, our results demonstrated that E. coli inactivation was influenced by its physiological state and the drug's concentration: experiments with stationary-phase cells or 4,000 μL/L (+)-limonene uncovered a different mechanism of cell death, likely unrelated to hydroxyl radicals. Our research has also shown that drug's concentration is an important factor influencing the mechanism of bacterial inactivation by antibiotics, such as kanamycin. These results might help in improving and spreading the use of (+)-limonene as an antimicrobial compound, and in clarifying the controversy about

Cuckoo Search Algorithm Based on Repeat-Cycle Asymptotic Self-Learning and Self-Evolving Disturbance for Function Optimization

PubMed Central

Wang, Jie-sheng; Li, Shu-xia; Song, Jiang-di

2015-01-01

In order to improve convergence velocity and optimization accuracy of the cuckoo search (CS) algorithm for solving the function optimization problems, a new improved cuckoo search algorithm based on the repeat-cycle asymptotic self-learning and self-evolving disturbance (RC-SSCS) is proposed. A disturbance operation is added into the algorithm by constructing a disturbance factor to make a more careful and thorough search near the bird's nests location. In order to select a reasonable repeat-cycled disturbance number, a further study on the choice of disturbance times is made. Finally, six typical test functions are adopted to carry out simulation experiments, meanwhile, compare algorithms of this paper with two typical swarm intelligence algorithms particle swarm optimization (PSO) algorithm and artificial bee colony (ABC) algorithm. The results show that the improved cuckoo search algorithm has better convergence velocity and optimization accuracy. PMID:26366164

Functional anatomy of visuo-spatial working memory during mental rotation is influenced by sex, menstrual cycle, and sex steroid hormones.

PubMed

Schöning, S; Engelien, A; Kugel, H; Schäfer, S; Schiffbauer, H; Zwitserlood, P; Pletziger, E; Beizai, P; Kersting, A; Ohrmann, P; Greb, R R; Lehmann, W; Heindel, W; Arolt, V; Konrad, C

2007-11-05

Recent observations indicate that sex and level of steroid hormones may influence cortical networks associated with specific cognitive functions, in particular visuo-spatial abilities. The present study probed the influence of sex, menstrual cycle, and sex steroid hormones on 3D mental rotation and brain function using 3-T fMRI. Twelve healthy women and 12 men were investigated. Menstrual cycle and hormone levels were assessed. The early follicular and midluteal phase of the menstrual cycle were chosen to examine short-term cyclical changes. Parietal and frontal areas were activated during mental rotation in both sexes. Significant differences between men and women were revealed in both phases of menstrual cycle. In men we observed a significant correlation of activation levels with testosterone levels in the left parietal lobe (BA 40). In women, a cycle-dependent correlation pattern was observed for testosterone: brain activation correlated with this male hormone only during the early follicular phase. In both cycle phases females' brain activation was significantly correlated with estradiol in frontal and parietal areas. Our study provides evidence that fMRI-related activity during performance of cognitive tasks varies across sex and phases of the menstrual cycle. The variation might be partly explained by better task performance in men, but our results indicate that further explanations like basic neuronal or neurovascular effects modulated by steroid hormones must be considered. Both estradiol and testosterone levels may influence fMRI signals of cognitive tasks, which should affect selection of subjects for future fMRI studies.

A saw-less direct conversion long term evolution receiver with 25% duty-cycle LO in 130 nm CMOS technology

NASA Astrophysics Data System (ADS)

Siyuan, He; Changhong, Zhang; Liang, Tao; Weifeng, Zhang; Longyue, Zeng; Wei, Lü; Haijun, Wu

2013-03-01

A CMOS long-term evolution (LTE) direct convert receiver that eliminates the interstage SAW filter is presented. The receiver consists of a low noise variable gain transconductance amplifier (TCA), a quadrature passive current commutating mixer with a 25% duty-cycle LO, a trans-impedance amplifier (TIA), a 7th-order Chebyshev filter and programmable gain amplifiers (PGAs). A wide dynamic gain range is allocated in the RF and analog parts. A current commutating passive mixer with a 25% duty-cycle LO improves gain, noise, and linearity. An LPF based on a Tow-Thomas biquad suppresses out-of-band interference. Fabricated in a 0.13 μm CMOS process, the receiver chain achieves a 107 dB maximum voltage gain, 2.7 dB DSB NF (from PAD port), -11 dBm IIP3, and > +65 dBm IIP2 after calibration, 96 dB dynamic control range with 1 dB steps, less than 2% error vector magnitude (EVM) from 2.3 to 2.7 GHz. The total receiver (total I Q path) draws 89 mA from a 1.2-V LDO on chip supply.

Functional anatomy of the sleep-wakefulness cycle: wakefulness.

PubMed

Reinoso-Suárez, Fernando; de Andrés, Isabel; Garzón, Miguel

2011-01-01

Sleep is a necessary, diverse, periodic, and an active condition circadian and homeostatically regulated and precisely meshed with waking time into the sleep-wakefulness cycle (SWC). Photic retinal stimulation modulates the suprachiasmatic nucleus, which acts as the pacemaker for SWC rhythmicity. Both the light period and social cues adjust the internal clock, making the SWC a circadian, 24-h period in the adult human. Bioelectrical and behavioral parameters characterize the different phases of the SWC. For a long time, lesions and electrical stimulation of brain structures, as well as connection studies, were the main methods used to decipher the foundations of the functional anatomy of the SWC. That is why the first section of this review presents these early historical studies to then discuss the current state of our knowledge based on our understanding of the functional anatomy of the structures underlying the SWC. Supported by this description, we then present a detailed review and update of the structures involved in the phase of wakefulness (W), including their morphological, functional, and chemical characteristics, as well as their anatomical connections. The structures for W generation are known as the "ascending reticular activating system", and they keep and maintain the "thalamo-cerebral cortex unit" awake. This system originates from the neuronal groups located within the brainstem, hypothalamus, and basal forebrain, which use known neurotransmitters and whose neurons are more active during W than during the other SWC states. Thus, synergies among several of these neurotransmitters are necessary to generate the cortical and thalamic activation that is characteristic of the W state, with all the plastic qualities and nuances present in its different behavioral circumstances. Each one of the neurotransmitters exerts powerful influences on the information and cognitive processes as well as attentional, emotional, motivational, behavioral, and arousal

An 8-Week Low-Intensity Progressive Cycling Training Improves Motor Functions in Patients with Early-Stage Parkinson's Disease.

PubMed

Chang, Hsiu Chen; Lu, Chin Song; Chiou, Wei Da; Chen, Chiung Chu; Weng, Yi Hsin; Chang, Ya Ju

2018-04-01

The effects of high-intensity cycling as an adjuvant therapy for early-stage Parkinson's disease (PD) were highlighted recently. However, patients experience difficulties in maintaining these cycling training programs. The present study investigated the efficacy of cycling at a mild-to-moderate intensity in early-stage PD. Thirteen PD patients were enrolled for 16 serial cycling sessions over a 2-month period. Motor function was assessed using the Unified Parkinson's Disease Rating Scale part III (UPDRS III) and Timed Up and Go (TUG) test as primary outcomes. The Montreal Cognitive Assessment (MoCA), modified Hoehn and Yahr Stage (mHYS), total UPDRS, Falls Efficacy Scale, New Freezing of Gait Questionnaire, Schwab and England Activities of Daily Living, 39-item Parkinson's Disease Questionnaire, Patient Global Impression of Change, and gait performance were assessed as secondary outcomes. The age and the age at onset were 59.67±7.24 and 53.23±10.26 years (mean±SD), respectively. The cycling cadence was 53.27±8.92 revolutions per minute. The UPDRS III score improved significantly after 8 training sessions (p=0.011) and 16 training sessions (T2) (p=0.001) in the off-state, and at T2 (p=0.004) in the on-state compared to pretraining (T0). The TUG duration was significantly shorter at T2 than at T0 (p<0.05). The findings of MoCA, total UPDRS, double limb support time, and mHYS (in both the off- and on-states) also improved significantly at T2. Our pioneer study has demonstrated that a low-intensity progressive cycling exercise can improve motor function in PD, especially akinesia. The beneficial effects were similar to those of high-intensity rehabilitation programs. Copyright © 2018 Korean Neurological Association.

Cerebral glucose metabolism and the glutamine cycle as detected by in vivo and in vitro 13C NMR spectroscopy.

PubMed

García-Espinosa, María A; Rodrigues, Tiago B; Sierra, Alejandra; Benito, Marina; Fonseca, Carla; Gray, Heather L; Bartnik, Brenda L; García-Martín, María L; Ballesteros, Paloma; Cerdán, Sebastián

2004-01-01

We review briefly 13C NMR studies of cerebral glucose metabolism with an emphasis on the roles of glial energetics and the glutamine cycle. Mathematical modeling analysis of in vivo 13C turnover experiments from the C4 carbons of glutamate and glutamine are consistent with: (i) the glutamine cycle being the major cerebral metabolic route supporting glutamatergic neurotransmission, (ii) glial glutamine synthesis being stoichiometrically coupled to glycolytic ATP production, (iii) glutamine serving as the main precursor of neurotransmitter glutamate and (iv) glutamatergic neurotransmission being supported by lactate oxidation in the neurons in a process accounting for 60-80% of the energy derived from glucose catabolism. However, more recent experimental approaches using inhibitors of the glial tricarboxylic acid (TCA) cycle (trifluoroacetic acid, TFA) or of glutamine synthase (methionine sulfoximine, MSO) reveal that a considerable portion of the energy required to support glutamine synthesis is derived from the oxidative metabolism of glucose in the astroglia and that a significant amount of the neurotransmitter glutamate is produced from neuronal glucose or lactate rather than from glial glutamine. Moreover, a redox switch has been proposed that allows the neurons to use either glucose or lactate as substrates for oxidation, depending on the relative availability of these fuels under resting or activation conditions, respectively. Together, these results suggest that the coupling mechanisms between neuronal and glial metabolism are more complex than initially envisioned.

Metaproteomics Provides Functional Insight into Activated Sludge Wastewater Treatment

PubMed Central

Wilmes, Paul; Wexler, Margaret; Bond, Philip L.

2008-01-01

Background Through identification of highly expressed proteins from a mixed culture activated sludge system this study provides functional evidence of microbial transformations important for enhanced biological phosphorus removal (EBPR). Methodology/Principal Findings A laboratory-scale sequencing batch reactor was successfully operated for different levels of EBPR, removing around 25, 40 and 55 mg/l P. The microbial communities were dominated by the uncultured polyphosphate-accumulating organism “Candidatus Accumulibacter phosphatis”. When EBPR failed, the sludge was dominated by tetrad-forming α-Proteobacteria. Representative and reproducible 2D gel protein separations were obtained for all sludge samples. 638 protein spots were matched across gels generated from the phosphate removing sludges. 111 of these were excised and 46 proteins were identified using recently available sludge metagenomic sequences. Many of these closely match proteins from “Candidatus Accumulibacter phosphatis” and could be directly linked to the EBPR process. They included enzymes involved in energy generation, polyhydroxyalkanoate synthesis, glycolysis, gluconeogenesis, glycogen synthesis, glyoxylate/TCA cycle, fatty acid β oxidation, fatty acid synthesis and phosphate transport. Several proteins involved in cellular stress response were detected. Conclusions/Significance Importantly, this study provides direct evidence linking the metabolic activities of “Accumulibacter” to the chemical transformations observed in EBPR. Finally, the results are discussed in relation to current EBPR metabolic models. PMID:18392150

Finding Limit Cycles in self-excited oscillators with infinite-series damping functions

NASA Astrophysics Data System (ADS)

Das, Debapriya; Banerjee, Dhruba; Bhattacharjee, Jayanta K.

2015-03-01

In this paper we present a simple method for finding the location of limit cycles of self excited oscillators whose damping functions can be represented by some infinite convergent series. We have used standard results of first-order perturbation theory to arrive at amplitude equations. The approach has been kept pedagogic by first working out the cases of finite polynomials using elementary algebra. Then the method has been extended to various infinite polynomials, where the fixed points of the corresponding amplitude equations cannot be found out. Hopf bifurcations for systems with nonlinear powers in velocities have also been discussed.

Renal and Hepatic Functions after A Week of Controlled Ovarian Hyperstimulation during In Vitro Fertilization Cycles.

PubMed

Romito, Ilaria; Gulino, Ferdinando Antonio; Laganà, Antonio Simone; Vitale, Salvatore Giovanni; Tuscano, Attilio; Leanza, Gianluca; Musmeci, Giulia; Leanza, Vito; Rapisarda, Agnese Maria Chiara; Palumbo, Marco Antonio

2017-01-01

One the main aspects of in vitro fertilization (IVF) cycle is to avoid any possible systemic damage on women undergoing a controlled ovarian hyperstimulation (COH). The aim of this work is to evaluate renal and hepatic function blood tests in patients undergoing controlled ovarian hyperstimulation during IVF cycles. We performed a prospective cohort analysis. All patients re- ceived a long stimulation protocol with gonadotropin-releasing hormone (GnRH) analogues by daily administration, since the twenty-first day of the previous ovarian cycle followed by COH with recombinant follicle-stimulating hormone (FSH). The daily dose of exogenous gonadotropins for every single patient was modified according to her follicular growth. The oocytes were retrieved during the oocyte pick up and fertilized by standard procedures of intracytoplasmic sperm injection (ICSI). The blood samples to evaluate renal and hepatic functions were taken at the 7 th day of ovarian stimulation. We enrolled 426 women aged between 19 and 44 years, with a mean body mass index (BMI) of 24.68 Kg/m 2 . The mean value of blood urea nitrogen was 14 ± 3.16 mg/ dl, creatinine: 1 ± 0.45 mg/dl, uric acid: 4 ± 1.95 mg/dl, total proteins: 7 ± 3.93 mg/dl, aspartate aminotransferase: 18 ± 6.29 mU/ml, alanine aminotransferase: 19 ± 10.41 mU/ ml, alkaline phosphatase: 81 ± 45.25 mU/ml, total bilirubin 1 ± 0.35 mg/dL. All of the results were considered as a normal range following the Medical Council of Canada. Our data suggest that, unlike ovarian hyperstimulation syndrome (OHSS), COH patients did not show any alteration to renal and hepatic functions.

Biosynthesis of Taxadiene in Saccharomyces cerevisiae : Selection of Geranylgeranyl Diphosphate Synthase Directed by a Computer-Aided Docking Strategy

PubMed Central

Li, Lin-feng; Zhai, Fang; Shang, Lu-qing; Yin, Zheng; Yuan, Ying-jin

2014-01-01

Identification of efficient key enzymes in biosynthesis pathway and optimization of the fitness between functional modules and chassis are important for improving the production of target compounds. In this study, the taxadiene biosynthesis pathway was firstly constructed in yeast by transforming ts gene and overexpressing erg20 and thmgr. Then, the catalytic capabilities of six different geranylgeranyl diphosphate synthases (GGPPS), the key enzyme in mevalonic acid (MVA) pathway catalyzing famesyl diphosphate (FPP) to geranylgeranyl diphosphate (GGPP), were predicted using enzyme-substrate docking strategy. GGPPSs from Taxus baccata x Taxus cuspidate (GGPPSbc), Erwinia herbicola (GGPPSeh), and S. cerevisiae (GGPPSsc) which ranked 1st, 4th and 6th in docking with FPP were selected for construction. The experimental results were consistent with the computer prediction that the engineered yeast with GGPPSbc exhibited the highest production. In addition, two chassis YSG50 and W303-1A were chosen, and the titer of taxadiene reached 72.8 mg/L in chassis YSG50 with GGPPSbc. Metabolomic study revealed that the contents of tricarboxylic acid cycle (TCA) intermediates and their precursor amino acids in chassis YSG50 was lower than those in W303-1A, indicating less carbon flux was divided into TCA cycle. Furthermore, the levels of TCA intermediates in the taxadiene producing yeasts were lower than those in chassis YSG50. Thus, it may result in more carbon flux in MVA pathway in chassis YSG50, which suggested that YSG50 was more suitable for engineering the taxadiene producing yeast. These results indicated that computer-aided protein modeling directed isoenzyme selection strategy and metabolomic study could guide the rational design of terpenes biosynthetic cells. PMID:25295588

microRNA-449a functions as a tumor suppressor in neuroblastoma through inducing cell differentiation and cell cycle arrest

PubMed Central

Zhao, Zhenze; Ma, Xiuye; Sung, Derek; Li, Monica; Kosti, Adam; Lin, Gregory; Chen, Yidong; Pertsemlidis, Alexander; Hsiao, Tzu-Hung; Du, Liqin

2015-01-01

microRNA-449a (miR-449a) has been identified to function as a tumor suppressor in several types of cancers. However, the role of miR-449a in neuroblastoma has not been intensively investigated. We recently found that the overexpression of miR-449a significantly induces neuroblastoma cell differentiation, suggesting its potential tumor suppressor function in neuroblastoma. In this study, we further investigated the mechanisms underlying the tumor suppressive function of miR-449a in neuroblastoma. We observed that miR-449a inhibits neuroblastoma cell survival and growth through 2 mechanisms—inducing cell differentiation and cell cycle arrest. Our comprehensive investigations on the dissection of the target genes of miR-449a revealed that 3 novel targets- MFAP4, PKP4 and TSEN15 -play important roles in mediating its differentiation-inducing function. In addition, we further found that its function in inducing cell cycle arrest involves down-regulating its direct targets CDK6 and LEF1. To determine the clinical significance of the miR-449a-mediated tumor suppressive mechanism, we examined the correlation between the expression of these 5 target genes in neuroblastoma tumor specimens and the survival of neuroblastoma patients. Remarkably, we noted that high tumor expression levels of all the 3 miR-449a target genes involved in regulating cell differentiation, but not the target genes involved in regulating cell cycle, are significantly correlated with poor survival of neuroblastoma patients. These results suggest the critical role of the differentiation-inducing function of miR-449a in determining neuroblastoma progression. Overall, our study provides the first comprehensive characterization of the tumor-suppressive function of miR-449a in neuroblastoma, and reveals the potential clinical significance of the miR-449a-mediated tumor suppressive pathway in neuroblastoma prognosis. PMID:25760387

Glial dysfunction in abstinent methamphetamine abusers

PubMed Central

Sailasuta, Napapon; Abulseoud, Osama; Harris, Kent C; Ross, Brian D

2010-01-01

Persistent neurochemical abnormalities in frontal brain structures are believed to result from methamphetamine use. We developed a localized 13C magnetic resonance spectroscopy (MRS) assay on a conventional MR scanner, to quantify selectively glial metabolic flux rate in frontal brain of normal subjects and a cohort of recovering abstinent methamphetamine abusers. Steady-state bicarbonate concentrations were similar, between 11 and 15 mmol/L in mixed gray-white matter of frontal brain of normal volunteers and recovering methamphetamine-abusing subjects (P>0.1). However, glial 13C-bicarbonate production rate from [1-13C]acetate, equating with glial tricarboxylic acid (TCA) cycle rate, was significantly reduced in frontal brain of abstinent methamphetamine-addicted women (methamphetamine 0.04 μmol/g per min (N=5) versus controls 0.11 μmol/g per min (N=5), P=0.001). This is equivalent to 36% of the normal glial TCA cycle rate. Severe reduction in glial TCA cycle rate that normally comprises 10% of total cerebral metabolic rate may impact operation of the neuronal glial glutamate cycle and result in accumulation of frontal brain glutamate, as observed in these recovering methamphetamine abusers. Although these are the first studies to define directly an abnormality in glial metabolism in human methamphetamine abuse, sequential studies using analogous 13C MRS methods may determine ‘cause and effect' between glial failure and neuronal injury. PMID:20040926

Metabolic profiles of exercise in patients with McArdle disease or mitochondrial myopathy

PubMed Central

Sharma, Rohit; Tadvalkar, Laura; Clish, Clary B.; Haller, Ronald G.; Mootha, Vamsi K.

2017-01-01

McArdle disease and mitochondrial myopathy impair muscle oxidative phosphorylation (OXPHOS) by distinct mechanisms: the former by restricting oxidative substrate availability caused by blocked glycogen breakdown, the latter because of intrinsic respiratory chain defects. We applied metabolic profiling to systematically interrogate these disorders at rest, when muscle symptoms are typically minimal, and with exercise, when symptoms of premature fatigue and potential muscle injury are unmasked. At rest, patients with mitochondrial disease exhibit elevated lactate and reduced uridine; in McArdle disease purine nucleotide metabolites, including xanthine, hypoxanthine, and inosine are elevated. During exercise, glycolytic intermediates, TCA cycle intermediates, and pantothenate expand dramatically in both mitochondrial disease and control subjects. In contrast, in McArdle disease, these metabolites remain unchanged from rest; but urea cycle intermediates are increased, likely attributable to increased ammonia production as a result of exaggerated purine degradation. Our results establish skeletal muscle glycogen as the source of TCA cycle expansion that normally accompanies exercise and imply that impaired TCA cycle flux is a central mechanism of restricted oxidative capacity in this disorder. Finally, we report that resting levels of long-chain triacylglycerols in mitochondrial myopathy correlate with the severity of OXPHOS dysfunction, as indicated by the level of impaired O2 extraction from arterial blood during peak exercise. Our integrated analysis of exercise and metabolism provides unique insights into the biochemical basis of these muscle oxidative defects, with potential implications for their clinical management. PMID:28716914

Biochar affects soil organic matter cycling and microbial functions but does not alter microbial community structure in a paddy soil.

PubMed

Tian, Jing; Wang, Jingyuan; Dippold, Michaela; Gao, Yang; Blagodatskaya, Evgenia; Kuzyakov, Yakov

2016-06-15

The application of biochar (BC) in conjunction with mineral fertilizers is one of the most promising management practices recommended to improve soil quality. However, the interactive mechanisms of BC and mineral fertilizer addition affecting microbial communities and functions associated with soil organic matter (SOM) cycling are poorly understood. We investigated the SOM in physical and chemical fractions, microbial community structure (using phospholipid fatty acid analysis, PLFA) and functions (by analyzing enzymes involved in C and N cycling and Biolog) in a 6-year field experiment with BC and NPK amendment. BC application increased total soil C and particulate organic C for 47.4-50.4% and 63.7-74.6%, respectively. The effects of BC on the microbial community and C-cycling enzymes were dependent on fertilization. Addition of BC alone did not change the microbial community compared with the control, but altered the microbial community structure in conjunction with NPK fertilization. SOM fractions accounted for 55% of the variance in the PLFA-related microbial community structure. The particulate organic N explained the largest variation in the microbial community structure. Microbial metabolic activity strongly increased after BC addition, particularly the utilization of amino acids and amines due to an increase in the activity of proteolytic (l-leucine aminopeptidase) enzymes. These results indicate that microorganisms start to mine N from the SOM to compensate for high C:N ratios after BC application, which consequently accelerate cycling of stable N. Concluding, BC in combination with NPK fertilizer application strongly affected microbial community composition and functions, which consequently influenced SOM cycling. Copyright © 2016 Elsevier B.V. All rights reserved.

Alveolate mitochondrial metabolic evolution: dinoflagellates force reassessment of the role of parasitism as a driver of change in apicomplexans.

PubMed

Danne, Jillian C; Gornik, Sebastian G; Macrae, James I; McConville, Malcolm J; Waller, Ross F

2013-01-01

Mitochondrial metabolism is central to the supply of ATP and numerous essential metabolites in most eukaryotic cells. Across eukaryotic diversity, however, there is evidence of much adaptation of the function of this organelle according to specific metabolic requirements and/or demands imposed by different environmental niches. This includes substantial loss or retailoring of mitochondrial function in many parasitic groups that occupy potentially nutrient-rich environments in their metazoan hosts. Infrakingdom Alveolata comprises a well-supported alliance of three disparate eukaryotic phyla-dinoflagellates, apicomplexans, and ciliates. These major taxa represent diverse lifestyles of free-living phototrophs, parasites, and predators and offer fertile territory for exploring character evolution in mitochondria. The mitochondria of apicomplexan parasites provide much evidence of loss or change of function from analysis of mitochondrial protein genes. Much less, however, is known of mitochondrial function in their closest relatives, the dinoflagellate algae. In this study, we have developed new models of mitochondrial metabolism in dinoflagellates based on gene predictions and stable isotope labeling experiments. These data show that many changes in mitochondrial gene content previously only known from apicomplexans are found in dinoflagellates also. For example, loss of the pyruvate dehydrogenase complex and changes in tricarboxylic acid (TCA) cycle enzyme complement are shared by both groups and, therefore, represent ancestral character states. Significantly, we show that these changes do not result in loss of typical TCA cycle activity fueled by pyruvate. Thus, dinoflagellate data show that many changes in alveolate mitochondrial metabolism are independent of the major lifestyle changes seen in these lineages and provide a revised view of mitochondria character evolution during evolution of parasitism in apicomplexans.

Integrated analysis of rice transcriptomic and metabolomic responses to elevated night temperatures identifies sensitivity- and tolerance-related profiles.

PubMed

Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen

2017-01-01

Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.

Distinct urine metabolome after Asian ginseng and American ginseng intervention based on GC-MS metabolomics approach

PubMed Central

Yang, Liu; Yu, Qing-Tao; Ge, Ya-Zhong; Zhang, Wen-Song; Fan, Yong; Ma, Chung-Wah; Liu, Qun; Qi, Lian-Wen

2016-01-01

Ginseng occupies a prominent position in the list of best-selling natural products worldwide. Asian ginseng (Panax ginseng) and American ginseng (Panax quinquefolius) show different properties and medicinal applications in pharmacology, even though the main active constituents of them are both thought to be ginsenosides. Metabolomics is a promising method to profile entire endogenous metabolites and monitor their fluctuations related to exogenous stimulus. Herein, an untargeted metabolomics approach was applied to study the overall urine metabolic differences between Asian ginseng and American ginseng in mice. Metabolomics analyses were performed using gas chromatography-mass spectrometry (GC-MS) together with multivariate statistical data analysis. A total of 21 metabolites related to D-glutamine and D-glutamate metabolism, glutathione metabolism, TCA cycle and glyoxylate and dicarboxylate metabolism, differed significantly under the Asian ginseng treatment; 34 metabolites mainly associated with glyoxylate and dicarboxylate metabolism, TCA cycle and taurine and hypotaurine metabolism, were significantly altered after American ginseng treatment. Urinary metabolomics reveal that Asian ginseng and American ginseng can benefit organism physiological and biological functions via regulating multiple metabolic pathways. The important pathways identified from Asian ginseng and American ginseng can also help to explore new therapeutic effects or action targets so as to broad application of these two ginsengs. PMID:27991533

Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate.

PubMed

Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H; Pedersen, Peter L; Goffeau, Andre; Ułaszewski, Stanisław

2016-03-01

In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP.

Quantitative protein expression and cell surface characteristics of Escherichia coli MG1655 biofilms.

PubMed

Mukherjee, Joy; Ow, Saw Yen; Noirel, Josselin; Biggs, Catherine A

2011-02-01

Cell surface physicochemical characterization techniques were combined with quantitative changes in protein expression, to investigate the biological and biophysical changes of Escherichia coli MG1655 cells when grown as a biofilm (BIO). The overall surface charge of BIO cells was found to be less negative, highlighting the need for a lower electrophoretic mobility for attachment to occur. Comparison of the chemical functional groups on the cell surface showed similar profiles, with the absorbance intensity higher for proteins and carbohydrates in the BIO cells. Quantitative proteomic analysis demonstrated that 3 proteins were significantly increased, and 9 proteins significantly decreased in abundance, in cells grown as a BIO compared to their planktonic counterparts, with 7 of these total 12 proteins unique to this study. Proteins showing significant increased or decreased abundance include proteins involved in acid resistance, DNA protection and binding and ABC transporters. Further predictive analysis of the metabolic pathways showed an increased abundance of the amino acid metabolism and tricarboxylic acid (TCA) cycle, with a decrease in expression within the pentose phosphate and glycolysis pathways. It is therefore hypothesized that cells grown as a BIO are still energetically viable potentially using amino acids as an indirect carbon backbone source into the TCA cycle. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Functional electrical stimulation cycling improves body composition, metabolic and neural factors in persons with spinal cord injury.

PubMed

Griffin, L; Decker, M J; Hwang, J Y; Wang, B; Kitchen, K; Ding, Z; Ivy, J L

2009-08-01

Persons with spinal cord injury (SCI) are at a heightened risk of developing type II diabetes and cardiovascular disease. The purpose of this investigation was to conduct an analysis of metabolic, body composition, and neurological factors before and after 10 weeks of functional electrical stimulation (FES) cycling in persons with SCI. Eighteen individuals with SCI received FES cycling 2-3 times per week for 10 weeks. Body composition was analyzed by dual X-ray absorptiometry. The American Spinal Injury Association (ASIA) neurological classification of SCI test battery was used to assess motor and sensory function. An oral glucose tolerance (OGTT) and insulin-response test was performed to assess blood glucose control. Additional metabolic variables including plasma cholesterol (total-C, HDL-C, LDL-C), triglyceride, and inflammatory markers (IL-6, TNF-alpha, and CRP) were also measured. Total FES cycling power and work done increased with training. Lean muscle mass also increased, whereas, bone and adipose mass did not change. The ASIA motor and sensory scores for the lower extremity significantly increased with training. Blood glucose and insulin levels were lower following the OGTT after 10 weeks of training. Triglyceride levels did not change following training. However, levels of IL-6, TNF-alpha, and CRP were all significantly reduced.

Energy-containing beverages: reproductive hormones and ovarian function in the BioCycle Study123

PubMed Central

Schliep, Karen C; Mumford, Sunni L; Pollack, Anna Z; Perkins, Neil J; Ye, Aijun; Zhang, Cuilin J; Stanford, Joseph B; Porucznik, Christina A; Hammoud, Ahmad O; Wactawski-Wende, Jean

2013-01-01

Background: Energy-containing beverages are widely consumed among premenopausal women, but their association with reproductive hormones is not well understood. Objective: The objective was to assess the association of energy-containing beverages, added sugars, and total fructose intake with reproductive hormones among ovulatory cycles and sporadic anovulation in healthy premenopausal women. Design: Women (n = 259) in the BioCycle Study were followed for up to 2 menstrual cycles; they provided fasting blood specimens during up to 8 visits/cycle and four 24-h dietary recalls/cycle. Results: Women who consumed ≥1 cup (1 cup = 237 mL) sweetened soda/d had 16.3% higher estradiol concentrations compared with women who consumed less sweetened soda (86.5 pg/mL compared with 74.4 pg/mL, P = 0.01) after adjustment for age, BMI, race, dietary factors, and physical activity. Similarly elevated estradiol concentrations were found for ≥1 cup cola/d and noncola soda intake. Neither artificially sweetened soda nor fruit juice intake ≥1 cup/d was significantly associated with reproductive hormones. Added sugar above the average US woman's intake (≥73.2 g/d) or above the 66th percentile in total fructose intake (≥41.5 g/d) was associated with significantly elevated estradiol but not consistently across all models. No associations were found between beverages, added sugars, or total fructose intake and anovulation after multivariate adjustment. Conclusions: Even at moderate consumption amounts, sweetened soda is associated with elevated follicular estradiol concentrations among premenopausal women but does not appear to affect ovulatory function. Further research into the mechanism driving the association between energy-containing beverages and reproductive hormones, and its potential implications for women's health, is warranted. PMID:23364018

Annual Cycle of Surface Longwave Radiation

NASA Technical Reports Server (NTRS)

Mlynczak, Pamela E.; Smith, G. Louis; Wilber, Anne C.; Stackhouse, Paul W.

2011-01-01

The annual cycles of upward and downward longwave fluxes at the Earth s surface are investigated by use of the NASA/GEWEX Surface Radiation Budget Data Set. Because of the immense difference between the heat capacity of land and ocean, the surface of Earth is partitioned into these two categories. Principal component analysis is used to quantify the annual cycles. Over land, the first principal component describes over 95% of the variance of the annual cycle of the upward and downward longwave fluxes. Over ocean the first term describes more than 87% of these annual cycles. Empirical orthogonal functions show the corresponding geographical distributions of these cycles. Phase plane diagrams of the annual cycles of upward longwave fluxes as a function of net shortwave flux show the thermal inertia of land and ocean.

Status of Cycle 23 Forecasts

NASA Technical Reports Server (NTRS)

Hathaway, D. H.

2000-01-01

A number of techniques for predicting solar activity on a solar cycle time scale are identified, described, and tested with historical data. Some techniques, e.g,, regression and curve-fitting, work well as solar activity approaches maximum and provide a month- by-month description of future activity, while others, e.g., geomagnetic precursors, work well near solar minimum but provide an estimate only of the amplitude of the cycle. A synthesis of different techniques is shown to provide a more accurate and useful forecast of solar cycle activity levels. A combination of two uncorrelated geomagnetic precursor techniques provides the most accurate prediction for the amplitude of a solar activity cycle at a time well before activity minimum. This precursor method gave a smoothed sunspot number maximum of 154+21 for cycle 23. A mathematical function dependent upon the time of cycle initiation and the cycle amplitude then describes the level of solar activity for the complete cycle. As the time of cycle maximum approaches a better estimate of the cycle activity is obtained by including the fit between recent activity levels and this function. This Combined Solar Cycle Activity Forecast now gives a smoothed sunspot maximum of 140+20 for cycle 23. The success of the geomagnetic precursors in predicting future solar activity suggests that solar magnetic phenomena at latitudes above the sunspot activity belts are linked to solar activity, which occurs many years later in the lower latitudes.

Oxaloacetate Ameliorates Chemical Liver Injury via Oxidative Stress Reduction and Enhancement of Bioenergetic Fluxes.

PubMed

Kuang, Ye; Han, Xiaoyun; Xu, Mu; Wang, Yue; Zhao, Yuxiang; Yang, Qing

2018-05-31

Chemical injury is partly due to free radical lipid peroxidation, which can induce oxidative stress and produce a large number of reactive oxygen species (ROS). Oxaloacetic acid is an important intermediary in the tricarboxylic acid cycle (TCA cycle) and participates in metabolism and energy production. In our study, we found that oxaloacetate (OA) effectively alleviated liver injury which was induced by hydrogen peroxide (H₂O₂) in vitro and carbon tetrachloride (CCl₄) in vivo. OA scavenged ROS, prevented oxidative damage and maintained the normal structure of mitochondria. We further confirmed that OA increased adenosine triphosphate (ATP) by promoting the TCA production cycle and oxidative phosphorylation (OXPHOS). Finally, OA inhibited the mitogen-activated protein kinase (MAPK) and apoptotic pathways by suppressing tumor necrosis factor-α (TNF-α). Our findings reveal a mechanism for OA ameliorating chemical liver injury and suggest a possible implementation for preventing the chemical liver injury.

The glutathione cycle: Glutathione metabolism beyond the γ-glutamyl cycle.

PubMed

Bachhawat, Anand Kumar; Yadav, Shambhu

2018-04-17

Glutathione was discovered in 1888, over 125 years ago. Since then, our understanding of various functions and metabolism of this important molecule has grown over these years. But it is only now, in the last decade, that a somewhat complete picture of its metabolism has emerged. Glutathione metabolism has till now been largely depicted and understood by the γ-glutamyl cycle that was proposed in 1970. However, new findings and knowledge particularly on the transport and degradation of glutathione have revealed that many aspects of the γ-glutamyl cycle are incorrect. Despite this, an integrated critical analysis of the cycle has never been undertaken and this has led to the cycle and its errors perpetuating in the literature. This review takes a careful look at the γ-glutamyl cycle and its shortcomings and presents a "glutathione cycle" that captures the current understanding of glutathione metabolism. © 2018 IUBMB Life, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

Metabolic profiling indicates impaired pyruvate dehydrogenase function in myalgic encephalopathy/chronic fatigue syndrome

PubMed Central

Mella, Olav; Bruland, Ove; Risa, Kristin; Dyrstad, Sissel E.; Alme, Kine; Rekeland, Ingrid G.; Sapkota, Dipak; Røsland, Gro V.; Fosså, Alexander; Ktoridou-Valen, Irini; Lunde, Sigrid; Sørland, Kari; Lien, Katarina; Herder, Ingrid; Thürmer, Hanne; Gotaas, Merete E.; Baranowska, Katarzyna A.; Bohnen, Louis M.L.J.; Schäfer, Christoph; McCann, Adrian; Sommerfelt, Kristian; Helgeland, Lars; Ueland, Per M.; Dahl, Olav

2016-01-01

Myalgic encephalopathy/chronic fatigue syndrome (ME/CFS) is a debilitating disease of unknown etiology, with hallmark symptoms including postexertional malaise and poor recovery. Metabolic dysfunction is a plausible contributing factor. We hypothesized that changes in serum amino acids may disclose specific defects in energy metabolism in ME/CFS. Analysis in 200 ME/CFS patients and 102 healthy individuals showed a specific reduction of amino acids that fuel oxidative metabolism via the TCA cycle, mainly in female ME/CFS patients. Serum 3-methylhistidine, a marker of endogenous protein catabolism, was significantly increased in male patients. The amino acid pattern suggested functional impairment of pyruvate dehydrogenase (PDH), supported by increased mRNA expression of the inhibitory PDH kinases 1, 2, and 4; sirtuin 4; and PPARδ in peripheral blood mononuclear cells from both sexes. Myoblasts grown in presence of serum from patients with severe ME/CFS showed metabolic adaptations, including increased mitochondrial respiration and excessive lactate secretion. The amino acid changes could not be explained by symptom severity, disease duration, age, BMI, or physical activity level among patients. These findings are in agreement with the clinical disease presentation of ME/CFS, with inadequate ATP generation by oxidative phosphorylation and excessive lactate generation upon exertion. PMID:28018972

Menstrual cycle phase modulates reward-related neural function in women.

PubMed

Dreher, Jean-Claude; Schmidt, Peter J; Kohn, Philip; Furman, Daniella; Rubinow, David; Berman, Karen Faith

2007-02-13

There is considerable evidence from animal studies that the mesolimbic and mesocortical dopamine systems are sensitive to circulating gonadal steroid hormones. Less is known about the influence of estrogen and progesterone on the human reward system. To investigate this directly, we used functional MRI and an event-related monetary reward paradigm to study women with a repeated-measures, counterbalanced design across the menstrual cycle. Here we show that during the midfollicular phase (days 4-8 after onset of menses) women anticipating uncertain rewards activated the orbitofrontal cortex and amygdala more than during the luteal phase (6-10 days after luteinizing hormone surge). At the time of reward delivery, women in the follicular phase activated the midbrain, striatum, and left fronto-polar cortex more than during the luteal phase. These data demonstrate augmented reactivity of the reward system in women during the midfollicular phase when estrogen is unopposed by progesterone. Moreover, investigation of between-sex differences revealed that men activated ventral putamen more than women during anticipation of uncertain rewards, whereas women more strongly activated the anterior medial prefrontal cortex at the time of reward delivery. Correlation between brain activity and gonadal steroid levels also revealed that the amygdalo-hippocampal complex was positively correlated with estradiol level, regardless of menstrual cycle phase. Together, our findings provide evidence of neurofunctional modulation of the reward system by gonadal steroid hormones in humans and establish a neurobiological foundation for understanding their impact on vulnerability to drug abuse, neuropsychiatric diseases with differential expression across males and females, and hormonally mediated mood disorders.

Small-molecule kinase inhibitors provide insight into Mps1 cell cycle function.

PubMed

Kwiatkowski, Nicholas; Jelluma, Nannette; Filippakopoulos, Panagis; Soundararajan, Meera; Manak, Michael S; Kwon, Mijung; Choi, Hwan Geun; Sim, Taebo; Deveraux, Quinn L; Rottmann, Sabine; Pellman, David; Shah, Jagesh V; Kops, Geert J P L; Knapp, Stefan; Gray, Nathanael S

2010-05-01

Mps1, a dual-specificity kinase, is required for the proper functioning of the spindle assembly checkpoint and for the maintenance of chromosomal stability. As Mps1 function has been implicated in numerous phases of the cell cycle, the development of a potent, selective small-molecule inhibitor of Mps1 should facilitate dissection of Mps1-related biology. We describe the cellular effects and Mps1 cocrystal structures of new, selective small-molecule inhibitors of Mps1. Consistent with RNAi studies, chemical inhibition of Mps1 leads to defects in Mad1 and Mad2 establishment at unattached kinetochores, decreased Aurora B kinase activity, premature mitotic exit and gross aneuploidy, without any evidence of centrosome duplication defects. However, in U2OS cells having extra centrosomes (an abnormality found in some cancers), Mps1 inhibition increases the frequency of multipolar mitoses. Lastly, Mps1 inhibitor treatment resulted in a decrease in cancer cell viability.

PIK3CA mutant tumors depend on oxoglutarate dehydrogenase | Office of Cancer Genomics

Cancer.gov

Oncogenic PIK3CA mutations are found in a significant fraction of human cancers, but therapeutic inhibition of PI3K has only shown limited success in clinical trials. To understand how mutant PIK3CA contributes to cancer cell proliferation, we used genome scale loss-of-function screening in a large number of genomically annotated cancer cell lines. As expected, we found that PIK3CA mutant cancer cells require PIK3CA but also require the expression of the TCA cycle enzyme 2-oxoglutarate dehydrogenase (OGDH).

Nucleosome architecture throughout the cell cycle

PubMed Central

Deniz, Özgen; Flores, Oscar; Aldea, Martí; Soler-López, Montserrat; Orozco, Modesto

2016-01-01

Nucleosomes provide additional regulatory mechanisms to transcription and DNA replication by mediating the access of proteins to DNA. During the cell cycle chromatin undergoes several conformational changes, however the functional significance of these changes to cellular processes are largely unexplored. Here, we present the first comprehensive genome-wide study of nucleosome plasticity at single base-pair resolution along the cell cycle in Saccharomyces cerevisiae. We determined nucleosome organization with a specific focus on two regulatory regions: transcription start sites (TSSs) and replication origins (ORIs). During the cell cycle, nucleosomes around TSSs display rearrangements in a cyclic manner. In contrast to gap (G1 and G2) phases, nucleosomes have a fuzzier organization during S and M phases, Moreover, the choreography of nucleosome rearrangements correlate with changes in gene expression during the cell cycle, indicating a strong association between nucleosomes and cell cycle-dependent gene functionality. On the other hand, nucleosomes are more dynamic around ORIs along the cell cycle, albeit with tighter regulation in early firing origins, implying the functional role of nucleosomes on replication origins. Our study provides a dynamic picture of nucleosome organization throughout the cell cycle and highlights the subsequent impact on transcription and replication activity. PMID:26818620

Glutamine fuels a vicious cycle of autophagy in the tumor stroma and oxidative mitochondrial metabolism in epithelial cancer cells

PubMed Central

Ko, Ying-Hui; Lin, Zhao; Flomenberg, Neal; Pestell, Richard G; Howell, Anthony; Sotgia, Federica

2011-01-01

Glutamine metabolism is crucial for cancer cell growth via the generation of intermediate molecules in the tricarboxylic acid (TCA) cycle, antioxidants and ammonia. The goal of the current study was to evaluate the effects of glutamine on metabolism in the breast cancer tumor microenvironment, with a focus on autophagy and cell death in both epithelial and stromal compartments. For this purpose, MCF7 breast cancer cells were cultured alone or co-cultured with nontransformed fibroblasts in media containing high glutamine and low glucose (glutamine +) or under control conditions, with no glutamine and high glucose (glutamine −). Here, we show that MCF7 cells maintained in co-culture with glutamine display increased mitochondrial mass, as compared with control conditions. Importantly, treatment with the autophagy inhibitor chloroquine abolishes the glutamine-induced augmentation of mitochondrial mass. It is known that loss of caveolin-1 (Cav-1) expression in fibroblasts is associated with increased autophagy and an aggressive tumor microenvironment. Here, we show that Cav-1 downregulation which occurs in fibroblasts maintained in co-culture specifically requires glutamine. Interestingly, glutamine increases the expression of autophagy markers in fibroblasts, but decreases expression of autophagy markers in MCF7 cells, indicating that glutamine regulates the autophagy program in a compartment-specific manner. Functionally, glutamine protects MCF7 cells against apoptosis, via the upregulation of the anti-apoptotic and anti-autophagic protein TIGAR. Also, we show that glutamine cooperates with stromal fibroblasts to confer tamoxifen-resistance in MCF7 cancer cells. Finally, we provide evidence that co-culture with fibroblasts (1) promotes glutamine catabolism, and (2) decreases glutamine synthesis in MCF7 cancer cells. Taken together, our findings suggest that autophagic fibroblasts may serve as a key source of energy-rich glutamine to fuel cancer cell mitochondrial

Cycling transport safety quantification

NASA Astrophysics Data System (ADS)

Drbohlav, Jiri; Kocourek, Josef

2018-05-01

Dynamic interest in cycling transport brings the necessity to design safety cycling infrastructure. In las few years, couple of norms with safety elements have been designed and suggested for the cycling infrastructure. But these were not fully examined. The main parameter of suitable and fully functional transport infrastructure is the evaluation of its safety. Common evaluation of transport infrastructure safety is based on accident statistics. These statistics are suitable for motor vehicle transport but unsuitable for the cycling transport. Cycling infrastructure evaluation of safety is suitable for the traffic conflicts monitoring. The results of this method are fast, based on real traffic situations and can be applied on any traffic situations.

Ganoderma lucidum ameliorate mitochondrial damage in isoproterenol-induced myocardial infarction in rats by enhancing the activities of TCA cycle enzymes and respiratory chain complexes.

PubMed

Sudheesh, N P; Ajith, T A; Janardhanan, K K

2013-04-30

Decreased mitochondrial function has been suggested to be one of the important pathological events in isoproterenol (ISO)-induced cardiotoxicity. In this communication, we have evaluated the protective effect of Ganoderma lucidum against ISO induced cardiac toxicity and mitochondrial dysfunction. Cardiac toxicity was assessed by determining the activities of creatine kinase (CK) and lactate dehydrogenases (LDH) after subcutaneous injection of ISO (85 mg/kg) at an interval of 24h for 2 days. The animals were sacrificed 24h after last ISO administration. G. lucidum (100 and 250 mg/kg, p.o.) was given to the rats once daily for 15 days prior to the ISO challenge. Similarly, α-Tocopherol (100mg/kg, p.o) was kept as the standard. To assess the extent of cardiac mitochondrial damage, the activities of Krebs cycle dehydrogenases and mitochondrial complexes I, II, III, and IV as well as the level of ROS and mitochondrial membrane potential (ΔΨmt) were evaluated. Administration of G. lucidum and α-tocopherol significantly protected the elevated activities of CK and LDH. Further, the activities of mitochondrial enzymes and the level of ΔΨmt were significantly enhanced and the level of ROS was significantly declined in the G. lucidum and α-tocopherol treatments. The present study concluded that the cardiac mitochondrial enzymes are markedly declined by the ISO challenge and the administration G. lucidum and α-Tocopherol significantly protected mitochondria by preventing the decline of antioxidant status and ΔΨmt or by directly scavenging the free radicals. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Functions and substrates of NEDDylation during cell cycle in the silkworm, Bombyx mori.

PubMed

Li, Zhiqing; Cui, Qixin; Wang, Xiaoyan; Li, Bingqian; Zhao, Dongchao; Xia, Qingyou; Zhao, Ping

2017-11-01

NEDDylation, a post-translational modification mediated by the conjugation of the ubiquitin-like protein Nedd8 to specific substrates, is an essential biological process that regulates cell cycle progression in eukaryotes. Here, we report the conservation of NEDDylation machinery and NEDDylated proteins in the silkworm, Bombyx mori. We have identified all the components necessary for reversible NEDDylation in the silkworm including Nedd8, E1, E2, E3, and deNEDDylation enzymes. By the approach of RNAi-mediated gene silencing, it was shown that knockdown of BmNedd8 and the conjugating enzymes decreased the global level of NEDDylation, while knockdown of deNEDDylation enzymes increased the prevalence of this modification in cultured silkworm cells. Moreover, the lack of the NEDDylation system caused cell cycle arrest at the G2/M phase and resulted in defects in chromosome congression and segregation. Using the wild-type and mutants of BmNedd8, we identified the specific substrates of BmNedd8, which are involved in the regulation for many cellular processes, including ribosome biogenesis, spliceosome structure, spindle formation, metabolism, and RNA biogenesis. This clearly demonstrates that the NEDDylation system is able to control multiple pathways in the silkworm. Altogether, the information on the functions and substrates of the NEDDylation system presented here could provide a basis for future investigations of protein NEDDylation and its regulatory mechanism on cell cycle progression in the silkworm. Copyright © 2017. Published by Elsevier Ltd.

A diet rich in high-glucoraphanin broccoli interacts with genotype to reduce discordance in plasma metabolite profiles by modulating mitochondrial function123

PubMed Central

Armah, Charlotte N; Traka, Maria H; Dainty, Jack R; Defernez, Marianne; Janssens, Astrid; Leung, Wing; Doleman, Joanne F; Potter, John F

2013-01-01

Background: Observational and experimental studies suggest that diets rich in cruciferous vegetables and glucosinolates may reduce the risk of cancer and cardiovascular disease (CVD). Objective: We tested the hypothesis that a 12-wk dietary intervention with high-glucoraphanin (HG) broccoli would modify biomarkers of CVD risk and plasma metabolite profiles to a greater extent than interventions with standard broccoli or peas. Design: Subjects were randomly assigned to consume 400 g standard broccoli, 400 g HG broccoli, or 400 g peas each week for 12 wk, with no other dietary restrictions. Biomarkers of CVD risk and 347 plasma metabolites were quantified before and after the intervention. Results: No significant differences in the effects of the diets on biomarkers of CVD risk were found. Multivariate analyses of plasma metabolites identified 2 discrete phenotypic responses to diet in individuals within the HG broccoli arm, differentiated by single nucleotide polymorphisms associated with the PAPOLG gene. Univariate analysis showed effects of sex (P < 0.001), PAPOLG genotype (P < 0.001), and PAPOLG genotype × diet (P < 0.001) on the plasma metabolic profile. In the HG broccoli arm, the consequence of the intervention was to reduce variation in lipid and amino acid metabolites, tricarboxylic acid (TCA) cycle intermediates, and acylcarnitines between the 2 PAPOLG genotypes. Conclusions: The metabolic changes observed with the HG broccoli diet are consistent with a rebalancing of anaplerotic and cataplerotic reactions and enhanced integration of fatty acid β-oxidation with TCA cycle activity. These modifications may contribute to the reduction in cancer risk associated with diets that are rich in cruciferous vegetables. This trial was registered at clinicaltrials.gov as NCT01114399. PMID:23964055

Inhibitors of the alpha-ketoglutarate dehydrogenase complex alter [1-13C]glucose and [U-13C]glutamate metabolism in cerebellar granule neurons.

PubMed

Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula

2006-02-15

Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.

Protein-bound NAD(P)H Lifetime is Sensitive to Multiple Fates of Glucose Carbon.

PubMed

Sharick, Joe T; Favreau, Peter F; Gillette, Amani A; Sdao, Sophia M; Merrins, Matthew J; Skala, Melissa C

2018-04-03

While NAD(P)H fluorescence lifetime imaging (FLIM) can detect changes in flux through the TCA cycle and electron transport chain (ETC), it remains unclear whether NAD(P)H FLIM is sensitive to other potential fates of glucose. Glucose carbon can be diverted from mitochondria by the pentose phosphate pathway (via glucose 6-phosphate dehydrogenase, G6PDH), lactate production (via lactate dehydrogenase, LDH), and rejection of carbon from the TCA cycle (via pyruvate dehydrogenase kinase, PDK), all of which can be upregulated in cancer cells. Here, we demonstrate that multiphoton NAD(P)H FLIM can be used to quantify the relative concentrations of recombinant LDH and malate dehydrogenase (MDH) in solution. In multiple epithelial cell lines, NAD(P)H FLIM was also sensitive to inhibition of LDH and PDK, as well as the directionality of LDH in cells forced to use pyruvate versus lactate as fuel sources. Among the parameters measurable by FLIM, only the lifetime of protein-bound NAD(P)H (τ 2 ) was sensitive to these changes, in contrast to the optical redox ratio, mean NAD(P)H lifetime, free NAD(P)H lifetime, or the relative amount of free and protein-bound NAD(P)H. NAD(P)H τ 2 offers the ability to non-invasively quantify diversions of carbon away from the TCA cycle/ETC, which may support mechanisms of drug resistance.

Cardiorespiratory demand of acute voluntary cycling with functional electrical stimulation in individuals with multiple sclerosis with severe mobility impairment.

PubMed

Edwards, Thomas; Motl, Robert W; Pilutti, Lara A

2018-01-01

Exercise training is one strategy for improving cardiorespiratory fitness (CRF) in multiple sclerosis (MS); however, few modalities are accessible for those with severe mobility impairment. Functional electrical stimulation (FES) cycling is an adapted exercise modality with the potential for improving CRF in people with severe MS. The objective of this study was to characterize the cardiorespiratory response of acute voluntary cycling with FES in people with MS with severe mobility impairment, and to compare this response to passive leg cycling. Eleven participants with MS that required assistance for ambulation completed a single bout of voluntary cycling with FES or passive leg cycling. Oxygen consumption, heart rate (HR), work rate (WR), and ratings of perceived exertion (RPE) were recorded throughout the session. For the FES group, mean exercising oxygen consumption was 8.7 ± 1.8 mL/(kg·min) -1 , or 63.5% of peak oxygen consumption. Mean HR was 102 ± 9.7 bpm, approximately 76.4% of peak HR. Mean WR was 27.0 ± 9.2 W, or 57.3% of peak WR, and median RPE was 13.5 (interquartile range = 5.5). Active cycling with FES was significantly (p < 0.05) more intense than passive leg cycling based on oxygen consumption, HR, WR, and RPE during exercise. In conclusion, voluntary cycling with FES elicited an acute response that corresponded with moderate-to vigorous-intensity activity, suggesting that active cycling with FES can elicit a sufficient stimulus for improving CRF.

Triheptanoin Protects Motor Neurons and Delays the Onset of Motor Symptoms in a Mouse Model of Amyotrophic Lateral Sclerosis

PubMed Central

Barkl-Luke, Mallory E.; Ngo, Shyuan T.; Thomas, Nicola K.; McDonald, Tanya S.; Borges, Karin

2016-01-01

There is increasing evidence that energy metabolism is disturbed in Amyotrophic Lateral Sclerosis (ALS) patients and animal models. Treatment with triheptanoin, the triglyceride of heptanoate, is a promising approach to provide alternative fuel to improve oxidative phosphorylation and aid ATP generation. Heptanoate can be metabolized to propionyl-CoA, which after carboxylation can produce succinyl-CoA and thereby re-fill the tricarboxylic acid (TCA) cycle (anaplerosis). Here we tested the hypothesis that treatment with triheptanoin prevents motor neuron loss and delays the onset of disease symptoms in female mice overexpressing the mutant human SOD1G93A (hSOD1G93A) gene. When oral triheptanoin (35% of caloric content) was initiated at P35, motor neuron loss at 70 days of age was attenuated by 33%. In untreated hSOD1G93A mice, the loss of hind limb grip strength began at 16.7 weeks. Triheptanoin maintained hind limb grip strength for 2.8 weeks longer (p<0.01). Loss of balance on the rotarod and reduction of body weight were delayed by 13 and 11 days respectively (both p<0.01). Improved motor function occurred in parallel with alterations in the expression of genes associated with muscle metabolism. In gastrocnemius muscles, the mRNA levels of pyruvate, 2-oxoglutarate and succinate dehydrogenases and methyl-malonyl mutase were reduced by 24–33% in 10 week old hSOD1G93A mice when compared to wild-type mice, suggesting that TCA cycling in skeletal muscle may be slowed in this ALS mouse model at a stage when muscle strength is still normal. At 25 weeks of age, mRNA levels of succinate dehydrogenases, glutamic pyruvic transaminase 2 and the propionyl carboxylase β subunit were reduced by 69–84% in control, but not in triheptanoin treated hSOD1G93A animals. Taken together, our results suggest that triheptanoin slows motor neuron loss and the onset of motor symptoms in ALS mice by improving TCA cycling. PMID:27564703

Impaired hippocampal glucose metabolism during and after flurothyl-induced seizures in mice: Reduced phosphorylation coincides with reduced activity of pyruvate dehydrogenase.

PubMed

McDonald, Tanya S; Borges, Karin

2017-07-01

To determine changes in glucose metabolism and the enzymes involved in the hippocampus ictally and postictally in the acute mouse flurothyl seizure model. [U- 13 C]-Glucose was injected (i.p.) prior to, or following a 5 min flurothyl-induced seizure. Fifteen minutes later, mice were killed and the total metabolite levels and % 13 C enrichment were analyzed in the hippocampal formation using gas chromatography-mass spectrometry. Activities of key metabolic and antioxidant enzymes and the phosphorylation status of pyruvate dehydrogenase were measured, along with lipid peroxidation. During seizures, total lactate levels increased 1.7-fold; however, [M + 3] enrichment of both lactate and alanine were reduced by 30% and 43%, respectively, along with a 28% decrease in phosphofructokinase activity. Postictally the % 13 C enrichments of all measured tricarboxylic acid (TCA) cycle intermediates and the amino acids were reduced by 46-93%. At this time, pyruvate dehydrogenase (PDH) activity was 56% of that measured in controls, and there was a 1.9-fold increase in the phosphorylation of PDH at ser232. Phosphorylation of PDH is known to decrease its activity. Here, we show that the increase of lactate levels during flurothyl seizures is from a source other than [U- 13 C]-glucose, such as glycogen. Surprisingly, although we saw a reduction in phosphofructokinase activity during the seizure, metabolism of [U- 13 C]-glucose into the TCA cycle seemed unaffected. Similar to our recent findings in the chronic phase of the pilocarpine model, postictally the metabolism of glucose by glycolysis and the TCA cycle was impaired along with reduced PDH activity. Although this decrease in activity may be a protective mechanism to reduce oxidative stress, which is observed in the flurothyl model, ATP is critical to the recovery of ion and neurotransmitter balance and return to normal brain function. Thus we identified promising novel strategies to enhance energy metabolism and recovery from

New structural and functional defects in polyphosphate deficient bacteria: a cellular and proteomic study.

PubMed

Varela, Cristian; Mauriaca, Cecilia; Paradela, Alberto; Albar, Juan P; Jerez, Carlos A; Chávez, Francisco P

2010-01-12

Inorganic polyphosphate (polyP), a polymer of tens or hundreds of phosphate residues linked by ATP-like bonds, is found in all organisms and performs a wide variety of functions. PolyP is synthesized in bacterial cells by the actions of polyphosphate kinases (PPK1 and PPK2) and degraded by exopolyphosphatase (PPX). Bacterial cells with polyP deficiencies due to knocking out the ppk1 gene are affected in many structural and important cellular functions such as motility, quorum sensing, biofilm formation and virulence among others. The cause of this pleiotropy is not entirely understood. The overexpression of exopolyphosphatase in bacteria mimicked some pleitropic defects found in ppk1 mutants. By using this approach we found new structural and functional defects in the polyP-accumulating bacteria Pseudomonas sp. B4, which are most likely due to differences in the polyP-removal strategy. Colony morphology phenotype, lipopolysaccharide (LPS) structure changes and cellular division malfunction were observed. Finally, we used comparative proteomics in order to elucidate the cellular adjustments that occurred during polyP deficiency in this bacterium and found some clues that helped to understand the structural and functional defects observed. The results obtained suggest that during polyP deficiency energy metabolism and particularly nucleoside triphosphate (NTP) formation were affected and that bacterial cells overcame this problem by increasing the flux of energy-generating metabolic pathways such as tricarboxilic acid (TCA) cycle, beta-oxidation and oxidative phosphorylation and by reducing energy-consuming ones such as active transporters and amino acid biosynthesis. Furthermore, our results suggest that a general stress response also took place in the cell during polyP deficiency.

Differences in Retinal Structure and Function between Aging Male and Female Sprague-Dawley Rats are Strongly Influenced by the Estrus Cycle

PubMed Central

Chaychi, Samaneh; Polosa, Anna; Lachapelle, Pierre

2015-01-01

Purpose Biological sex and age are considered as two important factors that may influence the function and structure of the retina, an effect that might be governed by sexual hormones such as estrogen. The purpose of this study was to delineate the influence that biological sex and age exert on the retinal function and structure of rodents and also clarify the effect that the estrus cycle might exert on the retinal function of female rats. Method The retinal function of 50 normal male and female albino Sprague-Dawley (SD) rats was investigated with the electroretinogram (ERG) at postnatal day (P) 30, 60, 100, 200, and 300 (n = 5–6 male and female rats/age). Following the ERG recording sessions, retinal histology was performed in both sexes. In parallel, the retinal function of premenopausal and menopausal female rats aged P540 were also compared. Results Sex and age-related changes in retinal structure and function were observed in our animal model. However, irrespective of age, no significant difference was observed in ERG and retinal histology obtained from male and female rats. Notwithstanding the above we did however notice that between P60 and P200 there was a gradual increase in ERG amplitudes of female rats compared to males. Furthermore, the ERG of premenopausal female rats aged 18 months old (P540) was larger compared to age-matched menopausal female rats as well as that of male rats. Conclusion Our results showed that biological sex and age can influence the retinal function and structure of albino SD rats. Furthermore, we showed that cycled female rats have better retinal function compared to the menopausal female rats suggesting a beneficial effect of the estrus cycle on the retinal function. PMID:26317201

The role of surface chemical analysis in a study to select replacement processes for TCA vapor degreasing

NASA Technical Reports Server (NTRS)

Lesley, Michael W.; Davis, Lawrence E.; Moulder, John F.; Carlson, Brad A.

1995-01-01

The role of surface-sensitive chemical analysis (ESCA, AES, and SIMS) in a study to select a process to replace 1, 1, 1-trichloroethane (TCA) vapor degreasing as a steel and aluminum bonding surface preparation method is described. The effort was primarily concerned with spray-in-air cleaning processes involving aqueous alkaline and semi-aqueous cleaners and a contamination sensitive epoxy-to-metal bondline. While all five cleaners tested produced bonding strength results equal to or better than those produced by vapor degreasing, the aqueous alkaline cleaners yielded results which were superior to those produced by the semi-aqueous cleaners. The main reason for the enhanced performance appears to be a silicate layer left behind by the aqueous alkaline cleaners. The silicate layer increases the polarity of the surface and enhances epoxy-to-metal bonding. On the other hand, one of the semi-aqueous cleaners left a nonpolar carbonaceous residue which appeared to have a negative effect on epoxy-to-metal bonding. Differences in cleaning efficiency between cleaners/processes were also identified. These differences in surface chemistry, which were sufficient to affect bonding, were not detected by conventional chemical analysis techniques.

Chemolithoautotrophy and its Relation to Magnetism and Biomineralization in Marine Magnetotactic Bacteria

NASA Astrophysics Data System (ADS)

Bazylinski, D. A.; Williams, T. J.; Zhang, C. L.; Scott, J. H.

2005-12-01

All cultured, marine, magnetite-producing, magnetotactic bacteria (MB) are capable of chemolithoautotrophy and use a number of electron donors to support this mode of growth including reduced sulfur compounds. Several vibrioid strains are known to rely on the Calvin-Benson-Bassham (CBB) cycle for autotrophy. An obligately microaerophilic, magnetite-producing, coccoid strain (MC-1) grew with sulfide and thiosulfate as electron donors and 14C-labelling experiments showed that virtually all cell C was derived from H14CO3-/14CO2 confirming autotrophy in this strain. Cell-free extracts of strain MC-1 did not exhibit ribulose-1,5-bisphosphate carboxylase-oxygenase (RubisCO) activity and nor were RubisCO genes found in the draft genome of the organism. Cell extracts also did not exhibit carbon monoxide dehydrogenase activity indicating that the acetyl-CoA pathway also does not function in strain MC-1. The 13C content of whole cells of strain MC-1 relative to the 13C content of the H14CO3-/14CO2 used for growth (Δδ13C) was -11.4 ppt. Cellular fatty acids showed enrichment of 13C relative to biomass. Activities for three key enzymes of the reverse or reductive tricarboxylic acid (rTCA) cycle were demonstrated for MC-1: fumarate reductase, pyruvate: acceptor oxidoreductase and 2-oxoglutarate: acceptor oxidoreductase. Although ATP citrate lyase (another key enzyme of the rTCA cycle) activity was not detected in cell-free extracts of strain MC-1 using commonly used assays for this enzyme, cell-free extract was found to rapidly cleave citrate, and the reaction was dependent upon the presence of ATP, coenzyme A and NADH. Thus, we infer the presence of an ATP-dependent citrate-cleaving enzyme or enzymes. The Δδ13C value and results from enzyme studies are consistent with the operation of the rTCA cycle for autotrophy in strain MC-1. Strain MC-1 appears to be the first known member of the alpha-Proteobacteria to assimilate CO2 during autotrophic growth using the rTCA cycle

Absence of Complex I Is Associated with Diminished Respiratory Chain Function in European Mistletoe.

PubMed

Maclean, Andrew E; Hertle, Alexander P; Ligas, Joanna; Bock, Ralph; Balk, Janneke; Meyer, Etienne H

2018-05-21

Parasitism is a life history strategy found across all domains of life whereby nutrition is obtained from a host. It is often associated with reductive evolution of the genome, including loss of genes from the organellar genomes [1, 2]. In some unicellular parasites, the mitochondrial genome (mitogenome) has been lost entirely, with far-reaching consequences for the physiology of the organism [3, 4]. Recently, mitogenome sequences of several species of the hemiparasitic plant mistletoe (Viscum sp.) have been reported [5, 6], revealing a striking loss of genes not seen in any other multicellular eukaryotes. In particular, the nad genes encoding subunits of respiratory complex I are all absent and other protein-coding genes are also lost or highly diverged in sequence, raising the question what remains of the respiratory complexes and mitochondrial functions. Here we show that oxidative phosphorylation (OXPHOS) in European mistletoe, Viscum album, is highly diminished. Complex I activity and protein subunits of complex I could not be detected. The levels of complex IV and ATP synthase were at least 5-fold lower than in the non-parasitic model plant Arabidopsis thaliana, whereas alternative dehydrogenases and oxidases were higher in abundance. Carbon flux analysis indicates that cytosolic reactions including glycolysis are greater contributors to ATP synthesis than the mitochondrial tricarboxylic acid (TCA) cycle. Our results describe the extreme adjustments in mitochondrial functions of the first reported multicellular eukaryote without complex I. Copyright © 2018 Elsevier Ltd. All rights reserved.

Organic Acids: The Pools of Fixed Carbon Involved in Redox Regulation and Energy Balance in Higher Plants

PubMed Central

Igamberdiev, Abir U.; Eprintsev, Alexander T.

2016-01-01

Organic acids are synthesized in plants as a result of the incomplete oxidation of photosynthetic products and represent the stored pools of fixed carbon accumulated due to different transient times of conversion of carbon compounds in metabolic pathways. When redox level in the cell increases, e.g., in conditions of active photosynthesis, the tricarboxylic acid (TCA) cycle in mitochondria is transformed to a partial cycle supplying citrate for the synthesis of 2-oxoglutarate and glutamate (citrate valve), while malate is accumulated and participates in the redox balance in different cell compartments (via malate valve). This results in malate and citrate frequently being the most accumulated acids in plants. However, the intensity of reactions linked to the conversion of these compounds can cause preferential accumulation of other organic acids, e.g., fumarate or isocitrate, in higher concentrations than malate and citrate. The secondary reactions, associated with the central metabolic pathways, in particularly with the TCA cycle, result in accumulation of other organic acids that are derived from the intermediates of the cycle. They form the additional pools of fixed carbon and stabilize the TCA cycle. Trans-aconitate is formed from citrate or cis-aconitate, accumulation of hydroxycitrate can be linked to metabolism of 2-oxoglutarate, while 4-hydroxy-2-oxoglutarate can be formed from pyruvate and glyoxylate. Glyoxylate, a product of either glycolate oxidase or isocitrate lyase, can be converted to oxalate. Malonate is accumulated at high concentrations in legume plants. Organic acids play a role in plants in providing redox equilibrium, supporting ionic gradients on membranes, and acidification of the extracellular medium. PMID:27471516

The metabolic role of isoleucine in detoxification of ammonia in cultured mouse neurons and astrocytes.

PubMed

Johansen, Maja L; Bak, Lasse K; Schousboe, Arne; Iversen, Peter; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Gjedde, Albert; Ott, Peter; Waagepetersen, Helle S

2007-06-01

Cerebral hyperammonemia is a hallmark of hepatic encephalopathy, a debilitating condition arising secondary to liver disease. Pyruvate oxidation including tricarboxylic acid (TCA) cycle metabolism has been suggested to be inhibited by hyperammonemia at the pyruvate and alpha-ketoglutarate dehydrogenase steps. Catabolism of the branched-chain amino acid isoleucine provides both acetyl-CoA and succinyl-CoA, thus by-passing both the pyruvate dehydrogenase and the alpha-ketoglutarate dehydrogenase steps. Potentially, this will enable the TCA cycle to work in the face of ammonium-induced inhibition. In addition, this will provide the alpha-ketoglutarate carbon skeleton for glutamate and glutamine synthesis by glutamate dehydrogenase and glutamine synthetase (astrocytes only), respectively, both reactions fixing ammonium. Cultured cerebellar neurons (primarily glutamatergic) or astrocytes were incubated in the presence of either [U-13C]glucose (2.5 mM) and isoleucine (1 mM) or [U-13C]isoleucine and glucose. Cell cultures were treated with an acute ammonium chloride load of 2 (astrocytes) or 5 mM (neurons and astrocytes) and incorporation of 13C-label into glutamate, aspartate, glutamine and alanine was determined employing mass spectrometry. Labeling from [U-13C]glucose in glutamate and aspartate increased as a result of ammonium-treatment in both neurons and astrocytes, suggesting that the TCA cycle was not inhibited. Labeling in alanine increased in neurons but not in astrocytes, indicating elevated glycolysis in neurons. For both neurons and astrocytes, labeling from [U-13C]isoleucine entered glutamate and aspartate albeit to a lower extent than from [U-13C]glucose. Labeling in glutamate and aspartate from [U-13C]isoleucine was decreased by ammonium treatment in neurons but not in astrocytes, the former probably reflecting increased metabolism of unlabeled glucose. In astrocytes, ammonia treatment resulted in glutamine production and release to the medium, partially

Dihydrolipoyl dehydrogenase as a potential UVB target in skin epidermis; using an integrated approach of label-free quantitative proteomics and targeted metabolite analysis.

PubMed

Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou

2015-03-18

Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified

Seasonal cycles, phylogenetic assembly, and functional diversity of orchid bee communities.

PubMed

Ramírez, Santiago R; Hernández, Carlos; Link, Andres; López-Uribe, Margarita M

2015-05-01

Neotropical rainforests sustain some of the most diverse terrestrial communities on Earth. Euglossine (or orchid) bees are a diverse lineage of insect pollinators distributed throughout the American tropics, where they provide pollination services to a staggering diversity of flowering plant taxa. Elucidating the seasonal patterns of phylogenetic assembly and functional trait diversity of bee communities can shed new light into the mechanisms that govern the assembly of bee pollinator communities and the potential effects of declining bee populations. Male euglossine bees collect, store, and accumulate odoriferous compounds (perfumes) to subsequently use during courtship display. Thus, synthetic chemical baits can be used to attract and monitor euglossine bee populations. We conducted monthly censuses of orchid bees in three sites in the Magdalena valley of Colombia - a region where Central and South American biotas converge - to investigate the structure, diversity, and assembly of euglossine bee communities through time in relation to seasonal climatic cycles. In particular, we tested the hypothesis that phylogenetic community structure and functional trait diversity changed in response to seasonal rainfall fluctuations. All communities exhibited strong to moderate phylogenetic clustering throughout the year, with few pronounced bursts of phylogenetic overdispersion that coincided with the transition from wet-to-dry seasons. Despite the heterogeneous distribution of functional traits (e.g., body size, body mass, and proboscis length) and the observed seasonal fluctuations in phylogenetic diversity, we found that functional trait diversity, evenness, and divergence remained constant during all seasons in all communities. However, similar to the pattern observed with phylogenetic diversity, functional trait richness fluctuated markedly with rainfall in all sites. These results emphasize the importance of considering seasonal fluctuations in community assembly and

A Natural Light/Dark Cycle Regulation of Carbon-Nitrogen Metabolism and Gene Expression in Rice Shoots.

PubMed

Li, Haixing; Liang, Zhijun; Ding, Guangda; Shi, Lei; Xu, Fangsen; Cai, Hongmei

2016-01-01

Light and temperature are two particularly important environmental cues for plant survival. Carbon and nitrogen are two essential macronutrients required for plant growth and development, and cellular carbon and nitrogen metabolism must be tightly coordinated. In order to understand how the natural light/dark cycle regulates carbon and nitrogen metabolism in rice plants, we analyzed the photosynthesis, key carbon-nitrogen metabolites, and enzyme activities, and differentially expressed genes and miRNAs involved in the carbon and nitrogen metabolic pathway in rice shoots at the following times: 2:00, 6:00, 10:00, 14:00, 18:00, and 22:00. Our results indicated that more CO2 was fixed into carbohydrates by a high net photosynthetic rate, respiratory rate, and stomatal conductance in the daytime. Although high levels of the nitrate reductase activity, free ammonium and carbohydrates were exhibited in the daytime, the protein synthesis was not significantly facilitated by the light and temperature. In mRNA sequencing, the carbon and nitrogen metabolism-related differentially expressed genes were obtained, which could be divided into eight groups: photosynthesis, TCA cycle, sugar transport, sugar metabolism, nitrogen transport, nitrogen reduction, amino acid metabolism, and nitrogen regulation. Additionally, a total of 78,306 alternative splicing events have been identified, which primarily belong to alternative 5' donor sites, alternative 3' acceptor sites, intron retention, and exon skipping. In sRNA sequencing, four carbon and nitrogen metabolism-related miRNAs (osa-miR1440b, osa-miR2876-5p, osa-miR1877 and osa-miR5799) were determined to be regulated by natural light/dark cycle. The expression level analysis showed that the four carbon and nitrogen metabolism-related miRNAs negatively regulated their target genes. These results may provide a good strategy to study how natural light/dark cycle regulates carbon and nitrogen metabolism to ensure plant growth and

The role of Pyruvate Dehydrogenase Complex in cardiovascular diseases.

PubMed

Sun, Wanqing; Liu, Quan; Leng, Jiyan; Zheng, Yang; Li, Ji

2015-01-15

The regulation of mammalian myocardial carbohydrate metabolism is complex; many factors such as arterial substrate and hormone levels, coronary flow, inotropic state and the nutritional status of the tissue play a role in regulating mammalian myocardial carbohydrate metabolism. The Pyruvate Dehydrogenase Complex (PDHc), a mitochondrial matrix multienzyme complex, plays an important role in energy homeostasis in the heart by providing the link between glycolysis and the tricarboxylic acid (TCA) cycle. In TCA cycle, PDHc catalyzes the conversion of pyruvate into acetyl-CoA. This review determines that there is altered cardiac glucose in various pathophysiological states consequently causing PDC to be altered. This review further summarizes evidence for the metabolism mechanism of the heart under normal and pathological conditions including ischemia, diabetes, hypertrophy and heart failure. Copyright © 2014 Elsevier Inc. All rights reserved.

Intact Arabidopsis RPB1 functions in stem cell niches maintenance and cell cycling control.

PubMed

Zhang, Qian-Qian; Li, Ying; Fu, Zhao-Ying; Liu, Xun-Biao; Yuan, Kai; Fang, Ying; Liu, Yan; Li, Gang; Zhang, Xian-Sheng; Chong, Kang; Ge, Lei

2018-05-12

Plant meristem activity depends on accurate execution of transcriptional networks required for establishing optimum functioning of stem cell niches. An Arabidopsis mutant card1-1 (constitutive auxin response with DR5:GFP) that encodes a truncated RPB1 (RNA Polymerase II's largest subunit) with shortened C-terminal domain (CTD) was identified. Phosphorylation of the CTD repeats of RPB1 is coupled to transcription in eukaryotes. Here we uncover that the truncated CTD of RPB1 disturbed cell cycling and enlarged the size of shoot and root meristem. The defects in patterning of root stem cell niche in card1-1 indicates that intact CTD of RPB1 is necessary for fine-tuning the specific expression of genes responsible for cell-fate determination. The gene-edited plants with different CTD length of RPB1, created by CRISPR-CAS9 technology, confirmed that both the full length and the DK-rich tail of RPB1's CTD play roles in the accurate transcription of CYCB1;1 encoding a cell-cycle marker protein in root meristem and hence participate in maintaining root meristem size. Our experiment proves that the intact RPB1 CTD is necessary for stem cell niche maintenance, which is mediated by transcriptional regulation of cell cycling genes. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

The effects of assisted cycling therapy (ACT) and voluntary cycling on reaction time and measures of executive function in adolescents with Down syndrome.

PubMed

Ringenbach, S D R; Holzapfel, S D; Mulvey, G M; Jimenez, A; Benson, A; Richter, M

2016-11-01

Reports of positive effects of aerobic exercise on cognitive function in persons with Down syndrome are extremely limited. However, a novel exercise intervention, termed assisted cycling therapy (ACT), has resulted in acutely improved cognitive planning ability and reaction times as well as improved cognitive planning after 8 weeks of ACT in adolescents and young adults with Down syndrome. Here, we report the effects of 8 weeks of ACT on reaction time, set-shifting, inhibition and language fluency in adolescents with Down syndrome. Adolescents with Down syndrome (age: ~18 years) were randomly assigned to 8 weeks of ACT (n = 17) or voluntary cycling (VC: n = 16), and a convenience sample (n = 11) was assigned to be an inactive comparison group (NC: n = 11). During ACT, the cycling cadence of the participants was augmented to an average cadence that was 80% faster than the voluntary cadence of the VC group. The increase in cadence was achieved with an electric motor in the stationary bicycle. Reaction time, set-shifting, inhibition and language fluency were assessed before and after 8 weeks of intervention. Power output and heart rates of the ACT and VC groups were almost identical, but the ACT cadence was significantly faster. The ACT group, but not the VC or NC groups, showed significantly improved reactions times (Hedges' g = -0.42) and inhibitory control (g = 0.18). Only the VC group showed improved set-shifting ability (g = 0.57). The ACT and VC groups displayed improved semantic language fluency (g = 0.25, g = 0.22, respectively). These and previous results support the hypothesis of increased neuroplasticity and prefrontal cortex function following ACT and, to a smaller extent, following VC. Both ACT and VC appear to be associated with cortical benefits, but based on current and previous results, ACT seems to maximize the benefits. © 2016 MENCAP and International Association of the Scientific Study of Intellectual

Serum caffeine and paraxanthine concentrations and menstrual cycle function: correlations with beverage intakes and associations with race, reproductive hormones, and anovulation in the BioCycle Study.

PubMed

Schliep, Karen C; Schisterman, Enrique F; Wactawski-Wende, Jean; Perkins, Neil J; Radin, Rose G; Zarek, Shvetha M; Mitchell, Emily M; Sjaarda, Lindsey A; Mumford, Sunni L

2016-07-01

Clinicians often recommend limiting caffeine intake while attempting to conceive; however, few studies have evaluated the associations between caffeine exposure and menstrual cycle function, and we are aware of no previous studies assessing biological dose via well-timed serum measurements. We assessed the relation between caffeine and its metabolites and reproductive hormones in a healthy premenopausal cohort and evaluated potential effect modification by race. Participants (n = 259) were followed for ≤2 menstrual cycles and provided fasting blood specimens ≤8 times/cycle. Linear mixed models were used to estimate associations between serum caffeine biomarkers and geometric mean reproductive hormones, whereas Poisson regression was used to assess risk of sporadic anovulation. The highest compared with the lowest serum caffeine tertile was associated with lower total testosterone [27.9 ng/dL (95% CI: 26.7, 29.0 ng/dL) compared with 29.1 ng/dL (95% CI: 27.9, 30.3 ng/dL), respectively] and free testosterone [0.178 ng/mL (95% CI: 0.171, 0.185 ng/dL) compared with 0.186 ng/mL (95% CI: 0.179, 0.194 ng/dL), respectively] after adjustment for age, race, percentage of body fat, daily vigorous exercise, perceived stress, depression, dietary factors, and alcohol intake. The highest tertiles compared with the lowest tertiles of caffeine and paraxanthine were also associated with reduced risk of anovulation [adjusted RRs (aRRs): 0.39 (95% CI: 0.18, 0.87) and 0.40 (95% CI: 0.18, 0.87), respectively]. Additional adjustment for self-reported coffee intake did not alter the reproductive hormone findings and only slightly attenuated the results for serum caffeine and paraxanthine and anovulation. Although reductions in the concentrations of total testosterone and free testosterone and decreased risk of anovulation were greatest in Asian women, there was no indication of effect modification by race. Caffeine intake, irrespective of the beverage source, may be associated with

Will Solar Cycles 25 and 26 Be Weaker than Cycle 24?

NASA Astrophysics Data System (ADS)

Javaraiah, J.

2017-11-01

The study of variations in solar activity is important for understanding the underlying mechanism of solar activity and for predicting the level of activity in view of the activity impact on space weather and global climate. Here we have used the amplitudes (the peak values of the 13-month smoothed international sunspot number) of Solar Cycles 1 - 24 to predict the relative amplitudes of the solar cycles during the rising phase of the upcoming Gleissberg cycle. We fitted a cosine function to the amplitudes and times of the solar cycles after subtracting a linear fit of the amplitudes. The best cosine fit shows overall properties (periods, maxima, minima, etc.) of Gleissberg cycles, but with large uncertainties. We obtain a pattern of the rising phase of the upcoming Gleissberg cycle, but there is considerable ambiguity. Using the epochs of violations of the Gnevyshev-Ohl rule (G-O rule) and the `tentative inverse G-O rule' of solar cycles during the period 1610 - 2015, and also using the epochs where the orbital angular momentum of the Sun is steeply decreased during the period 1600 - 2099, we infer that Solar Cycle 25 will be weaker than Cycle 24. Cycles 25 and 26 will have almost same strength, and their epochs are at the minimum between the current and upcoming Gleissberg cycles. In addition, Cycle 27 is expected to be stronger than Cycle 26 and weaker than Cycle 28, and Cycle 29 is expected to be stronger than both Cycles 28 and 30. The maximum of Cycle 29 is expected to represent the next Gleissberg maximum. Our analysis also suggests a much lower value (30 - 40) for the maximum amplitude of the upcoming Cycle 25.

Passive hind-limb cycling improves cardiac function and reduces cardiovascular disease risk in experimental spinal cord injury

PubMed Central

West, Christopher R; Crawford, Mark A; Poormasjedi-Meibod, Malihe-Sadat; Currie, Katharine D; Fallavollita, Andre; Yuen, Violet; McNeill, John H; Krassioukov, Andrei V

2014-01-01

Spinal cord injury (SCI) causes altered autonomic control and severe physical deconditioning that converge to drive maladaptive cardiac remodelling. We used a clinically relevant experimental model to investigate the cardio-metabolic responses to SCI and to establish whether passive hind-limb cycling elicits a cardio-protective effect. Initially, 21 male Wistar rats were evenly assigned to three groups: uninjured control (CON), T3 complete SCI (SCI) or T3 complete SCI plus passive hind-limb cycling (SCI-EX; 2 × 30 min day−1, 5 days week−1 for 4 weeks beginning 6 days post-SCI). On day 32, cardio-metabolic function was assessed using in vivo echocardiography, ex vivo working heart assessments, cardiac histology/molecular biology and blood lipid profiles. Twelve additional rats (n = 6 SCI and n = 6 SCI-EX) underwent in vivo echocardiography and basal haemodynamic assessments pre-SCI and at days 7, 14 and 32 post-SCI to track temporal cardiovascular changes. Compared with CON, SCI exhibited a rapid and sustained reduction in left ventricular dimensions and function that ultimately manifested as reduced contractility, increased myocardial collagen deposition and an up-regulation of transforming growth factor beta-1 (TGFβ1) and mothers against decapentaplegic homolog 3 (Smad3) mRNA. For SCI-EX, the initial reduction in left ventricular dimensions and function at day 7 post-SCI was completely reversed by day 32 post-SCI, and there were no differences in myocardial contractility between SCI-EX and CON. Collagen deposition was similar between SCI-EX and CON. TGFβ1 and Smad3 were down-regulated in SCI-EX. Blood lipid profiles were improved in SCI-EX versus SCI. We provide compelling novel evidence that passive hind-limb cycling prevents cardiac dysfunction and reduces cardiovascular disease risk in experimental SCI. PMID:24535438

Passive hind-limb cycling improves cardiac function and reduces cardiovascular disease risk in experimental spinal cord injury.

PubMed

West, Christopher R; Crawford, Mark A; Poormasjedi-Meibod, Malihe-Sadat; Currie, Katharine D; Fallavollita, Andre; Yuen, Violet; McNeill, John H; Krassioukov, Andrei V

2014-04-15

Spinal cord injury (SCI) causes altered autonomic control and severe physical deconditioning that converge to drive maladaptive cardiac remodelling. We used a clinically relevant experimental model to investigate the cardio-metabolic responses to SCI and to establish whether passive hind-limb cycling elicits a cardio-protective effect. Initially, 21 male Wistar rats were evenly assigned to three groups: uninjured control (CON), T3 complete SCI (SCI) or T3 complete SCI plus passive hind-limb cycling (SCI-EX; 2 × 30 min day(-1), 5 days week(-1) for 4 weeks beginning 6 days post-SCI). On day 32, cardio-metabolic function was assessed using in vivo echocardiography, ex vivo working heart assessments, cardiac histology/molecular biology and blood lipid profiles. Twelve additional rats (n = 6 SCI and n = 6 SCI-EX) underwent in vivo echocardiography and basal haemodynamic assessments pre-SCI and at days 7, 14 and 32 post-SCI to track temporal cardiovascular changes. Compared with CON, SCI exhibited a rapid and sustained reduction in left ventricular dimensions and function that ultimately manifested as reduced contractility, increased myocardial collagen deposition and an up-regulation of transforming growth factor beta-1 (TGFβ1) and mothers against decapentaplegic homolog 3 (Smad3) mRNA. For SCI-EX, the initial reduction in left ventricular dimensions and function at day 7 post-SCI was completely reversed by day 32 post-SCI, and there were no differences in myocardial contractility between SCI-EX and CON. Collagen deposition was similar between SCI-EX and CON. TGFβ1 and Smad3 were down-regulated in SCI-EX. Blood lipid profiles were improved in SCI-EX versus SCI. We provide compelling novel evidence that passive hind-limb cycling prevents cardiac dysfunction and reduces cardiovascular disease risk in experimental SCI.

Cellular and functional characterization of buffalo (Bubalus bubalis) corpus luteum during the estrous cycle and pregnancy.

PubMed

Baithalu, Rubina Kumari; Singh, S K; Gupta, Chhavi; Raja, Anuj K; Saxena, Abhishake; Kumar, Yogendra; Singh, R; Agarwal, S K

2013-08-01

In the present paper, cellular composition of buffalo corpus luteum (CL) with its functional characterization based on 3β-HSD and progesterone secretory ability at different stages of estrous cycle and pregnancy was studied. Buffalo uteri along with ovaries bearing CL were collected from the local slaughter house. These were classified into different stages of estrous cycle (Stage I, II, III and IV) and pregnancy (Stage I, II and III) based on morphological appearance of CL, surface follicles on the ovary and crown rump length of conceptus. Luteal cell population, progesterone content and steroidogenic properties were studied by dispersion of luteal cells using collagenase type I enzyme, RIA and 3β-HSD activity, respectively. Large luteal cells (LLC) appeared as polyhedral or spherical in shape with a centrally placed large round nucleus and an abundance of cytoplasmic lipid droplets. However, small luteal cells (SLC) appeared to be spindle shaped with an eccentrically placed irregular nucleus and there was paucity of cytoplasmic lipid droplets. The size of SLC (range 12-23μm) and LLC (range 25-55μm) increased (P<0.01) with the advancement of stage of estrous cycle and pregnancy. The mean progesterone concentration per gram and per CL increased (P<0.01) from Stage I to III of estrous cycle with maximum concentration at Stage III of estrous cycle and pregnancy. The progesterone concentration decreased at Stage IV (day 17-20) of estrous cycle coinciding with CL regression. Total luteal cell number (LLC and SLC) also increased (P<0.01) from Stage I to III of estrous cycle and decreased (P<0.05), thereafter, at Stage IV indicating degeneration of luteal cells and regression of the CL. Total luteal cell population during pregnancy also increased (P<0.01) from Stage I to II and thereafter decreased (P>0.05) indicating cessation of mitosis. Increased (P<0.05) large luteal cell numbers from Stage I to III of estrous cycle and pregnancy coincided with the increased

Succession of microbial functional communities in response to a pilot-scale ethanol-blended fuel release throughout the plume life cycle.

PubMed

Ma, Jie; Deng, Ye; Yuan, Tong; Zhou, Jizhong; Alvarez, Pedro J J

2015-03-01

GeoChip, a comprehensive gene microarray, was used to examine changes in microbial functional gene structure throughout the 4-year life cycle of a pilot-scale ethanol blend plume, including 2-year continuous released followed by plume disappearance after source removal. Canonical correlation analysis (CCA) and Mantel tests showed that dissolved O2 (which was depleted within 5 days of initiating the release and rebounded 194 days after source removal) was the most influential environmental factor on community structure. Initially, the abundance of anaerobic BTEX degradation genes increased significantly while that of aerobic BTEX degradation genes decreased. Gene abundance for N fixation, nitrification, P utilization, sulfate reduction and S oxidation also increased, potentially changing associated biogeochemical cycle dynamics. After plume disappearance, most genes returned to pre-release abundance levels, but the final functional structure significantly differed from pre-release conditions. Overall, observed successions of functional structure reflected adaptive responses that were conducive to biodegradation of ethanol-blend releases. Copyright © 2015. Published by Elsevier Ltd.

Increased Dynamics of Tricarboxylic Acid Cycle and Glutamate Synthesis in Obese Adipose Tissue

PubMed Central

Nagao, Hirofumi; Nishizawa, Hitoshi; Bamba, Takeshi; Nakayama, Yasumune; Isozumi, Noriyoshi; Nagamori, Shushi; Kanai, Yoshikatsu; Tanaka, Yoshimitsu; Kita, Shunbun; Fukuda, Shiro; Funahashi, Tohru; Maeda, Norikazu; Fukusaki, Eiichiro; Shimomura, Iichiro

2017-01-01

Obesity is closely associated with various metabolic disorders. However, little is known about abnormalities in the metabolic change of obese adipose tissue. Here we use static metabolic analysis and in vivo metabolic turnover analysis to assess metabolic dynamics in obese mice. The static metabolic analyses showed that glutamate and constitutive metabolites of the TCA cycle were increased in the white adipose tissue (WAT) of ob/ob and diet-induced obesity mice but not in the liver or skeletal muscle of these obese mice. Moreover, in vivo metabolic turnover analyses demonstrated that these glucose-derived metabolites were dynamically and specifically produced in obese WAT compared with lean WAT. Glutamate rise in obese WAT was associated with down-regulation of glutamate aspartate transporter (GLAST), a major glutamate transporter for adipocytes, and low uptake of glutamate into adipose tissue. In adipocytes, glutamate treatment reduced adiponectin secretion and insulin-mediated glucose uptake and phosphorylation of Akt. These data suggest that a high intra-adipocyte glutamate level potentially relates to adipocyte dysfunction in obesity. This study provides novel insights into metabolic dysfunction in obesity through comprehensive application of in vivo metabolic turnover analysis in two obese animal models. PMID:28119455

The Functional Breakdown Structure (FBS) and Its Relationship to Life Cycle Cost

NASA Technical Reports Server (NTRS)

DeHoff, Bryan; Levack, Danie J. H.; Rhodes, Russell E.

2009-01-01

The Functional Breakdown Structure (FBS) is a structured, modular breakdown of every function that must be addressed to perform a generic mission. It is also usable for any subset of the mission. Unlike a Work Breakdown Structure (WBS), the FBS is a function-oriented tree, not a product-oriented tree. The FBS details not products, but operations or activities that should be performed. The FBS is not tied to any particular architectural implementation because it is a listing of the needed functions, not the elements, of the architecture. The FBS for Space Transportation Systems provides a universal hierarchy of required functions, which include ground and space operations as well as infrastructure - it provides total visibility of the entire mission. By approaching the systems engineering problem from the functional view, instead of the element or hardware view, the SPST has created an exhaustive list of potential requirements which the architecture designers can use to evaluate the completeness of their designs. This is a new approach that will provide full accountability of all functions required to perform the planned mission. It serves as a giant check list to be sure that no functions are omitted, especially in the early architectural design phase. A significant characteristic of a FBS is that if architecture options are compared using this approach, then any missing or redundant elements of each option will be ' identified. Consequently, valid Life Cycle Costs (LCC) comparisons can be made. For example, one architecture option might not need a particular function while another option does. One option may have individual elements to perform each of three functions while another option needs only one element to perform the three functions. Once an architecture has been selected, the FBS will serve as a guide in development of the work breakdown structure, provide visibility of those technologies that need to be further developed to perform required functions

The Menstrual Cycle Influences Emotion but Has Limited Effect on Cognitive Function.

PubMed

Sundström-Poromaa, Inger

2018-01-01

From a psychological perspective, the menstrual cycle has been a research topic for more than 50 years. The most recent menstrual cycle research has been driven by an increased interest in sex differences in neuroscience, and the urge to understand sex disparities in prevalence, clinical presentation, and treatment response in psychiatric or neurologic disorders. Indeed, the menstrual cycle is an excellent model of ovarian steroid influence on emotion, behavior, and cognition. This review summarizes the emotion-related and cognitive findings of methodologically sound menstrual cycle studies. In particular, the review is devoted to the sex hormone-induced emotional disturbances in women with premenstrual dysphoric disorder, a subgroup of women responding with enhanced sensitivity to the normal fluctuations in endogenous hormone levels during the menstrual cycle. In addition, emotion processing and cognitive findings across the menstrual cycle in healthy women are also discussed. The overall conclusion is that that menstrual cycle differences in sexually dimorphic cognitive tasks are small and difficult to replicate. Emotion-related changes are more consistently found and are better associated with progesterone and the luteal phase, than with estradiol. © 2018 Elsevier Inc. All rights reserved.

Study of cyclic thermal aging of tube type receivers as a function of the duration of the cycle

NASA Astrophysics Data System (ADS)

Setien, Eneko; Fernández-Reche, Jesús; Ariza, María Jesús; Álvarez-de-Lara, Mónica

2017-06-01

The tube type receivers are exposed to variable duration cyclic operating conditions, which can jeopardize its reliability, and make it hard to estimate its long term performance. The designers have to deal with this problem and estimate the receiver long term performance based on the poor available litterature and the data sheets of the material. In order to help the designer better estimate the performance of the receivers, in this paper the cyclic thermal aging is analyzed as a function of the cycle duration. For this purpose, coated and uncoated Inconel alloy 625 tubular samples, similar to those used in the commercial receivers, are cyclically aged with different thermal cycle duration. The aging of these samples has been analyzed by means of oxidation kinetics, microstructure examination and mechanical and optical properties. The effect of the thermal cycle duration is studied and discussed by comparison of the results.

Intellectual, Adaptive, and Behavioral Functioning in Children with Urea Cycle Disorders

PubMed Central

Krivitzky, Lauren; Babikian, Talin; Lee, HyeSeung; Thomas, Nina Hattiangadi; Burk-Paull, Karen L.; Batshaw, Mark L.

2009-01-01

Inborn errors of urea synthesis lead to an accumulation of ammonia in blood and brain, and result in high rates of mortality and neurodevelopmental disability. The current study seeks to characterize the cognitive, adaptive, and emotional/behavioral functioning of children with Urea Cycle Disorders (UCDs). These domains were measured through testing and parent questionnaires in 92 children with UCDs (33 neonatal onset, 59 late onset). Results indicate that children who present with neonatal onset have poorer outcome than those who present later in childhood. Approximately half of the children with neonatal onset performed in the range of intellectual disability (ID), including a substantial number (~30%) who were severely impaired. In comparison, only a quarter of the late onset group were in the range of ID. There is also evidence that the UCD group has difficulties in aspects of emotional/behavioral and executive skills domains. In conclusion, children with UCDs present with a wide spectrum of cognitive outcomes. Children with neonatal onset disease have a much higher likelihood of having an intellectual disability, which becomes even more evident with increasing age. However, even children with late onset UCDs demonstrate evidence of neurocognitive and behavioral impairment, particularly in aspects of attention and executive functioning. PMID:19287347

Brachial artery endothelial function is stable across a menstrual and oral contraceptive pill cycle, but lower in premenopausal women than age-matched men.

PubMed

Shenouda, Ninette; Priest, Stacey E; Rizzuto, Vanessa I; MacDonald, Maureen J

2018-05-04

Sex hormone concentrations differ between men, premenopausal women with natural menstrual cycles (NAT), and premenopausal women using oral contraceptive pills (OCP), as well as across menstrual or OCP phases. This study sought to investigate how differences in sex hormones, particularly estradiol, between men and women and across cycle phases, may influence brachial artery endothelial function. Fifty-three healthy adults (22{plus minus}3 yrs; 20 men, 15 NAT, 18 second, third or fourth generation OCP) underwent assessments of sex hormones and endothelial (flow-mediated dilation test, FMD) and smooth muscle (nitroglycerin test, NTG) function. Men were tested three times at one-week intervals, and women were tested three times throughout a single menstrual or OCP cycle (NAT: menstrual, mid-follicular, luteal; OCP: placebo/no pill, 'early' and 'late' active pill). Endogenous estradiol concentration was comparable between men and women in their NAT menstrual or OCP placebo phase (p=0.36) but increased throughout a NAT cycle (p<0.001). Allometrically scaled FMD did not change across a NAT or OCP cycle but was lower in both groups of women than men (p=0.005), whereas scaled NTG was lower only in NAT women (p=0.001). Changes in estradiol across a NAT cycle were not associated with changes in relative FMD (r2=0.01, p=0.62) or NTG (r2=0.09, p=0.13). Duration of OCP use was negatively associated with the average relative FMD for second generation OCP users only (r=-0.65, p=0.04). Our findings suggest that brachial endothelial function is unaffected by cyclic hormonal changes in premenopausal women but may be negatively impacted by longer term use of second generation OCPs.

Serum caffeine and paraxanthine concentrations and menstrual cycle function: correlations with beverage intakes and associations with race, reproductive hormones, and anovulation in the BioCycle Study12

PubMed Central

Schisterman, Enrique F; Wactawski-Wende, Jean; Perkins, Neil J; Radin, Rose G; Zarek, Shvetha M; Mitchell, Emily M; Sjaarda, Lindsey A; Mumford, Sunni L

2016-01-01

Background: Clinicians often recommend limiting caffeine intake while attempting to conceive; however, few studies have evaluated the associations between caffeine exposure and menstrual cycle function, and we are aware of no previous studies assessing biological dose via well-timed serum measurements. Objectives: We assessed the relation between caffeine and its metabolites and reproductive hormones in a healthy premenopausal cohort and evaluated potential effect modification by race. Design: Participants (n = 259) were followed for ≤2 menstrual cycles and provided fasting blood specimens ≤8 times/cycle. Linear mixed models were used to estimate associations between serum caffeine biomarkers and geometric mean reproductive hormones, whereas Poisson regression was used to assess risk of sporadic anovulation. Results: The highest compared with the lowest serum caffeine tertile was associated with lower total testosterone [27.9 ng/dL (95% CI: 26.7, 29.0 ng/dL) compared with 29.1 ng/dL (95% CI: 27.9, 30.3 ng/dL), respectively] and free testosterone [0.178 ng/mL (95% CI: 0.171, 0.185 ng/dL) compared with 0.186 ng/mL (95% CI: 0.179, 0.194 ng/dL), respectively] after adjustment for age, race, percentage of body fat, daily vigorous exercise, perceived stress, depression, dietary factors, and alcohol intake. The highest tertiles compared with the lowest tertiles of caffeine and paraxanthine were also associated with reduced risk of anovulation [adjusted RRs (aRRs): 0.39 (95% CI: 0.18, 0.87) and 0.40 (95% CI: 0.18, 0.87), respectively]. Additional adjustment for self-reported coffee intake did not alter the reproductive hormone findings and only slightly attenuated the results for serum caffeine and paraxanthine and anovulation. Although reductions in the concentrations of total testosterone and free testosterone and decreased risk of anovulation were greatest in Asian women, there was no indication of effect modification by race. Conclusion: Caffeine intake

Semi-empirical long-term cycle life model coupled with an electrolyte depletion function for large-format graphite/LiFePO4 lithium-ion batteries

NASA Astrophysics Data System (ADS)

Park, Joonam; Appiah, Williams Agyei; Byun, Seoungwoo; Jin, Dahee; Ryou, Myung-Hyun; Lee, Yong Min

2017-10-01

To overcome the limitation of simple empirical cycle life models based on only equivalent circuits, we attempt to couple a conventional empirical capacity loss model with Newman's porous composite electrode model, which contains both electrochemical reaction kinetics and material/charge balances. In addition, an electrolyte depletion function is newly introduced to simulate a sudden capacity drop at the end of cycling, which is frequently observed in real lithium-ion batteries (LIBs). When simulated electrochemical properties are compared with experimental data obtained with 20 Ah-level graphite/LiFePO4 LIB cells, our semi-empirical model is sufficiently accurate to predict a voltage profile having a low standard deviation of 0.0035 V, even at 5C. Additionally, our model can provide broad cycle life color maps under different c-rate and depth-of-discharge operating conditions. Thus, this semi-empirical model with an electrolyte depletion function will be a promising platform to predict long-term cycle lives of large-format LIB cells under various operating conditions.

Trichloroacetic Acid Versus Salicylic Acid in the Treatment of Acne Vulgaris in Dark-Skinned Patients.

PubMed

Abdel Meguid, Azza Mahfouz; Elaziz Ahmed Attallah, Dalia Abd; Omar, Howida

2015-12-01

Treatment options for acne include chemical peeling. Trichloroacetic acid (TCA) has been used for treating acne. The ability of TCA to diminish corneocyte cohesion and keratinocyte plugging addresses this mode of treatment. Salicylic acid is an excellent keratolytic agent. It is believed to function through solubilization of intercellular cement, thereby reducing corneocyte adhesion. Comparing the therapeutic efficacy of TCA 25% peels with those of salicylic acid 30% in patients with acne vulgaris. Twenty patients, Fitzpatrick skin Types III to V with facial acne, were enrolled. Twenty-five percent of TCA was applied to the right half of the face and 30% salicylic acid to the left half at 2-week interval for 2 months. Total improvement was more frequent with salicylic acid peeling (95%) versus (85%) with TCA. Total comedones improvement was more frequent with TCA peeling (80%) versus (70%) with salicylic acid. Improvement of inflammatory lesions was more frequent among the side treated with salicylic acid (85%) versus (80%) with TCA peeling. However, the results did not reach the statistical significance level. Trichloroacetic acid is more superior in treating comedonal lesions, whereas salicylic is more superior in treating inflammatory lesions, without significant different between their results.

Abundance in proteins expressed after functional electrical stimulation cycling or arm cycling ergometry training in persons with chronic spinal cord injury.

PubMed

Gorgey, Ashraf S; Graham, Zachary A; Bauman, William A; Cardozo, Christopher; Gater, David R

2017-07-01

Longitudinal design. The study determined the effects of two forms of exercise training on the abundance of two proteins, (glucose transporter-4 [GLUT-4], adenosine monophosphate kinase [AMPK]) involved in glucose utilization and the transcriptional coactivator that regulates the genes involved in energy metabolism and mitochondrial biogenesis (peroxisome proliferator-activated receptor (PPAR) coactivator 1 alpha [PGC-1α]), in muscles in men with chronic motor-complete spinal cord injury (SCI). Clinical trial at a Medical Center. Nine men with chronic motor-complete SCI participated in functional electrical stimulation lower extremity cycling (FES-LEC; n = 4) or arm cycling ergometer (arm-cycling ergometer [ACE]; n = 5) 5 days/week for 16 weeks. Whole body composition was measured by dual energy X-ray absorptiometry. An intravenous glucose tolerance test was performed to measure glucose effectiveness (Sg) and insulin sensitivity (Si). Muscle biopsies of the right vastus lateralis (VL) and triceps muscles were collected one week prior to and post the exercise training intervention. Neither training intervention altered body composition or carbohydrate metabolism. GLUT-4 increased by 3.8 fold in the VL after FES training and increased 0.6 fold in the triceps after ACE training. PGC-1α increased by 2.3 fold in the VL after FES training and 3.8 fold in the triceps after ACE training. AMPK increased by 3.4 fold in the VL after FES training and in the triceps after ACE training. FES-LEC and ACE training were associated with greater protein expressions in the trained muscles by effectively influencing the abundance of GLUT-4, AMPK and PGC-1α. Thus, FES-LEC training of paralyzed muscle can modulate protein expression similar to that of trained and innervated muscle.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Brain mitochondrial metabolic dysfunction and glutamate level reduction in the pilocarpine model of temporal lobe epilepsy in mice

PubMed Central

Smeland, Olav B; Hadera, Mussie G; McDonald, Tanya S; Sonnewald, Ursula; Borges, Karin

2013-01-01

Although certain metabolic characteristics such as interictal glucose hypometabolism are well established for temporal lobe epilepsy (TLE), its pathogenesis still remains unclear. Here, we performed a comprehensive study of brain metabolism in a mouse model of TLE, induced by pilocarpine–status epilepticus (SE). To investigate glucose metabolism, we injected mice 3.5–4 weeks after SE with [1,2-13C]glucose before microwave fixation of the head. Using 1H and 13C nuclear magnetic resonance spectroscopy, gas chromatography—mass spectrometry and high-pressure liquid chromatography, we quantified metabolites and 13C labeling in extracts of cortex and hippocampal formation (HF). Hippocampal levels of glutamate, glutathione and alanine were decreased in pilocarpine–SE mice compared with controls. Moreover, the contents of N-acetyl aspartate, succinate and reduced nicotinamide adenine dinucleotide (phosphate) NAD(P)H were decreased in HF indicating impairment of mitochondrial function. In addition, the reduction in 13C enrichment of hippocampal citrate and malate suggests decreased tricarboxylic acid (TCA) cycle turnover in this region. In cortex, we found reduced 13C labeling of glutamate, glutamine and aspartate via the pyruvate carboxylation and pyruvate dehydrogenation pathways, suggesting slower turnover of these amino acids and/or the TCA cycle. In conclusion, mitochondrial metabolic dysfunction and altered amino-acid metabolism is found in both cortex and HF in this epilepsy model. PMID:23611869

Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate

PubMed Central

Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H.; Pedersen, Peter L.; Goffeau, Andre; Ułaszewski, Stanisław

2016-01-01

In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP. PMID:26862728

Proteomic analysis of the bacterial cell cycle

PubMed Central

Grünenfelder, Björn; Rummel, Gabriele; Vohradsky, Jiri; Röder, Daniel; Langen, Hanno; Jenal, Urs

2001-01-01

A global approach was used to analyze protein synthesis and stability during the cell cycle of the bacterium Caulobacter crescentus. Approximately one-fourth (979) of the estimated C. crescentus gene products were detected by two-dimensional gel electrophoresis, 144 of which showed differential cell cycle expression patterns. Eighty-one of these proteins were identified by mass spectrometry and were assigned to a wide variety of functional groups. Pattern analysis revealed that coexpression groups were functionally clustered. A total of 48 proteins were rapidly degraded in the course of one cell cycle. More than half of these unstable proteins were also found to be synthesized in a cell cycle-dependent manner, establishing a strong correlation between rapid protein turnover and the periodicity of the bacterial cell cycle. This is, to our knowledge, the first evidence for a global role of proteolysis in bacterial cell cycle control. PMID:11287652

Probing the Role of Nascent Helicity in p27 Function as a Cell Cycle Regulator

PubMed Central

Otieno, Steve; Kriwacki, Richard

2012-01-01

p27 regulates the activity of Cdk complexes which are the principal governors of phase transitions during cell division. Members of the p27 family of proteins, which also includes p21 and p57, are called the Cip/Kip cyclin-dependent kinase regulators (CKRs). Interestingly, the Cip/Kip CKRs play critical roles in cell cycle regulation by being intrinsically unstructured, a characteristic contrary to the classical structure-function paradigm. They exhibit nascent helicity which has been localized to a segment referred to as sub-domain LH. The nascent helicity of this sub-domain is conserved and we hypothesize that it is an important determinant of their functional properties. To test this hypothesis, we successfully designed and prepared p27 variants in which domain LH was either more or less helical with respect to the wild-type protein. Thermal denaturation experiments showed that the ternary complexes of the p27 variants bound to Cdk2/Cyclin A were less stable compared to the wild-type complex. Isothermal titration calorimetry experiments showed a decrease in the enthalpy of binding for all the mutants with respect to p27. The free energies of binding varied within a much narrower range. In vitro Cdk2 inhibition assays showed that the p27 variants exhibited disparate inhibitory potencies. Furthermore, when over-expressed in NIH 3T3 mouse fibroblast cells, the less helical p27 variants were less effective in causing cell cycle arrest relative to the wild-type p27. Our results indicate that the nascent helicity of sub-domain LH plays a key role mediating the biological function of p27. PMID:23071750

Label-free fluorescent enzymatic assay of citrate synthase by CoA-Au(I) co-ordination polymer and its application in a multi-enzyme logic gate cascade.

PubMed

Li, Yong; Wang, Huixia; Dai, Futao; Li, Pei; Jin, Xin; Huang, Yan; Nie, Zhou; Yao, Shouzhuo

2016-12-15

Citrate synthase (CS) is one of the key metabolic enzymes in the Krebs tricarboxylic acid (TCA) cycle. It regulates energy generation in mitochondrial respiration by catalysing the reaction between oxaloacetic acid (OAA) and acetyl coenzyme A (Ac-CoA) to generate citrate and coenzyme A (CoA). CS has been shown to be a biomarker of neurological diseases and various kinds of cancers. Here, a label-free fluorescent assay has been developed for homogeneously detecting CS and its inhibitor based on the in situ generation of CoA-Au(I) co-ordination polymer (CP) and the fluorescence signal-on by SYBR Green II-stained CoA-Au(I) CP. Because of the unique property of the CoA-Au(I) CP, this CS activity assay method could achieve excellent selectivity and sensitivity, with a linear range from 0.0033 U/μL to 0.264 U/μL and a limit of detection to be 0.00165 U/μL. Meanwhile, this assay method has advantages of being facile and cost effective with quick detection. Moreover, based on this method, a biomimetic logic system was established by rationally exploiting the cascade enzymatic interactions in TCA cycle for chemical information processing. In the TCA cycle-derived logic system, an AND-AND-AND-cascaded gate was rigorously operated step by step in one pot, and is outputted by a label-free fluorescent signal with visualized readout. Copyright © 2016 Elsevier B.V. All rights reserved.

LINE-1 protein localization and functional dynamics during the cell cycle

PubMed Central

Wudzinska, Aleksandra; Sun, Xiaoji; Andrade, Joshua; Nayak, Shruti; Kahler, David J; Badri, Sana; LaCava, John; Ueberheide, Beatrix; Yun, Chi Y; Fenyö, David

2018-01-01

LINE-1/L1 retrotransposon sequences comprise 17% of the human genome. Among the many classes of mobile genetic elements, L1 is the only autonomous retrotransposon that still drives human genomic plasticity today. Through its co-evolution with the human genome, L1 has intertwined itself with host cell biology. However, a clear understanding of L1’s lifecycle and the processes involved in restricting its insertion and intragenomic spread remains elusive. Here we identify modes of L1 proteins’ entrance into the nucleus, a necessary step for L1 proliferation. Using functional, biochemical, and imaging approaches, we also show a clear cell cycle bias for L1 retrotransposition that peaks during the S phase. Our observations provide a basis for novel interpretations about the nature of nuclear and cytoplasmic L1 ribonucleoproteins (RNPs) and the potential role of DNA replication in L1 retrotransposition. PMID:29309036

The tRNA-modifying function of MnmE is controlled by post-hydrolysis steps of its GTPase cycle

PubMed Central

Prado, Silvia; Villarroya, Magda; Medina, Milagros; Armengod, M.-Eugenia

2013-01-01

MnmE is a homodimeric multi-domain GTPase involved in tRNA modification. This protein differs from Ras-like GTPases in its low affinity for guanine nucleotides and mechanism of activation, which occurs by a cis, nucleotide- and potassium-dependent dimerization of its G-domains. Moreover, MnmE requires GTP hydrolysis to be functionally active. However, how GTP hydrolysis drives tRNA modification and how the MnmE GTPase cycle is regulated remains unresolved. Here, the kinetics of the MnmE GTPase cycle was studied under single-turnover conditions using stopped- and quench-flow techniques. We found that the G-domain dissociation is the rate-limiting step of the overall reaction. Mutational analysis and fast kinetics assays revealed that GTP hydrolysis, G-domain dissociation and Pi release can be uncoupled and that G-domain dissociation is directly responsible for the ‘ON’ state of MnmE. Thus, MnmE provides a new paradigm of how the ON/OFF cycling of GTPases may regulate a cellular process. We also demonstrate that the MnmE GTPase cycle is negatively controlled by the reaction products GDP and Pi. This feedback mechanism may prevent inefficacious GTP hydrolysis in vivo. We propose a biological model whereby a conformational change triggered by tRNA binding is required to remove product inhibition and initiate a new GTPase/tRNA-modification cycle. PMID:23630314

Vapor Compression Cycle Design Program (CYCLE_D)

National Institute of Standards and Technology Data Gateway

SRD 49 NIST Vapor Compression Cycle Design Program (CYCLE_D) (PC database for purchase)   The CYCLE_D database package simulates the vapor compression refrigeration cycles. It is fully compatible with REFPROP 9.0 and covers the 62 single-compound refrigerants . Fluids can be used in mixtures comprising up to five components.

Reduced cognitive function, increased blood-brain-barrier transport and inflammatory responses, and altered brain metabolites in LDLr -/-and C57BL/6 mice fed a western diet

PubMed Central

Lee, Linda L.; Puchowicz, Michelle; Golub, Mari S.; Befroy, Douglas E.; Wilson, Dennis W.; Anderson, Steven; Cline, Gary; Bini, Jason; Borkowski, Kamil; Knotts, Trina A.; Rutledge, John C.

2018-01-01

Recent work suggests that diet affects brain metabolism thereby impacting cognitive function. Our objective was to determine if a western diet altered brain metabolism, increased blood-brain barrier (BBB) transport and inflammation, and induced cognitive impairment in C57BL/6 (WT) mice and low-density lipoprotein receptor null (LDLr -/-) mice, a model of hyperlipidemia and cognitive decline. We show that a western diet and LDLr -/- moderately influence cognitive processes as assessed by Y-maze and radial arm water maze. Also, western diet significantly increased BBB transport, as well as microvessel factor VIII in LDLr -/- and microglia IBA1 staining in WT, both indicators of activation and neuroinflammation. Interestingly, LDLr -/- mice had a significant increase in 18F- fluorodeoxyglucose uptake irrespective of diet and brain 1H-magnetic resonance spectroscopy showed increased lactate and lipid moieties. Metabolic assessments of whole mouse brain by GC/MS and LC/MS/MS showed that a western diet altered brain TCA cycle and β-oxidation intermediates, levels of amino acids, and complex lipid levels and elevated proinflammatory lipid mediators. Our study reveals that the western diet has multiple impacts on brain metabolism, physiology, and altered cognitive function that likely manifest via multiple cellular pathways. PMID:29444171

Cadence Tracking and Disturbance Rejection in Functional Electrical Stimulation Cycling for Paraplegic Subjects: A Case Study.

PubMed

Fonseca, Lucas O da; Bó, Antônio P L; Guimarães, Juliana A; Gutierrez, Miguel E; Fachin-Martins, Emerson

2017-11-01

Functional electrical stimulation cycling has been proposed as an assistive technology with numerous health and fitness benefits for people with spinal cord injury, such as improvement in cardiovascular function, increase in muscular mass, and reduction of bone mass loss. However, some limitations, for example, lack of optimal control strategies that would delay fatigue, may still prevent this technology from achieving its full potential. In this work, we performed experiments on a person with complete spinal cord injury using a stationary tadpole trike when both cadence tracking and disturbance rejection were evaluated. In addition, two sets of experiments were conducted 6 months apart and considering activation of different muscles. The results showed that reference tracking is achieved above the cadence of 25 rpm with mean absolute errors between 1.9 and 10% when only quadriceps are activated. The disturbance test revealed that interferences may drop the cadence but do not interrupt a continuous movement if the cadence does not drop below 25 rpm, again when only quadriceps are activated. When other muscle groups were added, strong spasticity caused larger errors on reference tracking, but not when a disturbance was applied. In addition, spasticity caused the last experiments to result in less smooth cycling. © 2017 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

The life cycle of centrioles.

PubMed

Hatch, E; Stearns, T

2010-01-01

Centrioles organize the centrosome and nucleate the ciliary axoneme, and the centriole life cycle has many parallels to the chromosome cycle. The centriole cycle in animals begins at fertilization with the contribution of two centrioles by the male gamete. In the ensuing cell cycles, the duplication of centrioles is controlled temporally, spatially, and numerically. As a consequence of the duplication mechanism, the two centrioles in a typical interphase cell are of different ages and have different functions. Here, we discuss how new centrioles are assembled, what mechanisms limit centriole number, and the consequences of the inherent asymmetry of centriole duplication and segregation.

The odd-carbon medium-chain fatty triglyceride triheptanoin does not reduce hepatic steatosis.

PubMed

Comhair, Tine M; Garcia Caraballo, Sonia C; Dejong, Cornelis H C; Lamers, Wouter H; Koehler, S Eleonore

2017-02-01

Non-alcoholic fatty-liver disease (NAFLD) is the hepatic manifestation of the metabolic syndrome. Previously, we showed that a high-protein diet minimized diet-induced development of fatty liver and even reversed pre-existing steatosis. A high-protein diet leads to amino-acid catabolism, which in turn causes anaplerosis of the tricarboxylic-acid (TCA) cycle. Therefore, we hypothesized that anaplerosis of the TCA cycle could be responsible for the high-protein diet-induced improvement of NAFLD by channeling amino acids into the TCA cycle. Next we considered that an efficient anaplerotic agent, the odd-carbon medium-chain triglyceride triheptanoin (TH), might have similar beneficial effects. C57BL/6J mice were fed low-fat (8en%) or high-fat (42en%) oleate-containing diets with or without 15en% TH for 3 weeks. TH treatment enhanced the hepatic capacity for fatty-acid oxidation by a selective increase in hepatic Ppara, Acox, and Cd36 expression, and a decline in plasma acetyl-carnitines. It also induced pyruvate cycling through an increased hepatic PCK1 protein concentration and it increased thermogenesis reflected by an increased Ucp2 mRNA content. TH, however, did not reduce hepatic lipid content. The comparison of the present effects of dietary triheptanoin with a previous study by our group on protein supplementation shows that the beneficial effects of the high-protein diet are not mimicked by TH. This argues against anaplerosis as the sole explanatory mechanism for the anti-steatotic effect of a high-protein diet. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Study of the damage evolution function of tin silver copper in cycling

NASA Astrophysics Data System (ADS)

Qasaimeh, Awni

The present research focused on the assessment of solder joint fatigue life in microelectronics assemblies. A general concern of any reliability engineer is whether accelerated tests are relevant to field conditions. The risk of this was minimized by developing an approach to reduce the duration of an accelerated thermal cycling test, thus allowing for the use of less accelerated test conditions. For this purpose the conventional dye and pry technique was improved and used together with artificial neural networks to measure and characterize very early stages of crack growth. The same work also demonstrated a quantitative link between thermal cycling induced recrystallization and a strong acceleration of the subsequent fatigue crack growth and failure. A new study was conducted in which different combinations of annealing and isothermal cycling provided a systematic characterization of the effects of a range of individual parameters on the recrystallization. Experiments showed the ongoing coarsening of secondary precipitates to have a clear effect on recrystallization. The rate of recrystallization was also shown not to scale with the inelastic energy deposition. This means that the most popular current thermal cycling model cannot apply to SnAgCu solder joints. Recrystallization of the Sn grains is usually not the rate limiting mechanism in isothermal cycling. The crack initiation stage often takes up a much greater fraction of the overall life, and the eventual failure of BGA joints tends to involve transgranular crack growth instead. Cycling of individual solder joints allowed for monitoring of the evolution of the solder properties and the rate of inelastic energy deposition. Both the number of cycles to crack initiation and the subsequent number of cycles to failure were shown to be determined by the inelastic energy deposition. This provides for a simple model for the extrapolation of accelerated test results to the much milder cycling amplitudes

Dosage-Sensitive Function of RETINOBLASTOMA RELATED and Convergent Epigenetic Control Are Required during the Arabidopsis Life Cycle

PubMed Central

Johnston, Amal J.; Kirioukhova, Olga; Barrell, Philippa J.; Rutten, Twan; Moore, James M.; Baskar, Ramamurthy; Grossniklaus, Ueli; Gruissem, Wilhelm

2010-01-01

The plant life cycle alternates between two distinct multi-cellular generations, the reduced gametophytes and the dominant sporophyte. Little is known about how generation-specific cell fate, differentiation, and development are controlled by the core regulators of the cell cycle. In Arabidopsis, RETINOBLASTOMA RELATED (RBR), an evolutionarily ancient cell cycle regulator, controls cell proliferation, differentiation, and regulation of a subset of Polycomb Repressive Complex 2 (PRC2) genes and METHYLTRANSFERASE 1 (MET1) in the male and female gametophytes, as well as cell fate establishment in the male gametophyte. Here we demonstrate that RBR is also essential for cell fate determination in the female gametophyte, as revealed by loss of cell-specific marker expression in all the gametophytic cells that lack RBR. Maintenance of genome integrity also requires RBR, because diploid plants heterozygous for rbr (rbr/RBR) produce an abnormal portion of triploid offspring, likely due to gametic genome duplication. While the sporophyte of the diploid mutant plants phenocopied wild type due to the haplosufficiency of RBR, genetic analysis of tetraploid plants triplex for rbr (rbr/rbr/rbr/RBR) revealed that RBR has a dosage-dependent pleiotropic effect on sporophytic development, trichome differentiation, and regulation of PRC2 subunit genes CURLY LEAF (CLF) and VERNALIZATION 2 (VRN2), and MET1 in leaves. There were, however, no obvious cell cycle and cell proliferation defects in these plant tissues, suggesting that a single functional RBR copy in tetraploids is capable of maintaining normal cell division but is not sufficient for distinct differentiation and developmental processes. Conversely, in leaves of mutants in sporophytic PRC2 subunits, trichome differentiation was also affected and expression of RBR and MET1 was reduced, providing evidence for a RBR-PRC2-MET1 regulatory feedback loop involved in sporophyte development. Together, dosage-sensitive RBR function and

A Synthesis of Solar Cycle Prediction Techniques

NASA Technical Reports Server (NTRS)

Hathaway, David H.; Wilson, Robert M.; Reichmann, Edwin J.

1999-01-01

A number of techniques currently in use for predicting solar activity on a solar cycle timescale are tested with historical data. Some techniques, e.g., regression and curve fitting, work well as solar activity approaches maximum and provide a month-by-month description of future activity, while others, e.g., geomagnetic precursors, work well near solar minimum but only provide an estimate of the amplitude of the cycle. A synthesis of different techniques is shown to provide a more accurate and useful forecast of solar cycle activity levels. A combination of two uncorrelated geomagnetic precursor techniques provides a more accurate prediction for the amplitude of a solar activity cycle at a time well before activity minimum. This combined precursor method gives a smoothed sunspot number maximum of 154 plus or minus 21 at the 95% level of confidence for the next cycle maximum. A mathematical function dependent on the time of cycle initiation and the cycle amplitude is used to describe the level of solar activity month by month for the next cycle. As the time of cycle maximum approaches a better estimate of the cycle activity is obtained by including the fit between previous activity levels and this function. This Combined Solar Cycle Activity Forecast gives, as of January 1999, a smoothed sunspot maximum of 146 plus or minus 20 at the 95% level of confidence for the next cycle maximum.

Inhibition of the alpha-ketoglutarate dehydrogenase complex alters mitochondrial function and cellular calcium regulation.

PubMed

Huang, Hsueh-Meei; Zhang, Hui; Xu, Hui; Gibson, Gary E

2003-01-20

Mitochondrial dysfunction occurs in many neurodegenerative diseases. The alpha-ketoglutarate dehydrogenase complex (KGDHC) catalyzes a key and arguably rate-limiting step of the tricarboxylic acid cycle (TCA). A reduction in the activity of the KGDHC occurs in brains and cells of patients with many of these disorders and may underlie the abnormal mitochondrial function. Abnormalities in calcium homeostasis also occur in fibroblasts from Alzheimer's disease (AD) patients and in cells bearing mutations that lead to AD. Thus, the present studies test whether the reduction of KGDHC activity can lead to the alterations in mitochondrial function and calcium homeostasis. alpha-Keto-beta-methyl-n-valeric acid (KMV) inhibits KGDHC activity in living N2a cells in a dose- and time-dependent manner. Surprisingly, concentration of KMV that inhibit in situ KGDHC by 80% does not alter the mitochondrial membrane potential (MMP). However, similar concentrations of KMV induce the release of cytochrome c from mitochondria into the cytosol, reduce basal [Ca(2+)](i) by 23% (P<0.005), and diminish the bradykinin (BK)-induced calcium release from the endoplasmic reticulum (ER) by 46% (P<0.005). This result suggests that diminished KGDHC activities do not lead to the Ca(2+) abnormalities in fibroblasts from AD patients or cells bearing PS-1 mutations. The increased release of cytochrome c with diminished KGDHC activities will be expected to activate other pathways including cell death cascades. Reductions in this key mitochondrial enzyme will likely make the cells more vulnerable to metabolic insults that promote cell death.

Tricarboxylic acid cycle inhibition by Li+ in the human neuroblastoma SH-SY5Y cell line: a 13C NMR isotopomer analysis.

PubMed

Fonseca, Carla P; Jones, John G; Carvalho, Rui A; Jeffrey, F Mark H; Montezinho, Liliana P; Geraldes, Carlos F G C; Castro, M M C A

2005-11-01

Li+ effects on glucose metabolism and on the competitive metabolism of glucose and lactate were investigated in the human neuroblastoma SH-SY5Y cell line using 13C NMR spectroscopy. The metabolic model proposed for glucose and lactate metabolism in these cells, based on tcaCALC best fitting solutions, for both control and Li+ conditions, was consistent with: (i) a single pyruvate pool; (ii) anaplerotic flux from endogenous unlabelled substrates; (iii) no cycling between pyruvate and oxaloacetate. Li+ was shown to induce a 38 and 53% decrease, for 1 and 15 mM Li+, respectively, in the rate of glucose conversion into pyruvate, when [U-13C]glucose was present, while no effects on lactate production were observed. Pyruvate oxidation by the tricarboxylic acid cycle and citrate synthase flux were shown to be significantly reduced by 64 and 84% in the presence of 1 and 15 mM Li+, respectively, suggesting a direct inhibitory effect of Li+ on tricarboxylic acid cycle flux. This work also showed that when both glucose and lactate are present as energetic substrates, SH-SY5Y cells preferentially consumed exogenous lactate over glucose, as 62% of the acetyl-CoA was derived from [3-13C]lactate while only 26% was derived from [U-13C]glucose. Li+ did not significantly affect the relative utilisation of these two substrates by the cells or the residual contribution of unlabelled endogenous sources for the acetyl-CoA pool.

Alterations in dopamine system function across the estrous cycle of the MAM rodent model of schizophrenia.

PubMed

Perez, Stephanie M; Chen, Li; Lodge, Daniel J

2014-09-01

Clinical studies have reported differences in the incidence and severity of schizophrenia symptoms between male and female schizophrenia patients. Unfortunately, the cause of these differences is not currently known due, in part, to the fact that preclinical studies largely focus on male subjects. Dopamine neuron activity has been previously demonstrated to change across the estrous cycle, and may therefore be of relevance, as aberrant dopamine signaling is thought to underlie the positive symptoms of schizophrenia. Here we examine dopamine neuron activity across the estrous cycle in the MAM rodent model of schizophrenia. We demonstrate that the elevation in dopamine neuron activity, consistently observed in male MAM-treated rats, is most prominent during estrus and attenuated in met-estrus. Furthermore, this appears to be mediated, in part, by progesterone in the ventral hippocampus, as increases in dopamine neuron population activity (observed in estrus) were normalized by the intra-hippocampal administration of the progesterone receptor antagonist, mifepristone (but not the estrogen receptor antagonists, fulvestrant). Taken together, these data suggest that changes in dopamine system function occur across the estrous cycle in MAM-treated rats and may contribute to the differences in symptomatology between male and female schizophrenia patients. Copyright © 2014 Elsevier Ltd. All rights reserved.

An Empirical Orthogonal Function Reanalysis of the Northern Polar External and Induced Magnetic Field During Solar Cycle 23

NASA Astrophysics Data System (ADS)

Shore, R. M.; Freeman, M. P.; Gjerloev, J. W.

2018-01-01

We apply the method of data-interpolating empirical orthogonal functions (EOFs) to ground-based magnetic vector data from the SuperMAG archive to produce a series of month length reanalyses of the surface external and induced magnetic field (SEIMF) in 110,000 km2 equal-area bins over the entire northern polar region at 5 min cadence over solar cycle 23, from 1997.0 to 2009.0. Each EOF reanalysis also decomposes the measured SEIMF variation into a hierarchy of spatiotemporal patterns which are ordered by their contribution to the monthly magnetic field variance. We find that the leading EOF patterns can each be (subjectively) interpreted as well-known SEIMF systems or their equivalent current systems. The relationship of the equivalent currents to the true current flow is not investigated. We track the leading SEIMF or equivalent current systems of similar type by intermonthly spatial correlation and apply graph theory to (objectively) group their appearance and relative importance throughout a solar cycle, revealing seasonal and solar cycle variation. In this way, we identify the spatiotemporal patterns that maximally contribute to SEIMF variability over a solar cycle. We propose this combination of EOF and graph theory as a powerful method for objectively defining and investigating the structure and variability of the SEIMF or their equivalent ionospheric currents for use in both geomagnetism and space weather applications. It is demonstrated here on solar cycle 23 but is extendable to any epoch with sufficient data coverage.

Enhanced Cycling Stability of Sulfur Electrodes through Effective Binding of Pyridine-Functionalized Polymer

DOE PAGES

Tsao, Yuchi; Chen, Zheng; Rondeau-Gagne, Simon; ...

2017-09-20

Porous carbons have previously been widely used as host materials for sulfur (S) electrodes because of their high conductivity and high surface area. However, they generally lack strong chemical affinity to stabilize polysulfide species. Therefore, conducting polymers have been employed to stabilize S electrodes. Integrating conducting polymers with high-surface-area carbons can create a new materials platform and synergize their functions. However, the previously used conducting polymers were often insoluble, and coating them uniformly from solution onto a nonpolar carbon substrate is a challenge. Here, we report that solution-processable isoindigo-based polymers incorporating polar substituents provide critical features: the conjugated backbone providesmore » good conductivity; functional pyridine groups provide high affinity to polysulfide species; and they possess high solubility in organic solvents. Here, these lead to effective coating on various carbonaceous substrates to provide highly stable sulfur electrodes. Importantly, the electrodes exhibit good capacity retention (80% over 300 cycles) at sulfur mass loading of 3.2 mg/cm 2, which significantly surpasses the performance of others reported in polymer-enabled sulfur cathodes.« less

Fiat lux!

PubMed Central

Renault, Hugues

2013-01-01

The non-protein amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to a wide variety of environmental cues. Recent data point toward an involvement of GABA in tricarboxylic acid (TCA) cycle activity and respiration, especially in stressed roots. To gain further insights into potential GABA functions in plants, phylogenetic and bioinformatic approaches were undertaken. Phylogenetic reconstruction of the GABA transaminase (GABA-T) protein family revealed the monophyletic nature of plant GABA-Ts. However, this analysis also pointed to the common origin of several plant aminotransferases families, which were found more similar to plant GABA-Ts than yeast and human GABA-Ts. A computational analysis of AtGABA-T co-expressed genes was performed in roots and in stress conditions. This second approach uncovered a strong connection between GABA metabolism and glyoxylate cycle during stress. Both in silico analyses open new perspectives and hypotheses for GABA metabolic functions in plants. PMID:23518583

The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity

DTIC Science & Technology

2012-03-01

mitochondrial OAA measurement is performed by a commercial kit from Biovision . Briefly, whole cell lysates or mitochondria fraction were obtained from... Biovision based on the manufacturer protocols. 2) Cellular oxygen consumption and reactive oxygen (ROS) production. One of the metabolic consequences of

The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity

DTIC Science & Technology

2014-03-01

phosphorylation, Nat Rev Genet 2, 342-352. 17. Higgins , L. H., Withers, H. G., Garbens, A., Love, H. D., Magnoni, L., Hayward, S. W., and Moyes, C. D. (2009...MalateDehydrogenase 2ConfersDocetaxel Resistancevia Regulations of JNKSignaling andOxidativeMetabolism Qiong Liu, Chris T. Harvey, Hao Geng, Changhui...1036 Liuet al. The Prostate 40. Higgins LH, Withers HG, Garbens A, Love HD, Magnoni L, Hayward SW, Moyes CD. Hypoxia and the metabolic pheno- type of

Leukemia cells demonstrate a different metabolic perturbation provoked by 2-deoxyglucose.

PubMed

Miwa, Hiroshi; Shikami, Masato; Goto, Mineaki; Mizuno, Shohei; Takahashi, Miyuki; Tsunekawa-Imai, Norikazu; Ishikawa, Takamasa; Mizutani, Motonori; Horio, Tomohiro; Gotou, Mayuko; Yamamoto, Hidesuke; Wakabayashi, Motohiro; Watarai, Masaya; Hanamura, Ichiro; Imamura, Akira; Mihara, Hidetsugu; Nitta, Masakazu

2013-05-01

The shift in energy metabolism from oxidative phosphorylation to glycolysis can serve as a target for the inhibition of cancer growth. Here, we examined the metabolic changes induced by 2-deoxyglucose (2-DG), a glycolysis inhibitor, in leukemia cells by metabolome analysis. NB4 cells mainly utilized glucose as an energy source by glycolysis and oxidative phosphorylation in mitochondria, since metabolites in the glycolytic pathway and in the tricarboxylic acid (TCA) cycle were significantly decreased by 2-DG. In THP-1 cells, metabolites in the TCA cycle were not decreased to the same extent by 2-DG as in NB4 cells, which indicates that THP-1 utilizes energy sources other than glucose. TCA cycle metabolites in THP-1 cells may be derived from acetyl-CoA by fatty acid β-oxidation, which was supported by abundant detection of carnitine and acetylcarnitine in THP-1 cells. 2-DG treatment increased the levels of pentose phosphate pathway (PPP) metabolites and augmented the generation of NADPH by glucose-6-phosphate dehydrogenase. An increase in NADPH and upregulation of glutathione synthetase expression resulted in the increase in the reduced form of glutathione by 2-DG in NB4 cells. We demonstrated that a combination of 2-DG and inhibition of PPP by dehydroepiandrosterone (DHEA) effectively suppressed the growth of NB4 cells. The replenishment of the TCA cycle by fatty acid oxidation by carnitine palmitoyltransferase in THP-1 cells, treated by 2-DG, might be regulated by AMPK, as the combination of 2-DG and inhibition of AMPK by compound C potently suppressed the growth of THP-1 cells. Although 2-DG has been effective in preclinical and clinical studies, this treatment has not been fully explored due to concerns related to potential toxicities such as brain toxicity at high doses. We demonstrated that a combination of 2-DG and DHEA or compound C at a relatively low concentration effectively inhibits the growth of NB4 and THP-1 cells, respectively. These observations may

Not all counterclockwise thermodynamic cycles are refrigerators

NASA Astrophysics Data System (ADS)

Dickerson, R. H.; Mottmann, J.

2016-06-01

Clockwise cycles on PV diagrams always represent heat engines. It is therefore tempting to assume that counterclockwise cycles always represent refrigerators. This common assumption is incorrect: most counterclockwise cycles cannot be refrigerators. This surprising result is explored here for quasi-static ideal gas cycles, and the necessary conditions for refrigeration cycles are clarified. Three logically self-consistent criteria can be used to determine if a counterclockwise cycle is a refrigerator. The most fundamental test compares the counterclockwise cycle with a correctly determined corresponding Carnot cycle. Other criteria we employ include a widely accepted description of the functional behavior of refrigerators, and a corollary to the second law that limits a refrigerator's coefficient of performance.

A comparative look at sunspot cycles

NASA Technical Reports Server (NTRS)

Wilson, R. M.

1984-01-01

On the basis of cycles 8 through 20, spanning about 143 years, observations of sunspot number, smoothed sunspot number, and their temporal properties were used to compute means, standard deviations, ranges, and frequency of occurrence histograms for a number of sunspot cycle parameters. The resultant schematic sunspot cycle was contrasted with the mean sunspot cycle, obtained by averaging smoothed sunspot number as a function of time, tying all cycles (8 through 20) to their minimum occurence date. A relatively good approximation of the time variation of smoothed sunspot number for a given cycle is possible if sunspot cycles are regarded in terms of being either HIGH- or LOW-R(MAX) cycles or LONG- or SHORT-PERIOD cycles, especially the latter. Linear regression analyses were performed comparing late cycle parameters with early cycle parameters and solar cycle number. The early occurring cycle parameters can be used to estimate later occurring cycle parameters with relatively good success, based on cycle 21 as an example. The sunspot cycle record clearly shows that the trend for both R(MIN) and R(MAX) was toward decreasing value between cycles 8 through 14 and toward increasing value between cycles 14 through 20. Linear regression equations were also obtained for several measures of solar activity.

Life prediction for high temperature low cycle fatigue of two kinds of titanium alloys based on exponential function

NASA Astrophysics Data System (ADS)

Mu, G. Y.; Mi, X. Z.; Wang, F.

2018-01-01

The high temperature low cycle fatigue tests of TC4 titanium alloy and TC11 titanium alloy are carried out under strain controlled. The relationships between cyclic stress-life and strain-life are analyzed. The high temperature low cycle fatigue life prediction model of two kinds of titanium alloys is established by using Manson-Coffin method. The relationship between failure inverse number and plastic strain range presents nonlinear in the double logarithmic coordinates. Manson-Coffin method assumes that they have linear relation. Therefore, there is bound to be a certain prediction error by using the Manson-Coffin method. In order to solve this problem, a new method based on exponential function is proposed. The results show that the fatigue life of the two kinds of titanium alloys can be predicted accurately and effectively by using these two methods. Prediction accuracy is within ±1.83 times scatter zone. The life prediction capability of new methods based on exponential function proves more effective and accurate than Manson-Coffin method for two kinds of titanium alloys. The new method based on exponential function can give better fatigue life prediction results with the smaller standard deviation and scatter zone than Manson-Coffin method. The life prediction results of two methods for TC4 titanium alloy prove better than TC11 titanium alloy.

Fructose Alters Intermediary Metabolism of Glucose in Human Adipocytes and Diverts Glucose to Serine Oxidation in the One–Carbon Cycle Energy Producing Pathway

PubMed Central

Varma, Vijayalakshmi; Boros, László G.; Nolen, Greg T.; Chang, Ching-Wei; Wabitsch, Martin; Beger, Richard D.; Kaput, Jim

2015-01-01

Increased consumption of sugar and fructose as sweeteners has resulted in the utilization of fructose as an alternative metabolic fuel that may compete with glucose and alter its metabolism. To explore this, human Simpson-Golabi-Behmel Syndrome (SGBS) preadipocytes were differentiated to adipocytes in the presence of 0, 1, 2.5, 5 or 10 mM of fructose added to a medium containing 5 mM of glucose representing the normal blood glucose concentration. Targeted tracer [1,2-13C2]-d-glucose fate association approach was employed to examine the influence of fructose on the intermediary metabolism of glucose. Increasing concentrations of fructose robustly increased the oxidation of [1,2-13C2]-d-glucose to 13CO2 (p < 0.000001). However, glucose-derived 13CO2 negatively correlated with 13C labeled glutamate, 13C palmitate, and M+1 labeled lactate. These are strong markers of limited tricarboxylic acid (TCA) cycle, fatty acid synthesis, pentose cycle fluxes, substrate turnover and NAD+/NADP+ or ATP production from glucose via complete oxidation, indicating diminished mitochondrial energy metabolism. Contrarily, a positive correlation was observed between glucose-derived 13CO2 formed and 13C oleate and doses of fructose which indicate the elongation and desaturation of palmitate to oleate for storage. Collectively, these results suggest that fructose preferentially drives glucose through serine oxidation glycine cleavage (SOGC pathway) one-carbon cycle for NAD+/NADP+ production that is utilized in fructose-induced lipogenesis and storage in adipocytes. PMID:26087138

Nonlinear solar cycle forecasting: theory and perspectives

NASA Astrophysics Data System (ADS)

Baranovski, A. L.; Clette, F.; Nollau, V.

2008-02-01

In this paper we develop a modern approach to solar cycle forecasting, based on the mathematical theory of nonlinear dynamics. We start from the design of a static curve fitting model for the experimental yearly sunspot number series, over a time scale of 306 years, starting from year 1700 and we establish a least-squares optimal pulse shape of a solar cycle. The cycle-to-cycle evolution of the parameters of the cycle shape displays different patterns, such as a Gleissberg cycle and a strong anomaly in the cycle evolution during the Dalton minimum. In a second step, we extract a chaotic mapping for the successive values of one of the key model parameters - the rate of the exponential growth-decrease of the solar activity during the n-th cycle. We examine piece-wise linear techniques for the approximation of the derived mapping and we provide its probabilistic analysis: calculation of the invariant distribution and autocorrelation function. We find analytical relationships for the sunspot maxima and minima, as well as their occurrence times, as functions of chaotic values of the above parameter. Based on a Lyapunov spectrum analysis of the embedded mapping, we finally establish a horizon of predictability for the method, which allows us to give the most probable forecasting of the upcoming solar cycle 24, with an expected peak height of 93±21 occurring in 2011/2012.

De novo Fatty Acid Biosynthesis Contributes Significantly to Establishment of a Bioenergetically Favorable Environment for Vaccinia Virus Infection

PubMed Central

Greseth, Matthew D.; Traktman, Paula

2014-01-01

The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in

De novo fatty acid biosynthesis contributes significantly to establishment of a bioenergetically favorable environment for vaccinia virus infection.

PubMed

Greseth, Matthew D; Traktman, Paula

2014-03-01

The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in

Comparative transcriptome analysis reveals different molecular mechanisms of Bacillus coagulans 2-6 response to sodium lactate and calcium lactate during lactic acid production.

PubMed

Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping

2015-01-01

Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that 'ATP-binding cassette transporters' were significantly affected by calcium lactate stress, and 'amino sugar and nucleotide sugar metabolism' was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of 'glycolysis/gluconeogenesis' genes but positive effect on the expression of 'citrate cycle (TCA cycle)' genes. However, calcium lactate stress had positive influence on the expression of 'glycolysis/gluconeogenesis' genes and had minor influence on 'citrate cycle (TCA cycle)' genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans.

Comparative Transcriptome Analysis Reveals Different Molecular Mechanisms of Bacillus coagulans 2-6 Response to Sodium Lactate and Calcium Lactate during Lactic Acid Production

PubMed Central

Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping

2015-01-01

Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that ‘ATP-binding cassette transporters’ were significantly affected by calcium lactate stress, and ‘amino sugar and nucleotide sugar metabolism’ was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of ‘glycolysis/gluconeogenesis’ genes but positive effect on the expression of ‘citrate cycle (TCA cycle)’ genes. However, calcium lactate stress had positive influence on the expression of ‘glycolysis/gluconeogenesis’ genes and had minor influence on ‘citrate cycle (TCA cycle)’ genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans. PMID:25875592

CBX3 promotes colon cancer cell proliferation by CDK6 kinase-independent function during cell cycle

PubMed Central

Fan, Yao; Li, Haiping; Liang, Xiaolong; Xiang, Zheng

2017-01-01

Heterochromatin protein 1γ (CBX3) links histone methylation marks to transcriptional silence, DNA repair and RNA splicing, but a role for CBX3 in cancer remains largely unknown. In this study, we show that CBX3 in colon cancer cells promotes the progression of the cell cycle and proliferation in vitro and in vivo. Cell cycle (G1 phase to S phase) related gene CDK6 and p21 were further identified as targets of CBX3. In addition, we found that enhancing CDK6 suppresses cell proliferation by upregulating inhibitor p21 in the absence of CBX3, and this function is independent of the kinase activity of CDK6. Our results demonstrate a key role of CBX3 in colon carcinogenesis via suppressing the expression of CDK6/p21, which may disrupt the role of CDK6 in transcriptionally regulating p21, as part of a negative feedback loop to limit CDK6 excessive activation. PMID:28193906

A Novel Interaction of Ecdysoneless (ECD) Protein with R2TP Complex Component RUVBL1 Is Required for the Functional Role of ECD in Cell Cycle Progression.

PubMed

Mir, Riyaz A; Bele, Aditya; Mirza, Sameer; Srivastava, Shashank; Olou, Appolinaire A; Ammons, Shalis A; Kim, Jun Hyun; Gurumurthy, Channabasavaiah B; Qiu, Fang; Band, Hamid; Band, Vimla

2015-12-28

Ecdysoneless (ECD) is an evolutionarily conserved protein whose germ line deletion is embryonic lethal. Deletion of Ecd in cells causes cell cycle arrest, which is rescued by exogenous ECD, demonstrating a requirement of ECD for normal mammalian cell cycle progression. However, the exact mechanism by which ECD regulates cell cycle is unknown. Here, we demonstrate that ECD protein levels and subcellular localization are invariant during cell cycle progression, suggesting a potential role of posttranslational modifications or protein-protein interactions. Since phosphorylated ECD was recently shown to interact with the PIH1D1 adaptor component of the R2TP cochaperone complex, we examined the requirement of ECD phosphorylation in cell cycle progression. Notably, phosphorylation-deficient ECD mutants that failed to bind to PIH1D1 in vitro fully retained the ability to interact with the R2TP complex and yet exhibited a reduced ability to rescue Ecd-deficient cells from cell cycle arrest. Biochemical analyses demonstrated an additional phosphorylation-independent interaction of ECD with the RUVBL1 component of the R2TP complex, and this interaction is essential for ECD's cell cycle progression function. These studies demonstrate that interaction of ECD with RUVBL1, and its CK2-mediated phosphorylation, independent of its interaction with PIH1D1, are important for its cell cycle regulatory function. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

A Novel Interaction of Ecdysoneless (ECD) Protein with R2TP Complex Component RUVBL1 Is Required for the Functional Role of ECD in Cell Cycle Progression

PubMed Central

Mir, Riyaz A.; Bele, Aditya; Mirza, Sameer; Srivastava, Shashank; Olou, Appolinaire A.; Ammons, Shalis A.; Kim, Jun Hyun; Gurumurthy, Channabasavaiah B.; Qiu, Fang; Band, Hamid

2015-01-01

Ecdysoneless (ECD) is an evolutionarily conserved protein whose germ line deletion is embryonic lethal. Deletion of Ecd in cells causes cell cycle arrest, which is rescued by exogenous ECD, demonstrating a requirement of ECD for normal mammalian cell cycle progression. However, the exact mechanism by which ECD regulates cell cycle is unknown. Here, we demonstrate that ECD protein levels and subcellular localization are invariant during cell cycle progression, suggesting a potential role of posttranslational modifications or protein-protein interactions. Since phosphorylated ECD was recently shown to interact with the PIH1D1 adaptor component of the R2TP cochaperone complex, we examined the requirement of ECD phosphorylation in cell cycle progression. Notably, phosphorylation-deficient ECD mutants that failed to bind to PIH1D1 in vitro fully retained the ability to interact with the R2TP complex and yet exhibited a reduced ability to rescue Ecd-deficient cells from cell cycle arrest. Biochemical analyses demonstrated an additional phosphorylation-independent interaction of ECD with the RUVBL1 component of the R2TP complex, and this interaction is essential for ECD's cell cycle progression function. These studies demonstrate that interaction of ECD with RUVBL1, and its CK2-mediated phosphorylation, independent of its interaction with PIH1D1, are important for its cell cycle regulatory function. PMID:26711270

Promysalin Elicits Species-Selective Inhibition of Pseudomonas aeruginosa by Targeting Succinate Dehydrogenase.

PubMed

Keohane, Colleen E; Steele, Andrew D; Fetzer, Christian; Khowsathit, Jittasak; Van Tyne, Daria; Moynié, Lucile; Gilmore, Michael S; Karanicolas, John; Sieber, Stephan A; Wuest, William M

2018-02-07

Natural products have served as an inspiration to scientists both for their complex three-dimensional architecture and exquisite biological activity. Promysalin is one such Pseudomonad secondary metabolite that exhibits narrow-spectrum antibacterial activity, originally isolated from the rhizosphere. We herein utilize affinity-based protein profiling (AfBPP) to identify succinate dehydrogenase (Sdh) as the biological target of the natural product. The target was further validated in silico, in vitro, in vivo, and through the selection, and sequencing, of a resistant mutant. Succinate dehydrogenase plays an essential role in primary metabolism of Pseudomonas aeruginosa as the only enzyme that is involved both in the tricarboxylic acid cycle (TCA) and in respiration via the electron transport chain. These findings add credence to other studies that suggest that the TCA cycle is an understudied target in the development of novel therapeutics to combat P. aeruginosa, a significant pathogen in clinical settings.

[Metabolic flux analysis of L-serine synthesis by Corynebacterium glutamicum SYPS-062].

PubMed

Zhang, Xiaomei; Dou, Wenfang; Xu, Hongyu; Xu, Zhenghong

2010-10-01

Corynebacterium glutamicum SYPS-062 was an L-serine producing strain stored at our lab and could produce L-serine directly from sugar. We studied the effects of cofactors in one carbon unit metabolism-folate and VB12 on the cell growth, sucrose consumption and L-serine production by SYPS-062. In the same time, the metabolic flux distribution was determined in different conditions. The supplementation of folate or VB12 enhanced the cell growth, energy synthesis, and finally increased the flux of pentose phosphate pathway (HMP), whereas the carbon flux to L-serine was decreased. The addition of VB12 not only increased the ratio of L-serine synthesis pathway on G3P joint, but also caused the insufficiency of tricarboxylic acid cycle (TCA) flux, which needed more anaplerotic reaction flux to replenish TCA cycle, that was an important limiting factor for the further increasing of the L-serine productivity.

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

PubMed Central

Burkhart, Deborah L.; Wirt, Stacey E.; Zmoos, Anne-Flore; Kareta, Michael S.; Sage, Julien

2010-01-01

The retinoblastoma tumor suppressor (Rb) is a potent and ubiquitously expressed cell cycle regulator, but patients with a germline Rb mutation develop a very specific tumor spectrum. This surprising observation raises the possibility that mechanisms that compensate for loss of Rb function are present or activated in many cell types. In particular, p107, a protein related to Rb, has been shown to functionally overlap for loss of Rb in several cellular contexts. To investigate the mechanisms underlying this functional redundancy between Rb and p107 in vivo, we used gene targeting in embryonic stem cells to engineer point mutations in two consensus E2F binding sites in the endogenous p107 promoter. Analysis of normal and mutant cells by gene expression and chromatin immunoprecipitation assays showed that members of the Rb and E2F families directly bound these two sites. Furthermore, we found that these two E2F sites controlled both the repression of p107 in quiescent cells and also its activation in cycling cells, as well as in Rb mutant cells. Cell cycle assays further indicated that activation of p107 transcription during S phase through the two E2F binding sites was critical for controlled cell cycle progression, uncovering a specific role for p107 to slow proliferation in mammalian cells. Direct transcriptional repression of p107 by Rb and E2F family members provides a molecular mechanism for a critical negative feedback loop during cell cycle progression and tumorigenesis. These experiments also suggest novel therapeutic strategies to increase the p107 levels in tumor cells. PMID:20585628

Phosphatidylcholine and the CDP-Choline Cycle

PubMed Central

Fagone, Paolo; Jackowski, Suzanne

2012-01-01

The CDP-choline pathway of phosphatidylcholine (PtdCho) biosynthesis was first described more than 50 years ago. Investigation of the CDP-choline pathway in yeast provides a basis for understanding the CDP-choline pathway in mammals. PtdCho is considered as an intermediate in a cycle of synthesis and degradation, and the activity of a CDP-choline cycle is linked to subcellular membrane lipid movement. The components of the mammalian CDP-choline pathway include choline transport, choline kinase, phosphocholine cytidylyltransferase, and choline phosphotransferase activities. The protein isoforms and biochemical mechanisms of regulation of the pathway enzymes are related to their cell and tissue-specific functions. Regulated PtdCho turnover mediated by phospholipases or neuropathy target esterase participates in the mammalian CDP-choline cycle. Knockout mouse models define the biological functions of the CDP-choline cycle in mammalian cells and tissues. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:23010477

Altered functional brain asymmetry for mental rotation: effect of estradiol changes across the menstrual cycle.

PubMed

Zhu, Xun; Kelly, Thomas H; Curry, Thomas E; Lal, Chitra; Joseph, Jane E

2015-09-30

Mental rotation is a visuospatial task associated with pronounced sex differences. Performance is also affected by gonadal hormones such as testosterone and estradiol. To better understand hormonal modulation of the neural substrates of mental rotation, the present study examined the influence of estradiol using functional MRI. Ten premenopausal women were tested on a 3D mental rotation task during the early follicular and late follicular phases of the menstrual cycle. Change in estradiol between the two phases was confirmed by hormone assays. Brain activation patterns were similar across the two phases, but the change in estradiol had different associations with the two hemispheres. Better performance in the late follicular than the early follicular phase was associated with a pattern of reduced recruitment of the right hemisphere and increased recruitment of the left hemisphere. The increased recruitment of the left hemisphere was directly associated with greater changes in estradiol. Given that the right hemisphere is the dominant hemisphere in visuospatial processing, our results suggest that estradiol is associated with reduced functional asymmetry, consistent with recent accounts of hormonal modulation of neurocognitive function.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cline, Gary W., E-mail: gary.cline@yale.edu; Department of Surgery, University of Minnesota-Twin Cities, Minneapolis, MN 55455; Pongratz, Rebecca L.

Highlights: Black-Right-Pointing-Pointer We studied media effects on mechanisms of insulin secretion of INS-1 cells. Black-Right-Pointing-Pointer Insulin secretion was higher in DMEM than KRB despite identical ATP synthesis rates. Black-Right-Pointing-Pointer Insulin secretion rates correlated with rates of anaplerosis and TCA cycle. Black-Right-Pointing-Pointer Mitochondria metabolism and substrate cycles augment secretion signal of ATP. -- Abstract: Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as amore » surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with {sup 31}P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by {sup 13}C NMR isotopomer analysis of the fate of [U-{sup 13}C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15 mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria

Essential function of VCP/p97 in infection cycle of the nucleopolyhedrovirus AcMNPV in Spodoptera frugiperda Sf9 cells.

PubMed

Lyupina, Yulia V; Erokhov, Pavel A; Kravchuk, Oksana I; Finoshin, Alexander D; Abaturova, Svetlana B; Orlova, Olga V; Beljelarskaya, Svetlana N; Kostyuchenko, Margarita V; Mikhailov, Victor S

2018-06-08

The protein VCP/p97 (also named CDC48 and TER94) belongs to a type II subfamily of the AAA+ATPases and controls cellular proteostasis by acting upstream of proteasomes in the ubiquitin-proteasome protein degradation pathway. The function of VCP/p97 in the baculovirus infection cycle in insect cells remains unknown. Here, we identified VCP/p97 in the fall armyworm Spodoptera frugiperda (Sf9) cells and analyzed the replication of the Autographa californica multiple nucleopolyhedrovirus, AcMNPV, in Sf9 cells in which the VCP/p97 function was inhibited. The specific allosteric inhibitor of the VCP/p97 ATPase activity, NMS-873, did not deplete VCP/p97 in infected cells but caused a dose-dependent inhibition of viral DNA synthesis and efficiently suppressed expression of viral proteins and production of budded virions. NMS-873 caused accumulation of ubiquitinated proteins in a manner similar to the inhibitor of proteasome activity, Bortezomib. This suggests the essential function of VCP/p97 in the baculovirus infection cycle might be associated, at least in part, with the ubiquitin-proteasome system. Copyright © 2018 Elsevier B.V. All rights reserved.

Lipid-induced metabolic dysfunction in skeletal muscle.

PubMed

Muoio, Deborah M; Koves, Timothy R

2007-01-01

Insulin resistance is a hallmark of type 2 diabetes and commonly observed in other energy-stressed settings such as obesity, starvation, inactivity and ageing. Dyslipidaemia and 'lipotoxicity'--tissue accumulation of lipid metabolites-are increasingly recognized as important drivers of insulin resistant states. Mounting evidence suggests that lipid-induced metabolic dysfunction in skeletal muscle is mediated in large part by stress-activated serine kinases that interfere with insulin signal transduction. However, the metabolic and molecular events that connect lipid oversupply to stress kinase activation and glucose intolerance are as yet unclear. Application of transcriptomics and targeted mass spectrometry-based metabolomics tools has led to our finding that insulin resistance is a condition in which muscle mitochondria are persistently burdened with a heavy lipid load. As a result, high rates of beta-oxidation outpace metabolic flux through the TCA cycle, leading to accumulation of incompletely oxidized acyl-carnitine intermediates. In contrast, exercise training enhances mitochondrial performance, favouring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high fat diet. The exercise-activated transcriptional co-activator, PGC1alpha, plays a key role in co-ordinating metabolic flux through these two intersecting metabolic pathways, and its suppression by overfeeding may contribute to obesity-associated mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from mitochondrial lipid stress and a resultant disconnect between beta-oxidation and TCA cycle activity. Understanding this 'disconnect' and its molecular basis may lead to new therapeutic targets for combating metabolic disease.

Aerobic capacity and hepatic mitochondrial lipid oxidation alters susceptibility for chronic high-fat diet-induced hepatic steatosis.

PubMed

Morris, E Matthew; Meers, Grace M E; Koch, Lauren G; Britton, Steven L; Fletcher, Justin A; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C; Ibdah, Jamal A; Rector, R Scott; Thyfault, John P

2016-10-01

Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity.

Aerobic capacity and hepatic mitochondrial lipid oxidation alters susceptibility for chronic high-fat diet-induced hepatic steatosis

PubMed Central

Morris, E. Matthew; Meers, Grace M. E.; Koch, Lauren G.; Britton, Steven L.; Fletcher, Justin A.; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C.; Ibdah, Jamal A.; Rector, R. Scott

2016-01-01

Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity. PMID:27600823

Task-Specific and Functional Effects of Speed-Focused Elliptical or Motor-Assisted Cycle Training in Children With Bilateral Cerebral Palsy: Randomized Clinical Trial.

PubMed

Damiano, Diane L; Stanley, Christopher J; Ohlrich, Laurie; Alter, Katharine E

2017-08-01

Locomotor training using treadmills or robotic devices is commonly utilized to improve gait in cerebral palsy (CP); however, effects are inconsistent and fail to exceed those of equally intense alternatives. Possible limitations of existing devices include fixed nonvariable rhythm and too much limb or body weight assistance. To quantify and compare effectiveness of a motor-assisted cycle and a novel alternative, an elliptical, in CP to improve interlimb reciprocal coordination through intensive speed-focused leg training. A total of 27 children with bilateral CP, 5 to 17 years old, were randomized to 12 weeks of 20 minutes, 5 days per week home-based training (elliptical = 14; cycle = 13) at a minimum of 40 revolutions per minute, with resistance added when speed target was achieved. Primary outcomes were self-selected and fastest voluntary cadence on the devices and gait speed. Secondary outcomes included knee muscle strength, and selective control and functional mobility measures. Cadence on trained but not nontrained devices increased, demonstrating task specificity of training and increased exercise capability. Mean gait speed did not increase in either group, nor did parent-reported functional mobility. Knee extensor strength increased in both. An interaction between group and time was seen in selective control with scores slightly increasing for the elliptical and decreasing for the cycle, possibly related to tighter limb coupling with cycling. Task-specific effects were similarly positive across groups, but no transfer was seen to gait or function. Training dose was low (≤20 hours) compared with intensive upper-limb training recommendations and may be insufficient to produce appreciable clinical change.

Internal cycle modeling and environmental assessment of multiple cycle consumer products

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsiliyannis, C.A., E-mail: anion@otenet.gr

2012-01-15

Highlights: Black-Right-Pointing-Pointer Dynamic flow models are presented for remanufactured, reused or recycled products. Black-Right-Pointing-Pointer Early loss and stochastic return are included for fast and slow cycling products. Black-Right-Pointing-Pointer The reuse-to-input flow ratio (Internal Cycle Factor, ICF) is determined. Black-Right-Pointing-Pointer The cycle rate, which is increasing with the ICF, monitors eco-performance. Black-Right-Pointing-Pointer Early internal cycle losses diminish the ICF, the cycle rate and performance. - Abstract: Dynamic annual flow models incorporating consumer discard and usage loss and featuring deterministic and stochastic end-of-cycle (EOC) return by the consumer are developed for reused or remanufactured products (multiple cycle products, MCPs), including fast andmore » slow cycling, short and long-lived products. It is shown that internal flows (reuse and overall consumption) increase proportionally to the dimensionless internal cycle factor (ICF) which is related to environmental impact reduction factors. The combined reuse/recycle (or cycle) rate is shown capable for shortcut, albeit effective, monitoring of environmental performance in terms of waste production, virgin material extraction and manufacturing impacts of all MCPs, a task, which physical variables (lifetime, cycling frequency, mean or total number of return trips) and conventional rates, via which environmental policy has been officially implemented (e.g. recycling rate) cannot accomplish. The cycle rate is shown to be an increasing (hyperbolic) function of ICF. The impact of the stochastic EOC return characteristics on total reuse and consumption flows, as well as on eco-performance, is assessed: symmetric EOC return has a small, positive effect on performance compared to deterministic, while early shifted EOC return is more beneficial. In order to be efficient, environmental policy should set higher minimum reuse targets for higher trippage MCPs

Triheptanoin for glucose transporter type I deficiency (G1D): Modulation of human ictogenesis, cerebral metabolic rate and cognitive indices by a food supplement

PubMed Central

Pascual, Juan M.; Liu, Peiying; Mao, Deng; Kelly, Dorothy; Hernandez, Ana; Sheng, Min; Good, Levi B.; Ma, Qian; Marin-Valencia, Isaac; Zhang, Xuchen; Park, Jason Y.; Hynan, Linda S.; Stavinoha, Peter; Roe, Charles R.; Lu, Hanzhang

2015-01-01

Objective G1D is commonly associated with electrographic spike-wave and - less-noticeably – with absence seizures. The G1D syndrome has long been attributed to energy (i.e., ATP-synthetic) failure, as have experimental, toxic-rodent epilepsies to impaired brain metabolism and tricarboxylic acid (TCA) cycle intermediate depletion. Indeed, a (seldom-acknowledged) function of glucose and other substrates is the generation of brain TCAs via carbon-donor reactions collectively named anaplerosis. However, TCAs are preserved in murine G1D. This renders inferences about energy failure premature and suggests a different hypothesis, also grounded on our findings, that consumption of alternate TCA precursors is stimulated, potentially detracting from other functions. Second, common ketogenic diets can ameliorate G1D seizures, but lead to a therapeutically-counterintuitive reduction in blood glucose available to the brain, and they can prove ineffective in 1/3 of cases. While developing G1D treatments, all of this motivated us to: a) uphold (rather than attenuate) the residual brain glucose flux that all G1D patients possess; and b) stimulate the TCA cycle, including anaplerosis. Therefore, we tested the medium-chain triglyceride triheptanoin, a widely-used medical food supplement that can fulfill both of these metabolic roles. The rationale is that ketone bodies derived from ketogenic diets are not anaplerotic, in contrast with triheptanoin metabolites, as we have shown in the G1D mouse brain. Design We supplemented the regular diet of a case series of G1D patients with food-grade triheptanoin. First we confirmed that, despite their frequent electroencephalographic (EEG) presence as spike-waves, most seizures are rarely visible, such that perceptions by patients or others are inadequate for treatment evaluation. Thus, we used EEG, quantitative neuropsychological, blood analytical, and MRI cerebral metabolic rate measurements as main outcomes. Setting Academic and

The genome of Pelobacter carbinolicus reveals surprising metabolic capabilities and physiological features

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aklujkar, Muktak; Haveman, Shelley; DiDonatoJr, Raymond

2012-01-01

Background: The bacterium Pelobacter carbinolicus is able to grow by fermentation, syntrophic hydrogen/formate transfer, or electron transfer to sulfur from short-chain alcohols, hydrogen or formate; it does not oxidize acetate and is not known to ferment any sugars or grow autotrophically. The genome of P. carbinolicus was sequenced in order to understand its metabolic capabilities and physiological features in comparison with its relatives, acetate-oxidizing Geobacter species. Results: Pathways were predicted for catabolism of known substrates: 2,3-butanediol, acetoin, glycerol, 1,2-ethanediol, ethanolamine, choline and ethanol. Multiple isozymes of 2,3-butanediol dehydrogenase, ATP synthase and [FeFe]-hydrogenase were differentiated and assigned roles according to theirmore » structural properties and genomic contexts. The absence of asparagine synthetase and the presence of a mutant tRNA for asparagine encoded among RNA-active enzymes suggest that P. carbinolicus may make asparaginyl-tRNA in a novel way. Catabolic glutamate dehydrogenases were discovered, implying that the tricarboxylic acid (TCA) cycle can function catabolically. A phosphotransferase system for uptake of sugars was discovered, along with enzymes that function in 2,3-butanediol production. Pyruvate: ferredoxin/flavodoxin oxidoreductase was identified as a potential bottleneck in both the supply of oxaloacetate for oxidation of acetate by the TCA cycle and the connection of glycolysis to production of ethanol. The P. carbinolicus genome was found to encode autotransporters and various appendages, including three proteins with similarity to the geopilin of electroconductive nanowires. Conclusions: Several surprising metabolic capabilities and physiological features were predicted from the genome of P. carbinolicus, suggesting that it is more versatile than anticipated.« less

Global Molecular Analyses of Methane Metabolism in Methanotrophic Alphaproteobacterium, Methylosinus trichosporium OB3b. Part I: Transcriptomic Study

PubMed Central

Matsen, Janet B.; Yang, Song; Stein, Lisa Y.; Beck, David; Kalyuzhnaya, Marina G.

2013-01-01

Methane utilizing bacteria (methanotrophs) are important in both environmental and biotechnological applications, due to their ability to convert methane to multicarbon compounds. However, systems-level studies of methane metabolism have not been carried out in methanotrophs. In this work we have integrated genomic and transcriptomic information to provide an overview of central metabolic pathways for methane utilization in Methylosinus trichosporium OB3b, a model alphaproteobacterial methanotroph. Particulate methane monooxygenase, PQQ-dependent methanol dehydrogenase, the H4MPT-pathway, and NAD-dependent formate dehydrogenase are involved in methane oxidation to CO2. All genes essential for operation of the serine cycle, the ethylmalonyl-CoA (EMC) pathway, and the citric acid (TCA) cycle were expressed. PEP-pyruvate-oxaloacetate interconversions may have a function in regulation and balancing carbon between the serine cycle and the EMC pathway. A set of transaminases may contribute to carbon partitioning between the pathways. Metabolic pathways for acquisition and/or assimilation of nitrogen and iron are discussed. PMID:23565111

Rapid cycling medical synchrotron and beam delivery system

DOEpatents

Peggs, Stephen G [Port Jefferson, NY; Brennan, J Michael [East Northport, NY; Tuozzolo, Joseph E [Sayville, NY; Zaltsman, Alexander [Commack, NY

2008-10-07

A medical synchrotron which cycles rapidly in order to accelerate particles for delivery in a beam therapy system. The synchrotron generally includes a radiofrequency (RF) cavity for accelerating the particles as a beam and a plurality of combined function magnets arranged in a ring. Each of the combined function magnets performs two functions. The first function of the combined function magnet is to bend the particle beam along an orbital path around the ring. The second function of the combined function magnet is to focus or defocus the particle beam as it travels around the path. The radiofrequency (RF) cavity is a ferrite loaded cavity adapted for high speed frequency swings for rapid cycling acceleration of the particles.

Androgen Receptor Functional Analyses by High Throughput Imaging: Determination of Ligand, Cell Cycle, and Mutation-Specific Effects

PubMed Central

Szafran, Adam T.; Szwarc, Maria; Marcelli, Marco; Mancini, Michael A.

2008-01-01

Background Understanding how androgen receptor (AR) function is modulated by exposure to steroids, growth factors or small molecules can have important mechanistic implications for AR-related disease therapies (e.g., prostate cancer, androgen insensitivity syndrome, AIS), and in the analysis of environmental endocrine disruptors. Methodology/Principal Findings We report the development of a high throughput (HT) image-based assay that quantifies AR subcellular and subnuclear distribution, and transcriptional reporter gene activity on a cell-by-cell basis. Furthermore, simultaneous analysis of DNA content allowed determination of cell cycle position and permitted the analysis of cell cycle dependent changes in AR function in unsynchronized cell populations. Assay quality for EC50 coefficients of variation were 5–24%, with Z' values reaching 0.91. This was achieved by the selective analysis of cells expressing physiological levels of AR, important because minor over-expression resulted in elevated nuclear speckling and decreased transcriptional reporter gene activity. A small screen of AR-binding ligands, including known agonists, antagonists, and endocrine disruptors, demonstrated that nuclear translocation and nuclear “speckling” were linked with transcriptional output, and specific ligands were noted to differentially affect measurements for wild type versus mutant AR, suggesting differing mechanisms of action. HT imaging of patient-derived AIS mutations demonstrated a proof-of-principle personalized medicine approach to rapidly identify ligands capable of restoring multiple AR functions. Conclusions/Significance HT imaging-based multiplex screening will provide a rapid, systems-level analysis of compounds/RNAi that may differentially affect wild type AR or clinically relevant AR mutations. PMID:18978937

Effects of resistance-guided high intensity interval functional electrical stimulation cycling on an individual with paraplegia: A case report.

PubMed

Dolbow, David R; Credeur, Daniel P

2018-03-01

Individuals with spinal cord injury (SCI) are more than twice as likely to develop and die from cardio-metabolic diseases as compared to able-bodied. This increased risk is thought to be in part due to accelerated muscle atrophy and reduced blood flow through sublesional arteries. Thus, strategies to recondition paralyzed skeletal muscles may help reduce cardio-metabolic disease risk. The purpose of this case report was to examine the impact of a novel, resistance-guided, high intensity interval training functional electrical stimulation (RG-HIIT-FES) cycling program on cardio-metabolic health in people with chronic SCI. One adult female with chronic T10 SCI. A novel RG-HIIT-FES cycling program three times per week for 10 weeks. Measures of body composition and cardio-metabolic health (vascular endothelial function of the brachial artery via flow-mediated dilation) and HbA1c blood values were performed at baseline and following completion of the RG-HIIT-FES program. Total body lean mass and legs lean mass increased 2.8% and 5.3% respectively while vastus lateralis thickness increased by 59.5%. Reactive hyperemia and flow mediated dilation change in brachial artery diameter increased by 11.1% and 147.7% following the program, respectively. HbA1c level changed minimally (5 to 4.9%). This case report suggests that RG-HIIT-FES cycling was an effective strategy to improve lean mass, and systemic vascular endothelial health in an individual with chronic SCI.

Inflammation promotes oral squamous carcinoma immune evasion via induced programmed death ligand-1 surface expression.

PubMed

Lu, Wanlu; Lu, Libing; Feng, Yun; Chen, Jiao; Li, Yan; Kong, Xiangli; Chen, Sixiu; Li, Xiaoyu; Chen, Qianming; Zhang, Ping

2013-05-01

The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8 + T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment.

Inflammation promotes oral squamous carcinoma immune evasion via induced programmed death ligand-1 surface expression

PubMed Central

LU, WANLU; LU, LIBING; FENG, YUN; CHEN, JIAO; LI, YAN; KONG, XIANGLI; CHEN, SIXIU; LI, XIAOYU; CHEN, QIANMING; ZHANG, PING

2013-01-01

The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8+ T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment PMID:23761816

Influences of Moisture Regimes and Functional Plant Types on Nutrient Cycling in Permafrost Regions

NASA Astrophysics Data System (ADS)

McCaully, R. E.; Arendt, C. A.; Newman, B. D.; Heikoop, J. M.; Wilson, C. J.; Sevanto, S.; Wales, N. A.; Wullschleger, S.

2017-12-01

In the permafrost-dominated Arctic, climatic feedbacks exist between permafrost, soil moisture, functional plant type and presence of nutrients. Functional plant types present within the Arctic regulate and respond to changes in hydrologic regimes and nutrient cycling. Specifically, alders are a member of the birch family that use root nodules to fix nitrogen, which is a limiting nutrient strongly linked to fertilizing Arctic ecosystems. Previous investigations in the Seward Peninsula, AK show elevated presence of nitrate within and downslope of alder patches in degraded permafrost systems, with concentrations an order of magnitude greater than that of nitrate measured above these patches. Further observations within these degraded permafrost systems are crucial to assess whether alders are drivers of, or merely respond to, nitrate fluxes. In addition to vegetative feedbacks with nitrate supply, previous studies have also linked low moisture content to high nitrate production. Within discontinuous permafrost regions, the absence of permafrost creates well-drained regions with unsaturated soils whereas the presence of permafrost limits vertical drainage of soil-pore water creating elevated soil moisture content, which likely corresponds to lower nitrate concentrations. We investigate these feedbacks further in the Seward Peninsula, AK, through research supported by the United States Department of Energy Next Generation Ecosystem Experiment (NGEE) - Arctic. Using soil moisture and thaw depth as proxies to determine the extent of permafrost degradation, we identify areas of discontinuous permafrost over a heterogeneous landscape and collect co-located soilwater chemistry samples to highlight the complex relationships that exist between alder patches, soil moisture regimes, the presence of permafrost and available nitrate supply. Understanding the role of nitrogen in degrading permafrost systems, in the context of both vegetation present and soil moisture, is crucial

A "footprint" of plant carbon fixation cycle functions during the development of a heterotrophic fungus.

PubMed

Lyu, Xueliang; Shen, Cuicui; Xie, Jiatao; Fu, Yanping; Jiang, Daohong; Hu, Zijin; Tang, Lihua; Tang, Liguang; Ding, Feng; Li, Kunfei; Wu, Song; Hu, Yanping; Luo, Lilian; Li, Yuanhao; Wang, Qihua; Li, Guoqing; Cheng, Jiasen

2015-08-11

Carbon fixation pathway of plants (CFPP) in photosynthesis converts solar energy to biomass, bio-products and biofuel. Intriguingly, a large number of heterotrophic fungi also possess enzymes functionally associated with CFPP, raising the questions about their roles in fungal development and in evolution. Here, we report on the presence of 17 CFPP associated enzymes (ten in Calvin-Benson-Basham reductive pentose phosphate pathway and seven in C4-dicarboxylic acid cycle) in the genome of Sclerotinia sclerotiorum, a heterotrophic phytopathogenic fungus, and only two unique enzymes: ribulose-1, 5-bisphosphate carboxylase-oxygenase (Rubisco) and phosphoribulokinase (PRK) were absent. This data suggested an incomplete CFPP-like pathway (CLP) in fungi. Functional profile analysis demonstrated that the activity of the incomplete CLP was dramatically regulated during different developmental stages of S. sclerotiorum. Subsequent experiments confirmed that many of them were essential to the virulence and/or sclerotial formation. Most of the CLP associated genes are conserved in fungi. Phylogenetic analysis showed that many of them have undergone gene duplication, gene acquisition or loss and functional diversification in evolutionary history. These findings showed an evolutionary links in the carbon fixation processes of autotrophs and heterotrophs and implicated the functions of related genes were in course of continuous change in different organisms in evolution.

Glucose enhances tilapia against Edwardsiella tarda infection through metabolome reprogramming.

PubMed

Zeng, Zao-hai; Du, Chao-Chao; Liu, Shi-Rao; Li, Hui; Peng, Xuan-Xian; Peng, Bo

2017-02-01

We have recently reported that the survival of tilapia, Oreochromis niloticus, during Edwardsiella tarda infection is tightly associated with their metabolome, where the survived O. niloticus has distinct metabolomic profile to dying O. niloticus. Glucose is the key metabolite to distinguish the survival- and dying-metabolome. More importantly, exogenous administration of glucose to the fish greatly enhances their survival for the infection, indicating the functional roles of glucose in metabolome repurposing, known as reprogramming metabolomics. However, the underlying information for the reprogramming is not yet available. Here, GC/MS based metabolomics is used to understand the mechanisms by which how exogenous glucose elevates O. niloticus, anti-infectious ability to E. tarda. Results showed that exogenous glucose promotes stearic acid and palmitic acid biosynthesis but attenuates TCA cycle to potentiate O. niloticus against bacterial infection, which is confirmed by the fact that exogenous stearic acid increases immune protection in O. niloticus against E. tarda infection in a manner of Mx protein. These results indicate that exogenous glucose reprograms O. niloticus anti-infective metabolome that characterizes elevation of stearic acid and palmitic acid and attenuation of the TCA cycle. Therefore, our results proposed a novel mechanism that glucose promotes unsaturated fatty acid biosynthesis to cope with infection, thereby highlighting a potential way of enhancing fish immunity in aquaculture. Copyright © 2016 Elsevier Ltd. All rights reserved.

Integrated metabolomic and proteomic analysis reveals systemic responses of Rubrivivax benzoatilyticus JA2 to aniline stress.

PubMed

Mujahid, Md; Prasuna, M Lakshmi; Sasikala, Ch; Ramana, Ch Venkata

2015-02-06

Aromatic amines are widely distributed in the environment and are major environmental pollutants. Although degradation of aromatic amines is well studied in bacteria, physiological adaptations and stress response to these toxic compounds is not yet fully understood. In the present study, systemic responses of Rubrivivax benzoatilyticus JA2 to aniline stress were deciphered using metabolite and iTRAQ-labeled protein profiling. Strain JA2 tolerated high concentrations of aniline (30 mM) with trace amounts of aniline being transformed to acetanilide. GC-MS metabolite profiling revealed aniline stress phenotype wherein amino acid, carbohydrate, fatty acid, nitrogen metabolisms, and TCA (tricarboxylic acid cycle) were modulated. Strain JA2 responded to aniline by remodeling the proteome, and cellular functions, such as signaling, transcription, translation, stress tolerance, transport and carbohydrate metabolism, were highly modulated. Key adaptive responses, such as transcription/translational changes, molecular chaperones to control protein folding, and efflux pumps implicated in solvent extrusion, were induced in response to aniline stress. Proteo-metabolomics indicated extensive rewiring of metabolism to aniline. TCA cycle and amino acid catabolism were down-regulated while gluconeogenesis and pentose phosphate pathways were up-regulated, leading to the synthesis of extracellular polymeric substances. Furthermore, increased saturated fatty acid ratios in membranes due to aniline stress suggest membrane adaptation. The present study thus indicates that strain JA2 employs multilayered responses: stress response, toxic compound tolerance, energy conservation, and metabolic rearrangements to aniline.

Nutrient Dependence of RNase E Essentiality in Escherichia coli

PubMed Central

Tamura, Masaru; Moore, Christopher J.

2013-01-01

Escherichia coli cells normally require RNase E activity to form colonies (colony-forming ability [CFA]). The CFA-defective phenotype of cells lacking RNase E is partly reversed by overexpression of the related endoribonuclease RNase G or by mutation of the gene encoding the RNA helicase DeaD. We found that the carbon source utilization by rne deaD doubly mutant bacteria differs from that of rne+ cells and from that of cells mutated in deaD alone and that the loss of rne function in these bacteria limits conversion of the glycolytic pathway product phosphoenolpyruvate to the tricarboxylic acid (TCA) cycle intermediate oxaloacetic acid. We show that the mechanism underlying this effect is reduced production of the enzyme phosphoenolpyruvate carboxylase (PPC) and that adventitious overexpression of PPC, which facilitates phosphoenolpyruvate utilization and connects the glycolytic pathway with the TCA cycle, restored CFA to rne deaD mutant bacteria cultured on carbon sources that otherwise were unable to sustain growth. We further show that bacteria producing full-length RNase E, which allows formation of degradosomes, have nutritional requirements different from those of cells supplied with only the N-terminal catalytic region of RNase E and that mitigation of RNase E deficiency by overexpression of a related RNase, RNase G, is also affected by carbon source. Our results reveal previously unsuspected effects of RNase E deficiency and degradosome formation on nutrient utilization by E. coli cells. PMID:23275245

Phosphonate Analogs of 2-Oxoglutarate Perturb Metabolism and Gene Expression in Illuminated Arabidopsis Leaves

PubMed Central

Araújo, Wagner L.; Tohge, Takayuki; Nunes-Nesi, Adriano; Daloso, Danilo M.; Nimick, Mhairi; Krahnert, Ina; Bunik, Victoria I.; Moorhead, Greg B. G.; Fernie, Alisdair R.

2012-01-01

Although the role of the 2-oxoglutarate dehydrogenase complex (2-OGDHC) has previously been demonstrated in plant heterotrophic tissues its role in photosynthetically active tissues remains poorly understood. By using a combination of metabolite and transcript profiles we here investigated the function of 2-OGDHC in leaves of Arabidopsis thaliana via use of specific phosphonate inhibitors of the enzyme. Incubation of leaf disks with the inhibitors revealed that they produced the anticipated effects on the in situ enzyme activity. In vitro experiments revealed that succinyl phosphonate (SP) and a carboxy ethyl ester of SP are slow-binding inhibitors of the 2-OGDHC. Our results indicate that the reduced respiration rates are associated with changes in the regulation of metabolic and signaling pathways leading to an imbalance in carbon-nitrogen metabolism and cell homeostasis. The inducible alteration of primary metabolism was associated with altered expression of genes belonging to networks of amino acids, plant respiration, and sugar metabolism. In addition, by using isothermal titration calorimetry we excluded the possibility that the changes in gene expression resulted from an effect on 2-oxoglutarate (2OG) binding to the carbon/ATP sensing protein PII. We also demonstrated that the 2OG degradation by the 2-oxoglutarate dehydrogenase strongly influences the distribution of intermediates of the tricarboxylic acid (TCA) cycle and the GABA shunt. Our results indicate that the TCA cycle activity is clearly working in a non-cyclic manner upon 2-OGDHC inhibition during the light period. PMID:22876250

The contribution of ketone bodies to basal and activity-dependent neuronal oxidation in vivo.

PubMed

Chowdhury, Golam M I; Jiang, Lihong; Rothman, Douglas L; Behar, Kevin L

2014-07-01

The capacity of ketone bodies to replace glucose in support of neuronal function is unresolved. Here, we determined the contributions of glucose and ketone bodies to neocortical oxidative metabolism over a large range of brain activity in rats fasted 36 hours and infused intravenously with [2,4-(13)C₂]-D-β-hydroxybutyrate (BHB). Three animal groups and conditions were studied: awake ex vivo, pentobarbital-induced isoelectricity ex vivo, and halothane-anesthetized in vivo, the latter data reanalyzed from a recent study. Rates of neuronal acetyl-CoA oxidation from ketone bodies (V(acCoA-kbN)) and pyruvate (V(pdhN)), and the glutamate-glutamine cycle (V(cyc)) were determined by metabolic modeling of (13)C label trapped in major brain amino acid pools. V(acCoA-kbN) increased gradually with increasing activity, as compared with the steeper change in tricarboxylic acid (TCA) cycle rate (V(tcaN)), supporting a decreasing percentage of neuronal ketone oxidation: ∼100% (isoelectricity), 56% (halothane anesthesia), 36% (awake) with the BHB plasma levels achieved in our experiments (6 to 13 mM). In awake animals ketone oxidation reached saturation for blood levels >17 mM, accounting for 62% of neuronal substrate oxidation, the remainder (38%) provided by glucose. We conclude that ketone bodies present at sufficient concentration to saturate metabolism provides full support of basal (housekeeping) energy needs and up to approximately half of the activity-dependent oxidative needs of neurons.

Prediction of Functional Overreaching From Subjective Fatigue and Readiness to Train After Only 3 Days of Cycling.

PubMed

Ten Haaf, Twan; van Staveren, Selma; Oudenhoven, Erik; Piacentini, Maria F; Meeusen, Romain; Roelands, Bart; Koenderman, Leo; Daanen, Hein A M; Foster, Carl; de Koning, Jos J

2017-04-01

To investigate whether monitoring of easily measurable stressors and symptoms can be used to distinguish early between acute fatigue (AF) and functional overreaching (FOR). The study included 30 subjects (11 female, 19 male; age 40.8 ± 10.8 y, VO 2 max 51.8 ± 6.3 mL · kg -1 · min -1 ) who participated in an 8-d cycling event over 1300 km with 18,500 climbing meters. Performance was measured before and after the event using a maximal incremental test. Subjects with decreased performance after the event were classified as FOR, others as AF. Mental and physical well-being, internal training load, resting heart rate, temperature, and mood were measured daily during the event. Differences between AF and FOR were analyzed using mixed-model ANOVAs. Logistic regression was used to determine the best predictors of FOR after 3 and 6 d of cycling. Fifteen subjects were classified as FOR and 14 as AF (1 excluded). Although total group changes were observed during the event, no differences between AF and FOR were found for individual monitoring parameters. The combination of questionnaire-based changes in fatigue and readiness to train after 3 d cycling correctly predicted 78% of the subjects as AF or FOR (sensitivity = 79%, specificity = 77%). Monitoring changes in fatigue and readiness to train, using simple visual analog scales, can be used to identify subjects likely to become FOR after only 3 d of cycling. Hence, we encourage athlete support staff to monitor not only fatigue but also the subjective integrated mental and physical readiness to perform.

Analytic approximation for random muffin-tin alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mills, R.; Gray, L.J.; Kaplan, T.

1983-03-15

The methods introduced in a previous paper under the name of ''traveling-cluster approximation'' (TCA) are applied, in a multiple-scattering approach, to the case of a random muffin-tin substitutional alloy. This permits the iterative part of a self-consistent calculation to be carried out entirely in terms of on-the-energy-shell scattering amplitudes. Off-shell components of the mean resolvent, needed for the calculation of spectral functions, are obtained by standard methods involving single-site scattering wave functions. The single-site TCA is just the usual coherent-potential approximation, expressed in a form particularly suited for iteration. A fixed-point theorem is proved for the general t-matrix TCA, ensuringmore » convergence upon iteration to a unique self-consistent solution with the physically essential Herglotz properties.« less

Limit cycles and conformal invariance

NASA Astrophysics Data System (ADS)

Fortin, Jean-François; Grinstein, Benjamín; Stergiou, Andreas

2013-01-01

There is a widely held belief that conformal field theories (CFTs) require zero beta functions. Nevertheless, the work of Jack and Osborn implies that the beta functions are not actually the quantites that decide conformality, but until recently no such behavior had been exhibited. Our recent work has led to the discovery of CFTs with nonzero beta functions, more precisely CFTs that live on recurrent trajectories, e.g., limit cycles, of the beta-function vector field. To demonstrate this we study the S function of Jack and Osborn. We use Weyl consistency conditions to show that it vanishes at fixed points and agrees with the generator Q of limit cycles on them. Moreover, we compute S to third order in perturbation theory, and explicitly verify that it agrees with our previous determinations of Q. A byproduct of our analysis is that, in perturbation theory, unitarity and scale invariance imply conformal invariance in four-dimensional quantum field theories. Finally, we study some properties of these new, "cyclic" CFTs, and point out that the a-theorem still governs the asymptotic behavior of renormalization-group flows.

Metabolic Analysis of Adaptation to Short-Term Changes in Culture Conditions of the Marine Diatom Thalassiosira pseudonana

PubMed Central

Bromke, Mariusz A.; Giavalisco, Patrick; Willmitzer, Lothar; Hesse, Holger

2013-01-01

This report describes the metabolic and lipidomic profiling of 97 low-molecular weight compounds from the primary metabolism and 124 lipid compounds of the diatom Thalassiosira pseudonana. The metabolic profiles were created for diatoms perturbed for 24 hours with four different treatments: (I) removal of nitrogen, (II) lower iron concentration, (III) addition of sea salt, (IV) addition of carbonate to their growth media. Our results show that as early as 24 hours after nitrogen depletion significant qualitative and quantitative change in lipid composition as well as in the primary metabolism of Thalassiosira pseudonana occurs. So we can observe the accumulation of several storage lipids, namely triacylglycerides, and TCA cycle intermediates, of which citric acid increases more than 10-fold. These changes are positively correlated with expression of TCA enzymes genes. Next to the TCA cycle intermediates and storage lipid changes, we have observed decrease in N-containing lipids and primary metabolites such as amino acids. As a measure of counteracting nitrogen starvation, we have observed elevated expression levels of nitrogen uptake and amino acid biosynthetic genes. This indicates that diatoms can fast and efficiently adapt to changing environment by altering the metabolic fluxes and metabolite abundances. Especially, the accumulation of proline and the decrease of dimethylsulfoniopropionate suggest that the proline is the main osmoprotectant for the diatom in nitrogen rich conditions. PMID:23799147

Reduced expression of fumarate hydratase in clear cell renal cancer mediates HIF-2α accumulation and promotes migration and invasion.

PubMed

Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen

2011-01-01

Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.

c-Myc and AMPK Control Cellular Energy Levels by Cooperatively Regulating Mitochondrial Structure and Function

PubMed Central

Edmunds, Lia R.; Sharma, Lokendra; Wang, Huabo; Kang, Audry; d’Souza, Sonia; Lu, Jie; McLaughlin, Michael; Dolezal, James M.; Gao, Xiaoli; Weintraub, Susan T.; Ding, Ying; Zeng, Xuemei; Yates, Nathan; Prochownik, Edward V.

2015-01-01

The c-Myc (Myc) oncoprotein and AMP-activated protein kinase (AMPK) regulate glycolysis and oxidative phosphorylation (Oxphos) although often for different purposes. Because Myc over-expression depletes ATP with the resultant activation of AMPK, we explored the potential co-dependency of and cross-talk between these proteins by comparing the consequences of acute Myc induction in ampk+/+ (WT) and ampk-/- (KO) murine embryo fibroblasts (MEFs). KO MEFs showed a higher basal rate of glycolysis than WT MEFs and an appropriate increase in response to activation of a Myc-estrogen receptor (MycER) fusion protein. However, KO MEFs had a diminished ability to increase Oxphos, mitochondrial mass and reactive oxygen species in response to MycER activation. Other differences between WT and KO MEFs, either in the basal state or following MycER induction, included abnormalities in electron transport chain function, levels of TCA cycle-related oxidoreductases and cytoplasmic and mitochondrial redox states. Transcriptional profiling of pathways pertinent to glycolysis, Oxphos and mitochondrial structure and function also uncovered significant differences between WT and KO MEFs and their response to MycER activation. Finally, an unbiased mass-spectrometry (MS)-based survey capable of quantifying ~40% of all mitochondrial proteins, showed about 15% of them to be AMPK- and/or Myc-dependent in their steady state. Significant differences in the activities of the rate-limiting enzymes pyruvate kinase and pyruvate dehydrogenase, which dictate pyruvate and acetyl coenzyme A abundance, were also differentially responsive to Myc and AMPK and could account for some of the differences in basal metabolite levels that were also detected by MS. Thus, Myc and AMPK are highly co-dependent and appear to engage in significant cross-talk across numerous pathways which support metabolic and ATP-generating functions. PMID:26230505

Overexpression of the NADP+-specific isocitrate dehydrogenase gene (icdA) in citric acid-producing Aspergillus niger WU-2223L.

PubMed

Kobayashi, Keiichi; Hattori, Takasumi; Hayashi, Rie; Kirimura, Kohtaro

2014-01-01

In the tricarboxylic acid (TCA) cycle, NADP(+)-specific isocitrate dehydrogenase (NADP(+)-ICDH) catalyzes oxidative decarboxylation of isocitric acid to form α-ketoglutaric acid with NADP(+) as a cofactor. We constructed an NADP(+)-ICDH gene (icdA)-overexpressing strain (OPI-1) using Aspergillus niger WU-2223L as a host and examined the effects of increase in NADP(+)-ICDH activity on citric acid production. Under citric acid-producing conditions with glucose as the carbon source, the amounts of citric acid produced and glucose consumed by OPI-1 for the 12-d cultivation period decreased by 18.7 and 10.5%, respectively, compared with those by WU-2223L. These results indicate that the amount of citric acid produced by A. niger can be altered with the NADP(+)-ICDH activity. Therefore, NADP(+)-ICDH is an important regulator of citric acid production in the TCA cycle of A. niger. Thus, we propose that the icdA gene is a potentially valuable tool for modulating citric acid production by metabolic engineering.

SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less

Potential hepatic toxicity of buprofezin at sublethal concentrations: ROS-mediated conversion of energy metabolism.

PubMed

Ji, Xiaotong; Ku, Tingting; Zhu, Na; Ning, Xia; Wei, Wei; Li, Guangke; Sang, Nan

2016-12-15

Buprofezin is known for its broad-spectrum action and environmental safety. The popularity of buprofezin has raised concerns about its potentially adverse effects on human health and risk to the environment. In this study, we first identified the liver as one of the major organs in which buprofezin accumulated, and we detected a severe oxidative stress response. Next, we demonstrated that sublethal concentrations of buprofezin promoted the conversion of energy metabolism from the aerobic tricarboxylic acid (TCA) cycle and oxidative phosphorylation to anaerobic glycolysis. Importantly, reactive oxygen species (ROS) generation partially accounted for the shunting of the energy metabolism through the buprofezin-mediated inhibition of cytochrome c oxidase activity. ROS directly perturbed the activities of several key TCA cycle enzymes, stimulated glycolysis, and indirectly disturbed the activity of the respiratory chain complex by altering mitochondrial DNA (mtDNA). These findings clarify the potential mechanisms of buprofezin toxicity and provide biomarkers for buprofezin-mediated hepatotoxicity at sublethal concentrations. Copyright © 2016 Elsevier B.V. All rights reserved.

SbnG, a Citrate Synthase in Staphylococcus aureus

PubMed Central

Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; Heinrichs, David E.; Murphy, Michael E. P.

2014-01-01

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. PMID:25336653

SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme

DOE PAGES

Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; ...

2014-10-21

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less

SbnG, a citrate synthase in Staphylococcus aureus: a new fold on an old enzyme.

PubMed

Kobylarz, Marek J; Grigg, Jason C; Sheldon, Jessica R; Heinrichs, David E; Murphy, Michael E P

2014-12-05

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Cell cycle control, checkpoint mechanisms, and genotoxic stress.

PubMed Central

Shackelford, R E; Kaufmann, W K; Paules, R S

1999-01-01

The ability of cells to maintain genomic integrity is vital for cell survival and proliferation. Lack of fidelity in DNA replication and maintenance can result in deleterious mutations leading to cell death or, in multicellular organisms, cancer. The purpose of this review is to discuss the known signal transduction pathways that regulate cell cycle progression and the mechanisms cells employ to insure DNA stability in the face of genotoxic stress. In particular, we focus on mammalian cell cycle checkpoint functions, their role in maintaining DNA stability during the cell cycle following exposure to genotoxic agents, and the gene products that act in checkpoint function signal transduction cascades. Key transitions in the cell cycle are regulated by the activities of various protein kinase complexes composed of cyclin and cyclin-dependent kinase (Cdk) molecules. Surveillance control mechanisms that check to ensure proper completion of early events and cellular integrity before initiation of subsequent events in cell cycle progression are referred to as cell cycle checkpoints and can generate a transient delay that provides the cell more time to repair damage before progressing to the next phase of the cycle. A variety of cellular responses are elicited that function in checkpoint signaling to inhibit cyclin/Cdk activities. These responses include the p53-dependent and p53-independent induction of Cdk inhibitors and the p53-independent inhibitory phosphorylation of Cdk molecules themselves. Eliciting proper G1, S, and G2 checkpoint responses to double-strand DNA breaks requires the function of the Ataxia telangiectasia mutated gene product. Several human heritable cancer-prone syndromes known to alter DNA stability have been found to have defects in checkpoint surveillance pathways. Exposures to several common sources of genotoxic stress, including oxidative stress, ionizing radiation, UV radiation, and the genotoxic compound benzo[a]pyrene, elicit cell cycle

The polyamines of Xanthium strumarium and their response to photoperiod.

PubMed

Hamasaki, N; Galston, A W

1990-01-01

Flowering plants of Xanthium strumarium L., grown in 8 h photoperiods, were analysed for polyamines. Putrescine, spermidine and spermine were found throughout the plant in three forms: (a) as free polyamines; (b) conjugates soluble in 5% trichloracetic acid (TCA); and (c) bound to the TCA-insoluble precipitate. On a fresh weight basis, total polyamines are most abundant in young leaves and buds, especially flower buds. Spermidine predominates in the free polyamine fractions, while spermine is dominant in the conjugated fraction. Transfer of vegetative plants from 16 h photoperiods to 1, 2, 3, or 4 inductive cycles (8 h light + 16 h uninterrupted dark) caused rapid and marked changes in the polyamine titer of the leaves and ultimately, floral initiation. The titer of free putrescine per mg protein declined progressively with induction in all leaf sizes, while the titers of free spermidine and spermine rose during days 2 and 3 in small and expanding leaves. Conjugated putrescine, spermidine and spermine rose sharply after only 1 inductive cycle, especially in small and expanding leaves, and maintained the higher level for at least several cycles. In plants given 4 inductive cycles, buds harvested after 4 additional days had sharply elevated levels of conjugated polyamines, especially spermine, on a protein basis.

Cell cycle-coupled expansion of AR activity promotes cancer progression.

PubMed

McNair, C; Urbanucci, A; Comstock, C E S; Augello, M A; Goodwin, J F; Launchbury, R; Zhao, S G; Schiewer, M J; Ertel, A; Karnes, J; Davicioni, E; Wang, L; Wang, Q; Mills, I G; Feng, F Y; Li, W; Carroll, J S; Knudsen, K E

2017-03-23

The androgen receptor (AR) is required for prostate cancer (PCa) survival and progression, and ablation of AR activity is the first line of therapeutic intervention for disseminated disease. While initially effective, recurrent tumors ultimately arise for which there is no durable cure. Despite the dependence of PCa on AR activity throughout the course of disease, delineation of the AR-dependent transcriptional network that governs disease progression remains elusive, and the function of AR in mitotically active cells is not well understood. Analyzing AR activity as a function of cell cycle revealed an unexpected and highly expanded repertoire of AR-regulated gene networks in actively cycling cells. New AR functions segregated into two major clusters: those that are specific to cycling cells and retained throughout the mitotic cell cycle ('Cell Cycle Common'), versus those that were specifically enriched in a subset of cell cycle phases ('Phase Restricted'). Further analyses identified previously unrecognized AR functions in major pathways associated with clinical PCa progression. Illustrating the impact of these unmasked AR-driven pathways, dihydroceramide desaturase 1 was identified as an AR-regulated gene in mitotically active cells that promoted pro-metastatic phenotypes, and in advanced PCa proved to be highly associated with development of metastases, recurrence after therapeutic intervention and reduced overall survival. Taken together, these findings delineate AR function in mitotically active tumor cells, thus providing critical insight into the molecular basis by which AR promotes development of lethal PCa and nominate new avenues for therapeutic intervention.

Dual Functions of α-Ketoglutarate Dehydrogenase E2 in the Krebs Cycle and Mitochondrial DNA Inheritance in Trypanosoma brucei

PubMed Central

Sykes, Steven E.

2013-01-01

The dihydrolipoyl succinyltransferase (E2) of the multisubunit α-ketoglutarate dehydrogenase complex (α-KD) is an essential Krebs cycle enzyme commonly found in the matrices of mitochondria. African trypanosomes developmentally regulate mitochondrial carbohydrate metabolism and lack a functional Krebs cycle in the bloodstream of mammals. We found that despite the absence of a functional α-KD, bloodstream form (BF) trypanosomes express α-KDE2, which localized to the mitochondrial matrix and inner membrane. Furthermore, α-KDE2 fractionated with the mitochondrial genome, the kinetoplast DNA (kDNA), in a complex with the flagellum. A role for α-KDE2 in kDNA maintenance was revealed in α-KDE2 RNA interference (RNAi) knockdowns. Following RNAi induction, bloodstream trypanosomes showed pronounced growth reduction and often failed to equally distribute kDNA to daughter cells, resulting in accumulation of cells devoid of kDNA (dyskinetoplastic) or containing two kinetoplasts. Dyskinetoplastic trypanosomes lacked mitochondrial membrane potential and contained mitochondria of substantially reduced volume. These results indicate that α-KDE2 is bifunctional, both as a metabolic enzyme and as a mitochondrial inheritance factor necessary for the distribution of kDNA networks to daughter cells at cytokinesis. PMID:23125353

Dual functions of α-ketoglutarate dehydrogenase E2 in the Krebs cycle and mitochondrial DNA inheritance in Trypanosoma brucei.

PubMed

Sykes, Steven E; Hajduk, Stephen L

2013-01-01

The dihydrolipoyl succinyltransferase (E2) of the multisubunit α-ketoglutarate dehydrogenase complex (α-KD) is an essential Krebs cycle enzyme commonly found in the matrices of mitochondria. African trypanosomes developmentally regulate mitochondrial carbohydrate metabolism and lack a functional Krebs cycle in the bloodstream of mammals. We found that despite the absence of a functional α-KD, bloodstream form (BF) trypanosomes express α-KDE2, which localized to the mitochondrial matrix and inner membrane. Furthermore, α-KDE2 fractionated with the mitochondrial genome, the kinetoplast DNA (kDNA), in a complex with the flagellum. A role for α-KDE2 in kDNA maintenance was revealed in α-KDE2 RNA interference (RNAi) knockdowns. Following RNAi induction, bloodstream trypanosomes showed pronounced growth reduction and often failed to equally distribute kDNA to daughter cells, resulting in accumulation of cells devoid of kDNA (dyskinetoplastic) or containing two kinetoplasts. Dyskinetoplastic trypanosomes lacked mitochondrial membrane potential and contained mitochondria of substantially reduced volume. These results indicate that α-KDE2 is bifunctional, both as a metabolic enzyme and as a mitochondrial inheritance factor necessary for the distribution of kDNA networks to daughter cells at cytokinesis.