Common variant rs356182 near SNCA defines a Parkinson's disease endophenotype.

PubMed

Cooper, Christine A; Jain, Nimansha; Gallagher, Michael D; Weintraub, Daniel; Xie, Sharon X; Berlyand, Yosef; Espay, Alberto J; Quinn, Joseph; Edwards, Karen L; Montine, Thomas; Van Deerlin, Vivianna M; Trojanowski, John; Zabetian, Cyrus P; Chen-Plotkin, Alice S

2017-01-01

Parkinson's disease (PD) presents clinically with several motor subtypes that exhibit variable treatment response and prognosis. Here, we investigated genetic variants for their potential association with PD motor phenotype and progression. We screened 10 SNPs, previously associated with PD risk, for association with tremor-dominant (TD) versus postural-instability gait disorder (PIGD) motor subtypes. SNPs that correlated with the TD/PIGD ratio in a discovery cohort of 251 PD patients were then evaluated in a multi-site replication cohort of 559 PD patients. SNPs associated with motor phenotype in both cross-sectional cohorts were next evaluated for association with (1) rates of motor progression in a longitudinal subgroup of 230 PD patients and (2) brain alpha-synuclein ( SNCA ) expression in the GTEx (Genotype-Tissue Expression project) consortium database. Genotype at rs356182, near SNCA , correlated with the TD/PIGD ratio in both the discovery (Bonferroni-corrected P = 0.04) and replication cohorts ( P = 0.02). The rs356182 GG genotype was associated with a more tremor-predominant phenotype and predicted a slower rate of motor progression (1-point difference in annual rate of UPDRS-III motor score change, P = 0.01). The rs356182 genotype was associated with SNCA expression in the cerebellum ( P = 0.005). Our study demonstrates that the GG genotype at rs356182 provides molecular definition for a clinically important endophenotype associated with (1) more tremor-predominant motor phenomenology, (2) slower rates of motor progression, and (3) decreased brain expression of SNCA . Such molecularly defined endophenotyping in PD may benefit both clinical trial design and tailoring of clinical care as we enter the era of precision medicine.

Spectroscopic (FT-IR, FT-Raman and UV-Visible) investigations, NMR chemical shielding anisotropy (CSA) parameters of 2,6-Diamino-4-chloropyrimidine for dye sensitized solar cells using density functional theory.

PubMed

Gladis Anitha, E; Joseph Vedhagiri, S; Parimala, K

2015-02-05

The molecular structure, geometry optimization, vibrational frequencies of organic dye sensitizer 2,6-Diamino-4-chloropyrimidine (DACP) were studied based on Hartree-Fock (HF) and density functional theory (DFT) using B3LYP methods with 6-311++G(d,p) basis set. Ultraviolet-Visible (UV-Vis) spectrum was investigated by time dependent DFT (TD-DFT). Features of the electronic absorption spectrum in the UV-Visible regions were assigned based on TD-DFT calculation. The absorption bands are assigned to transitions. The interfacial electron transfer between semiconductor TiO2 electrode and dye sensitizer DACP is due to an electron injection process from excited dye to the semiconductor's conduction band. The observed and the calculated frequencies are found to be in good agreement. The energies of the frontier molecular orbitals (FMOS) have also been determined. The chemical shielding anisotropic (CSA) parameters are calculated from the NMR analysis, Stability of the molecule arising from hyperconjugative interactions and charge delocalization has been analyzed using natural bond orbital (NBO) analysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Solvent effects on the properties of hyperbranched polythiophenes.

PubMed

Torras, Juan; Zanuy, David; Aradilla, David; Alemán, Carlos

2016-09-21

The structural and electronic properties of all-thiophene dendrimers and dendrons in solution have been evaluated using very different theoretical approaches based on quantum mechanical (QM) and hybrid QM/molecular mechanics (MM) methodologies: (i) calculations on minimum energy conformations using an implicit solvation model in combination with density functional theory (DFT) or time-dependent DFT (TD-DFT) methods; (ii) hybrid QM/MM calculations, in which the solute and solvent molecules are represented at the DFT level as point charges, respectively, on snapshots extracted from classical molecular dynamics (MD) simulations using explicit solvent molecules, and (iii) QM/MM-MD trajectories in which the solute is described at the DFT or TD-DFT level and the explicit solvent molecules are represented using classical force-fields. Calculations have been performed in dichloromethane, tetrahydrofuran and dimethylformamide. A comparison of the results obtained using the different approaches with the available experimental data indicates that the incorporation of effects associated with both the conformational dynamics of the dendrimer and the explicit solvent molecules is strictly necessary to satisfactorily reproduce the properties of the investigated systems. Accordingly, QM/MM-MD simulations are able to capture such effects providing a reliable description of electronic properties-conformational flexibility relationships in all-Th dendrimers.

Molecular structure, Normal Coordinate Analysis, harmonic vibrational frequencies, Natural Bond Orbital, TD-DFT calculations and biological activity analysis of antioxidant drug 7-hydroxycoumarin

NASA Astrophysics Data System (ADS)

Sebastian, S.; Sylvestre, S.; Jayarajan, D.; Amalanathan, M.; Oudayakumar, K.; Gnanapoongothai, T.; Jayavarthanan, T.

2013-01-01

In this work, we report harmonic vibrational frequencies, molecular structure, NBO and HOMO, LUMO analysis of Umbelliferone also known as 7-hydroxycoumarin (7HC). The optimized geometric bond lengths and bond angles obtained by computation (monomer and dimmer) shows good agreement with experimental XRD data. Harmonic frequencies of 7HC were determined and analyzed by DFT utilizing 6-311+G(d,p) as basis set. The assignments of the vibrational spectra have been carried out with the help of Normal Coordinate Analysis (NCA) following the Scaled Quantum Mechanical Force Field Methodology (SQMFF). The change in electron density (ED) in the σ* and π* antibonding orbitals and stabilization energies E(2) have been calculated by Natural Bond Orbital (NBO) analysis to give clear evidence of stabilization originating in the hyperconjugation of hydrogen-bonded interaction. The energy and oscillator strength calculated by Time-Dependent Density Functional Theory (TD-DFT) complements with the experimental findings. The simulated spectra satisfactorily coincides with the experimental spectra. Microbial activity of studied compounds was tested against Staphylococcus aureus, Streptococcus pyogenes, Bacillus subtilis, Escherichia coli, Psuedomonas aeruginosa, Klebsiella pneumoniae, Proteus mirabilis, Shigella flexneri, Salmonella typhi and Enterococcus faecalis.

Muon Intensity Increase by Wedge Absorbers for Low-E Muon Experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neuffer, D. V.; Stratakis, D.; Bradley, J.

2017-09-01

Low energy muon experiments such as mu2e and g-2 have a limited energy spread acceptance. Following techniques developed in muon cooling studies and the MICE experiment, the number of muons within the desired energy spread can be increased by the matched use of wedge absorbers. More generally, the phase space of muon beams can be manipulated by absorbers in beam transport lines. Applications with simulation results are presented.

R&D Toward a Neutrino Factory and Muon Collider

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zisman, Michael S

2011-03-20

Significant progress has been made in recent years in R&D towards a neutrino factory and muon collider. The U.S. Muon Accelerator Program (MAP) has been formed recently to expedite the R&D efforts. This paper will review the U.S. MAP R&D programs for a neutrino factory and muon collider. Muon ionization cooling research is the key element of the program. The first muon ionization cooling demonstration experiment, MICE (Muon Ionization Cooling Experiment), is under construction now at RAL (Rutherford Appleton Laboratory) in the UK. The current status of MICE will be described.

A three-dimensional code for muon propagation through the rock: MUSIC

NASA Astrophysics Data System (ADS)

Antonioli, P.; Ghetti, C.; Korolkova, E. V.; Kudryavtsev, V. A.; Sartorelli, G.

1997-10-01

We present a new three-dimensional Monte-Carlo code MUSIC (MUon SImulation Code) for muon propagation through the rock. All processes of muon interaction with matter with high energy loss (including the knock-on electron production) are treated as stochastic processes. The angular deviation and lateral displacement of muons due to multiple scattering, as well as bremsstrahlung, pair production and inelastic scattering are taken into account. The code has been applied to obtain the energy distribution and angular and lateral deviations of single muons at different depths underground. The muon multiplicity distributions obtained with MUSIC and CORSIKA (Extensive Air Shower simulation code) are also presented. We discuss the systematic uncertainties of the results due to different muon bremsstrahlung cross-sections.

On muon energy spectrum in muon groups underground

NASA Technical Reports Server (NTRS)

Bakatanov, V. N.; Chudakov, A. E.; Novoseltsev, Y. F.; Novoseltseva, M. V.; Stenkin, Y. V.

1985-01-01

A method is described which was used to measure muon energy spectrum characteristics in muon groups underground using mu-e decays recording. The Baksan Telescope's experimental data on mu-e decays intensity in muon groups of various multiplicities are analyzed. The experimental data indicating very flat spectrum does not however represent the total spectrum in muon groups. Obviously the muon energy spectrum depends strongly on a distance from the group axis. The core attraction effect makes a significant distortion, making the spectrum flatter. After taking this into account and making corrections for this effect the integral total spectrum index in groups has a very small depencence on muon multiplicity and agrees well with expected one: beta=beta (sub expected) = 1.75.

Observation of seasonal variation of atmospheric multiple-muon events in the MINOS Near and Far Detectors

DOE PAGES

Adamson, P.; Bishai, M.; Diwan, M. V.; ...

2015-06-09

We report the first observation of seasonal modulations in the rates of cosmic ray multiple-muon events at two underground sites, the MINOS Near Detector with an overburden of 225 mwe, and the MINOS Far Detector site at 2100 mwe. At the deeper site, multiple-muon events with muons separated by more than 8 m exhibit a seasonal rate that peaks during the summer, similar to that of single-muon events. Conversely, the rate of multiple-muon events with muons separated by less than 5–8 m, and the rate of multiple-muon events in the smaller, shallower Near Detector, exhibit a seasonal rate modulation thatmore » peaks in the winter.« less

A plastic scintillator-based muon tomography system with an integrated muon spectrometer

NASA Astrophysics Data System (ADS)

Anghel, V.; Armitage, J.; Baig, F.; Boniface, K.; Boudjemline, K.; Bueno, J.; Charles, E.; Drouin, P.-L.; Erlandson, A.; Gallant, G.; Gazit, R.; Godin, D.; Golovko, V. V.; Howard, C.; Hydomako, R.; Jewett, C.; Jonkmans, G.; Liu, Z.; Robichaud, A.; Stocki, T. J.; Thompson, M.; Waller, D.

2015-10-01

A muon scattering tomography system which uses extruded plastic scintillator bars for muon tracking and a dedicated muon spectrometer that measures scattering through steel slabs has been constructed and successfully tested. The atmospheric muon detection efficiency is measured to be 97% per plane on average and the average intrinsic hit resolution is 2.5 mm. In addition to creating a variety of three-dimensional images of objects of interest, a quantitative study has been carried out to investigate the impact of including muon momentum measurements when attempting to detect high-density, high-Z material. As expected, the addition of momentum information improves the performance of the system. For a fixed data-taking time of 60 s and a fixed false positive fraction, the probability to detect a target increases when momentum information is used. This is the first demonstration of the use of muon momentum information from dedicated spectrometer measurements in muon scattering tomography.

Final muon cooling for a muon collider

NASA Astrophysics Data System (ADS)

Acosta Castillo, John Gabriel

To explore the new energy frontier, a new generation of particle accelerators is needed. Muon colliders are a promising alternative if muon cooling can be made to work. Muons are 200 times heavier than electrons, so they produce less synchrotron radiation, and they behave like point particles. However, they have a short lifetime of 2.2 mus and the beam is more difficult to cool than an electron beam. The Muon Accelerator Program (MAP) was created to develop concepts and technologies required by a muon collider. An important effort has been made in the program to design and optimize a muon beam cooling system. The goal is to achieve the small beam emittance required by a muon collider. This work explores a final ionization cooling system using magnetic quadrupole lattices with a low enough beta* region to cool the beam to the required limit with available low Z absorbers.

Studies on muon tomography for archaeological internal structures scanning

NASA Astrophysics Data System (ADS)

Gómez, H.; Carloganu, C.; Gibert, D.; Jacquemier, J.; Karyotakis, Y.; Marteau, J.; Niess, V.; Katsanevas, S.; Tonazzo, A.

2016-05-01

Muon tomography is a potential non-invasive technique for internal structure scanning. It has already interesting applications in geophysics and can be used for archaeological purposes. Muon tomography is based on the measurement of the muon flux after crossing the structure studied. Differences on the mean density of these structures imply differences on the detected muon rate for a given direction. Based on this principle, Monte Carlo simulations represent a useful tool to provide a model of the expected muon rate and angular distribution depending on the composition of the studied object, being useful to estimate the expected detected muons and to better understand the experimental results. These simulations are mainly dependent on the geometry and composition of the studied object and on the modelling of the initial muon flux at surface. In this work, the potential of muon tomography in archaeology is presented and evaluated with Monte Carlo simulations by estimating the differences on the muon rate due to the presence of internal structures and its composition. The influence of the chosen muon model at surface in terms of energy and angular distributions in the final result has been also studied.

Laboratory Directed Research & Development program. Annual report to the Department of Energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ogeka, G.J.; Romano, A.J.

1995-12-01

This report briefly discusses the following projects coordinated at Brookhaven National Laboratory: investigation of the utility of max-entropy methods for the analysis of powder diffraction data; analysis of structures and interactions of nucleic acids and proteins by small angle x-ray diffraction; relaxographic MRI and functional MRI; very low temperature infra-red laser absorption as a potential analytical tool; state-resolved measurements of H{sub 2} photodesorption: development of laser probes of H{sub 2} for in-situ accelerator measurements; Siberian snake prototype development for RHIC; synthesis and characterization of novel microporous solids; ozone depletion, chemistry and physics of stratospheric aerosols; understanding the molecular basis formore » the synthesis of plant fatty acids possessing unusual double bond positions; structure determination of outer surface proteins of the Lyme disease spirochete; low mass, low-cost multi-wire proportional chambers for muon systems of collider experiments; theory of self-organized criticality; development of the PCR-SSCP technique for the detection, at the single cell level, of specific genetic changes; feasibility of SPECT in imaging of F-18 FDG accumulation in tumors; visible free electron laser oscillator experiment; study of possible 2 + 2 TeV muon-muon collider; ultraviolet FEL R & D; precision machining using hard x-rays; new directions in in-vivo enzyme mapping: catechol-O-methyltransferase; proposal to develop a high rate muon polarimeter; development of intense, tunable 20-femtosecond laser systems; use of extreme thermophilic bacterium thermatoga maritima as a source of ribosomal components and translation factors for structural studies; and biochemical and structural studies of Chaperon proteins from thermophilic bacteria and other experiments.« less

Developing a cosmic ray muon sampling capability for muon tomography and monitoring applications

NASA Astrophysics Data System (ADS)

Chatzidakis, S.; Chrysikopoulou, S.; Tsoukalas, L. H.

2015-12-01

In this study, a cosmic ray muon sampling capability using a phenomenological model that captures the main characteristics of the experimentally measured spectrum coupled with a set of statistical algorithms is developed. The "muon generator" produces muons with zenith angles in the range 0-90° and energies in the range 1-100 GeV and is suitable for Monte Carlo simulations with emphasis on muon tomographic and monitoring applications. The muon energy distribution is described by the Smith and Duller (1959) [35] phenomenological model. Statistical algorithms are then employed for generating random samples. The inverse transform provides a means to generate samples from the muon angular distribution, whereas the Acceptance-Rejection and Metropolis-Hastings algorithms are employed to provide the energy component. The predictions for muon energies 1-60 GeV and zenith angles 0-90° are validated with a series of actual spectrum measurements and with estimates from the software library CRY. The results confirm the validity of the phenomenological model and the applicability of the statistical algorithms to generate polyenergetic-polydirectional muons. The response of the algorithms and the impact of critical parameters on computation time and computed results were investigated. Final output from the proposed "muon generator" is a look-up table that contains the sampled muon angles and energies and can be easily integrated into Monte Carlo particle simulation codes such as Geant4 and MCNP.

Sequence comparison in the crossover region of an oncogenic avian retrovirus recombinant and its nononcogenic parent: Genetic regions that control growth rate and oncogenic potential

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsichlis, P.N.; Donehower, L.; Hager, G.

1982-11-01

NTRE is an avian retrovirus recombinant of the endogeneous nononcogenic Rous-associated virus-0 (RAV-0) and the oncogenic, exogeneous, transformation-defective (td) Prague strain of Rous sarcoma virus B (td-PrRSV-B). Oligonucleotide mapping had shown that the recombinant virus is indistinguishable from its RAV-0 parent except for the 3'-end sequences, which were derived from td-PrRSV-B. However, the virus exhibits properties which are typical of an exogenous virus: it grows to high titers in tissue culture, and it is oncogenic in vivo. To accurately define the genetic region responsible for these properties, the authors determined the nucleotide sequences of the recombinant and its RAV-0 parentmore » by using molecular clones of their DNA. These were compared with sequences already available for PrRSV-C, a virus closely related to the exogenous parent td-PrRSV-B. The results suggested that the crossover event which generated NTRE 7 took place in a region -501 to -401 nucleotides from the 3' end of the td-PrRSV parental genome and that sequences to the right of the recombination region were responsible for its growth properties and oncogenic potential. Since the exogenous-virus-specific sequences are expected to be missing from transformation-defective mutants of the Schmidt-Ruppin strain of RSV, which, like other exogeneous viruses, grow to high tiers in tissue culture and are oncogenic in vivo, the authors concluded that the growth properties and oncogenic potential of the exogeneous viruses are determined by sequences in the U3 region of the long terminal repeat. However, the authors propose that the exogeneous-virus-specific region may play a role in determining the oncogenic spectrum of a given oncogenic virus.« less

Red Fluorescent Protein-Aequorin Fusions as Improved Bioluminescent Ca2+ Reporters in Single Cells and Mice

PubMed Central

Bakayan, Adil; Vaquero, Cecilia F.; Picazo, Fernando; Llopis, Juan

2011-01-01

Bioluminescence recording of Ca2+ signals with the photoprotein aequorin does not require radiative energy input and can be measured with a low background and good temporal resolution. Shifting aequorin emission to longer wavelengths occurs naturally in the jellyfish Aequorea victoria by bioluminescence resonance energy transfer (BRET) to the green fluorescent protein (GFP). This process has been reproduced in the molecular fusions GFP-aequorin and monomeric red fluorescent protein (mRFP)-aequorin, but the latter showed limited transfer efficiency. Fusions with strong red emission would facilitate the simultaneous imaging of Ca2+ in various cell compartments. In addition, they would also serve to monitor Ca2+ in living organisms since red light is able to cross animal tissues with less scattering. In this study, aequorin was fused to orange and various red fluorescent proteins to identify the best acceptor in red emission bands. Tandem-dimer Tomato-aequorin (tdTA) showed the highest BRET efficiency (largest energy transfer critical distance R0) and percentage of counts in the red band of all the fusions studied. In addition, red fluorophore maturation of tdTA within cells was faster than that of other fusions. Light output was sufficient to image ATP-induced Ca2+ oscillations in single HeLa cells expressing tdTA. Ca2+ rises caused by depolarization of mouse neuronal cells in primary culture were also recorded, and changes in fine neuronal projections were spatially resolved. Finally, it was also possible to visualize the Ca2+ activity of HeLa cells injected subcutaneously into mice, and Ca2+ signals after depositing recombinant tdTA in muscle or the peritoneal cavity. Here we report that tdTA is the brightest red bioluminescent Ca2+ sensor reported to date and is, therefore, a promising probe to study Ca2+ dynamics in whole organisms or tissues expressing the transgene. PMID:21589654

Distribution and characterisation of Glucagon-like peptide-1 receptor expressing cells in the mouse brain

PubMed Central

Cork, Simon C.; Richards, James E.; Holt, Marie K.; Gribble, Fiona M.; Reimann, Frank; Trapp, Stefan

2015-01-01

Objective Although Glucagon-like peptide 1 is a key regulator of energy metabolism and food intake, the precise location of GLP-1 receptors and the physiological relevance of certain populations is debatable. This study investigated the novel GLP-1R-Cre mouse as a functional tool to address this question. Methods Mice expressing Cre-recombinase under the Glp1r promoter were crossed with either a ROSA26 eYFP or tdRFP reporter strain to identify GLP-1R expressing cells. Patch-clamp recordings were performed on tdRFP-positive neurons in acute coronal brain slices from adult mice and selective targeting of GLP-1R cells in vivo was achieved using viral gene delivery. Results Large numbers of eYFP or tdRFP immunoreactive cells were found in the circumventricular organs, amygdala, hypothalamic nuclei and the ventrolateral medulla. Smaller numbers were observed in the nucleus of the solitary tract and the thalamic paraventricular nucleus. However, tdRFP positive neurons were also found in areas without preproglucagon-neuronal projections like hippocampus and cortex. GLP-1R cells were not immunoreactive for GFAP or parvalbumin although some were catecholaminergic. GLP-1R expression was confirmed in whole-cell recordings from BNST, hippocampus and PVN, where 100 nM GLP-1 elicited a reversible inward current or depolarisation. Additionally, a unilateral stereotaxic injection of a cre-dependent AAV into the PVN demonstrated that tdRFP-positive cells express cre-recombinase facilitating virally-mediated eYFP expression. Conclusions This study is a comprehensive description and phenotypic analysis of GLP-1R expression in the mouse CNS. We demonstrate the power of combining the GLP-1R-CRE mouse with a virus to generate a selective molecular handle enabling future in vivo investigation as to their physiological importance. PMID:26500843

Muon Accelerator Program (MAP) | Homepage

Science.gov Websites

collider and neutrino factory Scientists around the world are developing the technologies necessary for a factory or a muon collider. Read more: Neutrino factory Muon collider Developing a muon source One of the developing and testing RF cavities and magnets for a muon beamline. The facility allows scientists to test

The stopping rate of negative cosmic-ray muons near sea level

NASA Technical Reports Server (NTRS)

Spannagel, G.; Fireman, E. L.

1971-01-01

A production rate of 0.065 + or - 0.003 Ar-37 atom/kg min of K-39 at 2-mwe depth below sea level was measured by sweeping argon from potassium solutions. This rate is unaffected by surrounding the solution by paraffin and is attributed to negative muon captures and the electromagnetic interaction of fast muons, and not to nucleonic cosmic ray component. The Ar-37 yield from K-39 by the stopping of negative muons in a muon beam of a synchrocyclotron was measured to be 8.5 + or - 1.7%. The stopping rate of negative cosmic ray muons at 2-mwe depth below sea level from these measurements and an estimated 17% electromagnetic production is 0.63 + or - 0.13 muon(-)/kg min. Previous measurements on the muon stopping rate vary by a factor of 5. Our value is slightly higher but is consistent with two previous high values. The sensitivity of the Ar-37 radiochemical method for the detection of muons is considerably higher than that of the previous radiochemical methods and could be used to measure the negative muon capture rates at greater depths.

New approach to resolve the humidity problem in VOC determination in outdoor air samples using solid adsorbent tubes followed by TD-GC-MS.

PubMed

Maceira, Alba; Vallecillos, Laura; Borrull, Francesc; Marcé, Rosa Maria

2017-12-01

This study describes the humidity effect in the sampling process by adsorbent tubes followed by thermal desorption and gas chromatography-mass spectrometry (TD-GC-MS) for the determination of volatile organic compounds (VOCs) in air samples and evaluates possible solutions to this problem. Two multi-sorbent bed tubes, Tenax TA/Carbograph 1TD and Carbotrap B/Carbopack X/Carboxen 569, were tested in order to evaluate their behaviour in the presence of environmental humidity. Humidity problems were demonstrated with carbon-based tubes, while Tenax-based tubes did not display any influence. Silica gel, a molecular sieve and CaCl 2 were tried out as materials for drying tube to remove air humidity, placed prior to the sampling tube to prevent water from entering. The pre-tubes filled with 0.5g of CaCl 2 showed the best results with respect to their blanks, the analytes recoveries and their ability to remove ambient humidity. To avoid the possible agglomeration of CaCl 2 during the sampling process in high relative humidity atmospheres, 0.1g of diatomaceous earth were mixed with the desiccant agent. The applicability of the CaCl 2 pre-tube as drying agent prior to Carbotrap B/Carbopack X/Carboxen 569 tubes was tested in urban and industrial locations with samplings of air at high relative humidity. In addition, the results were compared with those obtained using Tenax TA/Carbograph 1TD tubes. Copyright © 2017 Elsevier B.V. All rights reserved.

A Hard X-ray Study of a Manganese-Terpyridine Dimer Catalyst in a Chromium-based Metal Organic Framework - Oral Presentation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramsey, Alexandra

2015-08-25

Cleaner forms of energy are needed, and H 2 produced from water spliFng is a possible source. However, a robust catalyst is necessary to carry out the water oxidaKon reacKon. Plants uKlize Photosystem II to catalyze water oxidaKon as a part of photosynthesis, and many syntheKc water oxidaKon catalysts use Photosystem II as a model. In this study, the catalyst of interest was [(terpy)Mn(μ-O)2Mn(terpy)]3+ (MnTD), which was synthesized in a chromium-based Metal Organic Framework (MOF) to avoid degradaKon of MnTD molecules. Hard X-ray powder diffracKon was the primary method of analysis. The diffracKon data was used to detect the presencemore » of MOF in samples at different catalyKc stages, and laFce parameters were assigned to the samples containing MOF. Fourier maps were constructed to determine the contents of the MOF as preliminary studies suggested that MnTD may not be present. Results showed that MOF is present before catalysis occurs, but disappears in the iniKal stages of catalysis. Changes in the MOF’s laFce parameters suggest aWracKve interacKons between the MOF and catalyst; these interacKons may lead to the observed MOF degradaKon. Fourier maps also reveal limited, if any, amounts of MnTD in the system. Molecular manganese oxide may be the source of the high rate of water oxidaKon catalysis in the studied system.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adamson, P.; Bishai, M.; Diwan, M. V.

We report the first observation of seasonal modulations in the rates of cosmic ray multiple-muon events at two underground sites, the MINOS Near Detector with an overburden of 225 mwe, and the MINOS Far Detector site at 2100 mwe. At the deeper site, multiple-muon events with muons separated by more than 8 m exhibit a seasonal rate that peaks during the summer, similar to that of single-muon events. Conversely, the rate of multiple-muon events with muons separated by less than 5–8 m, and the rate of multiple-muon events in the smaller, shallower Near Detector, exhibit a seasonal rate modulation thatmore » peaks in the winter.« less

78 FR 66423 - Proposed Collection: Comment Request for Regulation Project

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-05

... DEPARTMENT OF THE TREASURY Internal Revenue Service [TD 9057, TD 9154, TD 9187] Proposed Collection: Comment Request for Regulation Project AGENCY: Internal Revenue Service (IRS), Treasury. ACTION... Rules. OMB Number: 1545-1774. Regulation Project Number: TD 9057, TD 9154, and TD 9187. Abstract: The...

End of Century State of Science

DTIC Science & Technology

1998-09-12

the first cosmological objects. There have been several calculations of the molecular abundance as functions of the red shift with some differences...Compact Muon Solenoid) experiment, with the prospects for Higgs boson searches, for electroweak scale Supersymmetry and CP violation studies in the B...1.2.3] in a very down to earth way, and then consider the consequences for and relationships to biology, physics and cosmology in a somewhat less down to

Experimental study of nuclear fusion reactions in muonic molecular systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bogdanova, L. N., E-mail: ludmila@itep.ru

2013-03-15

Since the pioneering discovery of the muon catalysis by Alvarez [L. W. Alvarez, K. Brander, F. S. Crawford, et al., Phys. Rev. 105, 1127 (1957)], considerable efforts were aimed at observation of various fusion processes. Results of these studies facilitated understanding the properties of lightest nuclei and dynamics of low-energy fusion reactions. There still remain unsolved theoretical and experimental problems, especially in case of pt fusion.

Search for hidden high-Z materials inside containers with the Muon Portal Project

NASA Astrophysics Data System (ADS)

La Rocca, P.; Antonuccio, V.; Bandieramonte, M.; Becciani, U.; Belluomo, F.; Belluso, M.; Billotta, S.; Blancato, A. A.; Bonanno, D.; Bonanno, G.; Costa, A.; Fallica, G.; Garozzo, S.; Indelicato, V.; Leonora, E.; Longhitano, F.; Longo, S.; Lo Presti, D.; Massimino, P.; Petta, C.; Pistagna, C.; Pugliatti, C.; Puglisi, M.; Randazzo, N.; Riggi, F.; Riggi, S.; Romeo, G.; Russo, G. V.; Santagati, G.; Valvo, G.; Vitello, F.; Zaia, A.; Zappalà, G.

2014-01-01

The Muon Portal is a recently born project that plans to build a large area muon detector for a noninvasive inspection of shipping containers in the ports, searching for the presence of potential fissile (U, Pu) threats. The technique employed by the project is the well-known muon tomography, based on cosmic muon scattering from high-Z materials. The design and operational parameters of the muon portal under construction will be described in this paper, together with preliminary simulation and test results.

Birth of an intense pulsed muon source, J-PARC MUSE

NASA Astrophysics Data System (ADS)

Miyake, Yasuhiro; Shimomura, Koichiro; Kawamura, Naritoshi; Strasser, Patrick; Makimura, Shunsuke; Koda, Akihiro; Fujimori, Hiroshi; Nakahara, Kazutaka; Kadono, Ryosuke; Kato, Mineo; Takeshita, Soshi; Nishiyama, Kusuo; Higemoto, Wataru; Ishida, Katsuhiko; Matsuzaki, Teiichiro; Matsuda, Yasuyuki; Nagamine, Kanetada

2009-04-01

The muon science facility (MUSE), along with neutron, hadron, and neutrino facilities, is one of the experimental areas of the J-PARC (Japan Proton Accelerator Research Complex) project, which was approved for construction between 2001 and 2008. The MUSE facility is located in the Materials and Life Science Facility (MLF), which is a building integrated to include both neutron and muon science programs. Construction of the MLF building was started at the beginning of 2004, and was recently completed at the end of the 2006 fiscal year. We have been working on the installation of the beamline components, expecting the first muon beam in the autumn of 2008. For Phase 1, we are planning to install one superconducting decay/surface channel with a modest-acceptance (about 40 mSr) pion injector, with an estimated surface muon (μ+) rate of 3×107/s and a beam size of 25 mm diameter, and a corresponding decay muon (μ+/μ-) rate of 106/s for 60 MeV/ c (up to 107/s for 120 MeV/ c) with a beam size of 50 mm diameter. These intensities correspond to more than 10-times what is available at the RIKEN/RAL muon facility, which currently possess the most intense pulsed muon beams in the world. In addition to Phase 1, we are planning to install, a surface muon channel with a modest-acceptance (about 50 mSr), mainly for experiments related to material sciences, and a super-omega muon channel with a large acceptance of 400 mSr. In the case of the super-omega muon channel, the goal is to extract 4×108 surface muons/s for the generation of ultra-slow muons and 1×107 negative cloud muons/s with a momentum of 30-60 MeV/ c. One of the important goals for this beamline is to generate intense ultra-slow muons at MUSE, utilizing an intense pulsed VUV laser system. 104-106 ultra-slow muons/s are expected, which will allow for an extension of μSR into the area of thin film and surface science. At this symposium, the current status of J-PARC MUSE will be reported.

A Detector Scenario for a Muon Cooling Demonstration Experiment

NASA Astrophysics Data System (ADS)

McDonald, Kirk T.; Lu, Changguo; Prebys, Eric J.

1998-04-01

As a verification of the concept of ionization cooling of a muon beam, the Muon Collider Collaboration is planning an experiment to cool the 6-dimensional normalized emittance by a factor of two. We have designed a detector system to measure the 6-dimensional emittance before and after the cooling apparatus. To avoid the cost associated with preparation of a muon beam bunched at 800 MHz, the nominal frequency of the RF in the muon cooler, we propose to use an unbunched muon beam. Muons will be measured in the detector individually, and a subset chosen corresponding to an ideal input bunch. The muons are remeasured after the cooling apparatus and the output bunch emittance calculated to show the expected reduction in phase-space volume. The technique of tracing individual muons will reproduce all effects encountered by a bunch except for space-charge.

Compliance Testing of Eielson Air Force Base Central Heating and Power Plant, Coal Fired Boiler Number 3, Eielson Air Force Base, Alaska

DTIC Science & Technology

1988-12-01

a flue gas grab sample for orsat analysis (measures oxygen, and carbon dioxide for stack gas molecular weight determination and emissions correction... molecular weight, was obtained during particulate sampling. Testing was initially started on boiler 2 at the maximum rated steam output of 120,000 lbs/hr...I, r*~td AN[D l FL B( R\\ ViQ( lPjN L!II(,t 1 (d) Open burning of put.rcible iear- i\\ % ~i~ emisions , ec.dirig c dn jc p. c ,f1 pre- cri :rig pair

Ultra slow muon microscopy by laser resonant ionization at J-PARC, MUSE

NASA Astrophysics Data System (ADS)

Miyake, Y.; Ikedo, Y.; Shimomura, K.; Strasser, P.; Kawamura, N.; Nishiyama, K.; Koda, A.; Fujimori, H.; Makimura, S.; Nakamura, J.; Nagatomo, T.; Kadono, R.; Torikai, E.; Iwasaki, M.; Wada, S.; Saito, N.; Okamura, K.; Yokoyama, K.; Ito, T.; Higemoto, W.

2013-04-01

As one of the principal muon beam line at the J-PARC muon facility (MUSE), we are now constructing a Muon beam line (U-Line), which consists of a large acceptance solenoid made of mineral insulation cables (MIC), a superconducting curved transport solenoid and superconducting axial focusing magnets. There, we can extract 2 × 108/s surface muons towards a hot tungsten target. At the U-Line, we are now establishing a new type of muon microscopy; a new technique with use of the intense ultra-slow muon source generated by resonant ionization of thermal Muonium (designated as Mu; consisting of a μ + and an e - ) atoms generated from the surface of the tungsten target. In this contribution, the latest status of the Ultra Slow Muon Microscopy project, fully funded, is reported.

Molecular Studies of Alphavirus Immunogenicity

DTIC Science & Technology

1992-12-03

RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adamson, P.

We report the first observation of seasonal modulations in the rates of cosmic ray multiple-muon events at two underground sites, the MINOS Near Detector with an overburden of 225 mwe, and the MINOS Far Detector site at 2100 mwe. Thus, at the deeper site, multiple-muon events with muons separated by more than 8 m exhibit a seasonal rate that peaks during the summer, similar to that of single-muon events. In contrast and unexpectedly, the rate of multiple-muon events with muons separated by less than 5–8 m, and the rate of multiple-muon events in the smaller, shallower Near Detector, exhibit amore » seasonal rate modulation that peaks in the winter.« less

Electron-muon ranger: performance in the MICE muon beam

NASA Astrophysics Data System (ADS)

Adams, D.; Alekou, A.; Apollonio, M.; Asfandiyarov, R.; Barber, G.; Barclay, P.; de Bari, A.; Bayes, R.; Bayliss, V.; Bene, P.; Bertoni, R.; Blackmore, V. J.; Blondel, A.; Blot, S.; Bogomilov, M.; Bonesini, M.; Booth, C. N.; Bowring, D.; Boyd, S.; Bradshaw, T. W.; Bravar, U.; Bross, A. D.; Cadoux, F.; Capponi, M.; Carlisle, T.; Cecchet, G.; Charnley, C.; Chignoli, F.; Cline, D.; Cobb, J. H.; Colling, G.; Collomb, N.; Coney, L.; Cooke, P.; Courthold, M.; Cremaldi, L. M.; Debieux, S.; DeMello, A.; Dick, A.; Dobbs, A.; Dornan, P.; Drielsma, F.; Filthaut, F.; Fitzpatrick, T.; Franchini, P.; Francis, V.; Fry, L.; Gallagher, A.; Gamet, R.; Gardener, R.; Gourlay, S.; Grant, A.; Graulich, J. S.; Greis, J.; Griffiths, S.; Hanlet, P.; Hansen, O. M.; Hanson, G. G.; Hart, T. L.; Hartnett, T.; Hayler, T.; Heidt, C.; Hills, M.; Hodgson, P.; Hunt, C.; Husi, C.; Iaciofano, A.; Ishimoto, S.; Kafka, G.; Kaplan, D. M.; Karadzhov, Y.; Kim, Y. K.; Kuno, Y.; Kyberd, P.; Lagrange, J.-B.; Langlands, J.; Lau, W.; Leonova, M.; Li, D.; Lintern, A.; Littlefield, M.; Long, K.; Luo, T.; Macwaters, C.; Martlew, B.; Martyniak, J.; Masciocchi, F.; Mazza, R.; Middleton, S.; Moretti, A.; Moss, A.; Muir, A.; Mullacrane, I.; Nebrensky, J. J.; Neuffer, D.; Nichols, A.; Nicholson, R.; Nicola, L.; Noah Messomo, E.; Nugent, J. C.; Oates, A.; Onel, Y.; Orestano, D.; Overton, E.; Owens, P.; Palladino, V.; Pasternak, J.; Pastore, F.; Pidcott, C.; Popovic, M.; Preece, R.; Prestemon, S.; Rajaram, D.; Ramberger, S.; Rayner, M. A.; Ricciardi, S.; Roberts, T. J.; Robinson, M.; Rogers, C.; Ronald, K.; Rothenfusser, K.; Rubinov, P.; Rucinski, P.; Sakamato, H.; Sanders, D. A.; Sandström, R.; Santos, E.; Savidge, T.; Smith, P. J.; Snopok, P.; Soler, F. J. P.; Speirs, D.; Stanley, T.; Stokes, G.; Summers, D. J.; Tarrant, J.; Taylor, I.; Tortora, L.; Torun, Y.; Tsenov, R.; Tunnell, C. D.; Uchida, M. A.; Vankova-Kirilova, G.; Virostek, S.; Vretenar, M.; Warburton, P.; Watson, S.; White, C.; Whyte, C. G.; Wilson, A.; Wisting, H.; Yang, X.; Young, A.; Zisman, M.

2015-12-01

The Muon Ionization Cooling Experiment (MICE) will perform a detailed study of ionization cooling to evaluate the feasibility of the technique. To carry out this program, MICE requires an efficient particle-identification (PID) system to identify muons. The Electron-Muon Ranger (EMR) is a fully-active tracking-calorimeter that forms part of the PID system and tags muons that traverse the cooling channel without decaying. The detector is capable of identifying electrons with an efficiency of 98.6%, providing a purity for the MICE beam that exceeds 99.8%. The EMR also proved to be a powerful tool for the reconstruction of muon momenta in the range 100-280 MeV/c.

Hadronic interactions and EAS muon pseudorapidities investigated with the Muon Tracking Detector in KASCADE-Grande

NASA Astrophysics Data System (ADS)

Zabierowski, J.; Apel, W. D.; Arteaga, J. C.; Badea, F.; Bekk, K.; Bertaina, M.; Blümer, H.; Bozdog, H.; Brancus, I. M.; Brüggemann, M.; Buchholz, P.; Cantoni, E.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; de Souza, V.; di Pierro, F.; Doll, P.; Engel, R.; Engler, J.; Finger, M.; Fuhrmann, D.; Ghia, P. L.; Gils, H. J.; Glasstetter, R.; Grupen, C.; Haungs, A.; Heck, D.; Hörandel, J. R.; Huege, T.; Isar, P. G.; Kampert, K.-H.; Kang, D.; Kickelbick, D.; Klages, H. O.; Kolotaev, Y.; Łuczak, P.; Mathes, H. J.; Mayer, H. J.; Milke, J.; Mitrica, B.; Morello, C.; Navarra, G.; Nehls, S.; Oehlschläger, J.; Ostapchenko, S.; Petcu, M.; Pierog, T.; Rebel, H.; Roth, M.; Schieler, H.; Schröder, F.; Sima, O.; Stümpert, M.; Toma, G.; Trinchero, G. C.; Ulrich, H.; van Buren, J.; Walkowiak, W.; Weindl, A.; Wochele, J.; Wommer, M.; KASCADE-Grande Collaboration

2009-12-01

The Muon Tracking Detector in the KASCADE-Grande EAS experiment allows the precise measurement of shower muon directions up to 700 m distance from the shower center. This directional information is used to study the pseudorapidity of muons in EAS, closely related to the pseudorapidity of their parent mesons. Moreover, the mean value of muon pseudorapidity in a registered shower reflects the longitudinal development of its hadronic component. All of this makes it a good tool for testing hadronic interaction models. The possibilities of such tests given by the KASCADE-Grande experimental setup are discussed and an example of the obtained muon pseudorapidity spectrum is shown.

DFT/TD-semiempirical study on the structural and electronic properties and absorption spectra of supramolecular fullerene-porphyrine-metalloporphyrine triads based dye-sensitized solar cells.

PubMed

Rezvani, M; Darvish Ganji, M; Jameh-Bozorghi, S; Niazi, A

2018-04-05

In the present work density functional theory (DFT) and time-dependent semiempirical ZNIDO/S (TD-ZNIDO/S) methods have been used to investigate the ground state geometries, electronic structures and excited state properties of triad systems. The influences of the type of metal in the porphyrin ring, change in bridge position and porphyrine-ZnP duplicate on the energies of frontier molecular orbital and UV-Vis spectra has been studied. Geometry optimization, the energy levels and electron density of the Highest Occupied Molecular Orbital (HOMO) and the Lowest Unoccupied Molecular Orbital (LUMO), chemical hardness (η), electrophilicity index (ω), electron accepting power (ω + ) were calculated using ZINDO/S method to predict which molecule is the most efficient with a great capability to be used as a triad molecule in solar industry. Moreover the light harvesting efficiency (LHE) was calculated by means of the oscillator strengths which are obtained by TD-ZINDO/S calculation. Theoretical studies of the electronic spectra by ZINDO/S method were helpful in interpreting the observed electronic transitions. This aspect was systematically explored in a series of C 60 -Porphyrine-Metalloporphyrine (C 60 -P-Mp) triad system with M being Fe, Co, Ni, Ti, and Zn. Generally, transition metal coordination compounds are used as effective sensitizers, due to their intense charge-transfer absorption over the whole visible range and highly efficient metal-to-ligand charge transfer. We aim to optimize the performance of the title solar cells by altering the frontier orbital energy gaps. The results reveal that cell efficiency can be enhanced by metal functionalization of the free base porphyrin. Ti-porphyrin was found to be the most efficient dye sensitizer for dye sensitized solar cells (DSSCs) based on C 60 -P-Mptriad system due to C 60 -Por-TiP complex has lower chemical hardness, gap energy and chemical potential as well as higher electron accepting power among other complexes. In addition, the performance of solar cells favors better with doubly and increasing the π conjugated of the bridge. Copyright © 2018 Elsevier B.V. All rights reserved.

DFT/TD-semiempirical study on the structural and electronic properties and absorption spectra of supramolecular fullerene-porphyrine-metalloporphyrine triads based dye-sensitized solar cells

NASA Astrophysics Data System (ADS)

Rezvani, M.; Darvish Ganji, M.; Jameh-Bozorghi, S.; Niazi, A.

2018-04-01

In the present work density functional theory (DFT) and time-dependent semiempirical ZNIDO/S (TD-ZNIDO/S) methods have been used to investigate the ground state geometries, electronic structures and excited state properties of triad systems. The influences of the type of metal in the porphyrin ring, change in bridge position and porphyrine-ZnP duplicate on the energies of frontier molecular orbital and UV-Vis spectra has been studied. Geometry optimization, the energy levels and electron density of the Highest Occupied Molecular Orbital (HOMO) and the Lowest Unoccupied Molecular Orbital (LUMO), chemical hardness (η), electrophilicity index (ω), electron accepting power (ω+) were calculated using ZINDO/S method to predict which molecule is the most efficient with a great capability to be used as a triad molecule in solar industry. Moreover the light harvesting efficiency (LHE) was calculated by means of the oscillator strengths which are obtained by TD-ZINDO/S calculation. Theoretical studies of the electronic spectra by ZINDO/S method were helpful in interpreting the observed electronic transitions. This aspect was systematically explored in a series of C60-Porphyrine-Metalloporphyrine (C60-P-Mp) triad system with M being Fe, Co, Ni, Ti, and Zn. Generally, transition metal coordination compounds are used as effective sensitizers, due to their intense charge-transfer absorption over the whole visible range and highly efficient metal-to-ligand charge transfer. We aim to optimize the performance of the title solar cells by altering the frontier orbital energy gaps. The results reveal that cell efficiency can be enhanced by metal functionalization of the free base porphyrin. Ti-porphyrin was found to be the most efficient dye sensitizer for dye sensitized solar cells (DSSCs) based on C60-P-Mptriad system due to C60-Por-TiP complex has lower chemical hardness, gap energy and chemical potential as well as higher electron accepting power among other complexes. In addition, the performance of solar cells favors better with doubly and increasing the π conjugated of the bridge.

Muon simulations for Super-Kamiokande, KamLAND, and CHOOZ

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Alfred; Horton-Smith, Glenn; Kudryavtsev, Vitaly A.

2006-09-01

Muon backgrounds at Super-Kamiokande, KamLAND, and CHOOZ are calculated using MUSIC. A modified version of the Gaisser sea-level muon distribution and a well-tested Monte Carlo integration method are introduced. Average muon energy, flux, and rate are tabulated. Plots of average energy and angular distributions are given. Implications for muon tracker design in future experiments are discussed.

First measurements of muon production rate using a novel pion capture system at MuSIC

NASA Astrophysics Data System (ADS)

Cook, S.; D'Arcy, R.; Fukuda, M.; Hatanaka, K.; Hino, Y.; Kuno, Y.; Lancaster, M.; Mori, Y.; Nam, T. H.; Ogitsu, T.; Sakamoto, H.; Sato, A.; Truong, N. M.; Yamamoto, A.; Yoshida, M.; Wing, M.

2013-02-01

The MuSIC (Muon Science Innovative Channel) beam line at RCNP (Research Centre for Nuclear Physics), Osaka will be the most intense source of muons in the world. A proton beam is incident on a target and, by using a novel capture solenoid, guides the produced pions into the beam line where they subsequently decay to muons. This increased muon flux will allow more precise measurements of cLFV (charged Lepton Flavour Violation) as well as making muon beams more economically feasible. Currently the first 36° of solenoid beam pipe have been completed and installed for testing with low proton current of 1 nA. Measurements of the total particle flux and the muon life time were made. The measurements were taken using thin plastic scintillators coupled to MPPCs (Multi-Pixel Photon Counter) that surrounded a magnesium or copper stopping target. The scintillators were used to record which particles stopped and their subsequent decay times giving a muon yield of 8.5 × 105 muons W-1proton beam or 3 × 108 muons s-1 when using the RCNP's full power (400 W).

Online Learning for Muon Science

NASA Astrophysics Data System (ADS)

Baker, Peter J.; Loe, Tom; Telling, Mark; Cottrell, Stephen P.; Hillier, Adrian D.

As part of the EU-funded project SINE2020 we are developing an online learning environment to introduce people to muon spectroscopy and how it can be applied in a variety of science areas. Currently there are short interactive courses using cosmic ray muons to teach what muons are and how their decays are measured and a guide to analyzing muon data using the Mantid software package, as well as videos from the lectures at the ISIS Muon Spectroscopy Training School 2016. Here we describe the courses that have been developed and how they have already been used.

Status of the New Surface Muon Beamline at J-PARC MUSE

NASA Astrophysics Data System (ADS)

Strasser, P.; Koda, A.; Kojima, K. M.; Ito, T. U.; Fujimori, H.; Irie, Y.; Aoki, M.; Nakatsugawa, Y.; Higemoto, W.; Hiraishi, M.; Li, H.; Okabe, H.; Takeshita, S.; Shimomura, K.; Kawamura, N.; Kadono, R.; Miyake, Y.

A new surface muon beamline (S-line) dedicated to condensed matter physics experiments is being constructed at the Muon Science Facility (MUSE) located in the Materials and Life Science Facility (MLF) building at J-PARC. This beamline designed to provide high-intensity surface muons with a momentum of 28 MeV/c will comprise four beam legs and four experimental areas that will share the double-pulsed muon beam. The key feature is a new kicker system comprising two electric kickers to deliver the muon beam to the four experimental areas ensuring an optimum and seamless sharing of the double-pulsed muon beam. At present, only one experimental area (S1) has been completed and is now open to the user program since February 2017. An overview of the different aspects of this new surface muon beamline and the present status of the beam commissioning are presented.

Pion contamination in the MICE muon beam

NASA Astrophysics Data System (ADS)

Adams, D.; Alekou, A.; Apollonio, M.; Asfandiyarov, R.; Barber, G.; Barclay, P.; de Bari, A.; Bayes, R.; Bayliss, V.; Bertoni, R.; Blackmore, V. J.; Blondel, A.; Blot, S.; Bogomilov, M.; Bonesini, M.; Booth, C. N.; Bowring, D.; Boyd, S.; Brashaw, T. W.; Bravar, U.; Bross, A. D.; Capponi, M.; Carlisle, T.; Cecchet, G.; Charnley, C.; Chignoli, F.; Cline, D.; Cobb, J. H.; Colling, G.; Collomb, N.; Coney, L.; Cooke, P.; Courthold, M.; Cremaldi, L. M.; DeMello, A.; Dick, A.; Dobbs, A.; Dornan, P.; Drews, M.; Drielsma, F.; Filthaut, F.; Fitzpatrick, T.; Franchini, P.; Francis, V.; Fry, L.; Gallagher, A.; Gamet, R.; Gardener, R.; Gourlay, S.; Grant, A.; Greis, J. R.; Griffiths, S.; Hanlet, P.; Hansen, O. M.; Hanson, G. G.; Hart, T. L.; Hartnett, T.; Hayler, T.; Heidt, C.; Hills, M.; Hodgson, P.; Hunt, C.; Iaciofano, A.; Ishimoto, S.; Kafka, G.; Kaplan, D. M.; Karadzhov, Y.; Kim, Y. K.; Kuno, Y.; Kyberd, P.; Lagrange, J.-B.; Langlands, J.; Lau, W.; Leonova, M.; Li, D.; Lintern, A.; Littlefield, M.; Long, K.; Luo, T.; Macwaters, C.; Martlew, B.; Martyniak, J.; Mazza, R.; Middleton, S.; Moretti, A.; Moss, A.; Muir, A.; Mullacrane, I.; Nebrensky, J. J.; Neuffer, D.; Nichols, A.; Nicholson, R.; Nugent, J. C.; Oates, A.; Onel, Y.; Orestano, D.; Overton, E.; Owens, P.; Palladino, V.; Pasternak, J.; Pastore, F.; Pidcott, C.; Popovic, M.; Preece, R.; Prestemon, S.; Rajaram, D.; Ramberger, S.; Rayner, M. A.; Ricciardi, S.; Roberts, T. J.; Robinson, M.; Rogers, C.; Ronald, K.; Rubinov, P.; Rucinski, P.; Sakamato, H.; Sanders, D. A.; Santos, E.; Savidge, T.; Smith, P. J.; Snopok, P.; Soler, F. J. P.; Speirs, D.; Stanley, T.; Stokes, G.; Summers, D. J.; Tarrant, J.; Taylor, I.; Tortora, L.; Torun, Y.; Tsenov, R.; Tunnell, C. D.; Uchida, M. A.; Vankova-Kirilova, G.; Virostek, S.; Vretenar, M.; Warburton, P.; Watson, S.; White, C.; Whyte, C. G.; Wilson, A.; Winter, M.; Yang, X.; Young, A.; Zisman, M.

2016-03-01

The international Muon Ionization Cooling Experiment (MICE) will perform a systematic investigation of ionization cooling with muon beams of momentum between 140 and 240 MeV/c at the Rutherford Appleton Laboratory ISIS facility. The measurement of ionization cooling in MICE relies on the selection of a pure sample of muons that traverse the experiment. To make this selection, the MICE Muon Beam is designed to deliver a beam of muons with less than ~1% contamination. To make the final muon selection, MICE employs a particle-identification (PID) system upstream and downstream of the cooling cell. The PID system includes time-of-flight hodoscopes, threshold-Cherenkov counters and calorimetry. The upper limit for the pion contamination measured in this paper is fπ < 1.4% at 90% C.L., including systematic uncertainties. Therefore, the MICE Muon Beam is able to meet the stringent pion-contamination requirements of the study of ionization cooling.

Pion contamination in the MICE muon beam

DOE PAGES

Adams, D.; Alekou, A.; Apollonio, M.; ...

2016-03-01

Here, the international Muon Ionization Cooling Experiment (MICE) will perform a systematic investigation of ionization cooling with muon beams of momentum between 140 and 240\\,MeV/c at the Rutherford Appleton Laboratory ISIS facility. The measurement of ionization cooling in MICE relies on the selection of a pure sample of muons that traverse the experiment. To make this selection, the MICE Muon Beam is designed to deliver a beam of muons with less thanmore » $$\\sim$$1% contamination. To make the final muon selection, MICE employs a particle-identification (PID) system upstream and downstream of the cooling cell. The PID system includes time-of-flight hodoscopes, threshold-Cherenkov counters and calorimetry. The upper limit for the pion contamination measured in this paper is $$f_\\pi < 1.4\\%$$ at 90% C.L., including systematic uncertainties. Therefore, the MICE Muon Beam is able to meet the stringent pion-contamination requirements of the study of ionization cooling.« less

Non-invasive analysis of swelling in polymer dispersions by means of time-domain(TD)-NMR.

PubMed

Nestle, Nikolaus; Häberle, Karl

2009-11-03

In this contribution, we discuss the potential of low-field time-domain(TD)-NMR to study the swelling of (aqueous) polymer dispersions by a volatile solvent. Due to the sensitivity of transverse relaxation times (T2) to swelling-induced changes in the molecular dynamics of the polymer component, the effects of swelling can be measured without spectral resolution. The measurement is performed on polymer dispersions in native state with solids contents around 50% in a non-invasive way without separating the polymeric phase and the water phase from each other. Using acetone in two polyurethane (PU) dispersions with different hard phase contents, we explore the sensitivity of the method and present a data evaluation strategy based on multicomponent fitting and proton balancing. Furthermore, we report exchange continualization as a further effect that needs to be taken into account for correct interpretation of the data.

Medication-Induced Tardive Dyskinesia: A Review and Update

PubMed Central

Novitch, Matthew; Kaye, Alan David; Kata, Vijay; Kaye, Adam M.

2017-01-01

Background: Tardive dyskinesia (TD) is a movement disorder that causes involuntary, repetitive body movements and is commonly seen in patients who are on long-term treatment with antipsychotic medications. However, several other classes of medications with different mechanisms are also associated with TD. Methods: We conducted a PubMed search using keywords and combined word searches that involved medication-induced TD, as well as agents that are associated with causing or are used to treat medication-induced TD. We attempted to include as many recent (publication date of 2015 and later) articles as possible. Results: The reported incidence of TD seems to be reduced with the use of atypical antipsychotic drugs, yet the risk of developing TD remains with these medications. Furthermore, several other medication classes have a high prevalence of TD and yet are not commonly considered to be TD-inducing. This review highlights the need for a prevention-based focus of TD treatment that starts with a clinical consideration of pharmacologic choices related to each individual patient's history. Conclusion: This review offers the information current as of 2016 on the pathophysiology, etiology, and epidemiology of TD, as well as the medications associated with TD, mechanisms of medication-induced TD, and treatments for medication-induced TD. PMID:28638290

PREFACE: 13th International Conference on Muon Spin Rotation, Relaxation and Resonance

NASA Astrophysics Data System (ADS)

2014-12-01

The 13th International Conference on Muon Spin Rotation, Relaxation and Resonance (μSR2014) organized by the Laboratory for Muon Spin Spectroscopy, Paul Scherrer Institute in collaboration with the University of Zurich and the University of Fribourg, was held in Grindelwald, Switzerland from 1st to 6th June 2014. The conference provided a forum for researchers from around the world with interests in the applications of μSR to study a wide range of topics including condensed matter physics, materials and molecular sciences, chemistry and biology. Polarized muons provide a unique and versatile probe of matter, enabling studies at the atomic level of electronic structure and dynamics in a wide range of systems. The conference was the thirteenth in a series, which began in Rorschach in 1978 and it took place for the third time in Switzerland. The previous conferences were held in Cancun, Mexico (2011), Tsukuba, Japan (2008), Oxford, UK (2005), Williamsburg, USA (2002), Les Diablerets, Switzerland (1999), Nikko, Japan (1996), Maui, USA (1993), Oxford, UK (1990), Uppsala, Sweden (1986), Shimoda, Japan (1983), Vancouver, Canada (1980), and Rorschach, Switzerland (1978). These conference proceedings contain 67 refereed publications from presentations covering magnetism, superconductivity, chemistry, semiconductors, biophysics and techniques. The conference logo, displayed in the front pages of these proceedings, represents both the location of μSR2014 in the Alps and the muon-spin rotation technique. The silhouette represents the famous local mountains Eiger, Mönch and Jungfrau as drawn by the Swiss painter Ferdinand Hodler and the apple with arrow is at the same time a citation of the Wilhelm Tell legend and a remembrance of the key role played by the muon spin and the asymmetric muon decay (which for the highest positron energy has an apple like shape). More than 160 participants (including 32 registered as students and 13 as accompanying persons) from 19 countries submitted 227 contributions, which were intensively discussed during day and evening sessions. The scientific program was centered around invited talks from speakers outside the μSR community, who presented lectures on topics where μSR is giving or expected to give significant contributions. The invited speakers, covering various fields of interest, included Radu Coldea (Oxford, Quantum Magnetism), Claude- Henri Delmas (Bordeaux, Electro- and Solid State Chemistry), Dirk Johrendt (Munich, Iron Based Materials), Marc-Henri Julien (Grenoble, Cuprate Superconductors), Manfred Fiebig (Zürich, Multiferroics), Allan MacDonald (Austin, Topological Electronic States), Hidenori Takagi (Stuttgart and Tokyo, Transition Metal Oxides), and Jean-Marc Triscone (Geneva, Oxide Heterostructures). In addition to an overview about status and progress of the existing facilities in Europe, Canada and Japan, future projects and new ideas for μSR facilities in South Korea, China and the USA were presented. A special evening session was held to discuss about muon site and muon states calculations by DFT and other techniques. Several talks and posters can be found on the conference web page www.psi.ch/muSR2014. In a ceremony at the beginning of the conference, Roberto De Renzi from the University of Parma was awarded the 2014 Yamazaki Prize for muon science by the International Society for Muon Spin Spectroscopy (ISMS) for his sustained and exceptional contributions to the development of the muon spin relaxation technique to investigate magnetism and superconductivity and for promoting synergies between μSR and NMR. In the closing session Rob Kie (UBC Vancouver and TRIUMF) very effectively summarized the five days of meeting, while giving an enlightening personal impression. In the same session five best poster prizes were awarded and ISMS gave two prizes to young researchers presenting outstanding work at the conference. The conference organizers also on behalf of the entire μSR community are extremely grateful to the conference sponsors: PSI, University of Zürich, University of Fribourg and the Swiss National Foundation as well as to the various industrial sponsors, which are listed in these proceedings. Special mention should also be made of the local organizing committee who has been active during a long period first preparing and then running the conference. Finally we would like to thank the participants whose stimulating research presentations and lively discussion made μSR2014 such a success.

Federal Logistics Information System (FLIS) Procedures Manual. Volume 13. Change 1.

DTIC Science & Technology

1997-01-01

BD 06 TA 67 BD BD TU BD TU BD FBDA DF BD 06 TA 96 BD BD TU BD TU BD FBDD DF BD 06 TD 96 BD BD TU BD TU BD FBDE DF BD 06 SE 96 BD BD TU BD TU BD FBDG...XN TD FAZD DF AZ 06 TD 96 AZ AZ TU AZ TU TD FAZ7 DF AZ 22 TD 97 AZ AZ TU AZ TU TD FBDD DF BD 06 TD 96 BD BD TU BD TU TD FBD7 DF BD 22 TD 97 BD BD TU...48 TU TU FBDA DF BD 06 TA 96 BD BD TU BD TU TU FBDD DF BD 06 TD 96 BD BD TU BD TU TU FBDE DF BD 06 SE 96 BD BD TU BD TU TU FBDG DF BD 06 TG 96 BD BD TU

Atmospheric Muon Lifetime, Standard Model of Particles and the Lead Stopping Power for Muons

NASA Astrophysics Data System (ADS)

Gutarra-Leon, Angel; Barazandeh, Cioli; Majewski, Walerian

2017-01-01

The muon is a fundamental particles of matter. It decays into three other leptons through an exchange of the weak vector bosons W +/W-. Muons are present in the atmosphere from cosmic ray showers. By detecting the time delay between arrival of the muon and an appearance of the decay electron in our detector, we'll measure muon's lifetime at rest. From the lifetime we should be able to find the ratio gw /MW of the weak coupling constant gw (a weak analog of the electric charge) to the mass of the W-boson MW. Vacuum expectation value v of the Higg's field, which determines the masses of all particles of the Standard Model (SM), could be then calculated from our muon experiment as v =2MWc2/gw =(τ m μc2/6 π3ĥ)1/4m μc2 in terms of muon mass mµand muon lifetime τ only. Using known experimental value for MWc2 = 80.4 GeV we'll find the weak coupling constant gw. Using the SM relation e =gwsin θ√ hc ɛ0 with the experimental value of the Z0-photon weak mixing angle θ = 29o we could find from our muon lifetime the value of the elementary electric charge e. We'll determine the sea-level fluxes of low-energy and high-energy cosmic muons, then we'll shield the detector with varying thicknesses of lead plates and find the energy-dependent muon stopping power in lead.

Electron-Muon Ranger: Performance in the MICE muon beam

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adams, D.

2015-12-16

The Muon Ionization Cooling Experiment (MICE) will perform a detailed study of ionization cooling to evaluate the feasibility of the technique. To carry out this program, MICE requires an efficient particle-identification (PID) system to identify muons. The Electron-Muon Ranger (EMR) is a fully-active tracking-calorimeter that forms part of the PID system and tags muons that traverse the cooling channel without decaying. The detector is capable of identifying electrons with an efficiency of 98.6%, providing a purity for the MICE beam that exceeds 99.8%. Lastly, the EMR also proved to be a powerful tool for the reconstruction of muon momenta inmore » the range 100–280 MeV/c.« less

Study of muon-induced neutron production using accelerator muon beam at CERN

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakajima, Y.; Lin, C. J.; Ochoa-Ricoux, J. P.

2015-08-17

Cosmogenic muon-induced neutrons are one of the most problematic backgrounds for various underground experiments for rare event searches. In order to accurately understand such backgrounds, experimental data with high-statistics and well-controlled systematics is essential. We performed a test experiment to measure muon-induced neutron production yield and energy spectrum using a high-energy accelerator muon beam at CERN. We successfully observed neutrons from 160 GeV/c muon interaction on lead, and measured kinetic energy distributions for various production angles. Works towards evaluation of absolute neutron production yield is underway. This work also demonstrates that the setup is feasible for a future large-scale experimentmore » for more comprehensive study of muon-induced neutron production.« less

The new high field photoexcitation muon spectrometer at the ISIS pulsed neutron and muon source

NASA Astrophysics Data System (ADS)

Yokoyama, K.; Lord, J. S.; Murahari, P.; Wang, K.; Dunstan, D. J.; Waller, S. P.; McPhail, D. J.; Hillier, A. D.; Henson, J.; Harper, M. R.; Heathcote, P.; Drew, A. J.

2016-12-01

A high power pulsed laser system has been installed on the high magnetic field muon spectrometer (HiFi) at the International Science Information Service pulsed neutron and muon source, situated at the STFC Rutherford Appleton Laboratory in the UK. The upgrade enables one to perform light-pump muon-probe experiments under a high magnetic field, which opens new applications of muon spin spectroscopy. In this report we give an overview of the principle of the HiFi laser system and describe the newly developed techniques and devices that enable precisely controlled photoexcitation of samples in the muon instrument. A demonstration experiment illustrates the potential of this unique combination of the photoexcited system and avoided level crossing technique.

The new high field photoexcitation muon spectrometer at the ISIS pulsed neutron and muon source.

PubMed

Yokoyama, K; Lord, J S; Murahari, P; Wang, K; Dunstan, D J; Waller, S P; McPhail, D J; Hillier, A D; Henson, J; Harper, M R; Heathcote, P; Drew, A J

2016-12-01

A high power pulsed laser system has been installed on the high magnetic field muon spectrometer (HiFi) at the International Science Information Service pulsed neutron and muon source, situated at the STFC Rutherford Appleton Laboratory in the UK. The upgrade enables one to perform light-pump muon-probe experiments under a high magnetic field, which opens new applications of muon spin spectroscopy. In this report we give an overview of the principle of the HiFi laser system and describe the newly developed techniques and devices that enable precisely controlled photoexcitation of samples in the muon instrument. A demonstration experiment illustrates the potential of this unique combination of the photoexcited system and avoided level crossing technique.

The MICE Muon Beam on ISIS and the beam-line instrumentation of the Muon Ionization Cooling Experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bogomilov, M.; Karadzhov, Y.; Kolev, D.

2012-05-01

The international Muon Ionization Cooling Experiment (MICE), which is under construction at the Rutherford Appleton Laboratory (RAL), will demonstrate the principle of ionization cooling as a technique for the reduction of the phase-space volume occupied by a muon beam. Ionization cooling channels are required for the Neutrino Factory and the Muon Collider. MICE will evaluate in detail the performance of a single lattice cell of the Feasibility Study 2 cooling channel. The MICE Muon Beam has been constructed at the ISIS synchrotron at RAL, and in MICE Step I, it has been characterized using the MICE beam-instrumentation system. In thismore » paper, the MICE Muon Beam and beam-line instrumentation are described. The muon rate is presented as a function of the beam loss generated by the MICE target dipping into the ISIS proton beam. For a 1 V signal from the ISIS beam-loss monitors downstream of our target we obtain a 30 KHz instantaneous muon rate, with a neglible pion contamination in the beam.« less

Study of muons associated with jets in proton-antiproton collisions at $$\\sqrt{s}$$ = 1.8-TeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, David Austen

1988-11-01

Production of heavy quark flavors in proton-antiproton collisions with a centerof- mass energy of 1.8 X 10 12 electron volts is studied for events containing hadronic jets with a nearby muon track, where both the jet and the muon are produced at large angles from the incident beams. The muon tracking system and pattern recognition are described. Detailed calculations of the muon background due to meson decay and hadron noninteractive punchthrough are presented, and other background sources are evaluated. Distributions of muon transverse momentum relative to the beam and to the jet axis agree with QCD expectations for semileptonicmore » charm and beauty decay. Muon identification cuts and background subtraction leave 57.5 ± 17.1 muon-jet pairs, a rate consistent with the established production cross sections for charm and beauty quarks and the acceptance for minimum ionizing particles overlapping with nearby jets. A small dimuon sample clarifies the muon signature. No signatures of undiscovered phenomena are observed in this new energy domain. 111« less

A New Approach in Coal Mine Exploration Using Cosmic Ray Muons

NASA Astrophysics Data System (ADS)

Darijani, Reza; Negarestani, Ali; Rezaie, Mohammad Reza; Fatemi, Syed Jalil; Akhond, Ahmad

2016-08-01

Muon radiography is a technique that uses cosmic ray muons to image the interior of large scale geological structures. The muon absorption in matter is the most important parameter in cosmic ray muon radiography. Cosmic ray muon radiography is similar to X-ray radiography. The main aim in this survey is the simulation of the muon radiography for exploration of mines. So, the production source, tracking, and detection of cosmic ray muons were simulated by MCNPX code. For this purpose, the input data of the source card in MCNPX code were extracted from the muon energy spectrum at sea level. In addition, the other input data such as average density and thickness of layers that were used in this code are the measured data from Pabdana (Kerman, Iran) coal mines. The average thickness and density of these layers in the coal mines are from 2 to 4 m and 1.3 gr/c3, respectively. To increase the spatial resolution, a detector was placed inside the mountain. The results indicated that using this approach, the layers with minimum thickness about 2.5 m can be identified.

Lateral distributions of EAS muons (Eμ > 800 MeV) measured with the KASCADE-Grande Muon Tracking Detector in the primary energy range 1016 -1017 eV

NASA Astrophysics Data System (ADS)

Apel, W. D.; Arteaga-Velázquez, J. C.; Bekk, K.; Bertaina, M.; Blümer, J.; Bozdog, H.; Brancus, I. M.; Cantoni, E.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; de Souza, V.; Di Pierro, F.; Doll, P.; Engel, R.; Engler, J.; Fuchs, B.; Fuhrmann, D.; Gherghel-Lascu, A.; Gils, H. J.; Glasstetter, R.; Grupen, C.; Haungs, A.; Heck, D.; Hörandel, J. R.; Huber, D.; Huege, T.; Kampert, K.-H.; Kang, D.; Klages, H. O.; Link, K.; Łuczak, P.; Mathes, H. J.; Mayer, H. J.; Milke, J.; Mitrica, B.; Morello, C.; Oehlschläger, J.; Ostapchenko, S.; Palmieri, N.; Petcu, M.; Pierog, T.; Rebel, H.; Roth, M.; Schieler, H.; Schoo, S.; Schröder, F. G.; Sima, O.; Toma, G.; Trinchero, G. C.; Ulrich, H.; Weindl, A.; Wochele, J.; Zabierowski, J.

2015-05-01

The KASCADE-Grande large area (128 m2) Muon Tracking Detector has been built with the aim to identify muons ( Eμthr = 800 MeV) in Extensive Air Showers by track measurements under 18 r.l. shielding. This detector provides high-accuracy angular information (approx. 0.3 °) for muons up to 700 m distance from the shower core. In this work we present the lateral density distributions of muons in EAS measured with the Muon Tracking Detector of the KASCADE-Grande experiment. The density is calculated by counting muon tracks in a muon-to-shower-axis distance range from 100 m to 610 m from showers with reconstructed energy of 1016 -1017 eV and zenith angle θ < 18 ° . In the distance range covered by the experiment, these distributions are well described by functions phenomenologically determined already in the fifties (of the last century) by Greisen. They are compared also with the distributions obtained with the KASCADE scintillator array (Eμthr = 230 MeV) and with distributions obtained using simulated showers.

Low-field spin dynamics of Cr7Ni and Cr7Ni-Cu -Cr 7Ni molecular rings as detected by μ SR

NASA Astrophysics Data System (ADS)

Sanna, S.; Arosio, P.; Bordonali, L.; Adelnia, F.; Mariani, M.; Garlatti, E.; Baines, C.; Amato, A.; Sabareesh, K. P. V.; Timco, G.; Winpenny, R. E. P.; Blundell, S. J.; Lascialfari, A.

2017-11-01

Muon spin rotation measurements were used to investigate the spin dynamics of heterometallic Cr7Ni and Cr7Ni -Cu-Cr7Ni molecular clusters. In Cr7Ni the magnetic ions are arranged in a quasiplanar ring and interact via an antiferromagnetic exchange coupling constant J , while Cr7Ni -Cu-Cr7Ni is composed of two Cr7Ni linked by a bridging moiety containing one Cu ion, that induces an inter-ring ferromagnetic interaction J'≪J . The longitudinal muon relaxation rate λ collected at low magnetic fields μ0H <0.15 Tesla, shows that the two systems present differences in spin dynamics vs temperature. While both samples exhibit a main peak in the muon relaxation rate vs temperature, at T ˜10 K for Cr7Ni and T ˜8 K for Cr7Ni -Cu-Cr7Ni , the two compounds have distinct additional features: Cr7Ni shows a shoulder in λ (T ) for T <8 K, while Cr7Ni -Cu-Cr7Ni shows a flattening of λ (T ) for T <2 K down to temperatures as low as T =20 mK. The main peak of both systems is explained by a Bloembergen-Purcell-Pound (BPP)-like heuristic fitting model that takes into account of a distribution of electronic spin characteristic times for T >5 K, while the shoulder presented by Cr7Ni can be reproduced by a BPP function that incorporates a single electronic characteristic time theoretically predicted to dominate for T <5 K. The flattening of λ (T ) in Cr7Ni -Cu-Cr7Ni occurring at very low temperature can be tentatively attributed to field-dependent quantum effects and/or to an inelastic term in the spectral density of the electronic spin fluctuations.

Novel Application of Density Estimation Techniques in Muon Ionization Cooling Experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohayai, Tanaz Angelina; Snopok, Pavel; Neuffer, David

The international Muon Ionization Cooling Experiment (MICE) aims to demonstrate muon beam ionization cooling for the first time and constitutes a key part of the R&D towards a future neutrino factory or muon collider. Beam cooling reduces the size of the phase space volume occupied by the beam. Non-parametric density estimation techniques allow very precise calculation of the muon beam phase-space density and its increase as a result of cooling. These density estimation techniques are investigated in this paper and applied in order to estimate the reduction in muon beam size in MICE under various conditions.

Spectroscopic investigations (FT-IR, UV, 1H and 13C NMR) and DFT/TD-DFT calculations of potential analgesic drug 2-[2-(dimethylamino)ethyl]-6-methoxy-4-(pyridin-2-yl)-1(2H)-phthalazinone

NASA Astrophysics Data System (ADS)

Sroczyński, Dariusz; Malinowski, Zbigniew

2017-12-01

The theoretical molecular geometry and the IR, UV, 1H and 13C NMR spectroscopic properties of 2-[2-(dimethylamino)ethyl]-6-methoxy-4-(pyridin-2-yl)-1(2H)-phthalazinone with the previously demonstrated in vivo analgesic activity were characterized. The conformational analysis, performed using the molecular mechanics method with the General AMBER Force Field (GAFF) and the Density Functional Theory (DFT) approach with the B3LYP hybrid functional and the 6-31 + g(d) basis sets, allowed to determine the most stable rotamer. The theoretical molecular geometry of this conformer was then calculated at the B3LYP/6-311++g(d,p) level of theory, and its phthalazinone core was compared with the experimental geometry of 1(2H)-phthalazinone. The calculated vibrational frequencies and the potential energy distribution enabled to assign the theoretical vibrational modes to the experimental FT-IR bands. The UV spectrum calculated with the Time-Dependent Density Functional Theory (TD-DFT) method in methanol identified the main electronic transitions and their character. 1H and 13C NMR chemical shifts simulated by the Gauge-Independent Atomic Orbital (GIAO) method in chloroform confirmed the previous assignment of the experimental resonance signals. The stability of the molecule was considered taking into account the hyperconjugation and electron density delocalization effects evaluated by the Natural Bond Orbital (NBO) method. The calculated spatial distribution of molecular electrostatic potential made possible to estimate the regions with nucleophilic and electrophilic properties. The results of the potentiodynamic polarization measurements were also indicated the corrosion inhibition activity of the title compound on 100Cr6 bearing steel in 1 mol dm-3 HCl solution.

Imaging a vertical shaft from a tunnel using muons

NASA Astrophysics Data System (ADS)

Bonal, N.; Preston, L. A.; Dorsey, D. J.; Schwellenbach, D.; Green, A.; Smalley, D.

2015-12-01

We use muon technology to image a vertical shaft from a tunnel. The density of the materials through which cosmic ray muons pass influences the flux of muons because muons are more attenuated by higher density material. Additionally, muons can travel several kilometers allowing measurements through deep rock. Density maps are generated from muon flux measurements to locate subsurface features like tunnel structures and ore bodies. Additionally, muon data can be jointly inverted with other data such as gravity and seismic to produce higher quality earth models than produced from a single method. We collected several weeks of data in a tunnel to image a vertical shaft. The minimum length of rock between the vertical shaft and the detector is 120 meters and the diameter of the vertical shaft is 4.6 meters. The rock the muons traveled through consists of Tertiary age volcanic tuff and steeply dipping, small-displacement faults. Results will be presented for muon flux in the tunnel and Monte-Carlo simulations of this experiment. Simulations from both GEANT4 (Geometry And Tracking version 4) and MCNP6 (Monte-Carlo N-Particle version 6) models will be compared. The tunnel overburden from muon measurements is also estimated and compared with actual the overburden. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

Describing excited state relaxation and localization in TiO 2 nanoparticles using TD-DFT

DOE PAGES

Berardo, Enrico; Hu, Han -Shi; van Dam, Hubertus J. J.; ...

2014-02-26

We have investigated the description of excited state relaxation in naked and hydrated TiO 2 nanoparticles using Time-Dependent Density Functional Theory (TD-DFT) with three common hybrid exchange-correlation (XC) potentials; B3LYP, CAM-B3LYP and BHLYP. Use of TD-CAM-B3LYP and TD-BHLYP yields qualitatively similar results for all structures, which are also consistent with predictions of coupled cluster theory for small particles. TD-B3LYP, in contrast, is found to make rather different predictions; including apparent conical intersections for certain particles that are not observed with TD-CAM-B3LYP nor with TD-BHLYP. In line with our previous observations for vertical excitations, the issue with TD-B3LYP appears to bemore » the inherent tendency of TD-B3LYP, and other XC potentials with no or a low percentage of Hartree-Fock Like Exchange, to spuriously stabilize the energy of charge-transfer (CT) states. Even in the case of hydrated particles, for which vertical excitations are generally well described with all XC potentials, the use of TD-B3LYP appears to result in CT-problems for certain particles. We hypothesize that the spurious stabilization of CT-states by TD-B3LYP even may drive the excited state optimizations to different excited state geometries than those obtained using TD-CAM-B3LYP or TD-BHLYP. In conclusion, focusing on the TD-CAM-B3LYP and TD-BHLYP results, excited state relaxation in naked and hydrated TiO 2 nanoparticles is predicted to be associated with a large Stokes’ shift.« less

Describing excited state relaxation and localization in TiO 2 nanoparticles using TD-DFT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berardo, Enrico; Hu, Han -Shi; van Dam, Hubertus J. J.

We have investigated the description of excited state relaxation in naked and hydrated TiO 2 nanoparticles using Time-Dependent Density Functional Theory (TD-DFT) with three common hybrid exchange-correlation (XC) potentials; B3LYP, CAM-B3LYP and BHLYP. Use of TD-CAM-B3LYP and TD-BHLYP yields qualitatively similar results for all structures, which are also consistent with predictions of coupled cluster theory for small particles. TD-B3LYP, in contrast, is found to make rather different predictions; including apparent conical intersections for certain particles that are not observed with TD-CAM-B3LYP nor with TD-BHLYP. In line with our previous observations for vertical excitations, the issue with TD-B3LYP appears to bemore » the inherent tendency of TD-B3LYP, and other XC potentials with no or a low percentage of Hartree-Fock Like Exchange, to spuriously stabilize the energy of charge-transfer (CT) states. Even in the case of hydrated particles, for which vertical excitations are generally well described with all XC potentials, the use of TD-B3LYP appears to result in CT-problems for certain particles. We hypothesize that the spurious stabilization of CT-states by TD-B3LYP even may drive the excited state optimizations to different excited state geometries than those obtained using TD-CAM-B3LYP or TD-BHLYP. In conclusion, focusing on the TD-CAM-B3LYP and TD-BHLYP results, excited state relaxation in naked and hydrated TiO 2 nanoparticles is predicted to be associated with a large Stokes’ shift.« less

Beam dynamics design of the muon linac high-beta section

NASA Astrophysics Data System (ADS)

Kondo, Y.; Hasegawa, K.; Otani, M.; Mibe, T.; Yoshida, M.; Kitamura, R.

2017-07-01

A muon linac development for a new muon g-2 experiment is now going on at J-PARC. Muons from the muon beam line (H line) at the J-PARC muon science facility are once stopped in a silica-aerogel target, and room temperature muoniums are evaporated from the aerogel. They are dissociated with lasers, then accelerated up to 212 MeV using a linear accelerator. For the accelerating structure from 40 MeV, disk-loaded traveling-wave structure is applicable because the particle beta is more than 0.7. The structure itself is similar to that for electron linacs, however, the cell length should be harmonic to the increase of the particle velocity. In this paper, the beam dynamics design of this muon linac using the disk-loaded structure (DLS) is described.

Imaging the Subsurface with Upgoing Muons

NASA Astrophysics Data System (ADS)

Bonal, N.; Preston, L. A.; Schwellenbach, D.; Dreesen, W.; Green, A.

2014-12-01

We assess the feasibility of imaging the subsurface using upgoing muons. Traditional muon imaging focuses on more-prevalent downgoing muons. Muons are subatomic particles capable of penetrating the earth's crust several kilometers. Downgoing muons have been used to image the Pyramid of Khafre of Giza, various volcanoes, and smaller targets like cargo. Unfortunately, utilizing downgoing muons requires below-target detectors. For aboveground objects like a volcano, the detector is placed at the volcano's base and the top portion of the volcano is imaged. For underground targets like tunnels, the detector would have to be placed below the tunnel in a deeper tunnel or adjacent borehole, which can be costly and impractical for some locations. Additionally, detecting and characterizing subsurface features like voids from tunnels can be difficult. Typical characterization methods like sonar, seismic, and ground penetrating radar have shown mixed success. Voids have a marked density contrast with surrounding materials, so using methods sensitive to density variations would be ideal. High-energy cosmic ray muons are more sensitive to density variation than other phenomena, including gravity. Their absorption rate depends on the density of the materials through which they pass. Measurements of muon flux rate at differing directions provide density variations of the materials between the muon source (cosmic rays and neutrino interactions) and detector, much like a CAT scan. Currently, tomography using downgoing muons can resolve features to the sub-meter scale. We present results of exploratory work, which demonstrates that upgoing muon fluxes appear sufficient to achieve target detection within a few months. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

Treponema denticola chymotrypsin-like proteinase may contribute to orodigestive carcinogenesis through immunomodulation.

PubMed

Nieminen, Mikko T; Listyarifah, Dyah; Hagström, Jaana; Haglund, Caj; Grenier, Daniel; Nordström, Dan; Uitto, Veli-Jukka; Hernandez, Marcela; Yucel-Lindberg, Tülay; Tervahartiala, Taina; Ainola, Mari; Sorsa, Timo

2018-02-06

Periodontal pathogens have been linked to oral and gastrointestinal (orodigestive) carcinogenesis. However, the exact mechanisms remain unknown. Treponema denticola (Td) is associated with severe periodontitis, a chronic inflammatory disease leading to tooth loss. The anaerobic spirochete Td is an invasive bacteria due to its major virulence factor chymotrypsin-like proteinase. Here we aimed to investigate the presence of Td chymotrypsin-like proteinase (Td-CTLP) in major orodigestive tumours and to elucidate potential mechanisms for Td to contribute to carcinogenesis. The presence of Td-CTLP within orodigestive tumour tissues was examined using immunohistochemistry. Oral, tonsillar, and oesophageal squamous cell carcinomas, alongside gastric, pancreatic, and colon adenocarcinomas were stained with a Td-CTLP-specific antibody. Gingival tissue from periodontitis patients served as positive controls. SDS-PAGE and immunoblot were used to analyse the immumodulatory activity of Td-CTLP in vitro. Td-CTLP was present in majority of orodigestive tumour samples. Td-CTLP was found to convert pro MMP-8 and -9 into their active forms. In addition, Td-CTLP was able to degrade the proteinase inhibitors TIMP-1, TIMP-2, and α-1-antichymotrypsin, as well as complement C1q. Because of its presence within tumours and regulatory activity on proteins critical for the regulation of tumour microenvironment and inflammation, the Td-CTLP may contribute to orodigestive carcinogenesis.

Prevalence and risk factors associated with tardive dyskinesia among Indian patients with schizophrenia.

PubMed

Achalia, Rashmin M; Chaturvedi, Santosh K; Desai, Geetha; Rao, Girish N; Prakash, Om

2014-06-01

Tardive dyskinesia (TD) is one of the most distressing side effects of antipsychotic treatment. As prevalence studies of TD in Asian population are scarce, a cross-sectional study was performed to assess the frequency of TD in Indian patients with schizophrenia and risk factors of TD. Cross-sectional study of 160 Indian patients fulfilling the DSM-IV TR criteria for schizophrenia and who received antipsychotics for at least one year, were examined with two validated scales for TD. Logistic regression analyses were used to examine the relationship between TD and clinical risk factors. The frequency of probable TD in the total sample was 26.4%. The logistic regression yielded significant odds ratios between TD and age, intermittent treatment, and total cumulative antipsychotic dose. The difference of TD between SGA and FGA disappeared after adjusting for important co-variables in regression analysis. Indian patients with schizophrenia and long-term antipsychotic treatment have a high risk of TD, and TD is associated with older age, intermittent antipsychotic treatment, and a high total cumulative antipsychotic dose. Our study findings suggest that there is no significant difference between SGAs with regards to the risk of causing TD as compared to FGAs. Copyright © 2014 Elsevier B.V. All rights reserved.

Advanced applications of cosmic-ray muon radiography

NASA Astrophysics Data System (ADS)

Perry, John

The passage of cosmic-ray muons through matter is dominated by the Coulomb interaction with electrons and atomic nuclei. The muon's interaction with electrons leads to continuous energy loss and stopping through the process of ionization. The muon's interaction with nuclei leads to angular diffusion. If a muon stops in matter, other processes unfold, as discussed in more detail below. These interactions provide the basis for advanced applications of cosmic-ray muon radiography discussed here, specifically: 1) imaging a nuclear reactor with near horizontal muons, and 2) identifying materials through the analysis of radiation lengths weighted by density and secondary signals that are induced by cosmic-ray muon trajectories. We have imaged a nuclear reactor, type AGN-201m, at the University of New Mexico, using data measured with a particle tracker built from a set of sealed drift tubes, the Mini Muon Tracker (MMT). Geant4 simulations were compared to the data for verification and validation. In both the data and simulation, we can identify regions of interest in the reactor including the core, moderator, and shield. This study reinforces our claims for using muon tomography to image reactors following an accident. Warhead and special nuclear materials (SNM) imaging is an important thrust for treaty verification and national security purposes. The differentiation of SNM from other materials, such as iron and aluminum, is useful for these applications. Several techniques were developed for material identification using cosmic-ray muons. These techniques include: 1) identifying the radiation length weighted by density of an object and 2) measuring the signals that can indicate the presence of fission and chain reactions. By combining the radiographic images created by tracking muons through a target plane with the additional fission neutron and gamma signature, we are able to locate regions that are fissionable from a single side. The following materials were imaged with this technique: aluminum, concrete, steel, lead, and uranium. Provided that there is sufficient mass, U-235 could be differentiated from U-238 through muon induced fission.

Measurement of cosmic-ray muons and muon-induced neutrons in the Aberdeen Tunnel Underground Laboratory

DOE PAGES

Yeh, M.; Chan, Y. L.; Chen, X. C.; ...

2016-04-07

In this study, we have measured the muon flux and production rate of muon-induced neutrons at a depth of 611 m water equivalent. Our apparatus comprises three layers of crossed plastic scintillator hodoscopes for tracking the incident cosmic-ray muons and 760 L of a gadolinium-doped liquid scintillator for producing and detecting neutrons. The vertical muon intensity was measured to be I μ = (5.7±0.6)×10 –6 cm –2 s –1 sr –1. The yield of muon-induced neutrons in the liquid scintillator was determined to be Y n = (1.19 ± 0.08(stat) ± 0.21(syst)) × 10 –4 neutrons/(μ•g•cm –2). A fit tomore » the recently measured neutron yields at different depths gave a mean muon energy dependence of < E μ > 0.76±0.03 for liquid-scintillator targets.« less

Measuring the leading-order hadronic contribution to the muon g-2 in the space-like region

NASA Astrophysics Data System (ADS)

Carloni Calame, Carlo M.

2017-04-01

A new experiment is proposed to measure the running of the electromagnetic coupling constant in the space-like region by scattering high-energy muons on atomic electrons of a low-Z target. The differential cross section of the elastic process μe → μe provides direct sensitivity to the leading-order hadronic contribution to the muon anomaly aμHLO. It is argued that by using the 150-GeV muon beam available at the CERN North Area, with an average rate of 1.3 × 107 muon/s, a statistical uncertainty of 0.3% can be achieved on aμHLO after two years of data taking. The direct measurement of aμHLO via μe scattering will provide an independent determination and consolidate the theoretical prediction for the muon g-2 in the Standard Model. It will allow therefore a firmer interpretation of the measurements of the future muon g-2 experiments at Fermilab and JPARC.

Intact cell MALDI-TOF mass spectrometry on single bovine oocyte and follicular cells combined with top-down proteomics: A novel approach to characterise markers of oocyte maturation.

PubMed

Labas, Valérie; Teixeira-Gomes, Ana-Paula; Bouguereau, Laura; Gargaros, Audrey; Spina, Lucie; Marestaing, Aurélie; Uzbekova, Svetlana

2018-03-20

Intact cell MALDI-TOF mass spectrometry (ICM-MS) was adapted to bovine follicular cells from individual ovarian follicles to obtain the protein/peptide signatures (<17kDa) of single oocytes, cumulus cells (CC) and granulosa cells (GC), which shared a total of 439 peaks. By comparing the ICM-MS profiles of single oocytes and CC before and after in vitro maturation (IVM), 71 different peaks were characterised, and their relative abundance was found to vary depending on the stage of oocyte meiotic maturation. To identify these endogenous biomolecules, top-down workflow using high resolution MS/MS (TD HR-MS) was performed on the protein extracts from oocytes, CC and GC. The TD HR-MS proteomic approach allowed for: (1) identification of 386 peptide/proteoforms encoded by 194 genes; and (2) characterisation of proteolysis products likely resulting from the action of kallikreins and caspases. In total, 136 peaks observed by ICM-MS were annotated by TD HR-MS (ProteomeXchange PXD004892). Among these, 16 markers of maturation were identified, including IGF2 binding protein 3 and hemoglobin B in the oocyte, thymosins beta-4 and beta-10, histone H2B and ubiquitin in CC. The combination of ICM-MS and TD HR-MS proved to be a suitable strategy to identify non-invasive markers of oocyte quality using limited biological samples. Intact cell MALDI-TOF mass spectrometry on single oocytes and their surrounding cumulus cells, coupled to an optimised top-down HR-MS proteomic approach on ovarian follicular cells, was used to identify specific markers of oocyte meiotic maturation represented by whole low molecular weight proteins or products of degradation by specific proteases. Copyright © 2017 Elsevier B.V. All rights reserved.

Synthesis, Spectra, and Theoretical Investigations of 1,3,5-Triazines Compounds as Ultraviolet Rays Absorber Based on Time-Dependent Density Functional Calculations and three-Dimensional Quantitative Structure-Property Relationship.

PubMed

Wang, Xueding; Xu, Yilian; Yang, Lu; Lu, Xiang; Zou, Hao; Yang, Weiqing; Zhang, Yuanyuan; Li, Zicheng; Ma, Menglin

2018-03-01

A series of 1,3,5-triazines were synthesized and their UV absorption properties were tested. The computational chemistry methods were used to construct quantitative structure-property relationship (QSPR), which was used to computer aided design of new 1,3,5-triazines ultraviolet rays absorber compounds. The experimental UV absorption data are in good agreement with those predicted data using the Time-dependent density functional theory (TD-DFT) [B3LYP/6-311 + G(d,p)]. A suitable forecasting model (R > 0.8, P < 0.0001) was revealed. Predictive three-dimensional quantitative structure-property relationship (3D-QSPR) model was established using multifit molecular alignment rule of Sybyl program, which conclusion is consistent with the TD-DFT calculation. The exceptional photostability mechanism of such ultraviolet rays absorber compounds was studied and confirmed as principally banked upon their ability to undergo excited-state deactivation via an ultrafast excited-state proton transfer (ESIPT). The intramolecular hydrogen bond (IMHB) of 1,3,5-triazines compounds is the basis for the excited state proton transfer, which was explored by IR spectroscopy, UV spectra, structural and energetic aspects of different conformers and frontier molecular orbitals analysis.

Stress in (Al, Ga)N heterostructures grown on 6H-SiC and Si substrates byplasma-assisted molecular beam epitaxy

NASA Astrophysics Data System (ADS)

Koshelev, O. A.; Nechaev, D. V.; Sitnikova, A. A.; Ratnikov, V. V.; Ivanov, S. V.; Jmerik, V. N.

2017-11-01

The paper describes experimental results on low temperature plasma-assisted molecular beam epitaxy of GaN/AlN heterostructures on both 6H-SiC and Si(111) substrates. We demonstrate that application of migration enhanced epitaxy and metal-modulated epitaxy for growth of AlN nucleation and buffer layers lowers the screw and edge(total)threading dislocation (TD) densities down to 1.7·108 and 2·109 cm-2, respectively, in a 2.8-μm-thick GaN buffer layer grown atop of AlN/6H-SiC. The screw and total TD densities of 1.2·109 and 7.4·109 cm-2, respectively, were achieved in a 1-μm-thickGaN/AlNheterostructure on Si(111). Stress generation and relaxation in GaN/AlN heterostructures were investigated by using multi-beam optical stress sensor (MOSS) to achieve zero substrate curvature at room temperature. It is demonstrated that a 1-μm-thick GaN/AlN buffer layer grown by PA MBE provides planar substrate morphology in the case of growth on Si substrates whereas 5-μm-thick GaN buffer layers have to be used to achieve the same when growing on 6H-SiC substrates.

Two-Photon Absorption Properties of Gold Fluorescent Protein: A Combined Molecular Dynamics and Quantum Chemistry Study.

PubMed

Şimşek, Yusuf; Brown, Alex

2018-06-07

Molecular dynamics (MD) simulations were carried out to obtain the conformational changes of the chromophore in the gold fluorescent protein (PDB ID: 1OXF ). To obtain two-photon absorption (TPA) cross-sections, time dependent density functional theory (TD-DFT) computations were performed for chromophore geometries sampled along the trajectory. The TD-DFT computations used the CAM-B3LYP functional and 6-31+G(d) basis set. Results showed that two dihedral angles change remarkably over the simulation time. TPA cross-sections were found to average 13.82 GM for the excitation to S 1 computed from the equilibrium geometries; however, extending the structures with a water molecule and GLU residue, which make H bonds with the chromophore molecule, increased excitation energies and TPA cross-sections significantly. Besides the effects of the surrounding residues and the dihedrals on the spectroscopic properties, some bond lengths affected the excitation energies and the TPA cross-sections significantly (up to ±25-30%), while the effects of the bond angles were smaller (±5%). Overall the present results provide insight into the effects of the conformational flexibility on TPA (with gold fluorescent protein as a specific example) and suggest that further experimental measurements of TPA for the gold fluorescent protein should be undertaken.

Cosmic ray muons for spent nuclear fuel monitoring

NASA Astrophysics Data System (ADS)

Chatzidakis, Stylianos

There is a steady increase in the volume of spent nuclear fuel stored on-site (at reactor) as currently there is no permanent disposal option. No alternative disposal path is available and storage of spent nuclear fuel in dry storage containers is anticipated for the near future. In this dissertation, a capability to monitor spent nuclear fuel stored within dry casks using cosmic ray muons is developed. The motivation stems from the need to investigate whether the stored content agrees with facility declarations to allow proliferation detection and international treaty verification. Cosmic ray muons are charged particles generated naturally in the atmosphere from high energy cosmic rays. Using muons for proliferation detection and international treaty verification of spent nuclear fuel is a novel approach to nuclear security that presents significant advantages. Among others, muons have the ability to penetrate high density materials, are freely available, no radiological sources are required and consequently there is a total absence of any artificial radiological dose. A methodology is developed to demonstrate the applicability of muons for nuclear nonproliferation monitoring of spent nuclear fuel dry casks. Purpose is to use muons to differentiate between spent nuclear fuel dry casks with different amount of loading, not feasible with any other technique. Muon scattering and transmission are used to perform monitoring and imaging of the stored contents of dry casks loaded with spent nuclear fuel. It is shown that one missing fuel assembly can be distinguished from a fully loaded cask with a small overlapping between the scattering distributions with 300,000 muons or more. A Bayesian monitoring algorithm was derived to allow differentiation of a fully loaded dry cask from one with a fuel assembly missing in the order of minutes and negligible error rate. Muon scattering and transmission simulations are used to reconstruct the stored contents of sealed dry casks from muon measurements. A combination of muon scattering and muon transmission imaging can improve resolution and thus a missing fuel assembly can be identified for vertical and horizontal dry casks. The apparent separation of the images reveals that the muon scattering and transmission can be used for discrimination between casks, satisfying the diversion criteria set by IAEA.

First muon acceleration using a radio-frequency accelerator

NASA Astrophysics Data System (ADS)

Bae, S.; Choi, H.; Choi, S.; Fukao, Y.; Futatsukawa, K.; Hasegawa, K.; Iijima, T.; Iinuma, H.; Ishida, K.; Kawamura, N.; Kim, B.; Kitamura, R.; Ko, H. S.; Kondo, Y.; Li, S.; Mibe, T.; Miyake, Y.; Morishita, T.; Nakazawa, Y.; Otani, M.; Razuvaev, G. P.; Saito, N.; Shimomura, K.; Sue, Y.; Won, E.; Yamazaki, T.

2018-05-01

Muons have been accelerated by using a radio-frequency accelerator for the first time. Negative muonium atoms (Mu- ), which are bound states of positive muons (μ+) and two electrons, are generated from μ+'s through the electron capture process in an aluminum degrader. The generated Mu- 's are initially electrostatically accelerated and injected into a radio-frequency quadrupole linac (RFQ). In the RFQ, the Mu- 's are accelerated to 89 keV. The accelerated Mu- 's are identified by momentum measurement and time of flight. This compact muon linac opens the door to various muon accelerator applications including particle physics measurements and the construction of a transmission muon microscope.

Muon identification with Muon Telescope Detector at the STAR experiment

NASA Astrophysics Data System (ADS)

Huang, T. C.; Ma, R.; Huang, B.; Huang, X.; Ruan, L.; Todoroki, T.; Xu, Z.; Yang, C.; Yang, S.; Yang, Q.; Yang, Y.; Zha, W.

2016-10-01

The Muon Telescope Detector (MTD) is a newly installed detector in the STAR experiment. It provides an excellent opportunity to study heavy quarkonium physics using the dimuon channel in heavy ion collisions. In this paper, we report the muon identification performance for the MTD using proton-proton collisions at √{ s }=500 GeV with various methods. The result using the Likelihood Ratio method shows that the muon identification efficiency can reach up to ∼90% for muons with transverse momenta greater than 3 GeV/c and the significance of the J / ψ signal is improved by a factor of 2 compared to using the basic selection.

Friction welding.

NASA Technical Reports Server (NTRS)

Moore, T. J.

1972-01-01

Results of an exploratory study of the structure and properties of friction welds in Udimet 700 (U-700) and TD-nickel (TD-Ni) bar materials, as well as dissimilar U-700/TD-Ni friction welds. Butt welds were prepared by friction welding 12.7-mm-diam U-700 bars and TD-Ni bars. Specimens for elevated temperature tensile and stress rupture testing were machined after a postweld heat treatment. Friction welding of U-700 shows great potential because the welds were found to be as strong as the parent metal in stress rupture and tensile tests at 760 and 980 C. In addition, the weld line was not detectable by metallographic examination after postheating. Friction welds in TD-Ni or between U-700 and TD-Ni were extremely weak at elevated temperatures. The TD-Ni friction welds could support only 9% as much stress as the base metal for 10-hour stress rupture life at 1090 C. The U-700/TD-Ni weld could sustain only 15% as much stress as the TD-Ni parent metal for a 10-hour stress rupture life at 930 C. Thus friction welding is not a suitable joining method for obtaining high-strength TD-Ni or U-700/TD-Ni weldments.

A novel thiazolidinedione derivative TD118 showing selective algicidal effects for red tide control.

PubMed

Wu, Ying; Lee, Yew; Jung, Seul-Gi; Kim, Minju; Eom, Chi-Yong; Kim, Si Wouk; Cho, Hoon; Jin, Eonseon

2014-05-01

Thiazolidinedione (TD) derivatives have been found to have an algicidal effect on harmful algal bloom microalgae. In this study, 75 TD derivatives were synthesized and analyzed for algicidal activity. Among these synthetic TDs, 18 TD derivatives showed specific algicidal activity on two strains belonging to the classes Raphidophyceae (Chattonella marina and Heterosigma akashiwo) and Dinophyceae (Cochlodinium polykrikoides). Two strains belonging to Bacillariophyceae (Navicula pelliculosa and Phaeodactylum EPV), one strain belonging to Dinophyceae (Amphidinium sp.), and a Eustigmatophycean microalga (Nannochloropsis oculata) showed less sensitivity to the TD derivatives than the other two phyla. The most reactive TD derivative, compound 2 (TD118), was selected and tested for morphological and physiological changes. TD118 effectively damaged the cell membrane of C. marina, H. akashiwo and C. polykrikoides. The O₂ evolution and photosystem II efficiency (F(v)/F(m)) of C. marina, H. akashiwo and C. polykrikoides were also severely reduced by TD118 treatment. Amphidinium sp., N. pelliculosa, Phaeodactylum EPV and N. oculata showed less reduction of O₂ evolution and the F(v)/F(m) by TD118. These results imply that the species-specific TD structure relationship may be due to structural and/or physiological differences among microalgal species.

On the Feasibility of a Pulsed 14 TeV C.M.E. Muon Collider in the LHC Tunnel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shiltsev, Vladimir; Neuffer, D.

We discuss the technical feasibility, key machine pa-rameters and major challenges of a 14 TeV c.m.e. muon-muon collider in the LHC tunnel [1]. The luminosity of the collider is evaluated for three alternative muon sources – the PS synchrotron, one of a type developed by the US Muon Accelerator Program (MAP) and a low-emittance option based on resonant μ-pair production.

Accelerator performance analysis of the Fermilab Muon Campus

DOE PAGES

Stratakis, Diktys; Convery, Mary E.; Johnstone, Carol; ...

2017-11-21

Fermilab is dedicated to hosting world-class experiments in search of new physics that will operate in the coming years. The Muon g-2 Experiment is one such experiment that will determine with unprecedented precision the muon anomalous magnetic moment, which offers an important test of the Standard Model. We describe in this study the accelerator facility that will deliver a muon beam to this experiment. We first present the lattice design that allows for efficient capture, transport, and delivery of polarized muon beams. We then numerically examine its performance by simulating pion production in the target, muon collection by the downstreammore » beam line optics, as well as transport of muon polarization. Lastly, we finally establish the conditions required for the safe removal of unwanted secondary particles that minimizes contamination of the final beam.« less

Performance of the ATLAS muon trigger in pp collisions at √s = 8 TeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aad, G.

The performance of the ATLAS muon trigger system is evaluated with proton–proton collision data collected in 2012 at the Large Hadron Collider at a centre-of-mass energy of 8 TeV. It is primarily evaluated using events containing a pair of muons from the decay of Z bosons. The efficiency of the single-muon trigger is measured for muons with transverse momentum 25 < p T < 100 GeV, with a statistical uncertainty of less than 0.01 % and a systematic uncertainty of 0.6 %. The pT range for efficiency determination is extended by using muons from decays of J/ψ mesons, W bosons,more » and top quarks. The muon trigger shows highly uniform and stable performance. Thus, the performance is compared to the prediction of a detailed simulation.« less

Performance of the ATLAS muon trigger in pp collisions at √s = 8 TeV

DOE PAGES

Aad, G.

2015-03-13

The performance of the ATLAS muon trigger system is evaluated with proton–proton collision data collected in 2012 at the Large Hadron Collider at a centre-of-mass energy of 8 TeV. It is primarily evaluated using events containing a pair of muons from the decay of Z bosons. The efficiency of the single-muon trigger is measured for muons with transverse momentum 25 < p T < 100 GeV, with a statistical uncertainty of less than 0.01 % and a systematic uncertainty of 0.6 %. The pT range for efficiency determination is extended by using muons from decays of J/ψ mesons, W bosons,more » and top quarks. The muon trigger shows highly uniform and stable performance. Thus, the performance is compared to the prediction of a detailed simulation.« less

Muon background studies for shallow depth Double - Chooz near detector

NASA Astrophysics Data System (ADS)

Gómez, H.

2015-08-01

Muon events are one of the main concerns regarding background in neutrino experiments. The placement of experimental set-ups in deep underground facilities reduce considerably their impact on the research of the expected signals. But in the cases where the detector is installed on surface or at shallow depth, muon flux remains high, being necessary their precise identification for further rejection. Total flux, mean energy or angular distributions are some of the parameters that can help to characterize the muons. Empirically, the muon rate can be measured in an experiment by a number of methods. Nevertheless, the capability to determine the muons angular distribution strongly depends on the detector features, while the measurement of the muon energy is quite difficult. Also considering that on-site measurements can not be extrapolated to other sites due to the difference on the overburden and its profile, it is necessary to find an adequate solution to perform the muon characterization. The method described in this work to obtain the main features of the muons reaching the experimental set-up, is based on the muon transport simulation by the MUSIC software, combined with a dedicated sampling algorithm for shallow depth installations based on a modified Gaisser parametrization. This method provides all the required information about the muons for any shallow depth installation if the corresponding overburden profile is implemented. In this work, the method has been applied for the recently commissioned Double - Chooz near detector, which will allow the cross-check between the simulation and the experimental data, as it has been done for the far detector.

Impact of muon detection thresholds on the separability of primary cosmic rays

NASA Astrophysics Data System (ADS)

Müller, S.; Engel, R.; Pierog, T.; Roth, M.

2018-01-01

Knowledge of the mass composition of cosmic rays in the transition region of galactic to extragalactic cosmic rays is needed to discriminate different astrophysical models on their origin, acceleration, and propagation. An important observable to separate different mass groups of cosmic rays is the number of muons in extensive air showers. We performed a CORSIKA simulation study to analyze the impact of the detection threshold of muons on the separation quality of different primary cosmic rays in the energy region of the ankle. Using only the number of muons as the composition-sensitive observable, we find a clear dependence of the separation power on the detection threshold for ideal measurements. Although the number of detected muons increases when lowering the threshold, the discrimination power is reduced. If statistical fluctuations for muon detectors of limited size are taken into account, the threshold dependence remains qualitatively the same for small distances to the shower core but is reduced for large core distances. We interpret the impact of the detection threshold of muons on the composition sensitivity in terms of a change of the correlation of the number of muons nμ with the shower maximum Xmax as function of the muon energy as a result of the underlying hadronic interactions and the shower geometry. We further investigate the role of muons produced in a shower by photon-air interactions and conclude that, in addition to the effect of the nμ -Xmax correlation, the separability of primaries is reduced as a consequence of the presence of more muons from photonuclear reactions in proton than in iron showers.

Design and characterization of a small muon tomography system

NASA Astrophysics Data System (ADS)

Jo, Woo Jin; An, Su Jung; Kim, Hyun-Il; Lee, Chae Young; Chung, Heejun; Chung, Yong Hyun

2015-02-01

Muon tomography is a useful method for monitoring special nuclear materials (SNMs) because it can provide effective information on the presence of high-Z materials, has a high enough energy to deeply penetrate large amounts of shielding, and does not lead to any health risks and danger above background. We developed a 2-D muon detector and designed a muon tomography system employing four detector modules. Two top and two bottom detectors are, respectively, employed to record the incident and the scattered muon trajectories. The detector module for the muon tomography system consists of a plastic scintillator, wavelength-shifting (WLS) fiber arrays placed orthogonally on the top and the bottom of the scintillator, and a position-sensitive photomultiplier (PSPMT). The WLS fiber arrays absorb light photons emitted by the plastic scintillator and re-emit green lights guided to the PSPMT. The light distribution among the WLS fiber arrays determines the position of the muon interaction; consequently, 3-D tomographic images can be obtained by extracting the crossing points of the individual muon trajectories by using a point-of-closest-approach algorithm. The goal of this study is to optimize the design parameters of a muon tomography system by using the Geant4 code and to experimentally evaluate the performance of the prototype detector. Images obtained by the prototype detector with a 420-nm laser light source showed good agreement with the simulation results. This indicates that the proposed detector is feasible for use in a muon tomography system and can be used to verify the Z-discrimination capability of the muon tomography system.

Muon Accelerator Program (MAP) | Neutrino Factory | Research Goals

Science.gov Websites

; Committees Research Goals Research & Development Design & Simulation Technology Development Systems Demonstrations Activities MASS Muon Cooling MuCool Test Area MICE Experiment MERIT Muon Collider Research Goals Why Muons at the Energy Frontier? How does it work? Graphics Animation Neutrino Factory Research Goals

TdT activity in acute myeloid leukemias defined by monoclonal antibodies.

PubMed

San Miguel, J F; González, M; Cañizo, M C; Anta, J P; Portero, J A; López-Borrasca, A

1986-09-01

Blast cells from eight out of 71 patients diagnosed with acute myeloid leukemia (AML) by morphological, cytochemical, and immunological criteria showed TdT activity. Their distribution according to the FAB classification was one M1, one M2, one M4, two M5a, one M5b, one M6, and one undifferentiated case. The TdT+ AML cases did not show major clinical and hematological differences when compared with the classical TdT- AML patients. Other phenotypical aberrations in the expression of membrane antigens, apart from the presence of nuclear TdT, were not observed in these TdT+ cases after study with a large panel of monoclonal antibodies. A higher incidence of TdT+ cases was found among the monocytic variants of AML (M4 and M5)--four cases--than in the granulocytic variants (M1, M2, and M3)--2 cases. These TdT+ cases should be distinguished from mixed leukemias by double labeling techniques, assessing in the TdT+ AML the coexpression of TdT and myeloid markers in individual cells as shown in four of our cases.

Measuring the energy deposited by muon bundles of inclined EAS in the NEVOD-DECOR experiment

NASA Astrophysics Data System (ADS)

Kokoulin, R. P.; Bogdanov, A. G.; Barbashina, N. S.; Dushkin, L. I.; Kindin, V. V.; Kompaniets, K. G.; Mannocchi, G.; Petrukhin, A. A.; Saavedra, O.; Trinchero, G.; Khomyakov, V. A.; Khokhlov, S. S.; Chernov, D. V.; Shutenko, V. V.; Yurina, E. A.; Yashin, I. I.

2018-01-01

As part of an in-depth investigation of the muon excess observed in ultrahigh-energy cosmic rays, one needs to measure the energy characteristics of muon component of extensive air showers (EAS). The mean muon energy can be estimated from the energy deposited in the detector by the muon bundles. In the NEVOD-DECOR experiment, the local muon density and the shower-arrival direction are measured with a track-coordinate detector, and the deposited energy is measured in the Cherenkov calorimeter. The results of the measurements carried out in 17400 h of detector operation are compared with those of the simulation based on the CORSIKA package.

Muon identification with Muon Telescope Detector at the STAR experiment

DOE PAGES

Huang, T. C.; Ma, R.; Huang, B.; ...

2016-07-15

The Muon Telescope Detector (MTD) is a newly installed detector in the STAR experiment. It provides an excellent opportunity to study heavy quarkonium physics using the dimuon channel in heavy ion collisions. In this paper, we report the muon identification performance for the MTD using proton-proton collisions atmore » $$\\sqrt{s}$$ = 500 GeV with various methods. Here, the result using the Likelihood Ratio method shows that the muon identification efficiency can reach up to ~ 90% for muons with transverse momenta greater than 3 GeV/c and the significance of the J/ψ signal is improved by a factor of 2 compared to using the basic selection.« less

Integrated cosmic muon flux in the zenith angle range 0 < cosθ < 0.37 for momentum threshold up to 11.6 GeV/c

NASA Astrophysics Data System (ADS)

Fujii, Hirofumi; Hara, Kazuhiko; Hayashi, Kohei; Kakuno, Hidekazu; Kodama, Hideyo; Nagamine, Kanetada; Sato, Kazuyuki; Sato, Kotaro; Kim, Shin-Hong; Suzuki, Atsuto; Takahashi, Kazuki; Takasaki, Fumihiko

2017-12-01

We have measured the cosmic muon flux in the zenith angle range {<} cos θ {<} 0.37 with a detector comprising planes of scintillator hodoscope bars and iron blocks inserted between them. The muon ranges for up to 9.5 m-thick iron blocks allow the provision of muon flux data integrated over corresponding threshold momenta up to 11.6 GeV/c. Such a dataset covering the horizontal direction is extremely useful for a technique called muon radiography, where the mass distribution inside a large object is investigated from the cosmic muon distribution measured behind the object.

Identification and characterization of two plasma membrane aquaporins in durum wheat (Triticum turgidum L. subsp. durum) and their role in abiotic stress tolerance.

PubMed

Ayadi, Malika; Cavez, Damien; Miled, Nabil; Chaumont, François; Masmoudi, Khaled

2011-09-01

Plant plasma membrane intrinsic proteins (PIP) cluster in two phylogenetic groups, PIP1 and PIP2 that have different water channel activities when expressed in Xenopus oocytes. PIP2s induce a marked increase of the membrane osmotic water-permeability coefficient (P(f)), whereas PIP1s are generally inactive. Here we report the cloning of two durum wheat (Triticum turgidum L. subsp. durum) cDNAs encoding TdPIP1;1 and TdPIP2;1 belonging to the PIP1 and PIP2 subfamilies, respectively. Contrary to TdPIP1;1, expression of TdPIP2;1 in Xenopus oocytes resulted in an increase in P(f) compared to water-injected oocytes. Co-expression of the non-functional TdPIP1;1 and the functional TdPIP2;1 lead to a significant increase in P(f) compared with oocytes expressing TdPIP2;1 alone. A truncated form of TdPIP2;1, tdpip2;1, missing the first two transmembrane domains, had no water channel activity. Nonetheless, its co-expression with the functional TdPIP2;1 partially inhibits the P(f) and disrupt the activities of plant aquaporins. In contrast to the approach developed in Xenopus oocytes, phenotypic analyses of transgenic tobacco plants expressing TdPIP1;1 or TdPIP2;1 generated a tolerance phenotype towards osmotic and salinity stress. TdPIP1;1 and TdPIP2;1 are differentially regulated in roots and leaves in the salt-tolerant wheat variety when challenged with salt stress and abscisic acid. Confocal microscopy analysis of tobacco roots expressing TdPIP1;1 and TdPIP2;1 fused to the green fluorescent protein showed that the proteins were localized at the plasma membrane. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Focal Thalamic Degeneration from Ethanol and Thiamine Deficiency is Associated with Neuroimmune Gene Induction, Microglial Activation, and Lack of Monocarboxylic Acid Transporters

PubMed Central

Qin, Liya; Crews, Fulton T

2014-01-01

Background Wernicke's encephalopathy-Korsakoff syndrome (WE-KS) is common in alcoholics, caused by thiamine deficiency (TD; vitamin B1) and associated with lesions to the thalamus (THAL). Although TD alone can cause WE, the high incidence in alcoholism suggests that TD and ethanol (EtOH) interact. Methods Mice in control, TD, or EtOH groups alone or combined were studied after 5 or 10 days of treatment. THAL and entorhinal cortex (ENT) histochemistry and mRNA were assessed. Results Combined EtOH-TD treatment for 5 days (EtOH-TD5) showed activated microglia, proinflammatory gene induction and THAL neurodegeneration that was greater than that found with TD alone (TD5), whereas 10 days resulted in marked THAL degeneration and microglial-neuroimmune activation in both groups. In contrast, 10 days of TD did not cause ENT degeneration. Interestingly, in ENT, TD10 activated microglia and astrocytes more than EtOH-TD10. In THAL, multiple astrocytic markers were lost consistent with glial cell loss. TD blocks glucose metabolism more than acetate. Acetate derived from hepatic EtOH metabolism is transported by monocarboxylic acid transporters (MCT) into both neurons and astrocytes that use acetyl-CoA synthetase (AcCoAS) to generate cellular energy from acetate. MCT and AcCoAS expression in THAL is lower than ENT prompting the hypothesis that focal THAL degeneration is related to insufficient MCT and AcCoAS in THAL. To test this hypothesis, we administered glycerin triacetate (GTA) to increase blood acetate and found it protected the THAL from TD-induced degeneration. Conclusions Our findings suggest that EtOH potentiates TD-induced THAL degeneration through neuroimmune gene induction. The findings support the hypothesis that TD deficiency inhibits global glucose metabolism and that a reduced ability to process acetate for cellular energy results in THAL focal degeneration in alcoholics contributing to the high incidence of Wernicke-Korsakoff syndrome in alcoholism. PMID:24117525

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adams, D.; Alekou, A.; Apollonio, M.

Here, the international Muon Ionization Cooling Experiment (MICE) will perform a systematic investigation of ionization cooling with muon beams of momentum between 140 and 240\\,MeV/c at the Rutherford Appleton Laboratory ISIS facility. The measurement of ionization cooling in MICE relies on the selection of a pure sample of muons that traverse the experiment. To make this selection, the MICE Muon Beam is designed to deliver a beam of muons with less thanmore » $$\\sim$$1% contamination. To make the final muon selection, MICE employs a particle-identification (PID) system upstream and downstream of the cooling cell. The PID system includes time-of-flight hodoscopes, threshold-Cherenkov counters and calorimetry. The upper limit for the pion contamination measured in this paper is $$f_\\pi < 1.4\\%$$ at 90% C.L., including systematic uncertainties. Therefore, the MICE Muon Beam is able to meet the stringent pion-contamination requirements of the study of ionization cooling.« less

Muon detector for the COSINE-100 experiment

NASA Astrophysics Data System (ADS)

Prihtiadi, H.; Adhikari, G.; Adhikari, P.; Barbosa de Souza, E.; Carlin, N.; Choi, S.; Choi, W. Q.; Djamal, M.; Ezeribe, A. C.; Ha, C.; Hahn, I. S.; Hubbard, A. J. F.; Jeon, E. J.; Jo, J. H.; Joo, H. W.; Kang, W.; Kang, W. G.; Kauer, M.; Kim, B. H.; Kim, H.; Kim, H. J.; Kim, K. W.; Kim, N. Y.; Kim, S. K.; Kim, Y. D.; Kim, Y. H.; Kudryavtsev, V. A.; Lee, H. S.; Lee, J.; Lee, J. Y.; Lee, M. H.; Leonard, D. S.; Lim, K. E.; Lynch, W. A.; Maruyama, R. H.; Mouton, F.; Olsen, S. L.; Park, H. K.; Park, H. S.; Park, J. S.; Park, K. S.; Pettus, W.; Pierpoint, Z. P.; Ra, S.; Rogers, F. R.; Rott, C.; Scarff, A.; Spooner, N. J. C.; Thompson, W. G.; Yang, L.; Yong, S. H.

2018-02-01

The COSINE-100 dark matter search experiment has started taking physics data with the goal of performing an independent measurement of the annual modulation signal observed by DAMA/LIBRA. A muon detector was constructed by using plastic scintillator panels in the outermost layer of the shield surrounding the COSINE-100 detector. It detects cosmic ray muons in order to understand the impact of the muon annual modulation on dark matter analysis. Assembly and initial performance tests of each module have been performed at a ground laboratory. The installation of the detector in the Yangyang Underground Laboratory (Y2L) was completed in the summer of 2016. Using three months of data, the muon underground flux was measured to be 328 ± 1(stat.)± 10(syst.) muons/m2/day. In this report, the assembly of the muon detector and the results from the analysis are presented.

Performance of the ATLAS muon trigger in pp collisions at [Formula: see text] TeV.

PubMed

Aad, G; Abbott, B; Abdallah, J; Abdel Khalek, S; Abdinov, O; Aben, R; Abi, B; Abolins, M; AbouZeid, O S; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Agatonovic-Jovin, T; Aguilar-Saavedra, J A; Agustoni, M; Ahlen, S P; Ahmadov, F; Aielli, G; Akerstedt, H; Åkesson, T P A; Akimoto, G; Akimov, A V; Alberghi, G L; Albert, J; Albrand, S; Alconada Verzini, M J; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexandre, G; Alexopoulos, T; Alhroob, M; Alimonti, G; Alio, L; Alison, J; Allbrooke, B M M; Allison, L J; Allport, P P; Almond, J; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Altheimer, A; Alvarez Gonzalez, B; Alviggi, M G; Amako, K; Amaral Coutinho, Y; Amelung, C; Amidei, D; Amor Dos Santos, S P; Amorim, A; Amoroso, S; Amram, N; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anderson, K J; Andreazza, A; Andrei, V; Anduaga, X S; Angelidakis, S; Angelozzi, I; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antonaki, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Aperio Bella, L; Apolle, R; Arabidze, G; Aracena, I; Arai, Y; Araque, J P; Arce, A T H; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Arnaez, O; Arnal, V; Arnold, H; Arratia, M; Arslan, O; Artamonov, A; Artoni, G; Asai, S; Asbah, N; Ashkenazi, A; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Auerbach, B; Augsten, K; Aurousseau, M; Avolio, G; Azuelos, G; Azuma, Y; Baak, M A; Baas, A E; Bacci, C; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Backus Mayes, J; Badescu, E; Bagiacchi, P; Bagnaia, P; Bai, Y; Bain, T; Baines, J T; Baker, O K; Balek, P; Balli, F; Banas, E; Banerjee, Sw; Bannoura, A A E; Bansal, V; Bansil, H S; Barak, L; Baranov, S P; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barisonzi, M; Barklow, T; Barlow, N; Barnett, B M; Barnett, R M; Barnovska, Z; Baroncelli, A; Barone, G; Barr, A J; Barreiro, F; Barreiro Guimarães da Costa, J; Bartoldus, R; Barton, A E; Bartos, P; Bartsch, V; Bassalat, A; Basye, A; Bates, R L; Batley, J R; Battaglia, M; Battistin, M; Bauer, F; Bawa, H S; Beattie, M D; Beau, T; Beauchemin, P H; Beccherle, R; Bechtle, P; Beck, H P; Becker, K; Becker, S; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bedikian, S; Bednyakov, V A; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, K; Belanger-Champagne, C; Bell, P J; Bell, W H; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belotskiy, K; Beltramello, O; Benary, O; Benchekroun, D; Bendtz, K; Benekos, N; Benhammou, Y; Benhar Noccioli, E; Benitez Garcia, J A; Benjamin, D P; Bensinger, J R; Benslama, K; Bentvelsen, S; Berge, D; Bergeaas Kuutmann, E; Berger, N; Berghaus, F; Beringer, J; Bernard, C; Bernat, P; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertoli, G; Bertolucci, F; Bertsche, C; Bertsche, D; Besana, M I; Besjes, G J; Bessidskaia, O; Bessner, M; Besson, N; Betancourt, C; Bethke, S; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Bieniek, S P; Bierwagen, K; Biesiada, J; Biglietti, M; Bilbao De Mendizabal, J; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blanchard, J-B; Blazek, T; Bloch, I; Blocker, C; Blum, W; Blumenschein, U; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Bock, C; Boddy, C R; Boehler, M; Boek, T T; Bogaerts, J A; Bogdanchikov, A G; Bogouch, A; Bohm, C; Bohm, J; Boisvert, V; Bold, T; Boldea, V; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Borri, M; Borroni, S; Bortfeldt, J; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Boterenbrood, H; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Bousson, N; Boutouil, S; Boveia, A; Boyd, J; Boyko, I R; Bozic, I; Bracinik, J; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Brazzale, S F; Brelier, B; Brendlinger, K; Brennan, A J; Brenner, R; Bressler, S; Bristow, K; Bristow, T M; Britton, D; Brochu, F M; Brock, I; Brock, R; Bromberg, C; Bronner, J; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Brown, J; Bruckman de Renstrom, P A; Bruncko, D; Bruneliere, R; Brunet, S; Bruni, A; Bruni, G; Bruschi, M; Bryngemark, L; Buanes, T; Buat, Q; Bucci, F; Buchholz, P; Buckingham, R M; Buckley, A G; Buda, S I; Budagov, I A; Buehrer, F; Bugge, L; Bugge, M K; Bulekov, O; Bundock, A C; Burckhart, H; Burdin, S; Burghgrave, B; Burke, S; Burmeister, I; Busato, E; Büscher, D; Büscher, V; Bussey, P; Buszello, C P; Butler, B; Butler, J M; Butt, A I; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Byszewski, M; Cabrera Urbán, S; Caforio, D; Cakir, O; Calace, N; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Calkins, R; Caloba, L P; Calvet, D; Calvet, S; Camacho Toro, R; Camarda, S; Cameron, D; Caminada, L M; Caminal Armadans, R; Campana, S; Campanelli, M; Campoverde, A; Canale, V; Canepa, A; Cano Bret, M; Cantero, J; Cantrill, R; Cao, T; Capeans Garrido, M D M; Caprini, I; Caprini, M; Capua, M; Caputo, R; Cardarelli, R; Carli, T; Carlino, G; Carminati, L; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Casolino, M; Castaneda-Miranda, E; Castelli, A; Castillo Gimenez, V; Castro, N F; Catastini, P; Catinaccio, A; Catmore, J R; Cattai, A; Cattani, G; Caudron, J; Cavaliere, V; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Cerio, B C; Cerny, K; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cerv, M; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chalupkova, I; Chang, P; Chapleau, B; Chapman, J D; Charfeddine, D; Charlton, D G; Chau, C C; Chavez Barajas, C A; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, K; Chen, L; Chen, S; Chen, X; Chen, Y; Chen, Y; Cheng, H C; Cheng, Y; Cheplakov, A; Cherkaoui El Moursli, R; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiefari, G; Childers, J T; Chilingarov, A; Chiodini, G; Chisholm, A S; Chislett, R T; Chitan, A; Chizhov, M V; Chouridou, S; Chow, B K B; Chromek-Burckhart, D; Chu, M L; Chudoba, J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Ciftci, R; Cinca, D; Cindro, V; Ciocio, A; Cirkovic, P; Citron, Z H; Citterio, M; Ciubancan, M; Clark, A; Clark, P J; Clarke, R N; Cleland, W; Clemens, J C; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Cogan, J G; Coggeshall, J; Cole, B; Cole, S; Colijn, A P; Collot, J; Colombo, T; Colon, G; Compostella, G; Conde Muiño, P; Coniavitis, E; Conidi, M C; Connell, S H; Connelly, I A; Consonni, S M; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cooper-Smith, N J; Copic, K; Cornelissen, T; Corradi, M; Corriveau, F; Corso-Radu, A; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Côté, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Cree, G; Crépé-Renaudin, S; Crescioli, F; Cribbs, W A; Crispin Ortuzar, M; Cristinziani, M; Croft, V; Crosetti, G; Cuciuc, C-M; Cuhadar Donszelmann, T; Cummings, J; Curatolo, M; Cuthbert, C; Czirr, H; Czodrowski, P; Czyczula, Z; D'Auria, S; D'Onofrio, M; Cunha Sargedas De Sousa, M J Da; Via, C Da; Dabrowski, W; Dafinca, A; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Daniells, A C; Dano Hoffmann, M; Dao, V; Darbo, G; Darmora, S; Dassoulas, J A; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, E; Davies, M; Davignon, O; Davison, A R; Davison, P; Davygora, Y; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Castro, S; De Cecco, S; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Nooij, L; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Vivie De Regie, J B; Dearnaley, W J; Debbe, R; Debenedetti, C; Dechenaux, B; Dedovich, D V; Deigaard, I; Del Peso, J; Del Prete, T; Deliot, F; Delitzsch, C M; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Domenico, A; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Mattia, A; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Di Valentino, D; Dias, F A; Diaz, M A; Diehl, E B; Dietrich, J; Dietzsch, T A; Diglio, S; Dimitrievska, A; Dingfelder, J; Dionisi, C; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; do Vale, M A B; Do Valle Wemans, A; Dobos, D; Doglioni, C; Doherty, T; Dohmae, T; Dolejsi, J; Dolezal, Z; Dolgoshein, B A; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Dova, M T; Doyle, A T; Dris, M; Dubbert, J; Dube, S; Dubreuil, E; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Dudziak, F; Duflot, L; Duguid, L; Dührssen, M; Dunford, M; Duran Yildiz, H; Düren, M; Durglishvili, A; Dwuznik, M; Dyndal, M; Ebke, J; Edson, W; Edwards, N C; Ehrenfeld, W; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; El Kacimi, M; Ellert, M; Elles, S; Ellinghaus, F; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Endo, M; Engelmann, R; Erdmann, J; Ereditato, A; Eriksson, D; Ernis, G; Ernst, J; Ernst, M; Ernwein, J; Errede, D; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Ezhilov, A; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Falla, R J; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Favareto, A; Fayard, L; Federic, P; Fedin, O L; Fedorko, W; Fehling-Kaschek, M; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Fernandez Perez, S; Ferrag, S; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; Ferreira de Lima, D E; Ferrer, A; Ferrere, D; Ferretti, C; Ferretto Parodi, A; Fiascaris, M; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, A; Fischer, J; Fisher, W C; Fitzgerald, E A; Flechl, M; Fleck, I; Fleischmann, P; Fleischmann, S; Fletcher, G T; Fletcher, G; Flick, T; Floderus, A; Flores Castillo, L R; Florez Bustos, A C; Flowerdew, M J; Formica, A; Forti, A; Fortin, D; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Franchino, S; Francis, D; Franconi, L; Franklin, M; Franz, S; Fraternali, M; French, S T; Friedrich, C; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Fullana Torregrosa, E; Fulsom, B G; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gadatsch, S; Gadomski, S; Gagliardi, G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallo, V; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Gao, J; Gao, Y S; Garay Walls, F M; Garberson, F; García, C; García Navarro, J E; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Gatti, C; Gaudio, G; Gaur, B; Gauthier, L; Gauzzi, P; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Ge, P; Gecse, Z; Gee, C N P; Geerts, D A A; Geich-Gimbel, Ch; Gellerstedt, K; Gemme, C; Gemmell, A; Genest, M H; Gentile, S; George, M; George, S; Gerbaudo, D; Gershon, A; Ghazlane, H; Ghodbane, N; Giacobbe, B; Giagu, S; Giangiobbe, V; Giannetti, P; Gianotti, F; Gibbard, B; Gibson, S M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giordano, R; Giorgi, F M; Giorgi, F M; Giraud, P F; Giugni, D; Giuliani, C; Giulini, M; Gjelsten, B K; Gkaitatzis, S; Gkialas, I; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Glonti, G L; Goblirsch-Kolb, M; Goddard, J R; Godlewski, J; Goeringer, C; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gomez Fajardo, L S; Gonçalo, R; Goncalves Pinto Firmino Da Costa, J; Gonella, L; González de la Hoz, S; Gonzalez Parra, G; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gössling, C; Gostkin, M I; Gouighri, M; Goujdami, D; Goulette, M P; Goussiou, A G; Goy, C; Gozpinar, S; Grabas, H M X; Graber, L; Grabowska-Bold, I; Grafström, P; Grahn, K-J; Gramling, J; Gramstad, E; Grancagnolo, S; Grassi, V; Gratchev, V; Gray, H M; Graziani, E; Grebenyuk, O G; Greenwood, Z D; Gregersen, K; Gregor, I M; Grenier, P; Griffiths, J; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grishkevich, Y V; Grivaz, J-F; Grohs, J P; Grohsjean, A; Gross, E; Grosse-Knetter, J; Grossi, G C; Groth-Jensen, J; Grout, Z J; Guan, L; Guescini, F; Guest, D; Gueta, O; Guicheney, C; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Gunther, J; Guo, J; Gupta, S; Gutierrez, P; Gutierrez Ortiz, N G; Gutschow, C; Guttman, N; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Haddad, N; Haefner, P; Hageböeck, S; Hajduk, Z; Hakobyan, H; Haleem, M; Hall, D; Halladjian, G; Hamacher, K; Hamal, P; Hamano, K; Hamer, M; Hamilton, A; Hamilton, S; Hamity, G N; Hamnett, P G; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Hanke, P; Hanna, R; Hansen, J B; Hansen, J D; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Hariri, F; Harkusha, S; Harper, D; Harrington, R D; Harris, O M; Harrison, P F; Hartjes, F; Hasegawa, M; Hasegawa, S; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauschild, M; Hauser, R; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayashi, T; Hayden, D; Hays, C P; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, L; Hejbal, J; Helary, L; Heller, C; Heller, M; Hellman, S; Hellmich, D; Helsens, C; Henderson, J; Henderson, R C W; Heng, Y; Hengler, C; Henrichs, A; Henriques Correia, A M; Henrot-Versille, S; Hensel, C; Herbert, G H; Hernández Jiménez, Y; Herrberg-Schubert, R; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hickling, R; Higón-Rodriguez, E; Hill, E; Hill, J C; Hiller, K H; Hillert, S; Hillier, S J; Hinchliffe, I; Hines, E; Hirose, M; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoenig, F; Hoffman, J; Hoffmann, D; Hofmann, J I; Hohlfeld, M; Holmes, T R; Hong, T M; Hooft van Huysduynen, L; Hopkins, W H; Horii, Y; Hostachy, J-Y; Hou, S; Hoummada, A; Howard, J; Howarth, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hsu, C; Hsu, P J; Hsu, S-C; Hu, D; Hu, X; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hülsing, T A; Hurwitz, M; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Ideal, E; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikematsu, K; Ikeno, M; Ilchenko, Y; Iliadis, D; Ilic, N; Inamaru, Y; Ince, T; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Irles Quiles, A; Isaksson, C; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Iturbe Ponce, J M; Iuppa, R; Ivarsson, J; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jackson, B; Jackson, M; Jackson, P; Jaekel, M R; Jain, V; Jakobs, K; Jakobsen, S; Jakoubek, T; Jakubek, J; Jamin, D O; Jana, D K; Jansen, E; Jansen, H; Janssen, J; Janus, M; Jarlskog, G; Javadov, N; Javůrek, T; Jeanty, L; Jejelava, J; Jeng, G-Y; Jennens, D; Jenni, P; Jentzsch, J; Jeske, C; Jézéquel, S; Ji, H; Jia, J; Jiang, Y; Jimenez Belenguer, M; Jin, S; Jinaru, A; Jinnouchi, O; Joergensen, M D; Johansson, K E; Johansson, P; Johns, K A; Jon-And, K; Jones, G; Jones, R W L; Jones, T J; Jongmanns, J; Jorge, P M; Joshi, K D; Jovicevic, J; Ju, X; Jung, C A; Jungst, R M; Jussel, P; Juste Rozas, A; Kaci, M; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kajomovitz, E; Kalderon, C W; Kama, S; Kamenshchikov, A; Kanaya, N; Kaneda, M; Kaneti, S; Kantserov, V A; Kanzaki, J; Kaplan, B; Kapliy, A; Kar, D; Karakostas, K; Karastathis, N; Kareem, M J; Karnevskiy, M; Karpov, S N; Karpova, Z M; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kashif, L; Kasieczka, G; Kass, R D; Kastanas, A; Kataoka, Y; Katre, A; Katzy, J; Kaushik, V; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazama, S; Kazanin, V F; Kazarinov, M Y; Keeler, R; Kehoe, R; Keil, M; Keller, J S; Kempster, J J; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Kessoku, K; Keung, J; Khalil-Zada, F; Khandanyan, H; Khanov, A; Khodinov, A; Khomich, A; Khoo, T J; Khoriauli, G; Khoroshilov, A; Khovanskiy, V; Khramov, E; Khubua, J; Kim, H Y; Kim, H; Kim, S H; Kimura, N; Kind, O; King, B T; King, M; King, R S B; King, S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kittelmann, T; Kiuchi, K; Kladiva, E; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klioutchnikova, T; Klok, P F; Kluge, E-E; Kluit, P; Kluth, S; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, D; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koevesarki, P; Koffas, T; Koffeman, E; Kogan, L A; Kohlmann, S; Kohout, Z; Kohriki, T; Koi, T; Kolanoski, H; Koletsou, I; Koll, J; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; König, S; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Köpke, L; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Korotkov, V A; Kortner, O; Kortner, S; Kostyukhin, V V; Kotov, V M; Kotwal, A; Kourkoumelis, C; Kouskoura, V; Koutsman, A; Kowalewski, R; Kowalski, T Z; Kozanecki, W; Kozhin, A S; Kral, V; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kravchenko, A; Kreiss, S; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Kruker, T; Krumnack, N; Krumshteyn, Z V; Kruse, A; Kruse, M C; Kruskal, M; Kubota, T; Kuday, S; Kuehn, S; Kugel, A; Kuhl, A; Kuhl, T; Kukhtin, V; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunkle, J; Kupco, A; Kurashige, H; Kurochkin, Y A; Kurumida, R; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; La Rosa, A; La Rotonda, L; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Laier, H; Lambourne, L; Lammers, S; Lampen, C L; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lang, V S; Lankford, A J; Lanni, F; Lantzsch, K; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Lasagni Manghi, F; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Le Dortz, O; Le Guirriec, E; Le Menedeu, E; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, H; Lee, J S H; Lee, S C; Lee, L; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Lehmacher, M; Lehmann Miotto, G; Lei, X; Leight, W A; Leisos, A; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzen, G; Lenzi, B; Leone, R; Leone, S; Leonidopoulos, C; Leontsinis, S; Leroy, C; Lester, C G; Lester, C M; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Lewis, A; Lewis, G H; Leyko, A M; Leyton, M; Li, B; Li, B; Li, H; Li, H L; Li, L; Li, L; Li, S; Li, Y; Liang, Z; Liao, H; Liberti, B; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limbach, C; Limosani, A; Lin, S C; Lin, T H; Linde, F; Lindquist, B E; Linnemann, J T; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, M; Liu, Y; Livan, M; Livermore, S S A; Lleres, A; Llorente Merino, J; Lloyd, S L; Lo Sterzo, F; Lobodzinska, E; Loch, P; Lockman, W S; Loddenkoetter, T; Loebinger, F K; Loevschall-Jensen, A E; Loginov, A; Lohse, T; Lohwasser, K; Lokajicek, M; Lombardo, V P; Long, B A; Long, J D; Long, R E; Lopes, L; Lopez Mateos, D; Lopez Paredes, B; Lopez Paz, I; Lorenz, J; Lorenzo Martinez, N; Losada, M; Loscutoff, P; Lou, X; Lounis, A; Love, J; Love, P A; Lowe, A J; Lu, F; Lu, N; Lubatti, H J; Luci, C; Lucotte, A; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Lungwitz, M; Lynn, D; Lysak, R; Lytken, E; Ma, H; Ma, L L; Maccarrone, G; Macchiolo, A; Machado Miguens, J; Macina, D; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeno, M; Maeno, T; Maevskiy, A; Magradze, E; Mahboubi, K; Mahlstedt, J; Mahmoud, S; Maiani, C; Maidantchik, C; Maier, A A; Maio, A; Majewski, S; Makida, Y; Makovec, N; Mal, P; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyshev, V M; Malyukov, S; Mamuzic, J; Mandelli, B; Mandelli, L; Mandić, I; Mandrysch, R; Maneira, J; Manfredini, A; Manhaes de Andrade Filho, L; Manjarres Ramos, J A; Mann, A; Manning, P M; Manousakis-Katsikakis, A; Mansoulie, B; Mantifel, R; Mapelli, L; March, L; Marchand, J F; Marchiori, G; Marcisovsky, M; Marino, C P; Marjanovic, M; Marques, C N; Marroquim, F; Marsden, S P; Marshall, Z; Marti, L F; Marti-Garcia, S; Martin, B; Martin, B; Martin, T A; Martin, V J; Martin Dit Latour, B; Martinez, H; Martinez, M; Martin-Haugh, S; Martyniuk, A C; Marx, M; Marzano, F; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massa, L; Massol, N; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Mättig, P; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Mazzaferro, L; Mc Goldrick, G; Mc Kee, S P; McCarn, A; McCarthy, R L; McCarthy, T G; McCubbin, N A; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; McMahon, S J; McPherson, R A; Mechnich, J; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Melachrinos, C; Mellado Garcia, B R; Meloni, F; Mengarelli, A; Menke, S; Meoni, E; Mercurio, K M; Mergelmeyer, S; Meric, N; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Merritt, H; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Middleton, R P; Migas, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Milic, A; Miller, D W; Mills, C; Milov, A; Milstead, D A; Milstein, D; Minaenko, A A; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mirabelli, G; Mitani, T; Mitrevski, J; Mitsou, V A; Mitsui, S; Miucci, A; Miyagawa, P S; Mjörnmark, J U; Moa, T; Mochizuki, K; Mohapatra, S; Mohr, W; Molander, S; Moles-Valls, R; Mönig, K; Monini, C; Monk, J; Monnier, E; Montejo Berlingen, J; Monticelli, F; Monzani, S; Moore, R W; Morange, N; Moreno, D; Moreno Llácer, M; Morettini, P; Morgenstern, M; Morii, M; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Morvaj, L; Moser, H G; Mosidze, M; Moss, J; Motohashi, K; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, K; Mueller, T; Mueller, T; Muenstermann, D; Munwes, Y; Murillo Quijada, J A; Murray, W J; Musheghyan, H; Musto, E; Myagkov, A G; Myska, M; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagai, Y; Nagano, K; Nagarkar, A; Nagasaka, Y; Nagel, M; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Namasivayam, H; Nanava, G; Narayan, R; Nattermann, T; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Nef, P D; Negri, A; Negri, G; Negrini, M; Nektarijevic, S; Nellist, C; Nelson, A; Nelson, T K; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newman, P R; Nguyen, D H; Nickerson, R B; Nicolaidou, R; Nicquevert, B; Nielsen, J; Nikiforou, N; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolics, K; Nikolopoulos, K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nodulman, L; Nomachi, M; Nomidis, I; Norberg, S; Nordberg, M; Novgorodova, O; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nunes Hanninger, G; Nunnemann, T; Nurse, E; Nuti, F; O'Brien, B J; O'grady, F; O'Neil, D C; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, M I; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Okamura, W; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Olchevski, A G; Olivares Pino, S A; Oliveira Damazio, D; Oliver Garcia, E; Olszewski, A; Olszowska, J; Onofre, A; Onyisi, P U E; Oram, C J; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Oropeza Barrera, C; Orr, R S; Osculati, B; Ospanov, R; Otero Y Garzon, G; Otono, H; Ouchrif, M; Ouellette, E A; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Ovcharova, A; Owen, M; Ozcan, V E; Ozturk, N; Pachal, K; Pacheco Pages, A; Padilla Aranda, C; Pagáčová, M; Pagan Griso, S; Paganis, E; Pahl, C; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palestini, S; Palka, M; Pallin, D; Palma, A; Palmer, J D; Pan, Y B; Panagiotopoulou, E; Panduro Vazquez, J G; Pani, P; Panikashvili, N; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Paredes Hernandez, D; Parker, M A; Parodi, F; Parsons, J A; Parzefall, U; Pasqualucci, E; Passaggio, S; Passeri, A; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Patel, N D; Pater, J R; Patricelli, S; Pauly, T; Pearce, J; Pedersen, L E; Pedersen, M; Pedraza Lopez, S; Pedro, R; Peleganchuk, S V; Pelikan, D; Peng, H; Penning, B; Penwell, J; Perepelitsa, D V; Perez Codina, E; Pérez García-Estañ, M T; Perez Reale, V; Perini, L; Pernegger, H; Perrella, S; Perrino, R; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petrolo, E; Petrucci, F; Pettersson, N E; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Piegaia, R; Pignotti, D T; Pilcher, J E; Pilkington, A D; Pina, J; Pinamonti, M; Pinder, A; Pinfold, J L; Pingel, A; Pinto, B; Pires, S; Pitt, M; Pizio, C; Plazak, L; Pleier, M-A; Pleskot, V; Plotnikova, E; Plucinski, P; Poddar, S; Podlyski, F; Poettgen, R; Poggioli, L; Pohl, D; Pohl, M; Polesello, G; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Portell Bueso, X; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Pralavorio, P; Pranko, A; Prasad, S; Pravahan, R; Prell, S; Price, D; Price, J; Price, L E; Prieur, D; Primavera, M; Proissl, M; Prokofiev, K; Prokoshin, F; Protopapadaki, E; Protopopescu, S; Proudfoot, J; Przybycien, M; Przysiezniak, H; Ptacek, E; Puddu, D; Pueschel, E; Puldon, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quarrie, D R; Quayle, W B; Queitsch-Maitland, M; Quilty, D; Qureshi, A; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Rajagopalan, S; Rammensee, M; Randle-Conde, A S; Rangel-Smith, C; Rao, K; Rauscher, F; Rave, T C; Ravenscroft, T; Raymond, M; Read, A L; Readioff, N P; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Rehnisch, L; Reisin, H; Relich, M; Rembser, C; Ren, H; Ren, Z L; Renaud, A; Rescigno, M; Resconi, S; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Ridel, M; Rieck, P; Rieger, J; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Rodrigues, L; Roe, S; Røhne, O; Rolli, S; Romaniouk, A; Romano, M; Romero Adam, E; Rompotis, N; Ronzani, M; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, M; Rose, P; Rosendahl, P L; Rosenthal, O; Rossetti, V; Rossi, E; Rossi, L P; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rubinskiy, I; Rud, V I; Rudolph, C; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryder, N C; Saavedra, A F; Sacerdoti, S; Saddique, A; Sadeh, I; Sadrozinski, H F-W; Sadykov, R; Safai Tehrani, F; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Saleem, M; Salek, D; Sales De Bruin, P H; Salihagic, D; Salnikov, A; Salt, J; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sampsonidis, D; Sanchez, A; Sánchez, J; Sanchez Martinez, V; Sandaker, H; Sandbach, R L; Sander, H G; Sanders, M P; Sandhoff, M; Sandoval, T; Sandoval, C; Sandstroem, R; Sankey, D P C; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Santoyo Castillo, I; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sartisohn, G; Sasaki, O; Sasaki, Y; Sauvage, G; Sauvan, E; Savard, P; Savu, D O; Sawyer, C; Sawyer, L; Saxon, D H; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Scarfone, V; Schaarschmidt, J; Schacht, P; Schaefer, D; Schaefer, R; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Scherzer, M I; Schiavi, C; Schieck, J; Schillo, C; Schioppa, M; Schlenker, S; Schmidt, E; Schmieden, K; Schmitt, C; Schmitt, S; Schneider, B; Schnellbach, Y J; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schorlemmer, A L S; Schott, M; Schouten, D; Schovancova, J; Schramm, S; Schreyer, M; Schroeder, C; Schuh, N; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwanenberger, C; Schwartzman, A; Schwarz, T A; Schwegler, Ph; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Schwoerer, M; Sciacca, F G; Scifo, E; Sciolla, G; Scott, W G; Scuri, F; Scutti, F; Searcy, J; Sedov, G; Sedykh, E; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekula, S J; Selbach, K E; Seliverstov, D M; Sellers, G; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Serre, T; Seuster, R; Severini, H; Sfiligoj, T; Sforza, F; Sfyrla, A; Shabalina, E; Shamim, M; Shan, L Y; Shang, R; Shank, J T; Shapiro, M; Shatalov, P B; Shaw, K; Shehu, C Y; Sherwood, P; Shi, L; Shimizu, S; Shimmin, C O; Shimojima, M; Shiyakova, M; Shmeleva, A; Shochet, M J; Short, D; Shrestha, S; Shulga, E; Shupe, M A; Shushkevich, S; Sicho, P; Sidiropoulou, O; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silva, J; Silver, Y; Silverstein, D; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simoniello, R; Simonyan, M; Sinervo, P; Sinev, N B; Sipica, V; Siragusa, G; Sircar, A; Sisakyan, A N; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skottowe, H P; Skovpen, K Yu; Skubic, P; Slater, M; Slavicek, T; Sliwa, K; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, K M; Smizanska, M; Smolek, K; Snesarev, A A; Snidero, G; Snyder, S; Sobie, R; Socher, F; Soffer, A; Soh, D A; Solans, C A; Solar, M; Solc, J; Soldatov, E Yu; Soldevila, U; Solodkov, A A; Soloshenko, A; Solovyanov, O V; Solovyev, V; Sommer, P; Song, H Y; Soni, N; Sood, A; Sopczak, A; Sopko, B; Sopko, V; Sorin, V; Sosebee, M; Soualah, R; Soueid, P; Soukharev, A M; South, D; Spagnolo, S; Spanò, F; Spearman, W R; Spettel, F; Spighi, R; Spigo, G; Spiller, L A; Spousta, M; Spreitzer, T; Spurlock, B; Denis, R D St; Staerz, S; Stahlman, J; Stamen, R; Stamm, S; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, J; Staroba, P; Starovoitov, P; Staszewski, R; Stavina, P; Steinberg, P; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stern, S; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, E; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Strubig, A; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Subramaniam, R; Succurro, A; Sugaya, Y; Suhr, C; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, S; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, Y; Svatos, M; Swedish, S; Swiatlowski, M; Sykora, I; Sykora, T; Ta, D; Taccini, C; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takai, H; Takashima, R; Takeda, H; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tam, J Y C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tanaka, S; Tanasijczuk, A J; Tannenwald, B B; Tannoury, N; Tapprogge, S; Tarem, S; Tarrade, F; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Tavares Delgado, A; Tayalati, Y; Taylor, F E; Taylor, G N; Taylor, W; Teischinger, F A; Teixeira Dias Castanheira, M; Teixeira-Dias, P; Temming, K K; Ten Kate, H; Teng, P K; Teoh, J J; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Therhaag, J; Theveneaux-Pelzer, T; Thomas, J P; Thomas-Wilsker, J; Thompson, E N; Thompson, P D; Thompson, P D; Thompson, R J; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Thong, W M; Thun, R P; Tian, F; Tibbetts, M J; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tiouchichine, E; Tipton, P; Tisserant, S; Todorov, T; Todorova-Nova, S; Toggerson, B; Tojo, J; Tokár, S; Tokushuku, K; Tollefson, K; Tolley, E; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Topilin, N D; Torrence, E; Torres, H; Torró Pastor, E; Toth, J; Touchard, F; Tovey, D R; Tran, H L; Trefzger, T; Tremblet, L; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Trischuk, W; Trocmé, B; Troncon, C; Trottier-McDonald, M; Trovatelli, M; True, P; Trzebinski, M; Trzupek, A; Tsarouchas, C; Tseng, J C-L; Tsiareshka, P V; Tsionou, D; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tudorache, A; Tudorache, V; Tuna, A N; Tupputi, S A; Turchikhin, S; Turecek, D; Turk Cakir, I; Turra, R; Tuts, P M; Tykhonov, A; Tylmad, M; Tyndel, M; Uchida, K; Ueda, I; Ueno, R; Ughetto, M; Ugland, M; Uhlenbrock, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Unverdorben, C; Urbaniec, D; Urquijo, P; Usai, G; Usanova, A; Vacavant, L; Vacek, V; Vachon, B; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Valladolid Gallego, E; Vallecorsa, S; Valls Ferrer, J A; Van Den Wollenberg, W; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; Van Der Leeuw, R; van der Ster, D; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vankov, P; Vannucci, F; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vazeille, F; Vazquez Schroeder, T; Veatch, J; Veloso, F; Veneziano, S; Ventura, A; Ventura, D; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Vickey Boeriu, O E; Viehhauser, G H A; Viel, S; Vigne, R; Villa, M; Villaplana Perez, M; Vilucchi, E; Vincter, M G; Vinogradov, V B; Virzi, J; Vivarelli, I; Vives Vaque, F; Vlachos, S; Vladoiu, D; Vlasak, M; Vogel, A; Vogel, M; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Radziewski, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Vranjes Milosavljevic, M; Vrba, V; Vreeswijk, M; Vu Anh, T; Vuillermet, R; Vukotic, I; Vykydal, Z; Wagner, P; Wagner, W; Wahlberg, H; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wall, R; Waller, P; Walsh, B; Wang, C; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, X; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Warsinsky, M; Washbrook, A; Wasicki, C; Watkins, P M; Watson, A T; Watson, I J; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Webster, J S; Weidberg, A R; Weigell, P; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wendland, D; Weng, Z; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Wessels, M; Wetter, J; Whalen, K; White, A; White, M J; White, R; White, S; Whiteson, D; Wicke, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wijeratne, P A; Wildauer, A; Wildt, M A; Wilkens, H G; Will, J Z; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, A; Wilson, J A; Wingerter-Seez, I; Winklmeier, F; Winter, B T; Wittgen, M; Wittig, T; Wittkowski, J; Wollstadt, S J; Wolter, M W; Wolters, H; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wright, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wulf, E; Wyatt, T R; Wynne, B M; Xella, S; Xiao, M; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yakabe, R; Yamada, M; Yamaguchi, H; Yamaguchi, Y; Yamamoto, A; Yamamoto, K; Yamamoto, S; Yamamura, T; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, U K; Yang, Y; Yanush, S; Yao, L; Yao, W-M; Yasu, Y; Yatsenko, E; Yau Wong, K H; Ye, J; Ye, S; Yeletskikh, I; Yen, A L; Yildirim, E; Yilmaz, M; Yoosoofmiya, R; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yurkewicz, A; Yusuff, I; Zabinski, B; Zaidan, R; Zaitsev, A M; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zeitnitz, C; Zeman, M; Zemla, A; Zengel, K; Zenin, O; Ženiš, T; Zerwas, D; Zevi Della Porta, G; Zhang, D; Zhang, F; Zhang, H; Zhang, J; Zhang, L; Zhang, X; Zhang, Z; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, L; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhukov, K; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, R; Zimmermann, S; Zimmermann, S; Zinonos, Z; Ziolkowski, M; Zobernig, G; Zoccoli, A; Zur Nedden, M; Zurzolo, G; Zutshi, V; Zwalinski, L

The performance of the ATLAS muon trigger system is evaluated with proton-proton collision data collected in 2012 at the Large Hadron Collider at a centre-of-mass energy of 8 TeV. It is primarily evaluated using events containing a pair of muons from the decay of [Formula: see text] bosons. The efficiency of the single-muon trigger is measured for muons with transverse momentum [Formula: see text] GeV, with a statistical uncertainty of less than 0.01 % and a systematic uncertainty of 0.6 %. The [Formula: see text] range for efficiency determination is extended by using muons from decays of [Formula: see text] mesons, [Formula: see text] bosons, and top quarks. The muon trigger shows highly uniform and stable performance. The performance is compared to the prediction of a detailed simulation.

Inverse Flux versus Pressure of Muons from Cosmic Rays

NASA Astrophysics Data System (ADS)

Buitrago, D.; Armendariz, R.

2017-12-01

When an incoming cosmic ray proton or atom collides with particles in earth's atmosphere a shower of secondary muons is created. Cosmic ray muon flux was measured at the Queensborough Community College using a QuarkNet detector consisting of three stacked scintillator muon counters and a three-fold coincidence trigger. Data was recorded during a three-day period during a severe weather storm that occurred from March 13-17, 2017. A computer program was created in Python to read the muon flux rate and atmospheric pressure sensor readings from the detector's data acquisition board. The program converts the data from hexadecimal to decimal, re-bins the data in a more suitable format, creates and overlays plots of muon flux with atmospheric pressure. Results thus far show a strong correlation between muon flux and atmospheric pressure. More data analysis will be done to verify the above conclusion.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acosta Castillo, John Gabriel

To explore the new energy frontier, a new generation of particle accelerators is needed. Muon colliders are a promising alternative, if muon cooling can be made to work. Muons are 200 times heavier than electrons, so they produce less synchrotron radiation, and they behave like point particles. However, they have a short lifetime of 2.2more » $$\\mathrm{\\mu s}$$ and the beam is more difficult to cool than an electron beam. The Muon Accelerator Program (MAP) was created to develop concepts and technologies required by a muon collider. An important effort has been made in the program to design and optimize a muon beam cooling system. The goal is to achieve the small beam emittance required by a muon collider. This work explores a final ionization cooling system using magnetic quadrupole lattices with a low enough $$\\beta^{\\star} $$ region to cool the beam to the required limit with available low Z absorbers.« less

Noninvasive Reactor Imaging Using Cosmic-Ray Muons

NASA Astrophysics Data System (ADS)

Miyadera, H.; Fujita, K.; Karino, Y.; Kume, N.; Nakayama, K.; Sano, Y.; Sugita, T.; Yoshioka, K.; Morris, C. L.; Bacon, J. D.; Borozdin, K. N.; Perry, J. O.; Mizokami, S.; Otsuka, Y.; Yamada, D.

2015-10-01

Cosmic-ray-muon imaging is proposed to assess the damages to the Fukushima Daiichi reactors. Simulation studies showed capability of muon imaging to reveal the core conditions.The muon-imaging technique was demonstrated at Toshiba Nuclear Critical Assembly, where the uranium-dioxide fuel assembly was imaged with 3-cm spatial resolution after 1 month of measurement.

The CMS muon system: status and upgrades for LHC Run-2 and performance of muon reconstruction with 13 TeV data

NASA Astrophysics Data System (ADS)

Battilana, C.

2017-01-01

The CMS muon system has played a key role for many physics results obtained from the LHC Run-1 and Run-2 data. During the Long Shutdown (2013-2014), as well as during the last year-end technical stop (2015-2016), significant consolidation and upgrades have been carried out on the muon detectors and on the L1 muon trigger. The algorithms for muon reconstruction and identification have also been improved for both the High-Level Trigger and the offline reconstruction. Results of the performance of muon detectors, reconstruction and trigger, obtained using data collected at 13 TeV centre-of-mass energy during the 2015 and 2016 LHC runs, will be presented. Comparison of simulation with experimental data will also be discussed where relevant. The system's state of the art performance will be shown, and the improvements foreseen to achieve excellent overall quality of muon reconstruction in CMS, in the conditions expected during the high-luminosity phase of Run-2, will be described.

Muon Telescope (MuTe): A first study using Geant4

NASA Astrophysics Data System (ADS)

Asorey, H.; Balaguera-Rojas, A.; Calderon-Ardila, R.; Núñez, L. A.; Sanabria-Gómez, J. D.; Súarez-Durán, M.; Tapia, A.

2017-07-01

Muon tomography is based on recording the difference of absorption of muons by matter, as ordinary radiography does for using X-rays. The interaction of cosmic rays with the atmosphere produces extensive air showers which provides an abundant source for atmospheric muons, benefiting various applications of muon tomography, particularly the study of the inner structure of volcanoes. The MuTe (for Muon Telescope) is a hybrid detector composed of scintillation bars and a water Cherenkov detector designed to measure cosmic muon flux crossing volcanic edifices. This detector consists of two scintillator plates (1.44 m2 with 30 x 30 pixels), with a maximum distance of 2.0m of separation. In this work we report the first simulation of the MuTe using GEANT4 -set of simulation tools, based in C++ - that provides information about the interaction between radiation and matter. This computational tool allows us to know the energy deposited by the muons and modeling the response of the scintillators and the water cherenkov detector to the passage of radiation which is crucial to compare to our data analysis.

End-to-end simulation of bunch merging for a muon collider

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bao, Yu; Stratakis, Diktys; Hanson, Gail G.

2015-05-03

Muon accelerator beams are commonly produced indirectly through pion decay by interaction of a charged particle beam with a target. Efficient muon capture requires the muons to be first phase-rotated by rf cavities into a train of 21 bunches with much reduced energy spread. Since luminosity is proportional to the square of the number of muons per bunch, it is crucial for a Muon Collider to use relatively few bunches with many muons per bunch. In this paper we will describe a bunch merging scheme that should achieve this goal. We present for the first time a complete end-to-end simulationmore » of a 6D bunch merger for a Muon Collider. The 21 bunches arising from the phase-rotator, after some initial cooling, are merged in longitudinal phase space into seven bunches, which then go through seven paths with different lengths and reach the final collecting "funnel" at the same time. The final single bunch has a transverse and a longitudinal emittance that matches well with the subsequent 6D rectilinear cooling scheme.« less

Prospects for a Muon Spin Resonance Facility in the Fermilab MuCool Test Area

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnstone, John A.; Johnstone, Carol

This paper investigates the feasibility of re-purposing the MuCool Test Area (MTA) beamline and experimental hall to support a Muon Spin Resonance (MuSR) facility, which would make it the only such facility in the US. This report reviews the basic muon production concepts studied and operationally implemented at TRIUMF, PSI, and RAL and their application in the context of the MTA facility. Two scenarios were determined feasible. One, an initial minimal-shielding and capital-cost investment stage with a single secondary muon beamline that utilizes an existing high- intensity beam absorber and, another, upgraded stage, that implements an optimized production target pile,more » a proximate high-intensity absorber, and optimized secondary muon lines. A unique approach is proposed which chops or strips a macropulse of H$^-$ beam into a micropulse substructure – a muon creation timing scheme – which allows Muon Spin Resonance experiments in a linac environment. With this timing scheme, and attention to target design and secondary beam collection, the MTA can host enabling and competitive Muon Spin Resonance experiments.« less

Measuring the leading hadronic contribution to the muon g-2 via μ e scattering

NASA Astrophysics Data System (ADS)

Abbiendi, G.; Calame, C. M. Carloni; Marconi, U.; Matteuzzi, C.; Montagna, G.; Nicrosini, O.; Passera, M.; Piccinini, F.; Tenchini, R.; Trentadue, L.; Venanzoni, G.

2017-03-01

We propose a new experiment to measure the running of the electromagnetic coupling constant in the space-like region by scattering high-energy muons on atomic electrons of a low- Z target through the elastic process μ e → μ e. The differential cross section of this process, measured as a function of the squared momentum transfer t=q^2<0, provides direct sensitivity to the leading-order hadronic contribution to the muon anomaly a^{HLO}_{μ }. By using a muon beam of 150 GeV, with an average rate of ˜ 1.3 × 10^7 muon/s, currently available at the CERN North Area, a statistical uncertainty of ˜ 0.3% can be achieved on a^{HLO}_{μ } after two years of data taking. The direct measurement of a^{HLO}_{μ } via μ e scattering will provide an independent determination, competitive with the time-like dispersive approach, and consolidate the theoretical prediction for the muon g-2 in the Standard Model. It will allow therefore a firmer interpretation of the measurements of the future muon g-2 experiments at Fermilab and J-PARC.

Pulsed source of ultra low energy positive muons for near-surface μSR studies

NASA Astrophysics Data System (ADS)

Bakule, Pavel; Matsuda, Yasuyuki; Miyake, Yasuhiro; Nagamine, Kanetada; Iwasaki, Masahiko; Ikedo, Yutaka; Shimomura, Koichiro; Strasser, Patrick; Makimura, Shunshuke

2008-01-01

We have produced a pulsed beam of low energy (ultra slow) polarized positive muons (LE-μ+) and performed several demonstration muon spin rotation/relaxation (μSR) experiments at ISIS RIKEN-RAL muon facility in UK. The energy of the muons implanted into a sample is tuneable between 0.1 keV and 18 keV. This allows us to use muons as local magnetic microprobes on a nanometre scale. The control over the implantation depth is from several nanometres to hundreds of nanometres depending on the sample density and muon energy. The LE-μ+ are produced by two-photon resonant laser ionization of thermal muonium atoms. Currently ∼15 LE-μ+/s with 50% spin polarization are transported to the μSR sample position, where they are focused to a small spot with a diameter of only 4 mm. The overall LE-μ+ generation efficiency of 3 × 10-5 is comparable to that obtained when moderating the muon beam to epithermal energies in simple van der Waals bound solids. In contrast to other methods of LE-μ+ generation, the implantation of the muons into the sample can be externally triggered with the duration of the LE-μ+ pulse being only 7.5 ns. This allows us to measure spin rotation frequencies of up to 40 MHz.

Perspective of Muon Production Target at J-PARC MLF MUSE

NASA Astrophysics Data System (ADS)

Makimura, Shunsuke; Matoba, Shiro; Kawamura, Naritoshi; Matsuzawa, Yukihiro; Tabe, Masato; Aoyagi, Hiroyuki; Kondo, Hiroto; Kobayashi, Yasuo; Fujimori, Hiroshi; Ikedo, Yutaka; Kadono, Ryosuke; Koda, Akihiro; Kojima, Kenji M.; Miyake, Yasuhiro; Nakamura, Jumpei G.; Oishi, Yu; Okabe, Hirotaka; Shimomura, Koichiro; Strasser, Patrick

A pulsed muon beam with unprecedented intensity will be generated by a 3-GeV 333-microA proton beam on a muon target made of 20-mm thick isotropic graphite at J-PARC MLF MUSE (Muon Science Establishment). The first muon beam was successfully generated on September 26th, 2008. Gradually upgrading the beam intensity, continuous 300-kW proton beam has been operated by a fixed target method without replacements till June of 2014. However, the lifetime of the fixed target was anticipated to be less than 1 year by the proton-irradiation damage of the graphite through 1-MW beam operation. To extend the lifetime, a muon rotating target, in which the radiation damage is distributed to a wider area, was installed in September of 2014, and continuous and stable operation has been successfully performed. Because the muon target becomes highly radioactive by the proton irradiation, the maintenance is conducted by remote handling in the Hot cell. In September of 2015, a scraper No. 1 to collimate the proton beam scattered by the target was replaced for further high-power beam operation. Recently, new developments on monitoring and maintenance of the muon target for higher power operation are in progress. In this article, perspective of muon production target at J-PARC MLF MUSE will be described.

Isotope effects and the temperature dependences of the hyperfine coupling constants of muoniated sec-butyl radicals in condensed phases.

PubMed

Fleming, Donald G; Bridges, Michael D; Arseneau, Donald J; Chen, Ya Kun; Wang, Yan Alexander

2011-04-07

Reported here is the first μSR study of the muon (A(μ)) and proton (A(p)) β-hyperfine coupling constants (Hfcc) of muoniated sec-butyl radicals, formed by muonium (Mu) addition to 1-butene and to cis- and trans-2-butene. The data are compared with in vacuo spin-unrestricted MP2 and hybrid DFT/B3YLP calculations reported in the previous paper (I), which played an important part in the interpretation of the data. The T-dependences of both the (reduced) muon, A(μ)′(T), and proton, A(p)(T), Hfcc are surprisingly well explained by a simple model, in which the calculated Hfcc from paper I at energy minima of 0 and near ±120° are thermally averaged, assuming an energy dependence given by a basic 2-fold torsional potential. Fitted torsional barriers to A(μ)′(T) from this model are similar (~3 kJ/mol) for all muoniated butyl radicals, suggesting that these are dominated by ZPE effects arising from the C−Mu bond, but for A(p)(T) exhibit wide variations depending on environment. For the cis- and trans-2-butyl radicals formed from 2-butene, A(μ)′(T) exhibits clear discontinuities at bulk butene melting points, evidence for molecular interactions enhancing these muon Hfcc in the environment of the solid state, similar to that found in earlier reports for muoniated tert-butyl. In contrast, for Mu−sec-butyl formed from 1-butene, there is no such discontinuity. The muon hfcc for the trans-2-butyl radical are seemingly very well predicted by B3LYP calculations in the solid phase, but for sec-butyl from 1-butene, showing the absence of further interactions, much better agreement is found with the MP2 calculations across the whole temperature range. Examples of large proton Hfcc near 0 K are also reported, due to eclipsed C−H bonds, in like manner to C−Mu, which then also exhibit clear discontinuities in A(p)(T) at bulk melting points. The data suggest that the good agreement found between theory and experiment from the B3LYP calculations for eclipsed bonds in the solid phase may be fortuitous. For the staggered protons of the sec-butyl radicals formed, no discontinuities are seen at all in A(p)(T), also demonstrating no further effects of molecular interactions on these particular proton Hfcc.

Static beam tomotherapy as an optimisation method in whole-breast radiation therapy (WBRT).

PubMed

Squires, Matthew; Hu, Yunfei; Byrne, Mikel; Archibald-Heeren, Ben; Cheers, Sonja; Bosco, Bruno; Teh, Amy; Fong, Andrew

2017-12-01

TomoTherapy (Accuray, Sunnyvale, CA) has recently introduced a static form of tomotherapy: TomoDirect™ (TD). This study aimed to evaluate TD against a contemporary intensity modulated radiation therapy (IMRT) alternative through comparison of target and organ at risk (OAR) doses in breast cancer cases. A secondary objective was to evaluate planning efficiency by measuring optimisation times. Treatment plans of 27 whole-breast radiation therapy (WBRT) patients optimised with a tangential hybrid IMRT technique were replanned using TD. Parameters included a dynamic field width of 2.5 cm, a pitch of 0.251 and a modulation factor of 2.000; 50 Gy in 25 fractions was prescribed and planning time recorded. The planning metrics used in analysis were ICRU based, with the mean PTV minimum (D 99 ) used as the point of comparison. Both modalities met ICRU50 target heterogeneity objectives (TD D 99 = 48.0 Gy vs. IMRT = 48.1 Gy, P = 0.26; TD D 1 = 53.5 Gy vs. IMRT = 53.0 Gy, P = 0.02; Homogeneity index TD = 0.11 vs. IMRT = 0.10, P = 0.03), with TD plans generating higher median doses (TD D 50 = 51.1 Gy vs. IMRT = 50.9 Gy, P = 0.03). No significant difference was found in prescription dose coverage (TD V 50 = 85.5% vs. IMRT = 82.0%, P = 0.09). TD plans produced a statistically significant reduction in V 5 ipsilateral lung doses (TD V 5 = 23.2% vs. IMRT = 27.2%, P = 0.04), while other queried OARs remained comparable (TD ipsilateral lung V 20 = 13.2% vs. IMRT = 14.6%, P = 0.30; TD heart V 5 = 2.7% vs. IMRT = 2.8%, P = 0.47; TD heart V 10 = 1.7% vs. IMRT = 1.8%, P = 0.44). TD reduced planning time considerably (TD = 9.8 m vs. IMRT = 27.6 m, P < 0.01), saving an average planning time of 17.8 min per patient. TD represents a suitable WBRT treatment approach both in terms of plan quality metrics and planning efficiency. © 2017 The Authors. Journal of Medical Radiation Sciences published by John Wiley & Sons Australia, Ltd on behalf of Australian Society of Medical Imaging and Radiation Therapy and New Zealand Institute of Medical Radiation Technology.

20 years of cosmic muons research performed in IFIN-HH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mitrica, Bogdan

2012-11-20

During the last two decades a modern direction in particle physics research has been developed in IFIN-HH Bucharest, Romania. The history started with the WILLI detector built in IFIN-HH Bucharest in collaboration with KIT Karlsruhe (formerly Forschungszentrum Karlsruhe). The detector was designed for measurements of the low energy muon charge ratio (< 1GeV) based on a delayed coincidence method, measuring the decay time of the muons stopped in the detector: the positive muons decay freely, but the negative muons are captured in the atom thus creating muonic atoms and decay depending on the nature of the host atom. In amore » first configuration, the WILLI detector was placed in a fixed position for measuring vertical muons. Further WILLI has been transformed in a rotatable device which allows directional measurements of muon charge ratio and muon flux. The results exhibit a pronounced azimuthal asymmetry (East-West effect) due to the different in fluence of the geomagnetic field on the trajectories of positive and negative muons in air. In parallel, flux measurement, taking into account muon events with nergies > 0.4GeV, show a diurnal modulation of the muon flux. The analysis of the muon events for energies < 0.6GeV reveals an aperiodic variation of the muon flux. A new detection system performing coincidence measurements between the WILLI calorimeter and a small array of 12 scintillators plates has been installed in IFIN-HH starting from the autumn of 2010. The aim of the system is to investigate muon charge ratio from individual EAS by using the mini-array as trigger for the WILLI calorimeter. Such experimental studies could provide detailed information on hadronic interaction models and primary cosmic ray composition at energies around 10{sup 15}eV. Simulation studies and preliminary experimental tests, regarding the performances of the mini-array, have been performed using H and Fe primaries, with energies in a range 10{sup 13}eV - 10{sup 15}eV. The results show detailed effects of the direction of EAS incidence relative to the geomagnetic field, depending, in particular, of the primary mass. Based on the results, we can say that WILLI-EAS experiment could be used for testing the hadronic interaction models. Measurements of the high energy muon flux in underground of the salt mine from Slanic Prahova, Romania was performed using a new mobile detector developed in IFIN-HH, Bucharest. Consisting of 2 scintillator plates measuring in coincidence, the detector is installed on a van which facilitates measurements on different positions at surface or in underground. The detector was used to measure muon fluxes in different locations at surface or in underground. The detector was used to measure muon fluxes at different sites of Romania and in the underground of the salt mines from Slanic Prahova, Romania where IFIN-HH has a modern underground laboratory. New methods for the detection of cosmic ray muons are investigated in our institute based on scintillator techniques using optical fiber and MPPC photodyodes.« less

Excited state absorption spectra of dissolved and aggregated distyrylbenzene: A TD-DFT state and vibronic analysis

NASA Astrophysics Data System (ADS)

Oliveira, Eliezer Fernando; Shi, Junqing; Lavarda, Francisco Carlos; Lüer, Larry; Milián-Medina, Begoña; Gierschner, Johannes

2017-07-01

A time-dependent density functional theory study is performed to reveal the excited state absorption (ESA) features of distyrylbenzene (DSB), a prototype π-conjugated organic oligomer. Starting with a didactic insight to ESA based on simple molecular orbital and configuration considerations, the performance of various density functional theory functionals is tested to reveal the full vibronic ESA features of DSB at short and long probe delay times.

Molecular structure, spectroscopic (FT-IR, FT Raman, UV, NMR and THz) investigation and hyperpolarizability studies of 3-(2-Chloro-6-fluorophenyl)-1-(2-thienyl) prop-2-en-1-one

NASA Astrophysics Data System (ADS)

Kumar, Rajesh; Kumar, Amit; Deval, Vipin; Gupta, Archana; Tandon, Poonam; Patil, P. S.; Deshmukh, Prathmesh; Chaturvedi, Deepika; Watve, J. G.

2017-02-01

In the present work, a combined experimental and theoretical study on ground state molecular structure, spectroscopic and nonlinear optical properties of the chalcone derivative 3-(2-Chloro-6-fluorophenyl)-1-(2-thienyl) prop-2-en-1-one (2C6F2SC) is reported. Initial geometry generated from single crystal X-ray diffraction parameters was minimized at DFT level employing B3LYP/6-311++G (d,p) without any constraint to the potential energy surface. The molecule has been characterized using various experimental techniques FT-IR, FT-Raman, UV-Vis, 1H NMR, TD-THz and the spectroscopic data have been analyzed theoretically by Density Functional Theory (DFT) method. Harmonic vibrational frequencies were calculated theoretically using the optimized ground state geometry and the spectra were interpreted by means of potential energy distribution. Time Dependent Density Functional Theory (TD-DFT) has been used to calculate energies, absorption wavelengths, oscillator strengths of electronic singlet-singlet transitions. The calculated energy and oscillator strength complement with the experimental findings. The HOMO-LUMO energy gap explains the charge interaction taking place within the molecule. Good correlations between the experimental 1H NMR chemical shifts and calculated GIAO shielding tensors were found. Stability of the molecule, hyperconjugative interactions and charge delocalization has been analyzed by natural bond orbital (NBO) analysis. The first order hyperpolarizability (β) of this molecular system and related properties (μ, <α> and Δα) have been calculated using the finite-field approach.

Origin of the Absorption Band of Bromophenol Blue in Acidic and Basic pH: Insight from a Combined Molecular Dynamics and TD-DFT/MM Study.

PubMed

Chattopadhyaya, M; Murugan, N Arul; Rinkevicius, Zilvinas

2016-09-15

We study the linear and nonlinear optical properties of a well-known acid-base indicator, bromophenol blue (BPB), in aqueous solution by employing static and integrated approaches. In the static approach, optical properties have been calculated using time-dependent density functional theory (TD-DFT) on the fully relaxed geometries of the neutral and different unprotonated forms of BPB. Moreover, both closed and open forms of BPB were considered. In the integrated approach, the optical properties have been computed over many snapshots extracted from molecular dynamics simulation using a hybrid time-dependent density functional theory/molecular mechanics approach. The static approach suggests closed neutral ⇒ anionic interconversion as the dominant mechanism for the red shift in the absorption spectra of BPB due to a change from acidic to basic pH. It is found by employing an integrated approach that the two interconversions, namely open neutral ⇒ anionic and open neutral ⇒ dianionic, can contribute to the pH-dependent shift in the absorption spectra of BPB. Even though both static and integrated approaches reproduce the pH-dependent red shift in the absorption spectra of BPB, the latter one is suitable to determine both the spectra and spectral broadening. Finally, the computed static first hyperpolarizability for various protonated and deprotonated forms of BPB reveals that this molecule can be used as a nonlinear optical probe for pH sensing in addition to its highly exploited use as an optical probe.

Synthesis, spectroscopic investigations (FT-IR, NMR, UV-Vis, and TD-DFT), and molecular docking of (E)-1-(benzo[d][1, 3]dioxol-6-yl)-3-(6-methoxynaphthalen-2-yl)prop-2-en-1-one

NASA Astrophysics Data System (ADS)

Therasa Alphonsa, A.; Loganathan, C.; Athavan Alias Anand, S.; Kabilan, S.

2017-02-01

The compound (E)-1-(benzo [d] [1, 3] dioxol-6-yl)-3-(6-methoxy naphthalen-2-yl) prop-2-en-1-one (AKN) was synthesized and characterized by FT-IR, NMR, and UV-Vis spectrometer. The optimized molecular geometry, bond lengths, bond angles, atomic charges, harmonic vibrational wave numbers and intensities of vibrational bonds of the title compound have been investigated by Time dependent- Density Functional Theory (TD-DFT) using a standard B3LYP method with 6-31 G (d, p) basis set available in the Gaussian 09W package. 1H and 13C NMR chemical shifts of the molecule were calculated using Gauge-independent atomic orbital method (GIAO). Experimental excitation energies of the molecules were matched with the theoretically calculated energies. The atomic charge distributions of the various atoms present in the AKN were obtained by Mulliken charge population analysis. The Molecular Electrostatic Potential (MEP) analysis reveals the sites for electrophilic attack and nucleophilic reactions in the molecule. The difference between the observed and scaled frequencies was small. The HOMO to LUMO transition implies an electron density transfer. The intramolecular contacts have been interpreted using Natural Bond Orbital (NBO) analysis. The calculation results were applied to simulate spectra of the title compound, which show excellent agreement with observed spectra. To provide information about the interactions between human cytochrome protein and the novel compound theoretically, docking studies were carried out using Schrödinger software.

VLSI (Very Large Scale Integration) Design Tools Reference Manual - Release 1.0.

DTIC Science & Technology

1983-10-01

Pulse PULSE(VI V2 TD TR TF PW PER) Examples: VIN 3 0 PULSE(-i 1 2NS 2NS 2NS SONS lOONS) parameter default units V1 (initial value) Volts or Amps V2...VO VA FREQ TD THETA) Examples: VIN 3 0 SIN(0 1 OOMEG 1NS 1EO) parameter default value units VO (offset) Volts or Amps VA (amplitude) Volts or Amps...TD to TSTOP V O+VAe (-(" -nTD)%)in(2iFRJEQ (tim +TD)) t ° I. 3. Exponential EXP(V1 V2 TD1 TAU1 TD2 TAU2) Examples: VIN 3 0 EXP(-4 -1 2NS 3ONS 6ONS

Candidate muon-probe sites in oxide superconductors

NASA Astrophysics Data System (ADS)

Dawson, W. K.; Tibbs, K.; Weathersby, S. P.; Boekema, C.; Chan, K.-C. B.

1988-11-01

Two independent search methods (potential-energy and magnetic-dipole-field calculations) are used to determine muon stop sites in the RBa2Cu3O(x) (x equal to about 7) superconductors. Possible sites, located about 1 A away from oxygen ions, have been found and are prime candidates as muon-probe locations. The results are discussed in light of existing muon-spin-relaxation data of these exciting oxides, and are compared to H-oxide and positron-oxide superconductor studies. Further work is in progress to establish in detail the muon-probe sites.

Toroidal magnetic detector for high resolution measurement of muon momenta

DOEpatents

Bonanos, P.

1992-01-07

A muon detector system including central and end air-core superconducting toroids and muon detectors enclosing a central calorimeter/detector. Muon detectors are positioned outside of toroids and all muon trajectory measurements are made in a nonmagnetic environment. Internal support for each magnet structure is provided by sheets, located at frequent and regularly spaced azimuthal planes, which interconnect the structural walls of the toroidal magnets. In a preferred embodiment, the shape of the toroidal magnet volume is adjusted to provide constant resolution over a wide range of rapidity. 4 figs.

Toroidal magnetic detector for high resolution measurement of muon momenta

DOEpatents

Bonanos, Peter

1992-01-01

A muon detector system including central and end air-core superconducting toroids and muon detectors enclosing a central calorimeter/detector. Muon detectors are positioned outside of toroids and all muon trajectory measurements are made in a nonmagnetic environment. Internal support for each magnet structure is provided by sheets, located at frequent and regularly spaced azimuthal planes, which interconnect the structural walls of the toroidal magnets. In a preferred embodiment, the shape of the toroidal magnet volume is adjusted to provide constant resolution over a wide range of rapidity.

End-to-End Beam Simulations for the New Muon G-2 Experiment at Fermilab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Korostelev, Maxim; Bailey, Ian; Herrod, Alexander

2016-06-01

The aim of the new muon g-2 experiment at Fermilab is to measure the anomalous magnetic moment of the muon with an unprecedented uncertainty of 140 ppb. A beam of positive muons required for the experiment is created by pion decay. Detailed studies of the beam dynamics and spin polarization of the muons are important to predict systematic uncertainties in the experiment. In this paper, we present the results of beam simulations and spin tracking from the pion production target to the muon storage ring. The end-to-end beam simulations are developed in Bmad and include the processes of particle decay,more » collimation (with accurate representation of all apertures) and spin tracking.« less

A grey incidence algorithm to detect high-Z material using cosmic ray muons

NASA Astrophysics Data System (ADS)

He, W.; Xiao, S.; Shuai, M.; Chen, Y.; Lan, M.; Wei, M.; An, Q.; Lai, X.

2017-10-01

Muon scattering tomography (MST) is a method for using cosmic muons to scan cargo containers and vehicles for special nuclear materials. However, the flux of cosmic ray muons is low, in the real life application, the detection has to be done a short timescale with small numbers of muons. In this paper, we present a novel approach to detection of special nuclear material by using cosmic ray muons. We use the degree of grey incidence to distinguish typical waste fuel material, uranium, from low-Z material, medium-Z material and other high-Z materials of tungsten and lead. The result shows that using this algorithm, it is possible to detect high-Z materials with an acceptable timescale.

Pathophysiological analyses of periventricular nodular heterotopia using gyrencephalic mammals.

PubMed

Matsumoto, Naoyuki; Hoshiba, Yoshio; Morita, Kazuya; Uda, Natsu; Hirota, Miwako; Minamikawa, Maki; Ebisu, Haruka; Shinmyo, Yohei; Kawasaki, Hiroshi

2017-03-15

Although periventricular nodular heterotopia (PNH) is often found in the cerebral cortex of people with thanatophoric dysplasia (TD), the pathophysiology of PNH in TD is largely unknown. This is mainly because of difficulties in obtaining brain samples of TD patients and a lack of appropriate animal models for analyzing the pathophysiology of PNH in TD. Here we investigate the pathophysiological mechanisms of PNH in the cerebral cortex of TD by utilizing a ferret TD model which we recently developed. To make TD ferrets, we electroporated fibroblast growth factor 8 (FGF8) into the cerebral cortex of ferrets. Our immunohistochemical analyses showed that PNH nodules in the cerebral cortex of TD ferrets were mostly composed of cortical neurons, including upper layer neurons and GABAergic neurons. We also found disorganizations of radial glial fibers and of the ventricular lining in the TD ferret cortex, indicating that PNH may result from defects in radial migration of cortical neurons along radial glial fibers during development. Our findings provide novel mechanistic insights into the pathogenesis of PNH in TD. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Temporal mapping of photochemical reactions and molecular excited states with carbon specificity

NASA Astrophysics Data System (ADS)

Wang, K.; Murahari, P.; Yokoyama, K.; Lord, J. S.; Pratt, F. L.; He, J.; Schulz, L.; Willis, M.; Anthony, J. E.; Morley, N. A.; Nuccio, L.; Misquitta, A.; Dunstan, D. J.; Shimomura, K.; Watanabe, I.; Zhang, S.; Heathcote, P.; Drew, A. J.

2017-04-01

Photochemical reactions are essential to a large number of important industrial and biological processes. A method for monitoring photochemical reaction kinetics and the dynamics of molecular excitations with spatial resolution within the active molecule would allow a rigorous exploration of the pathway and mechanism of photophysical and photochemical processes. Here we demonstrate that laser-excited muon pump-probe spin spectroscopy (photo-μSR) can temporally and spatially map these processes with a spatial resolution at the single-carbon level in a molecule with a pentacene backbone. The observed time-dependent light-induced changes of an avoided level crossing resonance demonstrate that the photochemical reactivity of a specific carbon atom is modified as a result of the presence of the excited state wavefunction. This demonstrates the sensitivity and potential of this technique in probing molecular excitations and photochemistry.

Computational studies of molecular charge transfer complexes of heterocyclic 4-methylepyridine-2-azomethine-p-benzene derivatives with picric acid and m-dinitrobenzene.

PubMed

Al-Harbi, L M; El-Mossalamy, E H; Obaid, A Y; Al-Jedaani, A H

2014-01-01

Charge transfer complexes of substituted aryl Schiff bases as donors with picric acid and m-dinitrobenzene as acceptors were investigated by using computational analysis calculated by Configuration Interaction Singles Hartree-Fock (CIS-HF) at standard 6-31G∗ basis set and Time-Dependent Density-Functional Theory (TD-DFT) levels of theory at standard 6-31G∗∗ basis set, infrared spectra, visible and nuclear magnetic resonance spectra are investigated. The optimized geometries and vibrational frequencies were evaluated. The energy and oscillator strength were calculated by Configuration Interaction Singles Hartree-Fock method (CIS-HF) and the Time-Dependent Density-Functional Theory (TD-DFT) results. Electronic properties, such as HOMO and LUMO energies and band gaps of CTCs set, were studied by the Time-Dependent density functional theory with Becke-Lee-Young-Parr (B3LYP) composite exchange correlation functional and by Configuration Interaction Singles Hartree-Fock method (CIS-HF). The ionization potential Ip and electron affinity EA were calculated by PM3, HF and DFT methods. The columbic force was calculated theoretically by using (CIS-HF and TD-DFT) methods. This study confirms that the theoretical calculation of vibrational frequencies for (aryl Schiff bases--(m-dinitrobenzene and picric acid)) complexes are quite useful for the vibrational assignment and for predicting new vibrational frequencies. Copyright © 2013 Elsevier B.V. All rights reserved.

Electron- and positron-molecule scattering: development of the molecular convergent close-coupling method

NASA Astrophysics Data System (ADS)

Zammit, Mark C.; Fursa, Dmitry V.; Savage, Jeremy S.; Bray, Igor

2017-06-01

Starting from first principles, this tutorial describes the development of the adiabatic-nuclei convergent close-coupling (CCC) method and its application to electron and (single-centre) positron scattering from diatomic molecules. We give full details of the single-centre expansion CCC method, namely the formulation of the molecular target structure; solving the momentum-space coupled-channel Lippmann-Schwinger equation; deriving adiabatic-nuclei cross sections and calculating V-matrix elements. Selected results are presented for electron and positron scattering from molecular hydrogen H2 and electron scattering from the vibrationally excited molecular hydrogen ion {{{H}}}2+ and its isotopologues (D2 +, {{{T}}}2+, HD+, HT+ and TD+). Convergence in both the close-coupling (target state) and projectile partial-wave expansions of fixed-nuclei electron- and positron-molecule scattering calculations is demonstrated over a broad energy-range and discussed in detail. In general, the CCC results are in good agreement with experiments.

Continuous performance test in pediatric obsessive-compulsive disorder and tic disorders: the role of sustained attention.

PubMed

Lucke, Ilse M; Lin, Charlotte; Conteh, Fatmata; Federline, Amanda; Sung, Huyngmo; Specht, Matthew; Grados, Marco A

2015-10-01

Pediatric obsessive-compulsive disorder (OCD) and tic disorders (TD) are often associated with attention-deficit hyperactivity disorder (ADHD). In order to clarify the role of attention and inhibitory control in pediatric OCD and TD, a continuous performance test (CPT) was administered to a cohort of children and adolescents with OCD alone, TD alone, and OCD+TD. A clinical cohort of 48 children and adolescents with OCD alone (n=20), TD alone (n=15), or OCD+TD (n=13) was interviewed clinically and administered the Conners Continuous Performance Test II (CPT-II). The Conners CPT-II is a 14-minute normed computerized test consisting of 6 blocks. It taps into attention, inhibitory control, and sustained attention cognitive domains. Key parameters include errors of omission (distractability), commission (inhibitory control), and variable responding over time (sustained attention). Diagnostic and Statistical Manual of Mental Disorders, 4th Edition (DSM-IV) criteria were applied in a best-estimate process to diagnose OCD, TD, ADHD, and anxiety disorders. Children with OCD+TD had more errors of omission (p=0.03), and more hit RT block change (p=0.003) and hit SE block change (p=0.02) than subjects with OCD alone and TD alone. These deficits in sustained attention were associated with younger age and hoarding tendencies. A clinical diagnosis of ADHD in the OCD+TD group also determined worse sustained attention. A deficit in sustained attention, a core marker of ADHD, is also a marker of OCD+TD, compared to OCD alone and TD alone. Biological correlates of sustained attention may serve to uncover the pathophysiology of OCD and TD through genetic and imaging studies.

Influence of a National Cancer Institute transdisciplinary research and training initiative on trainees' transdisciplinary research competencies and scholarly productivity.

PubMed

Vogel, Amanda L; Feng, Annie; Oh, April; Hall, Kara L; Stipelman, Brooke A; Stokols, Daniel; Okamoto, Janet; Perna, Frank M; Moser, Richard; Nebeling, Linda

2012-12-01

Over the past several decades, there has been burgeoning interest and investment in large transdisciplinary (TD) team science initiatives that aim to address complex societal problems. Despite this trend, TD training opportunities in the health sciences remain limited, and evaluations of these opportunities are even more uncommon due to funding constraints. We had the unique opportunity to conduct an exploratory study to examine the potential outcomes and impacts of TD training in a National Cancer Institute-supported initiative for TD research and training-the Transdisciplinary Research on Energetics and Cancer I (TREC I) initiative. This study used a retrospective mixed-methods approach leveraging secondary analysis of existing data sources to learn about TREC trainees' experiences with TREC training, TD research competencies, changes in scholarly productivity, and the associations among these domains. Results indicated that, on average, TREC trainees were satisfied with their TREC mentoring experiences and believed that TREC training processes were effective, in general. Participation in TREC training was associated with TD research competencies, including TD research orientation, positive general attitude toward TD training, development of scientific skills for TD research, and intrapersonal/interpersonal competencies for collaboration. There was also a significant increase in trainees' scholarly productivity from before to after starting in TREC training, as indicated by average annual number of publications and presentations and average number of coauthors per publication. Perceived effectiveness of TREC training was positively correlated with change in average annual number of research presentations from before to after starting in TREC training (r = 0.65, p < 0.05, N = 12), as well as TD research orientation (r = 0.36, p < 0.05), general attitude toward TD training (0.39, p < 0.05), scientific skills for TD research (r = 0.45-0.48, p < 0.05), and perceived collaborative productivity at one's TREC center (r = 0.47, p < 0.01). Finally, a significant positive correlation was observed between multi-mentoring experiences and both TD research orientation (r = 0.58, p < 0.05) and perceived collaborative productivity at one's TREC center (r = 0.44, p < 0.05). This exploratory study had methodological constraints including the absence of a comparison group and cross-sectional rather than longitudinal data related to TD research competencies. Despite these limitations, the study provided an opportunity to use existing data sources to explore potential outcomes and impacts of TD training and inform development of future rigorous evaluations of TD training. Overall, findings suggest that TD training in the context of a TD research initiative can provide satisfying training opportunities that support the development of TD research competencies and promote scholarly productivity.

Pioneering the Transdisciplinary Team Science Approach: Lessons Learned from National Cancer Institute Grantees

PubMed Central

Vogel, Amanda L; Stipelman, Brooke A; Hall, Kara L; Nebeling, Linda; Stokols, Daniel; Spruijt-Metz, Donna

2014-01-01

The National Cancer Institute has been a leader in supporting transdisciplinary (TD) team science. From 2005-2010, the NCI supported Transdisciplinary Research on Energetic and Cancer I (TREC I), a center initiative fostering the TD integration of social, behavioral, and biological sciences to examine the relationships among obesity, nutrition, physical activity and cancer. In the final year of TREC I, we conducted qualitative in-depth-interviews with 31 participating investigators and trainees to learn more about their experiences with TD team science, including challenges, facilitating factors, strategies for success, and impacts. Five main challenges emerged: (1) limited published guidance for how to engage in TD team science, when TREC I was implemented; (2) conceptual and scientific challenges inherent to efforts to achieve TD integration; (3) discipline-based differences in values, terminology, methods, and work styles; (4) project management challenges involved in TD team science; and (5) traditional incentive and reward systems that do not recognize or reward TD team science. Four main facilitating factors and strategies for success emerged: (1) beneficial attitudes and beliefs about TD research and team science; (2) effective team processes; (3) brokering and bridge-building activities by individuals holding particular roles in a research center; and (4) funding initiative characteristics that support TD team science. Broad impacts of participating in TD team science in the context of TREC I included: (1) new positive attitudes about TD research and team science; (2) new boundary-crossing collaborations; (3) scientific advances related to research approaches, findings, and dissemination; (4) institutional culture change and resource creation in support of TD team science; and (5) career advancement. Funding agencies, academic institutions, and scholarly journals can help to foster TD team science through funding opportunities, institutional policies on extra-departmental and cross-school collaboration, promotion and tenure policies, and publishing opportunities for TD research. PMID:25554748

Shedding light on the Early Pleistocene of TD6 (Gran Dolina, Atapuerca, Spain): The technological sequence and occupational inferences

PubMed Central

2018-01-01

This paper aims to update the information available on the lithic assemblage from the entire sequence of TD6 now that the most recent excavations have been completed, and to explore possible changes in both occupational patterns and technological strategies evidenced in the unit. This is the first study to analyse the entire TD6 sequence, including subunits TD6.3 and TD6.1, which have never been studied, along with the better-known TD6.2 Homo antecessor-bearing subunit. We also present an analysis of several lithic refits found in TD6, as well as certain technical features that may help characterise the hominin occupations. The archaeo-palaeontological record from TD6 consists of 9,452 faunal remains, 443 coprolites, 1,046 lithic pieces, 170 hominin remains and 91 Celtis seeds. The characteristics of this record seem to indicate two main stages of occupation. In the oldest subunit, TD6.3, the lithic assemblage points to the light and limited hominin occupation of the cave, which does, however, grow over the course of the level. In contrast, the lithic assemblages from TD6.2 and TD6.1 are rich and varied, which may reflect Gran Dolina cave’s establishment as a landmark in the region. Despite the occupational differences between the lowermost subunit and the rest of the deposit, technologically the TD6 lithic assemblage is extremely homogeneous throughout. In addition, the composition and spatial distribution of the 12 groups of lithic refits found in unit TD6, as well as the in situ nature of the assemblage demonstrate the high degree of preservation at the site. This may help clarify the nature of the Early Pleistocene hominin occupations of TD6, and raise reasonable doubt about the latest interpretations that support the ex situ character of the assemblage as a whole. PMID:29370188

Shedding light on the Early Pleistocene of TD6 (Gran Dolina, Atapuerca, Spain): The technological sequence and occupational inferences.

PubMed

Mosquera, Marina; Ollé, Andreu; Rodríguez-Álvarez, Xose Pedro; Carbonell, Eudald

2018-01-01

This paper aims to update the information available on the lithic assemblage from the entire sequence of TD6 now that the most recent excavations have been completed, and to explore possible changes in both occupational patterns and technological strategies evidenced in the unit. This is the first study to analyse the entire TD6 sequence, including subunits TD6.3 and TD6.1, which have never been studied, along with the better-known TD6.2 Homo antecessor-bearing subunit. We also present an analysis of several lithic refits found in TD6, as well as certain technical features that may help characterise the hominin occupations. The archaeo-palaeontological record from TD6 consists of 9,452 faunal remains, 443 coprolites, 1,046 lithic pieces, 170 hominin remains and 91 Celtis seeds. The characteristics of this record seem to indicate two main stages of occupation. In the oldest subunit, TD6.3, the lithic assemblage points to the light and limited hominin occupation of the cave, which does, however, grow over the course of the level. In contrast, the lithic assemblages from TD6.2 and TD6.1 are rich and varied, which may reflect Gran Dolina cave's establishment as a landmark in the region. Despite the occupational differences between the lowermost subunit and the rest of the deposit, technologically the TD6 lithic assemblage is extremely homogeneous throughout. In addition, the composition and spatial distribution of the 12 groups of lithic refits found in unit TD6, as well as the in situ nature of the assemblage demonstrate the high degree of preservation at the site. This may help clarify the nature of the Early Pleistocene hominin occupations of TD6, and raise reasonable doubt about the latest interpretations that support the ex situ character of the assemblage as a whole.

Uplink Scheduling and Adjacent-Channel Coupling Loss Analysis for TD-LTE Deployment

PubMed Central

Yeo, Woon-Young; Moon, Sung Ho

2014-01-01

TD-LTE, one of the two duplexing modes in LTE, operates in unpaired spectrum and has the advantages of TDD-based technologies. It is expected that TD-LTE will be more rapidly deployed in near future and most of WiMax operators will upgrade their networks to TD-LTE gradually. Before completely upgrading to TD-LTE, WiMax may coexist with TD-LTE in an adjacent frequency band. In addition, multiple TD-LTE operators may deploy their networks in adjacent bands. When more than one TDD network operates in adjacent frequency bands, severe interference may happen due to adjacent channel interference (ACI) and unsynchronized operations. In this paper, coexistence issues between TD-LTE and other systems are analyzed and coexistence requirements are provided. This paper has three research objectives. First, frame synchronization between TD-LTE and WiMax is discussed by investigating possible combinations of TD-LTE and WiMax configurations. Second, an uplink scheduling algorithm is proposed to utilize a leakage pattern of ACI in synchronized operations. Third, minimum requirements for coexistence in unsynchronized operations are analyzed by introducing a concept of adjacent-channel coupling loss. From the analysis and simulation results, we can see that coexistence of TD-LTE with other TDD systems is feasible if the two networks are synchronized. For the unsynchronized case, some special cell-site engineering techniques may be required to reduce the ACI. PMID:24707214

Uplink scheduling and adjacent-channel coupling loss analysis for TD-LTE deployment.

PubMed

Yeo, Woon-Young; Moon, Sung Ho; Kim, Jae-Hoon

2014-01-01

TD-LTE, one of the two duplexing modes in LTE, operates in unpaired spectrum and has the advantages of TDD-based technologies. It is expected that TD-LTE will be more rapidly deployed in near future and most of WiMax operators will upgrade their networks to TD-LTE gradually. Before completely upgrading to TD-LTE, WiMax may coexist with TD-LTE in an adjacent frequency band. In addition, multiple TD-LTE operators may deploy their networks in adjacent bands. When more than one TDD network operates in adjacent frequency bands, severe interference may happen due to adjacent channel interference (ACI) and unsynchronized operations. In this paper, coexistence issues between TD-LTE and other systems are analyzed and coexistence requirements are provided. This paper has three research objectives. First, frame synchronization between TD-LTE and WiMax is discussed by investigating possible combinations of TD-LTE and WiMax configurations. Second, an uplink scheduling algorithm is proposed to utilize a leakage pattern of ACI in synchronized operations. Third, minimum requirements for coexistence in unsynchronized operations are analyzed by introducing a concept of adjacent-channel coupling loss. From the analysis and simulation results, we can see that coexistence of TD-LTE with other TDD systems is feasible if the two networks are synchronized. For the unsynchronized case, some special cell-site engineering techniques may be required to reduce the ACI.

Dependence of the muon intensity on the atmospheric temperature measured by the GRAPES-3 experiment

NASA Astrophysics Data System (ADS)

Arunbabu, K. P.; Ahmad, S.; Chandra, A.; Dugad, S. R.; Gupta, S. K.; Hariharan, B.; Hayashi, Y.; Jagadeesan, P.; Jain, A.; Jhansi, V. B.; Kawakami, S.; Kojima, H.; Mohanty, P. K.; Morris, S. D.; Nayak, P. K.; Oshima, A.; Rao, B. S.; Reddy, L. V.; Shibata, S.; Tanaka, K.; Zuberi, M.

2017-09-01

The large area (560 m2) GRAPES-3 tracking muon telescope has been operating uninterruptedly at Ooty, India since 2001. Every day, it records 4 × 109 muons of ≥1 GeV with an angular resolution of ∼4°. The variation of atmospheric temperature affects the rate of decay of muons produced by the galactic cosmic rays (GCRs), which in turn modulates the muon intensity. By analyzing the GRAPES-3 data of six years (2005-2010), a small (amplitude ∼0.2%) seasonal variation (1 year (Yr) period) in the intensity of muons could be measured. The effective temperature 'Teff' of the upper atmosphere also displays a periodic variation with an amplitude of ∼1 K which was responsible for the observed seasonal variation in the muon intensity. At GeV energies, the muons detected by the GRAPES-3 are expected to be anti-correlated with Teff. The anti-correlation between the seasonal variation of Teff, and the muon intensity was used to measure the temperature coefficient αT by fast Fourier transform (FFT) technique. The magnitude of αT was found to scale with the assumed attenuation length 'λ' of the hadrons in the range λ = 80-180 g cm-2. However, the magnitude of the correction in the muon intensity was found to be almost independent of the value of λ used. For λ = 120 g cm-2 the value of temperature coefficient αT was found to be (- 0.17 ± 0.02)% K-1.

Simulation of Underground Muon Flux with Application to Muon Tomography

NASA Astrophysics Data System (ADS)

Yamaoka, J. A. K.; Bonneville, A.; Flygare, J.; Lintereur, A.; Kouzes, R.

2015-12-01

Muon tomography uses highly energetic muons, produced by cosmic rays interacting within the upper atmosphere, to image dense materials. Like x-rays, an image can be constructed from the negative of the absorbed (or scattered) muons. Unlike x-rays, these muons can penetrate thousands of meters of earth. Muon tomography has been shown to be useful across a wide range of applications (such as imaging of the interior of volcanoes and cargo containers). This work estimates the sensitivity of muon tomography for various underground applications. We use simulations to estimate the change in flux as well as the spatial resolution when imaging static objects, such as mine shafts, and dynamic objects, such as a CO2 reservoir filling over time. We present a framework where we import ground density data from other sources, such as wells, gravity and seismic data, to generate an expected muon flux distribution at specified underground locations. This information can further be fed into a detector simulation to estimate a final experimental sensitivity. There are many applications of this method. We explore its use to image underground nuclear test sites, both the deformation from the explosion as well as the supporting infrastructure (access tunnels and shafts). We also made estimates for imaging a CO2 sequestration site similar to Futuregen 2.0 in Illinois and for imaging magma chambers beneath the Cascade Range volcanoes. This work may also be useful to basic science, such as underground dark matter experiments, where increasing experimental sensitivity requires, amongst other factors, a precise knowledge of the muon background.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gómez, H.

Muon events are one of the main concerns regarding background in neutrino experiments. The placement of experimental set-ups in deep underground facilities reduce considerably their impact on the research of the expected signals. But in the cases where the detector is installed on surface or at shallow depth, muon flux remains high, being necessary their precise identification for further rejection. Total flux, mean energy or angular distributions are some of the parameters that can help to characterize the muons. Empirically, the muon rate can be measured in an experiment by a number of methods. Nevertheless, the capability to determine themore » muons angular distribution strongly depends on the detector features, while the measurement of the muon energy is quite difficult. Also considering that on-site measurements can not be extrapolated to other sites due to the difference on the overburden and its profile, it is necessary to find an adequate solution to perform the muon characterization. The method described in this work to obtain the main features of the muons reaching the experimental set-up, is based on the muon transport simulation by the MUSIC software, combined with a dedicated sampling algorithm for shallow depth installations based on a modified Gaisser parametrization. This method provides all the required information about the muons for any shallow depth installation if the corresponding overburden profile is implemented. In this work, the method has been applied for the recently commissioned Double - Chooz near detector, which will allow the cross-check between the simulation and the experimental data, as it has been done for the far detector.« less

Epidemiology and Self-Treatment of Travelers’ Diarrhea in a Large, Prospective Cohort of Department of Defense Beneficiaries

PubMed Central

Lalani, Tahaniyat; Maguire, Jason D.; Grant, Edward M.; Fraser, Jamie; Ganesan, Anuradha; Johnson, Mark D.; Deiss, Robert G.; Riddle, Mark S.; Burgess, Timothy; Tribble, David R.

2014-01-01

Background Infectious diarrhea is a common problem among travelers. Expert guidelines recommend the prompt use of antibiotics for self-treatment of moderate or severe traveler’s diarrhea (TD). There is limited data on whether travelers follow these self-treatment guidelines. We evaluated the risk factors associated with TD, use of TD self-treatment, and risk of irritable bowel syndrome (IBS) during travel. Methods Department of Defense beneficiaries traveling outside the US for ≤ 6.5 months were enrolled in a prospective cohort study. Participants received pre- and post-travel surveys, and could opt into a travel illness diary and follow-up surveys for symptoms of IBS. Standard definitions were used to assess for TD and IBS. Sub-optimal self-treatment was defined as use of antibiotics (with or without antidiarrheal agents) for mild TD, or use of antidiarrheals alone or no self-treatment in cases of moderate or severe TD. Results Twenty-four percent of participants (270/1120) met criteria for TD. The highest incidence was recorded in Africa (8.6 cases/100 person-weeks, 95% CI: 6.7–10.5). Two hundred and twelve TD cases provided information regarding severity and self-treatment: 89 (42%) had mild TD and 123 (58%) had moderate or severe TD. Moderate or severe TD was independently associated with suboptimal self-treatment (OR 10.4 [95% CI: 4.92–22.0]). Time to last unformed stool did not differ between optimal and suboptimal self-treatment. IBS occurred in 4.5% (7/154) of TD cases and 3.1% (16/516) of patients without TD (p=0.39). Among TD cases, a lower incidence of IBS was noted in participants who took antibiotics (4.8% (5/105) vs. 2.2% (1/46)), but the difference did not reach statistical significance (p=0.60). Conclusions Our results suggest the underutilization of antibiotics in travelers with moderate or severe TD. Further studies are needed to systematically evaluate pre-travel instruction and traveler adherence to self-treatment guidelines, and the impact of suboptimal self-treatment on outcomes. PMID:25483360

Densitometric tomography using the measurement of muon flux

NASA Astrophysics Data System (ADS)

Hivert, F.; Busto, J.; Brunner, J.; Salin, P.; Gaffet, S.

2013-12-01

The knowledge of the subsurface properties is essentially obtained by geophysical methods, e.g. seismic imaging, electric prospection or gravimetry. The present work develops a recent method to investigate the in situ density of rocks using atmospheric the muon flux measurement , its attenuation depending on the rock density and thickness. This new geophysical technique have been mainly applied in volcanology (Lesparre N., 2011) using scintillator detectors. The present project (T2DM2) aims to realize underground muons flux measurements in order to characterizing the rock massif density variations above the LSBB underground research facility in Rustrel (France). The muon flux will be measure with a new Muon telescope instrumentation using Micromegas detectors in Time Projection Chambers (TPC) configuration. The first step of the work presented considers the muon flux simulation using the Gaisser model, for the interactions between muons and atmospheric particles, and the MUSIC code (Kudryavtsev V. A., 2008) for the muons/rock interactions. The results show that the muon flux attenuation caused by density variations are enough significant to be observed until around 500 m depth and for period of time in the order of one month. Such a duration scale and depth of investigation is compatible with the duration of the water transfer processes involved within the Karst unsaturated zone where LSBB is located. Our work now concentrates on the optimization of the spatial distribution of detectors that will be deployed in future.

Muon tomography of rock density using Micromegas-TPC telescope

NASA Astrophysics Data System (ADS)

Hivert, Fanny; Busto, José; Gaffet, Stéphane; Ernenwein, Jean-Pierre; Brunner, Jurgen; Salin, Pierre; Decitre, Jean-Baptiste; Lázaro Roche, Ignacio; Martin, Xavier

2014-05-01

The knowledge of the subsurface properties is essentially obtained by geophysical methods, e.g., seismic imaging, electric prospection or gravimetry. The current work is based on a recently developed method to investigate in situ the density of rocks using a measurement of the muon flux, whose attenuation depends on the quantity of matter the particles travel through and hence on the rock density and thickness. The present project (T2DM2) aims at performing underground muon flux measurements in order to characterize spatial and temporal rock massif density variations above the LSBB underground research facility in Rustrel (France). The muon flux will be measured with a new muon telescope device using Micromegas-Time Projection Chamber (TPC) detectors. The first step of the work presented covers the muon flux simulation based on the Gaisser model (Gaisser T., 1990), for the muon flux at the ground level, and on the MUSIC code (Kudryavtsev V. A., 2008) for the propagation of muons through the rock. The results show that the muon flux distortion caused by density variations is enough significant to be observed at 500 m depth for measurement times of about one month. This time-scale is compatible with the duration of the water transfer processes within the unsaturated Karst zone where LSBB is located. The work now focuses on the optimization of the detector layout along the LSBB galleries in order to achieve the best sensitivity.

Muonic molecular ions p p μ and p d μ driven by superintense VUV laser pulses: Postexcitation muonic and nuclear oscillations and high-order harmonic generation

NASA Astrophysics Data System (ADS)

Paramonov, Guennaddi K.; Saalfrank, Peter

2018-05-01

The non-Born-Oppenheimer quantum dynamics of p p μ and p d μ molecular ions excited by ultrashort, superintense VUV laser pulses polarized along the molecular axis (z ) is studied by the numerical solution of the time-dependent Schrödinger equation within a three-dimensional (3D) model, including the internuclear distance R and muon coordinates z and ρ , a transversal degree of freedom. It is shown that in both p p μ and p d μ , muons approximately follow the applied laser field out of phase. After the end of the laser pulse, expectation values , <ρ > , and demonstrate "post-laser-pulse" oscillations in both p p μ and p d μ . In the case of p d μ , the post-laser-pulse oscillations of and appear as shaped "echo pulses." Power spectra, which are related to high-order harmonic generation (HHG), generated due to muonic and nuclear motion are calculated in the acceleration form. For p d μ it is found that there exists a unique characteristic frequency ωoscp d μ representing both frequencies of post-laser-pulse muonic oscillations and the frequency of nuclear vibrations, which manifest themselves by very sharp maxima in the corresponding power spectra of p d μ . The homonuclear p p μ ion does not possess such a unique characteristic frequency. The "exact" dynamics and power, and HHG spectra of the 3D model are compared with a Born-Oppenheimer, fixed-nuclei model featuring interesting differences: postpulse oscillations are absent and HHG spectra are affected indirectly or directly by nuclear motion.

Modular detector for deep underwater registration of muons and muon groups

NASA Technical Reports Server (NTRS)

Demianov, A. I.; Sarycheva, L. I.; Sinyov, N. B.; Varadanyan, I. N.; Yershov, A. A.

1985-01-01

Registration and identification of muons and muon groups penetrating into the ocean depth, can be performed using a modular multilayer detector with high resolution bidimensional readout - deep underwater calorimeter (project NADIR). Laboratory testing of a prototype sensor cell with liquid scintillator in light-tight casing, testifies to the practicability of the full-scale experiment within reasonable expences.

Materials science with muon spin rotation

NASA Technical Reports Server (NTRS)

1988-01-01

During this reporting period, the focus of activity in the Materials Science with Muon Spin Rotation (MSMSR) program was muon spin rotation studies of superconducting materials, in particular the high critical temperature and heavy-fermion materials. Apart from these studies, work was continued on the analysis of muon motion in metal hydrides. Results of these experiments are described in six papers included as appendices.

Measurement of muon annual modulation and muon-induced phosphorescence in NaI(Tl) crystals with DM-Ice17

DOE PAGES

Cherwinka, J.; Grant, D.; Halzen, F.; ...

2016-02-01

We report the measurement of muons and muon-induced phosphorescence in DM-Ice17, a NaI(Tl) direct detection dark matter experiment at the South Pole. Muon interactions in the crystal are identified by their observed pulse shape and large energy depositions. The measured muon rate in DM-Ice17 is 2.93±0.04 μ/crystal/day with a modulation amplitude of 12.3±1.7%, consistent with expectation. Following muon interactions, we observe long-lived phosphorescence in the NaI(Tl) crystals with a decay time of 5.5±0.5 s. The prompt energy deposited by a muon is correlated to the amount of delayed phosphorescence, the brightest of which consist of tens of millions of photons.more » These photons are distributed over tens of seconds with a rate and arrival timing that do not mimic a scintillation signal above 2 keV ee. Furthermore, while the properties of phosphorescence vary among individual crystals, the annually modulating signal observed by DAMA cannot be accounted for by phosphorescence with the characteristics observed in DM-Ice17.« less

The performance of the Muon Veto of the G erda experiment

NASA Astrophysics Data System (ADS)

Freund, K.; Falkenstein, R.; Grabmayr, P.; Hegai, A.; Jochum, J.; Knapp, M.; Lubsandorzhiev, B.; Ritter, F.; Schmitt, C.; Schütz, A.-K.; Jitnikov, I.; Shevchik, E.; Shirchenko, M.; Zinatulina, D.

2016-05-01

Low background experiments need a suppression of cosmogenically induced events. The Gerda experiment located at Lngs is searching for the 0ν β β decay of ^{76}Ge. It is equipped with an active muon veto the main part of which is a water Cherenkov veto with 66 PMTs in the water tank surrounding the Gerda cryostat. With this system 806 live days have been recorded, 491 days were combined muon-germanium data. A muon detection efficiency of \\varepsilon _\\upmu d=(99.935± 0.015) % was found in a Monte Carlo simulation for the muons depositing energy in the germanium detectors. By examining coincident muon-germanium events a rejection efficiency of \\varepsilon _{\\upmu r}=(99.2_{-0.4}^{+0.3}) % was found. Without veto condition the muons by themselves would cause a background index of {BI}_{μ }=(3.16 ± 0.85)× 10^{-3} cts/(keV\\cdot kg\\cdot year) at Q_{β β }.

Non-destructive elemental analysis of a carbonaceous chondrite with direct current Muon beam at MuSIC.

PubMed

Terada, K; Sato, A; Ninomiya, K; Kawashima, Y; Shimomura, K; Yoshida, G; Kawai, Y; Osawa, T; Tachibana, S

2017-11-13

Electron- or X-ray-induced characteristic X-ray analysis has been widely used to determine chemical compositions of materials in vast research fields. In recent years, analysis of characteristic X-rays from muonic atoms, in which a muon is captured, has attracted attention because both a muon beam and a muon-induced characteristic X-ray have high transmission abilities. Here we report the first non-destructive elemental analysis of a carbonaceous chondrite using one of the world-leading intense direct current muon beam source (MuSIC; MUon Science Innovative Channel). We successfully detected characteristic muonic X-rays of Mg, Si, Fe, O, S and C from Jbilet Winselwan CM chondrite, of which carbon content is about 2 wt%, and the obtained elemental abundance pattern was consistent with that of CM chondrites. Because of its high sensitivity to carbon, non-destructive elemental analysis with a muon beam can be a novel powerful tool to characterize future retuned samples from carbonaceous asteroids.

Investigation of very high energy cosmic rays by means of inclined muon bundles

NASA Astrophysics Data System (ADS)

Bogdanov, A. G.; Kokoulin, R. P.; Mannocchi, G.; Petrukhin, A. A.; Saavedra, O.; Shutenko, V. V.; Trinchero, G.; Yashin, I. I.

2018-03-01

In a typical approach to extensive air shower (EAS) investigations, horizontal arrays are used and near-vertical EAS are detected. In contrast, in this work vertically arranged muon detectors are used to study inclined EAS. At large zenith angles, EAS consisting solely of muon component are employed. The transverse dimensions of EAS rapidly increase when the zenith angle increases. Hence, EAS in a wide energy interval can be explored by means of a relatively small detector. Here we present results of the analysis of the data on inclined muon bundles accumulated from 2002 to 2016 in the DECOR experiment. For the first time, these results demonstrate with more than 3σ significance the existence of the second knee in the EAS muon component spectrum near 1017 eV primary energy. An excess of muon bundles at energies about 1 EeV found earlier in DECOR data has been confirmed and analyzed in detail. It is highly likely that the obtained outcomes indicate the appearance of new processes of muon generation.

imaging volcanos with gravity and muon tomography measurements

NASA Astrophysics Data System (ADS)

Jourde, Kevin; Gibert, Dominique; Marteau, Jacques; Deroussi, Sébastien; Dufour, Fabrice; de Bremond d'Ars, Jean; Ianigro, Jean-Christophe; Gardien, Serge; Girerd, Claude

2015-04-01

Both muon tomography and gravimetry are geohysical methods that provide information on the density structure of the Earth's subsurface. Muon tomography measures the natural flux of cosmic muons and its attenuation produced by the screening effect of the rock mass to image. Gravimetry generally consists in measurements of the vertical component of the local gravity field. Both methods are linearly linked to density, but their spatial sensitivity is very different. Muon tomography essentially works like medical X-ray scan and integrates density information along elongated narrow conical volumes while gravimetry measurements are linked to density by a 3-dimensional integral encompassing the whole studied domain. We show that gravity data are almost useless to constrain the density structure in regions sampled by more than two muon tomography acquisitions. Interestingly the resolution in deeper regions not sampled by muon tomography is significantly improved by joining the two techniques. Examples taken from field experiments performed on La Soufrière of Guadeloupe volcano are discussed.

Development of a muon radiographic imaging electronic board system for a stable solar power operation

NASA Astrophysics Data System (ADS)

Uchida, T.; Tanaka, H. K. M.; Tanaka, M.

2010-02-01

Cosmic-ray muon radiography is a method that is used to study the internal structure of volcanoes. We have developed a muon radiographic imaging board with a power consumption low enough to be powered by a small solar power system. The imaging board generates an angular distribution of the muons. Used for real-time reading, the method may facilitate the prediction of eruptions. For real-time observations, the Ethernet is employed, and the board works as a web server for a remote operation. The angular distribution can be obtained from a remote PC via a network using a standard web browser. We have collected and analyzed data obtained from a 3-day field study of cosmic-ray muons at a Satsuma-Iwojima volcano. The data provided a clear image of the mountain ridge as a cosmic-ray muon shadow. The measured performance of the system is sufficient for a stand-alone cosmic-ray muon radiography experiment.

Muon Colliders: The Next Frontier

ScienceCinema

Tourun, Yagmur

2017-12-22

Muon Colliders provide a path to the energy frontier in particle physics but have been regarded to be "at least 20 years away" for 20 years. I will review recent progress in design studies and hardware R&D and show that a Muon Collider can be established as a real option for the post-LHC era if the current vigorous R&D effort revitalized by the Muon Collider Task Force at Fermilab can be supported to its conclusion. All critical technologies are being addressed and no show-stoppers have emerged. Detector backgrounds have been studied in detail and appear to be manageable and the physics can be done with existing detector technology. A muon facility can be built through a staged scenario starting from a low-energy muon source with unprecedented intensity for exquisite reach for rare processes, followed by a Neutrino Factory with ultrapure neutrino beams with unparalleled sensitivity for disentangling neutrino mixing, leading to an energy frontier Muon Collider with excellent energy resolution.

A path integral molecular dynamics study of the hyperfine coupling constants of the muoniated and hydrogenated acetone radicals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oba, Yuki; Kawatsu, Tsutomu; Tachikawa, Masanori, E-mail: tachi@yokohama-cu.ac.jp

2016-08-14

The on-the-fly ab initio density functional path integral molecular dynamics (PIMD) simulations, which can account for both the nuclear quantum effect and thermal effect, were carried out to evaluate the structures and “reduced” isotropic hyperfine coupling constants (HFCCs) for muoniated and hydrogenated acetone radicals (2-muoxy-2-propyl and 2-hydoxy-2-propyl) in vacuo. The reduced HFCC value from a simple geometry optimization calculation without both the nuclear quantum effect and thermal effect is −8.18 MHz, and that by standard ab initio molecular dynamics simulation with only the thermal effect and without the nuclear quantum effect is 0.33 MHz at 300 K, where these twomore » methods cannot distinguish the difference between muoniated and hydrogenated acetone radicals. In contrast, the reduced HFCC value of the muoniated acetone radical by our PIMD simulation is 32.1 MHz, which is about 8 times larger than that for the hydrogenated radical of 3.97 MHz with the same level of calculation. We have found that the HFCC values are highly correlated with the local molecular structures; especially, the Mu—O bond length in the muoniated acetone radical is elongated due to the large nuclear quantum effect of the muon, which makes the expectation value of the HFCC larger. Although our PIMD result calculated in vacuo is about 4 times larger than the measured experimental value in aqueous solvent, the ratio of these HFCC values between muoniated and hydrogenated acetone radicals in vacuo is in reasonable agreement with the ratio of the experimental values in aqueous solvent (8.56 MHz and 0.9 MHz); the explicit presence of solvent molecules has a major effect on decreasing the reduced muon HFCC of in vacuo calculations for the quantitative reproduction.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Malgin, A. S., E-mail: malgin@lngs.infn.it

The parameters of the seasonal modulations in the intensity of muons and cosmogenic neutrons generated by them at a mean muon energy of 280 GeV have been determined in the LVD (Large Volume Detector) experiment. The modulations of muons and neutrons are caused by a temperature effect, the seasonal temperature and density variations of the upper atmospheric layers. The analysis performed here leads to the conclusion that the variations in the mean energy of the muon flux are the main source of underground cosmogenic neutron variations, because the energy of muons is more sensitive to the temperature effect than theirmore » intensity. The parameters of the seasonal modulations in the mean energy of muons and the flux of cosmogenic neutrons at the LVD depth have been determined from the data obtained over seven years of LVD operation.« less

J-PARC Muon Facility, MUSE

NASA Astrophysics Data System (ADS)

Miyake, Yasuhiro; Shimomura, Koichiro; Kawamura, Naritoshi; Koda, Akihiro; Strasser, Patrick; Kojima, Kenji M.; Fujimori, Hiroshi; Makimura, Shunsuke; Ikedo, Yutaka; Kobayashi, Yasushi; Nakamura, Jumpei; Oishi, Yu; Takeshita, Soshi; Adachi, Taihei; Datt Pant, Amba; Okabe, Hirotaka; Matoba, Shiro; Tampo, Motobobu; Hiraishi, Masatoshi; Hamada, Koji; Doiuchi, Shougo; Higemoto, Wataru; Ito, Takashi U.; Kadono, Ryosuke

At J-PARC MUSE (Muon Science Establishment), one graphite target was installed in the proton beam line on the way to the neutron source, from which four sets of the secondary lines were designed to be extracted and extended into two experimental halls (toward the west wing, one decay-surface muon channel (D-Line) and the axial focusing muon channel (U-Line), and towards the east wing one surface muon channel (S-Line) and one fundamental muon channel (H-Line). MUSE has been suffering from many troubles such as the giant earthquake, fire, twice water leakage from the neutron target. Although the proton beam intensity was restricted lower than 200 kW, we have been having a rather stable operation at the MUSE since February, 2016. In this paper, the latest situation on the MUSE is reported.

Measurement of the multiple-muon charge ratio in the MINOS Far Detector

DOE PAGES

Adamson, P.; Anghel, I.; Aurisano, A.; ...

2016-03-30

The charge ratio, R μ = N μ+/N μ-, for cosmogenic multiple-muon events observed at an underground depth of 2070 mwe has been measured using the magnetized MINOS Far Detector. The multiple-muon events, recorded nearly continuously from August 2003 until April 2012, comprise two independent data sets imaged with opposite magnetic field polarities, the comparison of which allows the systematic uncertainties of the measurement to be minimized. The multiple-muon charge ratio is determined to be R μ = 1.104±0.006(stat)more » $$+0.009\\atop{-0.010}$$(syst). As a result, this measurement complements previous determinations of single-muon and multiple-muon charge ratios at underground sites and serves to constrain models of cosmic-ray interactions at TeV energies.« less

Recent progress in neutrino factory and muon collider research within the Muon Collaboration

DOE Office of Scientific and Technical Information (OSTI.GOV)

M. M. Alsharoa; Charles M. Ankenbrandt; Muzaffer Atac

2003-08-01

We describe the status of our effort to realize a first neutrino factory and the progress made in understanding the problems associated with the collection and cooling of muons towards that end. We summarize the physics that can be done with neutrino factories as well as with intense cold beams of muons. The physics potential of muon colliders is reviewed, both as Higgs Factories and compact high energy lepton colliders. The status and timescale of our research and development effort is reviewed as well as the latest designs in cooling channels including the promise of ring coolers in achieving longitudinalmore » and transverse cooling simultaneously. We detail the efforts being made to mount an international cooling experiment to demonstrate the ionization cooling of muons.« less

Review of possible applications of cosmic muon tomography

NASA Astrophysics Data System (ADS)

Checchia, P.

2016-12-01

Muon radiographic methods can be used to explore inaccessible volumes profiting of the property of muons to penetrate thick materials. An extension of the muon radiographic methods, the muon scattering tomography, was proposed for the first time in 2003 and it is based on the measurement of the multiple Coulomb scattering of muons crossing the volume under investigation. In this talk, the principles of tomographic image reconstruction are first outlined and then the experimental setup and the most adequate detectors are described. A review of the possible applications of this technique is reported, with specific reference to security in transports and monitoring of industrial processes. The technique can also be used to provide precise measurements of the properties of various materials. The experimental challenge related to this activity is discussed.

Production of muons for fusion catalysis using a migma configuration

NASA Astrophysics Data System (ADS)

Chapline, George F.; Moir, Ralph W.

1988-08-01

Muon-catalyzed fusion requires a very efficient means of producing muons. We describe a muon-producing magnetic-mirror scheme with triton migma that may be more energy efficient than any heretofore proposed. If one could catalyze 200 fusions per muon and employ a uranium blanket that would multiply the neutron energy by a factor of 10, one might produce electricity with an overall plant efficiency (ratio of electric energy produced to nuclear energy released) approaching 30%. The self-colliding arrangement of triton orbits will result in many π-'s being produced near the axis of the magnetic mirror. The pions quickly decay into muons, which are transported into a small (few cm diameter) reactor chamber producing approximately 1 MW/m2 neutron flux on the chamber walls.

The active muon shield in the SHiP experiment

NASA Astrophysics Data System (ADS)

Akmete, A.; Alexandrov, A.; Anokhina, A.; Aoki, S.; Atkin, E.; Azorskiy, N.; Back, J. J.; Bagulya, A.; Baranov, A.; Barker, G. J.; Bay, A.; Bayliss, V.; Bencivenni, G.; Berdnikov, A. Y.; Berdnikov, Y. A.; Bertani, M.; Betancourt, C.; Bezshyiko, I.; Bezshyyko, O.; Bick, D.; Bieschke, S.; Blanco, A.; Boehm, J.; Bogomilov, M.; Bondarenko, K.; Bonivento, W. M.; Boyarsky, A.; Brenner, R.; Breton, D.; Brundler, R.; Bruschi, M.; Büscher, V.; Buonaura, A.; Buontempo, S.; Cadeddu, S.; Calcaterra, A.; Campanelli, M.; Chauveau, J.; Chepurnov, A.; Chernyavsky, M.; Choi, K.-Y.; Chumakov, A.; Ciambrone, P.; Dallavalle, G. M.; D'Ambrosio, N.; D'Appollonio, G.; De Lellis, G.; De Roeck, A.; De Serio, M.; Dedenko, L.; Di Crescenzo, A.; Di Marco, N.; Dib, C.; Dijkstra, H.; Dmitrenko, V.; Domenici, D.; Donskov, S.; Dubreuil, A.; Ebert, J.; Enik, T.; Etenko, A.; Fabbri, F.; Fabbri, L.; Fedin, O.; Fedorova, G.; Felici, G.; Ferro-Luzzi, M.; Fini, R. A.; Fonte, P.; Franco, C.; Fukuda, T.; Galati, G.; Gavrilov, G.; Gerlach, S.; Golinka-Bezshyyko, L.; Golubkov, D.; Golutvin, A.; Gorbunov, D.; Gorbunov, S.; Gorkavenko, V.; Gornushkin, Y.; Gorshenkov, M.; Grachev, V.; Graverini, E.; Grichine, V.; Guler, A. M.; Guz, Yu.; Hagner, C.; Hakobyan, H.; van Herwijnen, E.; Hollnagel, A.; Hosseini, B.; Hushchyn, M.; Iaselli, G.; Iuliano, A.; Jacobsson, R.; Jonker, M.; Kadenko, I.; Kamiscioglu, C.; Kamiscioglu, M.; Khabibullin, M.; Khaustov, G.; Khotyantsev, A.; Kim, S. H.; Kim, V.; Kim, Y. G.; Kitagawa, N.; Ko, J.-W.; Kodama, K.; Kolesnikov, A.; Kolev, D. I.; Kolosov, V.; Komatsu, M.; Konovalova, N.; Korkmaz, M. A.; Korol, I.; Korol'ko, I.; Korzenev, A.; Kovalenko, S.; Krasilnikova, I.; Krivova, K.; Kudenko, Y.; Kurochka, V.; Kuznetsova, E.; Lacker, H. M.; Lai, A.; Lanfranchi, G.; Lantwin, O.; Lauria, A.; Lebbolo, H.; Lee, K. Y.; Lévy, J.-M.; Lopes, L.; Lyubovitskij, V.; Maalmi, J.; Magnan, A.; Maleev, V.; Malinin, A.; Mefodev, A.; Mermod, P.; Mikado, S.; Mikhaylov, Yu.; Milstead, D. A.; Mineev, O.; Montanari, A.; Montesi, M. C.; Morishima, K.; Movchan, S.; Naganawa, N.; Nakamura, M.; Nakano, T.; Novikov, A.; Obinyakov, B.; Ogawa, S.; Okateva, N.; Owen, P. H.; Paoloni, A.; Park, B. D.; Paparella, L.; Pastore, A.; Patel, M.; Pereyma, D.; Petrenko, D.; Petridis, K.; Podgrudkov, D.; Poliakov, V.; Polukhina, N.; Prokudin, M.; Prota, A.; Rademakers, A.; Ratnikov, F.; Rawlings, T.; Razeti, M.; Redi, F.; Ricciardi, S.; Roganova, T.; Rogozhnikov, A.; Rokujo, H.; Rosa, G.; Rovelli, T.; Ruchayskiy, O.; Ruf, T.; Samoylenko, V.; Saputi, A.; Sato, O.; Savchenko, E. S.; Schmidt-Parzefall, W.; Serra, N.; Shakin, A.; Shaposhnikov, M.; Shatalov, P.; Shchedrina, T.; Shchutska, L.; Shevchenko, V.; Shibuya, H.; Shustov, A.; Silverstein, S. B.; Simone, S.; Skorokhvatov, M.; Smirnov, S.; Sohn, J. Y.; Sokolenko, A.; Starkov, N.; Storaci, B.; Strolin, P.; Takahashi, S.; Timiryasov, I.; Tioukov, V.; Tosi, N.; Treille, D.; Tsenov, R.; Ulin, S.; Ustyuzhanin, A.; Uteshev, Z.; Vankova-Kirilova, G.; Vannucci, F.; Venkova, P.; Vilchinski, S.; Villa, M.; Vlasik, K.; Volkov, A.; Voronkov, R.; Wanke, R.; Woo, J.-K.; Wurm, M.; Xella, S.; Yilmaz, D.; Yilmazer, A. U.; Yoon, C. S.; Zaytsev, Yu.

2017-05-01

The SHiP experiment is designed to search for very weakly interacting particles beyond the Standard Model which are produced in a 400 GeV/c proton beam dump at the CERN SPS. An essential task for the experiment is to keep the Standard Model background level to less than 0.1 event after 2× 1020 protons on target. In the beam dump, around 1011 muons will be produced per second. The muon rate in the spectrometer has to be reduced by at least four orders of magnitude to avoid muon-induced combinatorial background. A novel active muon shield is used to magnetically deflect the muons out of the acceptance of the spectrometer. This paper describes the basic principle of such a shield, its optimization and its performance.

Muon production height studies with the air shower experiment KASCADE-Grande

NASA Astrophysics Data System (ADS)

Apel, W. D.; Arteaga, J. C.; Bekk, K.; Bertaina, M.; Blümer, J.; Bozdog, H.; Brancus, I. M.; Buchholz, P.; Büttner, C.; Cantoni, E.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; de Souza, V.; di Pierro, F.; Doll, P.; Engel, R.; Engler, J.; Finger, M.; Fuhrmann, D.; Ghia, P. L.; Gils, H. J.; Glasstetter, R.; Grupen, C.; Haungs, A.; Heck, D.; Hörandel, J. R.; Huege, T.; Isar, P. G.; Kampert, K.-H.; Kang, D.; Kickelbick, D.; Klages, H. O.; Link, K.; Ludwig, M.; Łuczak, P.; Mathes, H. J.; Mayer, H. J.; Melissas, M.; Milke, J.; Mitrica, B.; Morello, C.; Navarra, G.; Nehls, S.; Obenland, R.; Oehlschläger, J.; Ostapchenko, S.; Over, S.; Palmieri, N.; Petcu, M.; Pierog, T.; Rebel, H.; Roth, M.; Schatz, G.; Schieler, H.; Schröder, F.; Sima, O.; Toma, G.; Trinchero, G. C.; Ulrich, H.; Weindl, A.; Wochele, J.; Wommer, M.; Zabierowski, J.

2011-01-01

A large area (128 m2) muon tracking detector, located within the KASCADE experiment, has been built with the aim to identify muons (Eμ > 0.8 GeV) and their angular correlation in extensive air showers by track measurements under 18 r.l. shielding. Orientation of the muon track with respect to the shower axis is expressed in terms of the radial and tangential angles, which are the basic tools for all muon investigations with the tracking detector. By means of triangulation the muon production height is determined. Distributions of measured production heights are compared to CORSIKA shower simulations. Analysis of these heights reveals a transition from light to heavy cosmic ray primary particles with increasing shower energy in the energy region of the 'Knee' of the cosmic ray spectrum

Stopped cosmic-ray muons in plastic scintillators on the surface and at the depth of 25 m.w.e

NASA Astrophysics Data System (ADS)

Maletić, D.; Dragić, A.; Banjanac, R.; Joković, D.; Veselinović, N.; Udovičić, V.; Savić, M.; Puzović, J.; Aničin, I.

2013-02-01

Cosmic ray muons stopped in 5 cm thick plastic scintillators at surface and at depth of 25 m.w.e are studied. Apart from the stopped muon rate we measured the spectrum of muon decay electrons and the degree of polarization of stopped muons. Preliminary results for the Michel parameter yield values lower than the currently accepted one, while the asymmetry between the numbers of decay positrons registered in the upper and lower hemispheres appear higher than expected on the basis of numerous earlier studies.

Cyclic creep and fatigue of TD-NiCr (thoria-dispersion-strengthened nickel-chromium), TD-Ni, and NiCr sheet at 1200 C

NASA Technical Reports Server (NTRS)

Hirschberg, M. H.; Spera, D. A.; Klima, S. J.

1972-01-01

The resistance of thin TD-NiCr sheet to cyclic deformation was compared with that of TD-Ni and a conventional nickel-chromium alloy. Strains were determined by a calibration technique which combines room-temperature strain gage and deflection measurements with high-temperature deflection measurements. Analyses of the cyclic tests using measured tensile and creep-rupture data indicated that the TD-NiCr and NiCr alloy specimens failed by a cyclic creep mechanism. The TD-Ni specimens, on the other hand, failed by a fatigue mechanism.

Ca K-Edge XAS as a Probe of Calcium Centers in Complex Systems

DOE PAGES

Martin-Diaconescu, Vlad; Gennari, Marcello; Gerey, Bertrand; ...

2014-12-10

Calcium K-edge pre-edges coupled with TD-DFT theoretical calculation of spectra provide a powerful approach for the characterization of complex calcium centers in inorganic and bioinorganic chemistry. Herein, Ca K-edge X-ray absorption spectroscopy (XAS) is developed as a means to characterize the local environment of calcium centers. The spectra for six, seven, and eight coordinate inorganic and molecular calcium complexes were analyzed and determined to be primarily influenced by the coordination environment and site symmetry at the calcium center. The experimental results are closely correlated to time-dependent density functional theory (TD-DFT) calculations of the XAS spectra. The applicability of this methodologymore » to complex systems was investigated using structural mimics of the oxygen-evolving complex (OEC) of PSII. It was found that Ca K-edge XAS is a sensitive probe for structural changes occurring in the cubane heterometallic cluster due to Mn oxidation. Future applications to the OEC are discussed.« less

Anharmonicity in Amino Acids

NASA Astrophysics Data System (ADS)

Martinho, Herculano; Lima, Thamires; Ishikawa, Mariana

2012-02-01

Two special dynamical transitions of universal character have been recently observed in macromolecules (lysozyme, myoglobin, bacteriorhodopsin, DNA, and RNA) at T^*˜100 - 150 K and TD˜180 - 220 K. The underlying mechanisms governing these transitions have been subject of debate. In the present work it is reported a survey on the temperature dependence of structural, vibrational and thermodynamical properties of a nearly anhydrous amino acid (orthorhombic polymorph of the amino acids L-cysteine and L-proline at a hydration level of 3.5%). The temperature dependence of X-Ray diffraction, Raman spectroscopy, and specific heat were considered. The data were analyzed considering amino acid-amino acid, amino acid-water, and water-water phonon-phonon interactions, and molecular rotors activation. Our results indicated that the two referred temperatures define the triggering of very simple and specific events that govern all the interactions of the biomolecule: activation of CH2 rigid rotors (TTD).

Copper-tolerant yeasts: Raman spectroscopy in determination of bioaccumulation mechanism.

PubMed

Radić, Danka S; Pavlović, Vera P; Lazović, Milana M; Jovičić-Petrović, Jelena P; Karličić, Vera M; Lalević, Blažo T; Raičević, Vera B

2017-09-01

Modern, efficient, and cost-effective approach to remediation of heavy metal-contaminated soil is based on the application of microorganisms. In this paper, four isolates from agricultural and urban contaminated soil showed abundant growth in the presence of copper(II) sulfate pentahydrate (CuSO 4 ·5H 2 O) up to 2 mM. Selected yeasts were identified by molecular methods as Candida tropicalis (three isolates) and Schwanniomyces occidentalis (one isolate). C. tropicalis (4TD1101S) showed the highest percentage of bioaccumulation capabilities (94.37%), determined by the inductively coupled plasma optical emission spectrometry (ICP-OES). The Raman spectra of C. tropicalis (4TD1101S) analyzed in a medium with the addition of 2 mM CuSO 4 ·5H 2 O showed certain increase in metallothionein production, which represents a specific response of the yeast species to the stress conditions. These results indicate that soil yeasts represent a potential for practical application in the bioremediation of contaminated environments.

Simulation of Near-Edge X-ray Absorption Fine Structure with Time-Dependent Equation-of-Motion Coupled-Cluster Theory.

PubMed

Nascimento, Daniel R; DePrince, A Eugene

2017-07-06

An explicitly time-dependent (TD) approach to equation-of-motion (EOM) coupled-cluster theory with single and double excitations (CCSD) is implemented for simulating near-edge X-ray absorption fine structure in molecular systems. The TD-EOM-CCSD absorption line shape function is given by the Fourier transform of the CCSD dipole autocorrelation function. We represent this transform by its Padé approximant, which provides converged spectra in much shorter simulation times than are required by the Fourier form. The result is a powerful framework for the blackbox simulation of broadband absorption spectra. K-edge X-ray absorption spectra for carbon, nitrogen, and oxygen in several small molecules are obtained from the real part of the absorption line shape function and are compared with experiment. The computed and experimentally obtained spectra are in good agreement; the mean unsigned error in the predicted peak positions is only 1.2 eV. We also explore the spectral signatures of protonation in these molecules.

Statistical study of muons counts rates in differents directions, observed at the Brazilian Southern Space Observatory

NASA Astrophysics Data System (ADS)

Grams, Guilherme; Schuch, Nelson Jorge; Braga, Carlos Roberto; Purushottam Kane, Rajaram; Echer, Ezequiel; Ronan Coelho Stekel, Tardelli

Cosmic ray are charged particles, at the most time protons, that reach the earth's magne-tosphere from interplanetary space with velocities greater than the solar wind. When these impinge the atmosphere, they interact with atmosphere constituents and decay into sub-particles forming an atmospheric shower. The muons are the sub-particles which normally maintain the originated direction of the primary cosmic ray. A multi-directional muon detec-tor (MMD) was installed in 2001 and upgraded in 2005, through an international cooperation between Brazil, Japan and USA, and operated since then at the Southern Space Observatory -SSO/CRS/CCR/INPE -MCT, (29,4° S, 53,8° W, 480m a.s.l.), São Martinho da Serra, RS, a Brazil. The main objetive of this work is to present a statistical analysis of the intensity of muons, with energy between 50 and 170 GeV, in differents directions, measured by the SSO's multi-directional muon detector. The analysis was performed with data from 2006 and 2007 collected by the SSO's MMD. The MMD consists of two layers of 4x7 detectors with a total observation area of 28 m2 . The counting of muons in each directional channel is made by a coincidence of pulses pair, one from a detector in the upper layer and the other from a detector in the lower layer. The SSO's MMD is equipped with 119 directional channels for muon count rate measurement and is capable of detecting muons incident with zenithal angle between 0° and 75,53° . A statistical analysis was made with the MMD muon count rate for all the di-rectional channels. The average and the standard deviation of the muon count rate in each directional component were calculated. The results show lower cont rate for the channels with larger zenith, and higher cont rate with smaller zenith, as expected from the production and propagation of muons in the atmosphere. It is also possible to identify the Stormer cone. The SSO's MMD is also a detector component of the Global Muon Detector Network (GMDN), which has been developed in an international collaboration lead by Shinshu University, Japan.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonzales-Vigil, Eliana; Bianchetti, Christopher M.; Phillips, Jr., George N.

Gene duplication is a major source of plant chemical diversity that mediates plant-herbivore interactions. There is little direct evidence, however, that novel chemical traits arising from gene duplication reduce herbivory. Higher plants use threonine deaminase (TD) to catalyze the dehydration of threonine (Thr) to {alpha}-ketobutyrate and ammonia as the committed step in the biosynthesis of isoleucine (Ile). Cultivated tomato and related Solanum species contain a duplicated TD paralog (TD2) that is coexpressed with a suite of genes involved in herbivore resistance. Analysis of TD2-deficient tomato lines showed that TD2 has a defensive function related to Thr catabolism in the gutmore » of lepidopteran herbivores. During herbivory, the regulatory domain of TD2 is removed by proteolysis to generate a truncated protein (pTD2) that efficiently degrades Thr without being inhibited by Ile. We show that this proteolytic activation step occurs in the gut of lepidopteran but not coleopteran herbivores, and is catalyzed by a chymotrypsin-like protease of insect origin. Analysis of purified recombinant enzymes showed that TD2 is remarkably more resistant to proteolysis and high temperature than the ancestral TD1 isoform. The crystal structure of pTD2 provided evidence that electrostatic interactions constitute a stabilizing feature associated with adaptation of TD2 to the extreme environment of the lepidopteran gut. These findings demonstrate a role for gene duplication in the evolution of a plant defense that targets and co-opts herbivore digestive physiology.« less

Joint-inversion of gravity data and cosmic ray muon flux to detect shallow subsurface density structure beneath volcanoes: Testing the method at a well-characterized site

NASA Astrophysics Data System (ADS)

Roy, M.; Lewis, M.; George, N. K.; Johnson, A.; Dichter, M.; Rowe, C. A.; Guardincerri, E.

2016-12-01

The joint-inversion of gravity data and cosmic ray muon flux measurements has been utilized by a number of groups to image subsurface density structure in a variety of settings, including volcanic edifices. Cosmic ray muons are variably-attenuated depending upon the density structure of the material they traverse, so measuring muon flux through a region of interest provides an independent constraint on the density structure. Previous theoretical studies have argued that the primary advantage of combining gravity and muon data is enhanced resolution in regions not sampled by crossing muon trajectories, e.g. in sensing deeper structure or structure adjacent to the region sampled by muons. We test these ideas by investigating the ability of gravity data alone and the joint-inversion of gravity and muon flux to image subsurface density structure, including voids, in a well-characterized field location. Our study area is a tunnel vault located at the Los Alamos National Laboratory within Quaternary ash-flow tuffs on the Pajarito Plateau, flanking the Jemez Volcano in New Mexico. The regional geology of the area is well-characterized (with density measurements in nearby wells) and the geometry of the tunnel and the surrounding terrain is known. Gravity measurements were made using a Lacoste and Romberg D meter and the muon detector has a conical acceptance region of 45 degrees from the vertical and track resolution of several milliradians. We obtain individual and joint resolution kernels for gravity and muon flux specific to our experimental design and plan to combine measurements of gravity and muon flux both within and above the tunnel to infer density structure. We plan to compare our inferred density structure against the expected densities from the known regional hydro-geologic framework.

[Tardive dyskinesia induced by classical antipsychotic drugs: a Tunisian sample of schizophrenics].

PubMed

Sejil, I; Oumaya, A; Bouguerra, C; Mehdi, F; Bellaaj, R; Gallali, S

2013-05-01

The term tardive dyskinesia (TD) is used to describe abnormal movement, primarily associated with typical antipsychotic drugs, which are used to treat psychotic states such as schizophrenia. TD is characterised by repetitive involuntary purposeless muscle contractions that force parts of the body into abnormal, and sometimes painful, movements or postures. These movements are involuntary and are difficult or impossible to control. TD usually begins with the face, mouth, lips and tongue, and includes grimacing, lip-smacking, tongue movements and rapid blinking. It may also involve the rest of the body and produce involuntary gestures, tics and writhing movements. TD is severe physically and socially disabling. Schizophrenia is thought to be the psychiatric diagnosis the most frequently associated with TD. The purpose of this article is to study the characteristics of TD in a Tunisian sample of 157 schizophrenics. A variety of demographic and clinical information was obtained by a questionnaire. Diagnoses of schizophrenia and TD were determined by using DSM-VI-R criteria. TD was assessed using the Abnormal Involuntary Movements Scale (AIMS). The average age in this sample was 37 ± 6 years. The intermediate duration of evolution of the disease was 8 ± 3 years with a medium full number of hospitalizations of 4 ± 3. We found 58% of the paranoid sub-type. The intermediate duration of exposure to classical neuroleptics was 7 ± 3 years. The average of daily neuroleptic amount was 572.9 ± 145.3 equivalent milligrams of chlorpromazine. Extended release antipsychotics were used in 64.3% of cases, with fluphenazine deaconate in 90% and haloperidol deaconate in 10%. Anticholinergics were used by 74.5% of patients, with use of biperidene in 96% of cases. Therapeutic observance was good in 89.2% of patients. The prevalence of TD was an estimated 35%. The average of AIMS score was 17 ± 9, with a minimal score of 3 and a maximal one of 34. The distribution of patients according to severity found a prevalence of 52.7% of subjects with moderate TD, 38.2% with light TD and 9.1% with severe TD. The distribution of patients according to type, according to DSM-IV criteria, found 78.4% of cases with choreiform TD, 17.5% of cases with athetosic TD and 4.1% of cases with rhythmic TD. The intermediate duration of evolution of TD was estimated at 18 ± 6 months with a minimal duration of 3 months and a maximum of 72 months. The distribution of subjects according to duration of evolution of TD found that approximately three quarter of patients presented with TD that had evolved since one duration, lower or equal to one year. The average age of patients at the moment of installation of TD was estimated at 36 ± 6 years with 22 years as a minimal and 46 years as a maximal age. Among them, 81.8% of patients were aged over 30 at the time of the installation of TD. The majority of patients with schizophrenia in Tunisia are still treated with typical antipsychotic drugs, and that's why the prevalence of TD remains relatively high. Copyright © 2012 L’Encéphale, Paris. Published by Elsevier Masson SAS. All rights reserved.

A detailed evaluation of TomoDirect 3DCRT planning for whole-breast radiation therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fields, Emma C.; Rabinovitch, Rachel; Ryan, Nicole E.

2013-01-01

The goal of this work was to develop planning strategies for whole-breast radiotherapy (WBRT) using TomoDirect three-dimensional conformal radiation therapy (TD-3DCRT) and to compare TD-3DCRT with conventional 3DCRT and TD intensity-modulated radiation therapy (TD-IMRT) to evaluate differences in WBRT plan quality. Computed tomography (CT) images of 10 women were used to generate 150 WBRT plans, varying in target structures, field width (FW), pitch, and number of beams. Effects on target and external maximum doses (EMD), organ-at-risk (OAR) doses, and treatment time were assessed for each parameter to establish an optimal planning technique. Using this technique, TD-3DCRT plans were generated andmore » compared with TD-IMRT and standard 3DCRT plans. FW 5.0 cm with pitch = 0.250 cm significantly decreased EMD without increasing lung V20 Gy. Increasing number of beams from 2 to 6 and using an additional breast planning structure decreased EMD though increased lung V20 Gy. Changes in pitch had minimal effect on plan metrics. TD-3DCRT plans were subsequently generated using FW 5.0 cm, pitch = 0.250 cm, and 2 beams, with additional beams or planning structures added to decrease EMD when necessary. TD-3DCRT and TD-IMRT significantly decreased target maximum dose compared to standard 3DCRT. FW 5.0 cm with 2 to 6 beams or novel planning structures or both allow for TD-3DCRT WBRT plans with excellent target coverage and OAR doses. TD-3DCRT plans are comparable to plans generated using TD-IMRT and provide an alternative to conventional 3DCRT for WBRT.« less

Characterization of the Interior Density Structure of Near Earth Objects with Muons

NASA Astrophysics Data System (ADS)

Prettyman, T. H.; Sykes, M. V.; Miller, R. S.; Pinsky, L. S.; Empl, A.; Nolan, M. C.; Koontz, S. L.; Lawrence, D. J.; Mittlefehldt, D. W.; Reddell, B. D.

2015-12-01

Near Earth Objects (NEOs) are a diverse population of short-lived asteroids originating from the main belt and Jupiter family comets. Some have orbits that are easy to access from Earth, making them attractive as targets for science and exploration as well as a potential resource. Some pose a potential impact threat. NEOs have undergone extensive collisional processing, fragmenting and re-accreting to form rubble piles, which may be compositionally heterogeneous (e.g., like 2008 TC3, the precursor to Almahata Sitta). At present, little is known about their interior structure or how these objects are held together. The wide range of inferred NEO macroporosities hint at complex interiors. Information about their density structure would aid in understanding their formation and collisional histories, the risks they pose to human interactions with their surfaces, the constraints on industrial processing of NEO resources, and the selection of hazard mitigation strategies (e.g., kinetic impactor vs nuclear burst). Several methods have been proposed to characterize asteroid interiors, including radar imaging, seismic tomography, and muon imaging (muon radiography and tomography). Of these, only muon imaging has the potential to determine interior density structure, including the relative density of constituent fragments. Muons are produced by galactic cosmic ray showers within the top meter of asteroid surfaces. High-energy muons can traverse large distances through rock with little deflection. Muons transmitted through an Itokawa-sized asteroid can be imaged using a compact hodoscope placed on or near the surface. Challenges include background rejection and correction for variations in muon production with surface density. The former is being addressed by hodoscope design. Surface density variations can be determined via radar or muon limb imaging. The performance of muon imaging is evaluated for prospective NEO interior-mapping missions.

Development and validation of the Overlap Muon Track Finder for the CMS experiment

NASA Astrophysics Data System (ADS)

Dobosz, J.; Mietki, P.; Zawistowski, K.; Żarnecki, G.

2016-09-01

Present article is a description of the authors contribution in upgrade and analysis of performance of the Level-1 Muon Trigger of the CMS experiment. The authors are students of University of Warsaw and Gdansk University of Technology. They are collaborating with the CMS Warsaw Group. This article summarises students' work presented during the Students session during the Workshop XXXVIII-th IEEE-SPIE Joint Symposium Wilga 2016. In the first section the CMS experiment is briefly described and the importance of the trigger system is explained. There is also shown basic difference between old muon trigger strategy and the upgraded one. The second section is devoted to Overlap Muon Track Finder (OMTF). This is one of the crucial components of the Level-1 Muon Trigger. The algorithm of OMTF is described. In the third section there is discussed one of the event selection aspects - cut on the muon transverse momentum pT . Sometimes physical muon with pT bigger than a certain threshold is unnecessarily cut and physical muon with lower pT survives. To improve pT selection modified algorithm was proposed and its performance was studied. One of the features of the OMTF is that one physical muon often results in several muon candidates. The Ghost-Buster algorithm is designed to eliminate surplus candidates. In the fourth section this algorithm and its performance on different data samples are discussed. In the fifth section Local Data Acquisition System (Local DAQ) is briefly described. It supports initial system commissioning. The test done with OMTF Local DAQ are described. In the sixth section there is described development of web application used for the control and monitoring of CMS electronics. The application provides access to graphical user interface for manual control and the connection to the CMS hierarchical Run Control.

Where to place the positive muon in the Periodic Table?

PubMed

Goli, Mohammad; Shahbazian, Shant

2015-03-14

In a recent study it was suggested that the positively charged muon is capable of forming its own "atoms in molecules" (AIM) in the muonic hydrogen-like molecules, composed of two electrons, a muon and one of the hydrogen's isotopes, thus deserves to be placed in the Periodic Table [Phys. Chem. Chem. Phys., 2014, 16, 6602]. In the present report, the capacity of the positively charged muon in forming its own AIM is considered in a large set of molecules replacing muons with all protons in the hydrides of the second and third rows of the Periodic Table. Accordingly, in a comparative study the wavefunctions of both sets of hydrides and their muonic congeners are first derived beyond the Born-Oppenheimer (BO) paradigm, assuming protons and muons as quantum waves instead of clamped particles. Then, the non-BO wavefunctions are used to derive the AIM structures of both hydrides and muonic congeners within the context of the multi-component quantum theory of atoms in molecules. The results of the analysis demonstrate that muons are generally capable of forming their own atomic basins and the properties of these basins are not fundamentally different from those AIM containing protons. Particularly, the bonding modes in the muonic species seem to be qualitatively similar to their congener hydrides and no new bonding model is required to describe the bonding of muons to a diverse set of neighboring atoms. All in all, the positively charged muon is similar to a proton from the structural and bonding viewpoint and deserves to be placed in the same box of hydrogen in the Periodic Table. This conclusion is in line with a large body of studies on the chemical kinetics of the muonic molecules portraying the positively charged muon as a lighter isotope of hydrogen.

Density Imaging of Puy de Dôme Volcano with Atmospheric Muons in French Massif Central as a Case Study for Volcano Muography

NASA Astrophysics Data System (ADS)

Carloganu, Cristina; Le Ménédeu, Eve

2016-04-01

High energy atmospheric muons have high penetration power that renders them appropriate for geophysical studies. Provided the topography is known, the measurement of the muon flux transmittance leads in an univoque way to 2D density mapping (so called radiographic images) revealing spatial and possibly also temporal variations. Obviously, several radiographic images could be combined into 3D tomographies, though the inverse 3D problem is generally ill-posed. The muography has a high potential for imaging remotely (from kilometers away) and with high resolution (better than 100 mrad2) volcanoes. The experimental and methodological task is however not straightforward since atmospheric muons have non trivial spectra that fall rapidly with muon energy. As shown in [Ambrosino 2015] successfully imaging km-scale volcanoes remotely requires state-of-the art, high-resolution and large-scale muon detectors. This contribution presents the geophysical motivation for muon imaging as well as the first quantitative density radiographies of Puy de Dôme volcano obtained by the TOMUVOL collaboration using a highly segmented muon telescope based on Glass Resistive Plate Chambers. In parallel with the muographic studies, the volcano was imaged through standard geophysical methods (gravimetry, electrical resistivity) [Portal 2013] allowing in depth comparisons of the different methods. Ambrosino, F., et al. (2015), Joint measurement of the atmospheric muon flux through the Puy de Dôme volcano with plastic scintillators and Resistive Plate Chambers detectors, J. Geophys. Res. Solid Earth, 120, doi:10.1002/2015JB011969 A. Portal et al (2013) , "Inner structure of the Puy de Dme volcano: cross-comparison of geophysical models (ERT, gravimetry, muon imaging)", Geosci. Instrum. Method. Data Syst., 2, 47-54, 2013

Characterizing the dynamics of hydrothermal systems with muon tomography: the case of La Soufrière de Guadeloupe

NASA Astrophysics Data System (ADS)

Rosas-Carbajal, M.; Marteau, J.; Tramontini, M.; de Bremond d Ars, J.; Le Gonidec, Y.; Carlus, B.; Ianigro, J. C.; Deroussi, S.; Komorowski, J. C.; Gibert, D.

2017-12-01

Muon imaging has recently emerged as a powerful method to complement standard geophysical tools in the study of the Earth's subsurface. Muon measurements yield a radiography of the average density along the muon path, allowing to image large volumes of a geological body from a single observation point. Long-term measurements allow to infer density changes by tracking the associated variations in the muon flux. In the context of volcanic hydrothermal systems, this approach helps to characterize zones of steam formation, condensation, water infiltration and storage. We present results of imaging the La Soufrière de Guadeloupe dome and shallow active hydrothermal system with a network of muon telescopes viewing the dome from different positions around its base. First, we jointly invert the muon radiographies of the different telescopes with gravity data to obtain a three-dimensional density model of the lava dome. The model reveals an extended low density region where the hydrothermal system is most active. We then analyze the dynamics of the hydrothermal system from long-term measurements (more than 2 years of almost non-interrupted acquisition) with 5 simultaneous muon telescopes. We identify a periodicity of 1-2 months in the density increase/decrease in the most active zones below fumaroles and acid boiling ponds. Our simultaneous-muon telescope strategy provides constraints on the three-dimensional location of the density changes and an improved quantification of the associated mass flux changes. We compare the temporal trends acquired by the different muon telescopes to time-series of rainfall on the summit recharge area as well as to ground temperature profiles in the vicinity of thermal anomalies and high-discharge summit fumaroles.

Electronic states of Myricetin. UV-Vis polarization spectroscopy and quantum chemical calculations

NASA Astrophysics Data System (ADS)

Vojta, Danijela; Karlsen, Eva Marie; Spanget-Larsen, Jens

2017-02-01

Myricetin (3,3‧,4‧,5,5‧,7‧-hexahydroxyflavone) was investigated by linear dichroism spectroscopy on molecular samples partially aligned in stretched poly(vinyl alcohol) (PVA). At least five electronic transitions in the range 40,000-20,000 cm- 1 were characterized with respect to their wavenumbers, relative intensities, and transition moment directions. The observed bands were assigned to electronic transitions predicted with TD-B3LYP/6-31 + G(d,p).

Development of Advanced Ill-Nitride Materials

DTIC Science & Technology

2008-09-24

have continued to work on InN and related materials. During the last year, we have completed many of our basic materials studies and extended our...conductivity of InN films The origin of bulk electrons in In-face InN has been studied by considering the effects of both unintentionally incorporated... studied in In- and N-face InN films grown on GaN by plasma-assisted molecular beam epitaxy. The TD densities were determined by non-destructive x-ray

Benchmarking the Bethe–Salpeter Formalism on a Standard Organic Molecular Set

PubMed Central

2015-01-01

We perform benchmark calculations of the Bethe–Salpeter vertical excitation energies for the set of 28 molecules constituting the well-known Thiel’s set, complemented by a series of small molecules representative of the dye chemistry field. We show that Bethe–Salpeter calculations based on a molecular orbital energy spectrum obtained with non-self-consistent G0W0 calculations starting from semilocal DFT functionals dramatically underestimate the transition energies. Starting from the popular PBE0 hybrid functional significantly improves the results even though this leads to an average −0.59 eV redshift compared to reference calculations for Thiel’s set. It is shown, however, that a simple self-consistent scheme at the GW level, with an update of the quasiparticle energies, not only leads to a much better agreement with reference values, but also significantly reduces the impact of the starting DFT functional. On average, the Bethe–Salpeter scheme based on self-consistent GW calculations comes close to the best time-dependent DFT calculations with the PBE0 functional with a 0.98 correlation coefficient and a 0.18 (0.25) eV mean absolute deviation compared to TD-PBE0 (theoretical best estimates) with a tendency to be red-shifted. We also observe that TD-DFT and the standard adiabatic Bethe–Salpeter implementation may differ significantly for states implying a large multiple excitation character. PMID:26207104

Epoxy resin synthesis using low molecular weight lignin separated from various lignocellulosic materials.

PubMed

Asada, Chikako; Basnet, Sunita; Otsuka, Masaya; Sasaki, Chizuru; Nakamura, Yoshitoshi

2015-03-01

A low molecular weight lignin from various lignocellulosic materials was used for the synthesis of bio-based epoxy resins. The lignin extracted with methanol from steam-exploded samples (steaming time of 5 min at steam pressure of 3.5 MPa) from different biomasses (i.e., cedar, eucalyptus, and bamboo) were functionalized by the reaction with epichlorohydrin, catalyzed by a water-soluble phase transfer catalyst tetramethylammonium chloride, which was further reacted with 30 wt% aqueous NaOH for ring closure using methyl ethyl ketone as a solvent. The glycidylated products of the lignin with good yields were cured to epoxy polymer networks with bio-based curing agents i.e., lignin itself and a commercial curing agent TD2131. Relatively good thermal properties of the bio-based epoxy network was obtained and thermal decomposition temperature at 5% weight loss (Td5) of cedar-derived epoxy resin was higher than that derived from eucalyptus and bamboo. The bio-based resin satisfies the stability requirement of epoxy resin applicable for electric circuit boards. The methanol-insoluble residues were enzymatically hydrolyzed to produce glucose. This study indicated that the biomass-derived methanol-soluble lignin may be a promising candidate to be used as a substitute for petroleum-based epoxy resin derived from bisphenol A, while insoluble residues may be processed to give a bioethanol precursor i.e., glucose. Copyright © 2015 Elsevier B.V. All rights reserved.

DFT/TD-DFT study of solvent effect as well the substituents influence on the different features of TPP derivatives for PDT application

NASA Astrophysics Data System (ADS)

Dulski, Mateusz; Kempa, Marta; Kozub, Patrycja; Wójcik, Justyna; Rojkiewicz, Marcin; Kuś, Piotr; Szurko, Agnieszka; Ratuszna, Alicja; Wrzalik, Roman

2013-03-01

Spectral characteristics study of meso-tetraphenylporphyrin derivatives (TPP1 and TPP2) used as photosensitizers for utilization in photodynamic therapy (PDT) has been performed by density functional theory (DFT) and time dependent DFT (TD-DFT) calculations at B3LYP/6-31G(d) level of theory using PCM solvation model. The geometrical parameters of porphyrins have been studied for ground and excited-state geometry to deduce the influence of various substituents as well as solvent effect on the deformation of porphyrin ring. Two theoretical approaches - linear response (LR) and external iteration (EI) - have been performed to replicate absorption and fluorescence emission spectra. Experimental and theoretical investigations have shown that EI method reproduces the absorption energies very well for both singlet-singlet and triplet-triplet transitions, whereas the LR approach is more coherent with experimental fluorescence emission spectra. Spectral features and HOMO-LUMO band gap analysis have shown that TPP1 can be more useful in PDT. Calculations have revealed that two the highest occupied and two the lowest unoccupied molecular orbitals are responsible for the Q-band absorption and are located mainly on the porphyrin ring. In order to verify the substituent effect on the activity of tested compounds in their ground and excited states, the molecular electrostatic potential surfaces have been analyzed.

Combined spectroscopic, DFT, TD-DFT and MD study of newly synthesized thiourea derivative

NASA Astrophysics Data System (ADS)

Menon, Vidya V.; Sheena Mary, Y.; Shyma Mary, Y.; Panicker, C. Yohannan; Bielenica, Anna; Armaković, Stevan; Armaković, Sanja J.; Van Alsenoy, Christian

2018-03-01

A novel thiourea derivative, 1-(3-bromophenyl)-3-[3-(trifluoromethyl)phenyl]thiourea (ANF-22) is synthesized and characterized by FTIR, FT-Raman and NMR spectroscopy experimentally and theoretically. A detailed conformational analysis of the title molecule has been conducted in order to locate the lowest energy geometry, which was further subjected to the detailed investigation of spectroscopic, reactive, degradation and docking studies by density functional theory (DFT) calculations and molecular dynamics (MD) simulations. Time dependent DFT (TD-DFT) calculations have been used also in order to simulate UV spectra and investigate charge transfer within molecule. Natural bond orbital analysis has been performed analyzing the charge delocalization and using HOMO and LUMO energies the electronic properties are analyzed. Molecular electrostatic potential map is used for the quantitative measurement of active sites in the molecule. In order to determine the locations possibly prone to electrophilic attacks we have calculated average local ionization energies and mapped them to the electron density surface. Further insight into the local reactivity properties have been obtained by calculation of Fukui functions, also mapped to the electron density surface. Possible degradation properties by the autoxidation mechanism have been assessed by calculations of bond dissociation energies for hydrogen abstraction. Atoms of title molecule with significant interactions with water molecules have been determined by calculations of radial distribution functions. The title compound can be a lead compound for developing new analgesic drug.

Developmental rates of immatures of three Chrysomya species (Diptera: Calliphoridae) under the effect of methylphenidate hydrochloride, phenobarbital, and methylphenidate hydrochloride associated with phenobarbital.

PubMed

Rezende, Fábio; Alonso, Marcela A; Souza, Carina M; Thyssen, Patrícia J; Linhares, Arício X

2014-05-01

Entomotoxicology is focused on obtaining data on necrophagous entomofauna, for criminal investigations purposes. This study aimed to evaluate the effect of different concentrations of methylphenidate hydrochloride, phenobarbital, and their association on the developmental rate, larval and pupal survivorship, and the interval of emergence of adults of Chrysomya albiceps (Wiedemann), Chrysomya megacephala (Fabricius), and Chrysomya putoria (Wiedemann) (Diptera: Calliphoridae). Considering the therapeutic dose (TD) of methylphenidate hydrochloride (0.29 mg/Kg), the concentrations tested were 10× TD, 50× TD, and 100× TD. For phenobarbital, the concentrations used were 1× TD (=150 mg/Kg), 3.3× TD, and 6.7× TD. For the association of the drugs, the combinations used were 10× TD-methylphenidate hydrochloride plus 1× TD-phenobarbital, 50× TD-methylphenidate hydrochloride plus 3.3× TD-phenobarbital, and 100× TD-methylphenidate hydrochloride plus 6.7× TD-phenobarbital. The control group, without addition of drug, was maintained under the same conditions of temperature (25 ± 1 °C), humidity (70 ± 10%), and photoperiod (12 h). Specimens of each group were weighed every 12 h until pupariation. The developmental rate of the three Chrysomya species immatures was monitored. For C. albiceps the developmental time was delayed in 24 h for methylphenidate hydrochloride group and in 12 h for the phenobarbital and the drugs association groups. The effect was observed only at specific ages for C. megacephala, without altering the developmental time. For C. putoria, the developmental time was delayed in 12 h for methylphenidate hydrochloride group and in 24 h for the phenobarbital and the drugs association groups. The emergence interval was similar among all experimental groups, but larval and pupal viabilities were affected in different ways.

The Probability of Muon Sticking and X-Ray Yields in the Muon Catalyzed Fusion Cycle in a Deuterium and Tritium Mixture

NASA Astrophysics Data System (ADS)

Pahlavani, M. R.; Motevalli, S. M.

2008-03-01

The muon catalyzed fusion cycle in mixtures of deuterium and tritium is of particular interest due to the observation of high fusion yields. In the D-T mixture, the most serious limitation to the efficiency of the fusion chain is the probability of muon sticking to the alpha -particle produced in the nuclear reaction. An accurate kinetic treatment has been applied to the muonic helium atoms formed by a muon sticking to the alpha -particles. In this work accurate rates for collisions of alpha mu + ions with hydrogen atoms have been used for calculation of muon stripping probability and the intensities of X-ray transitions by solving a set of coupled differential equations numerically. Our calculated results are in good agreement with experimental data available in literature.

IceTop tank response to muons

NASA Astrophysics Data System (ADS)

Demirörs, L.; Beimforde, M.; Eisch, J.; Madsen, J.; Niessen, P.; Spiczak, G.M.; Stoyanov, S.; Tilav, S

The calibration of the surface air shower array of IceCube - IceTop is based on identifying and understanding the muon response of each IceTop tank. Special calibration runs are carried out throughout the year and are supplemented with austral season measurements with tagging telescope for vertical muons. The vertical equivalent muon (VEM) charge value of each tank is determined and monitored by keeping track of its variation with time and temperature. We also study muons that stop and decay in the tank. The energy spectrum of the electrons from muon decay (Michel spectrum) is well known with maximum energy of 53 MeV. This energy is usually deposited inside the tank and can also be used as a calibration tool. We use both these spectra and compare them to a Monte Carlo simulation to gain a better understanding of the tank properties.

Concepts for a Muon Accelerator Front-End

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stratakis, Diktys; Berg, Scott; Neuffer, David

2017-03-16

We present a muon capture front-end scheme for muon based applications. In this Front-End design, a proton bunch strikes a target and creates secondary pions that drift into a capture channel, decaying into muons. A series of rf cavities forms the resulting muon beams into a series of bunches of differerent energies, aligns the bunches to equal central energies, and initiates ionization cooling. We also discuss the design of a chicane system for the removal of unwanted secondary particles from the muon capture region and thus reduce activation of the machine. With the aid of numerical simulations we evaluate themore » performance of this Front-End scheme as well as study its sensitivity against key parameters such as the type of target, the number of rf cavities and the gas pressure of the channel.« less

Improvement of density models of geological structures by fusion of gravity data and cosmic muon radiographies

NASA Astrophysics Data System (ADS)

Jourde, K.; Gibert, D.; Marteau, J.

2015-04-01

This paper examines how the resolution of small-scale geological density models is improved through the fusion of information provided by gravity measurements and density muon radiographies. Muon radiography aims at determining the density of geological bodies by measuring their screening effect on the natural flux of cosmic muons. Muon radiography essentially works like medical X-ray scan and integrates density information along elongated narrow conical volumes. Gravity measurements are linked to density by a 3-D integration encompassing the whole studied domain. We establish the mathematical expressions of these integration formulas - called acquisition kernels - and derive the resolving kernels that are spatial filters relating the true unknown density structure to the density distribution actually recovered from the available data. The resolving kernels approach allows to quantitatively describe the improvement of the resolution of the density models achieved by merging gravity data and muon radiographies. The method developed in this paper may be used to optimally design the geometry of the field measurements to perform in order to obtain a given spatial resolution pattern of the density model to construct. The resolving kernels derived in the joined muon/gravimetry case indicate that gravity data are almost useless to constrain the density structure in regions sampled by more than two muon tomography acquisitions. Interestingly the resolution in deeper regions not sampled by muon tomography is significantly improved by joining the two techniques. The method is illustrated with examples for La Soufrière of Guadeloupe volcano.

Energy spectrum of cascades generated by muons in Baksan underground scintillation telescope

NASA Technical Reports Server (NTRS)

Bakatanov, V. N.; Chudakov, A. E.; Novoseltsev, Y. F.; Novoseltseva, M. V.; Achkasov, V. M.; Semenov, A. M.; Stenkin, Y. V.

1985-01-01

Spectrum of cascades generated by cosmic ray muons underground is presented. The mean zenith angle of the muon arrival is theta=35 deg the depth approx. 1000 hg/sq cm. In cascades energy range 700 GeV the measured spectrum is in agreement with the sea-level integral muon spectrum index gamma=3.0. Some decrease of this exponent has been found in the range 4000 Gev.

M$^3$: A New Muon Missing Momentum Experiment to Probe $$(g-2)_{\\mu}$$ and Dark Matter at Fermilab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kahn, Yonatan; Krnjaic, Gordan; Tran, Nhan

New light, weakly-coupled particles are commonly invoked to address the persistentmore » $$\\sim 4\\sigma$$ anomaly in $$(g-2)_\\mu$$ and serve as mediators between dark and visible matter. If such particles couple predominantly to heavier generations and decay invisibly, much of their best-motivated parameter space is inaccessible with existing experimental techniques. In this paper, we present a new fixed-target, missing-momentum search strategy to probe invisibly decaying particles that couple preferentially to muons. In our setup, a relativistic muon beam impinges on a thick active target. The signal consists of events in which a muon loses a large fraction of its incident momentum inside the target without initiating any detectable electromagnetic or hadronic activity in downstream veto systems. We propose a two-phase experiment, M$^3$ (Muon Missing Momentum), based at Fermilab. Phase 1 with $$\\sim 10^{10}$$ muons on target can test the remaining parameter space for which light invisibly-decaying particles can resolve the $$(g-2)_\\mu$$ anomaly, while Phase 2 with $$\\sim 10^{13}$$ muons on target can test much of the predictive parameter space over which sub-GeV dark matter achieves freeze-out via muon-philic forces, including gauged $$U(1)_{L_\\mu - L_\\tau}$$.« less

Valbenazine for the treatment of tardive dyskinesia.

PubMed

Seeberger, Lauren C; Hauser, Robert A

2017-08-01

Tardive dyskinesia (TD) is a hyperkinetic movement disorder that may result from treatment with antipsychotics or other dopamine receptor blocking agents. Underlying pathophysiology is incompletely understood but since the 1970s dopamine depleting agents have been used to reduce involuntary movements. The search for safe, effective treatments for TD is ongoing. Valbenazine, a novel VMAT2 inhibitor, has recently been FDA approved for treatment of TD. Areas covered: An overview of TD, unmet medical needs and current treatment guidelines are presented. The background, chemistry and clinical development of valbenazine to treat TD is detailed. A competitive market is developing as the treatment gap is identified and potential therapies are discussed in context of a broader market overview. Expert opinion: Antipsychotic use is growing among adults and children in the U.S. Consequently, prevalence of TD is expected to rise. Cessation of antipsychotics is often not possible as the psychiatric condition may deteriorate. Increasing doses of an antipsychotic to suppress involuntary movements is not sustainable long term as underlying TD worsens and movements typically recur. There were no FDA approved treatments for TD. The approval of valbenazine to treat TD is a critical step in addressing this gap in neurologic care.

Cosmic muon flux measurements at the Kimballton Underground Research Facility

NASA Astrophysics Data System (ADS)

Kalousis, L. N.; Guarnaccia, E.; Link, J. M.; Mariani, C.; Pelkey, R.

2014-08-01

In this article, the results from a series of muon flux measurements conducted at the Kimballton Underground Research Facility (KURF), Virginia, United States, are presented. The detector employed for these investigations, is made of plastic scintillator bars readout by wavelength shifting fibers and multianode photomultiplier tubes. Data was taken at several locations inside KURF, spanning rock overburden values from ~ 200 to 1450 m.w.e. From the extracted muon rates an empirical formula was devised, that estimates the muon flux inside the mine as a function of the overburden. The results are in good agreement with muon flux calculations based on analytical models and MUSIC.

A cosmic Ray Muon Experiment: a Way to Teach Standard Model of Particles at Community Colleges

NASA Astrophysics Data System (ADS)

Barazandeh, C.; Gutarra-Leon, A.; Rivas, R.; Glaser, H.; Majewski, W.

2016-11-01

This experiment is an example of research for early undergraduate students and of its benefits and challenges as an accessible strategy for community colleges, in the spirit of the report on improving undergraduate STEM education from the US President's Council of Advisors on Science and Technology. The goals of this project include measuring average low- energy muon flux, day/night flux difference, time dilation, energy spectra of electrons and muons in arbitrary units, muon decay curve, average lifetime of muons. From the lifetime data we calculate the weak coupling constant gw, electric charge e and the Higgs energy density.

3D Tomography of a Mesa Using Cosmic Ray Muons Detected in an Underground Tunnel

NASA Astrophysics Data System (ADS)

Guardincerri, E.; Rowe, C. A.

2016-12-01

The LANL Mini Muon Tracker (MMT) is a muon tracking detector made of sealed aluminum drift tubes. The MMT was operated at four locations inside a tunnel under the Los Alamos town site mesa between November 2015 and February 2016 and it collected cosmic ray muons attenuated by the tunnel overburden. The data were analyzed and used to obtain a 3D tomographic image of the mesa and will be later combined with gravity data collected around the same location. We describe here the muon data taking and their analysis, and we show the resulting 3D image.

Optimising the Active Muon Shield for the SHiP Experiment at CERN

NASA Astrophysics Data System (ADS)

Baranov, A.; Burnaev, E.; Derkach, D.; Filatov, A.; Klyuchnikov, N.; Lantwin, O.; Ratnikov, F.; Ustyuzhanin, A.; Zaitsev, A.

2017-12-01

The SHiP experiment is designed to search for very weakly interacting particles beyond the Standard Model which are produced in a 400 GeV/c proton beam dump at the CERN SPS. The critical challenge for this experiment is to keep the Standard Model background level negligible. In the beam dump, around 1011 muons will be produced per second. The muon rate in the spectrometer has to be reduced by at least four orders of magnitude to avoid muoninduced backgrounds. It is demonstrated that new improved active muon shield may be used to magnetically deflect the muons out of the acceptance of the spectrometer.

Muon Production Height investigated by the Air-Shower Experiment KASCADE-Grande

NASA Astrophysics Data System (ADS)

Doll, P.; Apel, W. D.; Arteaga, J. C.; Badea, F.; Bekk, K.; Bertaina, M.; Blümer, H.; Bozdog, H.; Brancus, I. M.; Brüggemann, M.; Buchholz, P.; Cantoni, E.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; de Souza, V.; di Pierro, F.; Engel, R.; Engler, J.; Finger, M.; Fuhrmann, D.; Ghia, P. L.; Gils, H. J.; Glasstetter, R.; Grupen, C.; Haungs, A.; Heck, D.; Hörandel, J. R.; Huege, T.; Isar, P. G.; Kampert, K.-H.; Kang, D.; Kickelbick, D.; Klages, H. O.; Kolotaev, Y.; Łuczak, P.; Mathes, H. J.; Mayer, H. J.; Milke, J.; Mitrica, B.; Morello, C.; Navarra, G.; Nehls, S.; Oehlschläger, J.; Ostapchenko, S.; Over, S.; Petcu, M.; Pierog, T.; Rebel, H.; Roth, M.; Schieler, H.; Schröder, F.; Sima, O.; Stümpert, M.; Toma, G.; Trinchero, G. C.; Ulrich, H.; van Buren, J.; Walkowiak, W.; Weindl, A.; Wochele, J.; Wommer, M.; Zabierowski, J.; KASCADE-Grande Collaboration

2009-12-01

A large area (128 m2) Muon Tracking Detector (MTD), located within the KASCADE experiment, has been built with the aim to identify muons ( E>0.8 GeV) and their directions in extensive air showers by track measurements under more than 18 r.l. shielding. The orientation of the muon track with respect to the shower axis is expressed in terms of the radial- and tangential angles. By means of triangulation the muon production height H is determined. By means of H, a transition from light to heavy cosmic ray primary particles with increasing shower energy E from 1-10 PeV is observed.

Characterisation of the muon beams for the Muon Ionisation Cooling Experiment

DOE PAGES

Adams, D.; Adey, D.; Alekou, A.; ...

2013-10-01

A novel single-particle technique to measure emittance has been developed and used to characterise seventeen different muon beams for the Muon Ionisation Cooling Experiment (MICE). The muon beams, whose mean momenta vary from 171 to 281 MeV/c, have emittances of approximately 1.2-2.3 π mm-rad horizontally and 0.6-1.0 π mm-rad vertically, a horizontal dispersion of 90-190 mm and momentum spreads of about 25 MeV/c. There is reasonable agreement between the measured parameters of the beams and the results of simulations. The beams are found to meet the requirements of MICE.

Organosilicon compounds meet subatomic physics: Muon spin resonance.

PubMed

West, Robert; Percival, Paul W

2010-10-21

Silylenes, germylenes and silenes react with muonium atoms, produced from muons generated at a particle accelerator. The resulting radicals can be studied by muon spin resonance spectroscopy, providing unique information about their structure and reactivity.

RNA-Binding Protein L1TD1 Interacts with LIN28 via RNA and is Required for Human Embryonic Stem Cell Self-Renewal and Cancer Cell Proliferation

PubMed Central

Närvä, Elisa; Rahkonen, Nelly; Emani, Maheswara Reddy; Lund, Riikka; Pursiheimo, Huha-Pekka; Nästi, Juuso; Autio, Reija; Rasool, Omid; Denessiouk, Konstantin; Lähdesmäki, Harri; Rao, Anjana; Lahesmaa, Ritta

2012-01-01

Human embryonic stem cells (hESC) have a unique capacity to self-renew and differentiate into all the cell types found in human body. Although the transcriptional regulators of pluripotency are well studied, the role of cytoplasmic regulators is still poorly characterized. Here, we report a new stem cell-specific RNA-binding protein L1TD1 (ECAT11, FLJ10884) required for hESC self-renewal and cancer cell proliferation. Depletion of L1TD1 results in immediate downregulation of OCT4 and NANOG. Furthermore, we demonstrate that OCT4, SOX2, and NANOG all bind to the promoter of L1TD1. Moreover, L1TD1 is highly expressed in seminomas, and depletion of L1TD1 in these cancer cells influences self-renewal and proliferation. We show that L1TD1 colocalizes and interacts with LIN28 via RNA and directly with RNA helicase A (RHA). LIN28 has been reported to regulate translation of OCT4 in complex with RHA. Thus, we hypothesize that L1TD1 is part of the L1TD1-RHA-LIN28 complex that could influence levels of OCT4. Our results strongly suggest that L1TD1 has an important role in the regulation of stemness. PMID:22162396

Impact of tire debris on in vitro and in vivo systems

PubMed Central

Gualtieri, Maurizio; Andrioletti, Manuela; Mantecca, Paride; Vismara, Claudio; Camatini, Marina

2005-01-01

Background It is estimated that over 80% of respirable particulate matter (PM10) in cities comes from road transport and that tire and brake wear are responsible for the 3–7% emission of it. Data on the indicators of environmental impact of tire debris (TD), originated from the tire abrasion on roads, are extremely scarce, even though TD contains chemicals (zinc and organic compounds) which can be released in the environment. Methods TD particle morphology was analysed with SEM, TEM and FIB instruments. TD eluates and TD organic extracts were tested at dilution series on human cell lines and Xenopus laevis embryos. 50 and 100 g/L TD were used for the eluates obtained after 24 h at pH 3 and the quantity of zinc present was measured with a ICP-AES. Eluates diluted to 1%, 10%, 50% in culture media and undiluted were used on X. laevis embryos in the FETAX test. HepG2 cells were exposed for 24 h to 0.05 – 50 μg/ml of zinc salt while A549 cells were exposed for 24, 48 and 72 h to 10, 50, 60, or 75 μg/ml of TD extract. X. laevis embryos were exposed to 50, 80, 100, or 120 μg/ml TD extract. Results The solution of undiluted 50 g/L TD produced 80.2% mortality (p < 0.01) in X. laevis embryos and this toxic effect was three times greater than that produced by 100 g/L TD. Zn accumulation in HepG2 cells was evident after 4 h exposure. A549 cells exposed to TD organic extract for 72 h presented a modified morphology, a decrease in cell proliferation and an increase in DNA damage as shown by comet assay. The dose 80 μg/ml of TD extract produced 14.6% mortality in X. laevis embryos and 15.9% mortality at 120 μg/ml. Treatment with 80, 100, or 120 μg/ml TD organic extract increased from 14.8% to 37.8% malformed larvae percentages compared to 5.6% in the control. Conclusion Since the amount of Zn leached from TD is related to pH, aggregation of particles and elution process, the quantity of TD present in the environment has to be taken into account. Moreover the atmospheric conditions, which may deeply influence the particle properties, have to be considered. The TD organic fraction was toxic for cells and organisms. Thus, because of its chemical components, TD may have a potential environmental impact and has to be further investigated. PMID:15813962

Muon Energy Reconstruction in ANTARES and Its Application to the Diffuse Neutrino Flux

NASA Astrophysics Data System (ADS)

Romeyer, A.; Bruijn, R.; Zornoza, J.-d.-D.; ANTARES Collaboration

2003-07-01

The Europ ean collab oration ANTARES aims to operate a large neutrino telescope in the Mediterranean Sea, 2400 m deep, 40 km from Toulon (France). Muon neutrinos are detected through the muon produced in charged current interactions in the medium surrounding the detector. The Cherenkov light emitted by the muon is registered by a 3D photomultiplier array. Muon energy can be inferred using 3 different methods based on the knowledge of the features of muon energy losses. They result in an energy resolution of a factor ˜ 2 above 1 TeV. The ANTARES sensitivity to diffuse neutrino flux models is obtained from an energy cut, rejecting most of the atmospheric neutrino background which has a softer spectrum. Fake upgoing events from downgoing atmospheric muons are rejected using dedicated variables. After 1 year of data taking, the ANTARES sensitivity is E 2 dΦν /dEν º 8 · 10-8 GeV cm-2 s-1 sr -1 for a 10 string detector and an E -2 diffuse flux spectrum.

Travelers' Diarrhea and Other Gastrointestinal Symptoms Among Boston-Area International Travelers

PubMed Central

Stoney, Rhett J.; Han, Pauline V.; Barnett, Elizabeth D.; Wilson, Mary E.; Jentes, Emily S.; Benoit, Christine M.; MacLeod, William B.; Hamer, Davidson H.; Chen, Lin H.

2017-01-01

This prospective cohort study describes travelers' diarrhea (TD) and non-TD gastrointestinal (GI) symptoms among international travelers from the Boston area, the association of TD with traveler characteristics and dietary practices, use of prescribed antidiarrheal medications, and the impact of TD and non-TD GI symptoms on planned activities during and after travel. We included adults who received a pre-travel consultation at three Boston-area travel clinics and who completed a three-part survey: pre-travel, during travel, and post-travel (2–4 weeks after return). TD was defined as self-reported diarrhea with or without nausea/vomiting, abdominal pain, or fever. Demographic and travel characteristics were evaluated by χ2 test for categorical and Wilcoxon rank-sum test for continuous variables. Analysis of dietary practices used logistic generalized estimating equation models or logistic regression models. Of 628 travelers, 208 (33%) experienced TD and 45 (7%) experienced non-TD GI symptoms. Of 208 with TD, 128 (64%), 71 (36%), and 123 (62%) were prescribed ciprofloxacin, azithromycin, and/or loperamide before travel, respectively. Thirty-nine (36%) of 108 took ciprofloxacin, 20 (38%) of 55 took azithromycin, and 28 (28%) of 99 took loperamide during travel. Of 172 with TD during travel, 24% stopped planned activities, and 2% were hospitalized. Of 31 with non-TD GI symptoms during travel, six (13%) stopped planned activities. International travelers continue to experience diarrhea and other GI symptoms, resulting in disruption of planned activities and healthcare visits for some. Although these illnesses resulted in interruption of travel plans, a relatively small proportion took prescribed antibiotics. PMID:28719282

Travelers' Diarrhea and Other Gastrointestinal Symptoms Among Boston-Area International Travelers.

PubMed

Stoney, Rhett J; Han, Pauline V; Barnett, Elizabeth D; Wilson, Mary E; Jentes, Emily S; Benoit, Christine M; MacLeod, William B; Hamer, Davidson H; Chen, Lin H

2017-06-01

AbstractThis prospective cohort study describes travelers' diarrhea (TD) and non-TD gastrointestinal (GI) symptoms among international travelers from the Boston area, the association of TD with traveler characteristics and dietary practices, use of prescribed antidiarrheal medications, and the impact of TD and non-TD GI symptoms on planned activities during and after travel. We included adults who received a pre-travel consultation at three Boston-area travel clinics and who completed a three-part survey: pre-travel, during travel, and post-travel (2-4 weeks after return). TD was defined as self-reported diarrhea with or without nausea/vomiting, abdominal pain, or fever. Demographic and travel characteristics were evaluated by χ 2 test for categorical and Wilcoxon rank-sum test for continuous variables. Analysis of dietary practices used logistic generalized estimating equation models or logistic regression models. Of 628 travelers, 208 (33%) experienced TD and 45 (7%) experienced non-TD GI symptoms. Of 208 with TD, 128 (64%), 71 (36%), and 123 (62%) were prescribed ciprofloxacin, azithromycin, and/or loperamide before travel, respectively. Thirty-nine (36%) of 108 took ciprofloxacin, 20 (38%) of 55 took azithromycin, and 28 (28%) of 99 took loperamide during travel. Of 172 with TD during travel, 24% stopped planned activities, and 2% were hospitalized. Of 31 with non-TD GI symptoms during travel, six (13%) stopped planned activities. International travelers continue to experience diarrhea and other GI symptoms, resulting in disruption of planned activities and healthcare visits for some. Although these illnesses resulted in interruption of travel plans, a relatively small proportion took prescribed antibiotics.

--No Title--

Science.gov Websites

{ clear:both; } .hidden { display:none; } #results td.highlight, #pcd td.highlight { background-color:#eee ; } #results tr.bld, #pcd tr.bld { font-weight:bold; } #results td.note, #pcd td.note { font-size:11px; color ; color:#fff; text-decoration:none; padding:7px 20px; } #topnav a { position:relative; display:block

First Measurement of Monoenergetic Muon Neutrino Charged Current Interactions

DOE PAGES

Aguilar-Arevalo, A. A.; Brown, B. C.; Bugel, L.; ...

2018-04-06

We report the first measurement of monoenergetic muon neutrino charged current interactions. MiniBooNE has isolated 236 MeV muon neutrino events originating from charged kaon decay at rest (more » $$K^+ \\rightarrow \\mu^+ \

First Measurement of Monoenergetic Muon Neutrino Charged Current Interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aguilar-Arevalo, A. A.; Brown, B. C.; Bugel, L.

We report the first measurement of monoenergetic muon neutrino charged current interactions. MiniBooNE has isolated 236 MeV muon neutrino events originating from charged kaon decay at rest (more » $$K^+ \\rightarrow \\mu^+ \

Muons in the Cathedral

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guardincerri, Elena

2017-08-17

Muon-imaging technology — far better at penetrating materials than x-rays — makes it ideal for peering into thick, dense objects. While muon-imaging technology was developed for national security purposes, such as searching cargo shipments for nuclear materials, it could also be useful for determining what is inside any structure. Now, scientists at Los Alamos are using muons to look inside a nearly 600-year-old Italian church in hopes of preserving it for centuries to come.

MUFFSgenMC: An Open Source MUon Flexible Framework for Spectral GENeration for Monte Carlo Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chatzidakis, Stylianos; Greulich, Christopher

A cosmic ray Muon Flexible Framework for Spectral GENeration for Monte Carlo Applications (MUFFSgenMC) has been developed to support state-of-the-art cosmic ray muon tomographic applications. The flexible framework allows for easy and fast creation of source terms for popular Monte Carlo applications like GEANT4 and MCNP. This code framework simplifies the process of simulations used for cosmic ray muon tomography.

Study of muons from the direction of Cygnus X-3 using an underground proportional-tube array

NASA Astrophysics Data System (ADS)

Kochocki, J. A.; Allison, W. W.; Alner, G. J.; Ambats, I.; Ayres, D. S.; Balka, L. J.; Barr, G. D.; Barrett, W. L.; Benjamin, D.; Border, P.; Brooks, C. B.; Cobb, J. H.; Cockerill, D. J.; Coover, K.; Courant, H.; Dahlin, B.; Dasgupta, U.; Dawson, J. W.; Edwards, V. W.; Fields, T. H.; Kirby-Gallagher, L. M.; Garcia-Garcia, C.; Giles, R. H.; Goodman, M. C.; Heller, K.; Heppelman, S.; Hill, N.; Hoftiezer, J. H.; Jankowski, D. J.; Johns, K.; Joyce, T.; Kafka, T.; Litchfield, P. J.; Lopez, F. V.; Lowe, M.; Mann, W. A.; Marshak, M. L.; May, E. N.; McMaster, L.; Milburn, R. H.; Miller, W.; Napier, A.; Oliver, W. P.; Pearce, G. F.; Perkins, D. H.; Peterson, E. A.; Price, L. E.; Roback, D.; Rosen, D. B.; Ruddick, K.; Saitta, B.; Schlereth, J. L.; Schmid, D.; Schneps, J.; Shield, P. D.; Shupe, M.; Sundaralingam, N.; Thomson, M. A.; Thron, J. L.; Werkema, S.; West, N.

1990-11-01

From July 1987 through March 1988 an array of proportional wire modules was operated as a muon detector at a depth of 2090 meters water equivalent in the Soudan mine in northern Minnesota. A spatial angular resolution of 1.2° was achieved for muon tracking. A clean sample of 1.02×105 muon trajectories recorded underground is used to search for an excess flux of muons from the direction of Cygnus X-3. For muons within the phase interval [0.6, 0.9] of the source's 4.8-h period, 90%-C.L. upper limits for fluxes arriving within 3° and 1.5° half-angle cones centered on the Cygnus X-3 direction are 8.5×10-11 cm-2s-1 and 3.1×10-11 cm-2s-1, respectively.

Performance of the CMS muon detector and muon reconstruction with proton-proton collisions at $$\\sqrt{s}=$$ 13 TeV

DOE PAGES

Sirunyan, Albert M; et al.

2018-06-19

The CMS muon detector system, muon reconstruction software, and high-level trigger underwent significant changes in 2013-2014 in preparation for running at higher LHC collision energy and instantaneous luminosity. The performance of the modified system is studied using proton-proton collision data at center-of-mass energymore » $$\\sqrt{s}=$$ 13 TeV, collected at the LHC in 2015 and 2016. The measured performance parameters, including spatial resolution, efficiency, and timing, are found to meet all design specifications and are well reproduced by simulation. Despite the more challenging running conditions, the modified muon system is found to perform as well as, and in many aspects better than, previously. We dedicate this paper to the memory of Prof. Alberto Benvenuti, whose work was fundamental for the CMS muon detector.« less

Separation of the electromagnetic and the muon component in EAS by their arrival times

NASA Astrophysics Data System (ADS)

Brüggemann, M.; Apel, W.D.; Arteaga, J.C.; Badea, F.; Bekk, K.; Bertaina, M.; Blümer, J.; Bozdog, H.; Brancus, I.M.; Buchholz, P.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; de Souza, V.; Di Pierro, F.; Doll, P.; Engel, R.; Engler, J.; Finger, M.; Fuhrmann, D.; Ghia, P.L.; Gils, H.J.; Glasstetter, R.; Grupen, C.; Haungs, A.; Heck, D.; Hörandel, J.R.; Huege, T.; Isar, P.G.; Kampert, K.-H.; Kickelbick, D.; Klages, H.O.; Kolotaev, Y.; Luczak, P.; Mathes, H.J.; Mayer, H.J.; Meurer, C.; Milke, J.; Mitrica, B.; Morales, A.; Morello, C.; Navarra, G.; Nehls, S.; Oehlschläger, J.; Ostapchenko, S.; Over, S.; Petcu, M.; Pierog, T.; Plewnia, S.; Rebel, H.; Roth, M.; Schieler, H.; Sima, O.; Stümpert, M.; Toma, G.; Trinchero, G.C.; Ulrich, H.; van Buren, J.; Walkowiak, W.; Weindl, A.; Wochele, J.; Zabierowski, J.

The KASCADE-Grande experiment at Forschungszentrum Karlsruhe, Germany, measures extensive air showers initiated by primary particles with energies between 100 TeV and 1 EeV. Detector pulses digitized by a Flash-ADC based data acquisition system were unfolded to study the arrival times of secondary particles separately for the electromagnetic and the muonic shower component. Muons arrive on average earlier at ground level than electrons. A cut on the particle arrival time has been determined as a function of the distance to the shower core for the separation of electrons and muons. This cut is intended to be used for the determination of the muon content of air showers in experiments without dedicated muon detectors but with time resolving detector electronics. The muon content is essential for the reconstruction of the cosmic ray energy spectrum separated into individual elemental groups.

Results of investigation of muon fluxes of superhigh energy cosmic rays with X-ray emulsion chambers

NASA Technical Reports Server (NTRS)

Ivanenko, I. P.; Ivanova, M. A.; Kuzmichev, L. A.; Ilyina, N. P.; Mandritskaya, K. V.; Osipova, E. A.; Rakobolskaya, I. V.; Zatsepin, G. T.

1985-01-01

The overall data from the investigation of the cosmic ray muon flux in the range of zenith angles (0-90) deg within the energy range (3.5 to 5.0) TeV is presented. The exposure of large X-ray emulsion chambers underground was 1200 tons. year. The data were processe using the method which was applied in the experiment Pamir and differred from the earlier applied one. The obtained value of a slope power index of the differential energy spectrum of the global muon flux is =3.7 that corresponds to the slope of the pion generation differential spectrum, gamma sub PI = 2.75 + or - .04. The analysis of the muon zenith-angular distribution showed that the contribution of rapid generation muons in the total muon flux agree the best with the value .2% and less with .7% at a 90% reliability level.

Performance of the CMS muon detector and muon reconstruction with proton-proton collisions at $$\\sqrt{s}=$$ 13 TeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirunyan, Albert M; et al.

The CMS muon detector system, muon reconstruction software, and high-level trigger underwent significant changes in 2013-2014 in preparation for running at higher LHC collision energy and instantaneous luminosity. The performance of the modified system is studied using proton-proton collision data at center-of-mass energymore » $$\\sqrt{s}=$$ 13 TeV, collected at the LHC in 2015 and 2016. The measured performance parameters, including spatial resolution, efficiency, and timing, are found to meet all design specifications and are well reproduced by simulation. Despite the more challenging running conditions, the modified muon system is found to perform as well as, and in many aspects better than, previously. We dedicate this paper to the memory of Prof. Alberto Benvenuti, whose work was fundamental for the CMS muon detector.« less

Can muon-induced backgrounds explain the DAMA data?

NASA Astrophysics Data System (ADS)

Klinger, Joel; Kudryavtsev, Vitaly A.

2016-05-01

We present an accurate simulation of the muon-induced background in the DAMA/LIBRA experiment. Muon sampling underground has been performed using the MUSIC/MUSUN codes and subsequent interactions in the rock around the DAMA/LIBRA detector cavern and the experimental setup including shielding, have been simulated with GEANT4.9.6. In total we simulate the equivalent of 20 years of muon data. We have calculated the total muon-induced neutron flux in the DAMA/LIBRA detector cavern as Φμ n = 1.0 × 10-9 cm-2s-1, which is consistent with other simulations. After selecting events which satisfy the DAMA/LIBRA signal criteria, our simulation predicts 3.49 × 10-5 cpd/kg/keV which accounts for less than 0.3% of the DAMA/LIBRA modulation amplitude. We conclude from our work that muon-induced backgrounds are unable to contribute to the observed signal modulation.

Prospects for a Muon Spin Resonance Facility in the MuCool Test Area

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnstone, John A.

2017-04-12

This paper investigates the feasibility of re-purposing the MuCool Test Area beamline and experimental hall to support a Muon Spin Resonance facility, which would make it the only such facility in the US. This report reviews the basic muon production concepts studied and operationally implemented at TRIUMF, PSI, and RAL and their application to the MTA facility. Two scenarios were determined feasible. One represents an initial minimal-shielding and capital-cost investment stage with a single secondary muon beamline that transports the primary beam to an existing high-intensity beam absorber located outside of the hall. Another, upgraded stage, involves an optimized productionmore » target pile and high-intensity absorber installed inside the experimental hall and potentially multiple secondary muon lines. In either scenario, with attention to target design, the MTA can host enabling and competitive Muon Spin Resonance experiments« less

Epicyclic helical channels for parametric resonance ionization cooling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johson, Rolland Paul; Derbenev, Yaroslav

Proposed next-generation muon colliders will require major technical advances to achieve rapid muon beam cooling requirements. Parametric-resonance Ionization Cooling (PIC) is proposed as the final 6D cooling stage of a high-luminosity muon collider. In PIC, a half-integer parametric resonance causes strong focusing of a muon beam at appropriately placed energy absorbers while ionization cooling limits the beam’s angular spread. Combining muon ionization cooling with parametric resonant dynamics in this way should then allow much smaller final transverse muon beam sizes than conventional ionization cooling alone. One of the PIC challenges is compensation of beam aberrations over a sufficiently wide parametermore » range while maintaining the dynamical stability with correlated behavior of the horizontal and vertical betatron motion and dispersion. We explore use of a coupling resonance to reduce the dimensionality of the problem and to shift the dynamics away from non-linear resonances. PIC simulations are presented.« less

Genetics of tardive dyskinesia: Promising leads and ways forward.

PubMed

Zai, Clement C; Maes, Miriam S; Tiwari, Arun K; Zai, Gwyneth C; Remington, Gary; Kennedy, James L

2018-06-15

Tardive dyskinesia (TD) is a potentially irreversible and often debilitating movement disorder secondary to chronic use of dopamine receptor blocking medications. Genetic factors have been implicated in the etiology of TD. We therefore have reviewed the most promising genes associated with TD, including DRD2, DRD3, VMAT2, HSPG2, HTR2A, HTR2C, and SOD2. In addition, we present evidence supporting a role for these genes from preclinical models of TD. The current understanding of the etiogenesis of TD is discussed in the light of the recent approvals of valbenazine and deutetrabenazine, VMAT2 inhibitors, for treating TD. Copyright © 2018 Elsevier B.V. All rights reserved.

Improvement of density models of geological structures by fusion of gravity data and cosmic muon radiographies

NASA Astrophysics Data System (ADS)

Jourde, K.; Gibert, D.; Marteau, J.

2015-08-01

This paper examines how the resolution of small-scale geological density models is improved through the fusion of information provided by gravity measurements and density muon radiographies. Muon radiography aims at determining the density of geological bodies by measuring their screening effect on the natural flux of cosmic muons. Muon radiography essentially works like a medical X-ray scan and integrates density information along elongated narrow conical volumes. Gravity measurements are linked to density by a 3-D integration encompassing the whole studied domain. We establish the mathematical expressions of these integration formulas - called acquisition kernels - and derive the resolving kernels that are spatial filters relating the true unknown density structure to the density distribution actually recovered from the available data. The resolving kernel approach allows one to quantitatively describe the improvement of the resolution of the density models achieved by merging gravity data and muon radiographies. The method developed in this paper may be used to optimally design the geometry of the field measurements to be performed in order to obtain a given spatial resolution pattern of the density model to be constructed. The resolving kernels derived in the joined muon-gravimetry case indicate that gravity data are almost useless for constraining the density structure in regions sampled by more than two muon tomography acquisitions. Interestingly, the resolution in deeper regions not sampled by muon tomography is significantly improved by joining the two techniques. The method is illustrated with examples for the La Soufrière volcano of Guadeloupe.

Molecular characterization of Cryptosporidium and Giardia from the Tasmanian devil (Sarcophilus harrisii).

PubMed

Wait, Liana F; Fox, Samantha; Peck, Sarah; Power, Michelle L

2017-01-01

The Tasmanian devil (Sarcophilus harrisii) is a carnivorous marsupial found only in the wild in Tasmania, Australia. Tasmanian devils are classified as endangered and are currently threatened by devil facial tumour disease, a lethal transmissible cancer that has decimated the wild population in Tasmania. To prevent extinction of Tasmanian devils, conservation management was implemented in 2003 under the Save the Tasmanian Devil Program. This study aimed to assess if conservation management was altering the interactions between Tasmanian devils and their parasites. Molecular tools were used to investigate the prevalence and diversity of two protozoan parasites, Cryptosporidium and Giardia, in Tasmanian devils. A comparison of parasite prevalence between wild and captive Tasmanian devils showed that both Cryptosporidium and Giardia were significantly more prevalent in wild devils (p < 0.05); Cryptosporidium was identified in 37.9% of wild devils but only 10.7% of captive devils, while Giardia was identified in 24.1% of wild devils but only 0.82% of captive devils. Molecular analysis identified the presence of novel genotypes of both Cryptosporidium and Giardia. The novel Cryptosporidium genotype was 98.1% similar at the 18S rDNA to Cryptosporidium varanii (syn. C. saurophilum) with additional samples identified as C. fayeri, C. muris, and C. galli. Two novel Giardia genotypes, TD genotype 1 and TD genotype 2, were similar to G. duodenalis from dogs (94.4%) and a Giardia assemblage A isolate from humans (86.9%). Giardia duodenalis BIV, a zoonotic genotype of Giardia, was also identified in a single captive Tasmanian devil. These findings suggest that conservation management may be altering host-parasite interactions in the Tasmanian devil, and the presence of G. duodenalis BIV in a captive devil points to possible human-devil parasite transmission.

Molecular characterization of Cryptosporidium and Giardia from the Tasmanian devil (Sarcophilus harrisii)

PubMed Central

Fox, Samantha; Peck, Sarah; Power, Michelle L.

2017-01-01

The Tasmanian devil (Sarcophilus harrisii) is a carnivorous marsupial found only in the wild in Tasmania, Australia. Tasmanian devils are classified as endangered and are currently threatened by devil facial tumour disease, a lethal transmissible cancer that has decimated the wild population in Tasmania. To prevent extinction of Tasmanian devils, conservation management was implemented in 2003 under the Save the Tasmanian Devil Program. This study aimed to assess if conservation management was altering the interactions between Tasmanian devils and their parasites. Molecular tools were used to investigate the prevalence and diversity of two protozoan parasites, Cryptosporidium and Giardia, in Tasmanian devils. A comparison of parasite prevalence between wild and captive Tasmanian devils showed that both Cryptosporidium and Giardia were significantly more prevalent in wild devils (p < 0.05); Cryptosporidium was identified in 37.9% of wild devils but only 10.7% of captive devils, while Giardia was identified in 24.1% of wild devils but only 0.82% of captive devils. Molecular analysis identified the presence of novel genotypes of both Cryptosporidium and Giardia. The novel Cryptosporidium genotype was 98.1% similar at the 18S rDNA to Cryptosporidium varanii (syn. C. saurophilum) with additional samples identified as C. fayeri, C. muris, and C. galli. Two novel Giardia genotypes, TD genotype 1 and TD genotype 2, were similar to G. duodenalis from dogs (94.4%) and a Giardia assemblage A isolate from humans (86.9%). Giardia duodenalis BIV, a zoonotic genotype of Giardia, was also identified in a single captive Tasmanian devil. These findings suggest that conservation management may be altering host-parasite interactions in the Tasmanian devil, and the presence of G. duodenalis BIV in a captive devil points to possible human-devil parasite transmission. PMID:28423030

Distinct age-related differences in temporal discounting and risk taking in adolescents and young adults.

PubMed

de Water, Erik; Cillessen, Antonius H N; Scheres, Anouk

2014-01-01

Age-related differences in temporal discounting (TD) and risk taking, and their association, were examined in adolescents and young adults (n = 337) aged 12-27 years. Since monetary rewards are typically used in TD and risk-taking tasks, the association between monetary reward valuation and age and decision making in these tasks was explored as well. TD declined linearly with age, with a particularly sharp decline from 15 to 16 years. In contrast, risk taking was not correlated with age and TD. Reward valuation was not associated with TD and risk taking, and age-related differences in TD remained significant after controlling for reward valuation. Together, these findings suggest that risk taking and TD are two separate constructs with distinct age-related differences in adolescence and young adulthood. © 2014 The Authors. Child Development © 2014 Society for Research in Child Development, Inc.

Tic disorders and obsessive compulsive disorder: where is the link?

PubMed

Roessner, V; Becker, A; Banaschewski, T; Rothenberger, A

2005-01-01

Over the last years evidence on the overlap between tic-disorders (TD) and obsessive compulsive behavior/disorder (OCB/OCD) has increased. The main focus of research have been the phenomenological and epidemiological similarities and differences in samples of different age, primary diagnosis (TD vs. OCD) including the co-occurrence of both. Unfortunately, only a minority of studies included all three groups (TD, TD + OCD, OCD). Nevertheless, new insight concerning possible subtypes for both TD and OCD has been gained. While some authors concentrated on OCD with/without tics we will summarize the field of TD and OCB/OCD from the viewpoint of tics, since OCB plays an important role in patients with TD. Thereby we will not only sharpen the clinicans' awareness of known differences in phenomenology, epidemiology, genetics and neurobiology, aimed to improve their diagnoses and treatment but also highlight the gaps of knowledge and discuss possibilities for further research in this field.

75 FR 47893 - Proposed Collection; Comment Request for REG-111583-07, (T.D. 9405) (Final)

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-09

...-111583-07, (T.D. 9405) (Final) AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and... comments concerning temporary and final regulations (REG-111583-07) (T.D. 9405), Employment Tax Adjustments... Adjustments. OMB Number: 1545-2097. Form Number: REG-111583-07 (T.D. 9405) (final). Abstract: This document...

Molecular design of donor-acceptor dyes for efficient dye-sensitized solar cells I: a DFT study.

PubMed

El-Shishtawy, Reda M; Asiri, Abdullah M; Aziz, Saadullah G; Elroby, Shaaban A K

2014-06-01

Dye-sensitized solar cells (DSSCs) have drawn great attention as low cost and high performance alternatives to conventional photovoltaic devices. The molecular design presented in this work is based on the use of pyran type dyes as donor based on frontier molecular orbitals (FMO) and theoretical UV-visible spectra in combination with squaraine type dyes as an acceptor. Density functional theory has been used to investigate several derivatives of pyran type dyes for a better dye design based on optimization of absorption, regeneration, and recombination processes in gas phase. The frontier molecular orbital (FMO) of the HOMO and LUMO energy levels plays an important role in the efficiency of DSSCs. These energies contribute to the generation of exciton, charge transfer, dissociation and exciton recombination. The computations of the geometries and electronic structures for the predicted dyes were performed using the B3LYP/6-31+G** level of theory. The FMO energies (EHOMO, ELUMO) of the studied dyes are calculated and analyzed in the terms of the UV-visible absorption spectra, which have been examined using time-dependent density functional theory (TD-DFT) techniques. This study examined absorption properties of pyran based on theoretical UV-visible absorption spectra, with comparisons between TD-DFT using B3LYP, PBE, and TPSSH functionals with 6-31+G (d) and 6-311++G** basis sets. The results provide a valuable guide for the design of donor-acceptor (D-A) dyes with high molar absorptivity and current conversion in DSSCs. The theoretical results indicated 4-(dicyanomethylene)-2-methyl-6-(p-dimethylaminostyryl)-4H-pyran dye (D2-Me) can be effectively used as a donor dye for DSSCs. This dye has a low energy gap by itself and a high energy gap with squaraine acceptor type dye, the design that reduces the recombination and improves the photocurrent generation in solar cell.

PANDA Muon System Prototype

NASA Astrophysics Data System (ADS)

Abazov, Victor; Alexeev, Gennady; Alexeev, Maxim; Frolov, Vladimir; Golovanov, Georgy; Kutuzov, Sergey; Piskun, Alexei; Samartsev, Alexander; Tokmenin, Valeri; Verkheev, Alexander; Vertogradov, Leonid; Zhuravlev, Nikolai

2018-04-01

The PANDA Experiment will be one of the key experiments at the Facility for Antiproton and Ion Research (FAIR) which is under construction now in the territory of the GSI Helmholtz Centre for Heavy Ion Research in Darmstadt, Germany. PANDA is aimed to study hadron spectroscopy and various topics of the weak and strong forces. Muon System is chosen as the most suitable technology for detecting the muons. The Prototype of the PANDA Muon System is installed on the test beam line T9 at the Proton Synchrotron (PS) at CERN. Status of the PANDA Muon System prototype is presented with few preliminary results.

The design and construction of the MICE Electron-Muon Ranger

NASA Astrophysics Data System (ADS)

Asfandiyarov, R.; Bene, P.; Blondel, A.; Bolognini, D.; Cadoux, F.; Debieux, S.; Drielsma, F.; Giannini, G.; Graulich, J. S.; Husi, C.; Karadzhov, Y.; Lietti, D.; Masciocchi, F.; Nicola, L.; Noah Messomo, E.; Prest, M.; Rothenfusser, K.; Sandstrom, R.; Vallazza, E.; Verguilov, V.; Wisting, H.

2016-10-01

The Electron-Muon Ranger (EMR) is a fully-active tracking-calorimeter installed in the beam line of the Muon Ionization Cooling Experiment (MICE). The experiment will demonstrate ionization cooling, an essential technology needed for the realization of a Neutrino Factory and/or a Muon Collider. The EMR is designed to measure the properties of low energy beams composed of muons, electrons and pions, and perform the identification particle-by-particle. The detector consists of 48 orthogonal layers of 59 triangular scintillator bars. The readout is implemented using FPGA custom made electronics and commercially available modules. This article describes the construction of the detector from its design up to its commissioning with cosmic data.

Detecting special nuclear material using muon-induced neutron emission

NASA Astrophysics Data System (ADS)

Guardincerri, Elena; Bacon, Jeffrey; Borozdin, Konstantin; Matthew Durham, J.; Fabritius, Joseph, II; Hecht, Adam; Milner, Edward C.; Miyadera, Haruo; Morris, Christopher L.; Perry, John; Poulson, Daniel

2015-07-01

The penetrating ability of cosmic ray muons makes them an attractive probe for imaging dense materials. Here, we describe experimental results from a new technique that uses neutrons generated by cosmic-ray muons to identify the presence of special nuclear material (SNM). Neutrons emitted from SNM are used to tag muon-induced fission events in actinides and laminography is used to form images of the stopping material. This technique allows the imaging of SNM-bearing objects tagged using muon tracking detectors located above or to the side of the objects, and may have potential applications in warhead verification scenarios. During the experiment described here we did not attempt to distinguish the type or grade of the SNM.

Muon-Induced Neutrons Do Not Explain the DAMA Data

NASA Astrophysics Data System (ADS)

Klinger, J.; Kudryavtsev, V. A.

2015-04-01

We present an accurate model of the muon-induced background in the DAMA/LIBRA experiment. Our work challenges proposed mechanisms which seek to explain the observed DAMA signal modulation with muon-induced backgrounds. Muon generation and transport are performed using the MUSIC /MUSUN code, and subsequent interactions in the vicinity of the DAMA detector cavern are simulated with Geant4. We estimate the total muon-induced neutron flux in the detector cavern to be Φnν=1.0 ×10-9 cm-2 s-1 . We predict 3.49 ×10-5 counts /day /kg /keV , which accounts for less than 0.3% of the DAMA signal modulation amplitude.

Muon tomography imaging algorithms for nuclear threat detection inside large volume containers with the Muon Portal detector

NASA Astrophysics Data System (ADS)

Riggi, S.; Antonuccio-Delogu, V.; Bandieramonte, M.; Becciani, U.; Costa, A.; La Rocca, P.; Massimino, P.; Petta, C.; Pistagna, C.; Riggi, F.; Sciacca, E.; Vitello, F.

2013-11-01

Muon tomographic visualization techniques try to reconstruct a 3D image as close as possible to the real localization of the objects being probed. Statistical algorithms under test for the reconstruction of muon tomographic images in the Muon Portal Project are discussed here. Autocorrelation analysis and clustering algorithms have been employed within the context of methods based on the Point Of Closest Approach (POCA) reconstruction tool. An iterative method based on the log-likelihood approach was also implemented. Relative merits of all such methods are discussed, with reference to full GEANT4 simulations of different scenarios, incorporating medium and high-Z objects inside a container.

Management of the Returning Traveler with Diarrhea

PubMed Central

2009-01-01

Abstract: Traveler's diarrhea (TD) strikes 20—60% of travelers visiting developing countries. It occurs shortly after the return and can be distinguished into two categories: acute and persistent TD. Acute TD, mostly caused by bacterial and viral pathogens, is usually mild and self-limited, and deserves empirical symptomatic and/or antibiotic therapy in selected cases. Fluoroquinolones are progressively superseded in this indication by azithromycin, a well tolerated macrolide active against most bacteria responsible for TD, including the quinolone-resistant species of Campylobacter jejuni that are now pervasive, especially in Southeast Asia and India. Persistent TD in the returning traveler is much rarer than its acute counterpart and may be associated with three types of causes. Persistent infections, among which Giardia and possibly Entamoeba predominate, account for a significant proportion of cases. Postinfectious processes represent a second cause and comprise temporary lactose malabsorption and postinfectious irritable bowel syndrome, now considered a major cause of persistent TD. Finally, apparently unrelated chronic diseases causing diarrhea are occasionally unmasked by TD and represent a third type of persistent TD, among which the well established case of incident inflammatory bowel disease poses intriguing pathogenesis questions. This review discusses recent advances in the field and provides practical recommendations for the management of TD in adult, immunocompetent returning travelers. PMID:21180583

Management of the returning traveler with diarrhea.

PubMed

de Saussure, Philippe P H

2009-11-01

Traveler's diarrhea (TD) strikes 20-60% of travelers visiting developing countries. It occurs shortly after the return and can be distinguished into two categories: acute and persistent TD. Acute TD, mostly caused by bacterial and viral pathogens, is usually mild and self-limited, and deserves empirical symptomatic and/or antibiotic therapy in selected cases. Fluoroquinolones are progressively superseded in this indication by azithromycin, a well tolerated macrolide active against most bacteria responsible for TD, including the quinolone-resistant species of Campylobacter jejuni that are now pervasive, especially in Southeast Asia and India. Persistent TD in the returning traveler is much rarer than its acute counterpart and may be associated with three types of causes. Persistent infections, among which Giardia and possibly Entamoeba predominate, account for a significant proportion of cases. Postinfectious processes represent a second cause and comprise temporary lactose malabsorption and postinfectious irritable bowel syndrome, now considered a major cause of persistent TD. Finally, apparently unrelated chronic diseases causing diarrhea are occasionally unmasked by TD and represent a third type of persistent TD, among which the well established case of incident inflammatory bowel disease poses intriguing pathogenesis questions. This review discusses recent advances in the field and provides practical recommendations for the management of TD in adult, immunocompetent returning travelers.

Beltless translocation domain of botulinum neurotoxin A embodies a minimum ion-conductive channel.

PubMed

Fischer, Audrey; Sambashivan, Shilpa; Brunger, Axel T; Montal, Mauricio

2012-01-13

Botulinum neurotoxin, the causative agent of the paralytic disease botulism, is an endopeptidase composed of a catalytic domain (or light chain (LC)) and a heavy chain (HC) encompassing the translocation domain (TD) and receptor-binding domain. Upon receptor-mediated endocytosis, the LC and TD are proposed to undergo conformational changes in the acidic endocytic environment resulting in the formation of an LC protein-conducting TD channel. The mechanism of channel formation and the conformational changes in the toxin upon acidification are important but less well understood aspects of botulinum neurotoxin intoxication. Here, we have identified a minimum channel-forming truncation of the TD, the "beltless" TD, that forms transmembrane channels with ion conduction properties similar to those of the full-length TD. At variance with the holotoxin and the HC, channel formation for both the TD and the beltless TD occurs independent of a transmembrane pH gradient. Furthermore, acidification in solution induces moderate secondary structure changes. The subtle nature of the conformational changes evoked by acidification on the TD suggests that, in the context of the holotoxin, larger structural rearrangements and LC unfolding occur preceding or concurrent to channel formation. This notion is consistent with the hypothesis that although each domain of the holotoxin functions individually, each domain serves as a chaperone for the others.

Treponema denticola chymotrypsin-like proteinase is present in early-stage mobile tongue squamous cell carcinoma and related to the clinicopathological features.

PubMed

Listyarifah, Dyah; Nieminen, Mikko T; Mäkinen, Laura K; Haglund, Caj; Grenier, Daniel; Häyry, Valtteri; Nordström, Dan; Hernandez, Marcela; Yucel-Lindberg, Tülay; Tervahartiala, Taina; Ainola, Mari; Sorsa, Timo; Hagström, Jaana

2018-05-10

Certain periodontopathogenic bacteria have been linked to cancers. Treponema denticola (Td) is associated with severe periodontitis. Chymotrypsin-like proteinase (CTLP), a major virulence factor of Td, can degrade various host proteins and peptides, and modulate inflammatory responses. However the role of Td in the tongue carcinogenesis remains unknown. This study aimed to investigate the presence of Td-CTLP in early-stage mobile tongue squamous cell carcinoma (MTSCC) and its relation to clinical and pathological characteristics. The immunopositivity of Td-CTLP was assessed in samples obtained from 60 MTSCC patients and associated with their clinicopathological data. Additionally, Td-CTLP expression was compared with immunoexpression of matrix metalloproteinases (MMP-8 and -9), toll-like receptors (TLR-2, -4, -7 and -9), c-Myc, Ki-67, Bmi-1, and Snail. Td-CTLP was present in 95% of MTSCC tumours of which many (40.4%) showed high immunopositivity. Td-CTLP positivity was significantly associated with invasion depth, tumour diameter, and the expression of TLR-7, TLR-9, and c-Myc. High Td-CTLP immunopositivity in patients under the age of 60 predicted early relapse. Our data indicate that Td and its CTLP are present in early-stage MTSCC carcinoma and may contribute to carcinogenesis, and therefore provide novel perspectives into intervention and therapeutic measures of MTSCC. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Atmospheric neutrino oscillations from upward throughgoing muon multiple scattering in MACRO

NASA Astrophysics Data System (ADS)

MACRO Collaboration; Ambrosio, M.; Antolini, R.; Bakari, D.; Baldini, A.; Barbarino, G. C.; Barish, B. C.; Battistoni, G.; Becherini, Y.; Bellotti, R.; Bemporad, C.; Bernardini, P.; Bilokon, H.; Bloise, C.; Bower, C.; Brigida, M.; Bussino, S.; Cafagna, F.; Calicchio, M.; Campana, D.; Carboni, M.; Caruso, R.; Cecchini, S.; Cei, F.; Chiarella, V.; Chiarusi, T.; Choudhary, B. C.; Coutu, S.; Cozzi, M.; de Cataldo, G.; Dekhissi, H.; de Marzo, C.; de Mitri, I.; Derkaoui, J.; de Vincenzi, M.; di Credico, A.; Favuzzi, C.; Forti, C.; Fusco, P.; Giacomelli, G.; Giannini, G.; Giglietto, N.; Giorgini, M.; Grassi, M.; Grillo, A.; Gustavino, C.; Habig, A.; Hanson, K.; Heinz, R.; Iarocci, E.; Katsavounidis, E.; Katsavounidis, I.; Kearns, E.; Kim, H.; Kumar, A.; Kyriazopoulou, S.; Lamanna, E.; Lane, C.; Levin, D. S.; Lipari, P.; Longo, M. J.; Loparco, F.; Maaroufi, F.; Mancarella, G.; Mandrioli, G.; Manzoor, S.; Margiotta, A.; Marini, A.; Martello, D.; Marzari-Chiesa, A.; Mazziotta, M. N.; Michael, D. G.; Mikheyev, S.; Monacelli, P.; Montaruli, T.; Monteno, M.; Mufson, S.; Musser, J.; Nicolò, D.; Nolty, R.; Orth, C.; Osteria, G.; Palamara, O.; Patera, V.; Patrizii, L.; Pazzi, R.; Peck, C. W.; Perrone, L.; Petrera, S.; Popa, V.; Rainò, A.; Reynoldson, J.; Ronga, F.; Rrhioua, A.; Satriano, C.; Scapparone, E.; Scholberg, K.; Sciubba, A.; Serra, P.; Sioli, M.; Sirri, G.; Sitta, M.; Spinelli, P.; Spinetti, M.; Spurio, M.; Steinberg, R.; Stone, J. L.; Sulak, L. R.; Surdo, A.; Tarlè, G.; Togo, V.; Vakili, M.; Walter, C. W.; Webb, R.

2003-07-01

The energy of atmospheric neutrinos detected by MACRO was estimated using multiple Coulomb scattering of upward throughgoing muons. This analysis allows a test of atmospheric neutrino oscillations, relying on the distortion of the muon energy distribution. These results have been combined with those coming from the upward throughgoing muon angular distribution only. Both analyses are independent of the neutrino flux normalization and provide strong evidence, above the /4σ level, in favour of neutrino oscillations.

Feasibility of Cosmic-Ray Muon Intensity Measurements for Tunnel Detection

DTIC Science & Technology

1990-06-01

BUR-’TR-3110 TECHNICAL REPORT BRL-TR-3110 mBRL I• FEASIBILITY OF COSMIC - RAY MUON INTENSITY MEASUREMENTS FOR TUNNEL DETECTION AIVARS CELIN. , JUNE...Feasibility of Cosmic - Ray Muon Intensity Measurements f or Tunnel Detection 612786H20001 4.AUTNOR(S) Aivars Celmins 7. PERORMING ORGANIZATION NAMe(S) AND... cosmic - ray muon intensity depends on the amount, of material above the point of reference and is therefore influenced by anomalies in rock density

The Muon Collider

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zisman, Michael S

2010-05-17

We describe the scientific motivation for a new type of accelerator, the muon collider. This accelerator would permit an energy-frontier scientific program and yet would fit on the site of an existing laboratory. Such a device is quite challenging, and requires a substantial R&D program. After describing the ingredients of the facility, the ongoing R&D activities of the Muon Accelerator Program are discussed. A possible U.S. scenario that could lead to a muon collider at Fermilab is briefly mentioned.

The Muon Collider

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zisman, Michael S.

2011-01-05

We describe the scientific motivation for a new type of accelerator, the muon collider. This accelerator would permit an energy-frontier scientific program and yet would fit on the site of an existing laboratory. Such a device is quite challenging, and requires a substantial R&D program. After describing the ingredients of the facility, the ongoing R&D activities of the Muon Accelerator Program are discussed. A possible U.S. scenario that could lead to a muon collider at Fermilab is briefly mentioned.

Forward scattering effects on muon imaging

NASA Astrophysics Data System (ADS)

Gómez, H.; Gibert, D.; Goy, C.; Jourde, K.; Karyotakis, Y.; Katsanevas, S.; Marteau, J.; Rosas-Carbajal, M.; Tonazzo, A.

2017-12-01

Muon imaging is one of the most promising non-invasive techniques for density structure scanning, specially for large objects reaching the kilometre scale. It has already interesting applications in different fields like geophysics or nuclear safety and has been proposed for some others like engineering or archaeology. One of the approaches of this technique is based on the well-known radiography principle, by reconstructing the incident direction of the detected muons after crossing the studied objects. In this case, muons detected after a previous forward scattering on the object surface represent an irreducible background noise, leading to a bias on the measurement and consequently on the reconstruction of the object mean density. Therefore, a prior characterization of this effect represents valuable information to conveniently correct the obtained results. Although the muon scattering process has been already theoretically described, a general study of this process has been carried out based on Monte Carlo simulations, resulting in a versatile tool to evaluate this effect for different object geometries and compositions. As an example, these simulations have been used to evaluate the impact of forward scattered muons on two different applications of muon imaging: archaeology and volcanology, revealing a significant impact on the latter case. The general way in which all the tools used have been developed can allow to make equivalent studies in the future for other muon imaging applications following the same procedure.

Investigating cosmic rays and air shower physics with IceCube/IceTop

NASA Astrophysics Data System (ADS)

Dembinski, Hans

2017-06-01

IceCube is a cubic-kilometer detector in the deep ice at South Pole. Its square-kilometer surface array, IceTop, is located at 2800 m altitude. IceTop is large and dense enough to cover the cosmic-ray energy spectrum from PeV to EeV energies with a remarkably small systematic uncertainty, thanks to being close to the shower maximum. The experiment offers new insights into hadronic physics of air showers by observing three components: the electromagnetic signal at the surface, GeV muons in the periphery of the showers, and TeV muons in the deep ice. The cosmic-ray flux is measured with the surface signal. The mass composition is extracted from the energy loss of TeV muons observed in the deep ice in coincidence with signals at the surface. The muon lateral distribution is obtained from GeV muons identified in surface signals in the periphery of the shower. The energy spectrum of the most energetic TeV muons is also under study, as well as special events with laterally separated TeV muon tracks which originate from high-pT TeV muons. A combination of all these measurements opens the possibility to perform powerful new tests of hadronic interaction models used to simulate air showers. The latest results will be reviewed from this perspective.

Positive Selection and Multiple Losses of the LINE-1-Derived L1TD1 Gene in Mammals Suggest a Dual Role in Genome Defense and Pluripotency

PubMed Central

Yang, Lei; Neme, Rafik; Wichman, Holly A.; Malik, Harmit S.

2014-01-01

Mammalian genomes comprise many active and fossilized retroelements. The obligate requirement for retroelement integration affords host genomes an opportunity to ‘domesticate’ retroelement genes for their own purpose, leading to important innovations in genome defense and placentation. While many such exaptations involve retroviruses, the L1TD1 gene is the only known domesticated gene whose protein-coding sequence is almost entirely derived from a LINE-1 (L1) retroelement. Human L1TD1 has been shown to play an important role in pluripotency maintenance. To investigate how this role was acquired, we traced the origin and evolution of L1TD1. We find that L1TD1 originated in the common ancestor of eutherian mammals, but was lost or pseudogenized multiple times during mammalian evolution. We also find that L1TD1 has evolved under positive selection during primate and mouse evolution, and that one prosimian L1TD1 has ‘replenished’ itself with a more recent L1 ORF1 from the prosimian genome. These data suggest that L1TD1 has been recurrently selected for functional novelty, perhaps for a role in genome defense. L1TD1 loss is associated with L1 extinction in several megabat lineages, but not in sigmodontine rodents. We hypothesize that L1TD1 could have originally evolved for genome defense against L1 elements. Later, L1TD1 may have become incorporated into pluripotency maintenance in some lineages. Our study highlights the role of retroelement gene domestication in fundamental aspects of mammalian biology, and that such domesticated genes can adopt different functions in different lineages. PMID:25211013

Application of Hermitian time-dependent coupled-cluster response Ansätze of second order to excitation energies and frequency-dependent dipole polarizabilities

NASA Astrophysics Data System (ADS)

Wälz, Gero; Kats, Daniel; Usvyat, Denis; Korona, Tatiana; Schütz, Martin

2012-11-01

Linear-response methods, based on the time-dependent variational coupled-cluster or the unitary coupled-cluster model, and truncated at the second order according to the Møller-Plesset partitioning, i.e., the TD-VCC[2] and TD-UCC[2] linear-response methods, are presented and compared. For both of these methods a Hermitian eigenvalue problem has to be solved to obtain excitation energies and state eigenvectors. The excitation energies thus are guaranteed always to be real valued, and the eigenvectors are mutually orthogonal, in contrast to response theories based on “traditional” coupled-cluster models. It turned out that the TD-UCC[2] working equations for excitation energies and polarizabilities are equivalent to those of the second-order algebraic diagrammatic construction scheme ADC(2). Numerical tests are carried out by calculating TD-VCC[2] and TD-UCC[2] excitation energies and frequency-dependent dipole polarizabilities for several test systems and by comparing them to the corresponding values obtained from other second- and higher-order methods. It turns out that the TD-VCC[2] polarizabilities in the frequency regions away from the poles are of a similar accuracy as for other second-order methods, as expected from the perturbative analysis of the TD-VCC[2] polarizability expression. On the other hand, the TD-VCC[2] excitation energies are systematically too low relative to other second-order methods (including TD-UCC[2]). On the basis of these results and an analysis presented in this work, we conjecture that the perturbative expansion of the Jacobian converges more slowly for the TD-VCC formalism than for TD-UCC or for response theories based on traditional coupled-cluster models.

The electro-mechanical window in anaesthetized guinea pigs: a new marker in screening for Torsade de Pointes risk

PubMed Central

Guns, P-J; Johnson, DM; Van Op den bosch, J; Weltens, E; Lissens, J

2012-01-01

BACKGROUND AND PURPOSE QT prolongation is commonly used as a surrogate marker for Torsade de Pointes (TdP) risk of non-cardiovascular drugs. However, use of this indirect marker often leads to misinterpretation of the realistic TdP risk, as tested compounds may cause QT prolongation without evoking TdP in humans. A negative electro-mechanical (E-M) window has recently been proposed as an alternative risk marker for TdP in a canine LQT1 model. Here, we evaluated the E-M window in anaesthetized guinea pigs as a screening marker for TdP in humans. EXPERIMENTAL APPROACH The effects of various reference drugs and changes in body temperature on the E-M window were assessed in instrumented guinea pigs. The E-M window was defined as the delay between the duration of the electrical (QT interval) and mechanical (QLVPend) systole. KEY RESULTS Drugs with known TdP liability (quinidine, haloperidol, domperidone, terfenadine, thioridazine and dofetilide), but not those with no TdP risk in humans (salbutamol and diltiazem) consistently decreased the E-M window. Interestingly, drugs with known clinical QT prolongation, but with low risk for TdP (amiodarone, moxifloxacin and ciprofloxacin) did not decrease the E-M window. Furthermore, the E-M window was minimally affected by changes in heart rate or body temperature. CONCLUSIONS AND IMPLICATIONS A decreased E-M window was consistently observed with drugs already known to have high TdP risk, but not with drugs with low or no TdP risk. These results suggest that the E-M window in anaesthetized guinea pigs is a risk marker for TdP in humans. PMID:22122450

Many-Body Perturbation Theory (MBPT) and Time-Dependent Density-Functional Theory (TD-DFT): MBPT Insights About What Is Missing In, and Corrections To, the TD-DFT Adiabatic Approximation.

PubMed

Casida, Mark E; Huix-Rotllant, Miquel

2016-01-01

In their famous paper, Kohn and Sham formulated a formally exact density-functional theory (DFT) for the ground-state energy and density of a system of N interacting electrons, albeit limited at the time by certain troubling representability questions. As no practical exact form of the exchange-correlation (xc) energy functional was known, the xc-functional had to be approximated, ideally by a local or semilocal functional. Nowadays, however, the realization that Nature is not always so nearsighted has driven us up Perdew's Jacob's ladder to find increasingly nonlocal density/wavefunction hybrid functionals. Time-dependent (TD-) DFT is a younger development which allows DFT concepts to be used to describe the temporal evolution of the density in the presence of a perturbing field. Linear response (LR) theory then allows spectra and other information about excited states to be extracted from TD-DFT. Once again the exact TD-DFT xc-functional must be approximated in practical calculations and this has historically been done using the TD-DFT adiabatic approximation (AA) which is to TD-DFT very similar to what the local density approximation (LDA) is to conventional ground-state DFT. Although some of the recent advances in TD-DFT focus on what can be done within the AA, others explore ways around the AA. After giving an overview of DFT, TD-DFT, and LR-TD-DFT, this chapter focuses on many-body corrections to LR-TD-DFT as one way to build hybrid density-functional/wavefunction methodology for incorporating aspects of nonlocality in time not present in the AA.

Determinants of torsades de pointes in older patients with drug-associated long QT syndrome: a case-control study.

PubMed

Goutelle, Sylvain; Sidolle, Elodie; Ducher, Michel; Caron, Jacques; Timour, Quadiri; Nony, Patrice; Gouraud, Aurore

2014-08-01

Many elderly patients are routinely exposed to drugs that may prolong the cardiac QT interval and cause Torsades de pointes (TdP). However, predictors of TdP in patients with drug-associated long QT syndrome (LQTS) are not fully understood, especially in the geriatric population. The objective of this study was to identify risk factors of TdP in elderly patients with drug-associated LQTS. In this retrospective, case-control study, documented reports of drug-associated LQTS plus TdP (n = 125) and LQTS without TdP (n = 81) in patients ≥65 years of age were retrieved from the French Pharmacovigilance Database over a 10-year period. Available clinical, biological, and drug therapy data were compared in the two groups and logistic regression was performed to identify significant predictors of TdP. The uncorrected QT interval was significantly longer in patients with TdP than in patients without TdP (577 ± 79 vs. 519 ± 68 ms; p = 0.0001). The number of drugs with a known risk of TdP administered to each patient was not a predictor of arrhythmia, nor was female gender. Logistic regression analysis identified the uncorrected QT interval as the only significant predictor of TdP. The receiver operating characteristic curve analysis was characterized by an area under the curve of 0.77 (95 % confidence interval 0.64-0.88) and a QT cutoff of 550 ms. The uncorrected QT interval was significantly associated with the probability of TdP in elderly patients with acquired, drug-associated LQTS.

Elucidation of the new generation fluorescent protein tdTomato for space related radiobiological research

NASA Astrophysics Data System (ADS)

Chishti, Arif Ali; Baumstark-Khan, Christa; Hellweg, Christine; Reitz, Guenther

Astronauts in space are exposed to a potentially harmful radiation field, which does not exist in its quality and quantity on earth. Radiation exposure in space can lead to delayed or acute health effects. A successful long-term space mission requires better risk estimation and development of appropriate countermeasures, therefore study of the cellular radiation response is necessary. Ionizing radiation can provoke active cellular responses (cell cycle arrest, DNA repair, apoptosis or other forms of cell type). Exposure to ionizing radiation also activates various signaling pathways in human cells. In the cellular radiation-response, two pivotal signal transduction pathways have to be comprehensively studied i.e. the p53-pathway and NF-κB-pathway. Discovery of fluorescent proteins has revolutionized biological research by making it possible to carry out functional studies in living cells and understanding complex signaling pathways. Previously the green fluorescent proteins EGFP and d2EGFP were used for signaling pathway studies. In this work the new red fluorescent protein tdTomato will be used for comprehensive investigation of NF-κB and other transcription factor activation after exposure of human cells to ionizing radiation (X-rays, heavy ions; space conditions). tdTomato has many advantages over EGFP because of its high fluorescence signals and a better signal/noise ratio in human cells. The previously constructed reporter system with d2EGFP was used to evaluate NF-kB activation after exposure to heavy ion particles of different biological effectiveness. The sensitivity threshold of this system was determined to be 2 particle traversals per cell nucleus. In the current study a more sensitive reporter assay will be constructed using a GAL4-VP16 turbo system that comprises a receptor plasmid and a reporter plasmid. This reporter assay will be designed and constructed with tdTomato and evaluation will be done with different molecular techniques.

Quantification of Alkyl Nitrates in Ambient Air by Thermal Dissociation Cavity Ring-Down Spectroscopy with Preconcentration

NASA Astrophysics Data System (ADS)

Ye, C. Z.; Osthoff, H. D.; Taha, Y. M.; Pak, J. K.; Saowapon, M. T.

2015-12-01

Alkyl nitrates (AN, molecular formula RONO2) play a crucial role in the troposphere as temporary reservoirs of nitrogen oxides (NOx =NO +NO2) and by acting as chain terminators in the photochemical production of ozone. Mixing ratios of AN in ambient air are commonly quantified by gas chromatography with electron capture or mass spectrometric detection (GC-ECD or GC-MS) coupled to purge-and-trap preconcentration, usually on Tenax sorbent, to improve the detection limits. The analysis, however, is quite laborious as there are many alkyl nitrates that are low in individual abundance (often less than 1 parts-per-trillion by volume, pptv) and that exhibit different instrumental response factors. An alternative method is to determine alkyl nitrates as a sum (ΣAN) by thermal dissociation (TD) to a common fragment (NO2), which can then be quantified with a uniform response factor by optical absorption, for example by cavity ring-down spectroscopy (CRDS). However, the determination of ΣAN by TD-CRDS is hampered by its relatively high detection limits (several 100 pptv) and secondary chemistry following TD that results in both negative and positive interferences and depends on the composition of the ambient air sampled. In this work, a TD-CRDS equipped with a Tenax preconcentration unit is described. Matrix effects are minimized by desorbing the samples from the Tenax in a background of nitrogen. The performance of the instrument, in particular the recovery from the Tenax sorbent, was evaluated by sampling laboratory-generated mixtures of alkyl and peroxyacyl nitrates. Field data from a coastal site collected during the Ozone-depleting reactions in a coastal atmosphere (ORCA) campaign, which took place at the Amphitrite Point Observatory in Ucluelet, BC, from July 6 - 31, 2015, are presented. Advantages and disadvantages of the new method are discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yanai, Takeshi; Fann, George I.; Beylkin, Gregory

Using the fully numerical method for time-dependent Hartree–Fock and density functional theory (TD-HF/DFT) with the Tamm–Dancoff (TD) approximation we use a multiresolution analysis (MRA) approach to present our findings. From a reformulation with effective use of the density matrix operator, we obtain a general form of the HF/DFT linear response equation in the first quantization formalism. It can be readily rewritten as an integral equation with the bound-state Helmholtz (BSH) kernel for the Green's function. The MRA implementation of the resultant equation permits excited state calculations without virtual orbitals. Moreover, the integral equation is efficiently and adaptively solved using amore » numerical multiresolution solver with multiwavelet bases. Our implementation of the TD-HF/DFT methods is applied for calculating the excitation energies of H 2, Be, N 2, H 2O, and C 2H 4 molecules. The numerical errors of the calculated excitation energies converge in proportion to the residuals of the equation in the molecular orbitals and response functions. The energies of the excited states at a variety of length scales ranging from short-range valence excitations to long-range Rydberg-type ones are consistently accurate. It is shown that the multiresolution calculations yield the correct exponential asymptotic tails for the response functions, whereas those computed with Gaussian basis functions are too diffuse or decay too rapidly. Finally, we introduce a simple asymptotic correction to the local spin-density approximation (LSDA) so that in the TDDFT calculations, the excited states are correctly bound.« less

Inactivation of thyA in Staphylococcus aureus Attenuates Virulence and Has a Strong Impact on Metabolism and Virulence Gene Expression

PubMed Central

Kriegeskorte, Andre; Block, Desiree; Drescher, Mike; Windmüller, Nadine; Mellmann, Alexander; Baum, Cathrin; Neumann, Claudia; Lorè, Nicola Ivan; Bragonzi, Alessandra; Liebau, Eva; Hertel, Patrick; Seggewiss, Jochen; Becker, Karsten; Proctor, Richard A.; Peters, Georg

2014-01-01

ABSTRACT Staphylococcus aureus thymidine-dependent small-colony variants (TD-SCVs) are frequently isolated from patients with chronic S. aureus infections after long-term treatment with trimethoprim-sulfamethoxazole (TMP-SMX). While it has been shown that TD-SCVs were associated with mutations in thymidylate synthase (TS; thyA), the impact of such mutations on protein function is lacking. In this study, we showed that mutations in thyA were leading to inactivity of TS proteins, and TS inactivity led to tremendous impact on S. aureus physiology and virulence. Whole DNA microarray analysis of the constructed ΔthyA mutant identified severe alterations compared to the wild type. Important virulence regulators (agr, arlRS, sarA) and major virulence determinants (hla, hlb, sspAB, and geh) were downregulated, while genes important for colonization (fnbA, fnbB, spa, clfB, sdrC, and sdrD) were upregulated. The expression of genes involved in pyrimidine and purine metabolism and nucleotide interconversion changed significantly. NupC was identified as a major nucleoside transporter, which supported growth of the mutant during TMP-SMX exposure by uptake of extracellular thymidine. The ΔthyA mutant was strongly attenuated in virulence models, including a Caenorhabditis elegans killing model and an acute pneumonia mouse model. This study identified inactivation of TS as the molecular basis of clinical TD-SCV and showed that thyA activity has a major role for S. aureus virulence and physiology. PMID:25073642

Tetrahedral 4 α and 12C+α cluster structures in 16O

NASA Astrophysics Data System (ADS)

Kanada-En'yo, Yoshiko

2017-09-01

I have investigated structures of the ground and excited states of 16O with the method of variation after spin-parity projection in the antisymmetrized molecular dynamics model combined with the generator coordinate method of 12C+α cluster. The calculation reasonably reproduces the experimental energy spectra; E 2 , E 3 , E 4 , and I S 1 transitions; and α -decay properties. The formation of 4 α clusters has been confirmed from nucleon degrees of freedom in the AMD model without assuming the existence of any clusters. They form "tetrahedral" 4 α - and 12C+α cluster structures. The 12C+α structure constructs the Kπ=0+ band consisting of the 02+, 21+, and 41+ states and the Kπ=0- band of the 12-, 32-, and 51- states. The 01+, 31-, and 42+ states are assigned to the ground band constructed from the tetrahedral 4 α structure. The 01+ and 31- are approximately interpreted as Td band members with the ideal tetrahedral configuration. The ground-state 4 α correlation plays an important role in the enhancement of the E 3 transition strength to the 31-. The 42+ state is not the ideal Td member but constructed from a distorted tetrahedral 4 α structure. Moreover, significant state mixing of the tetrahedral 4 α and 12C+α cluster structures occurs between 41+ and 42+ states, indicating that the Td configuration of 4 α is rather fragile at Jπ=4+ .

A combined TD-DFT and spectroscopic investigation of the solute-solvent interactions of efavirenz

NASA Astrophysics Data System (ADS)

Jordaan, Maryam A.; Singh, Parvesh; Martincigh, Bice S.

2016-03-01

Efavirenz, commercially known as Sustiva® or Stocrin®, is a first-line antiretroviral treatment for HIV/AIDS. The clinical efficacy of efavirenz is, however, hindered by its solubility. We sought to investigate the solute-solvent effects of efavirenz by means of a combined qualitative study implementing UV-visible spectrophotometry, 1H NMR spectroscopy and time-dependent density functional theory (TD-DFT) calculations. The UV spectrum displayed two main absorbance maxima, band I and band II at 246-260 and 291-295 nm, respectively. A general bathochromic shift was noticed from the non-polar solvent cyclohexane to the most polar solvent DMSO (≈ 13.69 nm) in band I and a smaller bathochromic (≈ 2.17 nm) and hyperchromic shift was observed in band II. We propose that these observations are due to the role of the amino (NH) and carbonyl (CO) functionalities which induce charge-transfer and intra- and inter-molecular hydrogen bonding. The aromatic and amine protons showed the most deshielded effects in the observed chemical shifts (δ) in the more polar DMSO-d6 solvent relative to CDCl3. The 1H NMR chemical shifts observed are due to the increased delocalization of the lone pair electrons of the amino nitrogen with increased polarity of the more polar DMSO solvent. The theoretical reproduction of the UV and 1H NMR spectra by means of TD-DFT is in good agreement with the experimental results.

Imaging CO2 reservoirs using muons borehole detectors

NASA Astrophysics Data System (ADS)

Bonneville, A.; Bonal, N.; Lintereur, A.; Mellors, R. J.; Paulsson, B. N. P.; Rowe, C. A.; Varner, G. S.; Kouzes, R.; Flygare, J.; Mostafanezhad, I.; Yamaoka, J. A. K.; Guardincerri, E.; Chapline, G.

2016-12-01

Monitoring of the post-injection fate of CO2 in subsurface reservoirs is of utmost importance. Generally, monitoring options are active methods, such as 4D seismic reflection or pressure measurements in monitoring wells. We present a method of 4D density tomography of subsurface CO2 reservoirs using cosmic-ray muon detectors deployed in a borehole. Although muon flux rapidly decreases with depth, preliminary analyses indicate that the muon technique is sufficiently sensitive to effectively map density variations caused by fluid displacement at depths consistent with proposed CO2reservoirs. The intensity of the muon flux is, to first order, inversely proportional to the density times the path length, with resolution increasing with measurement time. The primary technical challenge preventing deployment of this technology in subsurface locations is the lack of miniaturized muon-tracking detectors both capable of fitting in standard boreholes and that will be able to resist the harsh underground conditions (temperature, pressure, corrosion) for long periods of time. Such a detector with these capabilities has been developed through a collaboration supported by the U.S. Department of Energy. A prototype has been tested in underground laboratories during 2016. In particular, we will present results from a series of tests performed in a tunnel comparing efficiencies, and angular and position resolution to measurements collected at the same locations by large instruments developed by Los Alamos and Sandia National Laboratories. We will also present the results of simulations of muon detection for various CO2 reservoir situations and muon detector configurations. Finally, to improve imaging of 3D subsurface structures, a combination of seismic data, gravity data, and muons can be used. Because seismic waves, gravity anomalies, and muons are all sensitive to density, the combination of two or three of these measurements promises to be a powerful way to improve spatial resolution and reduce uncertainty. With sufficient crossing paths, the muon data can resolve spatial density anomalies, rather than simply a path-integrated flux variance. Several approaches for combining these three measurements will be presented and discussed.

Density tomography using cosmic ray muons: feasibility domain and field applications

NASA Astrophysics Data System (ADS)

Lesparre, N.; Gibert, D.; Marteau, J.; Déclais, Y.; Carbone, D.; Galichet, E.

2010-12-01

Muons are continuously produced when the protons forming the primary cosmic rays decay during their interactions with the molecules of the upper atmosphere. Both their short cross-section and their long life-time make the muons able to cross hectometers and even kilometers of rock before disintegrating. The flux of muons crossing a geological volume strongly depends on the quantity of matter encountered along their trajectories and, depending on both its size and its density, the geological object appears more or less opaque to muons. By measuring the muon flux emerging from the studied object and correcting for its geometry, the density structure can be deduced. The primary information obtained is the density averaged along muons trajectories and, to recover the 3D density distribution. The detector has to be moved around the target to acquire multi-angle images of the density structure. The inverse problem to be solved shares common features with seismic travel-time tomography and X-ray medical scans, but it also has specificities like Poissonian statistics, low signal-to-noise ratio and scattering which are discussed. Muon telescopes have been designed to sustain installations in harsh conditions such as might be encountered on volcanoes. Data acquired in open sky at various latitude and altitude allow to adjust the incoming muon flux model and to observe its temporal variations. The muon interactions with matter and the underground flux are constrained with data sets acquired inside the underground laboratory of the Mont Terri. The data analysis and the telescope model development are detailed. A model of the muon flux across a volcano is confronted to first measurements on La Soufrière de Guadeloupe volcano. The model takes into account a priori informations and solving kernels are computed to deduce the spatial resolution in order to define the elements size of the model heterogeneities. The spatio-temporal resolution of the method is in relation with the geometry and the installation time of the detector, it is evaluated to get the detectable density variations. The impact of additional telescopes around the volcano on the data quality is estimated to determine the best future locations of installations.

Perpetuation of torsade de pointes in heterogeneous hearts: competing foci or re-entry?

PubMed

Vandersickel, Nele; de Boer, Teun P; Vos, Marc A; Panfilov, Alexander V

2016-12-01

The underlying mechanism of torsade de pointes (TdP) remains of debate: perpetuation may be due to (1) focal activity or (2) re-entrant activity. The onset of TdP correlates with action potential heterogeneities in different regions of the heart. We studied the mechanism of perpetuation of TdP in silico using a 2D model of human cardiac tissue and an anatomically accurate model of the ventricles of the human heart. We found that the mechanism of perpetuation TdP depends on the degree of heterogeneity. If the degree of heterogeneity is large, focal activity alone can sustain a TdP, otherwise re-entrant activity emerges. This result can help to understand the relationship between the mechanisms of TdP and tissue properties and may help in developing new drugs against it. Torsade de pointes (TdP) can be the consequence of cardiac remodelling, drug effects or a combination of both. The mechanism underlying TdP is unclear, and may involve triggered focal activity or re-entry. Recent work by our group has indicated that both cases may exist, i.e. TdPs induced in the chronic atrioventricular block (CAVB) dog model may have a focal origin or are due to re-entry. Also it was found that heterogeneities might play an important role. In the current study we have used computational modelling to further investigate the mechanisms involved in TdP initiation and perpetuation, especially in the CAVB dog model, by the addition of heterogeneities with reduced repolarization reserve in comparison with the surrounding tissue. For this, the TNNP computer model was used for computations. We demonstrated in 2D and 3D simulations that ECGs with the typical TdP morphology can be caused by both multiple competing foci and re-entry circuits as a result of introduction of heterogeneities, depending on whether the heterogeneities have a large or a smaller reduced repolarization reserve in comparison with the surrounding tissue. Large heterogeneities can produce ectopic TdP, while smaller heterogeneities will produce re-entry-type TdP. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

Summary of the Committee to Advise on Tropical Medicine and Travel (CATMAT) Statement on Travellers’ Diarrhea

PubMed Central

Libman, M

2015-01-01

Background Most travellers’ diarrhea (TD) infections occur during travel to low- and middle-income countries. Type of travel, duration of stay, age of traveller and presence of certain medical conditions are important factors to consider for risk of TD. The Committee to Advise on Tropical Medicine and Travel (CATMAT) assembled a TD working group to develop recommendations on prevention and treatment of TD in travellers. This document is a summary of the Statement on Travellers’ Diarrhea. Methods Following a systematic review of the literature, recommendations on the prevention and treatment of TD were developed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) methodology to evaluate data quality, benefits and harms of the intervention, and values and preferences of the traveller. Other recommendations were based on a review of the literature and expert opinion. Recommendations Using the GRADE methodology, CATMAT concluded that oral cholera vaccine should not be routinely recommended to prevent TD in Canadian travellers. This recommendation was based on moderate quality data that showed this vaccine was not effective in preventing TD in travellers compared to placebo. Bismuth subsalicylate (BSS), fluoroquinolones or rifaximin are options for the prevention of TD based on high-quality data for BSS and fluoroquinolones and moderate evidence for rifaximin. For the treatment of TD, loperamide (alone or in combination with antibiotics), fluoroquinolones, azithromycin and rifaximin are all options, with varying degrees of data quality. Based on available evidence and expert opinion, CATMAT recommends handwashing or the use of hand sanitizer, as well as prudent choice and preparation of food and beverages as best practices for preventing diarrhea while travelling. At this time, a recommendation cannot be made for either the use of probiotics and prebiotics to prevent TD or the use of BSS to treat TD due to insufficient available evidence. Conclusion With the exception of BSS for prevention of TD (strong recommendation for use), CATMAT conditionally recommends the use of each of the other GRADE-evaluated preventive and therapeutic products assessed in this Statement. These CATMAT recommendations should be considered as options in the prevention and treatment of TD based on the particular situation of the traveller. PMID:29769922

Rotation of molecular hydrogen in Si: unambiguous identification of ortho-H(2) and para-D(2).

PubMed

Chen, E Elinor; Stavola, Michael; Beall Fowler, W; Zhou, J Anna

2002-06-17

The 3618.4 and 2642.6 cm(-1) infrared absorption lines of interstitial H(2) and D(2) in silicon have been studied under applied uniaxial stresses. The resulting splittings and their small dependence on isotope establish that H(2) in Si is a nearly free rotor and that these lines arise from vibrational transitions between rovibrational states with rotational quantum number J = 1 (T(2) in T(d) symmetry) for ortho-H(2) and para-D(2).

Electronic states of Myricetin. UV-Vis polarization spectroscopy and quantum chemical calculations.

PubMed

Vojta, Danijela; Karlsen, Eva Marie; Spanget-Larsen, Jens

2017-02-15

Myricetin (3,3',4',5,5',7'-hexahydroxyflavone) was investigated by linear dichroism spectroscopy on molecular samples partially aligned in stretched poly(vinyl alcohol) (PVA). At least five electronic transitions in the range 40,000-20,000cm -1 were characterized with respect to their wavenumbers, relative intensities, and transition moment directions. The observed bands were assigned to electronic transitions predicted with TD-B3LYP/6-31+G(d,p). Copyright © 2016 Elsevier B.V. All rights reserved.

Utilisation de dispositifs a transfert de charge pour la detection de muons cosmiques dans un contexte de tomographie

NASA Astrophysics Data System (ADS)

Marion-Ouellet, Laurence Olivier

Faced with the threat of nuclear terrorism, many countries have purchased radioactive material detectors to protect their borders. These systems usually detect gamma, beta or alpha ray emissions coming from uranium, radium, cesium or other radioactive material. However, the radioactive source can be concealed by thick lead shielding and radiation absorbing material. With enough shielding, an individual wishing to smuggle illicit nuclear material could cross borders without alerting the authorities. To address this risk, several laboratories worldwide are working on muon tomography technology. This technique aims to detect shielded nuclear material by measuring the deflection of a cosmic muon after crossing the cargo of interest. Since this deviation is a function of the Z number of atoms (the number of protons inside the nucleus), it is possible to determine the contents of the cargo. To calculate the angular deviation, we must first measure the position of the muon on four succeding horizontal planes (two pre-cargo, two after). This task is traditionally assigned to wire chambers or scintillators detectors but could also be fulfilled by CCD detectors (Charge-Coupled Devices). This work specifically addresses the use of CCDs for muon tomography. This thesis' objective is to determine the feasibility of using a commercial CCD based muon detector. To answer this question, numerical simulations have been performed using the software Geant4. This work allows us to obtain the theoretical energy deposition of muons of various kinetic energies into a silicon wafer representing a CCD chip. These results are then compared to numerical values derived from the theory presented in the literature to verify their validity. The muons' energy is varied from 50 MeV to 1 TeV and silicium thicknesses of 300 and 775 mum are studied. The results obtained indicate that a muon of 4 GeV (most probable cosmic muon energy) should deposit 106 and 281 keV for an average thickness of 300 and 775 mum respectively, which translates to 28 000 and 76 000 electron-hole pairs as signal for the two thicknesses. All the results obtained through Geant4 are consistent with the known theory of energy deposits in thin semiconductor materials. A practical experimentation was also considered, using an astronomical camera DMK51 AU02.AS to capture a series of images hidden from light with the camera turned towards the sky. The pixels presenting a high intensity are considered to be the consequence of the passage of a muon. The expected rate of detection according to the size of the detector was 0.372 muons per minute but the results were 0.1578 muons per minute for data taken inside Polytechnique and 0.1615 for images taken outside. Therefore, the presence of about two meters of concrete above the camera does not significantly affect the detectable muon flux. However, the ratio of 40 % between expected signal and the observations is explained by the small size of the sensitive area of a pixel when compared to its total size. Components such as electrodes and differently doped silicon occupy a certain area in the pixel causing it, in the eyes of the muon, to be much smaller. A smaller pixel will ensure a smaller expected muon flux. Also, the possibility that the energy deposition is simply too small in some cases to be detected is also studied in the results section and solutions to resolve this problem are presented in the conclusion.

Studies of Muons in Extensive Air Showers from Ultra-High Energy Cosmic Rays Observed with the Telescope Array Surface Detector

NASA Astrophysics Data System (ADS)

Takeishi, R.; Sagawa, H.; Fukushima, M.; Takeda, M.; Nonaka, T.; Kawata, K.; Kido, E.; Sakurai, N.; Okuda, T.; Ogio, S.; Matthews, J. N.; Stokes, B.

The number of muons in the air shower induced by ultra-high energy cosmic rays (UHECRs) has been measured with surface detector (SD) arrays of various experiments. Monte Carlo (MC) prediction of the number of muons in air showers depends on hadronic interaction models and the primary cosmic ray composition. By comparing the measured number of muons with the MC prediction, hadronic interaction models can be tested. The Pierre Auger Observatory reported that the number of muons measured by water Cherenkov type SD is about 1.8 times larger than the MC prediction for proton with QGSJET II-03 model. The number of muons in the Auger data is also larger than the MC prediction for iron. The Telescope Array experiment adopts plastic scintillator type SD, which is sensitive to the electromagnetic component that is the major part of secondary particles in the air shower. To search for the high muon purity condition in air showers observed by the TA, we divided air shower events into subsets by the zenith angle θ, the azimuth angle ϕ relative to the shower arrival direction projected onto the ground, and the distance R from shower axis. As a result, we found subsets with the high muon purity 65%, and compared the charge density between observed data and MC. The typical ratios of the charge density of the data to that of the MC are 1.71 ± 0.10 at 1870 m < R < 2150 m and 3.24 ± 0.40 at 2850 m < R < 3280 m. The difference in the charge density between the data and the MC is larger at the higher muon purity. These results imply that the excess of the charge density in the data is partly explained by the muon excess.

High Pressure Gas Filled RF Cavity Beam Test at the Fermilab MuCool Test Area

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freemire, Ben

2013-05-01

The high energy physics community is continually looking to push the limits with respect to the energy and luminosity of particle accelerators. In the realm of leptons, only electron colliders have been built to date. Compared to hadrons, electrons lose a large amount of energy when accelerated in a ring through synchrotron radiation. A solution to this problem is to build long, straight accelerators for electrons, which has been done with great success. With a new generation of lepton colliders being conceived, building longer, more powerful accelerators is not the most enticing option. Muons have been proposed as an alternativemore » particle to electrons. Muons lose less energy to synchrotron radiation and a Muon Collider can provide luminosity within a much smaller energy range than a comparable electron collider. This allows a circular collider to be built with higher attainable energy than any present electron collider. As part of the accelerator, but separate from the collider, it would also be possible to allow the muons to decay to study neutrinos. The possibility of a high energy, high luminosity muon collider and an abundant, precise source of neutrinos is an attractive one. The technological challenges of building a muon accelerator are many and diverse. Because the muon is an unstable particle, a muon beam must be cooled and accelerated to the desired energy within a short amount of time. This requirement places strict requisites on the type of acceleration and focusing that can be used. Muons are generated as tertiary beams with a huge phase space, so strong magnetic fields are required to capture and focus them. Radio frequency (RF) cavities are needed to capture, bunch and accelerate the muons. Unfortunately, traditional vacuum RF cavities have been shown to break down in the magnetic fields necessary for capture and focusing.« less

Feasibility of using backscattered muons for archeological imaging

NASA Astrophysics Data System (ADS)

Bonal, N.; Preston, L. A.

2013-12-01

Use of nondestructive methods to accurately locate and characterize underground objects such as rooms and tools found at archeological sites is ideal to preserve these historic sites. High-energy cosmic ray muons are very sensitive to density variation and have been used to image volcanoes and archeological sites such as the Egyptian and Mayan pyramids. Muons are subatomic particles produced in the upper atmosphere that penetrate the earth's crust up to few kilometers. Their absorption rate depends on the density of the materials through which they pass. Measurements of muon flux rate at differing directions provide density variations of the materials between the muon source (cosmic rays and neutrino interactions) and the detector, much like a CAT scan. Currently, muon tomography can resolve features to the sub-meter scale making it useful for this type of work. However, the muon detector must be placed below the target of interest. For imaging volcanoes, the upper portion is imaged when the detector is placed on the earth's surface at the volcano's base. For sites of interest beneath the ground surface, the muon detector would need to be placed below the site in a tunnel or borehole. Placing the detector underground can be costly and may disturb the historical site. We will assess the feasibility of imaging the subsurface using upward traveling muons, to eliminate the current constraint of positioning the detector below the target. This work consists of three parts 1) determine the backscattered flux rate from theory, 2) distinguish backscattered from forward scattered muons at the detector, and 3) validate the theoretical results with field experimentation. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

Muon energy estimate through multiple scattering with the MACRO detector

NASA Astrophysics Data System (ADS)

Ambrosio, M.; Antolini, R.; Auriemma, G.; Bakari, D.; Baldini, A.; Barbarino, G. C.; Barish, B. C.; Battistoni, G.; Becherini, Y.; Bellotti, R.; Bemporad, C.; Bernardini, P.; Bilokon, H.; Bloise, C.; Bower, C.; Brigida, M.; Bussino, S.; Cafagna, F.; Calicchio, M.; Campana, D.; Candela, A.; Carboni, M.; Caruso, R.; Cassese, F.; Cecchini, S.; Cei, F.; Chiarella, V.; Choudhary, B. C.; Coutu, S.; Cozzi, M.; de Cataldo, G.; de Deo, M.; Dekhissi, H.; de Marzo, C.; de Mitri, I.; Derkaoui, J.; de Vincenzi, M.; di Credico, A.; Dincecco, M.; Erriquez, O.; Favuzzi, C.; Forti, C.; Fusco, P.; Giacomelli, G.; Giannini, G.; Giglietto, N.; Giorgini, M.; Grassi, M.; Gray, L.; Grillo, A.; Guarino, F.; Gustavino, C.; Habig, A.; Hanson, K.; Heinz, R.; Iarocci, E.; Katsavounidis, E.; Katsavounidis, I.; Kearns, E.; Kim, H.; Kyriazopoulou, S.; Lamanna, E.; Lane, C.; Levin, D. S.; Lindozzi, M.; Lipari, P.; Longley, N. P.; Longo, M. J.; Loparco, F.; Maaroufi, F.; Mancarella, G.; Mandrioli, G.; Margiotta, A.; Marini, A.; Martello, D.; Marzari-Chiesa, A.; Mazziotta, M. N.; Michael, D. G.; Monacelli, P.; Montaruli, T.; Monteno, M.; Mufson, S.; Musser, J.; Nicolo, D.; Nolty, R.; Orth, C.; Osteria, G.; Palamara, O.; Patera, V.; Patrizii, L.; Pazzi, R.; Peck, C. W.; Perrone, L.; Petrera, S.; Pistilli, P.; Popa, V.; Raino, A.; Reynoldson, J.; Ronga, F.; Rrhioua, A.; Satriano, C.; Scapparone, E.; Scholberg, K.; Sciubba, A.; Serra, P.; Sioli, M.; Sirri, G.; Sitta, M.; Spinelli, P.; Spinetti, M.; Spurio, M.; Steinberg, R.; Stone, J. L.; Sulak, L. R.; Surdo, A.; Tarle, G.; Tatananni, E.; Togo, V.; Vakili, M.; Walter, C. W.; Webb, R.; MACRO Collaboration

2002-10-01

Muon energy measurement represents an important issue for any experiment addressing neutrino-induced up-going muon studies. Since the neutrino oscillation probability depends on the neutrino energy, a measurement of the muon energy adds an important piece of information concerning the neutrino system. We show in this paper how the MACRO limited streamer tube system can be operated in drift mode by using the TDCs included in the QTPs, an electronics designed for magnetic monopole search. An improvement of the space resolution is obtained, through an analysis of the multiple scattering of muon tracks as they pass through our detector. This information can be used further to obtain an estimate of the energy of muons crossing the detector. Here we present the results of two dedicated tests, performed at CERN PS-T9 and SPS-X7 beam lines, to provide a full check of the electronics and to exploit the feasibility of such a multiple scattering analysis. We show that by using a neural network approach, we are able to reconstruct the muon energy for E μ<40 GeV. The test beam data provide an absolute energy calibration, which allows us to apply this method to MACRO data.

75 FR 49023 - Proposed Collection; Comment Request for Form TD F 90-22.1

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-12

... TD F 90-22.1 AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for... Form TD F 90-22.1, Report of Foreign Bank and Financial Accounts. DATES: Written comments should be.... OMB Number: 1545-2038. Form Number: TD F 90-22.1. Abstract: This information is collected because of...

Muons and neutrinos

NASA Technical Reports Server (NTRS)

Stanev, T.

1986-01-01

The first generation of large and precise detectors, some initially dedicated to search for nucleon decay has accumulated significant statistics on neutrinos and high-energy muons. A second generation of even better and bigger detectors are already in operation or in advanced construction stage. The present set of experimental data on muon groups and neutrinos is qualitatively better than several years ago and the expectations for the following years are high. Composition studies with underground muon groups, neutrino detection, and expected extraterrestrial neutrino fluxes are discussed.

The MUSIC Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Makoto

A new muon channel, MUSIC, is being constructed at the Research Center for Nuclear Physics (RCNP) at Osaka University in Japan. The muon channel utilizes a strong solenoidal magnetic field to collect pions and to transport muons. A large-bore superconducting coil encloses the pion-production target to capture pions with a large solid angle. A long solenoid magnet transports pions and muons with the capability to select the charge and momentum of the particles. The design of the solenoid channel is described in this paper.

The Muon System of the Daya Bay Reactor Antineutrino Experiment

DOE PAGES

An, F. P.; Hackenburg, R. W.; Brown, R. E.; ...

2014-10-05

The Daya Bay experiment consists of functionally identical antineutrino detectors immersed in pools of ultrapure water in three well-separated underground experimental halls near two nuclear reactor complexes. These pools serve both as shields against natural, low-energy radiation, and as water Cherenkov detectors that efficiently detect cosmic muons using arrays of photomultiplier tubes. Each pool is covered by a plane of resistive plate chambers as an additional means of detecting muons. Design, construction, operation, and performance of these muon detectors are described. (auth)

Charm production in deep inelastic muon-iron interactions at 200 GeV/c

NASA Astrophysics Data System (ADS)

Arneodo, M.; Aubert, J. J.; Bassompierre, G.; Becks, K. H.; Benchouk, C.; Best, C.; Böhm, E.; de Bouard, X.; Brasse, F. W.; Broll, C.; Brown, S. C.; Carr, J.; Clifft, R.; Cobb, J. H.; Coignet, G.; Combley, F.; Court, G. R.; D'Agostini, G.; Dau, W. D.; Davies, J. K.; Declais, Y.; Dosselli, U.; Drees, J.; Edwards, A.; Edwards, M.; Favier, J.; Ferrero, M. I.; Flauger, W.; Forsbach, H.; Gabathuler, E.; Gamet, R.; Gayler, J.; Gerhardt, V.; Gössling, C.; Haas, J.; Hamacher, K.; Hayman, P.; Henckes, M.; Korbel, V.; Landgraf, U.; Leenen, M.; Maire, M.; Maselli, S.; Mohr, W.; Montgomery, H. E.; Moser, K.; Mount, R. P.; Nagy, E.; Nassalski, J.; Norton, P. R.; McNicholas, J.; Osborne, A. M.; Payre, P.; Peroni, C.; Pessard, H.; Pietrzyk, U.; Rith, K.; Schneegans, M.; Sloan, T.; Stier, H. E.; Stockhausen, W.; Thénard, J. M.; Thompson, J. C.; Urban, L.; Wahlen, H.; Whalley, M.; Williams, D.; Williams, W. S. C.; Williamson, J.; Wimpenny, S. J.

1987-03-01

Dimuon and trimuon events have been studied in deep inelastic muon scattering on an iron target at an incident muon energy of 200 GeV. The events are shown to originate mainly from charm production. Comparison of the measured cross sections with data taken at higher muon energies shows that charm production originates predominantly from transverse virtual photons. Within the framework of the photon gluon fusion model this indicates that the parity of the gluon is odd.

A search for free quarks in deep inelastic muon scattering

NASA Astrophysics Data System (ADS)

Aubert, J. J.; Bassompierre, G.; Becks, K. H.; Best, C.; Böhm, E.; de Bouard, X.; Brasse, F. W.; Broll, C.; Brown, S.; Carr, J.; Clifft, R. W.; Cobb, J. H.; Coignet, G.; Combley, F.; Court, G. R.; D'Agostini, G.; Dau, W. D.; Davies, J. K.; Déclais, Y.; Dobinson, R. W.; Dosselli, U.; Drees, J.; Edwards, A.; Edwards, M.; Favier, J.; Ferrero, M. I.; Flauger, W.; Gabathuler, E.; Gamet, R.; Gayler, J.; Gerhardt, V.; Gössling, C.; Haas, J.; Hamacher, K.; Hayman, P.; Henckes, M.; von Holtey, G.; Korbel, V.; Landgraf, U.; Leenen, M.; Maire, M.; Minssieux, H.; Mohr, W.; Montgomery, H. E.; Moser, K.; Mount, R. P.; Norton, P. R.; McNicholas, J.; Osborne, A. M.; Payre, P.; Peroni, C.; Pessard, H.; Pietrzyk, U.; Rith, K.; Schneegans, M.; Sloan, T.; Stier, H. E.; Stockhausen, W.; Thenard, J. M.; Thompson, J. C.; Urban, L.; Wahlen, H.; Whalley, M.; Williams, D.; Williams, W. S. C.; Wimpenny, S. J.

1983-12-01

A search was made at the CERN SPS for long-lived fractionally charged particles produced in deep inelastic muon interactions on a Be target using the existing muon beam line as a spectrometer. No such particles were found, leading to upper limits for the production cross section of the order of 10-36 cm2 for 200 GeV incident muon momentum and quark masses below 9 GeV for the 2/3 charge and 15 GeV for 1/3 charge.

Crossbar H-mode drift-tube linac design with alternative phase focusing for muon linac

NASA Astrophysics Data System (ADS)

Otani, M.; Futatsukawa, K.; Hasegawa, K.; Kitamura, R.; Kondo, Y.; Kurennoy, S.

2017-07-01

We have developed a Crossbar H-mode (CH) drift-tube linac (DTL) design with an alternative phase focusing (APF) scheme for a muon linac, in order to measure the anomalous magnetic moment and electric dipole moment (EDM) of muons at the Japan Proton Accelerator Research Complex (J-PARC). The CH-DTL accelerates muons from β = v/c = 0.08 to 0.28 at an operational frequency of 324 MHz. The design and results are described in this paper.

Non-Invasive Imaging of Reactor Cores Using Cosmic Ray Muons

NASA Astrophysics Data System (ADS)

Milner, Edward

2011-10-01

Cosmic ray muons penetrate deeply in material, with some passing completely through very thick objects. This penetrating quality is the basis of two distinct, but related imaging techniques. The first measures the number of cosmic ray muons transmitted through parts of an object. Relatively fewer muons are absorbed along paths in which they encounter less material, compared to higher density paths, so the relative density of material is measured. This technique is called muon transmission imaging, and has been used to infer the density and structure of a variety of large masses, including mine overburden, volcanoes, pyramids, and buildings. In a second, more recently developed technique, the angular deflection of muons is measured by trajectory-tracking detectors placed on two opposing sides of an object. Muons are deflected more strongly by heavy nuclei, since multiple Coulomb scattering angle is approximately proportional to the nuclear charge. Therefore, a map showing regions of large deflection will identify the location of uranium in contrast to lighter nuclei. This technique is termed muon scattering tomography (MST) and has been developed to screen shipping containers for the presence of concealed nuclear material. Both techniques are a good way of non-invasively inspecting objects. A previously unexplored topic was applying MST to imaging large objects. Here we demonstrate extending the MST technique to the task of identifying relatively thick objects inside very thick shielding. We measured cosmic ray muons passing through a physical arrangement of material similar to a nuclear reactor, with thick concrete shielding and a heavy metal core. Newly developed algorithms were used to reconstruct an image of the ``mock reactor core,'' with resolution of approximately 30 cm.

Characterization of the atmospheric muon flux in IceCube

NASA Astrophysics Data System (ADS)

Aartsen, M. G.; Abraham, K.; Ackermann, M.; Adams, J.; Aguilar, J. A.; Ahlers, M.; Ahrens, M.; Altmann, D.; Anderson, T.; Archinger, M.; Argüelles, C.; Arlen, T. C.; Auffenberg, J.; Bai, X.; Barwick, S. W.; Baum, V.; Bay, R.; Beatty, J. J.; Becker Tjus, J.; Becker, K.-H.; Beiser, E.; BenZvi, S.; Berghaus, P.; Berley, D.; Bernardini, E.; Bernhard, A.; Besson, D. Z.; Binder, G.; Bindig, D.; Bissok, M.; Blaufuss, E.; Blumenthal, J.; Boersma, D. J.; Bohm, C.; Börner, M.; Bos, F.; Bose, D.; Böser, S.; Botner, O.; Braun, J.; Brayeur, L.; Bretz, H.-P.; Brown, A. M.; Buzinsky, N.; Casey, J.; Casier, M.; Cheung, E.; Chirkin, D.; Christov, A.; Christy, B.; Clark, K.; Classen, L.; Coenders, S.; Cowen, D. F.; Cruz Silva, A. H.; Daughhetee, J.; Davis, J. C.; Day, M.; de André, J. P. A. M.; De Clercq, C.; Dembinski, H.; De Ridder, S.; Desiati, P.; de Vries, K. D.; de Wasseige, G.; de With, M.; DeYoung, T.; Díaz-Vélez, J. C.; Dumm, J. P.; Dunkman, M.; Eagan, R.; Eberhardt, B.; Ehrhardt, T.; Eichmann, B.; Euler, S.; Evenson, P. A.; Fadiran, O.; Fahey, S.; Fazely, A. R.; Fedynitch, A.; Feintzeig, J.; Felde, J.; Filimonov, K.; Finley, C.; Fischer-Wasels, T.; Flis, S.; Fuchs, T.; Glagla, M.; Gaisser, T. K.; Gaior, R.; Gallagher, J.; Gerhardt, L.; Ghorbani, K.; Gier, D.; Gladstone, L.; Glüsenkamp, T.; Goldschmidt, A.; Golup, G.; Gonzalez, J. G.; Góra, D.; Grant, D.; Gretskov, P.; Groh, J. C.; Groß, A.; Ha, C.; Haack, C.; Haj Ismail, A.; Hallgren, A.; Halzen, F.; Hansmann, B.; Hanson, K.; Hebecker, D.; Heereman, D.; Helbing, K.; Hellauer, R.; Hellwig, D.; Hickford, S.; Hignight, J.; Hill, G. C.; Hoffman, K. D.; Hoffmann, R.; Holzapfel, K.; Homeier, A.; Hoshina, K.; Huang, F.; Huber, M.; Huelsnitz, W.; Hulth, P. O.; Hultqvist, K.; In, S.; Ishihara, A.; Jacobi, E.; Japaridze, G. S.; Jero, K.; Jurkovic, M.; Kaminsky, B.; Kappes, A.; Karg, T.; Karle, A.; Kauer, M.; Keivani, A.; Kelley, J. L.; Kemp, J.; Kheirandish, A.; Kiryluk, J.; Kläs, J.; Klein, S. R.; Kohnen, G.; Koirala, R.; Kolanoski, H.; Konietz, R.; Koob, A.; Köpke, L.; Kopper, C.; Kopper, S.; Koskinen, D. J.; Kowalski, M.; Krings, K.; Kroll, G.; Kroll, M.; Kunnen, J.; Kurahashi, N.; Kuwabara, T.; Labare, M.; Lanfranchi, J. L.; Larson, M. J.; Lesiak-Bzdak, M.; Leuermann, M.; Leuner, J.; Lünemann, J.; Madsen, J.; Maggi, G.; Mahn, K. B. M.; Maruyama, R.; Mase, K.; Matis, H. S.; Maunu, R.; McNally, F.; Meagher, K.; Medici, M.; Meli, A.; Menne, T.; Merino, G.; Meures, T.; Miarecki, S.; Middell, E.; Middlemas, E.; Miller, J.; Mohrmann, L.; Montaruli, T.; Morse, R.; Nahnhauer, R.; Naumann, U.; Niederhausen, H.; Nowicki, S. C.; Nygren, D. R.; Obertacke, A.; Olivas, A.; Omairat, A.; O'Murchadha, A.; Palczewski, T.; Pandya, H.; Paul, L.; Pepper, J. A.; Pérez de los Heros, C.; Pfendner, C.; Pieloth, D.; Pinat, E.; Posselt, J.; Price, P. B.; Przybylski, G. T.; Pütz, J.; Quinnan, M.; Rädel, L.; Rameez, M.; Rawlins, K.; Redl, P.; Reimann, R.; Relich, M.; Resconi, E.; Rhode, W.; Richman, M.; Richter, S.; Riedel, B.; Robertson, S.; Rongen, M.; Rott, C.; Ruhe, T.; Ryckbosch, D.; Saba, S. M.; Sabbatini, L.; Sander, H.-G.; Sandrock, A.; Sandroos, J.; Sarkar, S.; Schatto, K.; Scheriau, F.; Schimp, M.; Schmidt, T.; Schmitz, M.; Schoenen, S.; Schöneberg, S.; Schönwald, A.; Schukraft, A.; Schulte, L.; Seckel, D.; Seunarine, S.; Shanidze, R.; Smith, M. W. E.; Soldin, D.; Spiczak, G. M.; Spiering, C.; Stahlberg, M.; Stamatikos, M.; Stanev, T.; Stanisha, N. A.; Stasik, A.; Stezelberger, T.; Stokstad, R. G.; Stößl, A.; Strahler, E. A.; Ström, R.; Strotjohann, N. L.; Sullivan, G. W.; Sutherland, M.; Taavola, H.; Taboada, I.; Ter-Antonyan, S.; Terliuk, A.; Tešić, G.; Tilav, S.; Toale, P. A.; Tobin, M. N.; Tosi, D.; Tselengidou, M.; Turcati, A.; Unger, E.; Usner, M.; Vallecorsa, S.; van Eijndhoven, N.; Vandenbroucke, J.; van Santen, J.; Vanheule, S.; Veenkamp, J.; Vehring, M.; Voge, M.; Vraeghe, M.; Walck, C.; Wallraff, M.; Wandkowsky, N.; Weaver, Ch.; Wendt, C.; Westerhoff, S.; Whelan, B. J.; Whitehorn, N.; Wichary, C.; Wiebe, K.; Wiebusch, C. H.; Wille, L.; Williams, D. R.; Wissing, H.; Wolf, M.; Wood, T. R.; Woschnagg, K.; Xu, D. L.; Xu, X. W.; Xu, Y.; Yáñez, J. P.; Yodh, G.; Yoshida, S.; Zarzhitsky, P.; Zoll, M.

2016-05-01

Muons produced in atmospheric cosmic ray showers account for the by far dominant part of the event yield in large-volume underground particle detectors. The IceCube detector, with an instrumented volume of about a cubic kilometer, has the potential to conduct unique investigations on atmospheric muons by exploiting the large collection area and the possibility to track particles over a long distance. Through detailed reconstruction of energy deposition along the tracks, the characteristics of muon bundles can be quantified, and individual particles of exceptionally high energy identified. The data can then be used to constrain the cosmic ray primary flux and the contribution to atmospheric lepton fluxes from prompt decays of short-lived hadrons. In this paper, techniques for the extraction of physical measurements from atmospheric muon events are described and first results are presented. The multiplicity spectrum of TeV muons in cosmic ray air showers for primaries in the energy range from the knee to the ankle is derived and found to be consistent with recent results from surface detectors. The single muon energy spectrum is determined up to PeV energies and shows a clear indication for the emergence of a distinct spectral component from prompt decays of short-lived hadrons. The magnitude of the prompt flux, which should include a substantial contribution from light vector meson di-muon decays, is consistent with current theoretical predictions. The variety of measurements and high event statistics can also be exploited for the evaluation of systematic effects. In the course of this study, internal inconsistencies in the zenith angle distribution of events were found which indicate the presence of an unexplained effect outside the currently applied range of detector systematics. The underlying cause could be related to the hadronic interaction models used to describe muon production in air showers.

Looking inside volcanoes with the Imaging Atmospheric Cherenkov Telescopes

NASA Astrophysics Data System (ADS)

Del Santo, M.; Catalano, O.; Cusumano, G.; La Parola, V.; La Rosa, G.; Maccarone, M. C.; Mineo, T.; Sottile, G.; Carbone, D.; Zuccarello, L.; Pareschi, G.; Vercellone, S.

2017-12-01

Cherenkov light is emitted when charged particles travel through a dielectric medium with velocity higher than the speed of light in the medium. The ground-based Imaging Atmospheric Cherenkov Telescopes (IACT), dedicated to the very-high energy γ-ray Astrophysics, are based on the detection of the Cherenkov light produced by relativistic charged particles in a shower induced by TeV photons interacting with the Earth atmosphere. Usually, an IACT consists of a large segmented mirror which reflects the Cherenkov light onto an array of sensors, placed at the focal plane, equipped by fast electronics. Cherenkov light from muons is imaged by an IACT as a ring, when muon hits the mirror, or as an arc when the impact point is outside the mirror. The Cherenkov ring pattern contains information necessary to assess both direction and energy of the incident muon. Taking advantage of the muon detection capability of IACTs, we present a new application of the Cherenkov technique that can be used to perform the muon radiography of volcanoes. The quantitative understanding of the inner structure of a volcano is a key-point to monitor the stages of the volcano activity, to forecast the next eruptive style and, eventually, to mitigate volcanic hazards. Muon radiography shares the same principle as X-ray radiography: muons are attenuated by higher density regions inside the target so that, by measuring the differential attenuation of the muon flux along different directions, it is possible to determine the density distribution of the interior of a volcano. To date, muon imaging of volcanic structures has been mainly achieved with detectors made up of scintillator planes. The advantage of using Cherenkov telescopes is that they are negligibly affected by background noise and allow a consistently improved spatial resolution when compared to the majority of the current detectors.

The PHENIX muon spectrometer and J/psi production in 200 GeV center of mass energy proton-proton collisions at RHIC

NASA Astrophysics Data System (ADS)

Hoover, Andrew S.

The PHENIX experiment is one of the large detector projects at the Relativistic Heavy-Ion Collider (RHIC) at Brookhaven National Laboratory. One of the unique features of the PHENIX detector is the muon tracking and identification system. No other RHIC experiment has a muon detection capability. Among the many physics topics explored by the observation of muons in Au-Au collisions are the effects of Debye screening on vector meson production, and the search for an enhancement in strangeness and heavy flavor production. In the collisions of polarized protons, the muon arms can explore the polarization of quarks and gluons in the proton through W boson production, the Drell-Yan process, and open heavy flavor production. The muon detector system covers the rapidity range -2.2 < y < -1.2 for the south arm and 1.2 < y < 2.4 for the north arm, with full azimuthal coverage. The detector provides muon tracking and identification in the momentum range 2 < p < 50 GeV, and pi/mu rejection of 10-4. The south muon arm was completed in 2001 for the second RHIC running period. The performance of the muon spectrometer during its first data taking period will be discussed. The production cross section for J/psi in proton-proton collisions at s = 200 GeV is measured. The measured value is in good agreement with the color evaporation model and QCD predictions. Although the number of J/psi currently available for study will not allow a definitive measurement of the J/psi polarization, a technique for performing the measurement is studied and a very low statistics analysis produces a result which is consistent with expectations.

Feasibility study of nuclear transmutation by negative muon capture reaction using the PHITS code

NASA Astrophysics Data System (ADS)

Abe, Shin-ichiro; Sato, Tatsuhiko

2016-06-01

Feasibility of nuclear transmutation of fission products in high-level radioactive waste by negative muon capture reaction is investigated using the Particle and Heave Ion Transport code System (PHITS). It is found that about 80 % of stopped negative muons contribute to transmute target nuclide into stable or short-lived nuclide in the case of 135Cs, which is one of the most important nuclide in the transmutation. The simulation result also indicates that the position of transmutation is controllable by changing the energy of incident negative muon. Based on our simulation, it takes approximately 8.5 × 108years to transmute 500 g of 135Cs by negative muon beam with the highest intensity currently available.

Performance of the CMS muon detector and muon reconstruction with proton-proton collisions at $$\\sqrt{s}=$$ 13 TeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirunyan, Albert M; et al.

The CMS muon detector system, muon reconstruction software, and high-level trigger underwent significant changes in 2013-2014 in preparation for running at higher LHC collision energy and instantaneous luminosity. The performance of the modified system is studied using proton-proton collision data at center-of-mass energymore » $$\\sqrt{s}=$$ 13 TeV, collected at the LHC in 2015 and 2016. The measured performance parameters, including spatial resolution, efficiency, and timing, are found to meet all design specifications and are well reproduced by simulation. Despite the more challenging running conditions, the modified muon system is found to perform as well as, and in many aspects better than, previously.« less

Using polarized muons as ultrasensitive spin labels in free radical chemistry

NASA Astrophysics Data System (ADS)

McKenzie, Iain; Roduner, Emil

2009-08-01

In a chemical sense, the positive muon is a light proton. It is obtained at the ports of accelerators in beams with a spin polarization of 100%, which makes it a highly sensitive probe of matter. The muonium atom is a light hydrogen isotope, nine times lighter than H, with a muon as its nucleus. It reacts the same way as H, and by addition to double bonds it is implemented in free radicals in which the muon serves as a fully polarized spin label. It is reviewed here how the muon can be used to obtain information about muonium and radical reaction rates, radical structure, dynamics, and local environments. It can even tell us what a fragrance molecule does in a shampoo.

Development of a gas-pressurized high-pressure μSR setup at the RIKEN-RAL Muon Facility

NASA Astrophysics Data System (ADS)

Watanabe, I.; Ishii, Y.; Kawamata, T.; Suzuki, T.; Pratt, F. L.; Done, R.; Chowdhury, M.; Goodway, C.; Dreyer, J.; Smith, C.; Southern, M.

2009-04-01

The development and testing of a gas-pressurized μSR setup for the RIKEN-RAL Muon Facility is reported. In collaboration with the high-pressure group of the ISIS Facility at the Rutherford Appleton Laboratory, a gas-pressurized setup for a pulsed muon beam at the RIKEN-RAL Muon Facility has been constructed in 2008. The sample is pressurized by helium gas and the designed maximum pressure is 6.4 kbar. The high-pressure cell can be cooled down to 2 K using an existing cryostat. Tests were made injecting the double-pulsed muon beam into a high-purity sample of Sn powder, which confirmed that the maximum pressure achieved at 2 K was close to the designed pressure.

Measurement of the Muon Production Depths at the Pierre Auger Observatory

DOE PAGES

Collica, Laura

2016-09-08

The muon content of extensive air showers is an observable sensitive to the primary composition and to the hadronic interaction properties. The Pierre Auger Observatory uses water-Cherenkov detectors to measure particle densities at the ground and therefore is sensitive to the muon content of air showers. We present here a method which allows us to estimate the muon production depths by exploiting the measurement of the muon arrival times at the ground recorded with the Surface Detector of the Pierre Auger Observatory. The analysis is performed in a large range of zenith angles, thanks to the capability of estimating and subtracting the electromagnetic component, and for energies betweenmore » $$10^{19.2}$$ and $$10^{20}$$ eV.« less

A Charge Separation Study to Enable the Design of a Complete Muon Cooling Channel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, C.; Ankenbrandt, Charles M.; Johnson, Rolland P.

2013-12-01

The most promising designs for 6D muon cooling channels operate on a specific sign of electric charge. In particular, the Helical Cooling Channel (HCC) and Rectilinear RFOFO designs are the leading candidates to become the baseline 6D cooling channel in the Muon Accelerator Program (MAP). Time constraints prevented the design of a realistic charge separator, so a simplified study was performed to emulate the effects of charge separation on muons exiting the front end of a muon collider. The output of the study provides particle distributions that the competing designs will use as input into their cooling channels. We reportmore » here on the study of the charge separator that created the simulated particles.« less

Effects of TD-5108 on Gastrointestinal Transit and Bowel Function in Health and Pharmacokinetics in Health and Constipation

PubMed Central

Manini, Mhd Louai; Camilleri, Michael; Goldberg, Michael; Sweetser, Seth; McKinzie, Sanna; Burton, Duane; Wong, Shekman; Kitt, Michael M.; Li, Yu-Ping; Zinsmeister, Alan R.

2010-01-01

Background TD-5108 is a potent, selective high intrinsic activity serotonin 5-HT4 receptor agonist. Aim To assess effects of TD-5108 on gastrointestinal transit and compare its pharmacokinetics (PK) in healthy volunteers (HV) and chronic constipation (CC) patients. Methods 60 HV were randomly assigned, double-blind to placebo, 5, 15, 30 or 50 mg TD-5108 (single and 6-day dosing). Primary endpoints were colonic transit (geometric center at 24 hours, GC24) and ascending colon emptying (ACE) T1/2 after first dose. Secondary endpoints included gastric emptying (GE) T1/2 and colonic filling at 6 h (CF6). Results Single dose TD-5108 significantly accelerated GC24, ACE T1/2, and CF6; 30 and 50°mg TD-5108 accelerated all 3 endpoints. With multiple doses, TD-5108 30 mg accelerated GC24, and overall accelerated GE T1/2 at 15–50 mg. PK studies showed dose proportionality in health, and no significant differences between health and chronic constipation with a 15 mg oral dose of TD-5108. Stimulation of bowel function after15 mg TD-5108 were similar in CC and controls. There were no serious adverse events; notable adverse were the predictable GI effects such as diarrhea or altered bowel movements. Conclusions TD-5108 significantly accelerated intestinal and colonic transit after single dosing and accelerated gastric emptying after multiple dosing. Further studies of its potential as a gastrointestinal and colonic prokinetic are warranted. PMID:19691492

Assessing the Relationship between Semantic Processing and Thought Disorder Symptoms in Schizophrenia.

PubMed

Tan, Eric Josiah; Neill, Erica; Rossell, Susan Lee

2015-09-01

Aberrant semantic processing has been linked to the etiology of formal thought disorder (TD) symptoms in schizophrenia. In this cross-sectional study, two prominent theories, overactivation and disorganized structure of semantic memory (SM), were examined in relation to TD symptoms using the continuum approach across two established semantic tasks (direct/indirect semantic priming and categorical fluency). The aim was to examine the validity of the two TD theories in relation to TD symptoms in schizophrenia. Greater direct and indirect priming, fluency productivity and category errors were expected if the data supported the overactivation theory. Reduced fluency productivity and increased category errors would be characteristic of disorganized storage. Fifty-seven schizophrenia/schizoaffective disorder patients and 48 controls completed a clinical assessment and the semantic tasks. There was significantly reduced direct priming in patients compared to controls (p<.05), while indirect priming was not significantly different; there was no association between TD and degree of priming. Patients produced more category-inappropriate words (p<.005) than controls, which was related to increasing severity of circumstantiality. The pattern of results was more indicative of a disorganized SM storage problem in this sample. This phenomenon may underlie some TD symptoms in general schizophrenia. The findings strengthen the relationship between SM deficits and TD symptoms, though this appears to differ between individual symptoms. The authors discuss the value of the continuum approach in addressing research questions in TD etiology. Given low levels of TD in this study, replication of these findings in a sample with greater TD is desirable.

Elena Guardincerri: Tracking muons to reduce nuclear threats and help preserve architectural treasures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Del Mauro, Diana; Guardincerri, Elena

When Elena Guardincerri was a physics PhD student at the University of Genova, she considered muons a nuisance. She built muon detectors to snare these secondary cosmic rays, which were interfering with her experiments to study elusive neutrinos.

Cosmic ray muon computed tomography of spent nuclear fuel in dry storage casks

DOE PAGES

Poulson, Daniel Cris; Durham, J. Matthew; Guardincerri, Elena; ...

2016-10-22

Radiography with cosmic ray muon scattering has proven to be a successful method of imaging nuclear material through heavy shielding. Of particular interest is monitoring dry storage casks for diversion of plutonium contained in spent reactor fuel. Using muon tracking detectors that surround a cylindrical cask, cosmic ray muon scattering can be simultaneously measured from all azimuthal angles, giving complete tomographic coverage of the cask interior. This article describes the first application of filtered back projection algorithms, typically used in medical imaging, to cosmic ray muon scattering imaging. The specific application to monitoring spent nuclear fuel in dry storage casksmore » is investigated via GEANT4 simulations. With a cylindrical muon tracking detector surrounding a typical spent fuel cask, simulations indicate that missing fuel bundles can be detected with a statistical significance of ~18σ in less than two days exposure and a sensitivity at 1σ to a 5% missing portion of a fuel bundle. Finally, we discuss potential detector technologies and geometries.« less

Los Alamos, Toshiba probing Fukushima with cosmic rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, Christopher

2014-06-16

Los Alamos National Laboratory has announced an impending partnership with Toshiba Corporation to use a Los Alamos technique called muon tomography to safely peer inside the cores of the Fukushima Daiichi reactors and create high-resolution images of the damaged nuclear material inside without ever breaching the cores themselves. The initiative could reduce the time required to clean up the disabled complex by at least a decade and greatly reduce radiation exposure to personnel working at the plant. Muon radiography (also called cosmic-ray radiography) uses secondary particles generated when cosmic rays collide with upper regions of Earth's atmosphere to create imagesmore » of the objects that the particles, called muons, penetrate. The process is analogous to an X-ray image, except muons are produced naturally and do not damage the materials they contact. Muon radiography has been used before in imaginative applications such as mapping the interior of the Great Pyramid at Giza, but Los Alamos's muon tomography technique represents a vast improvement over earlier technology.« less

Precision muon physics

NASA Astrophysics Data System (ADS)

Gorringe, T. P.; Hertzog, D. W.

2015-09-01

The muon is playing a unique role in sub-atomic physics. Studies of muon decay both determine the overall strength and establish the chiral structure of weak interactions, as well as setting extraordinary limits on charged-lepton-flavor-violating processes. Measurements of the muon's anomalous magnetic moment offer singular sensitivity to the completeness of the standard model and the predictions of many speculative theories. Spectroscopy of muonium and muonic atoms gives unmatched determinations of fundamental quantities including the magnetic moment ratio μμ /μp, lepton mass ratio mμ /me, and proton charge radius rp. Also, muon capture experiments are exploring elusive features of weak interactions involving nucleons and nuclei. We will review the experimental landscape of contemporary high-precision and high-sensitivity experiments with muons. One focus is the novel methods and ingenious techniques that achieve such precision and sensitivity in recent, present, and planned experiments. Another focus is the uncommonly broad and topical range of questions in atomic, nuclear and particle physics that such experiments explore.

Cosmic ray muon computed tomography of spent nuclear fuel in dry storage casks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poulson, Daniel Cris; Durham, J. Matthew; Guardincerri, Elena

Radiography with cosmic ray muon scattering has proven to be a successful method of imaging nuclear material through heavy shielding. Of particular interest is monitoring dry storage casks for diversion of plutonium contained in spent reactor fuel. Using muon tracking detectors that surround a cylindrical cask, cosmic ray muon scattering can be simultaneously measured from all azimuthal angles, giving complete tomographic coverage of the cask interior. This article describes the first application of filtered back projection algorithms, typically used in medical imaging, to cosmic ray muon scattering imaging. The specific application to monitoring spent nuclear fuel in dry storage casksmore » is investigated via GEANT4 simulations. With a cylindrical muon tracking detector surrounding a typical spent fuel cask, simulations indicate that missing fuel bundles can be detected with a statistical significance of ~18σ in less than two days exposure and a sensitivity at 1σ to a 5% missing portion of a fuel bundle. Finally, we discuss potential detector technologies and geometries.« less

Bayesian image reconstruction for improving detection performance of muon tomography.

PubMed

Wang, Guobao; Schultz, Larry J; Qi, Jinyi

2009-05-01

Muon tomography is a novel technology that is being developed for detecting high-Z materials in vehicles or cargo containers. Maximum likelihood methods have been developed for reconstructing the scattering density image from muon measurements. However, the instability of maximum likelihood estimation often results in noisy images and low detectability of high-Z targets. In this paper, we propose using regularization to improve the image quality of muon tomography. We formulate the muon reconstruction problem in a Bayesian framework by introducing a prior distribution on scattering density images. An iterative shrinkage algorithm is derived to maximize the log posterior distribution. At each iteration, the algorithm obtains the maximum a posteriori update by shrinking an unregularized maximum likelihood update. Inverse quadratic shrinkage functions are derived for generalized Laplacian priors and inverse cubic shrinkage functions are derived for generalized Gaussian priors. Receiver operating characteristic studies using simulated data demonstrate that the Bayesian reconstruction can greatly improve the detection performance of muon tomography.

Cosmic ray muon computed tomography of spent nuclear fuel in dry storage casks

NASA Astrophysics Data System (ADS)

Poulson, D.; Durham, J. M.; Guardincerri, E.; Morris, C. L.; Bacon, J. D.; Plaud-Ramos, K.; Morley, D.; Hecht, A. A.

2017-01-01

Radiography with cosmic ray muon scattering has proven to be a successful method of imaging nuclear material through heavy shielding. Of particular interest is monitoring dry storage casks for diversion of plutonium contained in spent reactor fuel. Using muon tracking detectors that surround a cylindrical cask, cosmic ray muon scattering can be simultaneously measured from all azimuthal angles, giving complete tomographic coverage of the cask interior. This paper describes the first application of filtered back projection algorithms, typically used in medical imaging, to cosmic ray muon scattering imaging. The specific application to monitoring spent nuclear fuel in dry storage casks is investigated via GEANT4 simulations. With a cylindrical muon tracking detector surrounding a typical spent fuel cask, simulations indicate that missing fuel bundles can be detected with a statistical significance of ∼ 18 σ in less than two days exposure and a sensitivity at 1σ to a 5% missing portion of a fuel bundle. Potential detector technologies and geometries are discussed.

An extensive air shower trigger station for the Muon Portal detector

NASA Astrophysics Data System (ADS)

Riggi, F.; Blancato, A. A.; La Rocca, P.; Riggi, S.; Santagati, G.

2014-11-01

The Muon Portal project ( [1]; Riggi et al., 2013 [2,5,7]; Lo Presti et al., 2012 [3]; La Rocca et al., 2014 [4]; Bandieramonte et al., 2013 [6]; Pugliatti et al., 2014 [8]) aims at the construction of a large area detector to reconstruct cosmic muon tracks above and below a container, to search for hidden high-Z materials inside its volume by the muon tomography technique. Due to its sensitive area (about 18 m2), with four XY detection planes, and its good tracking capabilities, the prototype under construction, which should be operational around mid-2015, also allows different studies in cosmic ray physics, including the detection of muon bundles. For such purpose, a trigger station based on three scintillation detectors operating in coincidence close to the main muon tracker has been built. This paper describes the design and preliminary results of the trigger station, together with the physics capabilities of the overall setup.

Front-end electronics for the Muon Portal project

NASA Astrophysics Data System (ADS)

Garozzo, S.; Marano, D.; Bonanno, G.; Grillo, A.; Romeo, G.; Timpanaro, M. C.; Lo Presti, D.; Riggi, F.; Russo, V.; Bonanno, D.; La Rocca, P.; Longhitano, F.; Bongiovanni, D. G.; Fallica, G.; Valvo, G.

2016-10-01

The Muon Portal Project was born as a joint initiative between Italian research and industrial partners, aimed at the construction of a real-size working detector prototype to inspect the content of traveling containers by means of secondary cosmic-ray muon radiation and recognize potentially dangerous hidden materials. The tomographic image is obtained by reconstructing the incoming and outgoing muon trajectories when crossing the inspected volume, employing two tracker planes located above and below the container under inspection. In this paper, the design and development of the front-end electronics of the Muon Portal detector is presented, with particular emphasis being devoted to the photo-sensor devices detecting the scintillation light and to the read-out circuitry which is in charge of processing and digitizing the analog pulse signals. In addition, the remote control system, mechanical housing, and thermal cooling system of all structural blocks of the Muon Portal tracker are also discussed, demonstrating the effectiveness and functionality of the adopted design.

The Muon g - 2 experiment at Fermilab

NASA Astrophysics Data System (ADS)

Mott, James; Muon g - 2 experiment

2017-06-01

The Muon g - 2 experiment at Fermilab will measure the anomalous magnetic moment of the muon to a precision of 140 ppb, reducing the experimental uncertainty by a factor of 4 compared to the previous measurement at BNL (E821). The measurement technique adopts the storage ring concept used for E821, with magic-momentum muons stored in a highly uniform 1.45 T magnetic dipole field. The spin precession frequency is extracted from an analysis of the modulation of the rate of higher-energy positrons from muon decays, detected by 24 calorimeters and 3 straw tracking detectors. Compared to the E821 experiment, muon beam preparation, storage ring internal hardware, field measuring equipment, and detector and electronics systems are all new or significantly upgraded. Herein, I report on the status of the experiment as of Sept. 2016, presenting the magnetic field uniformity results after the completion of the first round of shimming and outlining the construction progress of the main detector systems.

The Muon g $-$ 2 experiment at Fermilab

DOE PAGES

Mott, James

2017-06-21

Here, the Muon g-2 experiment at Fermilab will measure the anomalous magnetic moment of the muon to a precision of 140 ppb, reducing the experimental uncertainty by a factor of 4 compared to the previous measurement at BNL (E821). The measurement technique adopts the storage ring concept used for E821, with magic-momentum muons stored in a highly uniform 1.45 T magnetic dipole field. The spin precession frequency is extracted from an analysis of the modulation of the rate of higher-energy positrons from muon decays, detected by 24 calorimeters and 3 straw tracking detectors. Compared to the E821 experiment, muon beammore » preparation, storage ring internal hardware, field measuring equipment, and detector and electronics systems are all new or significantly upgraded. Herein, I report on the status of the experiment as of Sept. 2016, presenting the magnetic field uniformity results after the completion of the first round of shimming and outlining the construction progress of the main detector systems.« less

Lattice design and expected performance of the Muon Ionization Cooling Experiment demonstration of ionization cooling

NASA Astrophysics Data System (ADS)

Bogomilov, M.; Tsenov, R.; Vankova-Kirilova, G.; Song, Y.; Tang, J.; Li, Z.; Bertoni, R.; Bonesini, M.; Chignoli, F.; Mazza, R.; Palladino, V.; de Bari, A.; Cecchet, G.; Orestano, D.; Tortora, L.; Kuno, Y.; Ishimoto, S.; Filthaut, F.; Jokovic, D.; Maletic, D.; Savic, M.; Hansen, O. M.; Ramberger, S.; Vretenar, M.; Asfandiyarov, R.; Blondel, A.; Drielsma, F.; Karadzhov, Y.; Charnley, G.; Collomb, N.; Dumbell, K.; Gallagher, A.; Grant, A.; Griffiths, S.; Hartnett, T.; Martlew, B.; Moss, A.; Muir, A.; Mullacrane, I.; Oates, A.; Owens, P.; Stokes, G.; Warburton, P.; White, C.; Adams, D.; Anderson, R. J.; Barclay, P.; Bayliss, V.; Boehm, J.; Bradshaw, T. W.; Courthold, M.; Francis, V.; Fry, L.; Hayler, T.; Hills, M.; Lintern, A.; Macwaters, C.; Nichols, A.; Preece, R.; Ricciardi, S.; Rogers, C.; Stanley, T.; Tarrant, J.; Tucker, M.; Wilson, A.; Watson, S.; Bayes, R.; Nugent, J. C.; Soler, F. J. P.; Gamet, R.; Barber, G.; Blackmore, V. J.; Colling, D.; Dobbs, A.; Dornan, P.; Hunt, C.; Kurup, A.; Lagrange, J.-B.; Long, K.; Martyniak, J.; Middleton, S.; Pasternak, J.; Uchida, M. A.; Cobb, J. H.; Lau, W.; Booth, C. N.; Hodgson, P.; Langlands, J.; Overton, E.; Robinson, M.; Smith, P. J.; Wilbur, S.; Dick, A. J.; Ronald, K.; Whyte, C. G.; Young, A. R.; Boyd, S.; Franchini, P.; Greis, J. R.; Pidcott, C.; Taylor, I.; Gardener, R. B. S.; Kyberd, P.; Nebrensky, J. J.; Palmer, M.; Witte, H.; Bross, A. D.; Bowring, D.; Liu, A.; Neuffer, D.; Popovic, M.; Rubinov, P.; DeMello, A.; Gourlay, S.; Li, D.; Prestemon, S.; Virostek, S.; Freemire, B.; Hanlet, P.; Kaplan, D. M.; Mohayai, T. A.; Rajaram, D.; Snopok, P.; Suezaki, V.; Torun, Y.; Onel, Y.; Cremaldi, L. M.; Sanders, D. A.; Summers, D. J.; Hanson, G. G.; Heidt, C.; MICE Collaboration

2017-06-01

Muon beams of low emittance provide the basis for the intense, well-characterized neutrino beams necessary to elucidate the physics of flavor at a neutrino factory and to provide lepton-antilepton collisions at energies of up to several TeV at a muon collider. The international Muon Ionization Cooling Experiment (MICE) aims to demonstrate ionization cooling, the technique by which it is proposed to reduce the phase-space volume occupied by the muon beam at such facilities. In an ionization-cooling channel, the muon beam passes through a material in which it loses energy. The energy lost is then replaced using rf cavities. The combined effect of energy loss and reacceleration is to reduce the transverse emittance of the beam (transverse cooling). A major revision of the scope of the project was carried out over the summer of 2014. The revised experiment can deliver a demonstration of ionization cooling. The design of the cooling demonstration experiment will be described together with its predicted cooling performance.

Generating Low Beta Regions with Quadrupoles for Final Muon Cooling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acosta, J. G.; Cremaldi, L. M.; Hart, T. L.

2017-05-01

Muon beams and colliders are rich sources of new physics, if muons can be cooled. A normalized rms transverse muon emittance of 280 microns has been achieved in simulation with short solenoids and a betatron function of 3 cm. Here we use ICOOL, G4beamline, and MAD-X to explore using a 400 MeV/c muon beam and strong focusing quadrupoles to approach a normalized transverse emittance of 100 microns and finish 6D muon cooling. The low beta regions produced by the quadrupoles are occupied by dense, low Z absorbers, such as lithium hydride or beryllium, that cool the beam. Equilibrium transverse emittancemore » is linearly proportional to the beta function. Reverse emittance exchange with septa and/or wedges is then used to decrease transverse emittance from 100 to 25 microns at the expense of longitudinal emittance for a high energy lepton collider. Work remains to be done on chromaticity correction.« less

Los Alamos, Toshiba probing Fukushima with cosmic rays

ScienceCinema

Morris, Christopher

2018-01-16

Los Alamos National Laboratory has announced an impending partnership with Toshiba Corporation to use a Los Alamos technique called muon tomography to safely peer inside the cores of the Fukushima Daiichi reactors and create high-resolution images of the damaged nuclear material inside without ever breaching the cores themselves. The initiative could reduce the time required to clean up the disabled complex by at least a decade and greatly reduce radiation exposure to personnel working at the plant. Muon radiography (also called cosmic-ray radiography) uses secondary particles generated when cosmic rays collide with upper regions of Earth's atmosphere to create images of the objects that the particles, called muons, penetrate. The process is analogous to an X-ray image, except muons are produced naturally and do not damage the materials they contact. Muon radiography has been used before in imaginative applications such as mapping the interior of the Great Pyramid at Giza, but Los Alamos's muon tomography technique represents a vast improvement over earlier technology.

The Muon g $-$ 2 experiment at Fermilab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mott, James

Here, the Muon g-2 experiment at Fermilab will measure the anomalous magnetic moment of the muon to a precision of 140 ppb, reducing the experimental uncertainty by a factor of 4 compared to the previous measurement at BNL (E821). The measurement technique adopts the storage ring concept used for E821, with magic-momentum muons stored in a highly uniform 1.45 T magnetic dipole field. The spin precession frequency is extracted from an analysis of the modulation of the rate of higher-energy positrons from muon decays, detected by 24 calorimeters and 3 straw tracking detectors. Compared to the E821 experiment, muon beammore » preparation, storage ring internal hardware, field measuring equipment, and detector and electronics systems are all new or significantly upgraded. Herein, I report on the status of the experiment as of Sept. 2016, presenting the magnetic field uniformity results after the completion of the first round of shimming and outlining the construction progress of the main detector systems.« less

The Efficiency of Delone Coverings of the Canonical Tilings T^*(A4) and T^*(D6)

NASA Astrophysics Data System (ADS)

Papadopolos, Zorka; Kasner, Gerald

This chapter is devoted to the coverings of the two quasiperiodic canonical tilings T^*(A4) and T^*(D6) T^*(2F), obtained by projection from the root lattices A4 and D6, respectively. In the first major part of this chapter, in Sect. 5.2, we shall introduce a Delone covering C^sT^*(A4) of the 2-dimensional decagonal tiling T^*(A4). In the second major part of this chapter, Sect. 5.3, we summarize the results related to the Delone covering of the icosahedral tiling T^*(D6), CT^*(D6) and determine the zero-, single-, and double- deckings and the resulting thickness of the covering. In the conclusions section, we give some suggestions as to how the definition of the Delone covering might be changed in order to reach some real (full) covering of the icosahedral tiling T^*(D6). In Section 5.2 the definition of the Delone covering is also changed in order to avoid an unnecessary large thickness of the covering.

Enhanced efficacy of TD53, a novel algicidal agent, against the harmful algae via the liposomal delivery system.

PubMed

Han, Hyo-Kyung; Kim, Yeon-Mi; Lim, Soo-Jeong; Hong, Soon-Seok; Jung, Seul-Gi; Cho, Hoon; Lee, Wonjae; Jin, Eonseon

2011-02-28

The present study aimed to design the liposomal delivery system for TD53, a novel algicial drug in order to improve the delivery properties of TD53 and evaluate its algicidal effects as well as selectivity against harmful and non-harmful algae. Liposomes of TD53 were prepared with 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) by a lyophilization, resulting in relatively small size vesicles (234±38nm) and narrow size distribution (PI=0.130±0.027). The drug leakage from the liposome was negligible in the F/2 media (<2% during 96h incubation). Subsequently algicidal activity of liposomal TD53 against harmful and nonharmful algae was evaluated at various concentrations. The IC(50) values of TD53 in liposome against harmful algae such as Chattonella marina, Heterosigma akashiwo and Cocholodinium polykrikoides were 2.675, 2.029, and 0.480μM, respectively, and were reduced by approximately 50% compared to those obtained from non-liposomal TD53. In contrast, the algicidal effect of liposomal TD53 was insignificant against non-harmful algae including Navicula pelliculosa, Nannochloropsis oculata and Phaeodactylum EPV. Those results suggested that liposomal delivery systems might be effective to enhance the efficacy of TD53 while maintaining the selectivity to harmful algal species. Copyright © 2010 Elsevier B.V. All rights reserved.

Characterization of Thermophilic Halotolerant Aeribacillus pallidus TD1 from Tao Dam Hot Spring, Thailand

PubMed Central

Yasawong, Montri; Areekit, Supatra; Pakpitchareon, Arda; Santiwatanakul, Somchai; Chansiri, Kosum

2011-01-01

The bacterial strain TD1 was isolated from Tao Dam hot spring in Thailand. Strain TD1 was Gram positive, rod-shaped, aerobic, motile, and endospore forming. The cell was 2.0–40 μm in length and about 0.4 μm in diameter. The optimum growth occurred at 55–60 °C and at pH 7–8. Strain TD1 was able to grow on medium containing up to 10% NaCl. The DNA G+C content was 38.9 mol%. The cellular fatty acid content was mainly C16:0, which comprised 25.04% of the total amount of cellular fatty acid. 16S rDNA showed 99% identity to Aeribacillus pallidus DSM 3670T. Bayesian tree analysis strongly supported the idea that strain TD1 is affiliated with genus Aeribacillus, as Aeribacillus pallidus strain TD1. Although the 16S rDNA of A. pallidus strain TD1 is similar to that of A. pallidus DSM 3670T, some physiological properties and the cellular fatty acid profiles differ significantly. A. pallidus strain TD1 can produce extracellular pectate lyase, which has not been reported elsewhere for other bacterial strains in the genus Aeribacillus. A. pallidus strain TD1 may be a good candidate as a pectate lyase producer, which may have useful industrial applications. PMID:21954359

Attentional performance in children and adolescents with tic disorder and co-occurring attention-deficit/hyperactivity disorder: new insights from a 2 × 2 factorial design study.

PubMed

Greimel, Ellen; Wanderer, Sina; Rothenberger, Aribert; Herpertz-Dahlmann, Beate; Konrad, Kerstin; Roessner, Veit

2011-08-01

The aim of the present study was to investigate the effect of both tic disorder (TD) and attention-deficit/hyperactivity disorder (ADHD) on attentional functions. N=96 children and adolescents participated in the study, including n=21 subjects with TD, n=23 subjects with ADHD, n=25 subjects with TD+ADHD, and n=27 controls. Attentional performance was tested based on four computerized attention tasks (sustained attention, divided attention, go/nogo and set shifting). The effect of TD as well as ADHD on attentional performance was tested using a 2 × 2 factorial approach. A diagnosis of TD had no negative impact on attentional functions but was associated with improved performance in the set shifting task. By contrast, regardless of a diagnosis of TD, subjects with ADHD were found to perform worse in the sustained attention, divided attention and go/nogo task. No interaction effect between the factors TD and ADHD was revealed for any of the attention measures. Our results add to findings from other areas of research, showing that in subjects with TD and ADHD, ADHD psychopathology is often the main source of impairment, whereas a diagnosis of TD has little or no impact on neuropsychological performance in most cases and even seems to be associated with adaptive mechanisms.

Electron– and positron–molecule scattering: development of the molecular convergent close-coupling method

DOE PAGES

Zammit, Mark C.; Fursa, Dmitry V.; Savage, Jeremy S.; ...

2017-05-22

Starting from first principles, this tutorial describes the development of the adiabatic-nuclei convergent close-coupling (CCC) method and its application to electron and (single-centre) positron scattering from diatomic molecules. In this paper, we give full details of the single-centre expansion CCC method, namely the formulation of the molecular target structure; solving the momentum-space coupled-channel Lippmann-Schwinger equation; deriving adiabatic-nuclei cross sections and calculatingmore » $V$-matrix elements. Selected results are presented for electron and positron scattering from molecular hydrogen H$$_2$$ and electron scattering from the vibrationally excited molecular hydrogen ion H$$_2^+$$ and its isotopologues (D$$_2^+$$, T$$_2^+$$, HD$^+$, HT$^+$ and TD$^+$). Finally, convergence in both the close-coupling (target state) and projectile partial-wave expansions of fixed-nuclei electron- and positron-molecule scattering calculations is demonstrated over a broad energy-range and discussed in detail. In general the CCC results are in good agreement with experiments.« less

A new look into the quantum chemical and spectroscopic investigations of 5-chloro-1-methyl-4-nitroimidazole.

PubMed

Arjunan, V; Raj, Arushma; Anitha, R; Mohan, S

2014-05-05

Optimised geometrical structural parameters, harmonic vibrational frequencies, natural bonding orbital analysis and frontier molecular orbitals are determined by B3LYP and B3PW91 methods. The exact geometry of 5-chloro-1-methyl-4-nitroimidazole is determined through conformational analysis. The experimentally observed infrared and Raman bands have been assigned and analysed. The (13)C and (1)H NMR chemical shifts of the compound are investigated. The total electron density and molecular electrostatic potentials are determined. The electrostatic potential (electron+nuclei) distribution, molecular shape, size and dipole moments of the molecule have been displayed. The energies of the frontier molecular orbitals and LUMO-HOMO energy gap are measured. The possible electronic transitions of the molecule are studied by TD-DFT method along with the UV-Visible spectrum. The structure-activity relationship of the compound is also investigated by conceptual DFT methods. Copyright © 2014 Elsevier B.V. All rights reserved.

A Quantitative Measure of Handwriting Dysfluency for Assessing Tardive Dyskinesia

PubMed Central

Caligiuri, Michael P.; Teulings, Hans-Leo; Dean, Charles E.; Lohr, James B.

2015-01-01

Tardive dyskinesia (TD) is movement disorder commonly associated with chronic exposure to antidopaminergic medications which may be in some cases disfiguring and socially disabling. The consensus from a growing body of research on the incidence and prevalence of TD in the modern era of antipsychotics indicates that this disorder has not disappeared continues to challenge the effective management of psychotic symptoms in patients with schizophrenia. A fundamental component in an effective strategy for managing TD is its reliable and accurate assessment. In the present study, we examined the clinical utility of a brief handwriting dysfluency measure for quantifying TD. Digitized samples of handwritten circles and loops were obtained from 62 psychosis patients with or without TD and from 50 healthy subjects. Two measures of dysfluent pen movements were extracted from each vertical pen stroke, including normalized jerk and the number of acceleration peaks. TD patients exhibited significantly higher dysfluency scores than non-TD patients and controls. Severity of handwriting movement dysfluency was correlated with AIMS severity ratings for some tasks. The procedure yielded high degrees of test-retest reliability. These results suggest that measures of handwriting movement dysfluency may be particularly useful for objectively evaluating the efficacy of pharmacotherapeutic strategies for treating TD. PMID:25679121

Effects of histamine and 5-hydroxytryptamine on the growth rate of xenografted human bronchogenic carcinomas.

PubMed

Sheehan, P F; Baker, T; Tutton, P J; Barkla, D H

1996-01-01

1. The influence of histamine and 5-hydroxytryptamine (5-HT) antagonists and agonists on the volume doubling times (Td) of human bronchogenic carcinomas propagated as s.c. xenografts in immunosuppressed mice was examined. 2. The H2-receptor antagonists, cimetidine and ranitidine, increased Td. 3. Treatment with the H2-receptor agonist, 4-methyl histamine, had no effect on Td. 4. Co-administration of 4-methyl histamine and cimetidine abolished the effects of cimetidine. 5. The 5-HT2-receptor antagonists, cinanserin and ketanserin, both increased Td. 6. Treatment with the 5-HT1/2-receptor agonist quipazine (0.1 mg/kg, reflecting 5-HT2 agonist activity) decreased Td, while a higher dose (10.0 mg/kg) had no effect. 7. The 5-HT1/2-receptor antagonist, methiothepin, decreased Td. 8. The 5-HT uptake inhibitor, fluoxetine, increased Td in one tumour line but not in another, while the 5-HT releaser/depletor, fenfluramine, increased Td. 9. Histamine may stimulate tumour growth through the histamine H2-receptor, while the dominant effect of 5-HT is 5-HT1-receptor inhibition. 10. Tumour growth in some bronchogenic carcinomas may involve 5-HT uptake mechanisms.

Psychopathology in a Swedish population of school children with tic disorders.

PubMed

Khalifa, Najah; von Knorring, Anne-Liis

2006-11-01

To examine patterns of psychiatric comorbid disorders and associated problems in a school population of children with tic disorders. From a total population of 4,479 children, 25 with Tourette's disorder (TD), 34 with chronic motor tics (CMT), 24 with chronic vocal tics (CVT), and 214 with transient tics (TT) during the past year were found. A three-stage procedure was used: tic screening, telephone interview, and clinical assessment. The TD group was compared with 25 children with TT and 25 controls without tics. Psychiatric comorbid disorders were found in 92% of the children with TD. Attention-deficit/hyperactivity disorder was most common, and patterns of psychiatric comorbidity were similar in children with TD and CVT, but not with CMT and TT. Aggressive behavior was more common in children with TD than other tic disorders. Psychiatric comorbid disorders are common even in community-based samples of children with TD and CVT. TD and CVT seem to be part of the same disease entity, with TD being a more severe form. Chronic tics may be a marker for behavioral and learning difficulties in children, and awareness of these associations is critical to the care and treatment of children with tics.

Powerful model for the point source sky: Far-ultraviolet and enhanced midinfrared performance

NASA Technical Reports Server (NTRS)

Cohen, Martin

1994-01-01

I report further developments of the Wainscoat et al. (1992) model originally created for the point source infrared sky. The already detailed and realistic representation of the Galaxy (disk, spiral arms and local spur, molecular ring, bulge, spheroid) has been improved, guided by CO surveys of local molecular clouds, and by the inclusion of a component to represent Gould's Belt. The newest version of the model is very well validated by Infrared Astronomy Satellite (IRAS) source counts. A major new aspect is the extension of the same model down to the far ultraviolet. I compare predicted and observed far-utraviolet source counts from the Apollo 16 'S201' experiment (1400 A) and the TD1 satellite (for the 1565 A band).

TD-60 links RalA GTPase function to the CPC in mitosis

PubMed Central

Papini, Diana; Langemeyer, Lars; Abad, Maria A.; Kerr, Alastair; Samejima, Itaru; Eyers, Patrick A.; Jeyaprakash, A. Arockia; Higgins, Jonathan M. G.; Barr, Francis A.; Earnshaw, William C.

2015-01-01

TD-60 (also known as RCC2) is a highly conserved protein that structurally resembles the Ran guanine exchange factor (GEF) RCC1, but has not previously been shown to have GEF activity. TD-60 has a typical chromosomal passenger complex (CPC) distribution in mitotic cells, but associates with integrin complexes and is involved in cell motility during interphase. Here we show that TD-60 exhibits GEF activity, in vitro and in cells, for the small GTPase RalA. TD-60 or RalA depletion causes spindle abnormalities in prometaphase associated with abnormal centromeric accumulation of CPC components. TD-60 and RalA apparently work together to contribute to the regulation of kinetochore–microtubule interactions in early mitosis. Importantly, several mitotic phenotypes caused by TD-60 depletion are reverted by the expression of a GTP-locked mutant, RalA (Q72L). The demonstration that a small GTPase participates in the regulation of the CPC reveals a level of mitotic regulation not suspected in previous studies. PMID:26158537

Peptide-chaperone-directed transdermal protein delivery requires energy.

PubMed

Ruan, Renquan; Jin, Peipei; Zhang, Li; Wang, Changli; Chen, Chuanjun; Ding, Weiping; Wen, Longping

2014-11-03

The biologically inspired transdermal enhanced peptide TD1 has been discovered to specifically facilitate transdermal delivery of biological macromolecules. However, the biological behavior of TD1 has not been fully defined. In this study, we find that energy is required for the TD1-mediated transdermal protein delivery through rat and human skins. Our results show that the permeation activity of TD1-hEGF, a fusion protein composed of human epidermal growth factor (hEGF) and the TD1 sequence connected with a glycine-serine linker (GGGGS), can be inhibited by the energy inhibitor, rotenone or oligomycin. In addition, adenosine triphosphate (ATP), the essential energetic molecule in organic systems, can effectively facilitate the TD1 directed permeation of the protein-based drug into the skin in a dose-dependent fashion. Our results here demonstrate a novel energy-dependent permeation process during the TD1-mediated transdermal protein delivery that could be valuable for the future development of promising new transdermal drugs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zammit, Mark C.; Fursa, Dmitry V.; Savage, Jeremy S.

Starting from first principles, this tutorial describes the development of the adiabatic-nuclei convergent close-coupling (CCC) method and its application to electron and (single-centre) positron scattering from diatomic molecules. In this paper, we give full details of the single-centre expansion CCC method, namely the formulation of the molecular target structure; solving the momentum-space coupled-channel Lippmann-Schwinger equation; deriving adiabatic-nuclei cross sections and calculatingmore » $V$-matrix elements. Selected results are presented for electron and positron scattering from molecular hydrogen H$$_2$$ and electron scattering from the vibrationally excited molecular hydrogen ion H$$_2^+$$ and its isotopologues (D$$_2^+$$, T$$_2^+$$, HD$^+$, HT$^+$ and TD$^+$). Finally, convergence in both the close-coupling (target state) and projectile partial-wave expansions of fixed-nuclei electron- and positron-molecule scattering calculations is demonstrated over a broad energy-range and discussed in detail. In general the CCC results are in good agreement with experiments.« less

Enhancement of Permeation in Transdermal Drug Delivery System by 6μm Wavelength Area Using an MIR-FEL

NASA Astrophysics Data System (ADS)

Uchizono, T.; Ishii, K.; Iwao, Y.; Itou, Y.; Maruo, H.; Hori, M.; Awazu, K.

2005-03-01

Ablation of the stratum corneum (SC) by pulsed-laser irradiation is one method of enhancing transdermal drug delivery (TD). For non-invasive laser TD treatment, we have tried to enhance TD without ablation of the SC using an MIR-FEL (6-μm wavelength) (FEL : free electron laser). Lidocaine was used as the drug in this study. The enhancement of TD was measured by HPLC. It was found that the lidocaine TD of the sample irradiated by MIR-FEL was enhanced 10 fold faster than the non-irradiated sample with a flux at 0.5 μg/cm2/h, measured by HPLC. We have demonstrated the effectiveness of TD enhancement by an MIR-FEL (6-μm wavelength) irradiation.

Muons and seismic: a dynamic duo for the shallow subsurface?

DOE PAGES

Mellors, Robert; Chapline, George; Bonneville, Alain; ...

2016-12-01

This paper explores, at a preliminary level, the possibility of merging seismic data, both active and passive, with density constraints inferred from muon measurements. We focus on a theoretical analysis but note that muon experiments are ongoing to test model predictions with experimental data.

Development of a Portable Muon Witness System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aguayo Navarrete, Estanislao; Kouzes, Richard T.; Orrell, John L.

2011-01-01

Since understanding and quantifying cosmic ray induced radioactive backgrounds in copper and germanium are important to the MAJORANA DEMONSTRATOR, methods are needed for monitoring the levels of such backgrounds produced in materials being transported and processed for the experiment. This report focuses on work conducted at Pacific Northwest National Laboratory to develop a muon witness system as a one way of monitoring induced activities. The operational goal of this apparatus is to characterize cosmic ray exposure of materials. The cosmic ray flux at the Earth’s surface is composed of several types of particles, including neutrons, muons, gamma rays and protons.more » These particles induce nuclear reactions, generating isotopes that contribute to the radiological background. Underground, the main mechanism of activation is by muon produced spallation neutrons since the hadron component of cosmic rays is removed at depths greater than a few tens of meters. This is a sub-dominant contributor above ground, but muons become predominant in underground experiments. For low-background experiments cosmogenic production of certain isotopes, such as 68Ge and 60Co, must be accounted for in the background budgets. Muons act as minimum ionizing particles, depositing a fixed amount of energy per unit length in a material, and have a very high penetrating power. Using muon flux measurements as a “witness” for the hadron flux, the cosmogenic induced activity can be quantified by correlating the measured muon flux and known hadronic production rates. A publicly available coincident muon cosmic ray detector design, the Berkeley Lab Cosmic Ray Detector (BLCRD), assembled by Juniata College, is evaluated in this work. The performance of the prototype is characterized by assessing its muon flux measurements. This evaluation is done by comparing data taken in identical scenarios with other cosmic ray telescopes. The prototype is made of two plastic scintillator paddles with associated electronics to measure energy depositions in coincidence in the two paddles. For this particular application of the prototype, the measurements performed concentrated on a broad investigation of the dependence of the muon flux on depth underground. These tests were conducted inside at Building 3420/1307 and underground at Building 3425 at the Pacific Northwest National Laboratory. The second half of this report analyzes modifications to the electronics of the BLCRD to make this detector portable. Among other modifications, a battery powered version of these electronics is proposed for the final Muon Witness design.« less

The Role of Intestinal Bacteria in Acute Diarrheal Diseases

DTIC Science & Technology

1981-01-01

another enteric pathogen, Vibrio cholerae , is present in high number in the cral cavity during acute and convalescent periods. Also, the buccal cells...h42 LT/ST + - - 2 K32&c4 AD) Kenya ... . .- r K32ScT All Kenya - LT - - - NT TD46ZcT ADY Mexfco 06:HT6 LT/ST - - - Z13 TD260cl AD Mexico 06:H16 LT...2 TD514c! AD Mexico .. . . NT TD472cI A Mexico LT/ST - - NT TD514cZ AD Mexico - NT "TABLE 1 CONTINUED 2 1 Enterotoxins MR-HA Pili 3 Human Strains

Ferromagnetic ordering in superatomic solids.

PubMed

Lee, Chul-Ho; Liu, Lian; Bejger, Christopher; Turkiewicz, Ari; Goko, Tatsuo; Arguello, Carlos J; Frandsen, Benjamin A; Cheung, Sky C; Medina, Teresa; Munsie, Timothy J S; D'Ortenzio, Robert; Luke, Graeme M; Besara, Tiglet; Lalancette, Roger A; Siegrist, Theo; Stephens, Peter W; Crowther, Andrew C; Brus, Louis E; Matsuo, Yutaka; Nakamura, Eiichi; Uemura, Yasutomo J; Kim, Philip; Nuckolls, Colin; Steigerwald, Michael L; Roy, Xavier

2014-12-03

In order to realize significant benefits from the assembly of solid-state materials from molecular cluster superatomic building blocks, several criteria must be met. Reproducible syntheses must reliably produce macroscopic amounts of pure material; the cluster-assembled solids must show properties that are more than simply averages of those of the constituent subunits; and rational changes to the chemical structures of the subunits must result in predictable changes in the collective properties of the solid. In this report we show that we can meet these requirements. Using a combination of magnetometry and muon spin relaxation measurements, we demonstrate that crystallographically defined superatomic solids assembled from molecular nickel telluride clusters and fullerenes undergo a ferromagnetic phase transition at low temperatures. Moreover, we show that when we modify the constituent superatoms, the cooperative magnetic properties change in predictable ways.

19 CFR 19.3 - Bonded warehouses; alterations; relocation; suspensions; discontinuance.

Code of Federal Regulations, 2011 CFR

2011-04-01

... application. Rebonding will not be necessary as long as the original bond remains in force. (c) Discontinuance... decision in the Court of International Trade. [T.D. 82-204, 47 FR 49369, Nov. 1, 1982, as amended by T.D. 85-90, 50 FR 21431, May 24, 1985; T.D. 88-63, 53 FR 40219, Oct. 14, 1988; T.D. 92-81, 57 FR 37697...

Short-term Effects of Date Palm Extract (Phoenix dactylifera) on Ischemia/Reperfusion Injury Induced by Testicular Torsion/Detorsion in Rats.

PubMed

Jahromi, Alireza Raayat; Rasooli, Rokhsana; Kamali, Younes; Ahmadi, Nasrollah; Sattari, Ehsan

2017-01-01

Antioxidants are potent scavengers of free radicals and have beneficial effects on human health. The aim of this study was to investigate the potential protective antioxidant activity of the edible portion of date fruit extract in an experimental testicular torsion/detorsion (T/D) model in rats. To investigate the potential protective effects of date palm (DP), 30 male Spraque-Dawley rats were divided into three groups: sham-operated, T/D, and T/D + DP-treated (500 mg/kg, PO) groups. Testicular ischemia was induced via keeping the left testis under 720° clockwise torsion for 2 h (h), afterward, detorsion was performed. All rats were sacrificed 4 h after detorsion. Serum malondialdehyde (MDA) concentration, total oxidative status (TOS), total antioxidant status (TAS), oxidative stress index (OSI), and histopathological damage score were evaluated. Serum MDA, TOS, and OSI levels rose significantly in the T/D group. These values were lower in the T/D + DP group. TAS values decreased significantly in T/D group and rose in T/D + DP group. Severe injury was seen in the twisted testes of T/D group. In contrast, ipsilateral-twisted testicular tissue in the DP-treated group showed moderate-to-mild changes. Contralateral testicular tissue in the T/D group had a mild-to-moderate tissue injury; meanwhile, treated group revealed normal-to-mild changes. Spermatogenesis was significantly improved in DP-treated group when compared with the T/D group. The findings suggest a possible protective effect of DP against testicular oxidative damage induced by T/D; however, more detailed studies are warranted. Given the presence of several phenolic compounds possessing high antioxidant activity in DP, it could potentially be used to reduce testis ischemia/reperfusion-induced damage. Abbreviations Used : TAS: Total antioxidant status,TOS: Total oxidative status; OSI: Oxidative stress index; MDA: Malondialdehyde; C: Congestion; H: Hemorrhage, E: Edema; SG: Sloughed germinal cells; SA: Spermatogenesis arrest; STD: Seminiferous tubules disorganization; STA: Seminiferous tubules atrophy; G: Giant cells; T/D: Torsion/detorsion; DP: Date palm.

Density imaging of volcanos with atmospheric muons

NASA Astrophysics Data System (ADS)

Fehr, Felix; Tomuvol Collaboration

2012-07-01

Their long range in matter renders high-energy atmospheric muons a unique probe for geophysical explorations, permitting the cartography of density distributions which can reveal spatial and possibly also temporal variations in extended geological structures. A Collaboration between volcanologists and (astro-)particle physicists, TOMUVOL, was formed in 2009 to study tomographic muon imaging of volcanos with high-resolution tracking detectors. Here we discuss preparatory work towards muon tomography as well as the first flux measurements taken at the Puy de Dôme, an inactive lava dome volcano in the Massif Central.

Studies on Muon Induction Acceleration and an Objective Lens Design for Transmission Muon Microscope

NASA Astrophysics Data System (ADS)

Artikova, Sayyora; Yoshida, Mitsuhiro; Naito, Fujio

Muon acceleration will be accomplished by a set of induction cells, where each increases the energy of the muon beam by an increment of up to 30 kV. The cells are arranged in a linear way resulting in total accelerating voltage of 300 kV. Acceleration time in the linac is about hundred nanoseconds. Induction field calculation is based on an electrostatic approximation. Beam dynamics in the induction accelerator is investigated and final beam focusing on specimen is realized by designing a pole piece lens.

Horizontal cosmic ray muon radiography for imaging nuclear threats

NASA Astrophysics Data System (ADS)

Morris, Christopher L.; Bacon, Jeffrey; Borozdin, Konstantin; Fabritius, Joseph; Miyadera, Haruo; Perry, John; Sugita, Tsukasa

2014-07-01

Muon tomography is a technique that uses information contained in the Coulomb scattering of cosmic ray muons to generate three dimension images of volumes between tracking detectors. Advantages of this technique are the muons ability to penetrate significant overburden and the absence of any additional dose beyond the natural cosmic ray flux. Disadvantages include the long exposure times and limited resolution because of the low flux. Here we compare the times needed to image objects using both vertically and horizontally mounted tracking detectors and we develop a predictive model for other geometries.

Image reconstruction of muon tomographic data using a density-based clustering method

NASA Astrophysics Data System (ADS)

Perry, Kimberly B.

Muons are subatomic particles capable of reaching the Earth's surface before decaying. When these particles collide with an object that has a high atomic number (Z), their path of travel changes substantially. Tracking muon movement through shielded containers can indicate what types of materials lie inside. This thesis proposes using a density-based clustering algorithm called OPTICS to perform image reconstructions using muon tomographic data. The results show that this method is capable of detecting high-Z materials quickly, and can also produce detailed reconstructions with large amounts of data.

Helical FOFO Snake for 6D Ionization Cooling of Muons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexahin, Y.

2010-03-30

A channel for 6D ionization cooling of muons is described which consists of periodically inclined solenoids of alternating polarity, liquid hydrogen absorbers placed inside the solenoids and RF cavities between them. An important feature of such a channel (called Helical FOFO snake) is that it can cool simultaneously muons of both signs. Theoretical considerations as well as results of simulations with G4beamline are presented which show that a 200 MHz HFOFO snake has sufficient acceptance to be used for initial 6D cooling in muon colliders and neutrino factories.

Energy spectrum of cascade showers induced by cosmic ray muons in the range from 50 GeV to 5 TeV

NASA Technical Reports Server (NTRS)

Ashitkov, V. D.; Kirina, T. M.; Klimakov, A. P.; Kokoulin, R. P.; Petrukhin, A. A.; Yumatov, V. I.

1985-01-01

The energy spectrum of cascade showers induced by electromagnetic interactions of high energy muons of horizontal cosmic ray flux in iron absorber was measured. The total observation time exceeded 22,000 hours. Both the energy spectrum and angular distributions of cascade showers are fairly described in terms of the usual muon generation processes, with a single power index of the parent meson spectrum over the muon energy range from 150 GeV to 5 TeV.

Cosmic ray topography

NASA Astrophysics Data System (ADS)

Bressler, Matthew; Goodwin, Lydia; Kryemadhi, Abaz

2017-11-01

Cosmic ray muons are produced when high energy particles interact with nuclei in Earth's atmosphere. Muons make up the majority of charged particles that reach sea level and are the only particles (apart from neutrinos) that can penetrate to significant depths underground. The muon flux underground decreases approximately exponentially as a function of depth. We use a cosmic ray detector developed by the QuarkNet Program at Fermi National Laboratory to map the topography of the mountain above an abandoned Pennsylvania Turnpike tunnel by analyzing muon flux at different rock overburdens. Cosmic ray muons have been used in this capacity before to search for hidden chambers in pyramids and for mapping volcanoes. This study provides a unique field experience to learn about particle physics and particle detectors, which could be of interest to students and teachers in physics.

Cosmic muon induced EM showers in NO$$\

DOE PAGES

Yadav, Nitin; Duyang, Hongyue; Shanahan, Peter; ...

2016-11-15

Here, the NuMI Off-Axis v e Appearance (NOvA) experiment is a ne appearance neutrino oscillation experiment at Fermilab. It identifies the ne signal from the electromagnetic (EM) showers induced by the electrons in the final state of neutrino interactions. Cosmic muon induced EM showers, dominated by bremsstrahlung, are abundant in NOvA far detector. We use the Cosmic Muon- Removal technique to get pure EM shower sample from bremsstrahlung muons in data. We also use Cosmic muon decay in flight EM showers which are highly pure EM showers.The large Cosmic-EM sample can be used, as data driven method, to characterize themore » EM shower signature and provides valuable checks of the simulation, reconstruction, particle identification algorithm, and calibration across the NOvA detector.« less

An encoding readout method used for Multi-gap Resistive Plate Chambers (MRPCs) for muon tomography

NASA Astrophysics Data System (ADS)

Yue, X.; Zeng, M.; Wang, Y.; Wang, X.; Zeng, Z.; Zhao, Z.; Cheng, J.

2014-09-01

A muon tomography facility has been built in Tsinghua University. Because of the low flux of cosmic muon, an encoding readout method, based on the fine-fine configuration, was implemented for the 2880 channels induced signals from the Multi-gap Resistive Plate Chamber (MRPC) detectors. With the encoding method, the number of the readout electronics was dramatically reduced and thus the complexity and the cost of the facility was reduced, too. In this paper, the details of the encoding method, and the overall readout system setup in the muon tomography facility are described. With the commissioning of the facility, the readout method works well. The spatial resolution of all MRPC detectors are measured with cosmic muon and the preliminary imaging result are also given.

Investigation of humidity using the muon component of cosmic rays

NASA Astrophysics Data System (ADS)

Oskomov, V.; Sedov, A.; Saduyev, N.; Kalikulov, O.; Kenzhina, I.; Naurzbayeva, A.; Alimgazinova, N.; Zhumabaev, A.; Shinbulatov, S.; Erezhep, N.

2017-12-01

Determination of humidity is one of the most important types of hydrometeorological and glaciological observations performed in agriculture, hydropower and water supply. The work is devoted to the development of physical basis of moisture determination method, based on attenuation of the flux of cosmic-ray muons. The relationship between the intensity of muons registered in the underground room of the Tien Shan mountain research station (Almaty) and relative humidity was studied. The results of studies show that the values of the normalized mutual correlation function between the rows of muon intensity and relative humidity vary from 0.3 to 0.7, depending on the coincidence scheme. The data obtained from the muon telescope located at the the Tien Shan mountain research station was used in the work.

Tests of the SIBYLL 2.3 high-energy hadronic interaction model using the KASCADE-Grande muon data

NASA Astrophysics Data System (ADS)

Arteaga-Velázquez, J. C.; Rivera-Rangel, D.; Apel, W. D.; Bekk, K.; Bertaina, M.; Blümer, J.; Bozdog, H.; Brancus, I. M.; Cantoni, E.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; Souza, V. de; Pierro, F. Di; Doll, P.; Engel, R.; Fuhrmann, D.; Gherghel-Lascu, A.; Gils, H. J.; Glasstetter, R.; Grupen, C.; Haungs, A.; Heck, D.; Hörandel, J. R.; Huege, T.; Kampert, K. H.; Kang, D.; Klages, H. O.; Link, K.; Łuczak, P.; Mathes, H. J.; Mayer, H. J.; Milke, J.; Mitrica, B.; Morello, C.; Oehlschläger, J.; Ostapchenko, S.; Pierog, T.; Rebel, H.; Roth, M.; Schieler, H.; Schoo, S.; Schröder, F. G.; Sima, O.; Toma, G.; Trinchero, G. C.; Ulrich, H.; Weindl, A.; Wochele, J.; Zabierowski, J.

2018-01-01

The KASCADE-Grande observatory was a ground-based air shower array dedicated to study the energy and composition of cosmic rays in the energy interval E = 1 PeV -1 EeV. The experiment consisted of different detector systems which allowed the simultaneous measurement of distinct components of air showers (EAS), such as the muon content. In this contribution, we study the total muon number and the lateral density distribution of muons in EAS detected by KASCADE-Grande as a function of the zenith angle and the total number of charged particles. The attenuation length of the muon content of EAS is also measured. The results are compared with the predictions of the SIBYLL 2.3 high-energy hadronic interaction model.

Cosmic muon induced EM showers in NO$$\

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yadav, Nitin; Duyang, Hongyue; Shanahan, Peter

Here, the NuMI Off-Axis v e Appearance (NOvA) experiment is a ne appearance neutrino oscillation experiment at Fermilab. It identifies the ne signal from the electromagnetic (EM) showers induced by the electrons in the final state of neutrino interactions. Cosmic muon induced EM showers, dominated by bremsstrahlung, are abundant in NOvA far detector. We use the Cosmic Muon- Removal technique to get pure EM shower sample from bremsstrahlung muons in data. We also use Cosmic muon decay in flight EM showers which are highly pure EM showers.The large Cosmic-EM sample can be used, as data driven method, to characterize themore » EM shower signature and provides valuable checks of the simulation, reconstruction, particle identification algorithm, and calibration across the NOvA detector.« less

Commissioning of the ATLAS Muon Spectrometer with cosmic rays

NASA Astrophysics Data System (ADS)

Aad, G.; Abbott, B.; Abdallah, J.; Abdelalim, A. A.; Abdesselam, A.; Abdinov, O.; Abi, B.; Abolins, M.; Abramowicz, H.; Abreu, H.; Acharya, B. S.; Adams, D. L.; Addy, T. N.; Adelman, J.; Adorisio, C.; Adragna, P.; Adye, T.; Aefsky, S.; Aguilar-Saavedra, J. A.; Aharrouche, M.; Ahlen, S. P.; Ahles, F.; Ahmad, A.; Ahmed, H.; Ahsan, M.; Aielli, G.; Akdogan, T.; Åkesson, T. P. A.; Akimoto, G.; Akimov, A. V.; Aktas, A.; Alam, M. S.; Alam, M. A.; Albrand, S.; Aleksa, M.; Aleksandrov, I. N.; Alexa, C.; Alexander, G.; Alexandre, G.; Alexopoulos, T.; Alhroob, M.; Aliev, M.; Alimonti, G.; Alison, J.; Aliyev, M.; Allport, P. P.; Allwood-Spiers, S. E.; Almond, J.; Aloisio, A.; Alon, R.; Alonso, A.; Alviggi, M. G.; Amako, K.; Amelung, C.; Amorim, A.; Amorós, G.; Amram, N.; Anastopoulos, C.; Andeen, T.; Anders, C. F.; Anderson, K. J.; Andreazza, A.; Andrei, V.; Anduaga, X. S.; Angerami, A.; Anghinolfi, F.; Anjos, N.; Annovi, A.; Antonaki, A.; Antonelli, M.; Antonelli, S.; Antos, J.; Antunovic, B.; Anulli, F.; Aoun, S.; Arabidze, G.; Aracena, I.; Arai, Y.; Arce, A. T. H.; Archambault, J. P.; Arfaoui, S.; Arguin, J.-F.; Argyropoulos, T.; Arik, M.; Armbruster, A. J.; Arnaez, O.; Arnault, C.; Artamonov, A.; Arutinov, D.; Asai, M.; Asai, S.; Asfandiyarov, R.; Ask, S.; Åsman, B.; Asner, D.; Asquith, L.; Assamagan, K.; Astbury, A.; Astvatsatourov, A.; Atoian, G.; Auerbach, B.; Augsten, K.; Aurousseau, M.; Austin, N.; Avolio, G.; Avramidou, R.; Axen, D.; Ay, C.; Azuelos, G.; Azuma, Y.; Baak, M. A.; Bach, A. M.; Bachacou, H.; Bachas, K.; Backes, M.; Badescu, E.; Bagnaia, P.; Bai, Y.; Bain, T.; Baines, J. T.; Baker, O. K.; Baker, M. D.; Baker, S.; Dos Santos Pedrosa, F. Baltasar; Banas, E.; Banerjee, P.; Banerjee, S.; Banfi, D.; Bangert, A.; Bansal, V.; Baranov, S. P.; Baranov, S.; Barashkou, A.; Barber, T.; Barberio, E. L.; Barberis, D.; Barbero, M.; Bardin, D. Y.; Barillari, T.; Barisonzi, M.; Barklow, T.; Barlow, N.; Barnett, B. M.; Barnett, R. M.; Baroncelli, A.; Barr, A. J.; Barreiro, F.; Barreiro Guimarães da Costa, J.; Barrillon, P.; Bartoldus, R.; Bartsch, D.; Bates, R. L.; Batkova, L.; Batley, J. R.; Battaglia, A.; Battistin, M.; Bauer, F.; Bawa, H. S.; Bazalova, M.; Beare, B.; Beau, T.; Beauchemin, P. H.; Beccherle, R.; Becerici, N.; Bechtle, P.; Beck, G. A.; Beck, H. P.; Beckingham, M.; Becks, K. H.; Beddall, A. J.; Beddall, A.; Bednyakov, V. A.; Bee, C.; Begel, M.; Harpaz, S. Behar; Behera, P. K.; Beimforde, M.; Belanger-Champagne, C.; Bell, P. J.; Bell, W. H.; Bella, G.; Bellagamba, L.; Bellina, F.; Bellomo, M.; Belloni, A.; Belotskiy, K.; Beltramello, O.; Ben Ami, S.; Benary, O.; Benchekroun, D.; Bendel, M.; Benedict, B. H.; Benekos, N.; Benhammou, Y.; Benincasa, G. P.; Benjamin, D. P.; Benoit, M.; Bensinger, J. R.; Benslama, K.; Bentvelsen, S.; Beretta, M.; Berge, D.; Bergeaas Kuutmann, E.; Berger, N.; Berghaus, F.; Berglund, E.; Beringer, J.; Bernat, P.; Bernhard, R.; Bernius, C.; Berry, T.; Bertin, A.; Besana, M. I.; Besson, N.; Bethke, S.; Bianchi, R. M.; Bianco, M.; Biebel, O.; Biesiada, J.; Biglietti, M.; Bilokon, H.; Bindi, M.; Binet, S.; Bingul, A.; Bini, C.; Biscarat, C.; Bitenc, U.; Black, K. M.; Blair, R. E.; Blanchard, J.-B.; Blanchot, G.; Blocker, C.; Blondel, A.; Blum, W.; Blumenschein, U.; Bobbink, G. J.; Bocci, A.; Boehler, M.; Boek, J.; Boelaert, N.; Böser, S.; Bogaerts, J. A.; Bogouch, A.; Bohm, C.; Bohm, J.; Boisvert, V.; Bold, T.; Boldea, V.; Bondarenko, V. G.; Bondioli, M.; Boonekamp, M.; Bordoni, S.; Borer, C.; Borisov, A.; Borissov, G.; Borjanovic, I.; Borroni, S.; Bos, K.; Boscherini, D.; Bosman, M.; Boterenbrood, H.; Bouchami, J.; Boudreau, J.; Bouhova-Thacker, E. V.; Boulahouache, C.; Bourdarios, C.; Boveia, A.; Boyd, J.; Boyko, I. R.; Bozovic-Jelisavcic, I.; Bracinik, J.; Braem, A.; Branchini, P.; Brandenburg, G. W.; Brandt, A.; Brandt, G.; Brandt, O.; Bratzler, U.; Brau, B.; Brau, J. E.; Braun, H. M.; Brelier, B.; Bremer, J.; Brenner, R.; Bressler, S.; Britton, D.; Brochu, F. M.; Brock, I.; Brock, R.; Brodet, E.; Bromberg, C.; Brooijmans, G.; Brooks, W. K.; Brown, G.; Bruckman de Renstrom, P. A.; Bruncko, D.; Bruneliere, R.; Brunet, S.; Bruni, A.; Bruni, G.; Bruschi, M.; Bucci, F.; Buchanan, J.; Buchholz, P.; Buckley, A. G.; Budagov, I. A.; Budick, B.; Büscher, V.; Bugge, L.; Bulekov, O.; Bunse, M.; Buran, T.; Burckhart, H.; Burdin, S.; Burgess, T.; Burke, S.; Busato, E.; Bussey, P.; Buszello, C. P.; Butin, F.; Butler, B.; Butler, J. M.; Buttar, C. M.; Butterworth, J. M.; Byatt, T.; Caballero, J.; Cabrera Urbán, S.; Caforio, D.; Cakir, O.; Calafiura, P.; Calderini, G.; Calfayan, P.; Calkins, R.; Caloba, L. P.; Calvet, D.; Camarri, P.; Cameron, D.; Campana, S.; Campanelli, M.; Canale, V.; Canelli, F.; Canepa, A.; Cantero, J.; Capasso, L.; Capeans Garrido, M. D. M.; Caprini, I.; Caprini, M.; Capua, M.; Caputo, R.; Caramarcu, C.; Cardarelli, R.; Carli, T.; Carlino, G.; Carminati, L.; Caron, B.; Caron, S.; Carrillo Montoya, G. D.; Carron Montero, S.; Carter, A. A.; Carter, J. R.; Carvalho, J.; Casadei, D.; Casado, M. P.; Cascella, M.; Castaneda Hernandez, A. M.; Castaneda-Miranda, E.; Castillo Gimenez, V.; Castro, N. F.; Cataldi, G.; Catinaccio, A.; Catmore, J. R.; Cattai, A.; Cattani, G.; Caughron, S.; Cauz, D.; Cavalleri, P.; Cavalli, D.; Cavalli-Sforza, M.; Cavasinni, V.; Ceradini, F.; Cerqueira, A. S.; Cerri, A.; Cerrito, L.; Cerutti, F.; Cetin, S. A.; Chafaq, A.; Chakraborty, D.; Chan, K.; Chapman, J. D.; Chapman, J. W.; Chareyre, E.; Charlton, D. G.; Chavda, V.; Cheatham, S.; Chekanov, S.; Chekulaev, S. V.; Chelkov, G. A.; Chen, H.; Chen, S.; Chen, X.; Cheplakov, A.; Chepurnov, V. F.; Cherkaoui El Moursli, R.; Tcherniatine, V.; Chesneanu, D.; Cheu, E.; Cheung, S. L.; Chevalier, L.; Chevallier, F.; Chiarella, V.; Chiefari, G.; Chikovani, L.; Childers, J. T.; Chilingarov, A.; Chiodini, G.; Chizhov, V.; Choudalakis, G.; Chouridou, S.; Christidi, I. A.; Christov, A.; Chromek-Burckhart, D.; Chu, M. L.; Chudoba, J.; Ciapetti, G.; Ciftci, A. K.; Ciftci, R.; Cinca, D.; Cindro, V.; Ciobotaru, M. D.; Ciocca, C.; Ciocio, A.; Cirilli, M.; Citterio, M.; Clark, A.; Clark, P. J.; Cleland, W.; Clemens, J. C.; Clement, B.; Clement, C.; Coadou, Y.; Cobal, M.; Coccaro, A.; Cochran, J.; Coggeshall, J.; Cogneras, E.; Colijn, A. P.; Collard, C.; Collins, N. J.; Collins-Tooth, C.; Collot, J.; Colon, G.; Conde Muiño, P.; Coniavitis, E.; Consonni, M.; Constantinescu, S.; Conta, C.; Conventi, F.; Cooke, M.; Cooper, B. D.; Cooper-Sarkar, A. M.; Cooper-Smith, N. J.; Copic, K.; Cornelissen, T.; Corradi, M.; Corriveau, F.; Corso-Radu, A.; Cortes-Gonzalez, A.; Cortiana, G.; Costa, G.; Costa, M. J.; Costanzo, D.; Costin, T.; Côté, D.; Coura Torres, R.; Courneyea, L.; Cowan, G.; Cowden, C.; Cox, B. E.; Cranmer, K.; Cranshaw, J.; Cristinziani, M.; Crosetti, G.; Crupi, R.; Crépé-Renaudin, S.; Almenar, C. Cuenca; Cuhadar Donszelmann, T.; Curatolo, M.; Curtis, C. J.; Cwetanski, P.; Czyczula, Z.; D'Auria, S.; D'Onofrio, M.; D'Orazio, A.; da Via, C.; Dabrowski, W.; Dai, T.; Dallapiccola, C.; Dallison, S. J.; Daly, C. H.; Dam, M.; Danielsson, H. O.; Dannheim, D.; Dao, V.; Darbo, G.; Darlea, G. L.; Davey, W.; Davidek, T.; Davidson, N.; Davidson, R.; Davies, M.; Davison, A. R.; Dawson, I.; Daya, R. K.; de, K.; de Asmundis, R.; de Castro, S.; de Castro Faria Salgado, P. E.; de Cecco, S.; de Graat, J.; de Groot, N.; de Jong, P.; de Mora, L.; de Oliveira Branco, M.; de Pedis, D.; de Salvo, A.; de Sanctis, U.; de Santo, A.; de Vivie de Regie, J. B.; de Zorzi, G.; Dean, S.; Dedovich, D. V.; Degenhardt, J.; Dehchar, M.; Del Papa, C.; Del Peso, J.; Del Prete, T.; Dell'Acqua, A.; Dell'Asta, L.; Della Pietra, M.; Della Volpe, D.; Delmastro, M.; Delsart, P. A.; Deluca, C.; Demers, S.; Demichev, M.; Demirkoz, B.; Deng, J.; Deng, W.; Denisov, S. P.; Derkaoui, J. E.; Derue, F.; Dervan, P.; Desch, K.; Deviveiros, P. O.; Dewhurst, A.; Dewilde, B.; Dhaliwal, S.; Dhullipudi, R.; di Ciaccio, A.; di Ciaccio, L.; di Domenico, A.; di Girolamo, A.; di Girolamo, B.; di Luise, S.; di Mattia, A.; di Nardo, R.; di Simone, A.; di Sipio, R.; Diaz, M. A.; Diblen, F.; Diehl, E. B.; Dietrich, J.; Dietzsch, T. A.; Diglio, S.; Dindar Yagci, K.; Dingfelder, J.; Dionisi, C.; Dita, P.; Dita, S.; Dittus, F.; Djama, F.; Djilkibaev, R.; Djobava, T.; Do Vale, M. A. B.; Do Valle Wemans, A.; Doan, T. K. O.; Dobos, D.; Dobson, E.; Dobson, M.; Doglioni, C.; Doherty, T.; Dolejsi, J.; Dolenc, I.; Dolezal, Z.; Dolgoshein, B. A.; Dohmae, T.; Donega, M.; Donini, J.; Dopke, J.; Doria, A.; Dos Anjos, A.; Dotti, A.; Dova, M. T.; Doxiadis, A.; Doyle, A. T.; Drasal, Z.; Dris, M.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Dudarev, A.; Dudziak, F.; Dührssen, M.; Duflot, L.; Dufour, M.-A.; Dunford, M.; Duran Yildiz, H.; Dushkin, A.; Duxfield, R.; Dwuznik, M.; Düren, M.; Ebenstein, W. L.; Ebke, J.; Eckweiler, S.; Edmonds, K.; Edwards, C. A.; Egorov, K.; Ehrenfeld, W.; Ehrich, T.; Eifert, T.; Eigen, G.; Einsweiler, K.; Eisenhandler, E.; Ekelof, T.; El Kacimi, M.; Ellert, M.; Elles, S.; Ellinghaus, F.; Ellis, K.; Ellis, N.; Elmsheuser, J.; Elsing, M.; Emeliyanov, D.; Engelmann, R.; Engl, A.; Epp, B.; Eppig, A.; Erdmann, J.; Ereditato, A.; Eriksson, D.; Ermoline, I.; Ernst, J.; Ernst, M.; Ernwein, J.; Errede, D.; Errede, S.; Ertel, E.; Escalier, M.; Escobar, C.; Espinal Curull, X.; Esposito, B.; Etienvre, A. I.; Etzion, E.; Evans, H.; Fabbri, L.; Fabre, C.; Facius, K.; Fakhrutdinov, R. M.; Falciano, S.; Fang, Y.; Fanti, M.; Farbin, A.; Farilla, A.; Farley, J.; Farooque, T.; Farrington, S. M.; Farthouat, P.; Fassnacht, P.; Fassouliotis, D.; Fatholahzadeh, B.; Fayard, L.; Fayette, F.; Febbraro, R.; Federic, P.; Fedin, O. L.; Fedorko, W.; Feligioni, L.; Felzmann, C. U.; Feng, C.; Feng, E. J.; Fenyuk, A. B.; Ferencei, J.; Ferland, J.; Fernandes, B.; Fernando, W.; Ferrag, S.; Ferrando, J.; Ferrara, V.; Ferrari, A.; Ferrari, P.; Ferrari, R.; Ferrer, A.; Ferrer, M. L.; Ferrere, D.; Ferretti, C.; Fiascaris, M.; Fiedler, F.; Filipčič, A.; Filippas, A.; Filthaut, F.; Fincke-Keeler, M.; Fiolhais, M. C. N.; Fiorini, L.; Firan, A.; Fischer, G.; Fisher, M. J.; Flechl, M.; Fleck, I.; Fleckner, J.; Fleischmann, P.; Fleischmann, S.; Flick, T.; Flores Castillo, L. R.; Flowerdew, M. J.; Martin, T. Fonseca; Formica, A.; Forti, A.; Fortin, D.; Fournier, D.; Fowler, A. J.; Fowler, K.; Fox, H.; Francavilla, P.; Franchino, S.; Francis, D.; Franklin, M.; Franz, S.; Fraternali, M.; Fratina, S.; Freestone, J.; French, S. T.; Froeschl, R.; Froidevaux, D.; Frost, J. A.; Fukunaga, C.; Fullana Torregrosa, E.; Fuster, J.; Gabaldon, C.; Gabizon, O.; Gadfort, T.; Gadomski, S.; Gagliardi, G.; Gagnon, P.; Galea, C.; Gallas, E. J.; Gallo, V.; Gallop, B. J.; Gallus, P.; Galyaev, E.; Gan, K. K.; Gao, Y. S.; Gaponenko, A.; Garcia-Sciveres, M.; García, C.; Navarro, J. E. García; Gardner, R. W.; Garelli, N.; Garitaonandia, H.; Garonne, V.; Gatti, C.; Gaudio, G.; Gautard, V.; Gauzzi, P.; Gavrilenko, I. L.; Gay, C.; Gaycken, G.; Gazis, E. N.; Ge, P.; Gee, C. N. P.; Geich-Gimbel, Ch.; Gellerstedt, K.; Gemme, C.; Genest, M. H.; Gentile, S.; Georgatos, F.; George, S.; Gershon, A.; Ghazlane, H.; Ghodbane, N.; Giacobbe, B.; Giagu, S.; Giakoumopoulou, V.; Giangiobbe, V.; Gianotti, F.; Gibbard, B.; Gibson, A.; Gibson, S. M.; Gilbert, L. M.; Gilchriese, M.; Gilewsky, V.; Gingrich, D. M.; Ginzburg, J.; Giokaris, N.; Giordani, M. P.; Giordano, R.; Giorgi, F. M.; Giovannini, P.; Giraud, P. F.; Girtler, P.; Giugni, D.; Giusti, P.; Gjelsten, B. K.; Gladilin, L. K.; Glasman, C.; Glazov, A.; Glitza, K. W.; Glonti, G. L.; Godfrey, J.; Godlewski, J.; Goebel, M.; Göpfert, T.; Goeringer, C.; Gössling, C.; Göttfert, T.; Goggi, V.; Goldfarb, S.; Goldin, D.; Golling, T.; Gomes, A.; Fajardo, L. S. Gomez; Gonçalo, R.; Gonella, L.; Gong, C.; González de La Hoz, S.; Silva, M. L. Gonzalez; Gonzalez-Sevilla, S.; Goodson, J. J.; Goossens, L.; Gordon, H. A.; Gorelov, I.; Gorfine, G.; Gorini, B.; Gorini, E.; Gorišek, A.; Gornicki, E.; Gosdzik, B.; Gosselink, M.; Gostkin, M. I.; Eschrich, I. Gough; Gouighri, M.; Goujdami, D.; Goulette, M. P.; Goussiou, A. G.; Goy, C.; Grabowska-Bold, I.; Grafström, P.; Grahn, K.-J.; Grancagnolo, S.; Grassi, V.; Gratchev, V.; Grau, N.; Gray, H. M.; Gray, J. A.; Graziani, E.; Green, B.; Greenshaw, T.; Greenwood, Z. D.; Gregor, I. M.; Grenier, P.; Griesmayer, E.; Griffiths, J.; Grigalashvili, N.; Grillo, A. A.; Grimm, K.; Grinstein, S.; Grishkevich, Y. V.; Groh, M.; Groll, M.; Gross, E.; Grosse-Knetter, J.; Groth-Jensen, J.; Grybel, K.; Guicheney, C.; Guida, A.; Guillemin, T.; Guler, H.; Gunther, J.; Guo, B.; Gupta, A.; Gusakov, Y.; Gutierrez, A.; Gutierrez, P.; Guttman, N.; Gutzwiller, O.; Guyot, C.; Gwenlan, C.; Gwilliam, C. B.; Haas, A.; Haas, S.; Haber, C.; Hadavand, H. K.; Hadley, D. R.; Haefner, P.; Härtel, R.; Hajduk, Z.; Hakobyan, H.; Haller, J.; Hamacher, K.; Hamilton, A.; Hamilton, S.; Han, L.; Hanagaki, K.; Hance, M.; Handel, C.; Hanke, P.; Hansen, J. R.; Hansen, J. B.; Hansen, J. D.; Hansen, P. H.; Hansl-Kozanecka, T.; Hansson, P.; Hara, K.; Hare, G. A.; Harenberg, T.; Harrington, R. D.; Harris, O. M.; Harrison, K.; Hartert, J.; Hartjes, F.; Harvey, A.; Hasegawa, S.; Hasegawa, Y.; Hashemi, K.; Hassani, S.; Haug, S.; Hauschild, M.; Hauser, R.; Havranek, M.; Hawkes, C. M.; Hawkings, R. J.; Hayakawa, T.; Hayward, H. S.; Haywood, S. J.; Head, S. J.; Hedberg, V.; Heelan, L.; Heim, S.; Heinemann, B.; Heisterkamp, S.; Helary, L.; Heller, M.; Hellman, S.; Helsens, C.; Hemperek, T.; Henderson, R. C. W.; Henke, M.; Henrichs, A.; Correia, A. M. Henriques; Henrot-Versille, S.; Hensel, C.; Henß, T.; Hernández Jiménez, Y.; Hershenhorn, A. D.; Herten, G.; Hertenberger, R.; Hervas, L.; Hessey, N. P.; Higón-Rodriguez, E.; Hill, J. C.; Hiller, K. H.; Hillert, S.; Hillier, S. J.; Hinchliffe, I.; Hines, E.; Hirose, M.; Hirsch, F.; Hirschbuehl, D.; Hobbs, J.; Hod, N.; Hodgkinson, M. C.; Hodgson, P.; Hoecker, A.; Hoeferkamp, M. R.; Hoffman, J.; Hoffmann, D.; Hohlfeld, M.; Holy, T.; Holzbauer, J. L.; Homma, Y.; Horazdovsky, T.; Hori, T.; Horn, C.; Horner, S.; Horvat, S.; Hostachy, J.-Y.; Hou, S.; Hoummada, A.; Howe, T.; Hrivnac, J.; Hryn'ova, T.; Hsu, P. J.; Hsu, S.-C.; Huang, G. S.; Hubacek, Z.; Hubaut, F.; Huegging, F.; Hughes, E. W.; Hughes, G.; Hurwitz, M.; Husemann, U.; Huseynov, N.; Huston, J.; Huth, J.; Iacobucci, G.; Iakovidis, G.; Ibragimov, I.; Iconomidou-Fayard, L.; Idarraga, J.; Iengo, P.; Igonkina, O.; Ikegami, Y.; Ikeno, M.; Ilchenko, Y.; Iliadis, D.; Ince, T.; Ioannou, P.; Iodice, M.; Irles Quiles, A.; Ishikawa, A.; Ishino, M.; Ishmukhametov, R.; Isobe, T.; Issakov, V.; Issever, C.; Istin, S.; Itoh, Y.; Ivashin, A. V.; Iwanski, W.; Iwasaki, H.; Izen, J. M.; Izzo, V.; Jackson, B.; Jackson, J. N.; Jackson, P.; Jaekel, M. R.; Jain, V.; Jakobs, K.; Jakobsen, S.; Jakubek, J.; Jana, D. K.; Jansen, E.; Jantsch, A.; Janus, M.; Jared, R. C.; Jarlskog, G.; Jeanty, L.; Jen-La Plante, I.; Jenni, P.; Jez, P.; Jézéquel, S.; Ji, W.; Jia, J.; Jiang, Y.; Belenguer, M. Jimenez; Jin, S.; Jinnouchi, O.; Joffe, D.; Johansen, M.; Johansson, K. E.; Johansson, P.; Johnert, S.; Johns, K. A.; Jon-And, K.; Jones, G.; Jones, R. W. L.; Jones, T. J.; Jorge, P. M.; Joseph, J.; Juranek, V.; Jussel, P.; Kabachenko, V. V.; Kaci, M.; Kaczmarska, A.; Kado, M.; Kagan, H.; Kagan, M.; Kaiser, S.; Kajomovitz, E.; Kalinin, S.; Kalinovskaya, L. V.; Kalinowski, A.; Kama, S.; Kanaya, N.; Kaneda, M.; Kantserov, V. A.; Kanzaki, J.; Kaplan, B.; Kapliy, A.; Kaplon, J.; Kar, D.; Karagounis, M.; Karagoz Unel, M.; Kartvelishvili, V.; Karyukhin, A. N.; Kashif, L.; Kasmi, A.; Kass, R. D.; Kastanas, A.; Kastoryano, M.; Kataoka, M.; Kataoka, Y.; Katsoufis, E.; Katzy, J.; Kaushik, V.; Kawagoe, K.; Kawamoto, T.; Kawamura, G.; Kayl, M. S.; Kayumov, F.; Kazanin, V. A.; Kazarinov, M. Y.; Keates, J. R.; Keeler, R.; Keener, P. T.; Kehoe, R.; Keil, M.; Kekelidze, G. D.; Kelly, M.; Kenyon, M.; Kepka, O.; Kerschen, N.; Kerševan, B. P.; Kersten, S.; Kessoku, K.; Khakzad, M.; Khalil-Zada, F.; Khandanyan, H.; Khanov, A.; Kharchenko, D.; Khodinov, A.; Khomich, A.; Khoriauli, G.; Khovanskiy, N.; Khovanskiy, V.; Khramov, E.; Khubua, J.; Kim, H.; Kim, M. S.; Kim, P. C.; Kim, S. H.; Kind, O.; Kind, P.; King, B. T.; Kirk, J.; Kirsch, G. P.; Kirsch, L. E.; Kiryunin, A. E.; Kisielewska, D.; Kittelmann, T.; Kiyamura, H.; Kladiva, E.; Klein, M.; Klein, U.; Kleinknecht, K.; Klemetti, M.; Klier, A.; Klimentov, A.; Klingenberg, R.; Klinkby, E. B.; Klioutchnikova, T.; Klok, P. F.; Klous, S.; Kluge, E.-E.; Kluge, T.; Kluit, P.; Klute, M.; Kluth, S.; Knecht, N. S.; Kneringer, E.; Ko, B. R.; Kobayashi, T.; Kobel, M.; Koblitz, B.; Kocian, M.; Kocnar, A.; Kodys, P.; Köneke, K.; König, A. C.; Koenig, S.; Köpke, L.; Koetsveld, F.; Koevesarki, P.; Koffas, T.; Koffeman, E.; Kohn, F.; Kohout, Z.; Kohriki, T.; Kolanoski, H.; Kolesnikov, V.; Koletsou, I.; Koll, J.; Kollar, D.; Kolos, S.; Kolya, S. D.; Komar, A. A.; Komaragiri, J. R.; Kondo, T.; Kono, T.; Konoplich, R.; Konovalov, S. P.; Konstantinidis, N.; Koperny, S.; Korcyl, K.; Kordas, K.; Korn, A.; Korolkov, I.; Korolkova, E. V.; Korotkov, V. A.; Kortner, O.; Kostka, P.; Kostyukhin, V. V.; Kotov, S.; Kotov, V. M.; Kotov, K. Y.; Kourkoumelis, C.; Koutsman, A.; Kowalewski, R.; Kowalski, H.; Kowalski, T. Z.; Kozanecki, W.; Kozhin, A. S.; Kral, V.; Kramarenko, V. A.; Kramberger, G.; Krasny, M. W.; Krasznahorkay, A.; Kreisel, A.; Krejci, F.; Kretzschmar, J.; Krieger, N.; Krieger, P.; Kroeninger, K.; Kroha, H.; Kroll, J.; Kroseberg, J.; Krstic, J.; Kruchonak, U.; Krüger, H.; Krumshteyn, Z. V.; Kubota, T.; Kuehn, S.; Kugel, A.; Kuhl, T.; Kuhn, D.; Kukhtin, V.; Kulchitsky, Y.; Kuleshov, S.; Kummer, C.; Kuna, M.; Kunkle, J.; Kupco, A.; Kurashige, H.; Kurata, M.; Kurchaninov, L. L.; Kurochkin, Y. A.; Kus, V.; Kwee, R.; La Rotonda, L.; Labbe, J.; Lacasta, C.; Lacava, F.; Lacker, H.; Lacour, D.; Lacuesta, V. R.; Ladygin, E.; Lafaye, R.; Laforge, B.; Lagouri, T.; Lai, S.; Lamanna, M.; Lampen, C. L.; Lampl, W.; Lancon, E.; Landgraf, U.; Landon, M. P. J.; Lane, J. L.; Lankford, A. J.; Lanni, F.; Lantzsch, K.; Lanza, A.; Laplace, S.; Lapoire, C.; Laporte, J. F.; Lari, T.; Larner, A.; Lassnig, M.; Laurelli, P.; Lavrijsen, W.; Laycock, P.; Lazarev, A. B.; Lazzaro, A.; Le Dortz, O.; Le Guirriec, E.; Le Menedeu, E.; Le Vine, M.; Lebedev, A.; Lebel, C.; Lecompte, T.; Ledroit-Guillon, F.; Lee, H.; Lee, J. S. H.; Lee, S. C.; Lefebvre, M.; Legendre, M.; Legeyt, B. C.; Legger, F.; Leggett, C.; Lehmacher, M.; Lehmann Miotto, G.; Lei, X.; Leitner, R.; Lellouch, D.; Lellouch, J.; Lendermann, V.; Leney, K. J. C.; Lenz, T.; Lenzen, G.; Lenzi, B.; Leonhardt, K.; Leroy, C.; Lessard, J.-R.; Lester, C. G.; Leung Fook Cheong, A.; Levêque, J.; Levin, D.; Levinson, L. J.; Leyton, M.; Li, H.; Li, S.; Li, X.; Liang, Z.; Liang, Z.; Liberti, B.; Lichard, P.; Lichtnecker, M.; Lie, K.; Liebig, W.; Lilley, J. N.; Lim, H.; Limosani, A.; Limper, M.; Lin, S. C.; Linnemann, J. T.; Lipeles, E.; Lipinsky, L.; Lipniacka, A.; Liss, T. M.; Lissauer, D.; Lister, A.; Litke, A. M.; Liu, C.; Liu, D.; Liu, H.; Liu, J. B.; Liu, M.; Liu, T.; Liu, Y.; Livan, M.; Lleres, A.; Lloyd, S. L.; Lobodzinska, E.; Loch, P.; Lockman, W. S.; Lockwitz, S.; Loddenkoetter, T.; Loebinger, F. K.; Loginov, A.; Loh, C. W.; Lohse, T.; Lohwasser, K.; Lokajicek, M.; Long, R. E.; Lopes, L.; Lopez Mateos, D.; Losada, M.; Loscutoff, P.; Lou, X.; Lounis, A.; Loureiro, K. F.; Lovas, L.; Love, J.; Love, P. A.; Lowe, A. J.; Lu, F.; Lubatti, H. J.; Luci, C.; Lucotte, A.; Ludwig, A.; Ludwig, D.; Ludwig, I.; Luehring, F.; Luisa, L.; Lumb, D.; Luminari, L.; Lund, E.; Lund-Jensen, B.; Lundberg, B.; Lundberg, J.; Lundquist, J.; Lynn, D.; Lys, J.; Lytken, E.; Ma, H.; Ma, L. L.; Macana Goia, J. A.; Maccarrone, G.; Macchiolo, A.; Maček, B.; Miguens, J. Machado; Mackeprang, R.; Madaras, R. J.; Mader, W. F.; Maenner, R.; Maeno, T.; Mättig, P.; Mättig, S.; Magalhaes Martins, P. J.; Magradze, E.; Mahalalel, Y.; Mahboubi, K.; Mahmood, A.; Maiani, C.; Maidantchik, C.; Maio, A.; Majewski, S.; Makida, Y.; Makouski, M.; Makovec, N.; Malecki, Pa.; Malecki, P.; Maleev, V. P.; Malek, F.; Mallik, U.; Malon, D.; Maltezos, S.; Malyshev, V.; Malyukov, S.; Mambelli, M.; Mameghani, R.; Mamuzic, J.; Mandelli, L.; Mandić, I.; Mandrysch, R.; Maneira, J.; Mangeard, P. S.; Manjavidze, I. D.; Manning, P. M.; Manousakis-Katsikakis, A.; Mansoulie, B.; Mapelli, A.; Mapelli, L.; March, L.; Marchand, J. F.; Marchese, F.; Marchiori, G.; Marcisovsky, M.; Marino, C. P.; Marroquim, F.; Marshall, Z.; Marti-Garcia, S.; Martin, A. J.; Martin, A. J.; Martin, B.; Martin, B.; Martin, F. F.; Martin, J. P.; Martin, T. A.; Dit Latour, B. Martin; Martinez, M.; Outschoorn, V. Martinez; Martini, A.; Martyniuk, A. C.; Marzano, F.; Marzin, A.; Masetti, L.; Mashimo, T.; Mashinistov, R.; Masik, J.; Maslennikov, A. L.; Massa, I.; Massol, N.; Mastroberardino, A.; Masubuchi, T.; Matricon, P.; Matsunaga, H.; Matsushita, T.; Mattravers, C.; Maxfield, S. J.; Mayne, A.; Mazini, R.; Mazur, M.; Mazzanti, M.; Mc Donald, J.; Mc Kee, S. P.; McCarn, A.; McCarthy, R. L.; McCubbin, N. A.; McFarlane, K. W.; McGlone, H.; McHedlidze, G.; McMahon, S. J.; McPherson, R. A.; Meade, A.; Mechnich, J.; Mechtel, M.; Medinnis, M.; Meera-Lebbai, R.; Meguro, T. M.; Mehlhase, S.; Mehta, A.; Meier, K.; Meirose, B.; Melachrinos, C.; Mellado Garcia, B. R.; Mendoza Navas, L.; Meng, Z.; Menke, S.; Meoni, E.; Mermod, P.; Merola, L.; Meroni, C.; Merritt, F. S.; Messina, A. M.; Metcalfe, J.; Mete, A. S.; Meyer, J.-P.; Meyer, J.; Meyer, J.; Meyer, T. C.; Meyer, W. T.; Miao, J.; Michal, S.; Micu, L.; Middleton, R. P.; Migas, S.; Mijović, L.; Mikenberg, G.; Mikestikova, M.; Mikuž, M.; Miller, D. W.; Mills, W. J.; Mills, C. M.; Milov, A.; Milstead, D. A.; Milstein, D.; Minaenko, A. A.; Miñano, M.; Minashvili, I. A.; Mincer, A. I.; Mindur, B.; Mineev, M.; Ming, Y.; Mir, L. M.; Mirabelli, G.; Misawa, S.; Miscetti, S.; Misiejuk, A.; Mitrevski, J.; Mitsou, V. A.; Miyagawa, P. S.; Mjörnmark, J. U.; Mladenov, D.; Moa, T.; Moed, S.; Moeller, V.; Mönig, K.; Möser, N.; Mohr, W.; Mohrdieck-Möck, S.; Moles-Valls, R.; Molina-Perez, J.; Monk, J.; Monnier, E.; Montesano, S.; Monticelli, F.; Moore, R. W.; Herrera, C. Mora; Moraes, A.; Morais, A.; Morel, J.; Morello, G.; Moreno, D.; Llácer, M. Moreno; Morettini, P.; Morii, M.; Morley, A. K.; Mornacchi, G.; Morozov, S. V.; Morris, J. D.; Moser, H. G.; Mosidze, M.; Moss, J.; Mount, R.; Mountricha, E.; Mouraviev, S. V.; Moyse, E. J. W.; Mudrinic, M.; Mueller, F.; Mueller, J.; Mueller, K.; Müller, T. A.; Muenstermann, D.; Muir, A.; Munwes, Y.; Garcia, R. Murillo; Murray, W. J.; Mussche, I.; Musto, E.; Myagkov, A. G.; Myska, M.; Nadal, J.; Nagai, K.; Nagano, K.; Nagasaka, Y.; Nairz, A. M.; Nakamura, K.; Nakano, I.; Nakatsuka, H.; Nanava, G.; Napier, A.; Nash, M.; Nation, N. R.; Nattermann, T.; Naumann, T.; Navarro, G.; Nderitu, S. K.; Neal, H. A.; Nebot, E.; Nechaeva, P.; Negri, A.; Negri, G.; Nelson, A.; Nelson, T. K.; Nemecek, S.; Nemethy, P.; Nepomuceno, A. A.; Nessi, M.; Neubauer, M. S.; Neusiedl, A.; Neves, R. M.; Nevski, P.; Newcomer, F. M.; Nickerson, R. B.; Nicolaidou, R.; Nicolas, L.; Nicoletti, G.; Nicquevert, B.; Niedercorn, F.; Nielsen, J.; Nikiforov, A.; Nikolaev, K.; Nikolic-Audit, I.; Nikolopoulos, K.; Nilsen, H.; Nilsson, P.; Nisati, A.; Nishiyama, T.; Nisius, R.; Nodulman, L.; Nomachi, M.; Nomidis, I.; Nordberg, M.; Nordkvist, B.; Notz, D.; Novakova, J.; Nozaki, M.; Nožička, M.; Nugent, I. M.; Nuncio-Quiroz, A.-E.; Nunes Hanninger, G.; Nunnemann, T.; Nurse, E.; O'Neil, D. C.; O'Shea, V.; Oakham, F. G.; Oberlack, H.; Ochi, A.; Oda, S.; Odaka, S.; Odier, J.; Ogren, H.; Oh, A.; Oh, S. H.; Ohm, C. C.; Ohshima, T.; Ohshita, H.; Ohsugi, T.; Okada, S.; Okawa, H.; Okumura, Y.; Okuyama, T.; Olchevski, A. G.; Oliveira, M.; Damazio, D. Oliveira; Oliver, J.; Garcia, E. Oliver; Olivito, D.; Olszewski, A.; Olszowska, J.; Omachi, C.; Onofre, A.; Onyisi, P. U. E.; Oram, C. J.; Oreglia, M. J.; Oren, Y.; Orestano, D.; Orlov, I.; Oropeza Barrera, C.; Orr, R. S.; Ortega, E. O.; Osculati, B.; Ospanov, R.; Osuna, C.; Ottersbach, J. P.; Ould-Saada, F.; Ouraou, A.; Ouyang, Q.; Owen, M.; Owen, S.; Oyarzun, A.; Ozcan, V. E.; Ozone, K.; Ozturk, N.; Pacheco Pages, A.; Padilla Aranda, C.; Paganis, E.; Pahl, C.; Paige, F.; Pajchel, K.; Palestini, S.; Pallin, D.; Palma, A.; Palmer, J. D.; Pan, Y. B.; Panagiotopoulou, E.; Panes, B.; Panikashvili, N.; Panitkin, S.; Pantea, D.; Panuskova, M.; Paolone, V.; Papadopoulou, Th. D.; Park, S. J.; Park, W.; Parker, M. A.; Parker, S. I.; Parodi, F.; Parsons, J. A.; Parzefall, U.; Pasqualucci, E.; Passeri, A.; Pastore, F.; Pastore, Fr.; Pásztor, G.; Pataraia, S.; Pater, J. R.; Patricelli, S.; Patwa, A.; Pauly, T.; Peak, L. S.; Pecsy, M.; Pedraza Morales, M. I.; Peleganchuk, S. V.; Peng, H.; Penson, A.; Penwell, J.; Perantoni, M.; Perez, K.; Codina, E. Perez; Pérez García-Estañ, M. T.; Reale, V. Perez; Perini, L.; Pernegger, H.; Perrino, R.; Persembe, S.; Perus, P.; Peshekhonov, V. D.; Petersen, B. A.; Petersen, T. C.; Petit, E.; Petridou, C.; Petrolo, E.; Petrucci, F.; Petschull, D.; Petteni, M.; Pezoa, R.; Phan, A.; Phillips, A. W.; Piacquadio, G.; Piccinini, M.; Piegaia, R.; Pilcher, J. E.; Pilkington, A. D.; Pina, J.; Pinamonti, M.; Pinfold, J. L.; Pinto, B.; Pizio, C.; Placakyte, R.; Plamondon, M.; Pleier, M.-A.; Poblaguev, A.; Poddar, S.; Podlyski, F.; Poffenberger, P.; Poggioli, L.; Pohl, M.; Polci, F.; Polesello, G.; Policicchio, A.; Polini, A.; Poll, J.; Polychronakos, V.; Pomeroy, D.; Pommès, K.; Ponsot, P.; Pontecorvo, L.; Pope, B. G.; Popeneciu, G. A.; Popovic, D. S.; Poppleton, A.; Popule, J.; Portell Bueso, X.; Porter, R.; Pospelov, G. E.; Pospisil, S.; Potekhin, M.; Potrap, I. N.; Potter, C. J.; Potter, C. T.; Potter, K. P.; Poulard, G.; Poveda, J.; Prabhu, R.; Pralavorio, P.; Prasad, S.; Pravahan, R.; Pribyl, L.; Price, D.; Price, L. E.; Prichard, P. M.; Prieur, D.; Primavera, M.; Prokofiev, K.; Prokoshin, F.; Protopopescu, S.; Proudfoot, J.; Prudent, X.; Przysiezniak, H.; Psoroulas, S.; Ptacek, E.; Puigdengoles, C.; Purdham, J.; Purohit, M.; Puzo, P.; Pylypchenko, Y.; Qi, M.; Qian, J.; Qian, W.; Qin, Z.; Quadt, A.; Quarrie, D. R.; Quayle, W. B.; Quinonez, F.; Raas, M.; Radeka, V.; Radescu, V.; Radics, B.; Rador, T.; Ragusa, F.; Rahal, G.; Rahimi, A. M.; Rajagopalan, S.; Rammensee, M.; Rammes, M.; Rauscher, F.; Rauter, E.; Raymond, M.; Read, A. L.; Rebuzzi, D. M.; Redelbach, A.; Redlinger, G.; Reece, R.; Reeves, K.; Reinherz-Aronis, E.; Reinsch, A.; Reisinger, I.; Reljic, D.; Rembser, C.; Ren, Z. L.; Renkel, P.; Rescia, S.; Rescigno, M.; Resconi, S.; Resende, B.; Reznicek, P.; Rezvani, R.; Richards, A.; Richards, R. A.; Richter, R.; Richter-Was, E.; Ridel, M.; Rijpstra, M.; Rijssenbeek, M.; Rimoldi, A.; Rinaldi, L.; Rios, R. R.; Riu, I.; Rizatdinova, F.; Rizvi, E.; Roa Romero, D. A.; Robertson, S. H.; Robichaud-Veronneau, A.; Robinson, D.; Robinson, J. E. M.; Robinson, M.; Robson, A.; Rocha de Lima, J. G.; Roda, C.; Dos Santos, D. Roda; Rodriguez, D.; Garcia, Y. Rodriguez; Roe, S.; Røhne, O.; Rojo, V.; Rolli, S.; Romaniouk, A.; Romanov, V. M.; Romeo, G.; Romero Maltrana, D.; Roos, L.; Ros, E.; Rosati, S.; Rosenbaum, G. A.; Rosselet, L.; Rossetti, V.; Rossi, L. P.; Rotaru, M.; Rothberg, J.; Rousseau, D.; Royon, C. R.; Rozanov, A.; Rozen, Y.; Ruan, X.; Ruckert, B.; Ruckstuhl, N.; Rud, V. I.; Rudolph, G.; Rühr, F.; Ruggieri, F.; Ruiz-Martinez, A.; Rumyantsev, L.; Rurikova, Z.; Rusakovich, N. A.; Rutherfoord, J. P.; Ruwiedel, C.; Ruzicka, P.; Ryabov, Y. F.; Ryan, P.; Rybkin, G.; Rzaeva, S.; Saavedra, A. F.; Sadrozinski, H. F.-W.; Sadykov, R.; Sakamoto, H.; Salamanna, G.; Salamon, A.; Saleem, M. S.; Salihagic, D.; Salnikov, A.; Salt, J.; Salvachua Ferrando, B. M.; Salvatore, D.; Salvatore, F.; Salvucci, A.; Salzburger, A.; Sampsonidis, D.; Samset, B. H.; Sandaker, H.; Sander, H. G.; Sanders, M. P.; Sandhoff, M.; Sandhu, P.; Sandstroem, R.; Sandvoss, S.; Sankey, D. P. C.; Sanny, B.; Sansoni, A.; Santamarina Rios, C.; Santoni, C.; Santonico, R.; Saraiva, J. G.; Sarangi, T.; Sarkisyan-Grinbaum, E.; Sarri, F.; Sasaki, O.; Sasao, N.; Satsounkevitch, I.; Sauvage, G.; Savard, P.; Savine, A. Y.; Savinov, V.; Sawyer, L.; Saxon, D. H.; Says, L. P.; Sbarra, C.; Sbrizzi, A.; Scannicchio, D. A.; Schaarschmidt, J.; Schacht, P.; Schäfer, U.; Schaetzel, S.; Schaffer, A. C.; Schaile, D.; Schamberger, R. D.; Schamov, A. G.; Schegelsky, V. A.; Scheirich, D.; Schernau, M.; Scherzer, M. I.; Schiavi, C.; Schieck, J.; Schioppa, M.; Schlenker, S.; Schmieden, K.; Schmitt, C.; Schmitz, M.; Schott, M.; Schouten, D.; Schovancova, J.; Schram, M.; Schreiner, A.; Schroeder, C.; Schroer, N.; Schroers, M.; Schultes, J.; Schultz-Coulon, H.-C.; Schumacher, J. W.; Schumacher, M.; Schumm, B. A.; Schune, Ph.; Schwanenberger, C.; Schwartzman, A.; Schwemling, Ph.; Schwienhorst, R.; Schwierz, R.; Schwindling, J.; Scott, W. G.; Searcy, J.; Sedykh, E.; Segura, E.; Seidel, S. C.; Seiden, A.; Seifert, F.; Seixas, J. M.; Sekhniaidze, G.; Seliverstov, D. M.; Sellden, B.; Semprini-Cesari, N.; Serfon, C.; Serin, L.; Seuster, R.; Severini, H.; Sevior, M. E.; Sfyrla, A.; Shabalina, E.; Shamim, M.; Shan, L. Y.; Shank, J. T.; Shao, Q. T.; Shapiro, M.; Shatalov, P. B.; Shaw, K.; Sherman, D.; Sherwood, P.; Shibata, A.; Shimojima, M.; Shin, T.; Shmeleva, A.; Shochet, M. J.; Shupe, M. A.; Sicho, P.; Sidoti, A.; Siegert, F.; Siegrist, J.; Sijacki, Dj.; Silbert, O.; Silva, J.; Silver, Y.; Silverstein, D.; Silverstein, S. B.; Simak, V.; Simic, Lj.; Simion, S.; Simmons, B.; Simonyan, M.; Sinervo, P.; Sinev, N. B.; Sipica, V.; Siragusa, G.; Sisakyan, A. N.; Sivoklokov, S. Yu.; Sjoelin, J.; Sjursen, T. B.; Skovpen, K.; Skubic, P.; Slater, M.; Slavicek, T.; Sliwa, K.; Sloper, J.; Sluka, T.; Smakhtin, V.; Smirnov, S. Yu.; Smirnov, Y.; Smirnova, L. N.; Smirnova, O.; Smith, B. C.; Smith, D.; Smith, K. M.; Smizanska, M.; Smolek, K.; Snesarev, A. A.; Snow, S. W.; Snow, J.; Snuverink, J.; Snyder, S.; Soares, M.; Sobie, R.; Sodomka, J.; Soffer, A.; Solans, C. A.; Solar, M.; Solc, J.; Solfaroli Camillocci, E.; Solodkov, A. A.; Solovyanov, O. V.; Soluk, R.; Sondericker, J.; Sopko, V.; Sopko, B.; Sosebee, M.; Soukharev, A.; Spagnolo, S.; Spanò, F.; Spencer, E.; Spighi, R.; Spigo, G.; Spila, F.; Spiwoks, R.; Spousta, M.; Spreitzer, T.; Spurlock, B.; Denis, R. D. St.; Stahl, T.; Stahlman, J.; Stamen, R.; Stancu, S. N.; Stanecka, E.; Stanek, R. W.; Stanescu, C.; Stapnes, S.; Starchenko, E. A.; Stark, J.; Staroba, P.; Starovoitov, P.; Stastny, J.; Stavina, P.; Steele, G.; Steinbach, P.; Steinberg, P.; Stekl, I.; Stelzer, B.; Stelzer, H. J.; Stelzer-Chilton, O.; Stenzel, H.; Stevenson, K.; Stewart, G. A.; Stockton, M. C.; Stoerig, K.; Stoicea, G.; Stonjek, S.; Strachota, P.; Stradling, A. R.; Straessner, A.; Strandberg, J.; Strandberg, S.; Strandlie, A.; Strauss, M.; Strizenec, P.; Ströhmer, R.; Strom, D. M.; Stroynowski, R.; Strube, J.; Stugu, B.; Soh, D. A.; Su, D.; Sugaya, Y.; Sugimoto, T.; Suhr, C.; Suk, M.; Sulin, V. V.; Sultansoy, S.; Sumida, T.; Sun, X. H.; Sundermann, J. E.; Suruliz, K.; Sushkov, S.; Susinno, G.; Sutton, M. R.; Suzuki, T.; Suzuki, Y.; Sykora, I.; Sykora, T.; Szymocha, T.; Sánchez, J.; Ta, D.; Tackmann, K.; Taffard, A.; Tafirout, R.; Taga, A.; Takahashi, Y.; Takai, H.; Takashima, R.; Takeda, H.; Takeshita, T.; Talby, M.; Talyshev, A.; Tamsett, M. C.; Tanaka, J.; Tanaka, R.; Tanaka, S.; Tanaka, S.; Tapprogge, S.; Tardif, D.; Tarem, S.; Tarrade, F.; Tartarelli, G. F.; Tas, P.; Tasevsky, M.; Tassi, E.; Tatarkhanov, M.; Taylor, C.; Taylor, F. E.; Taylor, G. N.; Taylor, R. P.; Taylor, W.; Teixeira-Dias, P.; Ten Kate, H.; Teng, P. K.; Tennenbaum-Katan, Y. D.; Terada, S.; Terashi, K.; Terron, J.; Terwort, M.; Testa, M.; Teuscher, R. J.; Thioye, M.; Thoma, S.; Thomas, J. P.; Thompson, E. N.; Thompson, P. D.; Thompson, P. D.; Thompson, R. J.; Thompson, A. S.; Thomson, E.; Thun, R. P.; Tic, T.; Tikhomirov, V. O.; Tikhonov, Y. A.; Tipton, P.; Tique Aires Viegas, F. J.; Tisserant, S.; Toczek, B.; Todorov, T.; Todorova-Nova, S.; Toggerson, B.; Tojo, J.; Tokár, S.; Tokushuku, K.; Tollefson, K.; Tomasek, L.; Tomasek, M.; Tomoto, M.; Tompkins, L.; Toms, K.; Tonoyan, A.; Topfel, C.; Topilin, N. D.; Torrence, E.; Torró Pastor, E.; Toth, J.; Touchard, F.; Tovey, D. R.; Trefzger, T.; Tremblet, L.; Tricoli, A.; Trigger, I. M.; Trincaz-Duvoid, S.; Trinh, T. N.; Tripiana, M. F.; Triplett, N.; Trischuk, W.; Trivedi, A.; Trocmé, B.; Troncon, C.; Trzupek, A.; Tsarouchas, C.; Tseng, J. C.-L.; Tsiakiris, M.; Tsiareshka, P. V.; Tsionou, D.; Tsipolitis, G.; Tsiskaridze, V.; Tskhadadze, E. G.; Tsukerman, I. I.; Tsulaia, V.; Tsung, J.-W.; Tsuno, S.; Tsybychev, D.; Tuggle, J. M.; Turecek, D.; Turk Cakir, I.; Turlay, E.; Tuts, P. M.; Twomey, M. S.; Tylmad, M.; Tyndel, M.; Uchida, K.; Ueda, I.; Ugland, M.; Uhlenbrock, M.; Uhrmacher, M.; Ukegawa, F.; Unal, G.; Undrus, A.; Unel, G.; Unno, Y.; Urbaniec, D.; Urkovsky, E.; Urquijo, P.; Urrejola, P.; Usai, G.; Uslenghi, M.; Vacavant, L.; Vacek, V.; Vachon, B.; Vahsen, S.; Valente, P.; Valentinetti, S.; Valkar, S.; Valladolid Gallego, E.; Vallecorsa, S.; Valls Ferrer, J. A.; van Berg, R.; van der Graaf, H.; van der Kraaij, E.; van der Poel, E.; van der Ster, D.; van Eldik, N.; van Gemmeren, P.; van Kesteren, Z.; van Vulpen, I.; Vandelli, W.; Vaniachine, A.; Vankov, P.; Vannucci, F.; Vari, R.; Varnes, E. W.; Varouchas, D.; Vartapetian, A.; Varvell, K. E.; Vasilyeva, L.; Vassilakopoulos, V. I.; Vazeille, F.; Vellidis, C.; Veloso, F.; Veneziano, S.; Ventura, A.; Ventura, D.; Venturi, M.; Venturi, N.; Vercesi, V.; Verducci, M.; Verkerke, W.; Vermeulen, J. C.; Vetterli, M. C.; Vichou, I.; Vickey, T.; Viehhauser, G. H. A.; Villa, M.; Villani, E. G.; Villaplana Perez, M.; Vilucchi, E.; Vincter, M. G.; Vinek, E.; Vinogradov, V. B.; Viret, S.; Virzi, J.; Vitale, A.; Vitells, O.; Vivarelli, I.; Vives Vaque, F.; Vlachos, S.; Vlasak, M.; Vlasov, N.; Vogel, A.; Vokac, P.; Volpi, M.; von der Schmitt, H.; von Loeben, J.; von Radziewski, H.; von Toerne, E.; Vorobel, V.; Vorwerk, V.; Vos, M.; Voss, R.; Voss, T. T.; Vossebeld, J. H.; Vranjes, N.; Vranjes Milosavljevic, M.; Vrba, V.; Vreeswijk, M.; Anh, T. Vu; Vudragovic, D.; Vuillermet, R.; Vukotic, I.; Wagner, P.; Walbersloh, J.; Walder, J.; Walker, R.; Walkowiak, W.; Wall, R.; Wang, C.; Wang, H.; Wang, J.; Wang, S. M.; Warburton, A.; Ward, C. P.; Warsinsky, M.; Wastie, R.; Watkins, P. M.; Watson, A. T.; Watson, M. F.; Watts, G.; Watts, S.; Waugh, A. T.; Waugh, B. M.; Weber, M. D.; Weber, M.; Weber, M. S.; Weber, P.; Weidberg, A. R.; Weingarten, J.; Weiser, C.; Wellenstein, H.; Wells, P. S.; Wen, M.; Wenaus, T.; Wendler, S.; Wengler, T.; Wenig, S.; Wermes, N.; Werner, M.; Werner, P.; Werth, M.; Werthenbach, U.; Wessels, M.; Whalen, K.; White, A.; White, M. J.; White, S.; Whitehead, S. R.; Whiteson, D.; Whittington, D.; Wicek, F.; Wicke, D.; Wickens, F. J.; Wiedenmann, W.; Wielers, M.; Wienemann, P.; Wiglesworth, C.; Wiik, L. A. M.; Wildauer, A.; Wildt, M. A.; Wilkens, H. G.; Williams, E.; Williams, H. H.; Willocq, S.; Wilson, J. A.; Wilson, M. G.; Wilson, A.; Wingerter-Seez, I.; Winklmeier, F.; Wittgen, M.; Wolter, M. W.; Wolters, H.; Wosiek, B. K.; Wotschack, J.; Woudstra, M. J.; Wraight, K.; Wright, C.; Wright, D.; Wrona, B.; Wu, S. L.; Wu, X.; Wulf, E.; Wynne, B. M.; Xaplanteris, L.; Xella, S.; Xie, S.; Xu, D.; Xu, N.; Yamada, M.; Yamamoto, A.; Yamamoto, K.; Yamamoto, S.; Yamamura, T.; Yamaoka, J.; Yamazaki, T.; Yamazaki, Y.; Yan, Z.; Yang, H.; Yang, U. K.; Yang, Z.; Yao, W.-M.; Yao, Y.; Yasu, Y.; Ye, J.; Ye, S.; Yilmaz, M.; Yoosoofmiya, R.; Yorita, K.; Yoshida, R.; Young, C.; Youssef, S. P.; Yu, D.; Yu, J.; Yuan, L.; Yurkewicz, A.; Zaidan, R.; Zaitsev, A. M.; Zajacova, Z.; Zambrano, V.; Zanello, L.; Zaytsev, A.; Zeitnitz, C.; Zeller, M.; Zemla, A.; Zendler, C.; Zenin, O.; Zenis, T.; Zenonos, Z.; Zenz, S.; Zerwas, D.; Della Porta, G. Zevi; Zhan, Z.; Zhang, H.; Zhang, J.; Zhang, Q.; Zhang, X.; Zhao, L.; Zhao, T.; Zhao, Z.; Zhemchugov, A.; Zhong, J.; Zhou, B.; Zhou, N.; Zhou, Y.; Zhu, C. G.; Zhu, H.; Zhu, Y.; Zhuang, X.; Zhuravlov, V.; Zimmermann, R.; Zimmermann, S.; Zimmermann, S.; Ziolkowski, M.; Živković, L.; Zobernig, G.; Zoccoli, A.; Zur Nedden, M.; Zutshi, V.

2010-12-01

The ATLAS detector at the Large Hadron Collider has collected several hundred million cosmic ray events during 2008 and 2009. These data were used to commission the Muon Spectrometer and to study the performance of the trigger and tracking chambers, their alignment, the detector control system, the data acquisition and the analysis programs. We present the performance in the relevant parameters that determine the quality of the muon measurement. We discuss the single element efficiency, resolution and noise rates, the calibration method of the detector response and of the alignment system, the track reconstruction efficiency and the momentum measurement. The results show that the detector is close to the design performance and that the Muon Spectrometer is ready to detect muons produced in high energy proton-proton collisions.

Development and evaluation of a time-dependent radiographic technology by using a muon read out module

NASA Astrophysics Data System (ADS)

Kusagaya, T.; Uchida, T.; Tanaka, H. K. M.; Tanaka, M.

2012-04-01

We will present a real-time monitoring system for cosmic-ray muon radiography as an application of a readout module developed by T. Uchida et al [1,2]. The readout module was developed originally for probing the internal structure of volcanoes in 2008 [3]. Its features are small in size, low power consumption, and the capability to access remotely via Ethernet. The current statistics data of cosmic-ray muons can be read from a PC placed far from the module at anytime. By using this feature, we constructed a real-time monitoring system. As a test experiment, we observed fluid movement in a cylinder with a diameter of 112 meters water equivalent. In this work, we succeeded to resolve the fluid movement in the cylinder. We varied the fluid level inside the cylinder and measured the muon intensity. We found that the muon intensity correlates inversely with the fluid level: the muon intensity increases for the lower fluid level and decreases for the higher fluid level. Although the time resolution of muon radiography was sufficient to resolve changes in the fluid level, an adequate time window has to be chosen for different operating conditions. We anticipate that this system will be applicable to exploring high-speed phenomena in a gigantic object.

Preliminary frequency-domain analysis for the reconstructed spatial resolution of muon tomography

NASA Astrophysics Data System (ADS)

Yu, B.; Zhao, Z.; Wang, X.; Wang, Y.; Wu, D.; Zeng, Z.; Zeng, M.; Yi, H.; Luo, Z.; Yue, X.; Cheng, J.

2014-11-01

Muon tomography is an advanced technology to non-destructively detect high atomic number materials. It exploits the multiple Coulomb scattering information of muon to reconstruct the scattering density image of the traversed object. Because of the statistics of muon scattering, the measurement error of system and the data incompleteness, the reconstruction is always accompanied with a certain level of interference, which will influence the reconstructed spatial resolution. While statistical noises can be reduced by extending the measuring time, system parameters determine the ultimate spatial resolution that one system can reach. In this paper, an effective frequency-domain model is proposed to analyze the reconstructed spatial resolution of muon tomography. The proposed method modifies the resolution analysis in conventional computed tomography (CT) to fit the different imaging mechanism in muon scattering tomography. The measured scattering information is described in frequency domain, then a relationship between the measurements and the original image is proposed in Fourier domain, which is named as "Muon Central Slice Theorem". Furthermore, a preliminary analytical expression of the ultimate reconstructed spatial is derived, and the simulations are performed for validation. While the method is able to predict the ultimate spatial resolution of a given system, it can also be utilized for the optimization of system design and construction.

Probing the evolution of the EAS muon content in the atmosphere with KASCADE-Grande

NASA Astrophysics Data System (ADS)

Apel, W. D.; Arteaga-Velázquez, J. C.; Bekk, K.; Bertaina, M.; Blümer, J.; Bozdog, H.; Brancus, I. M.; Cantoni, E.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; de Souza, V.; Di Pierro, F.; Doll, P.; Engel, R.; Fuhrmann, D.; Gherghel-Lascu, A.; Gils, H. J.; Glasstetter, R.; Grupen, C.; Haungs, A.; Heck, D.; Hörandel, J. R.; Huege, T.; Kampert, K.-H.; Kang, D.; Klages, H. O.; Link, K.; Łuczak, P.; Mathes, H. J.; Mayer, H. J.; Milke, J.; Mitrica, B.; Morello, C.; Oehlschläger, J.; Ostapchenko, S.; Pierog, T.; Rebel, H.; Roth, M.; Schieler, H.; Schoo, S.; Schröder, F. G.; Sima, O.; Toma, G.; Trinchero, G. C.; Ulrich, H.; Weindl, A.; Wochele, J.; Zabierowski, J.

2017-10-01

The evolution of the muon content of very high energy air showers (EAS) in the atmosphere is investigated with data of the KASCADE-Grande observatory. For this purpose, the muon attenuation length in the atmosphere is obtained to Λμ = 1256 ± 85-232+229 (syst) g/cm2 from the experimental data for shower energies between 1016.3 and 1017.0 eV. Comparison of this quantity with predictions of the high-energy hadronic interaction models QGSJET-II-02, SIBYLL 2.1, QGSJET-II-04 and EPOS-LHC reveals that the attenuation of the muon content of measured EAS in the atmosphere is lower than predicted. Deviations are, however, less significant with the post-LHC models. The presence of such deviations seems to be related to a difference between the simulated and the measured zenith angle evolutions of the lateral muon density distributions of EAS, which also causes a discrepancy between the measured absorption lengths of the density of shower muons and the predicted ones at large distances from the EAS core. The studied deficiencies show that all four considered hadronic interaction models fail to describe consistently the zenith angle evolution of the muon content of EAS in the aforesaid energy regime.

Non-destructive elemental analysis of vertebral body trabecular bone using muonic X-rays.

PubMed

Hosoi, Y; Watanabe, Y; Sugita, R; Tanaka, Y; Nagamine, K; Ono, T; Sakamoto, K

1995-12-01

Non-destructive elemental analysis with muonic X-rays was performed on human vertebral bone and lumbar torso phantoms. It can provide quantitative information on all elements in small deep-seated localized volumes. The experiment was carried out using the superconducting muon channel at TRIUMF in Vancouver, Canada and a lithium drifted germanium detector with an active area of 18.5 cm2. The muon channel produced backward-decayed negative muons with wide kinetic energy range from 0.5 to 54.2 MeV. The muon beam was collimated to a diameter of 18 mm. The number of incoming muons was about 4 x 10(6) approximately 5 x 10(7) per data point. In the measurements with human vertebral bones fixed with neutralized formaldehyde, the correlation coefficient between calcium content measured by muons and by atomic absorption analysis was 0.99 and the level of significance was 0.0003. In the measurements with lumbar torso phantoms, the correlation coefficient between calcium content measured by muons and by atomic absorption analysis was 0.99 and the level of significance was 0.02. The results suggest that elemental analysis in vertebral body trabecular bone using muonic X-rays closely correlates with measurements by atomic absorption analysis.

A G protein-coupled receptor (GPCR) in red: live cell imaging of the kappa opioid receptor-tdTomato fusion protein (KOPR-tdT) in neuronal cells

PubMed Central

Huang, Peng; Chiu, Yi-Ting; Chen, Chongguang; Wang, Yujun; Liu-Chen, Lee-Yuan

2013-01-01

Introduction In contrast to green fluorescent protein and variants (GFPs), red fluorescent proteins (RFPs) have rarely been employed for generation of GPCR fusion proteins, likely because of formation of aggregates and cell toxicity of some RFPs. Among all the RFPs available, tdTomato (tdT), one of the non-aggregating RFP, has the highest brightness score (about 3 times that of eGFP) and unsurpassed photostability. Methods We fused tdT to the KOPR C-terminus. The KOPR-tdT cDNA construct was transfected into Neuro2A mouse neuroblastoma cell line (Neuro2A cells) and rat cortical primary neurons for characterization of pharmacological properties and imaging studies on KOPR trafficking. Results KOPR-tdT retained KOPR properties (cell surface expression, ligand binding, agonist-induced signaling and internalization) when expressed in Neuro2A cells and rat primary cortical neurons. Live cell imaging of KOPR-tdT enables visualization of time course of agonist-induced internalization of KOPR in real time for 60 min, without photobleaching and apparent cell toxicity. U50,488H-induced KOPR internalization occurred as early as 4 min and plateaued at about 30 min. A unique pattern of internalized KOPR in processes of primary neurons was induced by U50,488H. Discussion tdT is an alternative to, or even a better tool than, GFPs for fusing to GPCR for trafficking studies, because tdT has higher brightness and thus better resolution and less photobleaching problems due to reduced laser power used. It also has advantages associated with its longer-wavelength emission including spectral separation from autofluorescence and GFPs, reduced cell toxicity the laser may impose, and greater tissue penetration. These advantages of tdT over GPFs may be critical for live cell imaging studies of GPCRs in vitro and for studying GPCRs in vivo because of their low abundance. PMID:23856011

Do pattern deviation values accurately estimate glaucomatous visual field damage in eyes with glaucoma and cataract?

PubMed

Matsuda, Aya; Hara, Takeshi; Miyata, Kazunori; Matsuo, Hiroshi; Murata, Hiroshi; Mayama, Chihiro; Asaoka, Ryo

2015-09-01

To study the efficacy of pattern deviation (PD) values in the estimation of visual field compensating the influence of cataract in eyes with glaucoma. The study subjects comprised of 48 eyes of 37 glaucoma patients. Mean total deviation value (mTDs) on Humphrey Field Analyzer after cataract surgery was compared with mean PD (mPD) before the surgery. Visual field measurements were carried out ≤6 months before (VF(pre)) and following (VF(post)) successful cataract surgery. The difference between the mPD or mTD values in the VF(pre) and mTD values in the VF(post) (denoted as εmPD/ΔmTD) was calculated, and the influence of the extent of 'true' glaucomatous visual field damage or cataract (as represented by εmPD and ΔmTD, respectively) on this difference was also investigated. There was a significant difference between mTD in the VF(pre) and mTD in the VF(post) (p<0.001, repeated measures analysis of variance). There was not a significant difference between mPD in the VF(pre) and mTD in the VF(post) (p=0.06); however, εmPD was significantly correlated with the mTD in VF(post) and also ΔmTD (R(2)=0.56 and 0.27, p<0.001, Pearson's correlation). The accurate prediction of the mTD in the VF(post) can be achieved using the pattern standard deviation (PSD), mTD and also visual acuity before surgery. Clinicians should be very careful when reviewing the VF of a patient with glaucoma and cataract since PD values may underestimate glaucomatous VF damage in patients with advanced disease and also overestimate glaucomatous VF damage in patients with early to moderate cataract. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Oral Wild-Type Salmonella Typhi Challenge Induces Activation of Circulating Monocytes and Dendritic Cells in Individuals Who Develop Typhoid Disease.

PubMed

Toapanta, Franklin R; Bernal, Paula J; Fresnay, Stephanie; Darton, Thomas C; Jones, Claire; Waddington, Claire S; Blohmke, Christoph J; Dougan, Gordon; Angus, Brian; Levine, Myron M; Pollard, Andrew J; Sztein, Marcelo B

2015-06-01

A new human oral challenge model with wild-type Salmonella Typhi (S. Typhi) was recently developed. In this model, ingestion of 104 CFU of Salmonella resulted in 65% of subjects developing typhoid fever (referred here as typhoid diagnosis -TD-) 5-10 days post-challenge. TD criteria included meeting clinical (oral temperature ≥38°C for ≥12 h) and/or microbiological (S. Typhi bacteremia) endpoints. One of the first lines of defense against pathogens are the cells of the innate immune system (e.g., monocytes, dendritic cells -DCs-). Various changes in circulating monocytes and DCs have been described in the murine S. Typhimurium model; however, whether similar changes are present in humans remains to be explored. To address these questions, a subset of volunteers (5 TD and 3 who did not develop typhoid despite oral challenge -NoTD-) were evaluated for changes in circulating monocytes and DCs. Expression of CD38 and CD40 were upregulated in monocytes and DCs in TD volunteers during the disease days (TD-0h to TD-96h). Moreover, integrin α4β7, a gut homing molecule, was upregulated on monocytes but not DCs. CD21 upregulation was only identified in DCs. These changes were not observed among NoTD volunteers despite the same oral challenge. Moreover, monocytes and DCs from NoTD volunteers showed increased binding to S. Typhi one day after challenge. These monocytes showed phosphorylation of p38MAPK, NFkB and Erk1/2 upon stimulation with S. Typhi-LPS-QDot micelles. In contrast, monocytes from TD volunteers showed only a moderate increase in S. Typhi binding 48 h and 96 h post-TD, and only Erk1/2 phosphorylation. This is the first study to describe different activation and migration profiles, as well as differential signaling patterns, in monocytes and DCs which relate directly to the clinical outcome following oral challenge with wild type S. Typhi.

Models of torsades de pointes: effects of FPL64176, DPI201106, dofetilide, and chromanol 293B in isolated rabbit and guinea pig hearts.

PubMed

Cheng, Hsien C; Incardona, Josephine

2009-01-01

For studying the torsades de pointes (TdP) liability of a compound, most high and medium throughput methods use surrogate markers such as HERG inhibition and QT prolongation. In this study, we have tested whether isolated hearts may be modified to allow TdP to be the direct readout. Isolated spontaneously beating rabbit and guinea pig hearts were perfused according to the Langendorff method in hypokalemic (2.1 mM) solution. The in vitro lead II ECG equivalent and the incidence of TdP were monitored for 1 h. In addition, heart rate, QTc, Tp-Te, short-term variability (STV), time to arrhythmia, and time to TdP were also analyzed. FPL64176, a calcium channel activator; and DPI201106, a sodium channel inactivation inhibitor, produced TdP in isolated rabbit and guinea pig hearts in a concentration dependent manner; guinea pig hearts were 3- to 5-fold more sensitive than rabbit hearts. Both compounds also increased QTc and STV. In contrast, dofetilide, an IKr inhibitor, produced no (or a low incidence of) TdP in both species, in spite of prolongation of QTc intervals. Chromanol 293B, an IKs inhibitor, did not produce TdP in rabbit hearts but elicited TdP concentration dependently in guinea pig hearts even though the compound had no effect on QTc intervals. IKs inhibition appears to be more likely to produce TdP in isolated guinea pig hearts than IKr inhibition. Chromanol 293B did not produce TdP in rabbit hearts presumably due to a low level of IKs channels in the heart. TdP produced in this study was consistent with the notion that its production was a consequence of reduced repolarization reserve, thereby causing rhythmic abnormalities. This isolated, perfused, and spontaneously beating rabbit and guinea pig heart preparation in hypokalemic medium may be useful as a preclinical test model for studying proarrhythmic liability of compounds in new drug development.

Treatment of Tardive Dyskinesia: A General Overview with Focus on the Vesicular Monoamine Transporter 2 Inhibitors.

PubMed

Niemann, Nicki; Jankovic, Joseph

2018-04-01

Tardive dyskinesia (TD) encompasses the spectrum of iatrogenic hyperkinetic movement disorders following exposure to dopamine receptor-blocking agents (DRBAs). Despite the advent of atypical or second- and third-generation antipsychotics with a presumably lower risk of complications, TD remains a persistent and challenging problem. Prevention is the first step in mitigating the risk of TD, but early recognition, gradual withdrawal of offending medications, and appropriate treatment are also critical. As TD is often a persistent and troublesome disorder, specific antidyskinetic therapies are often needed for symptomatic relief. The vesicular monoamine transporter 2 (VMAT2) inhibitors, which include tetrabenazine, deutetrabenazine, and valbenazine, are considered the treatment of choice for most patients with TD. Deutetrabenazine-a deuterated version of tetrabenazine-and valbenazine, the purified parent product of one of the main tetrabenazine metabolites, are novel VMAT2 inhibitors and the only drugs to receive approval from the US FDA for the treatment of TD. VMAT2 inhibitors deplete presynaptic dopamine and reduce involuntary movements in many hyperkinetic movement disorders, particularly TD, Huntington disease, and Tourette syndrome. The active metabolites of the VMAT2 inhibitors have high affinity for VMAT2 and minimal off-target binding. Compared with tetrabenazine, deutetrabenazine and valbenazine have pharmacokinetic advantages that translate into less frequent dosing and better tolerability. However, no head-to-head studies have compared the various VMAT2 inhibitors. One of the major advantages of VMAT2 inhibitors over DRBAs, which are still being used by some clinicians in the treatment of some hyperkinetic disorders, including TD, is that they are not associated with the development of TD. We also briefly discuss other treatment options for TD, including amantadine, clonazepam, Gingko biloba, zolpidem, botulinum toxin, and deep brain stimulation. Treatment of TD and other drug-induced movement disorders must be individualized and based on the severity, phenomenology, potential side effects, and other factors discussed in this review.

Diarrhoea in a large prospective cohort of European travellers to resource-limited destinations

PubMed Central

2010-01-01

Background Incidence rates of travellers' diarrhoea (TD) need to be updated and risk factors are insufficiently known. Methods Between July 2006 and January 2008 adult customers of our Centre for Travel Health travelling to a resource-limited country for the duration of 1 to 8 weeks were invited to participate in a prospective cohort study. They received one questionnaire pre-travel and a second one immediately post-travel. First two-week incidence rates were calculated for TD episodes and a risk assessment was made including demographic and travel-related variables, medical history and behavioural factors. Results Among the 3100 persons recruited, 2800 could be investigated, resulting in a participation rate of 89.2%. The first two-weeks incidence for classic TD was 26.2% (95%CI 24.5-27.8). The highest rates were found for Central Africa (29.6%, 95% CI 12.4-46.8), the Indian subcontinent (26.3%, 95%CI 2.3-30.2) and West Africa (21.5%, 95%CI 14.9-28.1). Median TD duration was 2 days (range 1-90). The majority treated TD with loperamide (57.6%), while a small proportion used probiotics (23.0%) and antibiotics (6.8%). Multiple logistic regression analysis on any TD to determine risk factors showed that a resolved diarrhoeal episode experienced in the 4 months pre-travel (OR 2.03, 95%CI 1.59-2.54), antidepressive comedication (OR 2.11, 95%CI 1.17-3.80), allergic asthma (OR 1.67, 95%CI 1.10-2.54), and reporting TD-independent fever (OR 6.56, 95%CI 3.06-14.04) were the most prominent risk factors of TD. Conclusions TD remains a frequent travel disease, but there is a decreasing trend in the incidence rate. Patients with a history of allergic asthma, pre-travel diarrhoea, or of TD-independent fever were more likely to develop TD while abroad. PMID:20684768

Combined experimental and theoretical studies on the molecular structures, spectroscopy, and inhibitor activity of 3-(2-thienyl)acrylic acid through AIM, NBO,FT-IR, FT-Raman, UV and HOMO-LUMO analyses, and molecular docking

NASA Astrophysics Data System (ADS)

Issaoui, N.; Ghalla, H.; Bardak, F.; Karabacak, M.; Aouled Dlala, N.; Flakus, H. T.; Oujia, B.

2017-02-01

In this work, the molecular structures and vibrational spectral analyses of 3-(2-Theinyl)acrylic acid (3-2TAA) monomer and dimer structures have been reported by using density functional theory calculations at B3LYP/6-311++G(d,p) level of theory. The complete assignments of the fundamental vibrational modes were obtained using potential energy distribution. Intermolecular interactions were analyzed by orbital NBO and topological AIM approaches. The electronic properties have been carried out using TD-DFT approach. Great agreements between experimental and theoretical values were achieved throughout the analysis of structural parameters and spectroscopic features. Inhibitor characteristics on human monoamine oxidase B (MAOB) enzyme of two determined stable conformers of 3-2TAA (β and γ) along with four selective inhibitors, namely safinamide, a coumarin analogue, farnesol, and phenyethylhydrazine were investigated via molecular docking. Moreover, molecular electrostatic potential (MEP) and temperature dependency of thermodynamic functions have been reported.

The spectroscopic properties of anticancer drug Apigenin investigated by using DFT calculations, FT-IR, FT-Raman and NMR analysis

NASA Astrophysics Data System (ADS)

Mariappan, G.; Sundaraganesan, N.; Manoharan, S.

2012-09-01

The FT-Raman and FT-Infrared spectra of solid Apigenin sample were measured in order to elucidate the spectroscopic properties of title molecule in the spectral range of 3500-50 cm-1 and 4000-400 cm-1, respectively. The recorded FT-IR and FT-Raman spectral measurements favor the calculated (by B3LYP/6-31G(d,p) method) structural parameters which are further supported by spectral simulation. Additional support is given by the collected 1H and 13C NMR spectra recorded with the sample dissolved in DMSO. The predicted chemical shifts at the B3LYP/6-31G(d) level obtained using the Gauge-Invariant Atomic Orbitals (GIAO) method with and without inclusion of solvent using the Polarizable Continuum Model (PCM). By using TD-DFT method, electronic absorption spectra of the title compound have been predicted and a good agreement with the TD-DFT method and the experimental one is determined. The UV-visible absorption spectra of the compound that dissolved in Ethanol, Methanol and DMSO were recorded in the range of 800-200 nm. The formation of hydrogen bond and the most possible interaction are explained using natural bond orbital (NBO) analysis. In addition, the molecular electrostatic potential (MEP), frontier molecular orbitals (FMO) analysis and atomic charges of the title compound were investigated using theoretical calculations. The results are discussed herein and compared with similar molecules whenever appropriate.

Comparison of contrast media and low-molecular-weight dextran for frequency-domain optical coherence tomography.

PubMed

Ozaki, Yuichi; Kitabata, Hironori; Tsujioka, Hiroto; Hosokawa, Seiki; Kashiwagi, Manabu; Ishibashi, Kohei; Komukai, Kenichi; Tanimoto, Takashi; Ino, Yasushi; Takarada, Shigeho; Kubo, Takashi; Kimura, Keizo; Tanaka, Atsushi; Hirata, Kumiko; Mizukoshi, Masato; Imanishi, Toshio; Akasaka, Takashi

2012-01-01

Although an intracoronary frequency-domain optical coherence tomography (FD-OCT) system overcomes several limitations of the time-domain OCT (TD-OCT) system, the former requires injection of contrast media for image acquisition. The increased total amount of contrast media for FD-OCT image acquisition may lead to the impairment of renal function. The safety and usefulness of the non-occlusion method with low-molecular-weight dextran L (LMD-L) via a guiding catheter for TD-OCT image acquisition have been reported previously. The aim of the present study was to compare the image quality and quantitative measurements between contrast media and LMD-L for FD-OCT image acquisition in coronary stented lesions. Twenty-two patients with 25 coronary stented lesions were enrolled in this study. FD-OCT was performed with the continuous-flushing method via a guiding catheter. Both contrast media and LMD-L were infused at a rate of 4 ml/s by an autoinjector. With regard to image quality, the prevalence of clear image segments was comparable between contrast media and LMD-L (97.9% vs. 96.5%, P=0.90). Furthermore, excellent correlations were observed between both flushing solutions in terms of minimum lumen area, mean lumen area, and mean stent area. The total volumes of contrast media and of LMD-L needed for OCT image acquisition were similar. FD-OCT image acquisition with LMD-L has the potential to reduce the total amount of contrast media without loss of image quality.

DFT and TD-DFT calculations of metallotetraphenylporphyrin and metallotetraphenylporphyrin fullerene complexes as potential dye sensitizers for solar cells

NASA Astrophysics Data System (ADS)

El Mahdy, A. M.; Halim, Shimaa Abdel; Taha, H. O.

2018-05-01

Density functional theory (DFT) and time-dependent DFT calculations have been employed to model metallotetraphenylporphyrin dyes and metallotetraphenylporphyrin -fullerene complexes in order to investigate the geometries, electronic structures, the density of states, non-linear optical properties (NLO), IR-vis spectra, molecular electrostatic potential contours, and electrophilicity. To calculate the excited states of the tetraphenyl porphyrin analogs, time-dependent density functional theory (TD-DFT) are used. Their UV-vis spectra were also obtained and a comparison with available experimental and theoretical results is included. The results reveal that the metal and the tertiary butyl groups of the dyes are electron donors, and the tetraphenylporphyrin rings are electron acceptors. The HOMOs of the dyes fall within the (TiO2)60 and Ti38O76 band gaps and support the issue of typical interfacial electron transfer reaction. The resulting potential drop of Mn-TPP-C60 increased by ca. 3.50% under the effect of the tertiary butyl groups. The increase in the potential drop indicates that the tertiary butyl complexes could be a better choice for the strong operation of the molecular rectifiers. The introduction of metal atom and tertiary butyl groups to the tetraphenyl porphyrin moiety leads to a stronger response to the external electric field and induces higher photo-to-current conversion efficiency. This also shifts the absorption in the dyes and makes them potential candidates for harvesting light in the entire visible and near IR region for photovoltaic applications.

Plasma assisted molecular beam epitaxy growth and effect of varying buffer thickness on the formation of ultra-thin In{sub 0.17}Al{sub 0.83}N/GaN heterostructure on Si(111)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chowdhury, Subhra, E-mail: subhra1109@gmail.com; Biswas, Dhrubes; Department of E and E C E, Indian Institute of Technology Kharagpur, Kharagpur 721302

2015-02-23

This work reports on the detailed plasma-assisted molecular beam epitaxy (PAMBE) growth of ultra-thin In{sub 0.17}Al{sub 0.83}N/GaN heterostructures on Si(111) substrate with three different buffer thickness (600 nm, 400 nm, and 200 nm). Growth through critical optimization of growth conditions is followed by the investigation of impact of varying buffer thickness on the formation of ultra-thin 1.5 nm, In{sub 0.17}Al{sub 0.83}N–1.25 nm, GaN–1.5 nm, In{sub 0.17}Al{sub 0.83}N heterostructure, in terms of threading dislocation (TD) density. Analysis reveals a drastic reduction of TD density from the order 10{sup 10 }cm{sup −2} to 10{sup 8 }cm{sup −2} with increasing buffer thickness resulting smooth ultra-thin active region for thick buffer structure.more » Increasing strain with decreasing buffer thickness is studied through reciprocal space mapping analysis. Surface morphology through atomic force microscopy analysis also supports our study by observing an increase of pits and root mean square value (0.89 nm, 1.2 nm, and 1.45 nm) with decreasing buffer thickness which are resulted due to the internal strain and TDs.« less

Molecular identification of potential denitrifying bacteria and use of D-optimal mixture experimental design for the optimization of denitrification process.

PubMed

Ben Taheur, Fadia; Fdhila, Kais; Elabed, Hamouda; Bouguerra, Amel; Kouidhi, Bochra; Bakhrouf, Amina; Chaieb, Kamel

2016-04-01

Three bacterial strains (TE1, TD3 and FB2) were isolated from date palm (degla), pistachio and barley. The presence of nitrate reductase (narG) and nitrite reductase (nirS and nirK) genes in the selected strains was detected by PCR technique. Molecular identification based on 16S rDNA sequencing method was applied to identify positive strains. In addition, the D-optimal mixture experimental design was used to optimize the optimal formulation of probiotic bacteria for denitrification process. Strains harboring denitrification genes were identified as: TE1, Agrococcus sp LN828197; TD3, Cronobacter sakazakii LN828198 and FB2, Pedicoccus pentosaceus LN828199. PCR results revealed that all strains carried the nirS gene. However only C. sakazakii LN828198 and Agrococcus sp LN828197 harbored the nirK and the narG genes respectively. Moreover, the studied bacteria were able to form biofilm on abiotic surfaces with different degree. Process optimization showed that the most significant reduction of nitrate was 100% with 14.98% of COD consumption and 5.57 mg/l nitrite accumulation. Meanwhile, the response values were optimized and showed that the most optimal combination was 78.79% of C. sakazakii LN828198 (curve value), 21.21% of P. pentosaceus LN828199 (curve value) and absence (0%) of Agrococcus sp LN828197 (curve value). Copyright © 2016 Elsevier Ltd. All rights reserved.

Thiamine Deficiency Induces Anorexia by Inhibiting Hypothalamic AMPK

PubMed Central

Liu, Mei; Alimov, Alexander; Wang, Haiping; Frank, Jacqueline A.; Katz, Wendy; Xu, Mei; Ke, Zun-Ji; Luo, Jia

2014-01-01

Obesity and eating disorders are prevailing health concerns worldwide. It is important to understand the regulation of food intake and energy metabolism. Thiamine (vitamin B1) is an essential nutrient. Thiamine deficiency (TD) can cause a number of disorders in humans, such as Beriberi and Wernicke-Korsakoff syndrome. We demonstrated here that TD caused anorexia in C57BL/6 mice. After feeding a TD diet for 16 days, the mice displayed a significant decrease in food intake and an increase in resting energy expenditure (REE), which resulted in a severe weight loss. At the 22nd day, the food intake was reduced by 69% and 74% for male and female mice, respectively in TD group. The REE increased by 9 folds in TD group. The loss of body weight (17–24%) was similar between male and female animals and mainly resulted from the reduction of fat mass (49% decrease). Re-supplementation of thiamine (benfotiamine) restored animal's appetite, leading to a total recovery of body weight. The hypothalamic AMPK is a critical regulator of food intake. TD inhibited the phosphorylation of AMPK in the arcuate nucleus (ARN) and paraventricular nucleus (PVN) of the hypothalamus without affecting its expression. TD-induced inhibition of AMPK phosphorylation was reversed once thiamine was re-supplemented. In contrast, TD increased AMPK phosphorylation in the skeletal muscle and upregulated the uncoupling protein (UCP)-1 in brown adipose tissues which was consistent with increased basal energy expenditure. Re-administration of thiamine stabilized AMPK phosphorylation in the skeletal muscle as well as energy expenditure. Taken together, TD may induce anorexia by inhibiting hypothalamic AMPK activity. With a simultaneous increase in energy expenditure, TD caused an overall body weight loss. The results suggest that the status of thiamine levels in the body may affect food intake and body weight. PMID:24607345

Productivity, impact, and collaboration differences between transdisciplinary and traditionally trained doctoral students: A comparison of publication patterns.

PubMed

Keck, Anna-Sigrid; Sloane, Stephanie; Liechty, Janet M; Fiese, Barbara H; Donovan, Sharon M

2017-01-01

Transdisciplinary (TD) approaches are increasingly used to address complex public health problems such as childhood obesity. Compared to traditional grant-funded scientific projects among established scientists, those designed around a TD, team-based approach yielded greater publication output after three to five years. However, little is known about how a TD focus throughout graduate school training may affect students' publication-related productivity, impact, and collaboration. The objective of this study was to compare the publication patterns of students in traditional versus TD doctoral training programs. Productivity, impact, and collaboration of peer-reviewed publications were compared between traditional (n = 25) and TD (n = 11) students during the first five years of the TD program. Statistical differences were determined by t-test or chi square test at p < 0.05. The publication rate for TD students was 5.2 ± 10.1 (n = 56) compared to 3.6 ± 4.5 per traditional student (n = 82). Publication impact indicators were significantly higher for TD students vs. traditional students: 5.7 times more citations in Google Scholar, 6.1 times more citations in Scopus, 1.3 times higher journal impact factors, and a 1.4 times higher journal h-index. Collaboration indicators showed that publications by TD students had significantly more co-authors (1.3 times), and significantly more disciplines represented among co-authors (1.3 times), but not significantly more organizations represented per publication compared to traditional students. In conclusion, compared to doctoral students in traditional programs, TD students published works that were accepted into higher impact journals, were more frequently cited, and had more cross-disciplinary collaborations.

Productivity, impact, and collaboration differences between transdisciplinary and traditionally trained doctoral students: A comparison of publication patterns

PubMed Central

Sloane, Stephanie; Liechty, Janet M.; Fiese, Barbara H.; Donovan, Sharon M.

2017-01-01

Transdisciplinary (TD) approaches are increasingly used to address complex public health problems such as childhood obesity. Compared to traditional grant-funded scientific projects among established scientists, those designed around a TD, team-based approach yielded greater publication output after three to five years. However, little is known about how a TD focus throughout graduate school training may affect students’ publication-related productivity, impact, and collaboration. The objective of this study was to compare the publication patterns of students in traditional versus TD doctoral training programs. Productivity, impact, and collaboration of peer-reviewed publications were compared between traditional (n = 25) and TD (n = 11) students during the first five years of the TD program. Statistical differences were determined by t-test or chi square test at p < 0.05. The publication rate for TD students was 5.2 ± 10.1 (n = 56) compared to 3.6 ± 4.5 per traditional student (n = 82). Publication impact indicators were significantly higher for TD students vs. traditional students: 5.7 times more citations in Google Scholar, 6.1 times more citations in Scopus, 1.3 times higher journal impact factors, and a 1.4 times higher journal h-index. Collaboration indicators showed that publications by TD students had significantly more co-authors (1.3 times), and significantly more disciplines represented among co-authors (1.3 times), but not significantly more organizations represented per publication compared to traditional students. In conclusion, compared to doctoral students in traditional programs, TD students published works that were accepted into higher impact journals, were more frequently cited, and had more cross-disciplinary collaborations. PMID:29244832

Antimicrobials Increase Travelers' Risk of Colonization by Extended-Spectrum Betalactamase-Producing Enterobacteriaceae

PubMed Central

Kantele, Anu; Lääveri, Tinja; Mero, Sointu; Vilkman, Katri; Pakkanen, Sari H.; Ollgren, Jukka; Antikainen, Jenni; Kirveskari, Juha

2015-01-01

Background. More than 300 million travelers visit regions with poor hygiene annually. A significant percentage of them become colonized by resistant intestinal bacteria such as extended-spectrum beta-lactamase–producing Enterobacteriaceae (ESBL-PE) and may transmit the strains to others and to medical care settings when they return home. Despite the threats to global healthcare caused by an upsurge in antimicrobial resistance, no effort has been centered on prevention of colonization while traveling. Methods. Stool samples were collected from 430 Finns before and after traveling outside Scandinavia. All specimens were analyzed for ESBL- and carbapenemase-producing Enterobacteriaceae (CPE). Questionnaires were used to survey volunteers about use of antimicrobials as well as other potential risk factors. The results were subjected to multivariable analysis. Results. Twenty-one percent (90/430) of the travelers became colonized by ESBL-PE and none by CPE. Geographic region, occurrence of travelers' diarrhea (TD), age, and use of antimicrobial (AB) for TD were identified as independent risk factors predisposing to contracting ESBL-PE. Eleven percent of those in subgroup TD−AB−, 21% in TD+AB−, and 37% in TD+AB+ acquired ESBL-PE. The risk proved to be highest in South Asia (46%); 23% became colonized in subgroup TD−AB−, 47% in TD+AB−, and 80% in TD+AB+. In Southeast Asia, the rates were 14%, 37%, and 69%, respectively. Conclusions. TD and antimicrobials for TD proved to be independent risk factors, with up to 80% of TD+AB+ travelers contracting ESBL-PE. In modern pre-travel counseling for those visiting high-risk regions, travelers should be advised against taking antibiotics for mild or moderate TD. PMID:25613287

Double trouble: Co-occurrence of testosterone deficiency and body fatness associated with all-cause mortality in US men.

PubMed

Lopez, D S; Qiu, X; Advani, S; Tsilidis, K K; Khera, M; Kim, J; Morgentaler, A; Wang, R; Canfield, S

2018-01-01

Testosterone deficiency (TD, total testosterone ≤350 ng/dL [12.15 nmol L -1 ]) and obesity epidemic are growing in parallel in the United States. Yet, the sequelae of TD and obesity on the risk of mortality remain unclear. To investigate whether the co-occurrence of TD and overall obesity (body mass index ≥30 kg/m 2 ), and abdominal obesity (waist circumference ≥102 cm), is associated with a risk of all-cause mortality in American men. The data were obtained from the NHANES 1999-2004 and the Linked Mortality File (December 31, 2011). A total of 948 participants aged ≥20 years old with endogenous sex hormones and adiposity measurements data were included in this study. Over a median of 9.5 years of follow-up, 142 men died of any cause in this cohort. Multivariable analysis showed a 2.60 fold increased risk of death among men with TD compared with men without TD (Hazard Ratio [HR] = 2.60; 95% confidence interval [CI] = 1.20-5.80). No evidence for interaction between TD and overall or abdominal obesity with risk of death (P interaction ≥ .80). However, only after comparing men with TD and abdominal obesity with men without TD and no abdominal obesity, we found a 3.30 fold increased risk of death (HR = 3.30, 95% CI = 1.21-8.71). Men with co-occurrence of TD and abdominal obesity have a higher risk of mortality. The effect of co-occurrence of TD and abdominal obesity should be further explored with a larger and longer follow-up time study. © 2017 John Wiley & Sons Ltd.

Oral Challenge with Wild-Type Salmonella Typhi Induces Distinct Changes in B Cell Subsets in Individuals Who Develop Typhoid Disease.

PubMed

Toapanta, Franklin R; Bernal, Paula J; Fresnay, Stephanie; Magder, Laurence S; Darton, Thomas C; Jones, Claire; Waddington, Claire S; Blohmke, Christoph J; Angus, Brian; Levine, Myron M; Pollard, Andrew J; Sztein, Marcelo B

2016-06-01

A novel human oral challenge model with wild-type Salmonella Typhi (S. Typhi) was recently established by the Oxford Vaccine Group. In this model, 104 CFU of Salmonella resulted in 65% of participants developing typhoid fever (referred here as typhoid diagnosis -TD-) 6-9 days post-challenge. TD was diagnosed in participants meeting clinical (oral temperature ≥38°C for ≥12h) and/or microbiological (S. Typhi bacteremia) endpoints. Changes in B cell subpopulations following S. Typhi challenge remain undefined. To address this issue, a subset of volunteers (6 TD and 4 who did not develop TD -NoTD-) was evaluated. Notable changes included reduction in the frequency of B cells (cells/ml) of TD volunteers during disease days and increase in plasmablasts (PB) during the recovery phase (>day 14). Additionally, a portion of PB of TD volunteers showed a significant increase in activation (CD40, CD21) and gut homing (integrin α4β7) molecules. Furthermore, all BM subsets of TD volunteers showed changes induced by S. Typhi infections such as a decrease in CD21 in switched memory (Sm) CD27+ and Sm CD27- cells as well as upregulation of CD40 in unswitched memory (Um) and Naïve cells. Furthermore, changes in the signaling profile of some BM subsets were identified after S. Typhi-LPS stimulation around time of disease. Notably, naïve cells of TD (compared to NoTD) volunteers showed a higher percentage of cells phosphorylating Akt suggesting enhanced survival of these cells. Interestingly, most these changes were temporally associated with disease onset. This is the first study to describe differences in B cell subsets directly related to clinical outcome following oral challenge with wild-type S. Typhi in humans.

Exploratory study of friction welds in Udimet 700 and TD-Nickel bar

NASA Technical Reports Server (NTRS)

Moore, T. J.

1971-01-01

Friction welded butt joints were made in both Udimet 700 and TD-Nickel bar. Also, dissimilar metal friction welds were made between these materials. Friction welding of Udimet 700 shows great promise because the welds were found to be as strong as the parent metal in stress rupture and tensile tests at 760 and 980 C. The weld line was not detectable metallographically in the heat treated condition. Friction welding for TD-Nickel, however, holds little if any promise. TD-Nickel friction weldments could support only 9 percent as much stress as the base metal for a 10-hour stress-rupture life at 1090 C. Dissimilar Udimet 700/TD-Nickel friction welds could sustain only 15 percent as much stress as the TD-Nickel parent metal for a 10-hour rupture life at 930 C.

The Association between Baseline Subjective Anxiety Rating and Changes in Cardiac Autonomic Nervous Activity in Response to Tryptophan Depletion in Healthy Volunteers

PubMed Central

Hsiao, Chih Yin; Tsai, Hsin Chun; Chi, Mei Hung; Chen, Kao Chin; Chen, Po See; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang

2016-01-01

Abstract The aim of this study was to investigate the influence of serotonin on anxiety and autonomic nervous system (ANS) function; the correlation between subjective anxiety rating and changes of ANS function following tryptophan depletion (TD) in healthy volunteers was examined. Twenty-eight healthy participants, consisting of 15 females and 13 males, with an average age of 33.3 years, were recruited. Baseline Chinese Symptom Checklist-90-Revised and ANS function measurements were taken. TD was carried out on the testing day, and participants provided blood samples right before and 5 hours after TD. ANS function, somatic symptoms, and Visual Analogue Scales (VASs) were determined after TD. Wilcoxon signed rank test and Spearman ρ correlation were adapted for analyses of the results. The TD procedure reduced total and free plasma tryptophan effectively. After TD, the sympathetic nervous activity increased and parasympathetic nervous activity decreased. Baseline anxiety ratings positively correlated with post-TD changes in sympathetic nervous activity, VAS ratings, and physical symptoms. However, a negative correlation with post-TD changes in parasympathetic nervous activity was found. The change in ANS function after TD was associated with the severity of anxiety in healthy volunteers. This supports the fact that the effect of anxiety on heart rate variability is related to serotonin vulnerability. Furthermore, it also shows that the subjective anxiety rating has a biological basis related to serotonin. PMID:27175645

The Association between Baseline Subjective Anxiety Rating and Changes in Cardiac Autonomic Nervous Activity in Response to Tryptophan Depletion in Healthy Volunteers.

PubMed

Hsiao, Chih Yin; Tsai, Hsin Chun; Chi, Mei Hung; Chen, Kao Chin; Chen, Po See; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang

2016-05-01

The aim of this study was to investigate the influence of serotonin on anxiety and autonomic nervous system (ANS) function; the correlation between subjective anxiety rating and changes of ANS function following tryptophan depletion (TD) in healthy volunteers was examined. Twenty-eight healthy participants, consisting of 15 females and 13 males, with an average age of 33.3 years, were recruited.Baseline Chinese Symptom Checklist-90-Revised and ANS function measurements were taken. TD was carried out on the testing day, and participants provided blood samples right before and 5 hours after TD. ANS function, somatic symptoms, and Visual Analogue Scales (VASs) were determined after TD. Wilcoxon signed rank test and Spearman ρ correlation were adapted for analyses of the results.The TD procedure reduced total and free plasma tryptophan effectively. After TD, the sympathetic nervous activity increased and parasympathetic nervous activity decreased. Baseline anxiety ratings positively correlated with post-TD changes in sympathetic nervous activity, VAS ratings, and physical symptoms. However, a negative correlation with post-TD changes in parasympathetic nervous activity was found.The change in ANS function after TD was associated with the severity of anxiety in healthy volunteers. This supports the fact that the effect of anxiety on heart rate variability is related to serotonin vulnerability. Furthermore, it also shows that the subjective anxiety rating has a biological basis related to serotonin.

Novel push-pull fluorescent dyes - 7-(diethylamino)furo- and thieno[3,2-c]coumarins derivatives: structure, electronic spectra and TD-DFT study

NASA Astrophysics Data System (ADS)

Akchurin, Igor O.; Yakhutina, Anna I.; Bochkov, Andrei Y.; Solovjova, Natalya P.; Medvedev, Michael G.; Traven, Valerii F.

2018-05-01

Novel push-pull fluorescent dyes - 7-(diethylamino)furo- and 7-(diethylamino)thieno[3,2-c]coumarins derivatives have been synthesized using formyl derivatives of furo- and thieno[3,2-c]coumarins as starting materials. Electron absorption and fluorescent spectra of the dyes have been recorded in different solvents. Structure and solvent effects on the dyes spectral characteristics were analyzed. The fusion of five-membered heterocycle to coumarin provides a definite increase of Stokes shifts in all solvents and results in higher quantum yields of fluorescence. The absorption and emission bands of thieno[3,2-c] coumarin derivatives are definitely shifted to the red region (3-30 nm) compared to similar derivatives of furo[3,2-c]coumarin. TD-DFT calculations of some of the studied compounds have shown that hybrid DFT functionals and adequate representation of molecular environment are essential for obtaining accurate UV-Vis absorption spectra for the dyes with extended π-system. The longest-wave electron transitions in the studied compounds were computationally shown to be of push-pull nature.

Genetic and Immunological Studies of Bacteriophage T4 Thymidylate Synthetase

PubMed Central

Krauss, S. W.; Stollar, B. D.; Friedkin, M.

1973-01-01

Thymidylate synthetase, which appears after infection of Escherichia coli with bacteriophage T4, has been partially purified. The phage enzyme is immunologically distinct from the host enzyme and has a molecular weight of 50,000 in comparison to 68,000 for the host enzyme. A system has been developed to characterize T4 td mutants previously known to have impaired expression of phage thymidylate synthetase. For this system, an E. coli host lacking thymidylate synthetase was isolated. Known genetic suppressors were transduced into this host. The resulting isogenic hosts were infected with phage T4 td mutants. The specific activities and amounts of cross-reacting material induced by several different types of phage mutants under conditions of suppression or non-suppression have been examined. The results show that the phage carries the structural gene specifying the thymidylate synthetase which appears after phage infection, and that the combination of plaque morphology, enzyme activity assays, and an assay for immunologically cross-reacting material provides a means for identifying true amber mutants of the phage gene. Images PMID:4575286

Molecular dissection of botulinum neurotoxin reveals interdomain chaperone function.

PubMed

Fischer, Audrey; Montal, Mauricio

2013-12-01

Clostridium botulinum neurotoxin (BoNT) is a multi-domain protein made up of the approximately 100 kDa heavy chain (HC) and the approximately 50 kDa light chain (LC). The HC can be further subdivided into two halves: the N-terminal translocation domain (TD) and the C-terminal Receptor Binding Domain (RBD). We have investigated the minimal requirements for channel activity and LC translocation. We utilize a cellular protection assay and a single channel/single molecule LC translocation assay to characterize in real time the channel and chaperone activities of BoNT/A truncation constructs in Neuro 2A cells. The unstructured, elongated belt region of the TD is demonstrated to be dispensable for channel activity, although may be required for productive LC translocation. We show that the RBD is not necessary for channel activity or LC translocation, however it dictates the pH threshold of channel insertion into the membrane. These findings indicate that each domain functions as a chaperone for the others in addition to their individual functions, working in concert to achieve productive intoxication. Copyright © 2013 Elsevier Ltd. All rights reserved.

Photo-physics study of an hydroxy-quinoline derivative as inhibitor of Pim-1 kinase: ultraviolet-visible linear dichroism spectroscopy and quantum chemical calculations.

PubMed

Lamhasni, T; Ait Lyazidi, S; Hnach, M; Haddad, M; Desmaële, D; Spanget-Larsen, J; Nguyen, D D; Ducasse, L

2013-09-01

The photophysical properties of the antiviral 7-nicotinoyl-styrylquinoline (MB96) were investigated by means of UV-Vis linear dichroism (LD) spectroscopy on molecular samples aligned in stretched polyvinylalcohol (PVA), supported by time dependent density functional theory (TD-DFT) calculations. Experimentally, the directions of the transitions moments with respect to the long axis of the molecule were deduced from the orientation K factors, determined by means of "trial-and-error" procedure. The absorption spectrum presents two parts. The main transition in the lowest energy part, observed around 365 nm and showing the highest K value 0.8, is longitudinally in-plane polarized. The highest energy part which is extended between 230 and 320 nm, large, diffuse, and of weak intensity, shows estimated K values between 0.2 and 0.5. This complex structure is transversally polarized with some contamination by the longitudinal character of the first strong band. The TD-DFT results agree fairly well with the LD measurements. Copyright © 2013 Elsevier B.V. All rights reserved.

The possibilities of Cherenkov telescopes to perform cosmic-ray muon imaging of volcanoes

NASA Astrophysics Data System (ADS)

Carbone, Daniele; Catalano, Osvaldo; Cusumano, Giancarlo; Del Santo, Melania; Maccarone, Maria Concetta; Mineo, Teresa; Pareschi, Giovanni; Vercellone, Stefano; Zuccarello, Luciano

2016-04-01

Volcanic activity is regulated by the interaction of gas-liquid flow with conduit geometry. Hence, the quantitative understanding of the inner shallow structure of a volcano is mandatory to forecast the occurrence of dangerous stages of activity and mitigate volcanic hazards. Among the techniques used to investigate the underground structure of a volcano, muon imaging offers some advantages, as it provides a fine spatial resolution, and does not require neither spatially dense measurements in active zones, nor the implementation of cost demanding energizing systems, as when electric or active seismic sources are utilized. The principle of muon radiography is essentially the same as X-ray radiography: muons are more attenuated by higher density parts inside the target and thus information about its inner structure are obtained from the differential muon absorption. Up-to-date, muon imaging of volcanic structures has been mainly accomplished with detectors that employ planes of scintillator strips. These telescopes are exposed to different types of background noise (accidental coincidence of vertical shower particles, horizontal high-energy electrons, flux of upward going particles), whose amplitude is high relative to the tiny flux of interest. An alternative technique is based on the detection of the Cherenkov light produced by muons. The latter can be imaged as an annular pattern that contains the information needed to reconstruct both direction and energy of the particle. Cherenkov telescopes have never been utilized to perform muon imaging of volcanoes. Nonetheless, thanks to intrinsic features, they offer the possibility to detect the through-target muon flux with negligible levels of background noise. Under some circumstances, they would also provide a better spatial resolution and acceptance than scintillator-based telescopes. Furthermore, contrarily to the latter systems, Cherenkov detectors allow in-situ measurements of the open-sky energy spectrum of atmospheric muons, that is needed to asses a reference model of the through-target integrated flux. Here we describe our plans for the production of a Cherenkov telescope with suitable characteristics for installation in the summit zone of Etna volcano.

26 CFR 31.6011(a)-4 - Returns of income tax withheld.

Code of Federal Regulations, 2010 CFR

2010-04-01

...) Retirement pay for services in the Armed Forces of the United States subject to withholding under section..., 26 U.S.C. 7805; 68A Stat. 747, 26 U.S.C. 6051) [T.D. 6516, 25 FR 13032, Dec. 20, 1960, as amended by T.D. 7096, 36 FR 5217, Mar. 18, 1971; T.D. 7200, 37 FR 16544, Aug. 16, 1972; T.D. 7577, 43 FR 59359...

27 CFR 28.65 - Bond, Form 2738 (5110.68).

Code of Federal Regulations, 2010 CFR

2010-04-01

... as provided in § 28.171(d) and the terms of his bond on Form 2738 (5110.68), then in force, do not..., 5066) [T.D. 7112, 36 FR 8580, May 8, 1971. Redesignated at 40 FR 16835, Apr. 15, 1975, and amended by T.D. ATF-62, 44 FR 71721, Dec. 11, 1979; T.D. ATF-198, 50 FR 8559, Mar. 1, 1985; T.D. TTB-8, 69 FR...

26 CFR 31.6011(a)-4 - Returns of income tax withheld.

Code of Federal Regulations, 2011 CFR

2011-04-01

...) Retirement pay for services in the Armed Forces of the United States subject to withholding under section..., 26 U.S.C. 7805; 68A Stat. 747, 26 U.S.C. 6051) [T.D. 6516, 25 FR 13032, Dec. 20, 1960, as amended by T.D. 7096, 36 FR 5217, Mar. 18, 1971; T.D. 7200, 37 FR 16544, Aug. 16, 1972; T.D. 7577, 43 FR 59359...

27 CFR 28.65 - Bond, Form 2738 (5110.68).

Code of Federal Regulations, 2011 CFR

2011-04-01

... as provided in § 28.171(d) and the terms of his bond on Form 2738 (5110.68), then in force, do not..., 5066) [T.D. 7112, 36 FR 8580, May 8, 1971. Redesignated at 40 FR 16835, Apr. 15, 1975, and amended by T.D. ATF-62, 44 FR 71721, Dec. 11, 1979; T.D. ATF-198, 50 FR 8559, Mar. 1, 1985; T.D. TTB-8, 69 FR...

Sibling relationship quality and psychosocial outcomes among adult siblings of individuals with autism spectrum disorder and individuals with intellectual disability without autism.

PubMed

Tomeny, Theodore S; Ellis, Brandi M; Rankin, James A; Barry, Tammy D

2017-03-01

Research on adult typically-developing (TD) siblings of individuals with developmental disabilities remains limited, and outcomes for TD siblings appear to vary widely. For the current study, 82 adult TD siblings of individuals with autism spectrum disorder (ASD) or intellectual disability (ID) completed questionnaires about themselves and their affected sibling. Results of this study suggest that the attitudes possessed by adult TD siblings are important to consider when understanding adult TD sibling outcomes. Specifically, data indicate that higher levels of positive sibling relationship attitudes are related to TD siblings providing more aid/support to their sibling with a disability, along with having higher levels of general life satisfaction, and negatively related to levels of stress and depressive symptoms among TD siblings. Consistent with previous child research, siblings of individuals with ASD reported fewer positive sibling relationship attitudes compared to siblings of individuals with ID. Finally, group membership related to aid provided, depressive symptoms, and stress of TD siblings indirectly through sibling relationship attitudes. Overall, results indicate that sibling relationship attitudes may be particularly important to consider when conceptualizing sibling relationships when one sibling has an intellectual or developmental disability. Copyright © 2017 Elsevier Ltd. All rights reserved.

Bright ambient light conditions reduce the effect of tryptophan depletion in healthy females.

PubMed

Defrancesco, Michaela; Niederstätter, Harald; Parson, Walther; Kemmler, Georg; Hinterhuber, Hartmann; Marksteiner, Josef; Deisenhammer, Eberhard A

2013-11-30

Tryptophan depletion (TD) is an established method to influence the serotonergic system and mood. The purpose of this study was to examine the effect of TD under different ambient light conditions, measured through serotonin-associated plasma levels and a visual analog scale (VAS), on healthy females. Thirty-eight healthy female s-allele carriers of the serotonin transporter promoter gene (5-HTTLPR) were administered a TD under dim light conditions (75 lx). A sub-group of 8 participants repeated the procedure randomized in two additional light conditions (585 lx and 1530 lx respectively). Prior to, and 5h following administration of TD, various variables (serotonin-associated plasma levels, VAS) were measured. Due to not normal distributed data, non-parametric statistical tests were used. Overall analysis showed a significant mood lowering effect of TD. Moreover, TD decreased all measured serotonin-associated plasma levels significantly. Significant differences in varying light conditions were found for the VAS and plasma tryptophan, with the greatest effect of TD in the 75 lx condition. Results of our study showed an influence of even slight differences in ambient light intensity on the effect of TD concerning mood as well as on the serotonergic system. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Volume 51, Issue 7-8Copyright © 2003 WILEY-VCH Verlag GmbH & Co. KGaA, WeinheimSave Title to My Profile