Transfer to intermediate forms following concept discrimination by pigeons: chimeras and morphs.

PubMed Central

Ghosh, Natasha; Lea, Stephen E G; Noury, Malia

2004-01-01

Two experiments examined pigeons' generalization to intermediate forms following training of concept discriminations. In Experiment 1, the training stimuli were sets of images of dogs and cats, and the transfer stimuli were head/body chimeras, which humans tend to categorize more readily in terms of the head part rather than the body part. In Experiment 2, the training stimuli were sets of images of heads of dogs and cats, and the intermediate stimuli were computer-generated morphs. In both experiments, pigeons learned the concept discrimination quickly and generalized with some decrement to novel instances of the categories. In both experiments, transfer tests were carried out with intermediate forms generated from both familiar and novel exemplars of the training sets. In Experiment 1, the pigeons' transfer performance, unlike that of human infants exposed to similar stimuli, was best predicted by the body part of the stimulus when the chimeras were formed from familiar exemplars. Spatial frequency analysis of the stimuli showed that the body parts were richer in high spatial frequencies than the head parts, so these data are consistent with the hypothesis that categorization is more dependent on local stimulus features in pigeons than in humans. There was no corresponding trend when the chimeras were formed from novel exemplars. In Experiment 2, when morphs of training stimuli were used, response rates declined smoothly as the proportion of the morph contributed by the positive stimulus fell, although results with morphs of novel stimuli were again less orderly. PMID:15540501

A Review of Tensors and Tensor Signal Processing

NASA Astrophysics Data System (ADS)

Cammoun, L.; Castaño-Moraga, C. A.; Muñoz-Moreno, E.; Sosa-Cabrera, D.; Acar, B.; Rodriguez-Florido, M. A.; Brun, A.; Knutsson, H.; Thiran, J. P.

Tensors have been broadly used in mathematics and physics, since they are a generalization of scalars or vectors and allow to represent more complex properties. In this chapter we present an overview of some tensor applications, especially those focused on the image processing field. From a mathematical point of view, a lot of work has been developed about tensor calculus, which obviously is more complex than scalar or vectorial calculus. Moreover, tensors can represent the metric of a vector space, which is very useful in the field of differential geometry. In physics, tensors have been used to describe several magnitudes, such as the strain or stress of materials. In solid mechanics, tensors are used to define the generalized Hooke’s law, where a fourth order tensor relates the strain and stress tensors. In fluid dynamics, the velocity gradient tensor provides information about the vorticity and the strain of the fluids. Also an electromagnetic tensor is defined, that simplifies the notation of the Maxwell equations. But tensors are not constrained to physics and mathematics. They have been used, for instance, in medical imaging, where we can highlight two applications: the diffusion tensor image, which represents how molecules diffuse inside the tissues and is broadly used for brain imaging; and the tensorial elastography, which computes the strain and vorticity tensor to analyze the tissues properties. Tensors have also been used in computer vision to provide information about the local structure or to define anisotropic image filters.

New Insights on Insect's Silent Flight. Part I: Vortex Dynamics and Wing Morphing

NASA Astrophysics Data System (ADS)

Ren, Yan; Liu, Geng; Dong, Haibo; Geng, Biao; Zheng, Xudong; Xue, Qian

2016-11-01

Insects are capable of conducting silent flights. This is attributed to its specially designed wing material properties for the control of vibration and surface morphing during the flapping flight. In current work, we focus on the roles of dynamic wing morphing on the unsteady vortex dynamics of a cicada in steady flight. A 3D image-based surface reconstruction method is used to obtain kinematical and morphological data of cicada wings from high-quality high-speed videos. The observed morphing wing kinematics is highly complex and a singular value decomposition method is used to decompose the wing motion to several dominant modes with distinct motion features. A high-fidelity immersed-boundary-based flow solver is then used to study the vortex dynamics in details. The results show that vortical structures closely relate to the morphing mode, which plays key role in the development and attachment of leading-edge vortex (LEV), thus helps the silent flapping of the cicada wings. This work is supported by AFOSR FA9550-12-1-0071 and NSF CBET-1313217.

Four heads are better than one: combining face composites yields improvements in face likeness.

PubMed

Bruce, Vicki; Ness, Hayley; Hancock, Peter J B; Newman, Craig; Rarity, Jenny

2002-10-01

Four participants constructed face composites, of familiar and unfamiliar targets, using Pro-Fit, with reference images present or from memory. The "mean" of all 4 composites, created by morphing (4-morph) was rated as a better likeness than individual composites on average and was as good as the best individual likeness. When participants attempted to identify targets from line-ups, 4-morphs again performed as well as the best individual composite. In a second experiment, participants familiar with target women attempted to identify composites, and the trend showed better recognition from multiple composites, whether combined or shown together. In a line-up task with unfamiliar participants, 4-morphs produced most correct choices and fewest false positives from target-absent or target-present arrays. These results have practical implications for the way evidence from different witnesses is used in police investigations.

3D tensor-based blind multispectral image decomposition for tumor demarcation

NASA Astrophysics Data System (ADS)

Kopriva, Ivica; Peršin, Antun

2010-03-01

Blind decomposition of multi-spectral fluorescent image for tumor demarcation is formulated exploiting tensorial structure of the image. First contribution of the paper is identification of the matrix of spectral responses and 3D tensor of spatial distributions of the materials present in the image from Tucker3 or PARAFAC models of 3D image tensor. Second contribution of the paper is clustering based estimation of the number of the materials present in the image as well as matrix of their spectral profiles. 3D tensor of the spatial distributions of the materials is recovered through 3-mode multiplication of the multi-spectral image tensor and inverse of the matrix of spectral profiles. Tensor representation of the multi-spectral image preserves its local spatial structure that is lost, due to vectorization process, when matrix factorization-based decomposition methods (such as non-negative matrix factorization and independent component analysis) are used. Superior performance of the tensor-based image decomposition over matrix factorization-based decompositions is demonstrated on experimental red-green-blue (RGB) image with known ground truth as well as on RGB fluorescent images of the skin tumor (basal cell carcinoma).

Software and Algorithms for Biomedical Image Data Processing and Visualization

NASA Technical Reports Server (NTRS)

Talukder, Ashit; Lambert, James; Lam, Raymond

2004-01-01

A new software equipped with novel image processing algorithms and graphical-user-interface (GUI) tools has been designed for automated analysis and processing of large amounts of biomedical image data. The software, called PlaqTrak, has been specifically used for analysis of plaque on teeth of patients. New algorithms have been developed and implemented to segment teeth of interest from surrounding gum, and a real-time image-based morphing procedure is used to automatically overlay a grid onto each segmented tooth. Pattern recognition methods are used to classify plaque from surrounding gum and enamel, while ignoring glare effects due to the reflection of camera light and ambient light from enamel regions. The PlaqTrak system integrates these components into a single software suite with an easy-to-use GUI (see Figure 1) that allows users to do an end-to-end run of a patient s record, including tooth segmentation of all teeth, grid morphing of each segmented tooth, and plaque classification of each tooth image. The automated and accurate processing of the captured images to segment each tooth [see Figure 2(a)] and then detect plaque on a tooth-by-tooth basis is a critical component of the PlaqTrak system to do clinical trials and analysis with minimal human intervention. These features offer distinct advantages over other competing systems that analyze groups of teeth or synthetic teeth. PlaqTrak divides each segmented tooth into eight regions using an advanced graphics morphing procedure [see results on a chipped tooth in Figure 2(b)], and a pattern recognition classifier is then used to locate plaque [red regions in Figure 2(d)] and enamel regions. The morphing allows analysis within regions of teeth, thereby facilitating detailed statistical analysis such as the amount of plaque present on the biting surfaces on teeth. This software system is applicable to a host of biomedical applications, such as cell analysis and life detection, or robotic applications, such as product inspection or assembly of parts in space and industry.

Tri-Clustered Tensor Completion for Social-Aware Image Tag Refinement.

PubMed

Tang, Jinhui; Shu, Xiangbo; Qi, Guo-Jun; Li, Zechao; Wang, Meng; Yan, Shuicheng; Jain, Ramesh

2017-08-01

Social image tag refinement, which aims to improve tag quality by automatically completing the missing tags and rectifying the noise-corrupted ones, is an essential component for social image search. Conventional approaches mainly focus on exploring the visual and tag information, without considering the user information, which often reveals important hints on the (in)correct tags of social images. Towards this end, we propose a novel tri-clustered tensor completion framework to collaboratively explore these three kinds of information to improve the performance of social image tag refinement. Specifically, the inter-relations among users, images and tags are modeled by a tensor, and the intra-relations between users, images and tags are explored by three regularizations respectively. To address the challenges of the super-sparse and large-scale tensor factorization that demands expensive computing and memory cost, we propose a novel tri-clustering method to divide the tensor into a certain number of sub-tensors by simultaneously clustering users, images and tags into a bunch of tri-clusters. And then we investigate two strategies to complete these sub-tensors by considering (in)dependence between the sub-tensors. Experimental results on a real-world social image database demonstrate the superiority of the proposed method compared with the state-of-the-art methods.

Development of a morphing technique for predicting the position and size of an artificial ear in hemifacial microsomia patients.

PubMed

Coward, Trevor J; Richards, Robin; Scott, Brendan J J

2014-01-01

People with hemifacial microsomia may be missing an ear on the affected side of the face. The principal aim of the study was to develop a morphing technique and to determine whether it could be used to appropriately position an artificial ear, as well as to give an indication of prosthesis size in comparison with the natural ear. Comparisons also were made between the artificial ears being worn by the patients with their natural ears. Data from stereophotogrammetry images of the faces of 10 people were converted into stereolithographic format. Anthropometric points on the face and ear of the unaffected side were plotted. By a process of scaling, the distance between facial landmarks on the unaffected side was estimated for the affected side so as to identify where the morphed ear would be positioned once generated. Generally, the morphed ears appeared to be in acceptable positions. There was a statistically significant difference between the position of the morphed and natural ears (P = .011), as well as the artificial and natural ears (P = .001), but this was unlikely to have any clinical implications. There were no significant differences among the sizes of the natural, morphed, and artificial ears (P = .072). Morphing appears to offer a more precise way of planning the positioning and construction of an artificial ear on patients with hemifacial microsomia than traditional methods. Differences in facial shape on either side of the face may impact on the process. This requires further study.

Retrospective Correction of Physiological Noise in DTI Using an Extended Tensor Model and Peripheral Measurements

PubMed Central

Mohammadi, Siawoosh; Hutton, Chloe; Nagy, Zoltan; Josephs, Oliver; Weiskopf, Nikolaus

2013-01-01

Diffusion tensor imaging is widely used in research and clinical applications, but this modality is highly sensitive to artefacts. We developed an easy-to-implement extension of the original diffusion tensor model to account for physiological noise in diffusion tensor imaging using measures of peripheral physiology (pulse and respiration), the so-called extended tensor model. Within the framework of the extended tensor model two types of regressors, which respectively modeled small (linear) and strong (nonlinear) variations in the diffusion signal, were derived from peripheral measures. We tested the performance of four extended tensor models with different physiological noise regressors on nongated and gated diffusion tensor imaging data, and compared it to an established data-driven robust fitting method. In the brainstem and cerebellum the extended tensor models reduced the noise in the tensor-fit by up to 23% in accordance with previous studies on physiological noise. The extended tensor model addresses both large-amplitude outliers and small-amplitude signal-changes. The framework of the extended tensor model also facilitates further investigation into physiological noise in diffusion tensor imaging. The proposed extended tensor model can be readily combined with other artefact correction methods such as robust fitting and eddy current correction. PMID:22936599

Determining anisotropic conductivity using diffusion tensor imaging data in magneto-acoustic tomography with magnetic induction

NASA Astrophysics Data System (ADS)

Ammari, Habib; Qiu, Lingyun; Santosa, Fadil; Zhang, Wenlong

2017-12-01

In this paper we present a mathematical and numerical framework for a procedure of imaging anisotropic electrical conductivity tensor by integrating magneto-acoutic tomography with data acquired from diffusion tensor imaging. Magneto-acoustic tomography with magnetic induction (MAT-MI) is a hybrid, non-invasive medical imaging technique to produce conductivity images with improved spatial resolution and accuracy. Diffusion tensor imaging (DTI) is also a non-invasive technique for characterizing the diffusion properties of water molecules in tissues. We propose a model for anisotropic conductivity in which the conductivity is proportional to the diffusion tensor. Under this assumption, we propose an optimal control approach for reconstructing the anisotropic electrical conductivity tensor. We prove convergence and Lipschitz type stability of the algorithm and present numerical examples to illustrate its accuracy and feasibility.

Automatic deformable diffusion tensor registration for fiber population analysis.

PubMed

Irfanoglu, M O; Machiraju, R; Sammet, S; Pierpaoli, C; Knopp, M V

2008-01-01

In this work, we propose a novel method for deformable tensor-to-tensor registration of Diffusion Tensor Images. Our registration method models the distances in between the tensors with Geode-sic-Loxodromes and employs a version of Multi-Dimensional Scaling (MDS) algorithm to unfold the manifold described with this metric. Defining the same shape properties as tensors, the vector images obtained through MDS are fed into a multi-step vector-image registration scheme and the resulting deformation fields are used to reorient the tensor fields. Results on brain DTI indicate that the proposed method is very suitable for deformable fiber-to-fiber correspondence and DTI-atlas construction.

A Local Fast Marching-Based Diffusion Tensor Image Registration Algorithm by Simultaneously Considering Spatial Deformation and Tensor Orientation

PubMed Central

Xue, Zhong; Li, Hai; Guo, Lei; Wong, Stephen T.C.

2010-01-01

It is a key step to spatially align diffusion tensor images (DTI) to quantitatively compare neural images obtained from different subjects or the same subject at different timepoints. Different from traditional scalar or multi-channel image registration methods, tensor orientation should be considered in DTI registration. Recently, several DTI registration methods have been proposed in the literature, but deformation fields are purely dependent on the tensor features not the whole tensor information. Other methods, such as the piece-wise affine transformation and the diffeomorphic non-linear registration algorithms, use analytical gradients of the registration objective functions by simultaneously considering the reorientation and deformation of tensors during the registration. However, only relatively local tensor information such as voxel-wise tensor-similarity, is utilized. This paper proposes a new DTI image registration algorithm, called local fast marching (FM)-based simultaneous registration. The algorithm not only considers the orientation of tensors during registration but also utilizes the neighborhood tensor information of each voxel to drive the deformation, and such neighborhood tensor information is extracted from a local fast marching algorithm around the voxels of interest. These local fast marching-based tensor features efficiently reflect the diffusion patterns around each voxel within a spherical neighborhood and can capture relatively distinctive features of the anatomical structures. Using simulated and real DTI human brain data the experimental results show that the proposed algorithm is more accurate compared with the FA-based registration and is more efficient than its counterpart, the neighborhood tensor similarity-based registration. PMID:20382233

Tensor-based dynamic reconstruction method for electrical capacitance tomography

NASA Astrophysics Data System (ADS)

Lei, J.; Mu, H. P.; Liu, Q. B.; Li, Z. H.; Liu, S.; Wang, X. Y.

2017-03-01

Electrical capacitance tomography (ECT) is an attractive visualization measurement method, in which the acquisition of high-quality images is beneficial for the understanding of the underlying physical or chemical mechanisms of the dynamic behaviors of the measurement objects. In real-world measurement environments, imaging objects are often in a dynamic process, and the exploitation of the spatial-temporal correlations related to the dynamic nature will contribute to improving the imaging quality. Different from existing imaging methods that are often used in ECT measurements, in this paper a dynamic image sequence is stacked into a third-order tensor that consists of a low rank tensor and a sparse tensor within the framework of the multiple measurement vectors model and the multi-way data analysis method. The low rank tensor models the similar spatial distribution information among frames, which is slowly changing over time, and the sparse tensor captures the perturbations or differences introduced in each frame, which is rapidly changing over time. With the assistance of the Tikhonov regularization theory and the tensor-based multi-way data analysis method, a new cost function, with the considerations of the multi-frames measurement data, the dynamic evolution information of a time-varying imaging object and the characteristics of the low rank tensor and the sparse tensor, is proposed to convert the imaging task in the ECT measurement into a reconstruction problem of a third-order image tensor. An effective algorithm is developed to search for the optimal solution of the proposed cost function, and the images are reconstructed via a batching pattern. The feasibility and effectiveness of the developed reconstruction method are numerically validated.

Tensor-based Dictionary Learning for Spectral CT Reconstruction

PubMed Central

Zhang, Yanbo; Wang, Ge

2016-01-01

Spectral computed tomography (CT) produces an energy-discriminative attenuation map of an object, extending a conventional image volume with a spectral dimension. In spectral CT, an image can be sparsely represented in each of multiple energy channels, and are highly correlated among energy channels. According to this characteristics, we propose a tensor-based dictionary learning method for spectral CT reconstruction. In our method, tensor patches are extracted from an image tensor, which is reconstructed using the filtered backprojection (FBP), to form a training dataset. With the Candecomp/Parafac decomposition, a tensor-based dictionary is trained, in which each atom is a rank-one tensor. Then, the trained dictionary is used to sparsely represent image tensor patches during an iterative reconstruction process, and the alternating minimization scheme is adapted for optimization. The effectiveness of our proposed method is validated with both numerically simulated and real preclinical mouse datasets. The results demonstrate that the proposed tensor-based method generally produces superior image quality, and leads to more accurate material decomposition than the currently popular popular methods. PMID:27541628

Tensor Fukunaga-Koontz transform for small target detection in infrared images

NASA Astrophysics Data System (ADS)

Liu, Ruiming; Wang, Jingzhuo; Yang, Huizhen; Gong, Chenglong; Zhou, Yuanshen; Liu, Lipeng; Zhang, Zhen; Shen, Shuli

2016-09-01

Infrared small targets detection plays a crucial role in warning and tracking systems. Some novel methods based on pattern recognition technology catch much attention from researchers. However, those classic methods must reshape images into vectors with the high dimensionality. Moreover, vectorizing breaks the natural structure and correlations in the image data. Image representation based on tensor treats images as matrices and can hold the natural structure and correlation information. So tensor algorithms have better classification performance than vector algorithms. Fukunaga-Koontz transform is one of classification algorithms and it is a vector version method with the disadvantage of all vector algorithms. In this paper, we first extended the Fukunaga-Koontz transform into its tensor version, tensor Fukunaga-Koontz transform. Then we designed a method based on tensor Fukunaga-Koontz transform for detecting targets and used it to detect small targets in infrared images. The experimental results, comparison through signal-to-clutter, signal-to-clutter gain and background suppression factor, have validated the advantage of the target detection based on the tensor Fukunaga-Koontz transform over that based on the Fukunaga-Koontz transform.

Use of Computer Imaging in Rhinoplasty: A Survey of the Practices of Facial Plastic Surgeons.

PubMed

Singh, Prabhjyot; Pearlman, Steven

2017-08-01

The objective of this study was to quantify the use of computer imaging by facial plastic surgeons. AAFPRS Facial plastic surgeons were surveyed about their use of computer imaging during rhinoplasty consultations. The survey collected information about surgeon demographics, practice settings, practice patterns, and rates of computer imaging (CI) for primary and revision rhinoplasty. For those surgeons who used CI, additional information was also collected, which included who performed the imaging and whether the patient was given the morphed images after the consultation. A total of 238 out of 1200 (19.8%) facial plastic surgeons responded to the survey. Out of those who responded, 195 surgeons (83%) were board certified by the American Board of Facial Plastic and Reconstructive Surgeons (ABFPRS). The majority of respondents (150 surgeons, 63%) used CI during rhinoplasty consultation. Of the surgeons who use CI, 92% performed the image morphing themselves. Approximately two-thirds of surgeons who use CI gave their patient a printout of the morphed images after the consultation. Computer imaging (CI) is a frequently utilized tool for facial plastic surgeons during cosmetic consultations with patients. Based on these results of this study, it can be suggested that the majority of facial plastic surgeons who use CI do so for both primary and revision rhinoplasty. As more sophisticated systems become available, it is possible that utilization of CI modalities will increase. This provides the surgeon with further tools to use at his or her disposal during discussion of aesthetic surgery. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

The evolution of colour polymorphism in British winter-active Lepidoptera in response to search image use by avian predators.

PubMed

Weir, Jamie C

2018-05-10

Phenotypic polymorphism in cryptic species is widespread. This may evolve in response to search image use by predators exerting negative frequency-dependent selection on intraspecific colour morphs, 'apostatic selection'. Evidence exists to indicate search image formation by predators and apostatic selection operating on wild prey populations, though not to demonstrate search image use directly resulting in apostatic selection. The present study attempted to address this deficiency, using British Lepidoptera active in winter as a model system. It has been proposed that the typically polymorphic wing colouration of these species represents an anti-search image adaptation against birds. To test (a) for search image-driven apostatic selection, dimorphic populations of artificial moth-like models were established in woodland at varying relative morph frequencies and exposed to predation by natural populations of birds. In addition, to test (b) whether abundance and degree of polymorphism are correlated across British winter-active moths, as predicted where search image use drives apostatic selection, a series of phylogenetic comparative analyses were conducted. There was a positive relationship between artificial morph frequency and probability of predation, consistent with birds utilizing search images and exerting apostatic selection. Abundance and degree of polymorphism were found to be positively correlated across British Lepidoptera active in winter, though not across all taxonomic groups analysed. This evidence is consistent with polymorphism in this group having evolved in response to search image-driven apostatic selection and supports the viability of this mechanism as a means by which phenotypic and genetic variation may be maintained in natural populations. © 2018 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2018 European Society For Evolutionary Biology.

Computer-implemented system and method for automated and highly accurate plaque analysis, reporting, and visualization

NASA Technical Reports Server (NTRS)

Kemp, James Herbert (Inventor); Talukder, Ashit (Inventor); Lambert, James (Inventor); Lam, Raymond (Inventor)

2008-01-01

A computer-implemented system and method of intra-oral analysis for measuring plaque removal is disclosed. The system includes hardware for real-time image acquisition and software to store the acquired images on a patient-by-patient basis. The system implements algorithms to segment teeth of interest from surrounding gum, and uses a real-time image-based morphing procedure to automatically overlay a grid onto each segmented tooth. Pattern recognition methods are used to classify plaque from surrounding gum and enamel, while ignoring glare effects due to the reflection of camera light and ambient light from enamel regions. The system integrates these components into a single software suite with an easy-to-use graphical user interface (GUI) that allows users to do an end-to-end run of a patient record, including tooth segmentation of all teeth, grid morphing of each segmented tooth, and plaque classification of each tooth image.

Motion Detection in Ultrasound Image-Sequences Using Tensor Voting

NASA Astrophysics Data System (ADS)

Inba, Masafumi; Yanagida, Hirotaka; Tamura, Yasutaka

2008-05-01

Motion detection in ultrasound image sequences using tensor voting is described. We have been developing an ultrasound imaging system adopting a combination of coded excitation and synthetic aperture focusing techniques. In our method, frame rate of the system at distance of 150 mm reaches 5000 frame/s. Sparse array and short duration coded ultrasound signals are used for high-speed data acquisition. However, many artifacts appear in the reconstructed image sequences because of the incompleteness of the transmitted code. To reduce the artifacts, we have examined the application of tensor voting to the imaging method which adopts both coded excitation and synthetic aperture techniques. In this study, the basis of applying tensor voting and the motion detection method to ultrasound images is derived. It was confirmed that velocity detection and feature enhancement are possible using tensor voting in the time and space of simulated ultrasound three-dimensional image sequences.

Testosterone-Induced Expression of Male Colour Morphs in Females of the Polymorphic Tawny Dragon Lizard, Ctenophorus decresii.

PubMed

Rankin, Katrina; Stuart-Fox, Devi

2015-01-01

Many colour polymorphisms are present only in one sex, usually males, but proximate mechanisms controlling the expression of sex-limited colour polymorphisms have received little attention. Here, we test the hypothesis that artificial elevation of testosterone in females of the colour polymorphic tawny dragon lizard, Ctenophorus decresii, can induce them to express the same colour morphs, in similar frequencies, to those found in males. Male C. decresii, express four discrete throat colour morphs (orange, yellow, grey and an orange central patch surrounded by yellow). We used silastic implants to experimentally elevate testosterone levels in mature females to induce colour expression. Testosterone elevation resulted in a substantial increase in the proportion and intensity of orange but not yellow colouration, which was present in a subset of females prior to treatment. Consequently, females exhibited the same set of colour morphs as males, and we confirmed that these morphs are objectively classifiable, by using digital image analyses and spectral reflectance measurements, and occur in similar frequencies as in males. These results indicate that the influence of testosterone differs for different colours, suggesting that their expression may be governed by different proximate hormonal mechanisms. Thus, caution must be exercised when using artificial testosterone manipulation to induce female expression of sex-limited colour polymorphisms. Nevertheless, the ability to express sex-limited colours (in this case orange) to reveal the same, objectively classifiable morphs in similar frequencies to males suggests autosomal rather than sex-linked inheritance, and can facilitate further research on the genetic basis of colour polymorphism, including estimating heritability and selection on colour morphs from pedigree data.

Testosterone-Induced Expression of Male Colour Morphs in Females of the Polymorphic Tawny Dragon Lizard, Ctenophorus decresii

PubMed Central

Rankin, Katrina; Stuart-Fox, Devi

2015-01-01

Many colour polymorphisms are present only in one sex, usually males, but proximate mechanisms controlling the expression of sex-limited colour polymorphisms have received little attention. Here, we test the hypothesis that artificial elevation of testosterone in females of the colour polymorphic tawny dragon lizard, Ctenophorus decresii, can induce them to express the same colour morphs, in similar frequencies, to those found in males. Male C. decresii, express four discrete throat colour morphs (orange, yellow, grey and an orange central patch surrounded by yellow). We used silastic implants to experimentally elevate testosterone levels in mature females to induce colour expression. Testosterone elevation resulted in a substantial increase in the proportion and intensity of orange but not yellow colouration, which was present in a subset of females prior to treatment. Consequently, females exhibited the same set of colour morphs as males, and we confirmed that these morphs are objectively classifiable, by using digital image analyses and spectral reflectance measurements, and occur in similar frequencies as in males. These results indicate that the influence of testosterone differs for different colours, suggesting that their expression may be governed by different proximate hormonal mechanisms. Thus, caution must be exercised when using artificial testosterone manipulation to induce female expression of sex-limited colour polymorphisms. Nevertheless, the ability to express sex-limited colours (in this case orange) to reveal the same, objectively classifiable morphs in similar frequencies to males suggests autosomal rather than sex-linked inheritance, and can facilitate further research on the genetic basis of colour polymorphism, including estimating heritability and selection on colour morphs from pedigree data. PMID:26485705

SU-E-J-67: Evaluation of Adaptive MLC Morphing for Online Correction of Prostate Cancer Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sandhu, R; Qin, A; Yan, D

Purpose: Online adaptive MLC morphing is desirable over translational couch shifts to accommodate target position as well as anatomic changes. A reliable method of adaptive MLC segment to target during prostate cancer IMRT treatment is proposed and evaluated by comparison with daily online-image guidance (IGRT) correction and online-IMRT planning. Methods: The MLC adaptive algorithm involves following steps; move the MLC segments according to target translational shifts, and then morph the segment shape to maintain the spatial relationship between the planning-target contour and MLC segment. Efficacy of this method was evaluated retrospectively using daily-CBCT images on seven prostate patients treated withmore » seven-beam IMRT treatment to deliver 64Gy in 20 fractions. Daily modification was simulated with three approaches; daily-IGRT correction based on implanted radio-markers, adaptive MLC morphing, and online-IMRT planning, with no-residual variation. The selected dosimetric endpoints and nEUD (normalized equivalent uniform dose to online-IMRT planning) of each organ of interest were determined for evaluation and comparison. Results: For target(prostate), bladder and rectal-wall, the mean±sd of nEUD were 97.6%+3.2%, 103.9%±4.9% and 97.4%±1.1% for daily-IGRT correction; and 100.2%+0.2%, 108.9%±5.1% and 99.8%±1.2% for adaptive MLC morphing, respectively. For daily-IGRT correction, adaptive MLC morphing and online-IMRT planning, target D99 was <95% of the prescription dose in 30%, 0% and 0% of 140 fractions, respectively. For the rectal-wall, D5 exceeded 105% of the planned-D5 in 2.8%, 11.4% and 0% of 140 fractions, respectively. For the bladder, Dmax exceeded 105% of the planned-D5 in 2.8%, 5.6% and 0% of 140 fractions, respectively. D30 of bladder and rectal-wall were well within the planned-D30 for all three approaches. Conclusion: The proposed method of adaptive MLC morphing can be beneficial for the prostate patient population with large deformation and rotation. It is superior to the daily-IGRT correction, and comparable to the online-IMRT planning for dose to the target and rectal-wall.« less

Tensor Based Representation and Analysis of Diffusion-Weighted Magnetic Resonance Images

ERIC Educational Resources Information Center

Barmpoutis, Angelos

2009-01-01

Cartesian tensor bases have been widely used to model spherical functions. In medical imaging, tensors of various orders can approximate the diffusivity function at each voxel of a diffusion-weighted MRI data set. This approximation produces tensor-valued datasets that contain information about the underlying local structure of the scanned tissue.…

Tensor scale: An analytic approach with efficient computation and applications☆

PubMed Central

Xu, Ziyue; Saha, Punam K.; Dasgupta, Soura

2015-01-01

Scale is a widely used notion in computer vision and image understanding that evolved in the form of scale-space theory where the key idea is to represent and analyze an image at various resolutions. Recently, we introduced a notion of local morphometric scale referred to as “tensor scale” using an ellipsoidal model that yields a unified representation of structure size, orientation and anisotropy. In the previous work, tensor scale was described using a 2-D algorithmic approach and a precise analytic definition was missing. Also, the application of tensor scale in 3-D using the previous framework is not practical due to high computational complexity. In this paper, an analytic definition of tensor scale is formulated for n-dimensional (n-D) images that captures local structure size, orientation and anisotropy. Also, an efficient computational solution in 2- and 3-D using several novel differential geometric approaches is presented and the accuracy of results is experimentally examined. Also, a matrix representation of tensor scale is derived facilitating several operations including tensor field smoothing to capture larger contextual knowledge. Finally, the applications of tensor scale in image filtering and n-linear interpolation are presented and the performance of their results is examined in comparison with respective state-of-art methods. Specifically, the performance of tensor scale based image filtering is compared with gradient and Weickert’s structure tensor based diffusive filtering algorithms. Also, the performance of tensor scale based n-linear interpolation is evaluated in comparison with standard n-linear and windowed-sinc interpolation methods. PMID:26236148

Seamless Warping of Diffusion Tensor Fields

PubMed Central

Hao, Xuejun; Bansal, Ravi; Plessen, Kerstin J.; Peterson, Bradley S.

2008-01-01

To warp diffusion tensor fields accurately, tensors must be reoriented in the space to which the tensors are warped based on both the local deformation field and the orientation of the underlying fibers in the original image. Existing algorithms for warping tensors typically use forward mapping deformations in an attempt to ensure that the local deformations in the warped image remains true to the orientation of the underlying fibers; forward mapping, however, can also create “seams” or gaps and consequently artifacts in the warped image by failing to define accurately the voxels in the template space where the magnitude of the deformation is large (e.g., |Jacobian| > 1). Backward mapping, in contrast, defines voxels in the template space by mapping them back to locations in the original imaging space. Backward mapping allows every voxel in the template space to be defined without the creation of seams, including voxels in which the deformation is extensive. Backward mapping, however, cannot reorient tensors in the template space because information about the directional orientation of fiber tracts is contained in the original, unwarped imaging space only, and backward mapping alone cannot transfer that information to the template space. To combine the advantages of forward and backward mapping, we propose a novel method for the spatial normalization of diffusion tensor (DT) fields that uses a bijection (a bidirectional mapping with one-to-one correspondences between image spaces) to warp DT datasets seamlessly from one imaging space to another. Once the bijection has been achieved and tensors have been correctly relocated to the template space, we can appropriately reorient tensors in the template space using a warping method based on Procrustean estimation. PMID:18334425

Low Dimensional Analysis of Wing Surface Morphology in Hummingbird Free Flight

NASA Astrophysics Data System (ADS)

Shallcross, Gregory; Ren, Yan; Liu, Geng; Dong, Haibo; Tobalske, Bret

2015-11-01

Surface morphing in flapping wings is a hallmark of bird flight. In current work, the role of dynamic wing morphing of a free flying hummingbird is studied in detail. A 3D image-based surface reconstruction method is used to obtain the kinematics and deformation of hummingbird wings from high-quality high-speed videos. The observed wing surface morphing is highly complex and a number of modeling methods including singular value decomposition (SVD) are used to obtain the fundamental kinematical modes with distinct motion features. Their aerodynamic roles are investigated by conducting immersed-boundary-method based flow simulations. The results show that the chord-wise deformation modes play key roles in the attachment of leading-edge vortex, thus improve the performance of the flapping wings. This work is supported by NSF CBET-1313217 and AFOSR FA9550-12-1-0071.

Efficient Tensor Completion for Color Image and Video Recovery: Low-Rank Tensor Train.

PubMed

Bengua, Johann A; Phien, Ho N; Tuan, Hoang Duong; Do, Minh N

2017-05-01

This paper proposes a novel approach to tensor completion, which recovers missing entries of data represented by tensors. The approach is based on the tensor train (TT) rank, which is able to capture hidden information from tensors thanks to its definition from a well-balanced matricization scheme. Accordingly, new optimization formulations for tensor completion are proposed as well as two new algorithms for their solution. The first one called simple low-rank tensor completion via TT (SiLRTC-TT) is intimately related to minimizing a nuclear norm based on TT rank. The second one is from a multilinear matrix factorization model to approximate the TT rank of a tensor, and is called tensor completion by parallel matrix factorization via TT (TMac-TT). A tensor augmentation scheme of transforming a low-order tensor to higher orders is also proposed to enhance the effectiveness of SiLRTC-TT and TMac-TT. Simulation results for color image and video recovery show the clear advantage of our method over all other methods.

Neurocognitive Effects of Radiotherapy

DTIC Science & Technology

2013-11-05

tensor imaging ( DTI ), perfusion and diffusion. The majority of patients have completed baseline and at least two additional time-points in regards...completed a 1 hour standard MRI as well as additional testing including diffuse tensor imaging ( DTI ), perfusion and diffusion. The majority of...including diffuse tensor imaging ( DTI ), perfusion and diffusion. The majority of patients have completed baseline and at least two additional time

An Adaptive Spectrally Weighted Structure Tensor Applied to Tensor Anisotropic Nonlinear Diffusion for Hyperspectral Images

ERIC Educational Resources Information Center

Marin Quintero, Maider J.

2013-01-01

The structure tensor for vector valued images is most often defined as the average of the scalar structure tensors in each band. The problem with this definition is the assumption that all bands provide the same amount of edge information giving them the same weights. As a result non-edge pixels can be reinforced and edges can be weakened…

What is adapted in face adaptation? The neural representations of expression in the human visual system.

PubMed

Fox, Christopher J; Barton, Jason J S

2007-01-05

The neural representation of facial expression within the human visual system is not well defined. Using an adaptation paradigm, we examined aftereffects on expression perception produced by various stimuli. Adapting to a face, which was used to create morphs between two expressions, substantially biased expression perception within the morphed faces away from the adapting expression. This adaptation was not based on low-level image properties, as a different image of the same person displaying that expression produced equally robust aftereffects. Smaller but significant aftereffects were generated by images of different individuals, irrespective of gender. Non-face visual, auditory, or verbal representations of emotion did not generate significant aftereffects. These results suggest that adaptation affects at least two neural representations of expression: one specific to the individual (not the image), and one that represents expression across different facial identities. The identity-independent aftereffect suggests the existence of a 'visual semantic' for facial expression in the human visual system.

Evolving attractive faces using morphing technology and a genetic algorithm: a new approach to determining ideal facial aesthetics.

PubMed

Wong, Brian J F; Karimi, Koohyar; Devcic, Zlatko; McLaren, Christine E; Chen, Wen-Pin

2008-06-01

The objectives of this study were to: 1) determine if a genetic algorithm in combination with morphing software can be used to evolve more attractive faces; and 2) evaluate whether this approach can be used as a tool to define or identify the attributes of the ideal attractive face. Basic research study incorporating focus group evaluations. Digital images were acquired of 250 female volunteers (18-25 y). Randomly selected images were used to produce a parent generation (P) of 30 synthetic faces using morphing software. Then, a focus group of 17 trained volunteers (18-25 y) scored each face on an attractiveness scale ranging from 1 (unattractive) to 10 (attractive). A genetic algorithm was used to select 30 new pairs from the parent generation, and these were morphed using software to produce a new first generation (F1) of faces. The F1 faces were scored by the focus group, and the process was repeated for a total of four iterations of the algorithm. The algorithm mimics natural selection by using the attractiveness score as the selection pressure; the more attractive faces are more likely to morph. All five generations (P-F4) were then scored by three focus groups: a) surgeons (n = 12), b) cos-metology students (n = 44), and c) undergraduate students (n = 44). Morphometric measurements were made of 33 specific features on each of the 150 synthetic faces, and correlated with attractiveness scores using univariate and multivariate analysis. The average facial attractiveness scores increased with each generation and were 3.66 (+0.60), 4.59 (+/-0.73), 5.50 (+/-0.62), 6.23 (+/-0.31), and 6.39 (+/-0.24) for P and F1-F4 generations, respectively. Histograms of attractiveness score distributions show a significant shift in the skew of each curve toward more attractive faces with each generation. Univariate analysis identified nasal width, eyebrow arch height, and lip thickness as being significantly correlated with attractiveness scores. Multivariate analysis identified a similar collection of morphometric measures. No correlation with more commonly accepted measures such as the length facial thirds or fifths were identified. When images are examined as a montage (by generation), clear distinct trends are identified: oval shaped faces, distinct arched eyebrows, and full lips predominate. Faces evolve to approximate the guidelines suggested by classical canons. F3 and F4 generation faces look profoundly similar. The statistical and qualitative analysis indicates that the algorithm and methodology succeeds in generating successively more attractive faces. The use of genetic algorithms in combination with a morphing software and traditional focus-group derived attractiveness scores can be used to evolve attractive synthetic faces. We have demonstrated that the evolution of attractive faces can be mimicked in software. Genetic algorithms and morphing provide a robust alternative to traditional approaches rooted in comparing attractiveness scores with a series of morphometric measurements in human subjects.

Tensor Factorization for Low-Rank Tensor Completion.

PubMed

Zhou, Pan; Lu, Canyi; Lin, Zhouchen; Zhang, Chao

2018-03-01

Recently, a tensor nuclear norm (TNN) based method was proposed to solve the tensor completion problem, which has achieved state-of-the-art performance on image and video inpainting tasks. However, it requires computing tensor singular value decomposition (t-SVD), which costs much computation and thus cannot efficiently handle tensor data, due to its natural large scale. Motivated by TNN, we propose a novel low-rank tensor factorization method for efficiently solving the 3-way tensor completion problem. Our method preserves the low-rank structure of a tensor by factorizing it into the product of two tensors of smaller sizes. In the optimization process, our method only needs to update two smaller tensors, which can be more efficiently conducted than computing t-SVD. Furthermore, we prove that the proposed alternating minimization algorithm can converge to a Karush-Kuhn-Tucker point. Experimental results on the synthetic data recovery, image and video inpainting tasks clearly demonstrate the superior performance and efficiency of our developed method over state-of-the-arts including the TNN and matricization methods.

Software Toolbox for Low-Frequency Conductivity and Current Density Imaging Using MRI.

PubMed

Sajib, Saurav Z K; Katoch, Nitish; Kim, Hyung Joong; Kwon, Oh In; Woo, Eung Je

2017-11-01

Low-frequency conductivity and current density imaging using MRI includes magnetic resonance electrical impedance tomography (MREIT), diffusion tensor MREIT (DT-MREIT), conductivity tensor imaging (CTI), and magnetic resonance current density imaging (MRCDI). MRCDI and MREIT provide current density and isotropic conductivity images, respectively, using current-injection phase MRI techniques. DT-MREIT produces anisotropic conductivity tensor images by incorporating diffusion weighted MRI into MREIT. These current-injection techniques are finding clinical applications in diagnostic imaging and also in transcranial direct current stimulation (tDCS), deep brain stimulation (DBS), and electroporation where treatment currents can function as imaging currents. To avoid adverse effects of nerve and muscle stimulations due to injected currents, conductivity tensor imaging (CTI) utilizes B1 mapping and multi-b diffusion weighted MRI to produce low-frequency anisotropic conductivity tensor images without injecting current. This paper describes numerical implementations of several key mathematical functions for conductivity and current density image reconstructions in MRCDI, MREIT, DT-MREIT, and CTI. To facilitate experimental studies of clinical applications, we developed a software toolbox for these low-frequency conductivity and current density imaging methods. This MR-based conductivity imaging (MRCI) toolbox includes 11 toolbox functions which can be used in the MATLAB environment. The MRCI toolbox is available at http://iirc.khu.ac.kr/software.html . Its functions were tested by using several experimental datasets, which are provided together with the toolbox. Users of the toolbox can focus on experimental designs and interpretations of reconstructed images instead of developing their own image reconstruction softwares. We expect more toolbox functions to be added from future research outcomes. Low-frequency conductivity and current density imaging using MRI includes magnetic resonance electrical impedance tomography (MREIT), diffusion tensor MREIT (DT-MREIT), conductivity tensor imaging (CTI), and magnetic resonance current density imaging (MRCDI). MRCDI and MREIT provide current density and isotropic conductivity images, respectively, using current-injection phase MRI techniques. DT-MREIT produces anisotropic conductivity tensor images by incorporating diffusion weighted MRI into MREIT. These current-injection techniques are finding clinical applications in diagnostic imaging and also in transcranial direct current stimulation (tDCS), deep brain stimulation (DBS), and electroporation where treatment currents can function as imaging currents. To avoid adverse effects of nerve and muscle stimulations due to injected currents, conductivity tensor imaging (CTI) utilizes B1 mapping and multi-b diffusion weighted MRI to produce low-frequency anisotropic conductivity tensor images without injecting current. This paper describes numerical implementations of several key mathematical functions for conductivity and current density image reconstructions in MRCDI, MREIT, DT-MREIT, and CTI. To facilitate experimental studies of clinical applications, we developed a software toolbox for these low-frequency conductivity and current density imaging methods. This MR-based conductivity imaging (MRCI) toolbox includes 11 toolbox functions which can be used in the MATLAB environment. The MRCI toolbox is available at http://iirc.khu.ac.kr/software.html . Its functions were tested by using several experimental datasets, which are provided together with the toolbox. Users of the toolbox can focus on experimental designs and interpretations of reconstructed images instead of developing their own image reconstruction softwares. We expect more toolbox functions to be added from future research outcomes.

Accelerated High-Dimensional MR Imaging with Sparse Sampling Using Low-Rank Tensors

PubMed Central

He, Jingfei; Liu, Qiegen; Christodoulou, Anthony G.; Ma, Chao; Lam, Fan

2017-01-01

High-dimensional MR imaging often requires long data acquisition time, thereby limiting its practical applications. This paper presents a low-rank tensor based method for accelerated high-dimensional MR imaging using sparse sampling. This method represents high-dimensional images as low-rank tensors (or partially separable functions) and uses this mathematical structure for sparse sampling of the data space and for image reconstruction from highly undersampled data. More specifically, the proposed method acquires two datasets with complementary sampling patterns, one for subspace estimation and the other for image reconstruction; image reconstruction from highly undersampled data is accomplished by fitting the measured data with a sparsity constraint on the core tensor and a group sparsity constraint on the spatial coefficients jointly using the alternating direction method of multipliers. The usefulness of the proposed method is demonstrated in MRI applications; it may also have applications beyond MRI. PMID:27093543

Multigrid optimal mass transport for image registration and morphing

NASA Astrophysics Data System (ADS)

Rehman, Tauseef ur; Tannenbaum, Allen

2007-02-01

In this paper we present a computationally efficient Optimal Mass Transport algorithm. This method is based on the Monge-Kantorovich theory and is used for computing elastic registration and warping maps in image registration and morphing applications. This is a parameter free method which utilizes all of the grayscale data in an image pair in a symmetric fashion. No landmarks need to be specified for correspondence. In our work, we demonstrate significant improvement in computation time when our algorithm is applied as compared to the originally proposed method by Haker et al [1]. The original algorithm was based on a gradient descent method for removing the curl from an initial mass preserving map regarded as 2D vector field. This involves inverting the Laplacian in each iteration which is now computed using full multigrid technique resulting in an improvement in computational time by a factor of two. Greater improvement is achieved by decimating the curl in a multi-resolutional framework. The algorithm was applied to 2D short axis cardiac MRI images and brain MRI images for testing and comparison.

b matrix errors in echo planar diffusion tensor imaging

PubMed Central

Boujraf, Saïd; Luypaert, Robert; Osteaux, Michel

2001-01-01

Diffusion‐weighted magnetic resonance imaging (DW‐MRI) is a recognized tool for early detection of infarction of the human brain. DW‐MRI uses the signal loss associated with the random thermal motion of water molecules in the presence of magnetic field gradients to derive parameters that reflect the translational mobility of the water molecules in tissues. If diffusion‐weighted images with different values of b matrix are acquired during one individual investigation, it is possible to calculate apparent diffusion coefficient maps that are the elements of the diffusion tensor. The diffusion tensor elements represent the apparent diffusion coefficient of protons of water molecules in each pixel in the corresponding sample. The relation between signal intensity in the diffusion‐weighted images, diffusion tensor, and b matrix is derived from the Bloch equations. Our goal is to establish the magnitude of the error made in the calculation of the elements of the diffusion tensor when the imaging gradients are ignored. PACS number(s): 87.57. –s, 87.61.–c PMID:11602015

Binocular stereo matching method based on structure tensor

NASA Astrophysics Data System (ADS)

Song, Xiaowei; Yang, Manyi; Fan, Yubo; Yang, Lei

2016-10-01

In a binocular visual system, to recover the three-dimensional information of the object, the most important step is to acquire matching points. Structure tensor is the vector representation of each point in its local neighborhood. Therefore, structure tensor performs well in region detection of local structure, and it is very suitable for detecting specific graphics such as pedestrians, cars and road signs in the image. In this paper, the structure tensor is combined with the luminance information to form the extended structure tensor. The directional derivatives of luminance in x and y directions are calculated, so that the local structure of the image is more prominent. Meanwhile, the Euclidean distance between the eigenvectors of key points is used as the similarity determination metric of key points in the two images. By matching, the coordinates of the matching points in the detected target are precisely acquired. In this paper, experiments were performed on the captured left and right images. After the binocular calibration, image matching was done to acquire the matching points, and then the target depth was calculated according to these matching points. By comparison, it is proved that the structure tensor can accurately acquire the matching points in binocular stereo matching.

Novel region of interest interrogation technique for diffusion tensor imaging analysis in the canine brain.

PubMed

Li, Jonathan Y; Middleton, Dana M; Chen, Steven; White, Leonard; Ellinwood, N Matthew; Dickson, Patricia; Vite, Charles; Bradbury, Allison; Provenzale, James M

2017-08-01

Purpose We describe a novel technique for measuring diffusion tensor imaging metrics in the canine brain. We hypothesized that a standard method for region of interest placement could be developed that is highly reproducible, with less than 10% difference in measurements between raters. Methods Two sets of canine brains (three seven-week-old full-brains and two 17-week-old single hemispheres) were scanned ex-vivo on a 7T small-animal magnetic resonance imaging system. Strict region of interest placement criteria were developed and then used by two raters to independently measure diffusion tensor imaging metrics within four different white-matter regions within each specimen. Average values of fractional anisotropy, radial diffusivity, and the three eigenvalues (λ1, λ2, and λ3) within each region in each specimen overall and within each individual image slice were compared between raters by calculating the percentage difference between raters for each metric. Results The mean percentage difference between raters for all diffusion tensor imaging metrics when pooled by each region and specimen was 1.44% (range: 0.01-5.17%). The mean percentage difference between raters for all diffusion tensor imaging metrics when compared by individual image slice was 2.23% (range: 0.75-4.58%) per hemisphere. Conclusion Our results indicate that the technique described is highly reproducible, even when applied to canine specimens of differing age, morphology, and image resolution. We propose this technique for future studies of diffusion tensor imaging analysis in canine brains and for cross-sectional and longitudinal studies of canine brain models of human central nervous system disease.

Diffusion tensor imaging with direct cytopathological validation: characterisation of decorin treatment in experimental juvenile communicating hydrocephalus.

PubMed

Aojula, Anuriti; Botfield, Hannah; McAllister, James Patterson; Gonzalez, Ana Maria; Abdullah, Osama; Logan, Ann; Sinclair, Alexandra

2016-05-31

In an effort to develop novel treatments for communicating hydrocephalus, we have shown previously that the transforming growth factor-β antagonist, decorin, inhibits subarachnoid fibrosis mediated ventriculomegaly; however decorin's ability to prevent cerebral cytopathology in communicating hydrocephalus has not been fully examined. Furthermore, the capacity for diffusion tensor imaging to act as a proxy measure of cerebral pathology in multiple sclerosis and spinal cord injury has recently been demonstrated. However, the use of diffusion tensor imaging to investigate cytopathological changes in communicating hydrocephalus is yet to occur. Hence, this study aimed to determine whether decorin treatment influences alterations in diffusion tensor imaging parameters and cytopathology in experimental communicating hydrocephalus. Moreover, the study also explored whether diffusion tensor imaging parameters correlate with cellular pathology in communicating hydrocephalus. Accordingly, communicating hydrocephalus was induced by injecting kaolin into the basal cisterns in 3-week old rats followed immediately by 14 days of continuous intraventricular delivery of either human recombinant decorin (n = 5) or vehicle (n = 6). Four rats remained as intact controls and a further four rats served as kaolin only controls. At 14-days post-kaolin, just prior to sacrifice, routine magnetic resonance imaging and magnetic resonance diffusion tensor imaging was conducted and the mean diffusivity, fractional anisotropy, radial and axial diffusivity of seven cerebral regions were assessed by voxel-based analysis in the corpus callosum, periventricular white matter, caudal internal capsule, CA1 hippocampus, and outer and inner parietal cortex. Myelin integrity, gliosis and aquaporin-4 levels were evaluated by post-mortem immunohistochemistry in the CA3 hippocampus and in the caudal brain of the same cerebral structures analysed by diffusion tensor imaging. Decorin significantly decreased myelin damage in the caudal internal capsule and prevented caudal periventricular white matter oedema and astrogliosis. Furthermore, decorin treatment prevented the increase in caudal periventricular white matter mean diffusivity (p = 0.032) as well as caudal corpus callosum axial diffusivity (p = 0.004) and radial diffusivity (p = 0.034). Furthermore, diffusion tensor imaging parameters correlated primarily with periventricular white matter astrocyte and aquaporin-4 levels. Overall, these findings suggest that decorin has the therapeutic potential to reduce white matter cytopathology in hydrocephalus. Moreover, diffusion tensor imaging is a useful tool to provide surrogate measures of periventricular white matter pathology in communicating hydrocephalus.

Machine Learning Interface for Medical Image Analysis.

PubMed

Zhang, Yi C; Kagen, Alexander C

2017-10-01

TensorFlow is a second-generation open-source machine learning software library with a built-in framework for implementing neural networks in wide variety of perceptual tasks. Although TensorFlow usage is well established with computer vision datasets, the TensorFlow interface with DICOM formats for medical imaging remains to be established. Our goal is to extend the TensorFlow API to accept raw DICOM images as input; 1513 DaTscan DICOM images were obtained from the Parkinson's Progression Markers Initiative (PPMI) database. DICOM pixel intensities were extracted and shaped into tensors, or n-dimensional arrays, to populate the training, validation, and test input datasets for machine learning. A simple neural network was constructed in TensorFlow to classify images into normal or Parkinson's disease groups. Training was executed over 1000 iterations for each cross-validation set. The gradient descent optimization and Adagrad optimization algorithms were used to minimize cross-entropy between the predicted and ground-truth labels. Cross-validation was performed ten times to produce a mean accuracy of 0.938 ± 0.047 (95 % CI 0.908-0.967). The mean sensitivity was 0.974 ± 0.043 (95 % CI 0.947-1.00) and mean specificity was 0.822 ± 0.207 (95 % CI 0.694-0.950). We extended the TensorFlow API to enable DICOM compatibility in the context of DaTscan image analysis. We implemented a neural network classifier that produces diagnostic accuracies on par with excellent results from previous machine learning models. These results indicate the potential role of TensorFlow as a useful adjunct diagnostic tool in the clinical setting.

Quantitative analysis of hypertrophic myocardium using diffusion tensor magnetic resonance imaging

PubMed Central

Tran, Nicholas; Giannakidis, Archontis; Gullberg, Grant T.; Seo, Youngho

2016-01-01

Abstract. Systemic hypertension is a causative factor in left ventricular hypertrophy (LVH). This study is motivated by the potential to reverse or manage the dysfunction associated with structural remodeling of the myocardium in this pathology. Using diffusion tensor magnetic resonance imaging, we present an analysis of myocardial fiber and laminar sheet orientation in ex vivo hypertrophic (6 SHR) and normal (5 WKY) rat hearts using the covariance of the diffusion tensor. First, an atlas of normal cardiac microstructure was formed using the WKY b0 images. Then, the SHR and WKY b0 hearts were registered to the atlas. The acquired deformation fields were applied to the SHR and WKY heart tensor fields followed by the preservation of principal direction (PPD) reorientation strategy. A mean tensor field was then formed from the registered WKY tensor images. Calculating the covariance of the registered tensor images about this mean for each heart, the hypertrophic myocardium exhibited significantly increased myocardial fiber derangement (p=0.017) with a mean dispersion of 38.7 deg, and an increased dispersion of the laminar sheet normal (p=0.030) of 54.8 deg compared with 34.8 deg and 51.8 deg, respectively, in the normal hearts. Results demonstrate significantly altered myocardial fiber and laminar sheet structure in rats with hypertensive LVH. PMID:27872872

Life history differences between fat and lean morphs of lake charr (Salvelinus namaycush) in Great Slave Lake, Northwest Territories, Canada

USGS Publications Warehouse

Hansen, Michael J.; Nate, Nancy A.; Chavarie, Louise; Muir, Andrew M.; Zimmerman, Mara S.; Krueger, Charles C.

2016-01-01

Life history characteristics (size, age, plumpness, buoyancy, survival, growth, and maturity) were compared between fat and lean morphs of lake charr Salvelinus namaycush in Great Slave Lake, Canada, to determine if differences may reflect effects of resource polymorphism. Lake charr were sampled using graded-mesh gill nets set in three depth strata. Of 236 lake charr captured, 122 were a fat morph and 114 were a lean morph. Males and females did not differ from each other in any attributes for either fat or lean morphs. The fat morph averaged 15 mm longer, 481 g heavier, and 4.7 years older than the lean morph. The fat morph averaged 26% heavier and 48% more buoyant at length than the lean morph. Survival of the fat morph was 1.7% higher than that of the lean morph. The fat morph grew at a slower annual rate to a shorter asymptotic length than the lean morph. Fat and lean morphs matured at similar lengths and ages. We concluded that the connection between resource polymorphism and life histories in lean versus fat lake charr suggests that morph-specific restoration objectives may be needed in lakes where lake charr diversity is considered to be a restoration goal.

Experimental investigation of the dynamics of a hybrid morphing wing: time resolved particle image velocimetry and force measures

NASA Astrophysics Data System (ADS)

Jodin, Gurvan; Scheller, Johannes; Rouchon, Jean-François; Braza, Marianna; Mit Collaboration; Imft Collaboration; Laplace Collaboration

2016-11-01

A quantitative characterization of the effects obtained by high frequency-low amplitude trailing edge actuation is performed. Particle image velocimetry, as well as pressure and aerodynamic force measurements, are carried out on an airfoil model. This hybrid morphing wing model is equipped with both trailing edge piezoelectric-actuators and camber control shape memory alloy actuators. It will be shown that this actuation allows for an effective manipulation of the wake turbulent structures. Frequency domain analysis and proper orthogonal decomposition show that proper actuating reduces the energy dissipation by favoring more coherent vortical structures. This modification in the airflow dynamics eventually allows for a tapering of the wake thickness compared to the baseline configuration. Hence, drag reductions relative to the non-actuated trailing edge configuration are observed. Massachusetts Institute of Technology.

Evolving Attractive Faces Using Morphing Technology and a Genetic Algorithm: A New Approach to Determining Ideal Facial Aesthetics

PubMed Central

Wong, Brian J. F.; Karmi, Koohyar; Devcic, Zlatko; McLaren, Christine E.; Chen, Wen-Pin

2013-01-01

Objectives The objectives of this study were to: 1) determine if a genetic algorithm in combination with morphing software can be used to evolve more attractive faces; and 2) evaluate whether this approach can be used as a tool to define or identify the attributes of the ideal attractive face. Study Design Basic research study incorporating focus group evaluations. Methods Digital images were acquired of 250 female volunteers (18–25 y). Randomly selected images were used to produce a parent generation (P) of 30 synthetic faces using morphing software. Then, a focus group of 17 trained volunteers (18–25 y) scored each face on an attractiveness scale ranging from 1 (unattractive) to 10 (attractive). A genetic algorithm was used to select 30 new pairs from the parent generation, and these were morphed using software to produce a new first generation (F1) of faces. The F1 faces were scored by the focus group, and the process was repeated for a total of four iterations of the algorithm. The algorithm mimics natural selection by using the attractiveness score as the selection pressure; the more attractive faces are more likely to morph. All five generations (P-F4) were then scored by three focus groups: a) surgeons (n = 12), b) cosmetology students (n = 44), and c) undergraduate students (n = 44). Morphometric measurements were made of 33 specific features on each of the 150 synthetic faces, and correlated with attractiveness scores using univariate and multivariate analysis. Results The average facial attractiveness scores increased with each generation and were 3.66 (+0.60), 4.59 (±0.73), 5.50 (±0.62), 6.23 (±0.31), and 6.39 (±0.24) for P and F1–F4 generations, respectively. Histograms of attractiveness score distributions show a significant shift in the skew of each curve toward more attractive faces with each generation. Univariate analysis identified nasal width, eyebrow arch height, and lip thickness as being significantly correlated with attractiveness scores. Multivariate analysis identified a similar collection of morphometric measures. No correlation with more commonly accepted measures such as the length facial thirds or fifths were identified. When images are examined as a montage (by generation), clear distinct trends are identified: oval shaped faces, distinct arched eyebrows, and full lips predominate. Faces evolve to approximate the guidelines suggested by classical canon. F3 and F4 generation faces look profoundly similar. The statistical and qualitative analysis indicates that the algorithm and methodology succeeds in generating successively more attractive faces. Conclusions The use of genetic algorithms in combination with a morphing software and traditional focus-group derived attractiveness scores can be used to evolve attractive synthetic faces. We have demonstrated that the evolution of attractive faces can be mimicked in software. Genetic algorithms and morphing provide a robust alternative to traditional approaches rooted in comparing attractiveness scores with a series of morphometric measurements in human subjects. PMID:18401273

Visual one-shot learning as an 'anti-camouflage device': a novel morphing paradigm.

PubMed

Ishikawa, Tetsuo; Mogi, Ken

2011-09-01

Once people perceive what is in the hidden figure such as Dallenbach's cow and Dalmatian, they seldom seem to come back to the previous state when they were ignorant of the answer. This special type of learning process can be accomplished in a short time, with the effect of learning lasting for a long time (visual one-shot learning). Although it is an intriguing cognitive phenomenon, the lack of the control of difficulty of stimuli presented has been a problem in research. Here we propose a novel paradigm to create new hidden figures systematically by using a morphing technique. Through gradual changes from a blurred and binarized two-tone image to a blurred grayscale image of the original photograph including objects in a natural scene, spontaneous one-shot learning can occur at a certain stage of morphing when a sufficient amount of information is restored to the degraded image. A negative correlation between confidence levels and reaction times is observed, giving support to the fluency theory of one-shot learning. The correlation between confidence ratings and correct recognition rates indicates that participants had an accurate introspective ability (metacognition). The learning effect could be tested later by verifying whether or not the target object was recognized quicker in the second exposure. The present method opens a way for a systematic production of "good" hidden figures, which can be used to demystify the nature of visual one-shot learning.

Combining Diffusion Tensor Metrics and DSC Perfusion Imaging: Can It Improve the Diagnostic Accuracy in Differentiating Tumefactive Demyelination from High-Grade Glioma?

PubMed

Hiremath, S B; Muraleedharan, A; Kumar, S; Nagesh, C; Kesavadas, C; Abraham, M; Kapilamoorthy, T R; Thomas, B

2017-04-01

Tumefactive demyelinating lesions with atypical features can mimic high-grade gliomas on conventional imaging sequences. The aim of this study was to assess the role of conventional imaging, DTI metrics ( p:q tensor decomposition), and DSC perfusion in differentiating tumefactive demyelinating lesions and high-grade gliomas. Fourteen patients with tumefactive demyelinating lesions and 21 patients with high-grade gliomas underwent brain MR imaging with conventional, DTI, and DSC perfusion imaging. Imaging sequences were assessed for differentiation of the lesions. DTI metrics in the enhancing areas and perilesional hyperintensity were obtained by ROI analysis, and the relative CBV values in enhancing areas were calculated on DSC perfusion imaging. Conventional imaging sequences had a sensitivity of 80.9% and specificity of 57.1% in differentiating high-grade gliomas ( P = .049) from tumefactive demyelinating lesions. DTI metrics ( p : q tensor decomposition) and DSC perfusion demonstrated a statistically significant difference in the mean values of ADC, the isotropic component of the diffusion tensor, the anisotropic component of the diffusion tensor, the total magnitude of the diffusion tensor, and rCBV among enhancing portions in tumefactive demyelinating lesions and high-grade gliomas ( P ≤ .02), with the highest specificity for ADC, the anisotropic component of the diffusion tensor, and relative CBV (92.9%). Mean fractional anisotropy values showed no significant statistical difference between tumefactive demyelinating lesions and high-grade gliomas. The combination of DTI and DSC parameters improved the diagnostic accuracy (area under the curve = 0.901). Addition of a heterogeneous enhancement pattern to DTI and DSC parameters improved it further (area under the curve = 0.966). The sensitivity increased from 71.4% to 85.7% after the addition of the enhancement pattern. DTI and DSC perfusion add profoundly to conventional imaging in differentiating tumefactive demyelinating lesions and high-grade gliomas. The combination of DTI metrics and DSC perfusion markedly improved diagnostic accuracy. © 2017 by American Journal of Neuroradiology.

Social Inferences from Faces: Ambient Images Generate a Three-Dimensional Model

ERIC Educational Resources Information Center

Sutherland, Clare A. M.; Oldmeadow, Julian A.; Santos, Isabel M.; Towler, John; Burt, D. Michael; Young, Andrew W.

2013-01-01

Three experiments are presented that investigate the two-dimensional valence/trustworthiness by dominance model of social inferences from faces (Oosterhof & Todorov, 2008). Experiment 1 used image averaging and morphing techniques to demonstrate that consistent facial cues subserve a range of social inferences, even in a highly variable sample of…

Demographic stochasticity in small remnant populations of the declining distylous plant Primula veris

USGS Publications Warehouse

Kery, M.; Matthies, D.; Schmid, B.

2003-01-01

We studied ecological consequences of distyly for the declining perennial plant Primula veris in the Swiss Jura. Distyly favours cross-fertilization and avoids inbreeding, but may lead to pollen limitation and reduced reproduction if morph frequencies deviate from 50 %. Disassortative mating is promoted by the reciprocal position of stigmas and anthers in the two morphs (pin and thrum) and by intramorph incompatibility and should result in equal frequencies of morphs at equilibrium. However, deviations could arise because of demographic stochasticity, the lower intra-morph incompatibility of the pin morph, and niche differentiation between morphs. Demographic stochasticity should result in symmetric deviations from an even morph frequency among populations and in increased deviations with decreasing population size. If crosses between pins occurred, these would only generate pins, and this could result in a pin-bias of morph frequencies in general and in small populations in particular. If the morphs have different niches, morph frequencies should be related to environmental factors, morphs might be spatially segregated, and morphological differences between morphs would be expected. We tested these hypotheses in the declining distylous P. veris. We studied morph frequencies in relation to environmental conditions and population size, spatial segregation in field populations, morphological differences between morphs, and growth responses to nutrient addition. Morph frequencies in 76 populations with 1 - 80000 flowering plants fluctuated symmetrically about 50 %. Deviations from 50 % were much larger in small populations, and sixof the smallest populations had lost one morph altogether. In contrast, morph frequencies were neither related to population size nor to 17 measures of environmental conditions. We found no spatial segregation or morphological differences in the field or in the common garden. The results suggest that demographic stochasticity caused deviations of the morph ratiofrom unity in small populations. Demographic stochasticity was probably caused by the random elimination of plants during the fragmentation of formerly large continuous populations. Biased morph frequencies may be one of the reasons for the strongly reduced reproduction in small populations of P. veris.

Real-time object recognition in multidimensional images based on joined extended structural tensor and higher-order tensor decomposition methods

NASA Astrophysics Data System (ADS)

Cyganek, Boguslaw; Smolka, Bogdan

2015-02-01

In this paper a system for real-time recognition of objects in multidimensional video signals is proposed. Object recognition is done by pattern projection into the tensor subspaces obtained from the factorization of the signal tensors representing the input signal. However, instead of taking only the intensity signal the novelty of this paper is first to build the Extended Structural Tensor representation from the intensity signal that conveys information on signal intensities, as well as on higher-order statistics of the input signals. This way the higher-order input pattern tensors are built from the training samples. Then, the tensor subspaces are built based on the Higher-Order Singular Value Decomposition of the prototype pattern tensors. Finally, recognition relies on measurements of the distance of a test pattern projected into the tensor subspaces obtained from the training tensors. Due to high-dimensionality of the input data, tensor based methods require high memory and computational resources. However, recent achievements in the technology of the multi-core microprocessors and graphic cards allows real-time operation of the multidimensional methods as is shown and analyzed in this paper based on real examples of object detection in digital images.

A unified tensor level set for image segmentation.

PubMed

Wang, Bin; Gao, Xinbo; Tao, Dacheng; Li, Xuelong

2010-06-01

This paper presents a new region-based unified tensor level set model for image segmentation. This model introduces a three-order tensor to comprehensively depict features of pixels, e.g., gray value and the local geometrical features, such as orientation and gradient, and then, by defining a weighted distance, we generalized the representative region-based level set method from scalar to tensor. The proposed model has four main advantages compared with the traditional representative method as follows. First, involving the Gaussian filter bank, the model is robust against noise, particularly the salt- and pepper-type noise. Second, considering the local geometrical features, e.g., orientation and gradient, the model pays more attention to boundaries and makes the evolving curve stop more easily at the boundary location. Third, due to the unified tensor pixel representation representing the pixels, the model segments images more accurately and naturally. Fourth, based on a weighted distance definition, the model possesses the capacity to cope with data varying from scalar to vector, then to high-order tensor. We apply the proposed method to synthetic, medical, and natural images, and the result suggests that the proposed method is superior to the available representative region-based level set method.

A review of anisotropic conductivity models of brain white matter based on diffusion tensor imaging.

PubMed

Wu, Zhanxiong; Liu, Yang; Hong, Ming; Yu, Xiaohui

2018-06-01

The conductivity of brain tissues is not only essential for electromagnetic source estimation (ESI), but also a key reflector of the brain functional changes. Different from the other brain tissues, the conductivity of whiter matter (WM) is highly anisotropic and a tensor is needed to describe it. The traditional electrical property imaging methods, such as electrical impedance tomography (EIT) and magnetic resonance electrical impedance tomography (MREIT), usually fail to image the anisotropic conductivity tensor of WM with high spatial resolution. The diffusion tensor imaging (DTI) is a newly developed technique that can fulfill this purpose. This paper reviews the existing anisotropic conductivity models of WM based on the DTI and discusses their advantages and disadvantages, as well as identifies opportunities for future research on this subject. It is crucial to obtain the linear conversion coefficient between the eigenvalues of anisotropic conductivity tensor and diffusion tensor, since they share the same eigenvectors. We conclude that the electrochemical model is suitable for ESI analysis because the conversion coefficient can be directly obtained from the concentration of ions in extracellular liquid and that the volume fraction model is appropriate to study the influence of WM structural changes on electrical conductivity. Graphical abstract ᅟ.

Modeling and Optimization for Morphing Wing Concept Generation

NASA Technical Reports Server (NTRS)

Skillen, Michael D.; Crossley, William A.

2007-01-01

This report consists of two major parts: 1) the approach to develop morphing wing weight equations, and 2) the approach to size morphing aircraft. Combined, these techniques allow the morphing aircraft to be sized with estimates of the morphing wing weight that are more credible than estimates currently available; aircraft sizing results prior to this study incorporated morphing wing weight estimates based on general heuristics for fixed-wing flaps (a comparable "morphing" component) but, in general, these results were unsubstantiated. This report will show that the method of morphing wing weight prediction does, in fact, drive the aircraft sizing code to different results and that accurate morphing wing weight estimates are essential to credible aircraft sizing results.

Endocrine differences among colour morphs in a lizard with alternative behavioural strategies.

PubMed

Yewers, Madeleine St Clair; Jessop, Tim S; Stuart-Fox, Devi

2017-07-01

Alternative behavioural strategies of colour morphs are expected to associate with endocrine differences and to correspond to differences in physical performance (e.g. movement speed, bite force in lizards); yet the nature of correlated physiological and performance traits in colour polymorphic species varies widely. Colour morphs of male tawny dragon lizards Ctenophorus decresii have previously been found to differ in aggressive and anti-predator behaviours. We tested whether known behavioural differences correspond to differences in circulating baseline and post-capture stress levels of androgen and corticosterone, as well as bite force (an indicator of aggressive performance) and field body temperature. Immediately after capture, the aggressive orange morph had higher circulating androgen than the grey morph or the yellow morph. Furthermore, the orange morph maintained high androgen following acute stress (30min of capture); whereas androgen increased in the grey and yellow morphs. This may reflect the previously defined behavioural differences among morphs as the aggressive response of the yellow morph is conditional on the colour of the competitor and the grey morph shows consistently low aggression. In contrast, all morphs showed an increase in corticosterone concentration after capture stress and morphs did not differ in levels of corticosterone stress magnitude (CSM). Morphs did not differ in size- and temperature-corrected bite force but did in body temperature at capture. Differences in circulating androgen and body temperature are consistent with morph-specific behavioural strategies in C. decresii but our results indicate a complex relationship between hormones, behaviour, temperature and bite force within and between colour morphs. Copyright © 2017 Elsevier Inc. All rights reserved.

Probabilistic-driven oriented Speckle reducing anisotropic diffusion with application to cardiac ultrasonic images.

PubMed

Vegas-Sanchez-Ferrero, G; Aja-Fernandez, S; Martin-Fernandez, M; Frangi, A F; Palencia, C

2010-01-01

A novel anisotropic diffusion filter is proposed in this work with application to cardiac ultrasonic images. It includes probabilistic models which describe the probability density function (PDF) of tissues and adapts the diffusion tensor to the image iteratively. For this purpose, a preliminary study is performed in order to select the probability models that best fit the stastitical behavior of each tissue class in cardiac ultrasonic images. Then, the parameters of the diffusion tensor are defined taking into account the statistical properties of the image at each voxel. When the structure tensor of the probability of belonging to each tissue is included in the diffusion tensor definition, a better boundaries estimates can be obtained instead of calculating directly the boundaries from the image. This is the main contribution of this work. Additionally, the proposed method follows the statistical properties of the image in each iteration. This is considered as a second contribution since state-of-the-art methods suppose that noise or statistical properties of the image do not change during the filter process.

White matter structure in loneliness: preliminary findings from diffusion tensor imaging.

PubMed

Tian, Yin; Liang, Shanshan; Yuan, Zhen; Chen, Sifan; Xu, Peng; Yao, Dezhong

2014-08-06

A pilot study was carried out to determine individual differences in perceived loneliness using diffusion tensor imaging. To the best of our knowledge, this is the first preliminary diffusion tensor imaging evidence that the ventral attention network, generally activated by attentional reorienting, was also related to loneliness. Image reconstruction results indicated significantly decreased fractional anisotropy of white matter fibers and that associated nodes of the ventral attention network are highly correlated with increased loneliness ratings. By providing evidence on the structural level, our findings suggested that attention-reorienting capabilities play an important role in shaping an individual's loneliness.

Variation in style morph frequencies in tristylous Lythrum salicaria in the Iberian Peninsula: the role of geographical and demographic factors

PubMed Central

Costa, Joana; Castro, Sílvia; Loureiro, João; Barrett, Spencer C. H.

2016-01-01

Background and Aims The balance between stochastic forces and negative frequency-dependent selection largely determines style morph frequencies in heterostylous populations. Investigation of morph frequencies at geographical range limits can provide insights into the forces maintaining the floral polymorphism, and the factors causing biased morph ratios. Here, we investigate style morph frequencies in populations at the south-western European range limit of tristylous Lythrum salicaria, to explore the role of demographic and geographical factors influencing morph ratios in its native range. Methods We measured morph composition and evenness, and the size of 96 populations, along a north to south latitudinal transect from Galicia to Andalucia, Iberian Peninsula, traversing a steep climatic gradient. To examine the potential influence of morph-specific fitness components on morph ratios, we examined reproductive traits in 19 populations. Key Results Most populations of L. salicaria were trimorphic (94·79 %), the majority exhibiting 1 : 1 : 1 morph ratios (68·75 %). Populations with biased morph ratios had a deficiency of the short-styled morph. Population size and morph evenness were positively associated with latitude, with smaller populations and those with less even morph ratios occurring towards the south. Greater variance in morph evenness was evident at the southern range margin. There were no consistent differences in components of reproductive fitness among style morphs, but southern populations produced less fruit and seed than more northerly populations. Conclusions Our results demonstrate the influence of finite population size on morph frequencies in L. salicaria. However, they also illustrate the resilience of Iberian populations to the factors causing deviations from isoplethy and morph loss, especially at the southern range limit where populations are smaller. The maintenance of tristyly in small populations of L. salicaria may be aided by the genetic connectivity of populations in agricultural landscapes resulting from gene flow through pollen and seed dispersal. PMID:26658100

Patient specific computerized phantoms to estimate dose in pediatric CT

NASA Astrophysics Data System (ADS)

Segars, W. P.; Sturgeon, G.; Li, X.; Cheng, L.; Ceritoglu, C.; Ratnanather, J. T.; Miller, M. I.; Tsui, B. M. W.; Frush, D.; Samei, E.

2009-02-01

We create a series of detailed computerized phantoms to estimate patient organ and effective dose in pediatric CT and investigate techniques for efficiently creating patient-specific phantoms based on imaging data. The initial anatomy of each phantom was previously developed based on manual segmentation of pediatric CT data. Each phantom was extended to include a more detailed anatomy based on morphing an existing adult phantom in our laboratory to match the framework (based on segmentation) defined for the target pediatric model. By morphing a template anatomy to match the patient data in the LDDMM framework, it was possible to create a patient specific phantom with many anatomical structures, some not visible in the CT data. The adult models contain thousands of defined structures that were transformed to define them in each pediatric anatomy. The accuracy of this method, under different conditions, was tested using a known voxelized phantom as the target. Errors were measured in terms of a distance map between the predicted organ surfaces and the known ones. We also compared calculated dose measurements to see the effect of different magnitudes of errors in morphing. Despite some variations in organ geometry, dose measurements from morphing predictions were found to agree with those calculated from the voxelized phantom thus demonstrating the feasibility of our methods.

Usefulness of image morphing techniques in cancer treatment by conformal radiotherapy

NASA Astrophysics Data System (ADS)

Atoui, Hussein; Sarrut, David; Miguet, Serge

2004-05-01

Conformal radiotherapy is a cancer treatment technique, that targets high-energy X-rays to tumors with minimal exposure to surrounding healthy tissues. Irradiation ballistics is calculated based on an initial 3D Computerized Tomography (CT) scan. At every treatment session, the random positioning of the patient, compared to the reference position defined by the initial 3D CT scan, can generate treatment inaccuracies. Positioning errors potentially predispose to dangerous exposure to healthy tissues as well as insufficient irradiation to the tumor. A proposed solution would be the use of portal images generated by Electronic Portal Imaging Devices (EPID). Portal images (PI) allow a comparison with reference images retained by physicians, namely Digitally Reconstructed Radiographs (DRRs). At present, physicians must estimate patient positional errors by visual inspection. However, this may be inaccurate and consumes time. The automation of this task has been the subject of many researches. Unfortunately, the intensive use of DRRs and the high computing time required have prevented real time implementation. We are currently investigating a new method for DRR generation that calculates intermediate DRRs by 2D deformation of previously computed DRRs. We approach this investigation with the use of a morphing-based technique named mesh warping.

MRI diffusion tensor reconstruction with PROPELLER data acquisition.

PubMed

Cheryauka, Arvidas B; Lee, James N; Samsonov, Alexei A; Defrise, Michel; Gullberg, Grant T

2004-02-01

MRI diffusion imaging is effective in measuring the diffusion tensor in brain, cardiac, liver, and spinal tissue. Diffusion tensor tomography MRI (DTT MRI) method is based on reconstructing the diffusion tensor field from measurements of projections of the tensor field. Projections are obtained by appropriate application of rotated diffusion gradients. In the present paper, the potential of a novel data acquisition scheme, PROPELLER (Periodically Rotated Overlapping ParallEL Lines with Enhanced Reconstruction), is examined in combination with DTT MRI for its capability and sufficiency for diffusion imaging. An iterative reconstruction algorithm is used to reconstruct the diffusion tensor field from rotated diffusion weighted blades by appropriate rotated diffusion gradients. DTT MRI with PROPELLER data acquisition shows significant potential to reduce the number of weighted measurements, avoid ambiguity in reconstructing diffusion tensor parameters, increase signal-to-noise ratio, and decrease the influence of signal distortion.

Fluid Registration of Diffusion Tensor Images Using Information Theory

PubMed Central

Chiang, Ming-Chang; Leow, Alex D.; Klunder, Andrea D.; Dutton, Rebecca A.; Barysheva, Marina; Rose, Stephen E.; McMahon, Katie L.; de Zubicaray, Greig I.; Toga, Arthur W.; Thompson, Paul M.

2008-01-01

We apply an information-theoretic cost metric, the symmetrized Kullback-Leibler (sKL) divergence, or J-divergence, to fluid registration of diffusion tensor images. The difference between diffusion tensors is quantified based on the sKL-divergence of their associated probability density functions (PDFs). Three-dimensional DTI data from 34 subjects were fluidly registered to an optimized target image. To allow large image deformations but preserve image topology, we regularized the flow with a large-deformation diffeomorphic mapping based on the kinematics of a Navier-Stokes fluid. A driving force was developed to minimize the J-divergence between the deforming source and target diffusion functions, while reorienting the flowing tensors to preserve fiber topography. In initial experiments, we showed that the sKL-divergence based on full diffusion PDFs is adaptable to higher-order diffusion models, such as high angular resolution diffusion imaging (HARDI). The sKL-divergence was sensitive to subtle differences between two diffusivity profiles, showing promise for nonlinear registration applications and multisubject statistical analysis of HARDI data. PMID:18390342

The rock-paper-scissors game and the evolution of alternative male strategies

NASA Astrophysics Data System (ADS)

Sinervo, B.; Lively, C. M.

1996-03-01

MANY species exhibit colour polymorphisms associated with alternative male reproductive strategies, including territorial males and 'sneaker males' that behave and look like females1-3. The prevalence of multiple morphs is a challenge to evolutionary theory because a single strategy should prevail unless morphs have exactly equal fitness4,5 or a fitness advantage when rare6,7. We report here the application of an evolutionary stable strategy model to a three-morph mating system in the side-blotched lizard. Using parameter estimates from field data, the model predicted oscillations in morph frequency, and the frequencies of the three male morphs were found to oscillate over a six-year period in the field. The fitnesses of each morph relative to other morphs were non-transitive in that each morph could invade another morph when rare, but was itself invadable by another morph when common. Concordance between frequency-dependent selection and the among-year changes in morph fitnesses suggest that male interactions drive a dynamic 'rock-paper-scissors' game7.

The Value of Neurosurgical and Intraoperative Magnetic Resonance Imaging and Diffusion Tensor Imaging Tractography in Clinically Integrated Neuroanatomy Modules: A Cross-Sectional Study

ERIC Educational Resources Information Center

Familiari, Giuseppe; Relucenti, Michela; Heyn, Rosemarie; Baldini, Rossella; D'Andrea, Giancarlo; Familiari, Pietro; Bozzao, Alessandro; Raco, Antonino

2013-01-01

Neuroanatomy is considered to be one of the most difficult anatomical subjects for students. To provide motivation and improve learning outcomes in this area, clinical cases and neurosurgical images from diffusion tensor imaging (DTI) tractographies produced using an intraoperative magnetic resonance imaging apparatus (MRI/DTI) were presented and…

Diversity in shortjaw cisco (Coregonus zenithicus) in North America

USGS Publications Warehouse

Todd, T.N.; Steinhilber, M.

2002-01-01

Shortjaw cisco (Coregonus zenithicus) exhibit morphological variability across their geographic range in North America and could comprise more than one distinct morph or taxon. To investigate this, principal components analysis was applied to a data set that consisted of four variables from nine localities. All data were obtained from digital images of the specimens and the excised first gill arch. Confidence ellipses (95%) about the means of bivariate distributions of the principal components revealed that some populations were distinct from the others, but a continuity of overlap clouded understanding of pattern among the variation. Most populations had more and longer gillrakers than shortjaw cisco from George Lake (Manitoba) and Basswood Lake (Ontario) that had fewer and shorter gillrakers. This analysis supports the existence of a short- and few-rakered morph and a long- and many-rakered morph. However, most populations of shortjaw cisco from the Great Lakes across Canada to the Arctic share a similar morphology and likely represent a single, widespread species.

Basic concepts of MR imaging, diffusion MR imaging, and diffusion tensor imaging.

PubMed

de Figueiredo, Eduardo H M S G; Borgonovi, Arthur F N G; Doring, Thomas M

2011-02-01

MR image contrast is based on intrinsic tissue properties and specific pulse sequences and parameter adjustments. A growing number of MRI imaging applications are based on diffusion properties of water. To better understand MRI diffusion-weighted imaging, a brief overview of MR physics is presented in this article followed by physics of the evolving techniques of diffusion MR imaging and diffusion tensor imaging. Copyright © 2011. Published by Elsevier Inc.

Divergence of water balance mechanisms and acclimation potential in body color morphs of Drosophila ananassae.

PubMed

Parkash, Ravi; Aggarwal, Dau Dayal; Lambhod, Chanderkala; Singh, Divya

2014-01-01

Drosophila ananassae is a desiccation sensitive species, but the physiological basis of its abundance in the drier subtropical areas is largely unknown. We tested the hypothesis whether body color morphs of D. ananassae differ in the mechanistic basis of water conservation as well as desiccation acclimation potential, consistent with their distribution under dry or wet habitats. We observed reduced rate of water loss consistent with the greater desiccation potential of dark morph as compared with light morph, despite lack of quantitative differences in cuticular lipid mass between them. Dark morph evidenced greater wet and dry mass (∼1.17-fold) as well as higher hemolymph content (∼1.70-fold) and (∼17%) dehydration tolerance to sustain longer survival under desiccation stress (LT50 17.5 hr) as compared with light morph (LT50 4.3 hr). We found significant differences in the storage of energy metabolites in the body color morphs of D. ananassae, that is, carbohydrate content was significantly higher (∼0.18 mg/mg dry mass) in the dark morph as compared to light morph, but greater (∼0.05 mg/mg dry mass) body lipid content was evident in the light morph. Under desiccation stress, dark and light morphs utilized mainly carbohydrates but also lipids to a lesser extent. However, the rate of utilization of energy metabolites did not vary between dark and light morphs. Further, the dark morph consumed higher energy content derived from carbohydrates under desiccation stress as compared with the light morph. Finally, we found contrasting patterns of acclimation to desiccation stress in the two body color morphs, that is, increase in desiccation survival (4.7 hr), as well as in dehydration tolerance (∼6%) due to acclimation of the dark morph but no such effects were observed in the light morph. Thus, divergence in water balance mechanisms as well as acclimation potential reflects evolved physiological adaptations of the dark morph under drier but of the light morph to wet climatic conditions. © 2013 Wiley Periodicals, Inc.

Experimental evaluation of electrical conductivity imaging of anisotropic brain tissues using a combination of diffusion tensor imaging and magnetic resonance electrical impedance tomography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sajib, Saurav Z. K.; Jeong, Woo Chul; Oh, Tong In

Anisotropy of biological tissues is a low-frequency phenomenon that is associated with the function and structure of cell membranes. Imaging of anisotropic conductivity has potential for the analysis of interactions between electromagnetic fields and biological systems, such as the prediction of current pathways in electrical stimulation therapy. To improve application to the clinical environment, precise approaches are required to understand the exact responses inside the human body subjected to the stimulated currents. In this study, we experimentally evaluate the anisotropic conductivity tensor distribution of canine brain tissues, using a recently developed diffusion tensor-magnetic resonance electrical impedance tomography method. At lowmore » frequency, electrical conductivity of the biological tissues can be expressed as a product of the mobility and concentration of ions in the extracellular space. From diffusion tensor images of the brain, we can obtain directional information on diffusive movements of water molecules, which correspond to the mobility of ions. The position dependent scale factor, which provides information on ion concentration, was successfully calculated from the magnetic flux density, to obtain the equivalent conductivity tensor. By combining the information from both techniques, we can finally reconstruct the anisotropic conductivity tensor images of brain tissues. The reconstructed conductivity images better demonstrate the enhanced signal intensity in strongly anisotropic brain regions, compared with those resulting from previous methods using a global scale factor.« less

Contribution of cardiac-induced brain pulsation to the noise of the diffusion tensor in Turboprop diffusion tensor imaging (DTI).

PubMed

Gui, Minzhi; Tamhane, Ashish A; Arfanakis, Konstantinos

2008-05-01

To assess the effects of cardiac-induced brain pulsation on the noise of the diffusion tensor in Turboprop (a form of periodically rotated overlapping parallel lines with enhanced reconstruction [PROPELLER] imaging) diffusion tensor imaging (DTI). A total of six healthy human subjects were imaged with cardiac-gated as well as nongated Turboprop DTI. Gated and nongated Turboprop DTI datasets were also simulated using actual data acquired exclusively during the diastolic or systolic period of the cardiac cycle. The total variance of the diffusion tensor (TVDT) was measured and compared between acquisitions. The TVDT near the ventricles was significantly reduced in cardiac-gated compared to nongated Turboprop DTI acquisitions. Furthermore, the effects of brain pulsation were reduced, but not eliminated, when increasing the amount of data collected. Finally, data corrupted by cardiac-induced pulsation were not consistently detected by the step of the conventional Turboprop reconstruction algorithm that evaluates the quality of data in different blades. Thus, the inherent quality weighting of the conventional Turboprop reconstruction algorithm was unable to compensate for the increased noise in the diffusion tensor due to brain pulsation. Cardiac-induced brain pulsation increases the TVDT in Turboprop DTI. Use of cardiac gating to limit data acquisition to the diastolic period of the cardiac cycle reduces the TVDT at the expense of imaging time. (c) 2008 Wiley-Liss, Inc.

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Diffusion Tensor Magnetic Resonance Imaging Strategies for Color Mapping of Human Brain Anatomy

PubMed Central

Boujraf, Saïd

2018-01-01

Background: A color mapping of fiber tract orientation using diffusion tensor imaging (DTI) can be prominent in clinical practice. The goal of this paper is to perform a comparative study of visualized diffusion anisotropy in the human brain anatomical entities using three different color-mapping techniques based on diffusion-weighted imaging (DWI) and DTI. Methods: The first technique is based on calculating a color map from DWIs measured in three perpendicular directions. The second technique is based on eigenvalues derived from the diffusion tensor. The last technique is based on three eigenvectors corresponding to sorted eigenvalues derived from the diffusion tensor. All magnetic resonance imaging measurements were achieved using a 1.5 Tesla Siemens Vision whole body imaging system. A single-shot DW echoplanar imaging sequence used a Stejskal–Tanner approach. Trapezoidal diffusion gradients are used. The slice orientation was transverse. The basic measurement yielded a set of 13 images. Each series consists of a single image without diffusion weighting, besides two DWIs for each of the next six noncollinear magnetic field gradient directions. Results: The three types of color maps were calculated consequently using the DWI obtained and the DTI. Indeed, we established an excellent similarity between the image data in the color maps and the fiber directions of known anatomical structures (e.g., corpus callosum and gray matter). Conclusions: In the meantime, rotationally invariant quantities such as the eigenvectors of the diffusion tensor reflected better, the real orientation found in the studied tissue. PMID:29928631

On Adapting the Tensor Voting Framework to Robust Color Image Denoising

NASA Astrophysics Data System (ADS)

Moreno, Rodrigo; Garcia, Miguel Angel; Puig, Domenec; Julià, Carme

This paper presents an adaptation of the tensor voting framework for color image denoising, while preserving edges. Tensors are used in order to encode the CIELAB color channels, the uniformity and the edginess of image pixels. A specific voting process is proposed in order to propagate color from a pixel to its neighbors by considering the distance between pixels, the perceptual color difference (by using an optimized version of CIEDE2000), a uniformity measurement and the likelihood of the pixels being impulse noise. The original colors are corrected with those encoded by the tensors obtained after the voting process. Peak to noise ratios and visual inspection show that the proposed methodology has a better performance than state-of-the-art techniques.

Comparison of scalar measures used in magnetic resonance diffusion tensor imaging.

PubMed

Bahn, M M

1999-07-01

The tensors derived from diffusion tensor imaging describe complex diffusion in tissues. However, it is difficult to compare tensors directly or to produce images that contain all of the information of the tensor. Therefore, it is convenient to produce scalar measures that extract desired aspects of the tensor. These measures map the three-dimensional eigenvalues of the diffusion tensor into scalar values. The measures impose an order on eigenvalue space. Many invariant scalar measures have been introduced in the literature. In the present manuscript, a general approach for producing invariant scalar measures is introduced. Because it is often difficult to determine in clinical practice which of the many measures is best to apply to a given situation, two formalisms are introduced for the presentation, definition, and comparison of measures applied to eigenvalues: (1) normalized eigenvalue space, and (2) parametric eigenvalue transformation plots. All of the anisotropy information contained in the three eigenvalues can be retained and displayed in a two-dimensional plot, the normalized eigenvalue plot. An example is given of how to determine the best measure to use for a given situation by superimposing isometric contour lines from various anisotropy measures on plots of actual measured eigenvalue data points. Parametric eigenvalue transformation plots allow comparison of how different measures impose order on normalized eigenvalue space to determine whether the measures are equivalent and how the measures differ. These formalisms facilitate the comparison of scalar invariant measures for diffusion tensor imaging. Normalized eigenvalue space allows presentation of eigenvalue anisotropy information. Copyright 1999 Academic Press.

Diffusion tensor imaging, white matter lesions, the corpus callosum, and gait in the elderly

USDA-ARS?s Scientific Manuscript database

Gait impairment is common in the elderly, especially affected by stroke and white matter hyper intensities found in conventional brain magnetic resonance imaging (MRI). Diffusion tensor imaging (DTI) is more sensitive to white matter damage than conventional MRI. The relationship between DTI measure...

Sparse alignment for robust tensor learning.

PubMed

Lai, Zhihui; Wong, Wai Keung; Xu, Yong; Zhao, Cairong; Sun, Mingming

2014-10-01

Multilinear/tensor extensions of manifold learning based algorithms have been widely used in computer vision and pattern recognition. This paper first provides a systematic analysis of the multilinear extensions for the most popular methods by using alignment techniques, thereby obtaining a general tensor alignment framework. From this framework, it is easy to show that the manifold learning based tensor learning methods are intrinsically different from the alignment techniques. Based on the alignment framework, a robust tensor learning method called sparse tensor alignment (STA) is then proposed for unsupervised tensor feature extraction. Different from the existing tensor learning methods, L1- and L2-norms are introduced to enhance the robustness in the alignment step of the STA. The advantage of the proposed technique is that the difficulty in selecting the size of the local neighborhood can be avoided in the manifold learning based tensor feature extraction algorithms. Although STA is an unsupervised learning method, the sparsity encodes the discriminative information in the alignment step and provides the robustness of STA. Extensive experiments on the well-known image databases as well as action and hand gesture databases by encoding object images as tensors demonstrate that the proposed STA algorithm gives the most competitive performance when compared with the tensor-based unsupervised learning methods.

Gaussian mixtures on tensor fields for segmentation: applications to medical imaging.

PubMed

de Luis-García, Rodrigo; Westin, Carl-Fredrik; Alberola-López, Carlos

2011-01-01

In this paper, we introduce a new approach for tensor field segmentation based on the definition of mixtures of Gaussians on tensors as a statistical model. Working over the well-known Geodesic Active Regions segmentation framework, this scheme presents several interesting advantages. First, it yields a more flexible model than the use of a single Gaussian distribution, which enables the method to better adapt to the complexity of the data. Second, it can work directly on tensor-valued images or, through a parallel scheme that processes independently the intensity and the local structure tensor, on scalar textured images. Two different applications have been considered to show the suitability of the proposed method for medical imaging segmentation. First, we address DT-MRI segmentation on a dataset of 32 volumes, showing a successful segmentation of the corpus callosum and favourable comparisons with related approaches in the literature. Second, the segmentation of bones from hand radiographs is studied, and a complete automatic-semiautomatic approach has been developed that makes use of anatomical prior knowledge to produce accurate segmentation results. Copyright © 2010 Elsevier Ltd. All rights reserved.

Estimation of integral curves from high angular resolution diffusion imaging (HARDI) data.

PubMed

Carmichael, Owen; Sakhanenko, Lyudmila

2015-05-15

We develop statistical methodology for a popular brain imaging technique HARDI based on the high order tensor model by Özarslan and Mareci [10]. We investigate how uncertainty in the imaging procedure propagates through all levels of the model: signals, tensor fields, vector fields, and fibers. We construct asymptotically normal estimators of the integral curves or fibers which allow us to trace the fibers together with confidence ellipsoids. The procedure is computationally intense as it blends linear algebra concepts from high order tensors with asymptotical statistical analysis. The theoretical results are illustrated on simulated and real datasets. This work generalizes the statistical methodology proposed for low angular resolution diffusion tensor imaging by Carmichael and Sakhanenko [3], to several fibers per voxel. It is also a pioneering statistical work on tractography from HARDI data. It avoids all the typical limitations of the deterministic tractography methods and it delivers the same information as probabilistic tractography methods. Our method is computationally cheap and it provides well-founded mathematical and statistical framework where diverse functionals on fibers, directions and tensors can be studied in a systematic and rigorous way.

Estimation of integral curves from high angular resolution diffusion imaging (HARDI) data

PubMed Central

Carmichael, Owen; Sakhanenko, Lyudmila

2015-01-01

We develop statistical methodology for a popular brain imaging technique HARDI based on the high order tensor model by Özarslan and Mareci [10]. We investigate how uncertainty in the imaging procedure propagates through all levels of the model: signals, tensor fields, vector fields, and fibers. We construct asymptotically normal estimators of the integral curves or fibers which allow us to trace the fibers together with confidence ellipsoids. The procedure is computationally intense as it blends linear algebra concepts from high order tensors with asymptotical statistical analysis. The theoretical results are illustrated on simulated and real datasets. This work generalizes the statistical methodology proposed for low angular resolution diffusion tensor imaging by Carmichael and Sakhanenko [3], to several fibers per voxel. It is also a pioneering statistical work on tractography from HARDI data. It avoids all the typical limitations of the deterministic tractography methods and it delivers the same information as probabilistic tractography methods. Our method is computationally cheap and it provides well-founded mathematical and statistical framework where diverse functionals on fibers, directions and tensors can be studied in a systematic and rigorous way. PMID:25937674

Magnetic resonance neurography and diffusion tensor imaging: origins, history, and clinical impact of the first 50,000 cases with an assessment of efficacy and utility in a prospective 5000-patient study group.

PubMed

Filler, Aaron

2009-10-01

Methods were invented that made it possible to image peripheral nerves in the body and to image neural tracts in the brain. The history, physical basis, and dyadic tensor concept underlying the methods are reviewed. Over a 15-year period, these techniques-magnetic resonance neurography (MRN) and diffusion tensor imaging-were deployed in the clinical and research community in more than 2500 published research reports and applied to approximately 50,000 patients. Within this group, approximately 5000 patients having MRN were carefully tracked on a prospective basis. A uniform Neurography imaging methodology was applied in the study group, and all images were reviewed and registered by referral source, clinical indication, efficacy of imaging, and quality. Various classes of image findings were identified and subjected to a variety of small targeted prospective outcome studies. Those findings demonstrated to be clinically significant were then tracked in the larger clinical volume data set. MRN demonstrates mechanical distortion of nerves, hyperintensity consistent with nerve irritation, nerve swelling, discontinuity, relations of nerves to masses, and image features revealing distortion of nerves at entrapment points. These findings are often clinically relevant and warrant full consideration in the diagnostic process. They result in specific pathological diagnoses that are comparable to electrodiagnostic testing in clinical efficacy. A review of clinical outcome studies with diffusion tensor imaging also shows convincing utility. MRN and diffusion tensor imaging neural tract imaging have been validated as indispensable clinical diagnostic methods that provide reliable anatomic pathological information. There is no alternative diagnostic method in many situations. With the elapsing of 15 years, tens of thousands of imaging studies, and thousands of publications, these methods should no longer be considered experimental.

Pollinator visitation in populations of tristylous Eichhornia paniculata in northeastern Brazil.

PubMed

Husband, Brian C; Barrett, Spencer C H

1992-03-01

The frequencies of floral morphs in populations of tristylous Eichhornia paniculata often deviate from the theoretical expectation of equality. This variation is associated with the breakdown of tristyly and the evolution of self-fertilization. Differences in morph frequencies could result from selection pressures due to variable levels of insect visitation to populations and contrasting foraging behavior among the floral morphs. We estimated pollinator densities in 16 populations and quantified visitation sequences to morphs in five populations of E. paniculata in northeastern Brazil. Foraging behavior among floral morphs was measured as the frequency of visits to morphs relative to their frequency in the population (preference) and number of flights between inflorescences of the same versus different morphs (constancy). Pollinator density (number/m 2 /minute) was not correlated with population size, plant density or morph diversity. Pollinator densities varied most among populations of less than 200 plants. Whether pollinators discriminated among the morphs, depended on whether they primarily collected nectar or pollen. In four populations, nectar-feeding bees (Ancyloscelis and Florilegus spp.) and butterflies showed no consistent preference or constancy among the morphs. In contrast, pollen-collecting bees (Trigona sp.) visited a lower proportion of longstyled inflorescences than expected and tended to visit more mid-and short-styled inflorescences in succession, once they were encountered. Pollinator constancy for morphs did not result from differences in inflorescence production or spatial patchiness among the morphs. Although non-random pollinator visitation to morphs in heterostylous populations could potentially affect mating and hence morph frequencies, the observed visitation patterns in this study do not provide evidence that pollinators play a major role in influencing floral morph frequencies.

Mild hypothermia for treatment of diffuse axonal injury: a quantitative analysis of diffusion tensor imaging

PubMed Central

Jing, Guojie; Yao, Xiaoteng; Li, Yiyi; Xie, Yituan; Li, Wang#x2019;an; Liu, Kejun; Jing, Yingchao; Li, Baisheng; Lv, Yifan; Ma, Baoxin

2014-01-01

Fractional anisotropy values in diffusion tensor imaging can quantitatively reflect the consistency of nerve fibers after brain damage, where higher values generally indicate less damage to nerve fibers. Therefore, we hypothesized that diffusion tensor imaging could be used to evaluate the effect of mild hypothermia on diffuse axonal injury. A total of 102 patients with diffuse axonal injury were randomly divided into two groups: normothermic and mild hypothermic treatment groups. Patient's modified Rankin scale scores 2 months after mild hypothermia were significantly lower than those for the normothermia group. The difference in average fractional anisotropy value for each region of interest before and after mild hypothermia was 1.32-1.36 times higher than the value in the normothermia group. Quantitative assessment of diffusion tensor imaging indicates that mild hypothermia therapy may be beneficial for patients with diffuse axonal injury. PMID:25206800

Joint eigenvector estimation from mutually anisotropic tensors improves susceptibility tensor imaging of the brain, kidney, and heart.

PubMed

Dibb, Russell; Liu, Chunlei

2017-06-01

To develop a susceptibility-based MRI technique for probing microstructure and fiber architecture of magnetically anisotropic tissues-such as central nervous system white matter, renal tubules, and myocardial fibers-in three dimensions using susceptibility tensor imaging (STI) tools. STI can probe tissue microstructure, but is limited by reconstruction artifacts because of absent phase information outside the tissue and noise. STI accuracy may be improved by estimating a joint eigenvector from mutually anisotropic susceptibility and relaxation tensors. Gradient-recalled echo image data were simulated using a numerical phantom and acquired from the ex vivo mouse brain, kidney, and heart. Susceptibility tensor data were reconstructed using STI, regularized STI, and the proposed algorithm of mutually anisotropic and joint eigenvector STI (MAJESTI). Fiber map and tractography results from each technique were compared with diffusion tensor data. MAJESTI reduced the estimated susceptibility tensor orientation error by 30% in the phantom, 36% in brain white matter, 40% in the inner medulla of the kidney, and 45% in myocardium. This improved the continuity and consistency of susceptibility-based fiber tractography in each tissue. MAJESTI estimation of the susceptibility tensors yields lower orientation errors for susceptibility-based fiber mapping and tractography in the intact brain, kidney, and heart. Magn Reson Med 77:2331-2346, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

Longitudinal brain white matter alterations in minimal hepatic encephalopathy before and after liver transplantation.

PubMed

Lin, Wei-Che; Chou, Kun-Hsien; Chen, Chao-Long; Chen, Hsiu-Ling; Lu, Cheng-Hsien; Li, Shau-Hsuan; Huang, Chu-Chung; Lin, Ching-Po; Cheng, Yu-Fan

2014-01-01

Cerebral edema is the common pathogenic mechanism for cognitive impairment in minimal hepatic encephalopathy. Whether complete reversibility of brain edema, cognitive deficits, and their associated imaging can be achieved after liver transplantation remains an open question. To characterize white matter integrity before and after liver transplantation in patients with minimal hepatic encephalopathy, multiple diffusivity indices acquired via diffusion tensor imaging was applied. Twenty-eight patients and thirty age- and sex-matched healthy volunteers were included. Multiple diffusivity indices were obtained from diffusion tensor images, including mean diffusivity, fractional anisotropy, axial diffusivity and radial diffusivity. The assessment was repeated 6-12 month after transplantation. Differences in white matter integrity between groups, as well as longitudinal changes, were evaluated using tract-based spatial statistical analysis. Correlation analyses were performed to identify first scan before transplantation and interval changes among the neuropsychiatric tests, clinical laboratory tests, and diffusion tensor imaging indices. After transplantation, decreased water diffusivity without fractional anisotropy change indicating reversible cerebral edema was found in the left anterior cingulate, claustrum, postcentral gyrus, and right corpus callosum. However, a progressive decrease in fractional anisotropy and an increase in radial diffusivity suggesting demyelination were noted in temporal lobe. Improved pre-transplantation albumin levels and interval changes were associated with better recoveries of diffusion tensor imaging indices. Improvements in interval diffusion tensor imaging indices in the right postcentral gyrus were correlated with visuospatial function score correction. In conclusion, longitudinal voxel-wise analysis of multiple diffusion tensor imaging indices demonstrated different white matter changes in minimal hepatic encephalopathy patients. Transplantation improved extracellular cerebral edema and the results of associated cognition tests. However, white matter demyelination may advance in temporal lobe.

Detection experiments with humans implicate visual predation as a driver of colour polymorphism dynamics in pygmy grasshoppers

PubMed Central

2013-01-01

Background Animal colour patterns offer good model systems for studies of biodiversity and evolution of local adaptations. An increasingly popular approach to study the role of selection for camouflage for evolutionary trajectories of animal colour patterns is to present images of prey on paper or computer screens to human ‘predators’. Yet, few attempts have been made to confirm that rates of detection by humans can predict patterns of selection and evolutionary modifications of prey colour patterns in nature. In this study, we first analyzed encounters between human ‘predators’ and images of natural black, grey and striped colour morphs of the polymorphic Tetrix subulata pygmy grasshoppers presented on background images of unburnt, intermediate or completely burnt natural habitats. Next, we compared detection rates with estimates of capture probabilities and survival of free-ranging grasshoppers, and with estimates of relative morph frequencies in natural populations. Results The proportion of grasshoppers that were detected and time to detection depended on both the colour pattern of the prey and on the type of visual background. Grasshoppers were detected more often and faster on unburnt backgrounds than on 50% and 100% burnt backgrounds. Striped prey were detected less often than grey or black prey on unburnt backgrounds; grey prey were detected more often than black or striped prey on 50% burnt backgrounds; and black prey were detected less often than grey prey on 100% burnt backgrounds. Rates of detection mirrored previously reported rates of capture by humans of free-ranging grasshoppers, as well as morph specific survival in the wild. Rates of detection were also correlated with frequencies of striped, black and grey morphs in samples of T. subulata from natural populations that occupied the three habitat types used for the detection experiment. Conclusions Our findings demonstrate that crypsis is background-dependent, and implicate visual predation as an important driver of evolutionary modifications of colour polymorphism in pygmy grasshoppers. Our study provides the clearest evidence to date that using humans as ‘predators’ in detection experiments may provide reliable information on the protective values of prey colour patterns and of natural selection and microevolution of camouflage in the wild. PMID:23639215

Geodesic-loxodromes for diffusion tensor interpolation and difference measurement.

PubMed

Kindlmann, Gordon; Estépar, Raúl San José; Niethammer, Marc; Haker, Steven; Westin, Carl-Fredrik

2007-01-01

In algorithms for processing diffusion tensor images, two common ingredients are interpolating tensors, and measuring the distance between them. We propose a new class of interpolation paths for tensors, termed geodesic-loxodromes, which explicitly preserve clinically important tensor attributes, such as mean diffusivity or fractional anisotropy, while using basic differential geometry to interpolate tensor orientation. This contrasts with previous Riemannian and Log-Euclidean methods that preserve the determinant. Path integrals of tangents of geodesic-loxodromes generate novel measures of over-all difference between two tensors, and of difference in shape and in orientation.

Traumatic Brain Injury Diffusion Magnetic Resonance Imaging Research Roadmap Development Project

DTIC Science & Technology

2011-10-01

promising technology on the horizon is the Diffusion Tensor Imaging ( DTI ). Diffusion tensor imaging ( DTI ) is a magnetic resonance imaging (MRI)-based...in the brain. The potential for DTI to improve our understanding of TBI has not been fully explored and challenges associated with non-existent...processing tools, quality control standards, and a shared image repository. The recommendations will be disseminated and pilot tested. A DTI of TBI

Diffusion Tensor Imaging Correlates of Reading Ability in Dysfluent and Non-Impaired Readers

ERIC Educational Resources Information Center

Lebel, Catherine; Shaywitz, Bennett; Holahan, John; Shaywitz, Sally; Marchione, Karen; Beaulieu, Christian

2013-01-01

Many children and adults have specific reading disabilities; insight into the brain structure underlying these difficulties is evolving from imaging. Previous research highlights the left temporal-parietal white matter as important in reading, yet the degree of involvement of other areas remains unclear. Diffusion tensor imaging (DTI) and…

Morphological divergence between three Arctic charr morphs - the significance of the deep-water environment.

PubMed

Skoglund, Sigrid; Siwertsson, Anna; Amundsen, Per-Arne; Knudsen, Rune

2015-08-01

Morphological divergence was evident among three sympatric morphs of Arctic charr (Salvelinus alpinus (L.)) that are ecologically diverged along the shallow-, deep-water resource axis in a subarctic postglacial lake (Norway). The two deep-water (profundal) spawning morphs, a benthivore (PB-morph) and a piscivore (PP-morph), have evolved under identical abiotic conditions with constant low light and temperature levels in their deep-water habitat, and were morphologically most similar. However, they differed in important head traits (e.g., eye and mouth size) related to their different diet specializations. The small-sized PB-morph had a paedomorphic appearance with a blunt head shape, large eyes, and a deep body shape adapted to their profundal lifestyle feeding on submerged benthos from soft, deep-water sediments. The PP-morph had a robust head, large mouth with numerous teeth, and an elongated body shape strongly related to their piscivorous behavior. The littoral spawning omnivore morph (LO-morph) predominantly utilizes the shallow benthic-pelagic habitat and food resources. Compared to the deep-water morphs, the LO-morph had smaller head relative to body size. The LO-morph exhibited traits typical for both shallow-water benthic feeding (e.g., large body depths and small eyes) and planktivorous feeding in the pelagic habitat (e.g., streamlined body shape and small mouth). The development of morphological differences within the same deep-water habitat for the PB- and PP-morphs highlights the potential of biotic factors and ecological interactions to promote further divergence in the evolution of polymorphism in a tentative incipient speciation process. The diversity of deep-water charr in this study represents a novelty in the Arctic charr polymorphism as a truly deep-water piscivore morph has to our knowledge not been described elsewhere.

Motion immune diffusion imaging using augmented MUSE (AMUSE) for high-resolution multi-shot EPI

PubMed Central

Guhaniyogi, Shayan; Chu, Mei-Lan; Chang, Hing-Chiu; Song, Allen W.; Chen, Nan-kuei

2015-01-01

Purpose To develop new techniques for reducing the effects of microscopic and macroscopic patient motion in diffusion imaging acquired with high-resolution multi-shot EPI. Theory The previously reported Multiplexed Sensitivity Encoding (MUSE) algorithm is extended to account for macroscopic pixel misregistrations as well as motion-induced phase errors in a technique called Augmented MUSE (AMUSE). Furthermore, to obtain more accurate quantitative DTI measures in the presence of subject motion, we also account for the altered diffusion encoding among shots arising from macroscopic motion. Methods MUSE and AMUSE were evaluated on simulated and in vivo motion-corrupted multi-shot diffusion data. Evaluations were made both on the resulting imaging quality and estimated diffusion tensor metrics. Results AMUSE was found to reduce image blurring resulting from macroscopic subject motion compared to MUSE, but yielded inaccurate tensor estimations when neglecting the altered diffusion encoding. Including the altered diffusion encoding in AMUSE produced better estimations of diffusion tensors. Conclusion The use of AMUSE allows for improved image quality and diffusion tensor accuracy in the presence of macroscopic subject motion during multi-shot diffusion imaging. These techniques should facilitate future high-resolution diffusion imaging. PMID:25762216

Tensor voting for image correction by global and local intensity alignment.

PubMed

Jia, Jiaya; Tang, Chi-Keung

2005-01-01

This paper presents a voting method to perform image correction by global and local intensity alignment. The key to our modeless approach is the estimation of global and local replacement functions by reducing the complex estimation problem to the robust 2D tensor voting in the corresponding voting spaces. No complicated model for replacement function (curve) is assumed. Subject to the monotonic constraint only, we vote for an optimal replacement function by propagating the curve smoothness constraint using a dense tensor field. Our method effectively infers missing curve segments and rejects image outliers. Applications using our tensor voting approach are proposed and described. The first application consists of image mosaicking of static scenes, where the voted replacement functions are used in our iterative registration algorithm for computing the best warping matrix. In the presence of occlusion, our replacement function can be employed to construct a visually acceptable mosaic by detecting occlusion which has large and piecewise constant color. Furthermore, by the simultaneous consideration of color matches and spatial constraints in the voting space, we perform image intensity compensation and high contrast image correction using our voting framework, when only two defective input images are given.

Development of a Human Brain Diffusion Tensor Template

PubMed Central

Peng, Huiling; Orlichenko, Anton; Dawe, Robert J.; Agam, Gady; Zhang, Shengwei; Arfanakis, Konstantinos

2009-01-01

The development of a brain template for diffusion tensor imaging (DTI) is crucial for comparisons of neuronal structural integrity and brain connectivity across populations, as well as for the development of a white matter atlas. Previous efforts to produce a DTI brain template have been compromised by factors related to image quality, the effectiveness of the image registration approach, the appropriateness of subject inclusion criteria, the completeness and accuracy of the information summarized in the final template. The purpose of this work was to develop a DTI human brain template using techniques that address the shortcomings of previous efforts. Therefore, data containing minimal artifacts were first obtained on 67 healthy human subjects selected from an age-group with relatively similar diffusion characteristics (20–40 years of age), using an appropriate DTI acquisition protocol. Non-linear image registration based on mean diffusion-weighted and fractional anisotropy images was employed. DTI brain templates containing median and mean tensors were produced in ICBM-152 space and made publicly available. The resulting set of DTI templates is characterized by higher image sharpness, provides the ability to distinguish smaller white matter fiber structures, contains fewer image artifacts, than previously developed templates, and to our knowledge, is one of only two templates produced based on a relatively large number of subjects. Furthermore, median tensors were shown to better preserve the diffusion characteristics at the group level than mean tensors. Finally, white matter fiber tractography was applied on the template and several fiber-bundles were traced. PMID:19341801

Development of a human brain diffusion tensor template.

PubMed

Peng, Huiling; Orlichenko, Anton; Dawe, Robert J; Agam, Gady; Zhang, Shengwei; Arfanakis, Konstantinos

2009-07-15

The development of a brain template for diffusion tensor imaging (DTI) is crucial for comparisons of neuronal structural integrity and brain connectivity across populations, as well as for the development of a white matter atlas. Previous efforts to produce a DTI brain template have been compromised by factors related to image quality, the effectiveness of the image registration approach, the appropriateness of subject inclusion criteria, and the completeness and accuracy of the information summarized in the final template. The purpose of this work was to develop a DTI human brain template using techniques that address the shortcomings of previous efforts. Therefore, data containing minimal artifacts were first obtained on 67 healthy human subjects selected from an age-group with relatively similar diffusion characteristics (20-40 years of age), using an appropriate DTI acquisition protocol. Non-linear image registration based on mean diffusion-weighted and fractional anisotropy images was employed. DTI brain templates containing median and mean tensors were produced in ICBM-152 space and made publicly available. The resulting set of DTI templates is characterized by higher image sharpness, provides the ability to distinguish smaller white matter fiber structures, contains fewer image artifacts, than previously developed templates, and to our knowledge, is one of only two templates produced based on a relatively large number of subjects. Furthermore, median tensors were shown to better preserve the diffusion characteristics at the group level than mean tensors. Finally, white matter fiber tractography was applied on the template and several fiber-bundles were traced.

Diffusion Tensor Imaging: Application to the Study of the Developing Brain

ERIC Educational Resources Information Center

Cascio, Carissa J.; Gerig, Guido; Piven, Joseph

2007-01-01

Objective: To provide an overview of diffusion tensor imaging (DTI) and its application to the study of white matter in the developing brain in both healthy and clinical samples. Method: The development of DTI and its application to brain imaging of white matter tracts is discussed. Forty-eight studies using DTI to examine diffusion properties of…

Morphing Wings: A Study Using High-Fidelity Aerodynamic Shape Optimization

NASA Astrophysics Data System (ADS)

Curiale, Nathanael J.

With the aviation industry under pressure to reduce fuel consumption, morphing wings have the capacity to improve aircraft performance, thereby making a significant contribution to reversing climate change. Through high-fidelity aerodynamic shape optimization, various forms of morphing wings are assessed for a hypothetical regional-class aircraft. The framework used solves the Reynolds-averaged Navier-Stokes equations and utilizes a gradient-based optimization algorithm. Baseline geometries are developed through multipoint optimization, where the average drag coefficient is minimized over a range of flight conditions with additional dive constraints. Morphing optimizations are then performed, beginning with these baseline shapes. Five distinct types of morphing are investigated and compared. Overall, a theoretical fully adaptable wing produces roughly a 2% improvement in average performance, whereas trailing-edge morphing with a 27-point multipoint baseline results in just over a 1% improvement in average performance. Trailing-edge morphing proves to be more beneficial than leading-edge morphing, upper-surface morphing, and a conventional flap.

Spatial Mapping of Translational Diffusion Coefficients Using Diffusion Tensor Imaging: A Mathematical Description

PubMed Central

SHETTY, ANIL N.; CHIANG, SHARON; MALETIC-SAVATIC, MIRJANA; KASPRIAN, GREGOR; VANNUCCI, MARINA; LEE, WESLEY

2016-01-01

In this article, we discuss the theoretical background for diffusion weighted imaging and diffusion tensor imaging. Molecular diffusion is a random process involving thermal Brownian motion. In biological tissues, the underlying microstructures restrict the diffusion of water molecules, making diffusion directionally dependent. Water diffusion in tissue is mathematically characterized by the diffusion tensor, the elements of which contain information about the magnitude and direction of diffusion and is a function of the coordinate system. Thus, it is possible to generate contrast in tissue based primarily on diffusion effects. Expressing diffusion in terms of the measured diffusion coefficient (eigenvalue) in any one direction can lead to errors. Nowhere is this more evident than in white matter, due to the preferential orientation of myelin fibers. The directional dependency is removed by diagonalization of the diffusion tensor, which then yields a set of three eigenvalues and eigenvectors, representing the magnitude and direction of the three orthogonal axes of the diffusion ellipsoid, respectively. For example, the eigenvalue corresponding to the eigenvector along the long axis of the fiber corresponds qualitatively to diffusion with least restriction. Determination of the principal values of the diffusion tensor and various anisotropic indices provides structural information. We review the use of diffusion measurements using the modified Stejskal–Tanner diffusion equation. The anisotropy is analyzed by decomposing the diffusion tensor based on symmetrical properties describing the geometry of diffusion tensor. We further describe diffusion tensor properties in visualizing fiber tract organization of the human brain. PMID:27441031

Contour-based image warping

NASA Astrophysics Data System (ADS)

Chan, Kwai H.; Lau, Rynson W.

1996-09-01

Image warping concerns about transforming an image from one spatial coordinate to another. It is widely used for the vidual effect of deforming and morphing images in the film industry. A number of warping techniques have been introduced, which are mainly based on the corresponding pair mapping of feature points, feature vectors or feature patches (mostly triangular or quadrilateral). However, very often warping of an image object with an arbitrary shape is required. This requires a warping technique which is based on boundary contour instead of feature points or feature line-vectors. In addition, when feature point or feature vector based techniques are used, approximation of the object boundary by using point or vectors is required. In this case, the matching process of the corresponding pairs will be very time consuming if a fine approximation is required. In this paper, we propose a contour-based warping technique for warping image objects with arbitrary shapes. The novel idea of the new method is the introduction of mathematical morphology to allow a more flexible control of image warping. Two morphological operators are used as contour determinators. The erosion operator is used to warp image contents which are inside a user specified contour while the dilation operation is used to warp image contents which are outside of the contour. This new method is proposed to assist further development of a semi-automatic motion morphing system when accompanied with robust feature extractors such as deformable template or active contour model.

Separation of specular and diffuse components using tensor voting in color images.

PubMed

Nguyen, Tam; Vo, Quang Nhat; Yang, Hyung-Jeong; Kim, Soo-Hyung; Lee, Guee-Sang

2014-11-20

Most methods for the detection and removal of specular reflections suffer from nonuniform highlight regions and/or nonconverged artifacts induced by discontinuities in the surface colors, especially when dealing with highly textured, multicolored images. In this paper, a novel noniterative and predefined constraint-free method based on tensor voting is proposed to detect and remove the highlight components of a single color image. The distribution of diffuse and specular pixels in the original image is determined using tensors' saliency analysis, instead of comparing color information among neighbor pixels. The achieved diffuse reflectance distribution is used to remove specularity components. The proposed method is evaluated quantitatively and qualitatively over a dataset of highly textured, multicolor images. The experimental results show that our result outperforms other state-of-the-art techniques.

A bio-inspired, active morphing skin for camber morphing structures

NASA Astrophysics Data System (ADS)

Feng, Ning; Liu, Liwu; Liu, Yanju; Leng, Jinson

2015-03-01

In this study, one kind of developed morphing skin embedded with pneumatic muscle fibers (PMFs) was manufactured and was employed for camber morphing structures. The output force and contraction of PMF as well as the morphing skin were experimentally characterized at a series of discrete actuator pressures varying from 0.15 to 0.35 MPa. The active morphing skin test results show that the output force is 73.59 N and the contraction is 0.097 (9.7%) at 0.35 MPa. Due to these properties, this active morphing skin could be easily used for the morphing structures. Then the proper airfoil profile was chosen to manufacture the adaptive airfoil in this study. The chord-wise bending airfoil structure was achieved by employing this kind of active morphing skin. Finally the deformed shapes of this chord-wise bending airfoil structure were obtained by 3-dimensions scanning measurement. Meanwhile the camber morphing structures were analyzed through the finite element method (FEM) and the deformed shapes of the upper surface skins were obtained. The experimental result and FEM analysis result of deformed shapes of the upper surface skins were compared in this paper.

Evolutionary relationships among sympatric life history forms of Dolly Varden inhabiting the landlocked Kronotsky Lake, Kamchatka, and a neighboring anadromous population

USGS Publications Warehouse

Ostberg, C.O.; Pavlov, S.D.; Hauser, L.

2009-01-01

We investigated the evolutionary relationships among five sympatric morphs of Dolly Varden Salvelinus malma (white, Schmidti, longhead, river, and dwarf) inhabiting landlocked Kronotsky Lake on the Kamchatka Peninsula, Russia, and an anadromous population below the barrier waterfall on the outflowing Kronotsky River. Morphological analyses indicated phenotypic differentiation corresponding to preferred habitat, the longhead (a limnetic piscivorous morph) having a fusiform body, long jaw, and short fins and the Schmidti (a benthic morph) having a robust body, small jaw, and long fins. Analysis of molecular variance among the Kronotsky Lake morphs indicated that contemporary gene flow is restricted both among morphs within locations and among locations within morphs. Gene flow from Kronotsky Lake into the anadromous population also appears to be restricted. Our findings indicate that there are two divergent evolutionary lineages, one consisting of the white, Schmidti, river, and dwarf morphs and the other of the longhead morph and the anadromous population, which suggests that Kronotsky Lake was subject to separate waves of immigration. The Kronotsky Lake Dolly Varden morphs may represent an example of ecological speciation in progress, and we present a working hypothesis for the diversification of morphs within Kronotsky Lake.

Autism Spectrum Disorder: Does Neuroimaging Support the DSM-5 Proposal for a Symptom Dyad? A Systematic Review of Functional Magnetic Resonance Imaging and Diffusion Tensor Imaging Studies

ERIC Educational Resources Information Center

Pina-Camacho, Laura; Villero, Sonia; Fraguas, David; Boada, Leticia; Janssen, Joost; Navas-Sanchez, Francisco J.; Mayoral, Maria; Llorente, Cloe; Arango, Celso; Parellada, Mara

2012-01-01

A systematic review of 208 studies comprising functional magnetic resonance imaging and diffusion tensor imaging data in patients with "autism spectrum disorder" (ASD) was conducted, in order to determine whether these data support the forthcoming DSM-5 proposal of a social communication and behavioral symptom dyad. Studies consistently reported…

Camouflage effects of various colour-marking morphs against different microhabitat backgrounds in a polymorphic pygmy grasshopper Tetrix japonica.

PubMed

Tsurui, Kaori; Honma, Atsushi; Nishida, Takayoshi

2010-07-06

Colour-marking polymorphism is widely distributed among cryptic species. To account for the adaptive significance of such polymorphisms, several hypotheses have been proposed to date. Although these hypotheses argue over the degree of camouflage effects of marking morphs (and the interactions between morphs and their microhabitat backgrounds), as far as we know, most empirical evidence has been provided under unnatural conditions (i.e., using artificial prey). Tetrix japonica, a pygmy grasshopper, is highly polymorphic in colour-markings and occurs in both sand and grass microhabitats. Even within a microhabitat, T. japonica is highly polymorphic. Using humans as dummy predators and printed photographs in which various morphs of grasshoppers were placed against different backgrounds, we addressed three questions to test the neutral, background heterogeneity, and differential crypsis hypotheses in four marking-type morphs: 1) do the morphs differ in the degree of crypsis in each microhabitat, 2) are different morphs most cryptic in specific backgrounds of the microhabitats, and 3) does the morph frequency reflect the degree of crypsis? The degree of camouflage differed among the four morphs; therefore, the neutral hypothesis was rejected. Furthermore, the order of camouflage advantage among morphs differed depending on the two types of backgrounds (sand and grass), although the grass background consistently provided greater camouflage effects. Thus, based on our results, we could not reject the background heterogeneity hypothesis. Under field conditions, the more cryptic morphs comprised a minority of the population. Overall, our results demonstrate that the different morphs were not equivalent in the degree of crypsis, but the degree of camouflage of the morphs was not consistent with the morph frequency. These findings suggest that trade-offs exist between the camouflage benefit of body colouration and other fitness components, providing a better understanding of the adaptive significance of colour-markings and presumably supporting the differential crypsis hypothesis.

Comparative study of methods for recognition of an unknown person's action from a video sequence

NASA Astrophysics Data System (ADS)

Hori, Takayuki; Ohya, Jun; Kurumisawa, Jun

2009-02-01

This paper proposes a Tensor Decomposition Based method that can recognize an unknown person's action from a video sequence, where the unknown person is not included in the database (tensor) used for the recognition. The tensor consists of persons, actions and time-series image features. For the observed unknown person's action, one of the actions stored in the tensor is assumed. Using the motion signature obtained from the assumption, the unknown person's actions are synthesized. The actions of one of the persons in the tensor are replaced by the synthesized actions. Then, the core tensor for the replaced tensor is computed. This process is repeated for the actions and persons. For each iteration, the difference between the replaced and original core tensors is computed. The assumption that gives the minimal difference is the action recognition result. For the time-series image features to be stored in the tensor and to be extracted from the observed video sequence, the human body silhouette's contour shape based feature is used. To show the validity of our proposed method, our proposed method is experimentally compared with Nearest Neighbor rule and Principal Component analysis based method. Experiments using 33 persons' seven kinds of action show that our proposed method achieves better recognition accuracies for the seven actions than the other methods.

Tensor Rank Preserving Discriminant Analysis for Facial Recognition.

PubMed

Tao, Dapeng; Guo, Yanan; Li, Yaotang; Gao, Xinbo

2017-10-12

Facial recognition, one of the basic topics in computer vision and pattern recognition, has received substantial attention in recent years. However, for those traditional facial recognition algorithms, the facial images are reshaped to a long vector, thereby losing part of the original spatial constraints of each pixel. In this paper, a new tensor-based feature extraction algorithm termed tensor rank preserving discriminant analysis (TRPDA) for facial image recognition is proposed; the proposed method involves two stages: in the first stage, the low-dimensional tensor subspace of the original input tensor samples was obtained; in the second stage, discriminative locality alignment was utilized to obtain the ultimate vector feature representation for subsequent facial recognition. On the one hand, the proposed TRPDA algorithm fully utilizes the natural structure of the input samples, and it applies an optimization criterion that can directly handle the tensor spectral analysis problem, thereby decreasing the computation cost compared those traditional tensor-based feature selection algorithms. On the other hand, the proposed TRPDA algorithm extracts feature by finding a tensor subspace that preserves most of the rank order information of the intra-class input samples. Experiments on the three facial databases are performed here to determine the effectiveness of the proposed TRPDA algorithm.

Ball-morph: definition, implementation, and comparative evaluation.

PubMed

Whited, Brian; Rossignac, Jaroslaw Jarek

2011-06-01

We define b-compatibility for planar curves and propose three ball morphing techniques between pairs of b-compatible curves. Ball-morphs use the automatic ball-map correspondence, proposed by Chazal et al., from which we derive different vertex trajectories (linear, circular, and parabolic). All three morphs are symmetric, meeting both curves with the same angle, which is a right angle for the circular and parabolic. We provide simple constructions for these ball-morphs and compare them to each other and other simple morphs (linear-interpolation, closest-projection, curvature-interpolation, Laplace-blending, and heat-propagation) using six cost measures (travel-distance, distortion, stretch, local acceleration, average squared mean curvature, and maximum squared mean curvature). The results depend heavily on the input curves. Nevertheless, we found that the linear ball-morph has consistently the shortest travel-distance and the circular ball-morph has the least amount of distortion.

An introduction to diffusion tensor image analysis.

PubMed

O'Donnell, Lauren J; Westin, Carl-Fredrik

2011-04-01

Diffusion tensor magnetic resonance imaging (DTI) is a relatively new technology that is popular for imaging the white matter of the brain. This article provides a basic and broad overview of DTI to enable the reader to develop an intuitive understanding of these types of data, and an awareness of their strengths and weaknesses. Copyright © 2011 Elsevier Inc. All rights reserved.

Use of diffusion tensor imaging to identify similarities and differences between cerebellar and Parkinsonism forms of multiple system atrophy.

PubMed

Wang, Po-Shan; Wu, Hsiu-Mei; Lin, Ching-Po; Soong, Bing-Wen

2011-07-01

We performed diffusion tensor imaging to determine if multiple system atrophy (MSA)-cerebellar (C) and MSA-Parkinsonism (P) show similar changes, as shown in pathological studies. Nineteen patients with MSA-C, 12 patients with MSA-P, 20 patients with Parkinson disease, and 20 healthy controls were evaluated with the use of voxel-based morphometry analysis of diffusion tensor imaging. There was an increase in apparent diffusion coefficient values in the middle cerebellar peduncles and cerebellum and a decrease in fractional anisotropy in the pyramidal tract, middle cerebellar peduncles, and white matter of the cerebellum in patients with MSA-C and MSA-P compared to the controls (P < 0.001). In addition, isotropic diffusion-weighted image values were reduced in the cerebellar cortex and deep cerebellar nuclei in patients with MSA-C and increased in the basal ganglia in patients with MSA-P. These results indicate that despite their disparate clinical manifestations, patients with MSA-C and MSA-P share similar diffusion tensor imaging features in the infratentorial region. Further, the combination of FA, ADC and iDWI images can be used to distinguish between MSA (either form) and Parkinson disease, which has potential therapeutic implications.

MR Diffusion Tensor Imaging: A Window into White Matter Integrity of the Working Brain

PubMed Central

Chanraud, Sandra; Zahr, Natalie; Pfefferbaum, Adolf

2010-01-01

As Norman Geschwind asserted in 1965, syndromes resulting from white matter lesions could produce deficits in higher-order functions and “disconnexion” or the interruption of connection between gray matter regions could be as disruptive as trauma to those regions per se. The advent of in vivo diffusion tensor imaging, which allows quantitative characterization of white matter fiber integrity in health and disease, has served to strengthen Geschwind's proposal. Here we present an overview of the principles of diffusion tensor imaging (DTI) and its contribution to progress in our current understanding of normal and pathological brain function. PMID:20422451

Differential foraging success across a light level spectrum explains the maintenance and spatial structure of colour morphs in a polymorphic bird.

PubMed

Tate, Gareth J; Bishop, Jacqueline M; Amar, Arjun

2016-06-01

Detectability of different colour morphs under varying light conditions has been proposed as an important driver in the maintenance of colour polymorphism via disruptive selection. To date, no studies have tested whether different morphs have selective advantages under differing light conditions. We tested this hypothesis in the black sparrowhawk, a polymorphic raptor exhibiting a discrete white and dark morph, and found that prey provisioning rates differ between the morphs depending on light condition. Dark morphs delivered more prey in lower light conditions, while white morphs provided more prey in brighter conditions. We found support for the role of breeding season light level in explaining the clinal pattern of variation in morph ratio across the species range throughout South Africa. Our results provide the first empirical evidence supporting the hypothesis that polymorphism in a species, and the spatial structuring of morphs across its distribution, may be driven by differential selective advantage via improved crypsis, under varying light conditions. © 2016 John Wiley & Sons Ltd/CNRS.

Morphing Wing Weight Predictors and Their Application in a Template-Based Morphing Aircraft Sizing Environment II. Part 2; Morphing Aircraft Sizing via Multi-level Optimization

NASA Technical Reports Server (NTRS)

Skillen, Michael D.; Crossley, William A.

2008-01-01

This report presents an approach for sizing of a morphing aircraft based upon a multi-level design optimization approach. For this effort, a morphing wing is one whose planform can make significant shape changes in flight - increasing wing area by 50% or more from the lowest possible area, changing sweep 30 or more, and/or increasing aspect ratio by as much as 200% from the lowest possible value. The top-level optimization problem seeks to minimize the gross weight of the aircraft by determining a set of "baseline" variables - these are common aircraft sizing variables, along with a set of "morphing limit" variables - these describe the maximum shape change for a particular morphing strategy. The sub-level optimization problems represent each segment in the morphing aircraft's design mission; here, each sub-level optimizer minimizes fuel consumed during each mission segment by changing the wing planform within the bounds set by the baseline and morphing limit variables from the top-level problem.

Time-Optimized High-Resolution Readout-Segmented Diffusion Tensor Imaging

PubMed Central

Reishofer, Gernot; Koschutnig, Karl; Langkammer, Christian; Porter, David; Jehna, Margit; Enzinger, Christian; Keeling, Stephen; Ebner, Franz

2013-01-01

Readout-segmented echo planar imaging with 2D navigator-based reacquisition is an uprising technique enabling the sampling of high-resolution diffusion images with reduced susceptibility artifacts. However, low signal from the small voxels and long scan times hamper the clinical applicability. Therefore, we introduce a regularization algorithm based on total variation that is applied directly on the entire diffusion tensor. The spatially varying regularization parameter is determined automatically dependent on spatial variations in signal-to-noise ratio thus, avoiding over- or under-regularization. Information about the noise distribution in the diffusion tensor is extracted from the diffusion weighted images by means of complex independent component analysis. Moreover, the combination of those features enables processing of the diffusion data absolutely user independent. Tractography from in vivo data and from a software phantom demonstrate the advantage of the spatially varying regularization compared to un-regularized data with respect to parameters relevant for fiber-tracking such as Mean Fiber Length, Track Count, Volume and Voxel Count. Specifically, for in vivo data findings suggest that tractography results from the regularized diffusion tensor based on one measurement (16 min) generates results comparable to the un-regularized data with three averages (48 min). This significant reduction in scan time renders high resolution (1×1×2.5 mm3) diffusion tensor imaging of the entire brain applicable in a clinical context. PMID:24019951

Advances in magnetic resonance neuroimaging techniques in the evaluation of neonatal encephalopathy.

PubMed

Panigrahy, Ashok; Blüml, Stefan

2007-02-01

Magnetic resonance (MR) imaging has become an essential tool in the evaluation of neonatal encephalopathy. Magnetic resonance-compatible neonatal incubators allow sick neonates to be transported to the MR scanner, and neonatal head coils can improve signal-to-noise ratio, critical for advanced MR imaging techniques. Refinement of conventional imaging techniques include the use of PROPELLER techniques for motion correction. Magnetic resonance spectroscopic imaging and diffusion tensor imaging provide quantitative assessment of both brain development and brain injury in the newborn with respect to metabolite abnormalities and hypoxic-ischemic injury. Knowledge of normal developmental changes in MR spectroscopy metabolite concentration and diffusion tensor metrics is essential to interpret pathological cases. Perfusion MR and functional MR can provide additional physiological information. Both MR spectroscopy and diffusion tensor imaging can provide additional information in the differential of neonatal encephalopathy, including perinatal white matter injury, hypoxic-ischemic brain injury, metabolic disease, infection, and birth injury.

On the road to invariant recognition: explaining tradeoff and morph properties of cells in inferotemporal cortex using multiple-scale task-sensitive attentive learning.

PubMed

Grossberg, Stephen; Markowitz, Jeffrey; Cao, Yongqiang

2011-12-01

Visual object recognition is an essential accomplishment of advanced brains. Object recognition needs to be tolerant, or invariant, with respect to changes in object position, size, and view. In monkeys and humans, a key area for recognition is the anterior inferotemporal cortex (ITa). Recent neurophysiological data show that ITa cells with high object selectivity often have low position tolerance. We propose a neural model whose cells learn to simulate this tradeoff, as well as ITa responses to image morphs, while explaining how invariant recognition properties may arise in stages due to processes across multiple cortical areas. These processes include the cortical magnification factor, multiple receptive field sizes, and top-down attentive matching and learning properties that may be tuned by task requirements to attend to either concrete or abstract visual features with different levels of vigilance. The model predicts that data from the tradeoff and image morph tasks emerge from different levels of vigilance in the animals performing them. This result illustrates how different vigilance requirements of a task may change the course of category learning, notably the critical features that are attended and incorporated into learned category prototypes. The model outlines a path for developing an animal model of how defective vigilance control can lead to symptoms of various mental disorders, such as autism and amnesia. Copyright © 2011 Elsevier Ltd. All rights reserved.

Water temperature, not fish morph, determines parasite infections of sympatric Icelandic threespine sticklebacks (Gasterosteus aculeatus).

PubMed

Karvonen, Anssi; Kristjánsson, Bjarni K; Skúlason, Skúli; Lanki, Maiju; Rellstab, Christian; Jokela, Jukka

2013-06-01

Parasite communities of fishes are known to respond directly to the abiotic environment of the host, for example, to water quality and water temperature. Biotic factors are also important as they affect the exposure profile through heterogeneities in parasite distribution in the environment. Parasites in a particular environment may pose a strong selection on fish. For example, ecological differences in selection by parasites have been hypothesized to facilitate evolutionary differentiation of freshwater fish morphs specializing on different food types. However, as parasites may also respond directly to abiotic environment the parasite risk does not depend only on biotic features of the host environment. It is possible that different morphs experience specific selection gradients by parasites but it is not clear how consistent the selection is when abiotic factors change. We examined parasite pressure in sympatric morphs of threespine stickleback (Gasterosteus aculeatus) across a temperature gradient in two large Icelandic lakes, Myvatn and Thingvallavatn. Habitat-specific temperature gradients in these lakes are opposite. Myvatn lava rock morph lives in a warm environment, while the mud morph lives in the cold. In Thingvallavatn, the lava rock morph lives in a cold environment and the mud morph in a warm habitat. We found more parasites in fish living in higher temperature in both lakes, independent of the fish morph, and this pattern was similar for the two dominating parasite taxa, trematodes and cestodes. However, at the same time, we also found higher parasite abundance in a third morph living in deep cold-water habitat in Thingvallavatn compared to the cold-water lava morph, indicating strong effect of habitat-specific biotic factors. Our results suggest complex interactions between water temperature and biotic factors in determining the parasite community structure, a pattern that may have implications for differentiation of stickleback morphs.

Methodological improvements in voxel-based analysis of diffusion tensor images: applications to study the impact of apolipoprotein E on white matter integrity.

PubMed

Newlander, Shawn M; Chu, Alan; Sinha, Usha S; Lu, Po H; Bartzokis, George

2014-02-01

To identify regional differences in apparent diffusion coefficient (ADC) and fractional anisotropy (FA) using customized preprocessing before voxel-based analysis (VBA) in 14 normal subjects with the specific genes that decrease (apolipoprotein [APO] E ε2) and that increase (APOE ε4) the risk of Alzheimer's disease. Diffusion tensor images (DTI) acquired at 1.5 Tesla were denoised with a total variation tensor regularization algorithm before affine and nonlinear registration to generate a common reference frame for the image volumes of all subjects. Anisotropic and isotropic smoothing with varying kernel sizes was applied to the aligned data before VBA to determine regional differences between cohorts segregated by allele status. VBA on the denoised tensor data identified regions of reduced FA in APOE ε4 compared with the APOE ε2 healthy older carriers. The most consistent results were obtained using the denoised tensor and anisotropic smoothing before statistical testing. In contrast, isotropic smoothing identified regional differences for small filter sizes alone, emphasizing that this method introduces bias in FA values for higher kernel sizes. Voxel-based DTI analysis can be performed on low signal to noise ratio images to detect subtle regional differences in cohorts using the proposed preprocessing techniques. Copyright © 2013 Wiley Periodicals, Inc.

Floral variation and environmental heterogeneity in a tristylous clonal aquatic of the Pantanal wetlands of Brazil

PubMed Central

Leme da Cunha, Nicolay; Fischer, Erich; Lorenz-Lemke, Aline P.; Barrett, Spencer C. H.

2014-01-01

Background and Aims The balance between stochastic forces and frequency-dependent mating largely governs style morph frequencies in heterostylous populations. In clonal species, deviations from equal morph ratios often result from founder events and unfavourable conditions for sexual reproduction. The aim of this study was to investigate whether different flooding regimes, because of their influence on sexual vs. clonal reproduction, are associated with regional variation in morph frequencies and floral trait differentiation in populations of the clonal, tristylous, aquatic Eichhornia azurea (Pontederiaceae) in the Pantanal wetlands of Brazil. Methods Style morph frequencies were sampled from 73 populations distributed across four flooding regimes differing in depth and duration. Measurements of flower size, sex-organ dimension, pollen size and pollen production were made in selected populations, and pollinator assemblages and their functional traits were recorded. Key Results Most populations of E. azurea were tristylous (78 %), but the majority exhibited uneven morph ratios. The frequency of the mid-styled morph was significantly lower than that of the long- and short-styled morphs. Morph evenness was positively associated with population size but not with flooding regime. There were significant phenotypic differences among flooding regimes for all floral traits, including populations with reduced flower size, sex-organ length and smaller pollen. Pollinator assemblages varied with flood duration. Conclusions The similar morph structure and evenness of populations, regardless of flooding regime, suggest that sexual reproduction and clonal dispersal are sufficiently common to prevent the signature of founder events from dominating in a region. However, the pervasive occurrence of biased morph ratios in most populations suggests that many are in a non-equilibrium state. The reduced frequency of the mid-styled morph in trimorphic and dimorphic populations may be associated with the weak self-incompatibility of this morph resulting in selfing and inbreeding depression. Clonality in E. azurea and the weak self-incompatibility of the mid-styled morph may make it more vulnerable to geitonogamous selfing. PMID:25180289

Flutter suppression and stability analysis for a variable-span wing via morphing technology

NASA Astrophysics Data System (ADS)

Li, Wencheng; Jin, Dongping

2018-01-01

A morphing wing can enhance aerodynamic characteristics and control authority as an alternative to using ailerons. To use morphing technology for flutter suppression, the dynamical behavior and stability of a variable-span wing subjected to the supersonic aerodynamic loads are investigated numerically in this paper. An axially moving cantilever plate is employed to model the variable-span wing, in which the governing equations of motion are established via the Kane method and piston theory. A morphing strategy based on axially moving rates is proposed to suppress the flutter that occurs beyond the critical span length, and the flutter stability is verified by Floquet theory. Furthermore, the transient stability during the morphing motion is analyzed and the upper bound of the morphing rate is obtained. The simulation results indicate that the proposed morphing law, which is varying periodically with a proper amplitude, could accomplish the flutter suppression. Further, the upper bound of the morphing speed decreases rapidly once the span length is close to its critical span length.

Q-space trajectory imaging for multidimensional diffusion MRI of the human brain

PubMed Central

Westin, Carl-Fredrik; Knutsson, Hans; Pasternak, Ofer; Szczepankiewicz, Filip; Özarslan, Evren; van Westen, Danielle; Mattisson, Cecilia; Bogren, Mats; O’Donnell, Lauren; Kubicki, Marek; Topgaard, Daniel; Nilsson, Markus

2016-01-01

This work describes a new diffusion MR framework for imaging and modeling of microstructure that we call q-space trajectory imaging (QTI). The QTI framework consists of two parts: encoding and modeling. First we propose q-space trajectory encoding, which uses time-varying gradients to probe a trajectory in q-space, in contrast to traditional pulsed field gradient sequences that attempt to probe a point in q-space. Then we propose a microstructure model, the diffusion tensor distribution (DTD) model, which takes advantage of additional information provided by QTI to estimate a distributional model over diffusion tensors. We show that the QTI framework enables microstructure modeling that is not possible with the traditional pulsed gradient encoding as introduced by Stejskal and Tanner. In our analysis of QTI, we find that the well-known scalar b-value naturally extends to a tensor-valued entity, i.e., a diffusion measurement tensor, which we call the b-tensor. We show that b-tensors of rank 2 or 3 enable estimation of the mean and covariance of the DTD model in terms of a second order tensor (the diffusion tensor) and a fourth order tensor. The QTI framework has been designed to improve discrimination of the sizes, shapes, and orientations of diffusion microenvironments within tissue. We derive rotationally invariant scalar quantities describing intuitive microstructural features including size, shape, and orientation coherence measures. To demonstrate the feasibility of QTI on a clinical scanner, we performed a small pilot study comparing a group of five healthy controls with five patients with schizophrenia. The parameter maps derived from QTI were compared between the groups, and 9 out of the 14 parameters investigated showed differences between groups. The ability to measure and model the distribution of diffusion tensors, rather than a quantity that has already been averaged within a voxel, has the potential to provide a powerful paradigm for the study of complex tissue architecture. PMID:26923372

Cryptic dioecy in Mussaenda pubescens (Rubiaceae): a species with stigma-height dimorphism.

PubMed

Li, Ai-Min; Wu, Xiao-Qin; Zhang, Dian-Xiang; Barrett, Spencer C H

2010-10-01

Evolutionary transitions from heterostyly to dioecy have been proposed in several angiosperm families, particularly in Rubiaceae. These transitions involve the spread of male and female sterility mutations resulting in modifications to the gender of ancestral hermaphrodites. Despite sustained interest in the gender strategies of plants, the structural and developmental bases for transitions in sexual systems are poorly understood. Here, floral morphology, patterns of fertility, pollen-tube growth and floral development are investigated in two populations of the scandent shrub Mussaenda pubescens (Rubiaceae), native to southern China, by means of experimental and open-pollinations, light microscopy, fluorescence microscopy and scanning electron microscopy combined with paraffin sectioning. Mussaenda pubescens has perfect (hermaphroditic) flowers and populations with two style-length morphs but only weak differentiation in anther position (stigma-height dimorphism). Experimental pollinations demonstrated that despite morphological hermaphroditism, the species is functionally dioecious. The long-styled (L) morph possesses sterile pollen and functions as a female, whereas the short-styled (S) morph is female sterile and functions as a male. Self- and intra-morph pollinations of the S-morph were consistent with those expected from dimorphic incompatibility. The two populations investigated were both S-morph (male) biased. Investigations of early stages of floral development indicated patterns typical of hermaphroditic flowers, with no significant differences in organ growth between the floral morphs. Meiosis of microspore mother cells was of the simultaneous type with tetrads isobilateral in shape. The tapetal cells in anther walls of the L-morph became vacuolized during meiosis I, ahead of the uninucleate microspore stage in the S-morph. In the L-morph, the microspore nucleus degenerated at the tetrad stage resulting in male sterility. Microsporogenesis and male gametophyte development was normal in the S-morph. Failure in the formation of megaspore mother cells and/or the development of megagametophytes resulted in female sterility in the S-morph, compared with normal megasporogenesis in the L-morph. In M. pubescens, cryptic dioecy has evolved from stigma-height dimorphism as a result of morph-specific sterility mutations.

SMA actuators for morphing wings

NASA Astrophysics Data System (ADS)

Brailovski, V.; Terriault, P.; Georges, T.; Coutu, D.

An experimental morphing laminar wing was developed to prove the feasibility of aircraft fuel consumption reduction through enhancement of the laminar flow regime over the wing extrados. The morphing wing prototype designed for subsonic cruise flight conditions (Mach 0.2 … 0.3; angle of attack - 1 … +2∘), combines three principal subsystems: (1) flexible extrados, (2) rigid intrados and (3) an actuator group located inside the wing box. The morphing capability of the wing relies on controlled deformation of the wing extrados under the action of shape memory alloys (SMA) actuators. A coupled fluid-structure model of the morphing wing was used to evaluate its mechanical and aerodynamic performances in different flight conditions. A 0.5 m chord and 1 m span prototype of the morphing wing was tested in a subsonic wind tunnel. In this work, SMA actuators for morphing wings were modeled using a coupled thermo-mechanical finite element model and they were windtunnel validated. If the thermo-mechanical model of SMA actuators presented in this work is coupled with the previously developed structureaerodynamic model of the morphing wing, it could serve for the optimization of the entire morphing wing system.

Lipogenesis in a wing-polymorphic cricket: Canalization versus morph-specific plasticity as a function of nutritional heterogeneity.

PubMed

Zera, Anthony J; Clark, Rebecca; Behmer, Spence

2016-12-01

The influence of variable nutritional input on life history adaptation is a central, but incompletely understood aspect of life history physiology. The wing-polymorphic cricket, Gryllus firmus, has been extensively studied with respect to the biochemical basis of life history adaptation, in particular, modification of lipid metabolism that underlies the enhanced accumulation of lipid flight fuel in the dispersing morph [LW(f)=long wings with functional flight muscles] relative to the flightless (SW=short-winged) morph. To date, biochemical studies have been undertaken almost exclusively using a single laboratory diet. Thus, the extent to which nutritional heterogeneity, likely experienced in the field, influences this key morph adaptation is unknown. We used the experimental approach of the Geometric Framework for Nutrition and employed 13 diets that differed in the amounts and ratios of protein and carbohydrate to assess how nutrient amount and balance affects morph-specific lipid biosynthesis. Greater lipid biosynthesis and allocation to the soma in the LW(f) compared with the SW morph (1) occurred across the entire protein-carbohydrate landscape and (2) is likely an important contributor to elevated somatic lipid in the LW(f) morph across the entire protein-carbohydrate landscape. Nevertheless, dietary carbohydrate strongly affected lipid biosynthesis in a morph-specific manner (to a greater degree in the LW(f) morph). Lipogenesis in the SW morph may be constrained due to its more limited lipid storage capacity compared to the LW(f) morph. Elevated activity of NADP + -isocitrate dehydrogenase (NADP + -IDH), an enzyme that produces reducing equivalents for lipid biosynthesis, was correlated with and may be an important cause of the increased lipogenesis in the LW(f) morph across most, but not all regions of the protein-carbohydrate landscape. By contrast, ATP-citrate lyase (ACL), an enzyme that catalyzes the first step in the pathway of fatty acid biosynthesis, showed complex morph-specific patterns of activity that were strongly contingent upon diet. Morph-specific patterns of NADP + -IDH and ACL activities across the nutrient landscape were much more complex than expected from previous studies on a single diet. Collectively, our results indicate that the biochemical basis of an important life history adaptation, morph-specific lipogenesis, can be canalized in the face of substantial nutritional heterogeneity. However, in some regions of the protein-carbohydrate landscape, it is strongly modulated in a morph-specific manner. Copyright © 2016 Elsevier Ltd. All rights reserved.

Developmental decoupling of alternative phenotypes: insights from the transcriptomes of horn-polyphenic beetles

PubMed Central

Snell-Rood, Emilie C.; Cash, Amy; Han, Mira V.; Kijimoto, Teiya; Andrews, Justen; Moczek, Armin P.

2010-01-01

Developmental mechanisms play an important role in determining the costs, limits, and evolutionary consequences of phenotypic plasticity. One issue central to these claims is the hypothesis of developmental decoupling, where alternate morphs result from evolutionarily independent developmental pathways. We address this assumption through a microarray study that tests whether differences in gene expression between alternate morphs are as divergent as those between sexes, a classic example of developmental decoupling. We then examine whether genes with morph-biased expression are less conserved than genes with shared expression between morphs, as predicted if developmental decoupling relaxes pleiotropic constraints on divergence. We focus on the developing horns and brains of two species of horned beetles with spectacular sexual- and morph-dimorphism in the expression of horns and fighting behavior. We find that patterns of gene expression were as divergent between morphs as they were between sexes. However, overall patterns of gene expression were also highly correlated across morphs and sexes. Morph-biased genes were more evolutionarily divergent, suggesting a role of relaxed pleiotropic constraints or relaxed selection. Together these results suggest that alternate morphs are to some extent developmentally decoupled, and that this decoupling has significant evolutionary consequences. However, alternative morphs may not be as developmentally decoupled as sometimes assumed and such hypotheses of development should be revisited and refined. PMID:20731717

Groupwise Registration and Atlas Construction of 4th-Order Tensor Fields Using the ℝ+ Riemannian Metric*

PubMed Central

Barmpoutis, Angelos

2010-01-01

Registration of Diffusion-Weighted MR Images (DW-MRI) can be achieved by registering the corresponding 2nd-order Diffusion Tensor Images (DTI). However, it has been shown that higher-order diffusion tensors (e.g. order-4) outperform the traditional DTI in approximating complex fiber structures such as fiber crossings. In this paper we present a novel method for unbiased group-wise non-rigid registration and atlas construction of 4th-order diffusion tensor fields. To the best of our knowledge there is no other existing method to achieve this task. First we define a metric on the space of positive-valued functions based on the Riemannian metric of real positive numbers (denoted by ℝ+). Then, we use this metric in a novel functional minimization method for non-rigid 4th-order tensor field registration. We define a cost function that accounts for the 4th-order tensor re-orientation during the registration process and has analytic derivatives with respect to the transformation parameters. Finally, the tensor field atlas is computed as the minimizer of the variance defined using the Riemannian metric. We quantitatively compare the proposed method with other techniques that register scalar-valued or diffusion tensor (rank-2) representations of the DWMRI. PMID:20436782

If Arctic charr Salvelinus alpinus is “the most diverse vertebrate,” what is the lake charr Salvelinus namaycush?

USGS Publications Warehouse

Muir, Andrew M.; Hansen, Michael J.; Bronte, Charles R.; Krueger, Charles C.

2016-01-01

Teleost fishes are prominent vertebrate models of evolution, illustrated among old-world radiations by the Cichlidae of East African Great Lakes and new-world radiations by the circumpolar Arctic charr Salvelinus alpinus. Herein, we describe variation in lake charr S. namaycush morphology, life history, physiology, and ecology, as another example of radiation. The lake charr is restricted to northern North America, where it originated from glacial refugia and diversified in large lakes. Shallow and deepwater morphs arose in multiple lakes, with a large-bodied shallow-water ‘lean’ morph in shallow inshore depths, a small-bodied mid-water ‘humper’ morph on offshore shoals or banks, and a large-bodied deep-water ‘siscowet’ morph at depths > 100 m. Eye position, gape size, and gillraker length and spacing adapted for feeding on different-sized prey, with piscivorous morphs (leans and siscowets) reaching larger asymptotic size than invertivorous morphs (humpers). Lean morphs are light in color, whereas deepwater morphs are drab and dark, although the pattern is reversed in dark tannic lakes. Morphs shift from benthic to pelagic feeding at a length of 400–490-mm. Phenotypic differences in locomotion, buoyancy, and lipid metabolism evolved into different mechanisms for buoyancy regulation, with lean morphs relying on hydrodynamic lift and siscowet morphs relying on hydrostatic lift. We suggest that the Salvelinus genus, rather than the species S. alpinus, is a diverse genus that should be the subject of comparative studies of processes causing divergence and adaptation among member species that may lead to a more complete evolutionary conceptual model.

Pollinator Competition as a Driver of Floral Divergence: An Experimental Test.

PubMed

Temeles, Ethan J; Newman, Julia T; Newman, Jennifer H; Cho, Se Yeon; Mazzotta, Alexandra R; Kress, W John

2016-01-01

Optimal foraging models of floral divergence predict that competition between two different types of pollinators will result in partitioning, increased assortative mating, and divergence of two floral phenotypes. We tested these predictions in a tropical plant-pollinator system using sexes of purple-throated carib hummingbirds (Anthracothorax jugularis) as the pollinators, red and yellow inflorescence morphs of Heliconia caribaea as the plants, and fluorescent dyes as pollen analogs in an enclosed outdoor garden. When foraging alone, males exhibited a significant preference for the yellow morph of H. caribaea, whereas females exhibited no preference. In competition, males maintained their preference for the yellow morph and through aggression caused females to over-visit the red morph, resulting in resource partitioning. Competition significantly increased within-morph dye transfer (assortative mating) relative to non-competitive environments. Competition and partitioning of color morphs by sexes of purple-throated caribs also resulted in selection for floral divergence as measured by dye deposition on stigmas. Red and yellow morphs did not differ significantly in dye deposition in the competition trials, but differences in dye deposition and preferences for morphs when sexes of purple-throated caribs foraged alone implied fixation of one or the other color morph in the absence of competition. Competition also resulted in selection for divergence in corolla length, with the red morph experiencing directional selection for longer corollas and the yellow morph experiencing stabilizing selection on corolla length. Our results thus support predictions of foraging models of floral divergence and indicate that pollinator competition is a viable mechanism for divergence in floral traits of plants.

Pollinator Competition as a Driver of Floral Divergence: An Experimental Test

PubMed Central

Temeles, Ethan J.; Newman, Julia T.; Newman, Jennifer H.; Cho, Se Yeon; Mazzotta, Alexandra R.; Kress, W. John

2016-01-01

Optimal foraging models of floral divergence predict that competition between two different types of pollinators will result in partitioning, increased assortative mating, and divergence of two floral phenotypes. We tested these predictions in a tropical plant-pollinator system using sexes of purple-throated carib hummingbirds (Anthracothorax jugularis) as the pollinators, red and yellow inflorescence morphs of Heliconia caribaea as the plants, and fluorescent dyes as pollen analogs in an enclosed outdoor garden. When foraging alone, males exhibited a significant preference for the yellow morph of H. caribaea, whereas females exhibited no preference. In competition, males maintained their preference for the yellow morph and through aggression caused females to over-visit the red morph, resulting in resource partitioning. Competition significantly increased within-morph dye transfer (assortative mating) relative to non-competitive environments. Competition and partitioning of color morphs by sexes of purple-throated caribs also resulted in selection for floral divergence as measured by dye deposition on stigmas. Red and yellow morphs did not differ significantly in dye deposition in the competition trials, but differences in dye deposition and preferences for morphs when sexes of purple-throated caribs foraged alone implied fixation of one or the other color morph in the absence of competition. Competition also resulted in selection for divergence in corolla length, with the red morph experiencing directional selection for longer corollas and the yellow morph experiencing stabilizing selection on corolla length. Our results thus support predictions of foraging models of floral divergence and indicate that pollinator competition is a viable mechanism for divergence in floral traits of plants. PMID:26814810

MorphDB: Prioritizing Genes for Specialized Metabolism Pathways and Gene Ontology Categories in Plants.

PubMed

Zwaenepoel, Arthur; Diels, Tim; Amar, David; Van Parys, Thomas; Shamir, Ron; Van de Peer, Yves; Tzfadia, Oren

2018-01-01

Recent times have seen an enormous growth of "omics" data, of which high-throughput gene expression data are arguably the most important from a functional perspective. Despite huge improvements in computational techniques for the functional classification of gene sequences, common similarity-based methods often fall short of providing full and reliable functional information. Recently, the combination of comparative genomics with approaches in functional genomics has received considerable interest for gene function analysis, leveraging both gene expression based guilt-by-association methods and annotation efforts in closely related model organisms. Besides the identification of missing genes in pathways, these methods also typically enable the discovery of biological regulators (i.e., transcription factors or signaling genes). A previously built guilt-by-association method is MORPH, which was proven to be an efficient algorithm that performs particularly well in identifying and prioritizing missing genes in plant metabolic pathways. Here, we present MorphDB, a resource where MORPH-based candidate genes for large-scale functional annotations (Gene Ontology, MapMan bins) are integrated across multiple plant species. Besides a gene centric query utility, we present a comparative network approach that enables researchers to efficiently browse MORPH predictions across functional gene sets and species, facilitating efficient gene discovery and candidate gene prioritization. MorphDB is available at http://bioinformatics.psb.ugent.be/webtools/morphdb/morphDB/index/. We also provide a toolkit, named "MORPH bulk" (https://github.com/arzwa/morph-bulk), for running MORPH in bulk mode on novel data sets, enabling researchers to apply MORPH to their own species of interest.

Reconstruction of the arcuate fasciculus for surgical planning in the setting of peritumoral edema using two-tensor unscented Kalman filter tractography.

PubMed

Chen, Zhenrui; Tie, Yanmei; Olubiyi, Olutayo; Rigolo, Laura; Mehrtash, Alireza; Norton, Isaiah; Pasternak, Ofer; Rathi, Yogesh; Golby, Alexandra J; O'Donnell, Lauren J

2015-01-01

Diffusion imaging tractography is increasingly used to trace critical fiber tracts in brain tumor patients to reduce the risk of post-operative neurological deficit. However, the effects of peritumoral edema pose a challenge to conventional tractography using the standard diffusion tensor model. The aim of this study was to present a novel technique using a two-tensor unscented Kalman filter (UKF) algorithm to track the arcuate fasciculus (AF) in brain tumor patients with peritumoral edema. Ten right-handed patients with left-sided brain tumors in the vicinity of language-related cortex and evidence of significant peritumoral edema were retrospectively selected for the study. All patients underwent 3-Tesla magnetic resonance imaging (MRI) including a diffusion-weighted dataset with 31 directions. Fiber tractography was performed using both single-tensor streamline and two-tensor UKF tractography. A two-regions-of-interest approach was applied to perform the delineation of the AF. Results from the two different tractography algorithms were compared visually and quantitatively. Using single-tensor streamline tractography, the AF appeared disrupted in four patients and contained few fibers in the remaining six patients. Two-tensor UKF tractography delineated an AF that traversed edematous brain areas in all patients. The volume of the AF was significantly larger on two-tensor UKF than on single-tensor streamline tractography (p < 0.01). Two-tensor UKF tractography provides the ability to trace a larger volume AF than single-tensor streamline tractography in the setting of peritumoral edema in brain tumor patients.

Assessment of MRI-Based Marker of Dopaminergic Integrity as a Biological Indicator of Gulf War Illness

DTIC Science & Technology

2016-10-01

including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing and...SUBJECT TERMS Gulf war illness; magnetic resonance imaging; dopamine; diffusion tensor imaging 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...nigra, basal ganglia and cortex as markers of integrity of the nigro-striatal dopaminergic pathway using high resolution diffusion tensor imaging (DTI

Tensor scale-based fuzzy connectedness image segmentation

NASA Astrophysics Data System (ADS)

Saha, Punam K.; Udupa, Jayaram K.

2003-05-01

Tangible solutions to image segmentation are vital in many medical imaging applications. Toward this goal, a framework based on fuzzy connectedness was developed in our laboratory. A fundamental notion called "affinity" - a local fuzzy hanging togetherness relation on voxels - determines the effectiveness of this segmentation framework in real applications. In this paper, we introduce the notion of "tensor scale" - a recently developed local morphometric parameter - in affinity definition and study its effectiveness. Although, our previous notion of "local scale" using the spherical model successfully incorporated local structure size into affinity and resulted in measureable improvements in segmentation results, a major limitation of the previous approach was that it ignored local structural orientation and anisotropy. The current approach of using tensor scale in affinity computation allows an effective utilization of local size, orientation, and ansiotropy in a unified manner. Tensor scale is used for computing both the homogeneity- and object-feature-based components of affinity. Preliminary results of the proposed method on several medical images and computer generated phantoms of realistic shapes are presented. Further extensions of this work are discussed.

Semi-Supervised Tensor-Based Graph Embedding Learning and Its Application to Visual Discriminant Tracking.

PubMed

Hu, Weiming; Gao, Jin; Xing, Junliang; Zhang, Chao; Maybank, Stephen

2017-01-01

An appearance model adaptable to changes in object appearance is critical in visual object tracking. In this paper, we treat an image patch as a two-order tensor which preserves the original image structure. We design two graphs for characterizing the intrinsic local geometrical structure of the tensor samples of the object and the background. Graph embedding is used to reduce the dimensions of the tensors while preserving the structure of the graphs. Then, a discriminant embedding space is constructed. We prove two propositions for finding the transformation matrices which are used to map the original tensor samples to the tensor-based graph embedding space. In order to encode more discriminant information in the embedding space, we propose a transfer-learning- based semi-supervised strategy to iteratively adjust the embedding space into which discriminative information obtained from earlier times is transferred. We apply the proposed semi-supervised tensor-based graph embedding learning algorithm to visual tracking. The new tracking algorithm captures an object's appearance characteristics during tracking and uses a particle filter to estimate the optimal object state. Experimental results on the CVPR 2013 benchmark dataset demonstrate the effectiveness of the proposed tracking algorithm.

InterFace: A software package for face image warping, averaging, and principal components analysis.

PubMed

Kramer, Robin S S; Jenkins, Rob; Burton, A Mike

2017-12-01

We describe InterFace, a software package for research in face recognition. The package supports image warping, reshaping, averaging of multiple face images, and morphing between faces. It also supports principal components analysis (PCA) of face images, along with tools for exploring the "face space" produced by PCA. The package uses a simple graphical user interface, allowing users to perform these sophisticated image manipulations without any need for programming knowledge. The program is available for download in the form of an app, which requires that users also have access to the (freely available) MATLAB Runtime environment.

Multiple sclerosis: changes in microarchitecture of white matter tracts after training with a video game balance board.

PubMed

Prosperini, Luca; Fanelli, Fulvia; Petsas, Nikolaos; Sbardella, Emilia; Tona, Francesca; Raz, Eytan; Fortuna, Deborah; De Angelis, Floriana; Pozzilli, Carlo; Pantano, Patrizia

2014-11-01

To determine if high-intensity, task-oriented, visual feedback training with a video game balance board (Nintendo Wii) induces significant changes in diffusion-tensor imaging ( DTI diffusion-tensor imaging ) parameters of cerebellar connections and other supratentorial associative bundles and if these changes are related to clinical improvement in patients with multiple sclerosis. The protocol was approved by local ethical committee; each participant provided written informed consent. In this 24-week, randomized, two-period crossover pilot study, 27 patients underwent static posturography and brain magnetic resonance (MR) imaging at study entry, after the first 12-week period, and at study termination. Thirteen patients started a 12-week training program followed by a 12-week period without any intervention, while 14 patients received the intervention in reverse order. Fifteen healthy subjects also underwent MR imaging once and underwent static posturography. Virtual dissection of white matter tracts was performed with streamline tractography; values of DTI diffusion-tensor imaging parameters were then obtained for each dissected tract. Repeated measures analyses of variance were performed to evaluate whether DTI diffusion-tensor imaging parameters significantly changed after intervention, with false discovery rate correction for multiple hypothesis testing. There were relevant differences between patients and healthy control subjects in postural sway and DTI diffusion-tensor imaging parameters (P < .05). Significant main effects of time by group interaction for fractional anisotropy and radial diffusivity of the left and right superior cerebellar peduncles were found (F2,23 range, 5.555-3.450; P = .036-.088 after false discovery rate correction). These changes correlated with objective measures of balance improvement detected at static posturography (r = -0.381 to 0.401, P < .05). However, both clinical and DTI diffusion-tensor imaging changes did not persist beyond 12 weeks after training. Despite the low statistical power (35%) due to the small sample size, the results showed that training with the balance board system modified the microstructure of superior cerebellar peduncles. The clinical improvement observed after training might be mediated by enhanced myelination-related processes, suggesting that high-intensity, task-oriented exercises could induce favorable microstructural changes in the brains of patients with multiple sclerosis.

Diffusion Weighted/Tensor Imaging, Functional MRI and Perfusion Weighted Imaging in Glioblastoma-Foundations and Future.

PubMed

Salama, Gayle R; Heier, Linda A; Patel, Praneil; Ramakrishna, Rohan; Magge, Rajiv; Tsiouris, Apostolos John

2017-01-01

In this article, we review the basics of diffusion tensor imaging and functional MRI, their current utility in preoperative neurosurgical mapping, and their limitations. We also discuss potential future applications, including implementation of resting state functional MRI. We then discuss perfusion and diffusion-weighted imaging and their application in advanced neuro-oncologic practice. We explain how these modalities can be helpful in guiding surgical biopsies and differentiating recurrent tumor from treatment related changes.

Diffusion Weighted/Tensor Imaging, Functional MRI and Perfusion Weighted Imaging in Glioblastoma—Foundations and Future

PubMed Central

Salama, Gayle R.; Heier, Linda A.; Patel, Praneil; Ramakrishna, Rohan; Magge, Rajiv; Tsiouris, Apostolos John

2018-01-01

In this article, we review the basics of diffusion tensor imaging and functional MRI, their current utility in preoperative neurosurgical mapping, and their limitations. We also discuss potential future applications, including implementation of resting state functional MRI. We then discuss perfusion and diffusion-weighted imaging and their application in advanced neuro-oncologic practice. We explain how these modalities can be helpful in guiding surgical biopsies and differentiating recurrent tumor from treatment related changes. PMID:29403420

The instantaneous apparent resistivity tensor: a visualization scheme for LOTEM electric field measurements

NASA Astrophysics Data System (ADS)

Caldwell, T. Grant; Bibby, Hugh M.

1998-12-01

Long-offset transient electromagnetic (LOTEM) data have traditionally been represented as early- and late-time apparent resistivities. Time-varying electric field data recorded in a LOTEM survey made with multiple sources can be represented by an `instantaneous apparent resistivity tensor'. Three independent, coordinate-invariant, time-varying apparent resistivities can be derived from this tensor. For dipolar sources, the invariants are also independent of source orientation. In a uniform-resistivity half-space, the invariant given by the square root of the tensor determinant remains almost constant with time, deviating from the half-space resistivity by a maximum of 6 per cent. For a layered half-space, a distance-time pseudo-section of the determinant apparent resistivity produces an image of the layering beneath the measurement profile. As time increases, the instantaneous apparent resistivity tensor approaches the direct current apparent resistivity tensor. An approximate time-to-depth conversion can be achieved by integrating the diffusion depth formula with time, using the determinant apparent resistivity at each instant to represent the resistivity of the conductive medium. Localized near-surface inhomogeneities produce shifts in the time-domain apparent resistivity sounding curves that preserve the gradient, analogous to static shifts seen in magnetotelluric soundings. Instantaneous apparent resistivity tensors calculated for 3-D resistivity models suggest that profiles of LOTEM measurements across a simple 3-D structure can be used to create an image that reproduces the main features of the subsurface resistivity. Where measurements are distributed over an area, maps of the tensor invariants can be made into a sequence of images, which provides a way of `time slicing' down through the target structure.

Dictionary-Based Tensor Canonical Polyadic Decomposition

NASA Astrophysics Data System (ADS)

Cohen, Jeremy Emile; Gillis, Nicolas

2018-04-01

To ensure interpretability of extracted sources in tensor decomposition, we introduce in this paper a dictionary-based tensor canonical polyadic decomposition which enforces one factor to belong exactly to a known dictionary. A new formulation of sparse coding is proposed which enables high dimensional tensors dictionary-based canonical polyadic decomposition. The benefits of using a dictionary in tensor decomposition models are explored both in terms of parameter identifiability and estimation accuracy. Performances of the proposed algorithms are evaluated on the decomposition of simulated data and the unmixing of hyperspectral images.

Using Perturbation Theory to Reduce Noise in Diffusion Tensor Fields

PubMed Central

Bansal, Ravi; Staib, Lawrence H.; Xu, Dongrong; Laine, Andrew F.; Liu, Jun; Peterson, Bradley S.

2009-01-01

We propose the use of Perturbation theory to reduce noise in Diffusion Tensor (DT) fields. Diffusion Tensor Imaging (DTI) encodes the diffusion of water molecules along different spatial directions in a positive-definite, 3 × 3 symmetric tensor. Eigenvectors and eigenvalues of DTs allow the in vivo visualization and quantitative analysis of white matter fiber bundles across the brain. The validity and reliability of these analyses are limited, however, by the low spatial resolution and low Signal-to-Noise Ratio (SNR) in DTI datasets. Our procedures can be applied to improve the validity and reliability of these quantitative analyses by reducing noise in the tensor fields. We model a tensor field as a three-dimensional Markov Random Field and then compute the likelihood and the prior terms of this model using Perturbation theory. The prior term constrains the tensor field to be smooth, whereas the likelihood term constrains the smoothed tensor field to be similar to the original field. Thus, the proposed method generates a smoothed field that is close in structure to the original tensor field. We evaluate the performance of our method both visually and quantitatively using synthetic and real-world datasets. We quantitatively assess the performance of our method by computing the SNR for eigenvalues and the coherence measures for eigenvectors of DTs across tensor fields. In addition, we quantitatively compare the performance of our procedures with the performance of one method that uses a Riemannian distance to compute the similarity between two tensors, and with another method that reduces noise in tensor fields by anisotropically filtering the diffusion weighted images that are used to estimate diffusion tensors. These experiments demonstrate that our method significantly increases the coherence of the eigenvectors and the SNR of the eigenvalues, while simultaneously preserving the fine structure and boundaries between homogeneous regions, in the smoothed tensor field. PMID:19540791

Finite Element Analysis of Morphing Piezoelectric Structures Studied

NASA Technical Reports Server (NTRS)

Lee, Ho-Jun

2002-01-01

The development of morphing aerospace structures that optimize their shape offers the potential to significantly improve the performance of existing airplanes. These morphing vehicles will operate with new capabilities to reduce noise, damp vibrations, manipulate flow, and monitor damage. Piezoelectric materials represent one of the popular materials currently being investigated for applications in morphing structures.

Cannibalistic-morph Tiger Salamanders in unexpected ecological contexts

USGS Publications Warehouse

McLean, Kyle I.; Stockwell, Craig A.; Mushet, David M.

2016-01-01

Barred tiger salamanders [Ambystoma mavortium (Baird, 1850)] exhibit two trophic morphologies; a typical and a cannibalistic morph. Cannibalistic morphs, distinguished by enlarged vomerine teeth, wide heads, slender bodies, and cannibalistic tendencies, are often found where conspecifics occur at high density. During 2012 and 2013, 162 North Dakota wetlands and lakes were sampled for salamanders. Fifty-one contained A. mavortium populations; four of these contained cannibalistic morph individuals. Two populations with cannibalistic morphs occurred at sites with high abundances of conspecifics. However, the other two populations occurred at sites with unexpectedly low conspecific but high fathead minnow [Pimephales promelas (Rafinesque, 1820)] abundances. Further, no typical morphs were observed in either of these later two populations, contrasting with earlier research suggesting cannibalistic morphs only occur at low frequencies in salamander populations. Another anomaly of all four populations was the occurrence of cannibalistic morphs in permanent water sites, suggesting their presence was due to factors other than faster growth allowing them to occupy ephemeral habitats. Therefore, our findings suggest environmental factors inducing the cannibalistic morphism may be more complex than previously thought.

Morph-specific metabolic rate and the timing of reproductive senescence in a color polymorphic dragon.

PubMed

Friesen, Christopher R; Johansson, Rasmus; Olsson, Mats

2017-08-01

Polymorphism has fascinated biologists for over a century because morphs persist within populations through evolutionary time in spite of showing disparate behavioral and physiological phenotypes; any one morph should go to fixation with the slightest fitness advantage over the others. Surely there must be trade-offs that balance selection on them. The polychromatic morphs of the Australian painted dragon lizard, Ctenophorus pictus, are one such system. The male color morphs of painted dragons have different physiological and behavioral traits including reproductive tactics, hormone levels, and the rate of body condition loss through the reproductive season. Due to their differences in physiology and reproductive tactics, we tested the hypotheses that male morphs would differ in resting metabolic rates (RMRs) and that the morphs' RMR would decline at different rates through the mating season. We found that bib-morphs (yellow gular patch) differ in RMR with bibbed (more aggressive) males having consistently higher RMR than non-bibbed males. Furthermore, we show that male dragons experience a decline in RMR as they age from reproductively active to inactive. We also found that the RMR of bibbed males has higher repeatability than non-bibbed males. Our results reinforce previous hypotheses about the morph-specific costs of bearing a gular patch in painted dragons. © 2017 Wiley Periodicals, Inc.

Trade-offs in disease and bleaching susceptibility among two color morphs of the Hawaiian reef coral, Montipora capitata

NASA Astrophysics Data System (ADS)

Shore-Maggio, Amanda; Callahan, Sean M.; Aeby, Greta S.

2018-06-01

Two threats impacting coral reefs are bleaching and disease, and differential susceptibility to both exists among and within coral taxa. Bleaching resistance is commonly linked to the clade of endosymbiotic Symbiodinium, but may come at a cost to other biological traits. Montipora capitata is an Indo-Pacific reef-building coral with two color morphs, red and orange, which harbor different clades of Symbiodinium. We explored whether these color morphs displayed differences in bleaching/disease susceptibility and other biological traits (growth rate, reproductive output, and lipid content). We found a trade-off between disease and bleaching susceptibility. The orange morph had significantly higher disease prevalence, whereas the red morph had significantly higher bleaching prevalence. Thermal stress experiments found that bleaching and loss of photochemical efficiency occurred significantly faster in the red morph, but at normal temperatures, the red morph had a significantly higher growth rate. Higher abundance of the red morph in the field suggests that disease resistance is a more successful strategy in the absence of thermal stress events. The orange morph may better tolerate increases in sea temperatures, but may not persist due to decreased growth rate and increased disease susceptibility. Trade-offs in response to stressors highlight the need to consider local and global threats to coral reefs.

Using tensor-based morphometry to detect structural brain abnormalities in rats with adolescent intermittent alcohol exposure

NASA Astrophysics Data System (ADS)

Paniagua, Beatriz; Ehlers, Cindy; Crews, Fulton; Budin, Francois; Larson, Garrett; Styner, Martin; Oguz, Ipek

2011-03-01

Understanding the effects of adolescent binge drinking that persist into adulthood is a crucial public health issue. Adolescent intermittent ethanol exposure (AIE) is an animal model that can be used to investigate these effects in rodents. In this work, we investigate the application of a particular image analysis technique, tensor-based morphometry, for detecting anatomical differences between AIE and control rats using Diffusion Tensor Imaging (DTI). Deformation field analysis is a popular method for detecting volumetric changes analyzing Jacobian determinants calculated on deformation fields. Recent studies showed that computing deformation field metrics on the full deformation tensor, often referred to as tensor-based morphometry (TBM), increases the sensitivity to anatomical differences. In this paper we conduct a comprehensive TBM study for precisely locating differences between control and AIE rats. Using a DTI RARE sequence designed for minimal geometric distortion, 12-directional images were acquired postmortem for control and AIE rats (n=9). After preprocessing, average images for the two groups were constructed using an unbiased atlas building approach. We non-rigidly register the two atlases using Large Deformation Diffeomorphic Metric Mapping, and analyze the resulting deformation field using TBM. In particular, we evaluate the tensor determinant, geodesic anisotropy, and deformation direction vector (DDV) on the deformation field to detect structural differences. This yields data on the local amount of growth, shrinkage and the directionality of deformation between the groups. We show that TBM can thus be used to measure group morphological differences between rat populations, demonstrating the potential of the proposed framework.

Evidence for ontogenetically and morphologically distinct alternative reproductive tactics in the invasive Round Goby Neogobius melanostomus.

PubMed

Bleeker, Katinka; de Jong, Karen; van Kessel, Nils; Hinde, Camilla A; Nagelkerke, Leopold A J

2017-01-01

Alternative reproductive tactics are characterized by the occurrence of discrete alternative morphs that differ in behavioural, morphological and physiological traits within the same sex. Although much effort has been made to describe the behaviour, morphology and physiology of such alternative morphs, less effort has been invested investigating how much overlap there is in the characteristics of such morphs in natural populations. We studied random population samples of the invasive Round Goby Neogobius melanostomus from five different localities in the river Rhine system in the Netherlands. We found two morphologically and physiologically distinct male morphs which likely represent alternative reproductive tactics. Almost all mature males under 9.35 cm total length had a gonadosomatic index > 3%, suggestive of a sneaker tactic, while nearly all males above 9.35 cm has a gonadosomatic index of < 3%, suggestive of a parental tactic. Cheek size and eye diameter alone were sufficient to distinguish the two morphs. Gonads had a different relationship with size in the two morphs, indicating separate growth trajectories. The gonad mass of sneaker morphs would be ca. 7.5 times as high as the gonad mass of parental morphs of the same total length after extrapolation. Few (9%) intermediates were found, suggesting that the expression of alternative reproductive tactics is determined before the first breeding season. This contrasts with studies on other goby species, which show evidence of plastic tactics that can be affected by social circumstances. We conclude that it is possible to distinguish two alternative male morphs in the Dutch Round Goby population using morphological measurements alone. Although behavioural observations are needed to provide conclusive evidence, the difference in GSI between these morphs indicates that these morphs reflect alternative reproductive tactics.

Evidence for ontogenetically and morphologically distinct alternative reproductive tactics in the invasive Round Goby Neogobius melanostomus

PubMed Central

de Jong, Karen; van Kessel, Nils; Hinde, Camilla A.; Nagelkerke, Leopold A. J.

2017-01-01

Alternative reproductive tactics are characterized by the occurrence of discrete alternative morphs that differ in behavioural, morphological and physiological traits within the same sex. Although much effort has been made to describe the behaviour, morphology and physiology of such alternative morphs, less effort has been invested investigating how much overlap there is in the characteristics of such morphs in natural populations. We studied random population samples of the invasive Round Goby Neogobius melanostomus from five different localities in the river Rhine system in the Netherlands. We found two morphologically and physiologically distinct male morphs which likely represent alternative reproductive tactics. Almost all mature males under 9.35 cm total length had a gonadosomatic index > 3%, suggestive of a sneaker tactic, while nearly all males above 9.35 cm has a gonadosomatic index of < 3%, suggestive of a parental tactic. Cheek size and eye diameter alone were sufficient to distinguish the two morphs. Gonads had a different relationship with size in the two morphs, indicating separate growth trajectories. The gonad mass of sneaker morphs would be ca. 7.5 times as high as the gonad mass of parental morphs of the same total length after extrapolation. Few (9%) intermediates were found, suggesting that the expression of alternative reproductive tactics is determined before the first breeding season. This contrasts with studies on other goby species, which show evidence of plastic tactics that can be affected by social circumstances. We conclude that it is possible to distinguish two alternative male morphs in the Dutch Round Goby population using morphological measurements alone. Although behavioural observations are needed to provide conclusive evidence, the difference in GSI between these morphs indicates that these morphs reflect alternative reproductive tactics. PMID:28369128

Negative frequency-dependent selection or alternative reproductive tactics: maintenance of female polymorphism in natural populations

PubMed Central

2013-01-01

Background Sex-limited polymorphisms have long intrigued evolutionary biologists and have been the subject of long-standing debates. The coexistence of multiple male and/or female morphs is widely believed to be maintained through negative frequency-dependent selection imposed by social interactions. However, remarkably few empirical studies have evaluated how social interactions, morph frequencies and fitness parameters relate to one another under natural conditions. Here, we test two hypotheses proposed to explain the maintenance of a female polymorphism in a species with extreme geographical variation in morph frequencies. We first elucidate how fecundity traits of the morphs vary in relation to the frequencies and densities of males and female morphs in multiple sites over multiple years. Second, we evaluate whether the two female morphs differ in resource allocation among fecundity traits, indicating alternative tactics to maximize reproductive output. Results We present some of the first empirical evidence collected under natural conditions that egg number and clutch mass was higher in the rarer female morph. This morph-specific fecundity advantage gradually switched with the population morph frequency. Our results further indicate that all investigated fecundity traits are negatively affected by relative male density (i.e. operational sex ratio), which confirms male harassment as selective agent. Finally, we show a clear trade-off between qualitative (egg mass) and quantitative (egg number) fecundity traits. This trade-off, however, is not morph-specific. Conclusion Our reported frequency- and density-dependent fecundity patterns are consistent with the hypothesis that the polymorphism is driven by a conflict between sexes over optimal mating rate, with costly male sexual harassment driving negative frequency-dependent selection on morph fecundity. PMID:23822745

Water temperature, not fish morph, determines parasite infections of sympatric Icelandic threespine sticklebacks (Gasterosteus aculeatus)

PubMed Central

Karvonen, Anssi; Kristjánsson, Bjarni K; Skúlason, Skúli; Lanki, Maiju; Rellstab, Christian; Jokela, Jukka

2013-01-01

Parasite communities of fishes are known to respond directly to the abiotic environment of the host, for example, to water quality and water temperature. Biotic factors are also important as they affect the exposure profile through heterogeneities in parasite distribution in the environment. Parasites in a particular environment may pose a strong selection on fish. For example, ecological differences in selection by parasites have been hypothesized to facilitate evolutionary differentiation of freshwater fish morphs specializing on different food types. However, as parasites may also respond directly to abiotic environment the parasite risk does not depend only on biotic features of the host environment. It is possible that different morphs experience specific selection gradients by parasites but it is not clear how consistent the selection is when abiotic factors change. We examined parasite pressure in sympatric morphs of threespine stickleback (Gasterosteus aculeatus) across a temperature gradient in two large Icelandic lakes, Myvatn and Thingvallavatn. Habitat-specific temperature gradients in these lakes are opposite. Myvatn lava rock morph lives in a warm environment, while the mud morph lives in the cold. In Thingvallavatn, the lava rock morph lives in a cold environment and the mud morph in a warm habitat. We found more parasites in fish living in higher temperature in both lakes, independent of the fish morph, and this pattern was similar for the two dominating parasite taxa, trematodes and cestodes. However, at the same time, we also found higher parasite abundance in a third morph living in deep cold–water habitat in Thingvallavatn compared to the cold-water lava morph, indicating strong effect of habitat-specific biotic factors. Our results suggest complex interactions between water temperature and biotic factors in determining the parasite community structure, a pattern that may have implications for differentiation of stickleback morphs. PMID:23789063

A high-resolution multimode digital microscope system.

PubMed

Salmon, Edward D; Shaw, Sidney L; Waters, Jennifer C; Waterman-Storer, Clare M; Maddox, Paul S; Yeh, Elaine; Bloom, Kerry

2013-01-01

This chapter describes the development of a high-resolution, multimode digital imaging system based on a wide-field epifluorescent and transmitted light microscope, and a cooled charge-coupled device (CCD) camera. The three main parts of this imaging system are Nikon FXA microscope, Hamamatsu C4880 cooled CCD camera, and MetaMorph digital imaging system. This chapter presents various design criteria for the instrument and describes the major features of the microscope components-the cooled CCD camera and the MetaMorph digital imaging system. The Nikon FXA upright microscope can produce high resolution images for both epifluorescent and transmitted light illumination without switching the objective or moving the specimen. The functional aspects of the microscope set-up can be considered in terms of the imaging optics, the epi-illumination optics, the transillumination optics, the focus control, and the vibration isolation table. This instrument is somewhat specialized for microtubule and mitosis studies, and it is also applicable to a variety of problems in cellular imaging, including tracking proteins fused to the green fluorescent protein in live cells. The instrument is also valuable for correlating the assembly dynamics of individual cytoplasmic microtubules (labeled by conjugating X-rhodamine to tubulin) with the dynamics of membranes of the endoplasmic reticulum (labeled with DiOC6) and the dynamics of the cell cortex (by differential interference contrast) in migrating vertebrate epithelial cells. This imaging system also plays an important role in the analysis of mitotic mutants in the powerful yeast genetic system Saccharomyces cerevisiae. Copyright © 1998 Elsevier Inc. All rights reserved.

Diurnal and developmental differences in gene expression between adult dispersing and flightless morphs of the wing polymorphic cricket, Gryllus firmus: Implications for life-history evolution.

PubMed

Zera, Anthony J; Vellichirammal, Neetha Nanoth; Brisson, Jennifer A

2018-04-12

The functional basis of life history adaptation is a key topic of research in life history evolution. Studies of wing-polymorphism in the cricket Gryllus firmus have played a prominent role in this field. However, prior in-depth investigations of morph specialization have primarily focused on a single hormone, juvenile hormone, and a single aspect of intermediary metabolism, the fatty-acid biosynthetic component of lipid metabolism. Moreover, the role of diurnal variation in life history adaptation in G. firmus has been understudied, as is the case for organisms in general. Here, we identify genes whose expression differs consistently between the morphs independent of time-of-day during early adulthood, as well as genes that exhibit a strong pattern of morph-specific diurnal expression. We find strong, consistent, morph-specific differences in the expression of genes involved in endocrine regulation, carbohydrate and lipid metabolism, and immunity - in particular, in the expression of an insulin-like-peptide precursor gene and genes involved in triglyceride production. We also find that the flight-capable morph exhibited a substantially greater number of genes exhibiting diurnal change in gene expression compared with the flightless morph, correlated with the greater circadian change in the hemolymph juvenile titer in the dispersing morph. In fact, diurnal differences in expression within the dispersing morph at different times of the day were significantly greater in magnitude than differences between dispersing and flightless morphs at the same time-of-day. These results provide important baseline information regarding the potential role of variable gene expression on life history specialization in morphs of G. firmus, and the first information on genetically-variable, diurnal change in gene expression, associated with a key life history polymorphism. These results also suggest the existence of prominent morph-specific circadian differences in gene expression in G. firmus, possibly caused by the morph-specific circadian rhythm in the juvenile hormone titer. Copyright © 2018 Elsevier Ltd. All rights reserved.

The role of rare morph advantage and conspicuousness in the stable gold-dark colour polymorphism of a crater lake Midas cichlid fish.

PubMed

Torres-Dowdall, Julián; Golcher-Benavides, Jimena; Machado-Schiaffino, Gonzalo; Meyer, Axel

2017-09-01

Genetically based stable colour polymorphisms provide a unique opportunity to study the evolutionary processes that preserve genetic variability in the wild. Different mechanisms are proposed to promote the stability of polymorphisms, but only few empirical examples have been documented, resulting in an incomplete understanding of these mechanisms. A remarkable genetically determined stable colour polymorphism is found in the Nicaraguan Midas cichlid species complex (Amphilophus cf. citrinellus). All Midas cichlids start their life with a dark-grey coloration (dark morph), but individuals carrying the dominant "gold" allele (c. 10%) lose their melanophores later in life, revealing the underlying orange coloration (gold morph). How this polymorphism is maintained remains unclear. Two main hypotheses have been proposed, both suggesting differential predation upon colour morphs as the proximate mechanism. One predicts that the conspicuous gold morph is more likely to be preyed upon, but this disadvantage is balanced by their competitive dominance over the dark morph. The second hypothesis suggests a rare morph advantage where the rarer gold morph experiences less predation. Empirical evidence for either of these mechanisms is still circumstantial and inconclusive. We conducted two field experiments in a Nicaraguan crater lake using wax models simulating both morphs to determine predation pressure upon Midas cichlid colour morphs. First, we tested the interaction of coloration and depth on attack rate. Second, we tested the interaction of fish size and coloration. We contrasted the pattern of attacks from these experiments to the predicted predation patterns from the hypotheses proposed to explain the colour polymorphism's stability. Large models imitating colour morphs were attacked at similar rates irrespectively of their position in the water column. Yet, attacks upon small models resembling juveniles were directed mainly towards dark models. This resulted in a significant size-by-colour interaction. We suggest that gold Midas cichlids experience a rare morph advantage as juveniles when individuals of this morph are extremely uncommon. But this effect is reduced or disappears among adults, where gold individuals are relatively more common. Thus, the interaction of rare morph advantage and conspicuousness, rather than either of those factors alone, is a likely mechanism resulting in the stability of the colour polymorphism in Midas cichlids. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

Similar Tensor Arrays - A Framework for Storage of Tensor Array Data

NASA Astrophysics Data System (ADS)

Brun, Anders; Martin-Fernandez, Marcos; Acar, Burak; Munoz-Moreno, Emma; Cammoun, Leila; Sigfridsson, Andreas; Sosa-Cabrera, Dario; Svensson, Björn; Herberthson, Magnus; Knutsson, Hans

This chapter describes a framework for storage of tensor array data, useful to describe regularly sampled tensor fields. The main component of the framework, called Similar Tensor Array Core (STAC), is the result of a collaboration between research groups within the SIMILAR network of excellence. It aims to capture the essence of regularly sampled tensor fields using a minimal set of attributes and can therefore be used as a “greatest common divisor” and interface between tensor array processing algorithms. This is potentially useful in applied fields like medical image analysis, in particular in Diffusion Tensor MRI, where misinterpretation of tensor array data is a common source of errors. By promoting a strictly geometric perspective on tensor arrays, with a close resemblance to the terminology used in differential geometry, (STAC) removes ambiguities and guides the user to define all necessary information. In contrast to existing tensor array file formats, it is minimalistic and based on an intrinsic and geometric interpretation of the array itself, without references to other coordinate systems.

Susceptibility Tensor Imaging (STI) of the Brain

PubMed Central

Li, Wei; Liu, Chunlei; Duong, Timothy Q.; van Zijl, Peter C.M.; Li, Xu

2016-01-01

Susceptibility tensor imaging (STI) is a recently developed MRI technique that allows quantitative determination of orientation-independent magnetic susceptibility parameters from the dependence of gradient echo signal phase on the orientation of biological tissues with respect to the main magnetic field. By modeling the magnetic susceptibility of each voxel as a symmetric rank-2 tensor, individual magnetic susceptibility tensor elements as well as the mean magnetic susceptibility (MMS) and magnetic susceptibility anisotropy (MSA) can be determined for brain tissues that would still show orientation dependence after conventional scalar-based quantitative susceptibility mapping (QSM) to remove such dependence. Similar to diffusion tensor imaging (DTI), STI allows mapping of brain white matter fiber orientations and reconstruction of 3D white matter pathways using the principal eigenvectors of the susceptibility tensor. In contrast to diffusion anisotropy, the main determinant factor of susceptibility anisotropy in brain white matter is myelin. Another unique feature of susceptibility anisotropy of white matter is its sensitivity to gadolinium-based contrast agents. Mechanistically, MRI-observed susceptibility anisotropy is mainly attributed to the highly ordered lipid molecules in myelin sheath. STI provides a consistent interpretation of the dependence of phase and susceptibility on orientation at multiple scales. This article reviews the key experimental findings and physical theories that led to the development of STI, its practical implementations, and its applications for brain research. PMID:27120169

MULTISCALE TENSOR ANISOTROPIC FILTERING OF FLUORESCENCE MICROSCOPY FOR DENOISING MICROVASCULATURE.

PubMed

Prasath, V B S; Pelapur, R; Glinskii, O V; Glinsky, V V; Huxley, V H; Palaniappan, K

2015-04-01

Fluorescence microscopy images are contaminated by noise and improving image quality without blurring vascular structures by filtering is an important step in automatic image analysis. The application of interest here is to automatically extract the structural components of the microvascular system with accuracy from images acquired by fluorescence microscopy. A robust denoising process is necessary in order to extract accurate vascular morphology information. For this purpose, we propose a multiscale tensor with anisotropic diffusion model which progressively and adaptively updates the amount of smoothing while preserving vessel boundaries accurately. Based on a coherency enhancing flow with planar confidence measure and fused 3D structure information, our method integrates multiple scales for microvasculature preservation and noise removal membrane structures. Experimental results on simulated synthetic images and epifluorescence images show the advantage of our improvement over other related diffusion filters. We further show that the proposed multiscale integration approach improves denoising accuracy of different tensor diffusion methods to obtain better microvasculature segmentation.

Tract-Specific Analyses of Diffusion Tensor Imaging Show Widespread White Matter Compromise in Autism Spectrum Disorder

ERIC Educational Resources Information Center

Shukla, Dinesh K.; Keehn, Brandon; Muller, Ralph-Axel

2011-01-01

Background: Previous diffusion tensor imaging (DTI) studies have shown white matter compromise in children and adults with autism spectrum disorder (ASD), which may relate to reduced connectivity and impaired function of distributed networks. However, tract-specific evidence remains limited in ASD. We applied tract-based spatial statistics (TBSS)…

White Matter Compromise of Callosal and Subcortical Fiber Tracts in Children with Autism Spectrum Disorder: A Diffusion Tensor Imaging Study

ERIC Educational Resources Information Center

Shukla, Dinesh K.; Keehn, Brandon; Lincoln, Alan J.; Muller, Ralph-Axel

2010-01-01

Objective: Autism spectrum disorder (ASD) is increasingly viewed as a disorder of functional networks, highlighting the importance of investigating white matter and interregional connectivity. We used diffusion tensor imaging (DTI) to examine white matter integrity for the whole brain and for corpus callosum, internal capsule, and middle…

Eigenvalues of Random Matrices with Isotropic Gaussian Noise and the Design of Diffusion Tensor Imaging Experiments.

PubMed

Gasbarra, Dario; Pajevic, Sinisa; Basser, Peter J

2017-01-01

Tensor-valued and matrix-valued measurements of different physical properties are increasingly available in material sciences and medical imaging applications. The eigenvalues and eigenvectors of such multivariate data provide novel and unique information, but at the cost of requiring a more complex statistical analysis. In this work we derive the distributions of eigenvalues and eigenvectors in the special but important case of m×m symmetric random matrices, D , observed with isotropic matrix-variate Gaussian noise. The properties of these distributions depend strongly on the symmetries of the mean tensor/matrix, D̄ . When D̄ has repeated eigenvalues, the eigenvalues of D are not asymptotically Gaussian, and repulsion is observed between the eigenvalues corresponding to the same D̄ eigenspaces. We apply these results to diffusion tensor imaging (DTI), with m = 3, addressing an important problem of detecting the symmetries of the diffusion tensor, and seeking an experimental design that could potentially yield an isotropic Gaussian distribution. In the 3-dimensional case, when the mean tensor is spherically symmetric and the noise is Gaussian and isotropic, the asymptotic distribution of the first three eigenvalue central moment statistics is simple and can be used to test for isotropy. In order to apply such tests, we use quadrature rules of order t ≥ 4 with constant weights on the unit sphere to design a DTI-experiment with the property that isotropy of the underlying true tensor implies isotropy of the Fisher information. We also explain the potential implications of the methods using simulated DTI data with a Rician noise model.

Eigenvalues of Random Matrices with Isotropic Gaussian Noise and the Design of Diffusion Tensor Imaging Experiments*

PubMed Central

Gasbarra, Dario; Pajevic, Sinisa; Basser, Peter J.

2017-01-01

Tensor-valued and matrix-valued measurements of different physical properties are increasingly available in material sciences and medical imaging applications. The eigenvalues and eigenvectors of such multivariate data provide novel and unique information, but at the cost of requiring a more complex statistical analysis. In this work we derive the distributions of eigenvalues and eigenvectors in the special but important case of m×m symmetric random matrices, D, observed with isotropic matrix-variate Gaussian noise. The properties of these distributions depend strongly on the symmetries of the mean tensor/matrix, D̄. When D̄ has repeated eigenvalues, the eigenvalues of D are not asymptotically Gaussian, and repulsion is observed between the eigenvalues corresponding to the same D̄ eigenspaces. We apply these results to diffusion tensor imaging (DTI), with m = 3, addressing an important problem of detecting the symmetries of the diffusion tensor, and seeking an experimental design that could potentially yield an isotropic Gaussian distribution. In the 3-dimensional case, when the mean tensor is spherically symmetric and the noise is Gaussian and isotropic, the asymptotic distribution of the first three eigenvalue central moment statistics is simple and can be used to test for isotropy. In order to apply such tests, we use quadrature rules of order t ≥ 4 with constant weights on the unit sphere to design a DTI-experiment with the property that isotropy of the underlying true tensor implies isotropy of the Fisher information. We also explain the potential implications of the methods using simulated DTI data with a Rician noise model. PMID:28989561

Quantitative metrics for evaluating parallel acquisition techniques in diffusion tensor imaging at 3 Tesla.

PubMed

Ardekani, Siamak; Selva, Luis; Sayre, James; Sinha, Usha

2006-11-01

Single-shot echo-planar based diffusion tensor imaging is prone to geometric and intensity distortions. Parallel imaging is a means of reducing these distortions while preserving spatial resolution. A quantitative comparison at 3 T of parallel imaging for diffusion tensor images (DTI) using k-space (generalized auto-calibrating partially parallel acquisitions; GRAPPA) and image domain (sensitivity encoding; SENSE) reconstructions at different acceleration factors, R, is reported here. Images were evaluated using 8 human subjects with repeated scans for 2 subjects to estimate reproducibility. Mutual information (MI) was used to assess the global changes in geometric distortions. The effects of parallel imaging techniques on random noise and reconstruction artifacts were evaluated by placing 26 regions of interest and computing the standard deviation of apparent diffusion coefficient and fractional anisotropy along with the error of fitting the data to the diffusion model (residual error). The larger positive values in mutual information index with increasing R values confirmed the anticipated decrease in distortions. Further, the MI index of GRAPPA sequences for a given R factor was larger than the corresponding mSENSE images. The residual error was lowest in the images acquired without parallel imaging and among the parallel reconstruction methods, the R = 2 acquisitions had the least error. The standard deviation, accuracy, and reproducibility of the apparent diffusion coefficient and fractional anisotropy in homogenous tissue regions showed that GRAPPA acquired with R = 2 had the least amount of systematic and random noise and of these, significant differences with mSENSE, R = 2 were found only for the fractional anisotropy index. Evaluation of the current implementation of parallel reconstruction algorithms identified GRAPPA acquired with R = 2 as optimal for diffusion tensor imaging.

Plumage polymorphism and fitness in Swainson's hawks.

PubMed

Briggs, C W; Collopy, M W; Woodbridge, B

2011-10-01

We examine the maintenance of a plumage polymorphism, variation in plumages among the same age and sex class within a population, in a population of Swainson's Hawks. We take advantage of 32 years of data to examine two prevalent hypotheses used to explain the persistence of morphs: apostatic selection and heterozygous advantage. We investigate differences in fitness among three morph classes of a melanistic trait in Swainson's Hawks: light (7% of the local breeding population), intermediate (57%) and dark (36%). Specifically, we examined morph differences in adult apparent survival, breeding success, annual number of fledglings produced, probability of offspring recruitment into the breeding population and lifetime reproductive success (LRS). If apostatic selection were a factor in maintaining morphs, we would expect that individuals with the least frequent morph would perform best in one or more of these fitness categories. Alternatively, if heterozygous advantage played a role in the maintenance of this polymorphism, we would expect heterozygotes (i.e. intermediate morphs) to have one or more increased rates in these categories. We found no difference in adult apparent survival between morph classes. Similarly, there were no differences in breeding success, nest productivity, LRS or probability of recruitment of offspring between parental morph. We conclude that neither apostatic selection nor heterozygous advantage appear to play a role in maintaining morphs in this population. © 2011 The Authors. Journal of Evolutionary Biology © 2011 European Society For Evolutionary Biology.

Energy-based aeroelastic analysis of a morphing wing

NASA Astrophysics Data System (ADS)

De Breuker, Roeland; Abdalla, Mostafa; Gürdal, Zafer; Lindner, Douglas

2007-04-01

Aircraft are often confronted with distinct circumstances during different parts of their mission. Ideally the aircraft should fly optimally in terms of aerodynamic performance and other criteria in each one of these mission requirements. This requires in principle as many different aircraft configurations as there are flight conditions, so therefore a morphing aircraft would be the ideal solution. A morphing aircraft is a flying vehicle that i) changes its state substantially, ii) provides superior system capability and iii) uses a design that integrates innovative technologies. It is important for such aircraft that the gains due to the adaptability to the flight condition are not nullified by the energy consumption to carry out the morphing manoeuvre. Therefore an aeroelastic numerical tool that takes into account the morphing energy is needed to analyse the net gain of the morphing. The code couples three-dimensional beam finite elements model in a co-rotational framework to a lifting-line aerodynamic code. The morphing energy is calculated by summing actuation moments, applied at the beam nodes, multiplied by the required angular rotations of the beam elements. The code is validated with NASTRAN Aeroelasticity Module and found to be in agreement. Finally the applicability of the code is tested for a sweep morphing manoeuvre and it has been demonstrated that sweep morphing can improve the aerodynamic performance of an aircraft and that the inclusion of aeroelastic effects is important.

Multimodal MRI in cerebral small vessel disease: its relationship with cognition and sensitivity to change over time.

PubMed

Nitkunan, Arani; Barrick, Tom R; Charlton, Rebecca A; Clark, Chris A; Markus, Hugh S

2008-07-01

Cerebral small vessel disease is the most common cause of vascular dementia. Interest in using MRI parameters as surrogate markers of disease to assess therapies is increasing. In patients with symptomatic sporadic small vessel disease, we determined which MRI parameters best correlated with cognitive function on cross-sectional analysis and which changed over a period of 1 year. Thirty-five patients with lacunar stroke and leukoaraiosis were recruited. They underwent multimodal MRI (brain volume, fluid-attenuated inversion recovery lesion load, lacunar infarct number, fractional anisotropy, and mean diffusivity from diffusion tensor imaging) and neuropsychological testing. Twenty-seven agreed to reattend for repeat MRI and neuropsychology at 1 year. An executive function score correlated most strongly with diffusion tensor imaging (fractional anisotropy histogram, r=-0.640, P=0.004) and brain volume (r=0.501, P=0.034). Associations with diffusion tensor imaging were stronger than with all other MRI parameters. On multiple regression of all imaging parameters, a model that contained brain volume and fractional anisotropy, together with age, gender, and premorbid IQ, explained 74% of the variance of the executive function score (P=0.0001). Changes in mean diffusivity and fractional anisotropy were detectable over the 1-year follow-up; in contrast, no change in other MRI parameters was detectable over this time period. A multimodal MRI model explains a large proportion of the variation in executive function in cerebral small vessel disease. In particular, diffusion tensor imaging correlates best with executive function and is the most sensitive to change. This supports the use of MRI, in particular diffusion tensor imaging, as a surrogate marker in treatment trials.

Development of Thermally Actuated, High-Temperature Composite Morphing Concepts

DTIC Science & Technology

2016-05-11

Thermally Actuated, High- Temperature Composite Morphing Concepts 5a. CONTRACT NUMBER EOARD 14-0063 5b. GRANT NUMBER FA9550-14-1-0063 5c...mismatched thermal expansion coefficients. However, current bimorphs are generally limited to benign temperatures and linear temperature displacement... temperature morphing structures. Successful application of this work may yield morphing hot structures in extreme environments. A particularly appealing

Development of Thermally Actuated, High Temperature Composite Morphing Concepts

DTIC Science & Technology

2016-03-31

Thermally Actuated, High- Temperature Composite Morphing Concepts 5a. CONTRACT NUMBER EOARD 14-0063 5b. GRANT NUMBER FA9550-14-1-0063 5c...mismatched thermal expansion coefficients. However, current bimorphs are generally limited to benign temperatures and linear temperature displacement... temperature morphing structures. Successful application of this work may yield morphing hot structures in extreme environments. A particularly appealing

Tensor-based tracking of the aorta in phase-contrast MR images

NASA Astrophysics Data System (ADS)

Azad, Yoo-Jin; Malsam, Anton; Ley, Sebastian; Rengier, Fabian; Dillmann, Rüdiger; Unterhinninghofen, Roland

2014-03-01

The velocity-encoded magnetic resonance imaging (PC-MRI) is a valuable technique to measure the blood flow velocity in terms of time-resolved 3D vector fields. For diagnosis, presurgical planning and therapy control monitoring the patient's hemodynamic situation is crucial. Hence, an accurate and robust segmentation of the diseased vessel is the basis for further methods like the computation of the blood pressure. In the literature, there exist some approaches to transfer the methods of processing DT-MR images to PC-MR data, but the potential of this approach is not fully exploited yet. In this paper, we present a method to extract the centerline of the aorta in PC-MR images by applying methods from the DT-MRI. On account of this, in the first step the velocity vector fields are converted into tensor fields. In the next step tensor-based features are derived and by applying a modified tensorline algorithm the tracking of the vessel course is accomplished. The method only uses features derived from the tensor imaging without the use of additional morphology information. For evaluation purposes we applied our method to 4 volunteer as well as 26 clinical patient datasets with good results. In 29 of 30 cases our algorithm accomplished to extract the vessel centerline.

Performance of a non-tapered 3D morphing wing with integrated compliant ribs

NASA Astrophysics Data System (ADS)

Previtali, F.; Ermanni, P.

2012-05-01

Morphing wings have a high potential for improving the performance and reducing the fuel consumption of modern aircraft. Thanks to its simplicity, the compliant belt-rib concept is regarded by the authors as a promising solution. Using the compliant rib designed by Hasse and Campanile as a starting point, a compliant morphing wing made of composite materials is designed. Innovative methods for optimal placing of the actuation and for the quantification of the morphing are used. The performance of the compliant morphing wing in terms of three-dimensional (3D) structural behaviour and aerodynamic properties, both two- and three-dimensional, is presented and discussed. The fundamental importance of considering 3D coupling effects in the determination of the performance of morphing aerofoils is shown.

Retrospective correction of bias in diffusion tensor imaging arising from coil combination mode.

PubMed

Sakaie, Ken; Lowe, Mark

2017-04-01

To quantify and retrospectively correct for systematic differences in diffusion tensor imaging (DTI) measurements due to differences in coil combination mode. Multi-channel coils are now standard among MRI systems. There are several options for combining signal from multiple coils during image reconstruction, including sum-of-squares (SOS) and adaptive combine (AC). This contribution examines the bias between SOS- and AC-derived measures of tissue microstructure and a strategy for limiting that bias. Five healthy subjects were scanned under an institutional review board-approved protocol. Each set of raw image data was reconstructed twice-once with SOS and once with AC. The diffusion tensor was calculated from SOS- and AC-derived data by two algorithms-standard log-linear least squares and an approach that accounts for the impact of coil combination on signal statistics. Systematic differences between SOS and AC in terms of tissue microstructure (axial diffusivity, radial diffusivity, mean diffusivity and fractional anisotropy) were evaluated on a voxel-by-voxel basis. SOS-based tissue microstructure values are systematically lower than AC-based measures throughout the brain in each subject when using the standard tensor calculation method. The difference between SOS and AC can be virtually eliminated by taking into account the signal statistics associated with coil combination. The impact of coil combination mode on diffusion tensor-based measures of tissue microstructure is statistically significant but can be corrected retrospectively. The ability to do so is expected to facilitate pooling of data among imaging protocols. Copyright © 2016 Elsevier Inc. All rights reserved.

Investigating Musical Disorders with Diffusion Tensor Imaging: a Comparison of Imaging Parameters

PubMed Central

Loui, Psyche; Schlaug, Gottfried

2009-01-01

The Arcuate Fasciculus (AF) is a bundle of white matter traditionally thought to be responsible for language function. However, its role in music is not known. Here we investigate the connectivity of the AF using Diffusion Tensor Imaging (DTI) and show that musically tone-deaf individuals, who show impairments in pitch discrimination, have reduced connectivity in the AF relative to musically normal-functioning control subjects. Results were robust to variations in imaging parameters and emphasize the importance of brain connectivity in para-linguistic processes such as music. PMID:19673766

High-resolution dynamic 31 P-MRSI using a low-rank tensor model.

PubMed

Ma, Chao; Clifford, Bryan; Liu, Yuchi; Gu, Yuning; Lam, Fan; Yu, Xin; Liang, Zhi-Pei

2017-08-01

To develop a rapid 31 P-MRSI method with high spatiospectral resolution using low-rank tensor-based data acquisition and image reconstruction. The multidimensional image function of 31 P-MRSI is represented by a low-rank tensor to capture the spatial-spectral-temporal correlations of data. A hybrid data acquisition scheme is used for sparse sampling, which consists of a set of "training" data with limited k-space coverage to capture the subspace structure of the image function, and a set of sparsely sampled "imaging" data for high-resolution image reconstruction. An explicit subspace pursuit approach is used for image reconstruction, which estimates the bases of the subspace from the "training" data and then reconstructs a high-resolution image function from the "imaging" data. We have validated the feasibility of the proposed method using phantom and in vivo studies on a 3T whole-body scanner and a 9.4T preclinical scanner. The proposed method produced high-resolution static 31 P-MRSI images (i.e., 6.9 × 6.9 × 10 mm 3 nominal resolution in a 15-min acquisition at 3T) and high-resolution, high-frame-rate dynamic 31 P-MRSI images (i.e., 1.5 × 1.5 × 1.6 mm 3 nominal resolution, 30 s/frame at 9.4T). Dynamic spatiospectral variations of 31 P-MRSI signals can be efficiently represented by a low-rank tensor. Exploiting this mathematical structure for data acquisition and image reconstruction can lead to fast 31 P-MRSI with high resolution, frame-rate, and SNR. Magn Reson Med 78:419-428, 2017. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

Active-Vision Control Systems for Complex Adversarial 3-D Environments

DTIC Science & Technology

2009-03-01

Control Systems MURI Final Report 36 51. D. Nain, S. Haker , A. Bobick, A. Tannenbaum, "Multiscale 3D shape representation and segmentation using...Conference, August 2008. 99. L. Zhu, Y. Yang, S. Haker , and A. Tannenbaum, "An image morphing technique based on optimal mass preserving mapping," IEEE

Using Morphed Images to Study Visual Detection of Cutaneous Melanoma Symptom Evolution

ERIC Educational Resources Information Center

Dalianis, Elizabeth A.; Critchfield, Thomas S.; Howard, Niki L.; Jordan, J. Scott; Derenne, Adam

2011-01-01

Early detection attenuates otherwise high mortality from the skin cancer melanoma, and although major melanoma symptoms are well defined, little is known about how individuals detect them. Previous research has focused on identifying static stimuli as symptomatic vs. asymptomatic, whereas under natural conditions it is "changes" in skin lesions…

Effects of Dual Coded Multimedia Instruction Employing Image Morphing on Learning a Logographic Language

ERIC Educational Resources Information Center

Wang, Ling; Blackwell, Aleka Akoyunoglou

2015-01-01

Native speakers of alphabetic languages, which use letters governed by grapheme-phoneme correspondence rules, often find it particularly challenging to learn a logographic language whose writing system employs symbols with no direct sound-to-spelling connection but links to the visual and semantic information. The visuospatial properties of…

Dimensions of Attention Associated With the Microstructure of Corona Radiata White Matter.

PubMed

Stave, Elise A; De Bellis, Michael D; Hooper, Steven R; Woolley, Donald P; Chang, Suk Ki; Chen, Steven D

2017-04-01

Mirsky proposed a model of attention that included these dimensions: focus/execute, sustain, stabilize, encode, and shift. The neural correlates of these dimensions were investigated within corona radiata subregions in healthy youth. Diffusion tensor imaging and neuropsychological assessments were conducted in 79 healthy, right-handed youth aged 4-17 years. Diffusion tensor imaging maps were analyzed using standardized parcellation methods. Partial Pearson correlations between neuropsychological standardized scores, representing these attention dimensions, and diffusion tensor imaging measures of corona radiata subregions were calculated after adjusting for gender and IQ. Significant correlations were found between the focus/execute, sustain, stabilize, and shift dimensions and imaging metrics in hypothesized corona radiata subregions. Results suggest that greater microstructural white matter integrity of the corona radiata is partly associated with attention across 4 attention dimensions. Findings suggest that white matter microstructure of the corona radiata is a neural correlate of several, but not all, attention dimensions.

Dimensions of Attention Associated with the Microstructure of Corona Radiata White Matter

PubMed Central

Stave, Elise A.; Hooper, Stephen R.; Woolley, Donald P.; Chang, Suk Ki; Chen, Steven D.

2016-01-01

Mirsky proposed a model of attention that included these dimensions: focus/execute, sustain, stabilize, encode, and shift. The neural correlates of these dimensions were investigated within corona radiate subregions in healthy youth. Diffusion tensor imaging and neuropsychological assessments were conducted in 79 healthy, right-handed youth aged 4–17 years. Diffusion tensor imaging maps were analyzed using standardized parcellation methods. Partial Pearson correlations between neuropsychological standardized scores, representing these attention dimensions, and diffusion tensor imaging measures of corona radiate subregions were calculated after adjusting for gender and IQ. Significant correlations were found between the focus/execute, sustain, stabilize and shift dimensions and imaging metrics in hypothesized corona radiate subregions. Results suggest that greater microstructural white matter integrity of the corona radiata is partly associated with attention across four attention dimensions. Findings suggest that white matter microstructure of the corona radiata is a neural correlate of several, but not all, attention dimensions. PMID:28090797

Abnormal Corpus Callosum Connectivity, Socio-Communicative Deficits, and Motor Deficits in Children with Autism Spectrum Disorder: A Diffusion Tensor Imaging Study

ERIC Educational Resources Information Center

Hanaie, Ryuzo; Mohri, Ikuko; Kagitani-Shimono, Kuriko; Tachibana, Masaya; Matsuzaki, Junko; Watanabe, Yoshiyuki; Fujita, Norihiko; Taniike, Masako

2014-01-01

In addition to social and communicative deficits, many studies have reported motor deficits in autism spectrum disorder (ASD). This study investigated the macro and microstructural properties of the corpus callosum (CC) of 18 children with ASD and 12 typically developing controls using diffusion tensor imaging tractography. We aimed to explore…

Altered Development of White Matter in Youth at High Familial Risk for Bipolar Disorder: A Diffusion Tensor Imaging Study

ERIC Educational Resources Information Center

Versace, Amelia; Ladouceur, Cecile D.; Romero, Soledad; Birmaher, Boris; Axelson, David A.; Kupfer, David J.; Phillips, Mary L.

2010-01-01

Objective: To study white matter (WM) development in youth at high familial risk for bipolar disorder (BD). WM alterations are reported in youth and adults with BD. WM undergoes important maturational changes in adolescence. Age-related changes in WM microstructure using diffusion tensor imaging with tract-based spatial statistics in healthy…

Volume illustration of muscle from diffusion tensor images.

PubMed

Chen, Wei; Yan, Zhicheng; Zhang, Song; Crow, John Allen; Ebert, David S; McLaughlin, Ronald M; Mullins, Katie B; Cooper, Robert; Ding, Zi'ang; Liao, Jun

2009-01-01

Medical illustration has demonstrated its effectiveness to depict salient anatomical features while hiding the irrelevant details. Current solutions are ineffective for visualizing fibrous structures such as muscle, because typical datasets (CT or MRI) do not contain directional details. In this paper, we introduce a new muscle illustration approach that leverages diffusion tensor imaging (DTI) data and example-based texture synthesis techniques. Beginning with a volumetric diffusion tensor image, we reformulate it into a scalar field and an auxiliary guidance vector field to represent the structure and orientation of a muscle bundle. A muscle mask derived from the input diffusion tensor image is used to classify the muscle structure. The guidance vector field is further refined to remove noise and clarify structure. To simulate the internal appearance of the muscle, we propose a new two-dimensional example based solid texture synthesis algorithm that builds a solid texture constrained by the guidance vector field. Illustrating the constructed scalar field and solid texture efficiently highlights the global appearance of the muscle as well as the local shape and structure of the muscle fibers in an illustrative fashion. We have applied the proposed approach to five example datasets (four pig hearts and a pig leg), demonstrating plausible illustration and expressiveness.

Ongoing niche differentiation under high gene flow in a polymorphic brackish water threespine stickleback (Gasterosteus aculeatus) population.

PubMed

Østbye, Kjartan; Taugbøl, Annette; Ravinet, Mark; Harrod, Chris; Pettersen, Ruben Alexander; Bernatchez, Louis; Vøllestad, Leif Asbjørn

2018-02-05

Marine threespine sticklebacks colonized and adapted to brackish and freshwater environments since the last Pleistocene glacial. Throughout the Holarctic, three lateral plate morphs are observed; the low, partial and completely plated morph. We test if the three plate morphs in the brackish water Lake Engervann, Norway, differ in body size, trophic morphology (gill raker number and length), niche (stable isotopes; δ 15 N, δ 13 C, and parasites (Theristina gasterostei, Trematoda spp.)), genetic structure (microsatellites) and the lateral-plate encoding Stn382 (Ectodysplasin) gene. We examine differences temporally (autumn 2006/spring 2007) and spatially (upper/lower sections of the lake - reflecting low versus high salinity). All morphs belonged to one gene pool. The complete morph was larger than the low plated, with the partial morph intermediate. The number of lateral plates ranged 8-71, with means of 64.2 for complete, 40.3 for partial, and 14.9 for low plated morph. Stickleback δ 15 N was higher in the lower lake section, while δ 13 C was higher in the upper section. Stickleback isotopic values were greater in autumn. The low plated morph had larger variances in δ 15 N and δ 13 C than the other morphs. Sticklebacks in the upper section had more T. gasterostei than in the lower section which had more Trematoda spp. Sticklebacks had less T. gasterostei, but more Trematoda spp. in autumn than spring. Sticklebacks with few and short rakers had more T. gasterostei, while sticklebacks with longer rakers had more Trematoda. spp. Stickleback with higher δ 15 N values had more T. gasterostei, while sticklebacks with higher δ 15 N and δ 13 C values had more Trematoda spp. The low plated morph had fewer Trematoda spp. than other morphs. Trait-ecology associations may imply that the three lateral plate morphs in the brackish water lagoon of Lake Engervann are experiencing ongoing divergent selection for niche and migratory life history strategies under high gene flow. As such, the brackish water zone may generally act as a generator of genomic diversity to be selected upon in the different environments where threespine sticklebacks can live.

Preference for Male Traits Differ in Two Female Morphs of the Tree Lizard, Urosaurus ornatus

PubMed Central

Lattanzio, Matthew S.; Metro, Kevin J.; Miles, Donald B.

2014-01-01

Non-random female mating preferences may contribute to the maintenance of phenotypic variation in color polymorphic species. However, the effect of female preference depends on the types of male traits used as signals by receptive females. If preference signals derive from discrete male traits (i.e., morph-specific), female preferences may rapidly fix to a morph. However, female preference signals may also include condition-dependent male traits. In this scenario, female preference may differ depending on the social context (i.e., male morph availability). Male tree lizards (Urosaurus ornatus) exhibit a dewlap color polymorphism that covaries with mating behavior. Blue morph males are aggressive and defend territories, yellow males are less aggressive and defend smaller territories, and orange males are typically nomadic. Female U. ornatus are also polymorphic in dewlap color, but the covariation between dewlap color and female behavior is unknown. We performed an experiment to determine how female mate choice depends on the visual and chemical signals produced by males. We also tested whether female morphs differ in their preferences for these signals. Female preferences involved both male dewlap color and size of the ventral color patch. However, the female morphs responded to these signals differently and depended on the choice between the types of male morphs. Our experiment revealed that females may be capable of distinguishing among the male morphs using chemical signals alone. Yellow females exhibit preferences based on both chemical and visual signals, which may be a strategy to avoid ultra-dominant males. In contrast, orange females may prefer dominant males. We conclude that female U. ornatus morphs differ in mating behavior. Our findings also provide evidence for a chemical polymorphism among male lizards in femoral pore secretions. PMID:25033282

Design and aerodynamic characteristics of a span morphing wing

NASA Astrophysics Data System (ADS)

Yu, Yuemin; Liu, Yanju; Leng, Jinsong

2009-03-01

Flight vehicles are often designed to function around a primary operating point such as an efficient cruise or a high maneuverability mode. Performance and efficiency deteriorate rapidly as the airplane moves towards other portions of the flight envelope. One solution to this quandary is to radically change the shape of the aircraft. This yields both improved efficiency and a larger flight envelope. This global shape change is an example of morphing aircraft . One concept of morphing is the span morphing wing in which the wingspan is varied to accommodate multiple flight regimes. This type of design allows for at least two discreet modes of the aircraft. The original configuration, in which the extensible portion of the wing is fully retracted, yields a high speed dash mode. Fully extending the wing provides the aircraft with a low speed mode tailored for fine tracking and loiter tasks. This paper discusses the design of a span morphing wing that permits a change in the aspect ratio while simultaneously supporting structural wing loads. The wing cross section is maintained by NACA 4412 rib sections . The span morphing wing was investigated in different configurations. The wing area and the aspect ratio of the span morphing wing increase as the wings pan increases. Computational aerodynamics are used to estimate the performance and dynamic characteristics of each wing shape of this span morphing wing as its wingspan is changed. Results show that in order to obtain the same lift, the conventional wing requires a larger angle of attach(AOA) than that of the span morphing wing.The lift of the span morphing wing increases as the wing span ,Mach number and AOA increases.

Development of a morphing flap using shape memory alloy actuators: the aerodynamic characteristics of a morphing flap

NASA Astrophysics Data System (ADS)

Ko, Seung-Hee; Bae, Jae-Sung; Rho, Jin-Ho

2014-07-01

The discontinuous contour of a wing with conventional flaps diminishes the aerodynamic performance of an aircraft. A wing with a continuous contour does not experience extreme flow stream fluctuations during flight, and consequently has good aerodynamic characteristics. In this study, a morphing flap using shape memory alloy actuators is proposed, designed and fabricated, and its aerodynamic characteristics are investigated using aerodynamic analyses and wind tunnel tests. The ribs of the morphing flap are designed and fabricated with multiple elements joined together in a way that allows relative rotations of adjacent elements and forms a smooth contour of the morphing flap. The aerodynamic analyses of this multiple-element morphing-flap wing are performed using XFLR pro; its aerodynamic performance is compared with that of a mechanical-flap wing, and is measured through wind-tunnel tests.

Reconstruction of apparent orthotropic conductivity tensor image using magnetic resonance electrical impedance tomography

NASA Astrophysics Data System (ADS)

Sajib, Saurav Z. K.; Kim, Ji Eun; Jeong, Woo Chul; Kim, Hyung Joong; Kwon, Oh In; Woo, Eung Je

2015-03-01

Magnetic resonance electrical impedance tomography visualizes current density and/or conductivity distributions inside an electrically conductive object. Injecting currents into the imaging object along at least two different directions, induced magnetic flux density data can be measured using a magnetic resonance imaging scanner. Without rotating the object inside the scanner, we can measure only one component of the magnetic flux density denoted as Bz. Since the biological tissues such as skeletal muscle and brain white matter show strong anisotropic properties, the reconstruction of anisotropic conductivity tensor is indispensable for the accurate observations in the biological systems. In this paper, we propose a direct method to reconstruct an axial apparent orthotropic conductivity tensor by using multiple Bz data subject to multiple injection currents. To investigate the anisotropic conductivity properties, we first recover the internal current density from the measured Bz data. From the recovered internal current density and the curl-free condition of the electric field, we derive an over-determined matrix system for determining the internal absolute orthotropic conductivity tensor. The over-determined matrix system is designed to use a combination of two loops around each pixel. Numerical simulations and phantom experimental results demonstrate that the proposed algorithm stably determines the orthotropic conductivity tensor.

Challenge to the model of lake charr evolution: Shallow- and deep-water morphs exist within a small postglacial lake

USGS Publications Warehouse

Chavarie, Louise; Muir, Andrew M.; Zimmerman, Mara S.; Baillie, Shauna M.; Hansen, Michael J.; Nate, Nancy A.; Yule, Daniel L.; Middel, Trevor; Bentzen, Paul; Krueger, Charles C.

2016-01-01

All examples of lake charr (Salvelinus namaycush) diversity occur within the largest, deepest lakes of North America (i.e. > 2000 km2). We report here Rush Lake (1.3 km2) as the first example of a small lake with two lake charr morphs (lean and huronicus). Morphology, diet, life history, and genetics were examined to demonstrate the existence of morphs and determine the potential influence of evolutionary processes that led to their formation or maintenance. Results showed that the huronicus morph, caught in deep-water, had a deeper body, smaller head and jaws, higher eye position, greater buoyancy, and deeper peduncle than the shallow-water lean morph. Huronicus grew slower to a smaller adult size, and had an older mean age than the lean morph. Genetic comparisons showed low genetic divergence between morphs, indicating incomplete reproductive isolation. Phenotypic plasticity and differences in habitat use between deep and shallow waters associated with variation in foraging opportunities seems to have been sufficient to maintain the two morphs, demonstrating their important roles in resource polymorphism. Rush Lake expands previous explanations for lake charr intraspecific diversity, from large to small lakes and from reproductive isolation to the presence of gene flow associated with strong ecological drivers.

Direct Three-Dimensional Myocardial Strain Tensor Quantification and Tracking using zHARP★

PubMed Central

Abd-Elmoniem, Khaled Z.; Stuber, Matthias; Prince, Jerry L.

2008-01-01

Images of myocardial strain can be used to diagnose heart disease, plan and monitor treatment, and to learn about cardiac structure and function. Three-dimensional (3-D) strain is typically quantified using many magnetic resonance (MR) images obtained in two or three orthogonal planes. Problems with this approach include long scan times, image misregistration, and through-plane motion. This article presents a novel method for calculating cardiac 3-D strain using a stack of two or more images acquired in only one orientation. The zHARP pulse sequence encodes in-plane motion using MR tagging and out-of-plane motion using phase encoding, and has been previously shown to be capable of computing 3D displacement within a single image plane. Here, data from two adjacent image planes are combined to yield a 3-D strain tensor at each pixel; stacks of zHARP images can be used to derive stacked arrays of 3D strain tensors without imaging multiple orientations and without numerical interpolation. The performance and accuracy of the method is demonstrated in-vitro on a phantom and in-vivo in four healthy adult human subjects. PMID:18511332

Fraudulent ID using face morphs: Experiments on human and automatic recognition

PubMed Central

Robertson, David J.; Kramer, Robin S. S.

2017-01-01

Matching unfamiliar faces is known to be difficult, and this can give an opportunity to those engaged in identity fraud. Here we examine a relatively new form of fraud, the use of photo-ID containing a graphical morph between two faces. Such a document may look sufficiently like two people to serve as ID for both. We present two experiments with human viewers, and a third with a smartphone face recognition system. In Experiment 1, viewers were asked to match pairs of faces, without being warned that one of the pair could be a morph. They very commonly accepted a morphed face as a match. However, in Experiment 2, following very short training on morph detection, their acceptance rate fell considerably. Nevertheless, there remained large individual differences in people’s ability to detect a morph. In Experiment 3 we show that a smartphone makes errors at a similar rate to ‘trained’ human viewers—i.e. accepting a small number of morphs as genuine ID. We discuss these results in reference to the use of face photos for security. PMID:28328928

Fraudulent ID using face morphs: Experiments on human and automatic recognition.

PubMed

Robertson, David J; Kramer, Robin S S; Burton, A Mike

2017-01-01

Matching unfamiliar faces is known to be difficult, and this can give an opportunity to those engaged in identity fraud. Here we examine a relatively new form of fraud, the use of photo-ID containing a graphical morph between two faces. Such a document may look sufficiently like two people to serve as ID for both. We present two experiments with human viewers, and a third with a smartphone face recognition system. In Experiment 1, viewers were asked to match pairs of faces, without being warned that one of the pair could be a morph. They very commonly accepted a morphed face as a match. However, in Experiment 2, following very short training on morph detection, their acceptance rate fell considerably. Nevertheless, there remained large individual differences in people's ability to detect a morph. In Experiment 3 we show that a smartphone makes errors at a similar rate to 'trained' human viewers-i.e. accepting a small number of morphs as genuine ID. We discuss these results in reference to the use of face photos for security.

Neonatal Microstructural Development of the Internal Capsule on Diffusion Tensor Imaging Correlates with Severity of Gait and Motor Deficits

ERIC Educational Resources Information Center

Rose, Jessica; Mirmiran, Majid; Butler, Erin E.; Lin, Cindy Y.; Barnes, Patrick D.; Kermoian, Rosanne; Stevenson, David K.

2007-01-01

Neonatal microstructural development in the posterior limbs of the internal capsule (PLIC) was assessed using diffusion tensor imaging (DTI) fractional anisotropy (FA) in 24 very-low-birthweight preterm infants at 37 weeks' gestational age and compared with the children's gait and motor deficits at 4 years of age. There were 14 participants with…

Design Methods and Optimization for Morphing Aircraft

NASA Technical Reports Server (NTRS)

Crossley, William A.

2005-01-01

This report provides a summary of accomplishments made during this research effort. The major accomplishments are in three areas. The first is the use of a multiobjective optimization strategy to help identify potential morphing features that uses an existing aircraft sizing code to predict the weight, size and performance of several fixed-geometry aircraft that are Pareto-optimal based upon on two competing aircraft performance objectives. The second area has been titled morphing as an independent variable and formulates the sizing of a morphing aircraft as an optimization problem in which the amount of geometric morphing for various aircraft parameters are included as design variables. This second effort consumed most of the overall effort on the project. The third area involved a more detailed sizing study of a commercial transport aircraft that would incorporate a morphing wing to possibly enable transatlantic point-to-point passenger service.

Shape Sensing a Morphed Wing with an Optical Fiber Bragg Grating

NASA Technical Reports Server (NTRS)

Tai, Hsiang

2005-01-01

We suggest using distributed fiber Bragg sensors systems which were developed locally at Langley Research Center carefully placed on the wing surface to collect strain component information at each location. Then we used the fact that the rate change of slope in the definition of linear strain is very small and can be treated as a constant. Thereby the strain distribution information of a morphed surface can be reduced into a distribution of local slope information of a flat surface. In other words a morphed curve surface is replaced by the collection of individual flat surface of different slope. By assembling the height of individual flat surface, the morphed curved surface can be approximated. A more sophisticated graphic routine can be utilized to restore the curved morphed surface. With this information, the morphed wing can be further adjusted and controlled. A numerical demonstration is presented.

Advanced Magnetic Resonance Imaging techniques to probe muscle structure and function

NASA Astrophysics Data System (ADS)

Malis, Vadim

Structural and functional Magnetic Resonance Imaging (MRI) studies of skeletal muscle allow the elucidation of muscle physiology under normal and pathological conditions. Continuing on the efforts of the Muscle Imaging and Modeling laboratory, the focus of the thesis is to (i) extend and refine two challenging imaging modalities: structural imaging using Diffusion Tensor Imaging (DTI) and functional imaging based on Velocity Encoded Phase Contrast Imaging (VE-PC) and (ii) apply these methods to explore age related structure and functional differences of the gastrocnemius muscle. Diffusion Tensor Imaging allows the study of tissue microstructure as well as muscle fiber architecture. The images, based on an ultrafast single shot Echo Planar Imaging (EPI) sequence, suffer from geometric distortions and low signal to noise ratio. A processing pipeline was developed to correct for distortions and to improve image Signal to Noise Ratio (SNR). DTI acquired on a senior and young cohort of subjects were processed through the pipeline and differences in DTI derived indices and fiber architecture between the two cohorts were explored. The DTI indices indicated that at the microstructural level, fiber atrophy was accompanied with a reduction in fiber volume fraction. At the fiber architecture level, fiber length and pennation angles decreased with age that potentially contribute to the loss of muscle force with age. Velocity Encoded Phase Contrast imaging provides tissue (e.g. muscle) velocity at each voxel which allows the study of strain and Strain Rate (SR) under dynamic conditions. The focus of the thesis was to extract 2D strain rate tensor maps from the velocity images and apply the method to study age related differences. The tensor mapping can potentially provide unique information on the extracellular matrix and lateral transmission the role of these two elements has recently emerged as important determinants of force loss with age. In the cross sectional study on aging, strain rate during isometric contraction was significantly reduced in the seniors; presumably from decrease in muscle slack and increase in stiffness with age. Other parameters of interest from this study that allow inferences on the ECM and lateral transmission are the asymmetry of deformation in the fiber cross section as well as the angle between the SR and muscle fiber. The last part of thesis, which is a 'work-in-progress', is the extension to 3D SR tensor mapping using a 3D spatial, 3D velocity encoded imaging sequence. This is combined with Diffusion Tensor Imaging to obtain the lead eigenvector (muscle fiber direction) at each voxel. The 3D SR is then rotated to the basis of the DTI to obtain a 'Fiber Aligned Strain rate: FASR'. The off diagonal elements of FASR are shear strain terms. Detailed analysis of the shear strain will provide a unique non-invasive method to probe lateral transmission.

High-Fidelity Aerostructural Design Optimization of Transport Aircraft with Continuous Morphing Trailing Edge Technology

NASA Astrophysics Data System (ADS)

Burdette, David A., Jr.

Adaptive morphing trailing edge technology offers the potential to decrease the fuel burn of transonic commercial transport aircraft by allowing wings to dynamically adjust to changing flight conditions. Current configurations allow flap and aileron droop; however, this approach provides limited degrees of freedom and increased drag produced by gaps in the wing's surface. Leading members in the aeronautics community including NASA, AFRL, Boeing, and a number of academic institutions have extensively researched morphing technology for its potential to improve aircraft efficiency. With modern computational tools it is possible to accurately and efficiently model aircraft configurations in order to quantify the efficiency improvements offered by mor- phing technology. Coupled high-fidelity aerodynamic and structural solvers provide the capability to model and thoroughly understand the nuanced trade-offs involved in aircraft design. This capability is important for a detailed study of the capabilities of morphing trailing edge technology. Gradient-based multidisciplinary design opti- mization provides the ability to efficiently traverse design spaces and optimize the trade-offs associated with the design. This thesis presents a number of optimization studies comparing optimized config- urations with and without morphing trailing edge devices. The baseline configuration used throughout this work is the NASA Common Research Model. The first opti- mization comparison considers the optimal fuel burn predicted by the Breguet range equation at a single cruise point. This initial singlepoint optimization comparison demonstrated a limited fuel burn savings of less than 1%. Given the effectiveness of the passive aeroelastic tailoring in the optimized non-morphing wing, the singlepoint optimization offered limited potential for morphing technology to provide any bene- fit. To provide a more appropriate comparison, a number of multipoint optimizations were performed. With a 3-point stencil, the morphing wing burned 2.53% less fuel than its optimized non-morphing counterpart. Expanding further to a 7-point stencil, the morphing wing used 5.04% less fuel. Additional studies demonstrate that the size of the morphing device can be reduced without sizable performance reductions, and that as aircraft wings' aspect ratios increase, the effectiveness of morphing trailing edge devices increases. The final set of studies in this thesis consider mission analy- sis, including climb, multi-altitude cruise, and descent. These mission analyses were performed with a number of surrogate models, trained with O(100) optimizations. These optimizations demonstrated fuel burn reductions as large as 5% at off-design conditions. The fuel burn predicted by the mission analysis was up to 2.7% lower for the morphing wing compared to the conventional configuration.

A Framework for Linear and Non-Linear Registration of Diffusion-Weighted MRIs Using Angular Interpolation

PubMed Central

Duarte-Carvajalino, Julio M.; Sapiro, Guillermo; Harel, Noam; Lenglet, Christophe

2013-01-01

Registration of diffusion-weighted magnetic resonance images (DW-MRIs) is a key step for population studies, or construction of brain atlases, among other important tasks. Given the high dimensionality of the data, registration is usually performed by relying on scalar representative images, such as the fractional anisotropy (FA) and non-diffusion-weighted (b0) images, thereby ignoring much of the directional information conveyed by DW-MR datasets itself. Alternatively, model-based registration algorithms have been proposed to exploit information on the preferred fiber orientation(s) at each voxel. Models such as the diffusion tensor or orientation distribution function (ODF) have been used for this purpose. Tensor-based registration methods rely on a model that does not completely capture the information contained in DW-MRIs, and largely depends on the accurate estimation of tensors. ODF-based approaches are more recent and computationally challenging, but also better describe complex fiber configurations thereby potentially improving the accuracy of DW-MRI registration. A new algorithm based on angular interpolation of the diffusion-weighted volumes was proposed for affine registration, and does not rely on any specific local diffusion model. In this work, we first extensively compare the performance of registration algorithms based on (i) angular interpolation, (ii) non-diffusion-weighted scalar volume (b0), and (iii) diffusion tensor image (DTI). Moreover, we generalize the concept of angular interpolation (AI) to non-linear image registration, and implement it in the FMRIB Software Library (FSL). We demonstrate that AI registration of DW-MRIs is a powerful alternative to volume and tensor-based approaches. In particular, we show that AI improves the registration accuracy in many cases over existing state-of-the-art algorithms, while providing registered raw DW-MRI data, which can be used for any subsequent analysis. PMID:23596381

A Framework for Linear and Non-Linear Registration of Diffusion-Weighted MRIs Using Angular Interpolation.

PubMed

Duarte-Carvajalino, Julio M; Sapiro, Guillermo; Harel, Noam; Lenglet, Christophe

2013-01-01

Registration of diffusion-weighted magnetic resonance images (DW-MRIs) is a key step for population studies, or construction of brain atlases, among other important tasks. Given the high dimensionality of the data, registration is usually performed by relying on scalar representative images, such as the fractional anisotropy (FA) and non-diffusion-weighted (b0) images, thereby ignoring much of the directional information conveyed by DW-MR datasets itself. Alternatively, model-based registration algorithms have been proposed to exploit information on the preferred fiber orientation(s) at each voxel. Models such as the diffusion tensor or orientation distribution function (ODF) have been used for this purpose. Tensor-based registration methods rely on a model that does not completely capture the information contained in DW-MRIs, and largely depends on the accurate estimation of tensors. ODF-based approaches are more recent and computationally challenging, but also better describe complex fiber configurations thereby potentially improving the accuracy of DW-MRI registration. A new algorithm based on angular interpolation of the diffusion-weighted volumes was proposed for affine registration, and does not rely on any specific local diffusion model. In this work, we first extensively compare the performance of registration algorithms based on (i) angular interpolation, (ii) non-diffusion-weighted scalar volume (b0), and (iii) diffusion tensor image (DTI). Moreover, we generalize the concept of angular interpolation (AI) to non-linear image registration, and implement it in the FMRIB Software Library (FSL). We demonstrate that AI registration of DW-MRIs is a powerful alternative to volume and tensor-based approaches. In particular, we show that AI improves the registration accuracy in many cases over existing state-of-the-art algorithms, while providing registered raw DW-MRI data, which can be used for any subsequent analysis.

Acoustic characteristics used by Japanese macaques for individual discrimination.

PubMed

Furuyama, Takafumi; Kobayasi, Kohta I; Riquimaroux, Hiroshi

2017-10-01

The vocalizations of primates contain information about speaker individuality. Many primates, including humans, are able to distinguish conspecifics based solely on vocalizations. The purpose of this study was to investigate the acoustic characteristics used by Japanese macaques in individual vocal discrimination. Furthermore, we tested human subjects using monkey vocalizations to evaluate species specificity with respect to such discriminations. Two monkeys and five humans were trained to discriminate the coo calls of two unfamiliar monkeys. We created a stimulus continuum between the vocalizations of the two monkeys as a set of probe stimuli (whole morph). We also created two sets of continua in which only one acoustic parameter, fundamental frequency ( f 0 ) or vocal tract characteristic (VTC), was changed from the coo call of one monkey to that of another while the other acoustic feature remained the same ( f 0 morph and VTC morph, respectively). According to the results, the reaction times both of monkeys and humans were correlated with the morph proportion under the whole morph and f 0 morph conditions. The reaction time to the VTC morph was correlated with the morph proportion in both monkeys, whereas the reaction time in humans, on average, was not correlated with morph proportion. Japanese monkeys relied more consistently on VTC than did humans for discriminating monkey vocalizations. Our results support the idea that the auditory system of primates is specialized for processing conspecific vocalizations and suggest that VTC is a significant acoustic feature used by Japanese macaques to discriminate conspecific vocalizations. © 2017. Published by The Company of Biologists Ltd.

Variable stiffness corrugated composite structure with shape memory polymer for morphing skin applications

NASA Astrophysics Data System (ADS)

Gong, Xiaobo; Liu, Liwu; Scarpa, Fabrizio; Leng, Jinsong; Liu, Yanju

2017-03-01

This work presents a variable stiffness corrugated structure based on a shape memory polymer (SMP) composite with corrugated laminates as reinforcement that shows smooth aerodynamic surface, extreme mechanical anisotropy and variable stiffness for potential morphing skin applications. The smart composite corrugated structure shows a low in-plane stiffness to minimize the actuation energy, but also possess high out-of-plane stiffness to transfer the aerodynamic pressure load. The skin provides an external smooth aerodynamic surface because of the one-sided filling with the SMP. Due to variable stiffness of the shape memory polymer the morphing skin exhibits a variable stiffness with a change of temperature, which can help the skin adjust its stiffness according different service environments and also lock the temporary shape without external force. Analytical models related to the transverse and bending stiffness are derived and validated using finite element techniques. The stiffness of the morphing skin is further investigated by performing a parametric analysis against the geometry of the corrugation and various sets of SMP fillers. The theoretical and numerical models show a good agreement and demonstrate the potential of this morphing skin concept for morphing aircraft applications. We also perform a feasibility study of the use of this morphing skin in a variable camber morphing wing baseline. The results show that the morphing skin concept exhibits sufficient bending stiffness to withstand the aerodynamic load at low speed (less than 0.3 Ma), while demonstrating a large transverse stiffness variation (up to 191 times) that helps to create a maximum mechanical efficiency of the structure under varying external conditions.

Bayesian CP Factorization of Incomplete Tensors with Automatic Rank Determination.

PubMed

Zhao, Qibin; Zhang, Liqing; Cichocki, Andrzej

2015-09-01

CANDECOMP/PARAFAC (CP) tensor factorization of incomplete data is a powerful technique for tensor completion through explicitly capturing the multilinear latent factors. The existing CP algorithms require the tensor rank to be manually specified, however, the determination of tensor rank remains a challenging problem especially for CP rank . In addition, existing approaches do not take into account uncertainty information of latent factors, as well as missing entries. To address these issues, we formulate CP factorization using a hierarchical probabilistic model and employ a fully Bayesian treatment by incorporating a sparsity-inducing prior over multiple latent factors and the appropriate hyperpriors over all hyperparameters, resulting in automatic rank determination. To learn the model, we develop an efficient deterministic Bayesian inference algorithm, which scales linearly with data size. Our method is characterized as a tuning parameter-free approach, which can effectively infer underlying multilinear factors with a low-rank constraint, while also providing predictive distributions over missing entries. Extensive simulations on synthetic data illustrate the intrinsic capability of our method to recover the ground-truth of CP rank and prevent the overfitting problem, even when a large amount of entries are missing. Moreover, the results from real-world applications, including image inpainting and facial image synthesis, demonstrate that our method outperforms state-of-the-art approaches for both tensor factorization and tensor completion in terms of predictive performance.

Diffusion Tensor Imaging of Heterotopia: Changes of Fractional Anisotropy during Radial Migration of Neurons

PubMed Central

Kim, Jinna

2010-01-01

Purpose Diffusion tensor imaging provides better understanding of pathophysiology of congenital anomalies, involving central nervous system. This study was aimed to specify the pathogenetic mechanism of heterotopia, proved by diffusion tensor imaging, and establish new findings of heterotopia on fractional anisotropy maps. Materials and Methods Diffusion-weighted imaging data from 11 patients (M : F = 7 : 4, aged from 1 to 22 years, mean = 12.3 years) who visited the epilepsy clinic and received a routine seizure protocol MRI exam were retrospectively analyzed. Fractional anisotropy (FA) maps were generated from diffusion tensor imaging of 11 patients with heterotopia. Regions of interests (ROI) were placed in cerebral cortex, heterotopic gray matter and deep gray matter, including putamen. ANOVA analysis was performed for comparison of different gray matter tissues. Results Heterotopic gray matter showed signal intensities similar to normal gray matter on T1 and T2 weighted MRI. The measured FA of heterotopic gray matter was higher than that of cortical gray matter (0.236 ± 0.011 vs. 0.169 ± 0.015, p < 0.01, one way ANOVA), and slightly lower than that of deep gray matter (0.236 ± 0.011 vs. 0.259 ± 0.016, p < 0.01). Conclusion Increased FA of heterotopic gray matter suggests arrested neuron during radial migration and provides better understanding of neurodevelopment. PMID:20499428

Transfer to Intermediate Forms Following Concept Discrimination by Pigeons: Chimeras and Morphs

ERIC Educational Resources Information Center

Ghosh, Natasha; Lea, S. E. G.; Noury, Malia

2004-01-01

Two experiments examined pigeons' generalization to intermediate forms following training of concept discriminations. In Experiment 1, the training stimuli were sets of images of dogs and cats, and the transfer stimuli were head/body chimeras, which humans tend to categorize more readily in terms of the head part rather than the body part. In…

Survival of timber rattlesnakes (Crotalus horridus) estimated by capture-recapture models in relation to age, sex, color morph, time, and birthplace

USGS Publications Warehouse

Brown, W.S.; Kery, M.; Hines, J.E.

2007-01-01

Juvenile survival is one of the least known elements of the life history of many species, in particular snakes. We conducted a mark–recapture study of Crotalus horridus from 1978–2002 in northeastern New York near the northern limits of the species' range. We marked 588 neonates and estimated annual age-, sex-, and morph-specific recapture and survival rates using the Cormack-Jolly-Seber (CJS) model. Wild-caught neonates (field-born, n  =  407) and neonates produced by captive-held gravid females (lab-born, n  =  181) allowed comparison of the birthplace, or lab treatment effect, in estimated survival. Recapture rates declined from about 10–20% over time while increasing from young to older age classes. Estimated survival rates (S ± 1 SE) in the first year were significantly higher among field-born (black morph: S  =  0.773 ± 0.203; yellow morph: S  =  0.531 ± 0.104) than among lab-born snakes (black morph: S  =  0.411 ± 0.131; yellow morph: S  =  0.301 ± 0.081). Lower birth weights combined with a lack of field exposure until release apparently contributed to the lower survival rate of lab-born snakes. Subsequent survival estimates for 2–4-yr-old snakes were S  =  0.845 ± 0.084 for the black morph and S  =  0.999 (SE not available) for the yellow morph, and for ≥5-yr-old snakes S  =  0.958 ± 0.039 (black morph) and S  =  0.822 ± 0.034 (yellow morph). The most parsimonious model overall contained an independent time trend for survival of each age, morph, and lab-treatment group. For snakes of the first two age groups (ages 1 yr and 2–4 yr), survival tended to decline over the years for both morphs, while for adult snakes (5 yr and older), survival was constant or even slightly increased. Our data on survival and recapture are among the first rigorous estimates of these parameters in a rattlesnake and among the few yet available for any viperid snake. These data are useful for analyses of the life-history strategy, population dynamics, and conservation of this long-lived snake.

Spherical Tensor Calculus for Local Adaptive Filtering

NASA Astrophysics Data System (ADS)

Reisert, Marco; Burkhardt, Hans

In 3D image processing tensors play an important role. While rank-1 and rank-2 tensors are well understood and commonly used, higher rank tensors are rare. This is probably due to their cumbersome rotation behavior which prevents a computationally efficient use. In this chapter we want to introduce the notion of a spherical tensor which is based on the irreducible representations of the 3D rotation group. In fact, any ordinary cartesian tensor can be decomposed into a sum of spherical tensors, while each spherical tensor has a quite simple rotation behavior. We introduce so called tensorial harmonics that provide an orthogonal basis for spherical tensor fields of any rank. It is just a generalization of the well known spherical harmonics. Additionally we propose a spherical derivative which connects spherical tensor fields of different degree by differentiation. Based on the proposed theory we present two applications. We propose an efficient algorithm for dense tensor voting in 3D, which makes use of tensorial harmonics decomposition of the tensor-valued voting field. In this way it is possible to perform tensor voting by linear-combinations of convolutions in an efficient way. Secondly, we propose an anisotropic smoothing filter that uses a local shape and orientation adaptive filter kernel which can be computed efficiently by the use spherical derivatives.

DR-TAMAS: Diffeomorphic Registration for Tensor Accurate alignMent of Anatomical Structures

PubMed Central

Irfanoglu, M. Okan; Nayak, Amritha; Jenkins, Jeffrey; Hutchinson, Elizabeth B.; Sadeghi, Neda; Thomas, Cibu P.; Pierpaoli, Carlo

2016-01-01

In this work, we propose DR-TAMAS (Diffeomorphic Registration for Tensor Accurate alignMent of Anatomical Structures), a novel framework for intersubject registration of Diffusion Tensor Imaging (DTI) data sets. This framework is optimized for brain data and its main goal is to achieve an accurate alignment of all brain structures, including white matter (WM), gray matter (GM), and spaces containing cerebrospinal fluid (CSF). Currently most DTI-based spatial normalization algorithms emphasize alignment of anisotropic structures. While some diffusion-derived metrics, such as diffusion anisotropy and tensor eigenvector orientation, are highly informative for proper alignment of WM, other tensor metrics such as the trace or mean diffusivity (MD) are fundamental for a proper alignment of GM and CSF boundaries. Moreover, it is desirable to include information from structural MRI data, e.g., T1-weighted or T2-weighted images, which are usually available together with the diffusion data. The fundamental property of DR-TAMAS is to achieve global anatomical accuracy by incorporating in its cost function the most informative metrics locally. Another important feature of DR-TAMAS is a symmetric time-varying velocity-based transformation model, which enables it to account for potentially large anatomical variability in healthy subjects and patients. The performance of DR-TAMAS is evaluated with several data sets and compared with other widely-used diffeomorphic image registration techniques employing both full tensor information and/or DTI-derived scalar maps. Our results show that the proposed method has excellent overall performance in the entire brain, while being equivalent to the best existing methods in WM. PMID:26931817

DR-TAMAS: Diffeomorphic Registration for Tensor Accurate Alignment of Anatomical Structures.

PubMed

Irfanoglu, M Okan; Nayak, Amritha; Jenkins, Jeffrey; Hutchinson, Elizabeth B; Sadeghi, Neda; Thomas, Cibu P; Pierpaoli, Carlo

2016-05-15

In this work, we propose DR-TAMAS (Diffeomorphic Registration for Tensor Accurate alignMent of Anatomical Structures), a novel framework for intersubject registration of Diffusion Tensor Imaging (DTI) data sets. This framework is optimized for brain data and its main goal is to achieve an accurate alignment of all brain structures, including white matter (WM), gray matter (GM), and spaces containing cerebrospinal fluid (CSF). Currently most DTI-based spatial normalization algorithms emphasize alignment of anisotropic structures. While some diffusion-derived metrics, such as diffusion anisotropy and tensor eigenvector orientation, are highly informative for proper alignment of WM, other tensor metrics such as the trace or mean diffusivity (MD) are fundamental for a proper alignment of GM and CSF boundaries. Moreover, it is desirable to include information from structural MRI data, e.g., T1-weighted or T2-weighted images, which are usually available together with the diffusion data. The fundamental property of DR-TAMAS is to achieve global anatomical accuracy by incorporating in its cost function the most informative metrics locally. Another important feature of DR-TAMAS is a symmetric time-varying velocity-based transformation model, which enables it to account for potentially large anatomical variability in healthy subjects and patients. The performance of DR-TAMAS is evaluated with several data sets and compared with other widely-used diffeomorphic image registration techniques employing both full tensor information and/or DTI-derived scalar maps. Our results show that the proposed method has excellent overall performance in the entire brain, while being equivalent to the best existing methods in WM. Copyright © 2016 Elsevier Inc. All rights reserved.

Island biology and morphological divergence of the Skyros wall lizard Podarcis gaigeae: a combined role for local selection and genetic drift on color morph frequency divergence?

PubMed Central

2010-01-01

Background Patterns of spatial variation in discrete phenotypic traits can be used to draw inferences about the adaptive significance of traits and evolutionary processes, especially when compared to patterns of neutral genetic variation. Population divergence in adaptive traits such as color morphs can be influenced by both local ecology and stochastic factors such as genetic drift or founder events. Here, we use quantitative color measurements of males and females of Skyros wall lizard, Podarcis gaigeae, to demonstrate that this species is polymorphic with respect to throat color, and the morphs form discrete phenotypic clusters with limited overlap between categories. We use divergence in throat color morph frequencies and compare that to neutral genetic variation to infer the evolutionary processes acting on islet- and mainland populations. Results Geographically close islet- and mainland populations of the Skyros wall lizard exhibit strong divergence in throat color morph frequencies. Population variation in throat color morph frequencies between islets was higher than that between mainland populations, and the effective population sizes on the islets were small (Ne:s < 100). Population divergence (FST) for throat color morph frequencies fell within the neutral FST-distribution estimated from microsatellite markers, and genetic drift could thus not be rejected as an explanation for the pattern. Moreover, for both comparisons among mainland-mainland population pairs and between mainland-islet population pairs, morph frequency divergence was significantly correlated with neutral divergence, further pointing to some role for genetic drift in divergence also at the phenotypic level of throat color morphs. Conclusions Genetic drift could not be rejected as an explanation for the pattern of population divergence in morph frequencies. In spite of an expected stabilising selection, throat color frequencies diverged in the islet populations. These results suggest that there is an interaction between selection and genetic drift causing divergence even at a phenotypic level in these small, subdivided populations. PMID:20813033

De novo Sequencing and Comparative Transcriptomics of Floral Development of the Distylous Species Lithospermum multiflorum

PubMed Central

Cohen, James I.

2016-01-01

Genes controlling the morphological, micromorphological, and physiological components of the breeding system distyly have been hypothesized, but many of the genes have not been investigated throughout development of the two floral morphs. To this end, the present study is an examination of comparative transcriptomes from three stages of development for the floral organs of the morphs of Lithospermum multiflorum. Transcriptomes of flowers of the two morphs, from various stages of development, were sequenced using an Illumina HiSeq 2000. The floral transcriptome of L. multiflorum was assembled, and differential gene expression (DE) was identified between morphs, throughout development. Additionally, Gene Ontology (GO) terms for DE genes were determined. Fewer genes were DE early in development compared to later in development, with more genes highly expressed in the gynoecium of the SS morph and the corolla and androecium of the LS morph. A reciprocal pattern was observed later in development, and many more genes were DE during this latter stage. During early development, DE genes appear to be involved in growth and floral development, and during later development, DE genes seem to affect physiological functions. Interestingly, many genes involved in response to stress were identified as DE between morphs. PMID:28066486

De novo Sequencing and Comparative Transcriptomics of Floral Development of the Distylous Species Lithospermum multiflorum.

PubMed

Cohen, James I

2016-01-01

Genes controlling the morphological, micromorphological, and physiological components of the breeding system distyly have been hypothesized, but many of the genes have not been investigated throughout development of the two floral morphs. To this end, the present study is an examination of comparative transcriptomes from three stages of development for the floral organs of the morphs of Lithospermum multiflorum . Transcriptomes of flowers of the two morphs, from various stages of development, were sequenced using an Illumina HiSeq 2000. The floral transcriptome of L. multiflorum was assembled, and differential gene expression (DE) was identified between morphs, throughout development. Additionally, Gene Ontology (GO) terms for DE genes were determined. Fewer genes were DE early in development compared to later in development, with more genes highly expressed in the gynoecium of the SS morph and the corolla and androecium of the LS morph. A reciprocal pattern was observed later in development, and many more genes were DE during this latter stage. During early development, DE genes appear to be involved in growth and floral development, and during later development, DE genes seem to affect physiological functions. Interestingly, many genes involved in response to stress were identified as DE between morphs.

Parasites and parallel divergence of the number of individual MHC alleles between sympatric three-spined stickleback Gasterosteus aculeatus morphs in Iceland.

PubMed

Natsopoulou, M E; Pálsson, S; Ólafsdóttir, G Á

2012-10-01

Two pairs of sympatric three-spined stickleback Gasterosteus aculeatus morphs and two single morph populations inhabiting mud and lava or rocky benthic habitats in four Icelandic lakes were screened for parasites and genotyped for MHC class IIB diversity. Parasitic infection differed consistently between G. aculeatus from different benthic habitats. Gasterosteus aculeatus from the lava or rocky habitats were more heavily infected in all lakes. A parallel pattern was also found in individual MHC allelic variation with lava G. aculeatus morphs exhibiting lower levels of variation than the mud morphs. Evidence for selective divergence in MHC allele number is ambiguous but supported by two findings in addition to the parallel pattern observed. MHC allele diversity was not consistent with diversity reported at neutral markers (microsatellites) and in Þingvallavatn the most common number of alleles in each morph was associated with lower infection levels. In the Þingvallavatn lava morph, lower infection levels by the two most common parasites, Schistocephalus solidus and Diplostomum baeri, were associated with different MHC allele numbers. © 2012 The Authors. Journal of Fish Biology © 2012 The Fisheries Society of the British Isles.

Recent Results from NASA's Morphing Project

NASA Technical Reports Server (NTRS)

McGowan, Anna-Maria R.; Washburn, Anthony E.; Horta, Lucas G.; Bryant, Robert G.; Cox, David E.; Siochi, Emilie J.; Padula, Sharon L.; Holloway, Nancy M.

2002-01-01

The NASA Morphing Project seeks to develop and assess advanced technologies and integrated component concepts to enable efficient, multi-point adaptability in air and space vehicles. In the context of the project, the word "morphing" is defined as "efficient, multi-point adaptability" and may include macro, micro, structural and/or fluidic approaches. The project includes research on smart materials, adaptive structures, micro flow control, biomimetic concepts, optimization and controls. This paper presents an updated overview of the content of the Morphing Project including highlights of recent research results.

UNUSUAL PHENOLIC COMPOUNDS CONTRIBUTE TO ECOPHYSIOLOGICAL PERFORMANCE IN THE PURPLE-COLORED GREEN ALGA ZYGOGONIUM ERICETORUM (ZYGNEMATOPHYCEAE, STREPTOPHYTA) FROM A HIGH-ALPINE HABITAT

PubMed Central

Aigner, Siegfried; Remias, Daniel; Karsten, Ulf; Holzinger, Andreas

2013-01-01

The filamentous green alga Zygogonium ericetorum (Zygnematophyceae, Streptophyta) was collected in a high-alpine rivulet in Tyrol, Austria. Two different morphotypes of this alga were found: a purple morph with a visible purple vacuolar content and a green morph lacking this coloration. These morphotypes were compared with respect to their secondary metabolites, ultrastructure, and ecophysiological properties. Colorimetric tests with aqueous extracts of the purple morph indicated the presence of soluble compounds such as phenolics and hydrolyzable tannins. High-performance liquid chromatography-screening showed that Z. ericetorum contained several large phenolic peaks with absorption maxima at ∼280 nm and sometimes with minor maxima at ∼380 nm. Such compounds are uncommon for freshwater green microalgae, and could contribute to protect the organism against increased UV and visible (VIS) irradiation. The purple Z. ericetorum contained larger amounts (per dry weight) of the putative phenolic substances than the green morph; exposure to irradiation may be a key factor for accumulation of these phenolic compounds. Transmission electron microscopy of the purple morph showed massive vacuolization with homogenous medium electron-dense content in the cell periphery, which possibly contains the secondary compounds. In contrast, the green morph had smaller, electron-translucent vacuoles. The ecophysiological data on photosynthesis and desiccation tolerance indicated that increasing photon fluence densities led to much higher relative electron transport rates (rETR) in the purple than in the green morph. These data suggest that the secondary metabolites in the purple morph are important for light acclimation in high-alpine habitats. However, the green morph recovered better after 4 d of rehydration following desiccation stress. PMID:25810559

The colour of paternity: extra-pair paternity in the wild Gouldian finch does not appear to be driven by genetic incompatibility between morphs.

PubMed

Bolton, P E; Rollins, L A; Brazill-Boast, J; Kim, K-W; Burke, T; Griffith, S C

2017-01-01

In socially monogamous species, individuals can use extra-pair paternity and offspring sex allocation as adaptive strategies to ameliorate costs of genetic incompatibility with their partner. Previous studies on domesticated Gouldian finches (Erythrura gouldiae) demonstrated a genetic incompatibility between head colour morphs, the effects of which are more severe in female offspring. Domesticated females use differential sex allocation, and extra-pair paternity with males of compatible head colour, to reduce fitness costs associated with incompatibility in mixed-morph pairings. However, laboratory studies are an oversimplification of the complex ecological factors experienced in the wild and may only reflect the biology of a domesticated species. This study aimed to examine the patterns of parentage and sex ratio bias with respect to colour pairing combinations in a wild population of the Gouldian finch. We utilized a novel PCR assay that allowed us to genotype the morph of offspring before the morph phenotype develops and to explore bias in morph paternity and selection at the nest. Contrary to previous findings in the laboratory, we found no effect of pairing combinations on patterns of extra-pair paternity, offspring sex ratio or selection on morphs in nestlings. In the wild, the effect of morph incompatibility is likely much smaller, or absent, than was observed in the domesticated birds. Furthermore, the previously studied domesticated population is genetically differentiated from the wild population, consistent with the effects of domestication. It is possible that the domestication process fostered the emergence (or enhancement) of incompatibility between colour morphs previously demonstrated in the laboratory. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

The endocrine-genetic basis of life-history variation: the relationship between the ecdysteroid titer and morph-specific reproduction in the wing-polymorphic cricket Gryllus firmus.

PubMed

Zera, A J; Bottsford, J

2001-03-01

The hormonal basis of variation in life-history traits is a poorly studied topic in life-history evolution. An important step in identifying the endocrine-genetic causes of life-history variation is documenting statistical and functional associations between hormone titers and genotypes/phenotypes that vary in life-history traits. To this end, we compared the blood ecdysteroid titer and the mass of the ovaries during the first week of adulthood among a flight-capable morph and two flightless morphs of the wing-polymorphic cricket Gryllus firmus. Ecdysteroids are a group of structurally related hormones that regulate many important aspects of reproduction in insects. Both the ecdysteroid titer and ovarian mass were significantly higher in each of two flightless morphs compared with the flight-capable morph throughout the first week of adulthood. Genetically based differences in the ecdysteroid titer and ovarian mass between morphs from different selected lines were similar to phenotypically based differences among morphs from the same control (unselected) lines. By day 7 of adulthood, ovaries were typically 200-400% larger and the ecdysteroid titer was 60-300% higher in flightless versus the flight-capable morph. In addition, highly significant, positive, phenotypic correlations were observed between the ecdysteroid titer and ovarian mass in pooled samples of the two flightless and flight-capable crickets from control lines or from selected lines. The ecdysteroid titer was sufficiently elevated in the flightless morphs to account for their elevated ovarian growth. This is the first direct documentation that naturally occurring phenotypes/genotypes that differ in early fecundity, a key life-history trait, also differ phenotypically and genetically in the titer of a key reproductive hormone that potentially regulates that trait.

Differentiation of fibroblastic meningiomas from other benign subtypes using diffusion tensor imaging.

PubMed

Tropine, Andrei; Dellani, Paulo D; Glaser, Martin; Bohl, Juergen; Plöner, Till; Vucurevic, Goran; Perneczky, Axel; Stoeter, Peter

2007-04-01

To differentiate fibroblastic meningiomas, usually considered to be of a hard consistency, from other benign subtypes using diffusion tensor imaging (DTI). From DTI data sets of 30 patients with benign meningiomas, we calculated diffusion tensors and mean diffusivity (MD) and fractional anisotropy (FA) maps as well as barycentric maps representing the geometrical shape of the tensors. The findings were compared to postoperative histology. The study was approved by the local ethics committee, and informed consent was given by the patients. According to one-way analysis of variance (ANOVA), FA was the best parameter to differentiate between the subtypes (F=32.2; p<0.0001). Regarding tensor shape, endothelial meningiomas were represented by spherical tensors (80%) corresponding to isotropic diffusion, whereas the fibroblastic meningiomas showed a high percentage (43%) of nonspherical tensors, indicating planar or longitudinal diffusion. The difference was highly significant (F=28.4; p<0.0001) and may be due to the fascicular arrangement of long spindle-shaped tumor cells and the high content of intra- and interfascicular fibers as shown in the histology. In addition, a capsule-like rim of the in-plane diffusion surrounded most meningiomas irrespective of their histological type. If these results correlate to the intraoperative findings of meningioma consistency, DTI-based measurement of FA and analysis of the shape of the diffusion tensor is a promising method to differentiate between fibroblastic and other subtypes of benign meningiomas in order to get information about their "hard" or "soft" consistency prior to removal. Copyright (c) 2007 Wiley-Liss, Inc.

Mapping Magnetic Susceptibility Anisotropies of White Matter in vivo in the Human Brain at 7 Tesla

PubMed Central

Li, Xu; Vikram, Deepti S; Lim, Issel Anne L; Jones, Craig K; Farrell, Jonathan A.D.; van Zijl, Peter C. M.

2012-01-01

High-resolution magnetic resonance phase- or frequency- shift images acquired at high field show contrast related to magnetic susceptibility differences between tissues. Such contrast varies with the orientation of the organ in the field, but the development of quantitative susceptibility mapping (QSM) has made it possible to reproducibly image the intrinsic tissue susceptibility contrast. However, recent studies indicate that magnetic susceptibility is anisotropic in brain white matter and, as such, needs to be described by a symmetric second-rank tensor (χ¯¯). To fully determine the elements of this tensor, it would be necessary to acquire frequency data at six or more orientations. Assuming cylindrical symmetry of the susceptibility tensor in myelinated white matter fibers, we propose a simplified method to reconstruct the susceptibility tensor in terms of a mean magnetic susceptibility, MMS = (χ∥ + 2χ⊥)/3 and a magnetic susceptibility anisotropy, MSA = χ∥ − χ⊥, where χ∥ and χ⊥ are susceptibility parallel and perpendicular to the white matter fiber direction, respectively. Computer simulations show that with a practical head rotation angle of around 20°–30°, four head orientations suffice to reproducibly reconstruct the tensor with good accuracy. We tested this approach on whole brain 1×1×1 mm3 frequency data acquired from five healthy subjects at 7 T. The frequency information from phase images collected at four head orientations was combined with the fiber direction information extracted from diffusion tensor imaging (DTI) to map the white matter susceptibility tensor. The MMS and MSA were quantified for regions in several large white matter fiber structures, including the corona radiata, posterior thalamic radiation and corpus callosum. MMS ranged from −0.037 to −0.053 ppm (referenced to CSF being about zero). MSA values could be quantified without the need for a reference and ranged between 0.004 and 0.029 ppm, in line with the expectation that the susceptibility perpendicular to the fiber is more diamagnetic than the one parallel to it. PMID:22561358

Intermediate Templates Guided Groupwise Registration of Diffusion Tensor Images

PubMed Central

Jia, Hongjun; Yap, Pew-Thian; Wu, Guorong; Wang, Qian; Shen, Dinggang

2010-01-01

Registration of a population of diffusion tensor images (DTIs) is one of the key steps in medical image analysis, and it plays an important role in the statistical analysis of white matter related neurological diseases. However, pairwise registration with respect to a pre-selected template may not give precise results if the selected template deviates significantly from the distribution of images. To cater for more accurate and consistent registration, a novel framework is proposed for groupwise registration with the guidance from one or more intermediate templates determined from the population of images. Specifically, we first use a Euclidean distance, defined as a combinative measure based on the FA map and ADC map, for gauging the similarity of each pair of DTIs. A fully connected graph is then built with each node denoting an image and each edge denoting the distance between a pair of images. The root template image is determined automatically as the image with the overall shortest path length to all other images on the minimum spanning tree (MST) of the graph. Finally, a sequence of registration steps is applied to progressively warping each image towards the root template image with the help of intermediate templates distributed along its path to the root node on the MST. Extensive experimental results using diffusion tensor images of real subjects indicate that registration accuracy and fiber tract alignment are significantly improved, compared with the direct registration from each image to the root template image. PMID:20851197

Multiple exaggerated weapon morphs: a novel form of male polymorphism in harvestmen.

PubMed

Painting, Christina J; Probert, Anna F; Townsend, Daniel J; Holwell, Gregory I

2015-11-06

Alternative reproductive tactics in animals are commonly associated with distinct male phenotypes resulting in polymorphism of sexually selected weapons such as horns and spines. Typically, morphs are divided between small (unarmed) and large (armed) males according to one or more developmental thresholds in association with body size. Here, we describe remarkable weapon trimorphism within a single species, where two exaggerated weapon morphs and a third morph with reduced weaponry are present. Male Pantopsalis cheliferoides harvestmen display exaggerated chelicerae (jaws) which are highly variable in length among individuals. Across the same body size spectrum, however, some males belong to a distinct second exaggerated morph which possesses short, broad chelicerae. Multiple weapon morphs in a single species is a previously unknown phenomenon and our findings have significant implications for understanding weapon diversity and maintenance of polymorphism. Specifically, this species will be a valuable model for testing how weapons diverge by being able to test directly for the circumstances under which a certain weapon type is favoured and how weapon shape relates to performance.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gray, R.H.

A three-year field study was conducted in Illinois to investigate seasonal, annual and geographic variation in color morph proportions of the cricket frog, Acris crepitans. Life history information (i.e., time of overwintering, emergence of adults in spring, breeding, metamorphosis, emergence of juveniles in summer, and growth and survival) for A. crepitans color morphs was compared to evaluate the potential adaptive significance of this polymorphism. Although seasonal variations in color morph proportions were not significant, some annual and geographic differences were. No differences were found among morphs related to the timing of various life history events. Studies of individual movements, dispersal,more » growth and survivorship also revealed no differences among morphs. Comparison of these data, as well as physiological and behavioral data for A. crepitans from Illinois, with similar data from Texas and elsewhere suggests that different factors must operate throughout the species range to maintain this color polymorphism. Chance may be a major factor in determining color morph proportions in localized populations in Illinois. 22 references, 5 figures, 3 tables.« less

Comparative proteomic analysis of eggplant (Solanum melongena L.) heterostylous pistil development

PubMed Central

Li, Wenjia; Jiang, Yaqing; Song, Shiwei; Li, Yan; Chen, Riyuan

2017-01-01

Heterostyly is a common floral polymorphism, but the proteomic basis of this trait is still largely unexplored. In this study, self- and cross-pollination of L-morph and S-morph flowers and comparison of embryo sac development in eggplant (Solanum melongena L.) suggested that lower fruit set from S-morph flowers results from stigma-pollen incompatibility. To explore the molecular mechanism underlying heterostyly development, we conducted isobaric tags for relative and absolute quantification (iTRAQ) proteomic analysis of eggplant pistils for L- and S-morph flowers. A total of 5,259 distinct proteins were identified during heterostyly development. Compared S-morph flowers with L-morph, we discovered 57 and 184 differentially expressed proteins (DEPs) during flower development and maturity, respectively. Quantitative real time polymerase chain reactions were used for nine genes to verify DEPs from the iTRAQ approach. During flower development, DEPs were mainly involved in morphogenesis, biosynthetic processes, and metabolic pathways. At flower maturity, DEPs primarily participated in biosynthetic processes, metabolic pathways, and the formation of ribosomes and proteasomes. Additionally, some proteins associated with senescence and programmed cell death were found to be upregulated in S-morph pistils, which may lead to the lower fruit set in S-morph flowers. Although the exact roles of these related proteins are not yet known, this was the first attempt to use an iTRAQ approach to analyze proteomes of heterostylous eggplant flowers, and these results will provide insights into biochemical events taking place during the development of heterostyly. PMID:28586360

PROTECTED POLYMORPHISMS AND EVOLUTIONARY STABILITY OF PATCH-SELECTION STRATEGIES IN STOCHASTIC ENVIRONMENTS

PubMed Central

EVANS, STEVEN N.; HENING, ALEXANDRU; SCHREIBER, SEBASTIAN J.

2015-01-01

We consider a population living in a patchy environment that varies stochastically in space and time. The population is composed of two morphs (that is, individuals of the same species with different genotypes). In terms of survival and reproductive success, the associated phenotypes differ only in their habitat selection strategies. We compute invasion rates corresponding to the rates at which the abundance of an initially rare morph increases in the presence of the other morph established at equilibrium. If both morphs have positive invasion rates when rare, then there is an equilibrium distribution such that the two morphs coexist; that is, there is a protected polymorphism for habitat selection. Alternatively, if one morph has a negative invasion rate when rare, then it is asymptotically displaced by the other morph under all initial conditions where both morphs are present. We refine the characterization of an evolutionary stable strategy for habitat selection from [Schreiber, 2012] in a mathematically rigorous manner. We provide a necessary and sufficient condition for the existence of an ESS that uses all patches and determine when using a single patch is an ESS. We also provide an explicit formula for the ESS when there are two habitat types. We show that adding environmental stochasticity results in an ESS that, when compared to the ESS for the corresponding model without stochasticity, spends less time in patches with larger carrying capacities and possibly makes use of sink patches, thereby practicing a spatial form of bet hedging. PMID:25151369

Morph-specific differences in reproductive success in the distylous Primula veris in a context of habitat fragmentation

NASA Astrophysics Data System (ADS)

Van Rossum, Fabienne; De Sousa, Sara Campos; Triest, Ludwig

2006-11-01

Heterostylous self-incompatible plant species are particularly sensitive to habitat fragmentation and to disruption of pollination processes because of the need of intermorph cross-pollination for producing seeds. Heterostyly is characterized by sexual polymorphism through the occurrence of two (distyly) or three (tristyly) morph types that differ in floral traits (style length and anther position). We examined whether the long-styled (pin) and short-styled (thrum) morph types show differences in reproductive components and responses to habitat fragmentation in the distylous, self-incompatible perennial herb Primula veris. We documented reproductive components for pin and thrum individuals and their relationships with population size, plant density and morph ratio (pin frequency), in nine populations from Flanders (northern Belgium) located in fragmented habitats of the intensively used agricultural landscape. Seed abortion increased in small populations as a result of inbreeding depression. Fruit set increased with plant density. Seed set was positively related to pin proportion. Seed set was higher for pin than thrum in small populations, but lower in large populations. Two hypotheses can be considered to explain these morph-specific differences: a pollen transfer asymmetry, and a reproductive advantage for the partially self-compatible pin morph. Morph types appear to respond differently to habitat fragmentation constraints. A floral morph type showing partial self-compatibility may be favored in populations under pollination failure, because it can increase reproductive success and mating opportunities through intramorph crosses.

Evolutionary flight and enabling smart actuator devices

NASA Astrophysics Data System (ADS)

Manzo, Justin; Garcia, Ephrahim

2007-04-01

Recent interest in morphing vehicles with multiple, optimized configurations has led to renewed research on biological flight. The flying vertebrates - birds, bats, and pterosaurs - all made or make use of various morphing devices to achieve lift to suit rapidly changing flight demands, including maneuvers as complex as perching and hovering. The first part of this paper will discuss these devices, with a focus on the morphing elements and structural strong suits of each creature. Modern flight correlations to these devices will be discussed and analyzed as valid adaptations of these evolutionary traits. The second part of the paper will focus on the use of active joint structures for use in morphing aircraft devices. Initial work on smart actuator devices focused on NASA Langley's Hyper-Elliptical Cambered Span (HECS) wing platform, which led to development of a discretized spanwise curvature effector. This mechanism uses shape memory alloy (SMA) as the sole morphing actuator, allowing fast rotation with lightweight components at the expense of energy inefficiency. Phase two of morphing actuator development will add an element of active rigidity to the morphing structure, in the form of shape memory polymer (SMP). Employing a composite structure of polymer and alloy, this joint will function as part of a biomimetic morphing actuator system in a more energetically efficient manner. The joint is thermally actuated to allow compliance on demand and rigidity in the nominal configuration. Analytical and experimental joint models are presented, and potential applications on a bat-wing aircraft structure are outlined.

Impairment of facial recognition in patients with right cerebral infarcts quantified by computer aided "morphing".

PubMed Central

Rösler, A; Lanquillon, S; Dippel, O; Braune, H J

1997-01-01

OBJECTIVE: To investigate where facial recognition is located anatomically and to establish whether there is a graded transition from unimpaired recognition of faces to complete prosopagnosia after infarctions in the territory of the middle cerebral artery. METHODS: A computerised morphing program was developed which shows 30 frames gradually changing from portrait photographs of unfamiliar persons to those of well known persons. With a standardised protocol, 31 patients with right and left sided infarctions in the territory of the middle cerebral artery and an age and sex matched control group were compared by non-parametric tests. RESULTS AND CONCLUSION: Facial recognition in patients with right sided lesions was significantly impaired compared with controls and with patients with left sided lesions. A graded impairment in facial recognition in patients with right sided ischaemic infarcts in the territory of the middle cerebral artery seems to exist. Images PMID:9069481

Metaphorical mapping between raw-cooked food and strangeness-familiarity in Chinese culture.

PubMed

Deng, Xiaohong; Qu, Yuan; Zheng, Huihui; Lu, Yang; Zhong, Xin; Ward, Anne; Li, Zijun

2017-02-01

Previous research has demonstrated metaphorical mappings between physical coldness-warmth and social distance-closeness. Since the concepts of interpersonal warmth are frequently expressed in terms of food-related words in Chinese, the present study sought to explore whether the concept of raw-cooked food could be unconsciously and automatically mapped onto strangeness-familiarity. After rating the nutritive value of raw or cooked foods, participants were presented with morphing movies in which their acquaintances gradually transformed into strangers or strangers gradually morphed into acquaintances, and were asked to stop the movies when the combined images became predominantly target faces. The results demonstrated that unconscious and automatic metaphorical mappings between raw-cooked food and strangeness-familiarity exist. This study provides a foundation for testing whether Chinese people can think about interpersonal familiarity using mental representations of raw-cooked food and supports cognitive metaphor theory from a crosslinguistic perspective.

White matter tractography using diffusion tensor deflection.

PubMed

Lazar, Mariana; Weinstein, David M; Tsuruda, Jay S; Hasan, Khader M; Arfanakis, Konstantinos; Meyerand, M Elizabeth; Badie, Benham; Rowley, Howard A; Haughton, Victor; Field, Aaron; Alexander, Andrew L

2003-04-01

Diffusion tensor MRI provides unique directional diffusion information that can be used to estimate the patterns of white matter connectivity in the human brain. In this study, the behavior of an algorithm for white matter tractography is examined. The algorithm, called TEND, uses the entire diffusion tensor to deflect the estimated fiber trajectory. Simulations and imaging experiments on in vivo human brains were performed to investigate the behavior of the tractography algorithm. The simulations show that the deflection term is less sensitive than the major eigenvector to image noise. In the human brain imaging experiments, estimated tracts were generated in corpus callosum, corticospinal tract, internal capsule, corona radiata, superior longitudinal fasciculus, inferior longitudinal fasciculus, fronto-occipital fasciculus, and uncinate fasciculus. This approach is promising for mapping the organizational patterns of white matter in the human brain as well as mapping the relationship between major fiber trajectories and the location and extent of brain lesions. Copyright 2003 Wiley-Liss, Inc.

A morphing-based scheme for large deformation analysis with stereo-DIC

NASA Astrophysics Data System (ADS)

Genovese, Katia; Sorgente, Donato

2018-05-01

A key step in the DIC-based image registration process is the definition of the initial guess for the non-linear optimization routine aimed at finding the parameters describing the pixel subset transformation. This initialization may result very challenging and possibly fail when dealing with pairs of largely deformed images such those obtained from two angled-views of not-flat objects or from the temporal undersampling of rapidly evolving phenomena. To address this problem, we developed a procedure that generates a sequence of intermediate synthetic images for gradually tracking the pixel subset transformation between the two extreme configurations. To this scope, a proper image warping function is defined over the entire image domain through the adoption of a robust feature-based algorithm followed by a NURBS-based interpolation scheme. This allows a fast and reliable estimation of the initial guess of the deformation parameters for the subsequent refinement stage of the DIC analysis. The proposed method is described step-by-step by illustrating the measurement of the large and heterogeneous deformation of a circular silicone membrane undergoing axisymmetric indentation. A comparative analysis of the results is carried out by taking as a benchmark a standard reference-updating approach. Finally, the morphing scheme is extended to the most general case of the correspondence search between two largely deformed textured 3D geometries. The feasibility of this latter approach is demonstrated on a very challenging case: the full-surface measurement of the severe deformation (> 150% strain) suffered by an aluminum sheet blank subjected to a pneumatic bulge test.

Diffusion Tensor Imaging Tractography Detecting Isolated Oculomotor Nerve Damage After Traumatic Brain Injury.

PubMed

Jacquesson, Timothée; Frindel, Carole; Cotton, Francois

2017-04-01

A 24-year-old woman was hit by a bus and suffered an isolated complete oculomotor nerve palsy. Computed tomography scan did not show a skull base fracture. T2*-weighted magnetic resonance imaging revealed petechial cerebral hemorrhages sparing the brainstem. T2 constructive interference in steady state suggested a partial sectioning of the left oculomotor nerve just before entering the superior orbital fissure. Diffusion tensor imaging fiber tractography confirmed a sharp arrest of the left oculomotor nerve. This recent imaging technique could be of interest to assess white fiber damage and help make a diagnosis or prognosis. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection of electrophysiology catheters in noisy fluoroscopy images.

PubMed

Franken, Erik; Rongen, Peter; van Almsick, Markus; ter Haar Romeny, Bart

2006-01-01

Cardiac catheter ablation is a minimally invasive medical procedure to treat patients with heart rhythm disorders. It is useful to know the positions of the catheters and electrodes during the intervention, e.g. for the automatization of cardiac mapping. Our goal is therefore to develop a robust image analysis method that can detect the catheters in X-ray fluoroscopy images. Our method uses steerable tensor voting in combination with a catheter-specific multi-step extraction algorithm. The evaluation on clinical fluoroscopy images shows that especially the extraction of the catheter tip is successful and that the use of tensor voting accounts for a large increase in performance.

Low-Dose Dynamic Cerebral Perfusion Computed Tomography Reconstruction via Kronecker-Basis Representation Tensor Sparsity Regularization

PubMed Central

Zeng, Dong; Xie, Qi; Cao, Wenfei; Lin, Jiahui; Zhang, Hao; Zhang, Shanli; Huang, Jing; Bian, Zhaoying; Meng, Deyu; Xu, Zongben; Liang, Zhengrong; Chen, Wufan

2017-01-01

Dynamic cerebral perfusion computed tomography (DCPCT) has the ability to evaluate the hemodynamic information throughout the brain. However, due to multiple 3-D image volume acquisitions protocol, DCPCT scanning imposes high radiation dose on the patients with growing concerns. To address this issue, in this paper, based on the robust principal component analysis (RPCA, or equivalently the low-rank and sparsity decomposition) model and the DCPCT imaging procedure, we propose a new DCPCT image reconstruction algorithm to improve low dose DCPCT and perfusion maps quality via using a powerful measure, called Kronecker-basis-representation tensor sparsity regularization, for measuring low-rankness extent of a tensor. For simplicity, the first proposed model is termed tensor-based RPCA (T-RPCA). Specifically, the T-RPCA model views the DCPCT sequential images as a mixture of low-rank, sparse, and noise components to describe the maximum temporal coherence of spatial structure among phases in a tensor framework intrinsically. Moreover, the low-rank component corresponds to the “background” part with spatial–temporal correlations, e.g., static anatomical contribution, which is stationary over time about structure, and the sparse component represents the time-varying component with spatial–temporal continuity, e.g., dynamic perfusion enhanced information, which is approximately sparse over time. Furthermore, an improved nonlocal patch-based T-RPCA (NL-T-RPCA) model which describes the 3-D block groups of the “background” in a tensor is also proposed. The NL-T-RPCA model utilizes the intrinsic characteristics underlying the DCPCT images, i.e., nonlocal self-similarity and global correlation. Two efficient algorithms using alternating direction method of multipliers are developed to solve the proposed T-RPCA and NL-T-RPCA models, respectively. Extensive experiments with a digital brain perfusion phantom, preclinical monkey data, and clinical patient data clearly demonstrate that the two proposed models can achieve more gains than the existing popular algorithms in terms of both quantitative and visual quality evaluations from low-dose acquisitions, especially as low as 20 mAs. PMID:28880164

Exploring the perceptual spaces of faces, cars and birds in children and adults

PubMed Central

Tanaka, James W.; Meixner, Tamara L.; Kantner, Justin

2011-01-01

While much developmental research has focused on the strategies that children employ to recognize faces, less is known about the principles governing the organization of face exemplars in perceptual memory. In this study, we tested a novel, child-friendly paradigm for investigating the organization of face, bird and car exemplars. Children ages 3–4, 5–6, 7–8, 9–10, 11–12 and adults were presented with 50/50 morphs of typical and atypical face, bird and car parent images. Participants were asked to judge whether the 50/50 morph more strongly resembled the typical or the atypical parent image. Young and older children and adults showed a systematic bias to the atypical faces and birds, but no bias toward the atypical cars. Collectively, these findings argue that by the age of 3, children encode and organize faces, birds and cars in a perceptual space that is strikingly similar to that of adults. Category organization for both children and adults follows Krumhansl’s (1978) distance-density principle in which the similarity between two exemplars is jointly determined by their physical appearance and the density of neighboring exemplars in the perceptual space. PMID:21676096

4.7-T diffusion tensor imaging of acute traumatic peripheral nerve injury

PubMed Central

Boyer, Richard B.; Kelm, Nathaniel D.; Riley, D. Colton; Sexton, Kevin W.; Pollins, Alonda C.; Shack, R. Bruce; Dortch, Richard D.; Nanney, Lillian B.; Does, Mark D.; Thayer, Wesley P.

2015-01-01

Diagnosis and management of peripheral nerve injury is complicated by the inability to assess microstructural features of injured nerve fibers via clinical examination and electrophysiology. Diffusion tensor imaging (DTI) has been shown to accurately detect nerve injury and regeneration in crush models of peripheral nerve injury, but no prior studies have been conducted on nerve transection, a surgical emergency that can lead to permanent weakness or paralysis. Acute sciatic nerve injuries were performed microsurgically to produce multiple grades of nerve transection in rats that were harvested 1 hour after surgery. High-resolution diffusion tensor images from ex vivo sciatic nerves were obtained using diffusion-weighted spin-echo acquisitions at 4.7 T. Fractional anisotropy was significantly reduced at the injury sites of transected rats compared with sham rats. Additionally, minor eigenvalues and radial diffusivity were profoundly elevated at all injury sites and were negatively correlated to the degree of injury. Diffusion tensor tractography showed discontinuities at all injury sites and significantly reduced continuous tract counts. These findings demonstrate that high-resolution DTI is a promising tool for acute diagnosis and grading of traumatic peripheral nerve injuries. PMID:26323827

Diffusion tensor imaging in evaluation of human skeletal muscle injury.

PubMed

Zaraiskaya, Tatiana; Kumbhare, Dinesh; Noseworthy, Michael D

2006-08-01

To explore the capability and reliability of diffusion tensor magnetic resonance imaging (DTI) in the evaluation of human skeletal muscle injury. DTI of four patients with gastrocnemius and soleus muscles injuries was compared to eight healthy controls. Imaging was performed using a GE 3.0T short-bore scanner. A diffusion-weighted 2D spin echo echo-planar imaging (EPI) pulse sequence optimized for skeletal muscle was used. From a series of axially acquired diffusion tensor images the diffusion tensor eigenparameters (eigenvalues and eigenvectors), fractional anisotropy (FA), and apparent diffusion coefficient (ADC) were calculated and compared for injured and healthy calf muscles. Two dimensional (2D) projection maps of the principal eigenvectors were plotted to visualize the healthy and pathologic muscle fiber architectures. Clear differences in FA and ADC were observed in injured skeletal muscle, compared to healthy controls. Mean control FA was 0.23 +/- 0.02 for medial and lateral gastrocnemius (mg and lg) muscles, and 0.20 +/- 0.02 for soleus (sol) muscles. In all patients FA values were reduced compared to controls, to as low as 0.08 +/- 0.02. The ADC in controls ranged from 1.41 to 1.31 x 10(-9) m(2)/second, while in patients this was consistently higher. The 2D projection maps revealed muscle fiber disorder in injured calves, while in healthy controls the 2D projection maps show a well organized (ordered) fiber structure. DTI is a suitable method to assess human calf muscle injury.

The application of thermally induced multistable composites to morphing aircraft structures

NASA Astrophysics Data System (ADS)

Mattioni, Filippo; Weaver, Paul M.; Potter, Kevin D.; Friswell, Michael I.

2008-03-01

One approach to morphing aircraft is to use bistable or multistable structures that have two or more stable equilibrium configurations to define a discrete set of shapes for the morphing structure. Moving between these stable states may be achieved using an actuation system or by aerodynamic loads. This paper considers three concepts for morphing aircraft based on multistable structures, namely a variable sweep wing, bistable blended winglets and a variable camber trailing edge. The philosophy behind these concepts is outlined, and simulated and experimental results are given.

AVST Morphing Project Research Summaries in Fiscal Year 2001

NASA Technical Reports Server (NTRS)

McGowan, Anna-Maria R.

2002-01-01

The Morphing project at the National Aeronautics and Space Agency's Langley Research Center is part of the Aerospace Vehicle Systems Program Office that conducts fundamental research on advanced technologies for future flight vehicles. The objectives of the Morphing project are to develop and assess advanced technologies and integrated component concepts to enable efficient, multi-point adaptability in air and space vehicles. In the context of the project, the word "morphing" is defined as "efficient, multi-point adaptability" and may include micro or macro, structural or fluidic approaches. The current document on the Morphing project is a compilation of research summaries and other information on the project from fiscal year 2001. The focus of this document is to provide a brief overview of the project content, technical results and lessons learned from fiscal year 2001.

Preliminary Aerodynamic Investigation of Fan Rotor Blade Morphing

NASA Technical Reports Server (NTRS)

Tweedt, Daniel L.

2012-01-01

Various new technologies currently under development may enable controlled blade shape variability, or so-called blade morphing, to be practically employed in aircraft engine fans and compressors in the foreseeable future. The current study is a relatively brief, preliminary computational fluid dynamics investigation aimed at partially demonstrating and quantifying the aerodynamic potential of fan rotor blade morphing. The investigation is intended to provide information useful for near-term planning, as well as aerodynamic solution data sets that can be subsequently analyzed using advanced acoustic diagnostic tools, for the purpose of making fan noise comparisons. Two existing fan system models serve as baselines for the investigation: the Advanced Ducted Propulsor fan with a design tip speed of 806 ft/sec and a pressure ratio of 1.294, and the Source Diagnostic Test fan with a design tip speed of 1215 ft/sec and a pressure ratio of 1.470. Both are 22-in. sub-scale, low-noise research fan/nacelle models that have undergone extensive experimental testing in the 9- by 15-foot Low Speed Wind Tunnel at the NASA Glenn Research Center. The study, restricted to fan rotor blade morphing only, involves a fairly simple blade morphing technique. Specifically, spanwise-linear variations in rotor blade-section setting angle are applied to alter the blade shape; that is, the blade is linearly retwisted from hub to tip. Aerodynamic performance comparisons are made between morphed-blade and corresponding baseline configurations on the basis of equal fan system thrust, where rotor rotational speed for the morphed-blade fan is varied to change the thrust level for that configuration. The results of the investigation confirm that rotor blade morphing could be a useful technology, with the potential to enable significant improvements in fan aerodynamic performance. Even though the study is very limited in scope and confined to simple geometric perturbations of two existing fan systems, the aerodynamic effectiveness of blade morphing is demonstrated by the configurations analyzed. In particular, for the Advanced Ducted Propulsor fan it is demonstrated that the performance levels of the original variable-pitch baseline design can be achieved using blade morphing instead of variable pitch, and for the Source Diagnostic Test fan the performance at important off-design operating points is substantially increased with blade morphing.

Using Perturbation Theory to Compute the Morphological Similarity of Diffusion Tensors

PubMed Central

Bansal, Ravi; Staib, Lawrence H.; Xu, Dongrong; Laine, Andrew F.; Royal, Jason; Peterson, Bradley S.

2008-01-01

Computing the morphological similarity of Diffusion Tensors (DTs) at neighboring voxels within a DT image, or at corresponding locations across different DT images, is a fundamental and ubiquitous operation in the post-processing of DT images. The morphological similarity of DTs typically has been computed using either the Principal Directions (PDs) of DTs (i.e., the direction along which water molecules diffuse preferentially) or their tensor elements. Although comparing PDs allows the similarity of one morphological feature of DTs to be visualized directly in eigenspace, this method takes into account only a single eigenvector, and it is therefore sensitive to the presence of noise in the images that can introduce error into the estimation of that vector. Although comparing tensor elements, rather than PDs, is comparatively more robust to the effects of noise, the individual elements of a given tensor do not directly reflect the diffusion properties of water molecules. We propose a measure for computing the morphological similarity of DTs that uses both their eigenvalues and eigenvectors, and that also accounts for the noise levels present in DT images. Our measure presupposes that DTs in a homogeneous region within or across DT images are random perturbations of one another in the presence of noise. The similarity values that are computed using our method are smooth (in the sense that small changes in eigenvalues and eigenvectors cause only small changes in similarity), and they are symmetric when differences in eigenvalues and eigenvectors are also symmetric. In addition, our method does not presuppose that the corresponding eigenvectors across two DTs have been identified accurately, an assumption that is problematic in the presence of noise. Because we compute the similarity between DTs using their eigenspace components, our similarity measure relates directly to both the magnitude and the direction of the diffusion of water molecules. The favorable performance characteristics of our measure offer the prospect of substantially improving additional post-processing operations that are commonly performed on DTI datasets, such as image segmentation, fiber tracking, noise filtering, and spatial normalization. PMID:18450533

Development and Validation of the Morphing Fear Questionnaire (MFQ).

PubMed

Zysk, Eva; Shafran, Roz; Williams, Tim I; Melli, Gabriele

2016-11-01

Morphing fears (also called transformation obsessions) involve concerns that a person may become contaminated by and acquire undesirable characteristics of others. These symptoms are found in patients with obsessive-compulsive disorder (OCD) and are thought to be related to mental contamination. Given the high levels of distress and interference morphing fears can cause, a reliable and valid assessment measure is needed. This article describes the development and evaluation of the Morphing Fear Questionnaire (MFQ), a 13-item measure designed to assess for the presence and severity of morphing fears. A sample of 900 participants took part in the research. Of these, 140 reported having a current diagnosis of OCD (SR-OCD) and 760 reported never having had OCD (N-OCD; of whom 24 reported a diagnosis of an anxiety disorder and 23 reported a diagnosis of depression). Factor structure, reliability and construct and criterion-related validity were investigated. Exploratory and confirmatory factor analyses supported a one-factor structure replicable across the N-OCD and SR-OCD group. The MFQ was found to have high internal consistency and good temporal stability and showed significantly greater associations with convergent measures (assessing obsessive-compulsive symptoms, mental contamination, thought-action fusion and magical thinking) than with divergent measures (assessing depression and anxiety). Moreover, the MFQ successfully discriminated between the SR-OCD sample and the N-OCD group, anxiety disorder sample and depression sample. These findings suggest that the MFQ has sound psychometric properties and that it can be used to assess morphing fear. Clinical implications are discussed. Copyright © 2015 John Wiley & Sons, Ltd. Little remains known about morphing fears, but it is an important area of investigation due to symptoms being highly distressing and often debilitating Because morphing fears commonly present as obscure symptoms, they may not be recognized as a type of OCD The MFQ is a robust measure with clinical utility; it can facilitate recognition and assessment of morphing fears The MFQ will allow for further investigations of the prevalence, correlates and treatment outcomes of morphing fears. Copyright © 2015 John Wiley & Sons, Ltd.

Adaptive Significance of Flexistyly in Alpinia blepharocalyx (Zingiberaceae): A Hand-pollination Experiment

PubMed Central

Sun, Shan; Gao, Jiang-Yun; Liao, Wan-Jin; Li, Qing-Jun; Zhang, Da-Yong

2007-01-01

Background and Aims Flexistyly is a sexual dimorphism where there are two morphs that differ in the temporal expression of sexual function and also involve reciprocal movement of the stigmatic surface through a vertical axis during the flowering period. The adaptive significance of flexistyly has been interpreted as a floral mechanism for outcrossing, but it may also function to reduce sexual interference in which styles and stigmas impede the pollen export. Here these two explanations of flexistyly were tested in Alpinia blepharocalyx through a hand-pollination experiment. Methods Hand-pollinations were performed in two temporal morphs and consisted of two sequential pollination treatments, namely self-pollination in the morning and inter-morph pollination in the afternoon (treatment 1) or conversely inter-morph pollination in the morning and self-pollination in the afternoon (treatment 2), and two simultaneous self- and inter-morph cross-pollination treatments either in the morning (treatment 3) or in the afternoon (treatment 4). Seed paternity was then determined to assess relative success of self- versus cross-pollen using allozyme markers. Key Results In the sequential pollination treatments, whether the stigmas of recipients are receptive in the morning is crucial to the success of the pollen deposited. When the cataflexistylous (protandrous) morph served as pollen recipient, early-arriving pollen in the morning can sire only a very small proportion (<15%) of seeds because the stigmas were then unreceptive. However, when the anaflexistylous (protogynous) morph served as pollen recipient, early pollen did gain a large competitive advantage over the late pollen, particularly when cross-pollen arrived first. Simultaneous self- and inter-morph cross-pollination indicated that outcross-pollen is more competitive than self-pollen on receptive stigmas. Conclusions Differential maturing of male and female organs in Alpinia blepharocalyx is sufficient for selfing avoidance, obviating the need for style movements. Instead, the upward style curvature of the cataflexistylous morph in the morning and the anaflexistylous morph in the afternoon most likely represents a means of reducing interference with pollen export. PMID:17237211

Structural differences in interictal migraine attack after epilepsy: A diffusion tensor imaging analysis.

PubMed

Huang, Qi; Lv, Xin; He, Yushuang; Wei, Xing; Ma, Meigang; Liao, Yuhan; Qin, Chao; Wu, Yuan

2017-12-01

Patients with epilepsy (PWE) are more likely to suffer from migraine attack, and aberrant white matter (WM) organization may be the mechanism underlying this phenomenon. This study aimed to use diffusion tensor imaging (DTI) technique to quantify WM structural differences in PWE with interictal migraine. Diffusion tensor imaging data were acquired in 13 PWE with migraine and 12 PWE without migraine. Diffusion metrics were analyzed using tract-atlas-based spatial statistics analysis. Atlas-based and tract-based spatial statistical analyses were conducted for robustness analysis. Correlation was explored between altered DTI metrics and clinical parameters. The main results are as follows: (i) Axonal damage plays a key role in PWE with interictal migraine. (ii) Significant diffusing alterations included higher fractional anisotropy (FA) in the fornix, higher mean diffusivity (MD) in the middle cerebellar peduncle (CP), left superior CP, and right uncinate fasciculus, and higher axial diffusivity (AD) in the middle CP and right medial lemniscus. (iii) Diffusion tensor imaging metrics has the tendency of correlation with seizure/migraine type and duration. Results indicate that characteristic structural impairments exist in PWE with interictal migraine. Epilepsy may contribute to migraine by altering WMs in the brain stem. White matter tracts in the fornix and right uncinate fasciculus also mediate migraine after epilepsy. This finding may improve our understanding of the pathological mechanisms underlying migraine attack after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Traumatic Brain Injury: Hope Through Research

MedlinePlus

... last decade to image milder TBI damage. For example, diffusion tensor imaging (DTI) can image white matter tracts, more sensitive tests like fluid-attenuated inversion recovery (FLAIR) can detect ...

Odour-Mediated Orientation of Beetles Is Influenced by Age, Sex and Morph

PubMed Central

Arnold, Sarah E. J.; Stevenson, Philip C.; Belmain, Steven R.

2012-01-01

The behaviour of insects is dictated by a combination of factors and may vary considerably between individuals, but small insects are often considered en masse and thus these differences can be overlooked. For example, the cowpea bruchid Callosobruchus maculatus F. exists naturally in two adult forms: the active (flight) form for dispersal, and the inactive (flightless), more fecund but shorter-lived form. Given that these morphs show dissimilar biology, it is possible that they differ in odour-mediated orientation and yet studies of this species frequently neglect to distinguish morph type, or are carried out only on the inactive morph. Along with sex and age of individual, adult morph could be an important variable determining the biology of this and similar species, informing studies on evolution, ecology and pest management. We used an olfactometer with motion-tracking to investigate whether the olfactory behaviour and orientation of C. maculatus towards infested and uninfested cowpeas and a plant-derived repellent compound, methyl salicylate, differed between morphs or sexes. We found significant differences between the behaviour of male and female beetles and beetles of different ages, as well as interactive effects of sex, morph and age, in response to both host and repellent odours. This study demonstrates that behavioural experiments on insects should control for sex and age, while also considering differences between adult morphs where present in insect species. This finding has broad implications for fundamental entomological research, particularly when exploring the relationships between physiology, behaviour and evolutionary biology, and the application of crop protection strategies. PMID:23145074

Mutualists and antagonists drive among-population variation in selection and evolution of floral display in a perennial herb

PubMed Central

Ågren, Jon; Hellström, Frida; Toräng, Per; Ehrlén, Johan

2013-01-01

Spatial variation in the direction of selection drives the evolution of adaptive differentiation. However, few experimental studies have examined the relative importance of different environmental factors for variation in selection and evolutionary trajectories in natural populations. Here, we combine 8 y of observational data and field experiments to assess the relative importance of mutualistic and antagonistic interactions for spatial variation in selection and short-term evolution of a genetically based floral display dimorphism in the short-lived perennial herb Primula farinosa. Natural populations of this species include two floral morphs: long-scaped plants that present their flowers well above the ground and short-scaped plants with flowers positioned close to the ground. The direction and magnitude of selection on scape morph varied among populations, and so did the frequency of the short morph (median 19%, range 0–100%; n = 69 populations). A field experiment replicated at four sites demonstrated that variation in the strength of interactions with grazers and pollinators were responsible for among-population differences in relative fitness of the two morphs. Selection exerted by grazers favored the short-scaped morph, whereas pollinator-mediated selection favored the long-scaped morph. Moreover, variation in selection among natural populations was associated with differences in morph frequency change, and the experimental removal of grazers at nine sites significantly reduced the frequency of the short-scaped morph over 8 y. The results demonstrate that spatial variation in intensity of grazing and pollination produces a selection mosaic, and that changes in biotic interactions can trigger rapid genetic changes in natural plant populations. PMID:24145439

Mutualists and antagonists drive among-population variation in selection and evolution of floral display in a perennial herb.

PubMed

Agren, Jon; Hellström, Frida; Toräng, Per; Ehrlén, Johan

2013-11-05

Spatial variation in the direction of selection drives the evolution of adaptive differentiation. However, few experimental studies have examined the relative importance of different environmental factors for variation in selection and evolutionary trajectories in natural populations. Here, we combine 8 y of observational data and field experiments to assess the relative importance of mutualistic and antagonistic interactions for spatial variation in selection and short-term evolution of a genetically based floral display dimorphism in the short-lived perennial herb Primula farinosa. Natural populations of this species include two floral morphs: long-scaped plants that present their flowers well above the ground and short-scaped plants with flowers positioned close to the ground. The direction and magnitude of selection on scape morph varied among populations, and so did the frequency of the short morph (median 19%, range 0-100%; n = 69 populations). A field experiment replicated at four sites demonstrated that variation in the strength of interactions with grazers and pollinators were responsible for among-population differences in relative fitness of the two morphs. Selection exerted by grazers favored the short-scaped morph, whereas pollinator-mediated selection favored the long-scaped morph. Moreover, variation in selection among natural populations was associated with differences in morph frequency change, and the experimental removal of grazers at nine sites significantly reduced the frequency of the short-scaped morph over 8 y. The results demonstrate that spatial variation in intensity of grazing and pollination produces a selection mosaic, and that changes in biotic interactions can trigger rapid genetic changes in natural plant populations.

Passive morphing of flying wing aircraft: Z-shaped configuration

NASA Astrophysics Data System (ADS)

Mardanpour, Pezhman; Hodges, Dewey H.

2014-01-01

High Altitude, Long Endurance (HALE) aircraft can achieve sustained, uninterrupted flight time if they use solar power. Wing morphing of solar powered HALE aircraft can significantly increase solar energy absorbency. An example of the kind of morphing considered in this paper requires the wings to fold so as to orient a solar panel to be hit more directly by the sun's rays at specific times of the day. An example of the kind of morphing considered in this paper requires the wings to fold so as to orient a solar panel that increases the absorption of solar energy by decreasing the angle of incidence of the solar radiation at specific times of the day. In this paper solar powered HALE flying wing aircraft are modeled with three beams with lockable hinge connections. Such aircraft are shown to be capable of morphing passively, following the sun by means of aerodynamic forces and engine thrusts. The analysis underlying NATASHA (Nonlinear Aeroelastic Trim And Stability of HALE Aircraft), a computer program that is based on geometrically exact, fully intrinsic beam equations and a finite-state induced flow model, was extended to include the ability to simulate morphing of the aircraft into a "Z" configuration. Because of the "long endurance" feature of HALE aircraft, such morphing needs to be done without relying on actuators and at as near zero energy cost as possible. The emphasis of this study is to substantially demonstrate the processes required to passively morph a flying wing into a Z-shaped configuration and back again.

Trifocal Tensor-Based Adaptive Visual Trajectory Tracking Control of Mobile Robots.

PubMed

Chen, Jian; Jia, Bingxi; Zhang, Kaixiang

2017-11-01

In this paper, a trifocal tensor-based approach is proposed for the visual trajectory tracking task of a nonholonomic mobile robot equipped with a roughly installed monocular camera. The desired trajectory is expressed by a set of prerecorded images, and the robot is regulated to track the desired trajectory using visual feedback. Trifocal tensor is exploited to obtain the orientation and scaled position information used in the control system, and it works for general scenes owing to the generality of trifocal tensor. In the previous works, the start, current, and final images are required to share enough visual information to estimate the trifocal tensor. However, this requirement can be easily violated for perspective cameras with limited field of view. In this paper, key frame strategy is proposed to loosen this requirement, extending the workspace of the visual servo system. Considering the unknown depth and extrinsic parameters (installing position of the camera), an adaptive controller is developed based on Lyapunov methods. The proposed control strategy works for almost all practical circumstances, including both trajectory tracking and pose regulation tasks. Simulations are made based on the virtual experimentation platform (V-REP) to evaluate the effectiveness of the proposed approach.

Road detection in SAR images using a tensor voting algorithm

NASA Astrophysics Data System (ADS)

Shen, Dajiang; Hu, Chun; Yang, Bing; Tian, Jinwen; Liu, Jian

2007-11-01

In this paper, the problem of the detection of road networks in Synthetic Aperture Radar (SAR) images is addressed. Most of the previous methods extract the road by detecting lines and network reconstruction. Traditional algorithms such as MRFs, GA, Level Set, used in the progress of reconstruction are iterative. The tensor voting methodology we proposed is non-iterative, and non-sensitive to initialization. Furthermore, the only free parameter is the size of the neighborhood, related to the scale. The algorithm we present is verified to be effective when it's applied to the road extraction using the real Radarsat Image.

Six dimensional X-ray Tensor Tomography with a compact laboratory setup

NASA Astrophysics Data System (ADS)

Sharma, Y.; Wieczorek, M.; Schaff, F.; Seyyedi, S.; Prade, F.; Pfeiffer, F.; Lasser, T.

2016-09-01

Attenuation based X-ray micro computed tomography (XCT) provides three-dimensional images with micrometer resolution. However, there is a trade-off between the smallest size of the structures that can be resolved and the measurable sample size. In this letter, we present an imaging method using a compact laboratory setup that reveals information about micrometer-sized structures within samples that are several orders of magnitudes larger. We combine the anisotropic dark-field signal obtained in a grating interferometer and advanced tomographic reconstruction methods to reconstruct a six dimensional scattering tensor at every spatial location in three dimensions. The scattering tensor, thus obtained, encodes information about the orientation of micron-sized structures such as fibres in composite materials or dentinal tubules in human teeth. The sparse acquisition schemes presented in this letter enable the measurement of the full scattering tensor at every spatial location and can be easily incorporated in a practical, commercially feasible laboratory setup using conventional X-ray tubes, thus allowing for widespread industrial applications.

The Perception of Prototypical Motion: Synchronization Is Enhanced with Quantitatively Morphed Gestures of Musical Conductors

ERIC Educational Resources Information Center

Wollner, Clemens; Deconinck, Frederik J. A.; Parkinson, Jim; Hove, Michael J.; Keller, Peter E.

2012-01-01

Aesthetic theories have long suggested perceptual advantages for prototypical exemplars of a given class of objects or events. Empirical evidence confirmed that morphed (quantitatively averaged) human faces, musical interpretations, and human voices are preferred over most individual ones. In this study, biological human motion was morphed and…

Evolving and Combining Facial Composites: Between-Witness and Within-Witness Morphs Compared

ERIC Educational Resources Information Center

Valentine, Tim; Davis, Josh P.; Thorner, Kate; Solomon, Chris; Gibson, Stuart

2010-01-01

Student participant-witnesses produced 4 composites of unfamiliar faces with a system that uses a genetic algorithm to evolve appearance of artificial faces. Morphs of 4 composites produced by different witnesses (between-witness morphs) were judged better likenesses (Experiment 1) and were more frequently named (Experiment 2) by participants who…

Multiple exaggerated weapon morphs: a novel form of male polymorphism in harvestmen

PubMed Central

Painting, Christina J.; Probert, Anna F.; Townsend, Daniel J.; Holwell, Gregory I.

2015-01-01

Alternative reproductive tactics in animals are commonly associated with distinct male phenotypes resulting in polymorphism of sexually selected weapons such as horns and spines. Typically, morphs are divided between small (unarmed) and large (armed) males according to one or more developmental thresholds in association with body size. Here, we describe remarkable weapon trimorphism within a single species, where two exaggerated weapon morphs and a third morph with reduced weaponry are present. Male Pantopsalis cheliferoides harvestmen display exaggerated chelicerae (jaws) which are highly variable in length among individuals. Across the same body size spectrum, however, some males belong to a distinct second exaggerated morph which possesses short, broad chelicerae. Multiple weapon morphs in a single species is a previously unknown phenomenon and our findings have significant implications for understanding weapon diversity and maintenance of polymorphism. Specifically, this species will be a valuable model for testing how weapons diverge by being able to test directly for the circumstances under which a certain weapon type is favoured and how weapon shape relates to performance. PMID:26542456

Evolution and coexistence of pollination ecotypes in an African Gladiolus (Iridaceae).

PubMed

Anderson, Bruce; Alexandersson, Ronny; Johnson, Steven D

2010-04-01

Pollinator-mediated selection has been suggested as a key driver of speciation in plants. We examined the potential role of hawkmoth pollinators in driving allopatric divergence and maintaining sympatric coexistence of morphotypes in the African iris Gladiolus longicollis. Floral tube length in this species varies from 35 mm to 130 mm across its geographic range and reflects the prevailing tongue lengths of local hawkmoth assemblages. The distribution of floral tube lengths is bimodal with two relatively discrete categories--long (about 90 mm) or short (about 50 mm)--that match the bimodal distribution of hawkmoth tongue lengths in eastern South Africa. At a contact site between these two floral morphs, we found few individuals of intermediate length, suggesting limited gene flow between morphs despite their interfertility. A difference in flowering phenology appears to be the main isolating barrier between morphs at this site. Long- and short-tubed morphs differed markedly in the chemical composition of their floral fragrance, a trait that could be used as a cue for morph-specific foraging by hawkmoths. Positive directional selection on tube length was found to occur in both morphs.

Heterospecific aggression bias towards a rarer colour morph.

PubMed

Lehtonen, Topi K; Sowersby, Will; Wong, Bob B M

2015-09-22

Colour polymorphisms are a striking example of phenotypic diversity, yet the sources of selection that allow different morphs to persist within populations remain poorly understood. In particular, despite the importance of aggression in mediating social dominance, few studies have considered how heterospecific aggression might contribute to the maintenance or divergence of different colour morphs. To redress this gap, we carried out a field-based study in a Nicaraguan crater lake to investigate patterns of heterospecific aggression directed by the cichlid fish, Hypsophrys nicaraguensis, towards colour polymorphic cichlids in the genus Amphilophus. We found that H. nicaraguensis was the most frequent territorial neighbour of the colour polymorphic A. sagittae. Furthermore, when manipulating territorial intrusions using models, H. nicaraguensis were more aggressive towards the gold than dark colour morph of the sympatric Amphilophus species, including A. sagittae. Such a pattern of heterospecific aggression should be costly to the gold colour morph, potentially accounting for its lower than expected frequency and, more generally, highlighting the importance of considering heterospecific aggression in the context of morph frequencies and coexistence in the wild. © 2015 The Author(s).

PhotoMorphs™: A Novel Light-Activated Reagent for Controlling Gene Expression in Zebrafish

PubMed Central

Tomasini, Amber J.; Schuler, Aaron D.; Zebala, John A.; Mayer, Alan N.

2009-01-01

Manipulating gene expression in zebrafish is critical for exploiting the full potential of this vertebrate model organism. Morpholino oligos are the most commonly employed antisense technology for knocking down gene expression. However, morpholinos suffer from a lack of control over the timing and location of knockdown. In this report, we describe a novel light-activatable knockdown reagent called PhotoMorph™. PhotoMorphs can be generated from existing morpholinos by hybridization with a complementary caging strand containing a photocleavable linkage. The caging strand neutralizes the morpholino activity until irradiation of the PhotoMorph with UV light releases the morpholino. We generated PhotoMorphs to target genes encoding enhanced green fluorescent protein (EGFP), No tail, and E-cadherin to illustrate the utility of this approach. Temporal control of gene expression with PhotoMorphs permitted us to circumvent the early lethal phenotype of E-cadherin knockdown. A splice-blocking PhotoMorph directed to the rheb gene showed light-dependent gene knockdown up to 72 hpf. PhotoMorphs thus offer a new class of laboratory reagents suitable for the spatiotemporal control of gene expression in the zebrafish. PMID:19644983

Adaptive wing structures

NASA Astrophysics Data System (ADS)

Reed, John L., Jr.; Hemmelgarn, Christopher D.; Pelley, Bryan M.; Havens, Ernie

2005-05-01

Cornerstone Research Group, Inc. (CRG) is developing a unique adaptive wing structure intended to enhance the capability of loitering Unmanned Air Vehicles (UAVs). In order to tailor the wing design to a specific application, CRG has developed a wing structure capable of morphing in chord and increasing planform area by 80 percent. With these features, aircraft will be capable of optimizing their flight efficiency throughout the entire mission profile. The key benefit from this morphing design is increased maneuverability, resulting in improved effectiveness over the current design. During the development process CRG has overcome several challenges in the design of such a structure while incorporating advanced materials capable of maintaining aerodynamic shape and transferring aerodynamic loads while enabling crucial changes in planform shape. To overcome some of these challenges, CRG is working on integration of their shape memory polymer materials into the wing skin to enable seamless morphing. This paper will address the challenges associated with the development of a morphing aerospace structure capable of such large shape change, the materials necessary for enabling morphing capabilities, and the current status of the morphing program within CRG.

A single mitochondrial haplotype and nuclear genetic differentiation in sympatric colour morphs of a riverine cichlid fish.

PubMed

Koblmüller, S; Sefc, K M; Duftner, N; Katongo, C; Tomljanovic, T; Sturmbauer, C

2008-01-01

Some of the diversity of lacustrine cichlid fishes has been ascribed to sympatric divergence, whereas diversification in rivers is generally driven by vicariance and geographic isolation. In the riverine Pseudocrenilabrus philander species complex, several morphologically highly distinct populations are restricted to particular river systems, sinkholes and springs in southern Africa. One of these populations consists of a prevalent yellow morph in sympatry with a less frequent blue morph, and no individuals bear intermediate phenotypes. Genetic variation in microsatellites and AFLP markers was very low in both morphs and one single mtDNA haplotype was fixed in all samples, indicating a very young evolutionary age and small effective population size. Nevertheless, the nuclear markers detected low but significant differentiation between the two morphs. The data suggest recent and perhaps sympatric divergence in the riverine habitat.

Inference of segmented color and texture description by tensor voting.

PubMed

Jia, Jiaya; Tang, Chi-Keung

2004-06-01

A robust synthesis method is proposed to automatically infer missing color and texture information from a damaged 2D image by (N)D tensor voting (N > 3). The same approach is generalized to range and 3D data in the presence of occlusion, missing data and noise. Our method translates texture information into an adaptive (N)D tensor, followed by a voting process that infers noniteratively the optimal color values in the (N)D texture space. A two-step method is proposed. First, we perform segmentation based on insufficient geometry, color, and texture information in the input, and extrapolate partitioning boundaries by either 2D or 3D tensor voting to generate a complete segmentation for the input. Missing colors are synthesized using (N)D tensor voting in each segment. Different feature scales in the input are automatically adapted by our tensor scale analysis. Results on a variety of difficult inputs demonstrate the effectiveness of our tensor voting approach.

Classification of materials for conducting spheroids based on the first order polarization tensor

NASA Astrophysics Data System (ADS)

Khairuddin, TK Ahmad; Mohamad Yunos, N.; Aziz, ZA; Ahmad, T.; Lionheart, WRB

2017-09-01

Polarization tensor is an old terminology in mathematics and physics with many recent industrial applications including medical imaging, nondestructive testing and metal detection. In these applications, it is theoretically formulated based on the mathematical modelling either in electrics, electromagnetics or both. Generally, polarization tensor represents the perturbation in the electric or electromagnetic fields due to the presence of conducting objects and hence, it also desribes the objects. Understanding the properties of the polarization tensor is necessary and important in order to apply it. Therefore, in this study, when the conducting object is a spheroid, we show that the polarization tensor is positive-definite if and only if the conductivity of the object is greater than one. In contrast, we also prove that the polarization tensor is negative-definite if and only if the conductivity of the object is between zero and one. These features categorize the conductivity of the spheroid based on in its polarization tensor and can then help to classify the material of the spheroid.

What explains rare and conspicuous colours in a snail? A test of time-series data against models of drift, migration or selection.

PubMed

Johannesson, K; Butlin, R K

2017-01-01

It is intriguing that conspicuous colour morphs of a prey species may be maintained at low frequencies alongside cryptic morphs. Negative frequency-dependent selection by predators using search images ('apostatic selection') is often suggested without rejecting alternative explanations. Using a maximum likelihood approach we fitted predictions from models of genetic drift, migration, constant selection, heterozygote advantage or negative frequency-dependent selection to time-series data of colour frequencies in isolated populations of a marine snail (Littorina saxatilis), re-established with perturbed colour morph frequencies and followed for >20 generations. Snails of conspicuous colours (white, red, banded) are naturally rare in the study area (usually <10%) but frequencies were manipulated to levels of ~50% (one colour per population) in 8 populations at the start of the experiment in 1992. In 2013, frequencies had declined to ~15-45%. Drift alone could not explain these changes. Migration could not be rejected in any population, but required rates much higher than those recorded. Directional selection was rejected in three populations in favour of balancing selection. Heterozygote advantage and negative frequency-dependent selection could not be distinguished statistically, although overall the results favoured the latter. Populations varied idiosyncratically as mild or variable colour selection (3-11%) interacted with demographic stochasticity, and the overall conclusion was that multiple mechanisms may contribute to maintaining the polymorphisms.

Numerical and Experimental Validation of the Optimization Methodologies for a Wing-Tip Structure Equipped with Conventional and Morphing Ailerons =

NASA Astrophysics Data System (ADS)

Koreanschi, Andreea

In order to answer the problem of 'how to reduce the aerospace industry's environment footprint?' new morphing technologies were developed. These technologies were aimed at reducing the aircraft's fuel consumption through reduction of the wing drag. The morphing concept used in the present research consists of replacing the conventional aluminium upper surface of the wing with a flexible composite skin for morphing abilities. For the ATR-42 'Morphing wing' project, the wing models were manufactured entirely from composite materials and the morphing region was optimized for flexibility. In this project two rigid wing models and an active morphing wing model were designed, manufactured and wind tunnel tested. For the CRIAQ MDO 505 project, a full scale wing-tip equipped with two types of ailerons, conventional and morphing, was designed, optimized, manufactured, bench and wind tunnel tested. The morphing concept was applied on a real wing internal structure and incorporated aerodynamic, structural and control constraints specific to a multidisciplinary approach. Numerical optimization, aerodynamic analysis and experimental validation were performed for both the CRIAQ MDO 505 full scale wing-tip demonstrator and the ATR-42 reduced scale wing models. In order to improve the aerodynamic performances of the ATR-42 and CRIAQ MDO 505 wing airfoils, three global optimization algorithms were developed, tested and compared. The three algorithms were: the genetic algorithm, the artificial bee colony and the gradient descent. The algorithms were coupled with the two-dimensional aerodynamic solver XFoil. XFoil is known for its rapid convergence, robustness and use of the semi-empirical e n method for determining the position of the flow transition from laminar to turbulent. Based on the performance comparison between the algorithms, the genetic algorithm was chosen for the optimization of the ATR-42 and CRIAQ MDO 505 wing airfoils. The optimization algorithm was improved during the CRIAQ MDO 505 project for convergence speed by introducing a two-step cross-over function. Structural constraints were introduced in the algorithm at each aero-structural optimization interaction, allowing a better manipulation of the algorithm and giving it more capabilities of morphing combinations. The CRIAQ MDO 505 project envisioned a morphing aileron concept for the morphing upper surface wing. For this morphing aileron concept, two optimization methods were developed. The methods used the already developed genetic algorithm and each method had a different design concept. The first method was based on the morphing upper surface concept, using actuation points to achieve the desired shape. The second method was based on the hinge rotation concept of the conventional aileron but applied at multiple nodes along the aileron camber to achieve the desired shape. Both methods were constrained by manufacturing and aerodynamic requirements. The purpose of the morphing aileron methods was to obtain an aileron shape with a smoother pressure distribution gradient during deflection than the conventional aileron. The aerodynamic optimization results were used for the structural optimization and design of the wing, particularly the flexible composite skin. Due to the structural changes performed on the initial wing-tip structure, an aeroelastic behaviour analysis, more specific on flutter phenomenon, was performed. The analyses were done to ensure the structural integrity of the wing-tip demonstrator during wind tunnel tests. Three wind tunnel tests were performed for the CRIAQ MDO 505 wing-tip demonstrator at the IAR-NRC subsonic wind tunnel facility in Ottawa. The first two tests were performed for the wing-tip equipped with conventional aileron. The purpose of these tests was to validate the control system designed for the morphing upper surface, the numerical optimization and aerodynamic analysis and to evaluate the optimization efficiency on the boundary layer behaviour and the wing drag. The third set of wind tunnel tests was performed on the wing-tip equipped with a morphing aileron. The purpose of this test was to evaluate the performances of the morphing aileron, in conjunction with the active morphing upper surface, and their effect on the lift, drag and boundary layer behaviour. Transition data, obtained from Infrared Thermography, and pressure data, extracted from Kulite and pressure taps recordings, were used to validate the numerical optimization and aerodynamic performances of the wing-tip demonstrator. A set of wind tunnel tests was performed on the ATR-42 rigid wing models at the Price-Paidoussis subsonic wind tunnel at Ecole de technologie Superieure. The results from the pressure taps recordings were used to validate the numerical optimization. A second derivative of the pressure distribution method was applied to evaluate the transition region on the upper surface of the wing models for comparison with the numerical transition values. (Abstract shortened by ProQuest.).

Morphing hull implementation for unmanned underwater vehicles

NASA Astrophysics Data System (ADS)

Miller, Timothy F.; Gandhi, Farhan; Rufino, Russell J.

2013-11-01

There has been much interest and work in the area of morphing aircraft since the 1980s. Morphing could also potentially benefit unmanned underwater vehicles (UUVs). The current paper envisions a UUV with an interior pressure hull and a variable diameter outer flexible hull with fuel stored in the annulus between, and presents a mechanism to realize diameter change of the outer hull. The outer hull diameter of UUVs designed for very long endurance/range could be progressively reduced as fuel was consumed, thereby reducing drag and further increasing endurance and range capability. Diameter morphing could also be advantageous for compact storage of UUVs. A prototype is fabricated to represent an axial section of such a morphing diameter UUV. Diameter change is achieved using eight morphing trusses arranged equidistant around the circumference of the representative interior rigid hull. Each morphing truss has a lower rail (attached to the rigid hull) and an upper rail with V-linkages between, at either ends of the rail. Horizontal motion of the feet of the V-linkages (sliding in the lower rail) results in vertical motion of the upper rail which in turn produces diameter change of the outer hull. For the prototype built and tested, a 63% increase in outer diameter from 12.75″ to 20.75″ was achieved. The introduction of a stretched latex representative flexible skin around the outer rails increased actuation force requirement and led to a propensity for the wheel-in-track sliders in the morphing truss to bind. It is anticipated that this could be overcome with higher precision manufacturing. In addition to symmetric actuation of the morphing trusses resulting in diameter change, the paper also shows that with asymmetric actuation the hull cross-section shape can be changed (for example, from a circular section for underwater operation to a V-section for surface operations).

Combined Tensor Fitting and TV Regularization in Diffusion Tensor Imaging Based on a Riemannian Manifold Approach.

PubMed

Baust, Maximilian; Weinmann, Andreas; Wieczorek, Matthias; Lasser, Tobias; Storath, Martin; Navab, Nassir

2016-08-01

In this paper, we consider combined TV denoising and diffusion tensor fitting in DTI using the affine-invariant Riemannian metric on the space of diffusion tensors. Instead of first fitting the diffusion tensors, and then denoising them, we define a suitable TV type energy functional which incorporates the measured DWIs (using an inverse problem setup) and which measures the nearness of neighboring tensors in the manifold. To approach this functional, we propose generalized forward- backward splitting algorithms which combine an explicit and several implicit steps performed on a decomposition of the functional. We validate the performance of the derived algorithms on synthetic and real DTI data. In particular, we work on real 3D data. To our knowledge, the present paper describes the first approach to TV regularization in a combined manifold and inverse problem setup.

Perspectives on Highly Adaptive or Morphing Aircraft

NASA Technical Reports Server (NTRS)

McGowan, Anna-Maria R.; Vicroy, Dan D.; Busan, Ronald C.; Hahn, Andrew S.

2009-01-01

The ability to adapt to different flight conditions has been fundamental to aircraft design since the Wright Brothers first flight. Over a hundred years later, unconventional aircraft adaptability, often called aircraft morphing has become a topic of considerable renewed interest. In the past two decades, this interest has been largely fuelled by advancements in multi-functional or smart materials and structures. However, highly adaptive or morphing aircraft is certainly a cross-discipline challenge that stimulates a wide range of design possibilities. This paper will review some of the history of morphing aircraft including recent research programs and discuss some perspectives on this work.

TWave: High-Order Analysis of Functional MRI

PubMed Central

Barnathan, Michael; Megalooikonomou, Vasileios; Faloutsos, Christos; Faro, Scott; Mohamed, Feroze B.

2011-01-01

The traditional approach to functional image analysis models images as matrices of raw voxel intensity values. Although such a representation is widely utilized and heavily entrenched both within neuroimaging and in the wider data mining community, the strong interactions among space, time, and categorical modes such as subject and experimental task inherent in functional imaging yield a dataset with “high-order” structure, which matrix models are incapable of exploiting. Reasoning across all of these modes of data concurrently requires a high-order model capable of representing relationships between all modes of the data in tandem. We thus propose to model functional MRI data using tensors, which are high-order generalizations of matrices equivalent to multidimensional arrays or data cubes. However, several unique challenges exist in the high-order analysis of functional medical data: naïve tensor models are incapable of exploiting spatiotemporal locality patterns, standard tensor analysis techniques exhibit poor efficiency, and mixtures of numeric and categorical modes of data are very often present in neuroimaging experiments. Formulating the problem of image clustering as a form of Latent Semantic Analysis and using the WaveCluster algorithm as a baseline, we propose a comprehensive hybrid tensor and wavelet framework for clustering, concept discovery, and compression of functional medical images which successfully addresses these challenges. Our approach reduced runtime and dataset size on a 9.3 GB finger opposition motor task fMRI dataset by up to 98% while exhibiting improved spatiotemporal coherence relative to standard tensor, wavelet, and voxel-based approaches. Our clustering technique was capable of automatically differentiating between the frontal areas of the brain responsible for task-related habituation and the motor regions responsible for executing the motor task, in contrast to a widely used fMRI analysis program, SPM, which only detected the latter region. Furthermore, our approach discovered latent concepts suggestive of subject handedness nearly 100x faster than standard approaches. These results suggest that a high-order model is an integral component to accurate scalable functional neuroimaging. PMID:21729758

OPERATOR NORM INEQUALITIES BETWEEN TENSOR UNFOLDINGS ON THE PARTITION LATTICE

PubMed Central

Wang, Miaoyan; Duc, Khanh Dao; Fischer, Jonathan; Song, Yun S.

2017-01-01

Interest in higher-order tensors has recently surged in data-intensive fields, with a wide range of applications including image processing, blind source separation, community detection, and feature extraction. A common paradigm in tensor-related algorithms advocates unfolding (or flattening) the tensor into a matrix and applying classical methods developed for matrices. Despite the popularity of such techniques, how the functional properties of a tensor changes upon unfolding is currently not well understood. In contrast to the body of existing work which has focused almost exclusively on matricizations, we here consider all possible unfoldings of an order-k tensor, which are in one-to-one correspondence with the set of partitions of {1, …, k}. We derive general inequalities between the lp-norms of arbitrary unfoldings defined on the partition lattice. In particular, we demonstrate how the spectral norm (p = 2) of a tensor is bounded by that of its unfoldings, and obtain an improved upper bound on the ratio of the Frobenius norm to the spectral norm of an arbitrary tensor. For specially-structured tensors satisfying a generalized definition of orthogonal decomposability, we prove that the spectral norm remains invariant under specific subsets of unfolding operations. PMID:28286347

OPERATOR NORM INEQUALITIES BETWEEN TENSOR UNFOLDINGS ON THE PARTITION LATTICE.

PubMed

Wang, Miaoyan; Duc, Khanh Dao; Fischer, Jonathan; Song, Yun S

2017-05-01

Interest in higher-order tensors has recently surged in data-intensive fields, with a wide range of applications including image processing, blind source separation, community detection, and feature extraction. A common paradigm in tensor-related algorithms advocates unfolding (or flattening) the tensor into a matrix and applying classical methods developed for matrices. Despite the popularity of such techniques, how the functional properties of a tensor changes upon unfolding is currently not well understood. In contrast to the body of existing work which has focused almost exclusively on matricizations, we here consider all possible unfoldings of an order- k tensor, which are in one-to-one correspondence with the set of partitions of {1, …, k }. We derive general inequalities between the l p -norms of arbitrary unfoldings defined on the partition lattice. In particular, we demonstrate how the spectral norm ( p = 2) of a tensor is bounded by that of its unfoldings, and obtain an improved upper bound on the ratio of the Frobenius norm to the spectral norm of an arbitrary tensor. For specially-structured tensors satisfying a generalized definition of orthogonal decomposability, we prove that the spectral norm remains invariant under specific subsets of unfolding operations.

The relationship between functional magnetic resonance imaging activation, diffusion tensor imaging, and training effects.

PubMed

Farrar, Danielle; Budson, Andrew E

2017-04-01

While the relationship between diffusion tensor imaging (DTI) measurements and training effects is explored by Voelker et al. (this issue), a cursory discussion of functional magnetic resonance imaging (fMRI) measurements categorizes increased activation with findings of greater white matter integrity. Evidence of the relationship between fMRI activation and white matter integrity is conflicting, as is the relationship between fMRI activation and training effects. An examination of the changes in fMRI activation in response to training is helpful, but the relationship between DTI and fMRI activation, particularly in the context of white matter changes, must be examined further before general conclusions can be drawn.

Finding the optimal shape of the leading-and-trailing car of a high-speed train using design-by-morphing

NASA Astrophysics Data System (ADS)

Oh, Sahuck; Jiang, Chung-Hsiang; Jiang, Chiyu; Marcus, Philip S.

2017-10-01

We present a new, general design method, called design-by-morphing for an object whose performance is determined by its shape due to hydrodynamic, aerodynamic, structural, or thermal requirements. To illustrate the method, we design a new leading-and-trailing car of a train by morphing existing, baseline leading-and-trailing cars to minimize the drag. In design-by-morphing, the morphing is done by representing the shapes with polygonal meshes and spectrally with a truncated series of spherical harmonics. The optimal design is found by computing the optimal weights of each of the baseline shapes so that the morphed shape has minimum drag. As a result of optimization, we found that with only two baseline trains that mimic current high-speed trains with low drag that the drag of the optimal train is reduced by 8.04% with respect to the baseline train with the smaller drag. When we repeat the optimization by adding a third baseline train that under-performs compared to the other baseline train, the drag of the new optimal train is reduced by 13.46% . This finding shows that bad examples of design are as useful as good examples in determining an optimal design. We show that design-by-morphing can be extended to many engineering problems in which the performance of an object depends on its shape.

Finding the optimal shape of the leading-and-trailing car of a high-speed train using design-by-morphing

NASA Astrophysics Data System (ADS)

Oh, Sahuck; Jiang, Chung-Hsiang; Jiang, Chiyu; Marcus, Philip S.

2018-07-01

We present a new, general design method, called design-by-morphing for an object whose performance is determined by its shape due to hydrodynamic, aerodynamic, structural, or thermal requirements. To illustrate the method, we design a new leading-and-trailing car of a train by morphing existing, baseline leading-and-trailing cars to minimize the drag. In design-by-morphing, the morphing is done by representing the shapes with polygonal meshes and spectrally with a truncated series of spherical harmonics. The optimal design is found by computing the optimal weights of each of the baseline shapes so that the morphed shape has minimum drag. As a result of optimization, we found that with only two baseline trains that mimic current high-speed trains with low drag that the drag of the optimal train is reduced by 8.04% with respect to the baseline train with the smaller drag. When we repeat the optimization by adding a third baseline train that under-performs compared to the other baseline train, the drag of the new optimal train is reduced by 13.46%. This finding shows that bad examples of design are as useful as good examples in determining an optimal design. We show that design-by-morphing can be extended to many engineering problems in which the performance of an object depends on its shape.

Life history variation among four lake trout morphs at Isle Royale, Lake Superior

USGS Publications Warehouse

Hansen, Michael J.; Nate, Nancy A.; Muir, Andrew M.; Bronte, Charles R.; Zimmerman, Mara S.; Krueger, Charles C.

2016-01-01

Life history traits were compared among four morphs of lake trout at Isle Royale, Lake Superior. Of 738 lake trout caught at Isle Royale, 701 were assigned to a morph (119 humpers, 160 leans, 85 redfins, and 337 siscowets) using a combination of statistical analysis of head and body shape and visual assignment. On average, redfins were longer (544 mm), heavier (1,481 g), heavier at length (Wr = 94), more buoyant, and older (22 years) than siscowets (519 mm; 1,221 g; 90; 19 years), leans (479 mm; 854 g; 82; 13 years), and humpers (443 mm; 697 g; 87; 17 years). On average, leans grew from a younger age at length = 0 and shorter length at age = 0, at a faster early growth rate to a longer asymptotic length than the other three morphs, while redfins grew at a slower instantaneous rate and humpers grew to a shorter asymptotic length than other morphs. On average, leans were longer (562 mm) and older (15 years) at 50% maturity than redfins (427 mm, 12 years), siscowets (401 mm, 11 years), or humpers (394 mm, 13 years). Life history parameters did not differ between males and females within each morph. We conclude that differences in life history attributes of lean, humper, redfin, and siscowet morphs of lake trout are consistent with differential habitat use in waters around Isle Royale, Lake Superior.

Active Tensor Magnetic Gradiometer System

DTIC Science & Technology

2007-11-01

Modify Forward Computer Models .............................................................................................2 Modify TMGS Simulator...active magnetic gradient measurement system are based upon the existing tensor magnetic gradiometer system ( TMGS ) developed under project MM-1328...Magnetic Gradiometer System ( TMGS ) for UXO Detection, Imaging, and Discrimination.” The TMGS developed under MM-1328 was successfully tested at the

Assessment of diffusion tensor imaging indices in calf muscles following postural change from standing to supine position.

PubMed

Elzibak, Alyaa H; Noseworthy, Michael D

2014-10-01

To investigate whether postural change from erect to recumbent position affects calf muscle water diffusivity. Ten healthy adults (27.2 ± 4.9 years, 3 females) were imaged at baseline (following assumption of recumbent position), and after 34 min (session 2) and 64 min (session 3) of laying supine within a 3T MRI scanner. Diffusion tensor imaging (DTI) eigenvalues, fractional anisotropy (FA) and apparent diffusion coefficient (ADC) were evaluated in five calf muscles (anterior and posterior tibialis and triceps surae) during each of the three imaging sessions. Significant decreases were observed in all of the eigenvalues and ADC in each of the muscles with postural change. These reductions ranged from 3.2 to 6.7% and 3.4 to 7.5% for the various DTI metrics, following 34 and 64 min of supine rest, respectively (P < 0.05). No significant differences were noted in ADC or eigenvalues between the second and third imaging sessions for any muscle. FA did not change significantly with postural manipulation in any muscle compartment. Diffusion tensor imaging indices were altered with postural change. As differences were not apparent between the latter two imaging sessions, we suggest that a short supine resting period (~34 min) is sufficient for muscle diffusivity to stabilize prior to quantitative MR imaging in healthy young adults.

Promote quantitative ischemia imaging via myocardial perfusion CT iterative reconstruction with tensor total generalized variation regularization

NASA Astrophysics Data System (ADS)

Gu, Chengwei; Zeng, Dong; Lin, Jiahui; Li, Sui; He, Ji; Zhang, Hao; Bian, Zhaoying; Niu, Shanzhou; Zhang, Zhang; Huang, Jing; Chen, Bo; Zhao, Dazhe; Chen, Wufan; Ma, Jianhua

2018-06-01

Myocardial perfusion computed tomography (MPCT) imaging is commonly used to detect myocardial ischemia quantitatively. A limitation in MPCT is that an additional radiation dose is required compared to unenhanced CT due to its repeated dynamic data acquisition. Meanwhile, noise and streak artifacts in low-dose cases are the main factors that degrade the accuracy of quantifying myocardial ischemia and hamper the diagnostic utility of the filtered backprojection reconstructed MPCT images. Moreover, it is noted that the MPCT images are composed of a series of 2/3D images, which can be naturally regarded as a 3/4-order tensor, and the MPCT images are globally correlated along time and are sparse across space. To obtain higher fidelity ischemia from low-dose MPCT acquisitions quantitatively, we propose a robust statistical iterative MPCT image reconstruction algorithm by incorporating tensor total generalized variation (TTGV) regularization into a penalized weighted least-squares framework. Specifically, the TTGV regularization fuses the spatial correlation of the myocardial structure and the temporal continuation of the contrast agent intake during the perfusion. Then, an efficient iterative strategy is developed for the objective function optimization. Comprehensive evaluations have been conducted on a digital XCAT phantom and a preclinical porcine dataset regarding the accuracy of the reconstructed MPCT images, the quantitative differentiation of ischemia and the algorithm’s robustness and efficiency.

A diffusion tensor imaging tractography algorithm based on Navier-Stokes fluid mechanics.

PubMed

Hageman, Nathan S; Toga, Arthur W; Narr, Katherine L; Shattuck, David W

2009-03-01

We introduce a fluid mechanics based tractography method for estimating the most likely connection paths between points in diffusion tensor imaging (DTI) volumes. We customize the Navier-Stokes equations to include information from the diffusion tensor and simulate an artificial fluid flow through the DTI image volume. We then estimate the most likely connection paths between points in the DTI volume using a metric derived from the fluid velocity vector field. We validate our algorithm using digital DTI phantoms based on a helical shape. Our method segmented the structure of the phantom with less distortion than was produced using implementations of heat-based partial differential equation (PDE) and streamline based methods. In addition, our method was able to successfully segment divergent and crossing fiber geometries, closely following the ideal path through a digital helical phantom in the presence of multiple crossing tracts. To assess the performance of our algorithm on anatomical data, we applied our method to DTI volumes from normal human subjects. Our method produced paths that were consistent with both known anatomy and directionally encoded color images of the DTI dataset.

A Diffusion Tensor Imaging Tractography Algorithm Based on Navier-Stokes Fluid Mechanics

PubMed Central

Hageman, Nathan S.; Toga, Arthur W.; Narr, Katherine; Shattuck, David W.

2009-01-01

We introduce a fluid mechanics based tractography method for estimating the most likely connection paths between points in diffusion tensor imaging (DTI) volumes. We customize the Navier-Stokes equations to include information from the diffusion tensor and simulate an artificial fluid flow through the DTI image volume. We then estimate the most likely connection paths between points in the DTI volume using a metric derived from the fluid velocity vector field. We validate our algorithm using digital DTI phantoms based on a helical shape. Our method segmented the structure of the phantom with less distortion than was produced using implementations of heat-based partial differential equation (PDE) and streamline based methods. In addition, our method was able to successfully segment divergent and crossing fiber geometries, closely following the ideal path through a digital helical phantom in the presence of multiple crossing tracts. To assess the performance of our algorithm on anatomical data, we applied our method to DTI volumes from normal human subjects. Our method produced paths that were consistent with both known anatomy and directionally encoded color (DEC) images of the DTI dataset. PMID:19244007

Vessel Enhancement and Segmentation of 4D CT Lung Image Using Stick Tensor Voting

NASA Astrophysics Data System (ADS)

Cong, Tan; Hao, Yang; Jingli, Shi; Xuan, Yang

2016-12-01

Vessel enhancement and segmentation plays a significant role in medical image analysis. This paper proposes a novel vessel enhancement and segmentation method for 4D CT lung image using stick tensor voting algorithm, which focuses on addressing the vessel distortion issue of vessel enhancement diffusion (VED) method. Furthermore, the enhanced results are easily segmented using level-set segmentation. In our method, firstly, vessels are filtered using Frangi's filter to reduce intrapulmonary noises and extract rough blood vessels. Secondly, stick tensor voting algorithm is employed to estimate the correct direction along the vessel. Then the estimated direction along the vessel is used as the anisotropic diffusion direction of vessel in VED algorithm, which makes the intensity diffusion of points locating at the vessel wall be consistent with the directions of vessels and enhance the tubular features of vessels. Finally, vessels can be extracted from the enhanced image by applying level-set segmentation method. A number of experiments results show that our method outperforms traditional VED method in vessel enhancement and results in satisfied segmented vessels.

Adaptive local thresholding for robust nucleus segmentation utilizing shape priors

NASA Astrophysics Data System (ADS)

Wang, Xiuzhong; Srinivas, Chukka

2016-03-01

This paper describes a novel local thresholding method for foreground detection. First, a Canny edge detection method is used for initial edge detection. Then, tensor voting is applied on the initial edge pixels, using a nonsymmetric tensor field tailored to encode prior information about nucleus size, shape, and intensity spatial distribution. Tensor analysis is then performed to generate the saliency image and, based on that, the refined edge. Next, the image domain is divided into blocks. In each block, at least one foreground and one background pixel are sampled for each refined edge pixel. The saliency weighted foreground histogram and background histogram are then created. These two histograms are used to calculate a threshold by minimizing the background and foreground pixel classification error. The block-wise thresholds are then used to generate the threshold for each pixel via interpolation. Finally, the foreground is obtained by comparing the original image with the threshold image. The effective use of prior information, combined with robust techniques, results in far more reliable foreground detection, which leads to robust nucleus segmentation.

Mean template for tensor-based morphometry using deformation tensors.

PubMed

Leporé, Natasha; Brun, Caroline; Pennec, Xavier; Chou, Yi-Yu; Lopez, Oscar L; Aizenstein, Howard J; Becker, James T; Toga, Arthur W; Thompson, Paul M

2007-01-01

Tensor-based morphometry (TBM) studies anatomical differences between brain images statistically, to identify regions that differ between groups, over time, or correlate with cognitive or clinical measures. Using a nonlinear registration algorithm, all images are mapped to a common space, and statistics are most commonly performed on the Jacobian determinant (local expansion factor) of the deformation fields. In, it was shown that the detection sensitivity of the standard TBM approach could be increased by using the full deformation tensors in a multivariate statistical analysis. Here we set out to improve the common space itself, by choosing the shape that minimizes a natural metric on the deformation tensors from that space to the population of control subjects. This method avoids statistical bias and should ease nonlinear registration of new subjects data to a template that is 'closest' to all subjects' anatomies. As deformation tensors are symmetric positive-definite matrices and do not form a vector space, all computations are performed in the log-Euclidean framework. The control brain B that is already the closest to 'average' is found. A gradient descent algorithm is then used to perform the minimization that iteratively deforms this template and obtains the mean shape. We apply our method to map the profile of anatomical differences in a dataset of 26 HIV/AIDS patients and 14 controls, via a log-Euclidean Hotelling's T2 test on the deformation tensors. These results are compared to the ones found using the 'best' control, B. Statistics on both shapes are evaluated using cumulative distribution functions of the p-values in maps of inter-group differences.

Diffusion tensor eigenvector directional color imaging patterns in the evaluation of cerebral white matter tracts altered by tumor.

PubMed

Field, Aaron S; Alexander, Andrew L; Wu, Yu-Chien; Hasan, Khader M; Witwer, Brian; Badie, Behnam

2004-10-01

To categorize the varied appearances of tumor-altered white matter (WM) tracts on diffusion tensor eigenvector directional color maps. Diffusion tensor imaging (DTI) was obtained preoperatively in 13 patients with brain tumors ranging from benign to high-grade malignant, including primary and metastatic lesions, and maps of apparent diffusion coefficient (ADC), fractional anisotropy (FA), and major eigenvector direction were generated. Regions of interest (ROIs) were drawn within identifiable WM tracts affected by tumor, avoiding grossly cystic and necrotic regions, known fiber crossings, and gray matter. Patterns of WM tract alteration were categorized on the basis of qualitative analysis of directional color maps and correlation analysis of ADC and FA. Four basic patterns of WM alteration were identified: 1) normal or nearly normal FA and ADC, with abnormal tract location or tensor directions attributable to bulk mass displacement, 2) moderately decreased FA and increased ADC with normal tract locations and tensor directions, 3) moderately decreased FA and increased ADC with abnormal tensor directions, and 4) near isotropy. FA and ADC were inversely correlated for Patterns 1-3 but did not discriminate edema from infiltrating tumor. However, in the absence of mass displacement, infiltrating tumor was found to produce tensor directional changes that were not observed with vasogenic edema, suggesting the possibility of discrimination on the basis of directional statistics. Tumor alteration of WM tracts tends to produce one of four patterns on FA and directional color maps. Clinical application of these patterns must await further study. Copyright 2004 Wiley-Liss, Inc.

FY09 Annual Report to the Executive Agent

DTIC Science & Technology

2009-01-01

tensor imaging ( DTI ) after follow-up im- aging studies. This case report was published in Neuroimage, 2009 Aug; 47 Suppl 2:T152-3. Epub 2009 Feb 10 and...27(7), 2009. Diffusion Tensor Imaging Study Shows Blast Injury May Cause Brain Inflammation Researchers from the DCoE for PH/TBI used DTI to...similar to what occurs in the brain with infection or stroke. DTI in blast patients was different from the pattern seen for the traditional impact forms

Diffusion weighted imaging for the differentiation of breast tumors: From apparent diffusion coefficient to high order diffusion tensor imaging.

PubMed

Teruel, Jose R; Goa, Pål E; Sjøbakk, Torill E; Østlie, Agnes; Fjøsne, Hans E; Bathen, Tone F

2016-05-01

To compare "standard" diffusion weighted imaging, and diffusion tensor imaging (DTI) of 2(nd) and 4(th) -order for the differentiation of malignant and benign breast lesions. Seventy-one patients were imaged at 3 Tesla with a 16-channel breast coil. A diffusion weighted MRI sequence including b = 0 and b = 700 in 30 directions was obtained for all patients. The image data were fitted to three different diffusion models: isotropic model - apparent diffusion coefficient (ADC), 2(nd) -order tensor model (the standard model used for DTI) and a 4(th) -order tensor model, with increased degrees of freedom to describe anisotropy. The ability of the fitted parameters in the different models to differentiate between malignant and benign tumors was analyzed. Seventy-two breast lesions were analyzed, out of which 38 corresponded to malignant and 34 to benign tumors. ADC (using any model) presented the highest discriminative ability of malignant from benign tumors with a receiver operating characteristic area under the curve (AUC) of 0.968, and sensitivity and specificity of 94.1% and 94.7% respectively for a 1.33 × 10(-3) mm(2) /s cutoff. Anisotropy measurements presented high statistical significance between malignant and benign tumors (P < 0.001), but with lower discriminative ability of malignant from benign tumors than ADC (AUC of 0.896 and 0.897 for fractional anisotropy and generalized anisotropy respectively). Statistical significant difference was found between generalized anisotropy and fractional anisotropy for cancers (P < 0.001) but not for benign lesions (P = 0.87). While anisotropy parameters have the potential to provide additional value for breast applications as demonstrated in this study, ADC exhibited the highest differentiation power between malignant and benign breast tumors. © 2015 Wiley Periodicals, Inc.

Antioxidant Machinery Differs between Melanic and Light Nestlings of Two Polymorphic Raptors

PubMed Central

Galván, Ismael; Gangoso, Laura; Grande, Juan M.; Negro, Juan J.; Rodríguez, Airam; Figuerola, Jordi; Alonso-Alvarez, Carlos

2010-01-01

Colour polymorphism results from the expression of multiallelic genes generating phenotypes with very distinctive colourations. Most colour polymorphisms are due to differences in the type or amount of melanins present in each morph, which also differ in several behavioural, morphometric and physiological attributes. Melanin-based colour morphs could also differ in the levels of glutathione (GSH), a key intracellular antioxidant, because of the role of this molecule in melanogenesis. As GSH inhibits the synthesis of eumelanin (i.e. the darkest melanin form), individuals of darker morphs are expected to have lower GSH levels than those of lighter morphs. We tested this prediction in nestlings of two polymorphic raptors, the booted eagle Hieraaetus pennatus and the Eleonora's falcon Falco eleonorae, both of which occur in two morphs differing in the extent of eumelanic plumage. As expected, melanic booted eagle nestlings had lower blood GSH levels than light morph eagle nestlings. In the Eleonora's falcon, however, melanic nestlings only had lower GSH levels after controlling for the levels of other antioxidants. We also found that melanic female eagle nestlings had higher levels of antioxidants other than GSH and were in better body condition than light female eagle nestlings. These findings suggest an adaptive response of melanic nestlings to compensate for reduced GSH levels. Nevertheless, these associations were not found in falcons, indicating species-specific particularities in antioxidant machinery. Our results are consistent with previous work revealing the importance of GSH on the expression of melanic characters that show continuous variation, and suggest that this pathway also applies to discrete colour morphs. We suggest that the need to maintain low GSH levels for eumelanogenesis in dark morph individuals may represent a physiological constraint that helps regulate the evolution and maintenance of polymorphisms. PMID:20976228

Antioxidant machinery differs between melanic and light nestlings of two polymorphic raptors.

PubMed

Galván, Ismael; Gangoso, Laura; Grande, Juan M; Negro, Juan J; Rodríguez, Airam; Figuerola, Jordi; Alonso-Alvarez, Carlos

2010-10-14

Colour polymorphism results from the expression of multiallelic genes generating phenotypes with very distinctive colourations. Most colour polymorphisms are due to differences in the type or amount of melanins present in each morph, which also differ in several behavioural, morphometric and physiological attributes. Melanin-based colour morphs could also differ in the levels of glutathione (GSH), a key intracellular antioxidant, because of the role of this molecule in melanogenesis. As GSH inhibits the synthesis of eumelanin (i.e. the darkest melanin form), individuals of darker morphs are expected to have lower GSH levels than those of lighter morphs. We tested this prediction in nestlings of two polymorphic raptors, the booted eagle Hieraaetus pennatus and the Eleonora's falcon Falco eleonorae, both of which occur in two morphs differing in the extent of eumelanic plumage. As expected, melanic booted eagle nestlings had lower blood GSH levels than light morph eagle nestlings. In the Eleonora's falcon, however, melanic nestlings only had lower GSH levels after controlling for the levels of other antioxidants. We also found that melanic female eagle nestlings had higher levels of antioxidants other than GSH and were in better body condition than light female eagle nestlings. These findings suggest an adaptive response of melanic nestlings to compensate for reduced GSH levels. Nevertheless, these associations were not found in falcons, indicating species-specific particularities in antioxidant machinery. Our results are consistent with previous work revealing the importance of GSH on the expression of melanic characters that show continuous variation, and suggest that this pathway also applies to discrete colour morphs. We suggest that the need to maintain low GSH levels for eumelanogenesis in dark morph individuals may represent a physiological constraint that helps regulate the evolution and maintenance of polymorphisms.

Morphing unmanned aerial vehicles

NASA Astrophysics Data System (ADS)

Gomez, Juan Carlos; Garcia, Ephrahim

2011-10-01

Research on aircraft morphing has exploded in recent years. The motivation and driving force behind this has been to find new and novel ways to increase the capabilities of aircraft. Materials advancements have helped to increase possibilities with respect to actuation and, hence, a diversity of concepts and unimagined capabilities. The expanded role of unmanned aerial vehicles (UAVs) has provided an ideal platform for exploring these emergent morphing concepts since at this scale a greater amount of risk can be taken, as well as having more manageable fabrication and cost requirements. This review focuses on presenting the role UAVs have in morphing research by giving an overview of the UAV morphing concepts, designs, and technologies described in the literature. A presentation of quantitative information as well as a discussion of technical issues is given where possible to begin gaining some insight into the overall assessment and performance of these technologies.

Modeling and Optimization for Morphing Wing Concept Generation II. Part 1; Morphing Wing Modeling and Structural Sizing Techniques

NASA Technical Reports Server (NTRS)

Skillen, Michael D.; Crossley, William A.

2008-01-01

This report documents a series of investigations to develop an approach for structural sizing of various morphing wing concepts. For the purposes of this report, a morphing wing is one whose planform can make significant shape changes in flight - increasing wing area by 50% or more from the lowest possible area, changing sweep 30 or more, and / or increasing aspect ratio by as much as 200% from the lowest possible value. These significant changes in geometry mean that the underlying load-bearing structure changes geometry. While most finite element analysis packages provide some sort of structural optimization capability, these codes are not amenable to making significant changes in the stiffness matrix to reflect the large morphing wing planform changes. The investigations presented here use a finite element code capable of aeroelastic analysis in three different optimization approaches -a "simultaneous analysis" approach, a "sequential" approach, and an "aggregate" approach.

Design and analysis of morphing wing based on SMP composite

NASA Astrophysics Data System (ADS)

Yu, Kai; Yin, Weilong; Sun, Shouhua; Liu, Yanju; Leng, Jinsong

2009-03-01

A new concept of a morphing wing based on shape memory polymer (SMP) and its reinforced composites is proposed in this paper. SMP used in this study is a thermoset styrene-based resin in contrast to normal thermoplastic SMP. During heating, the wing curled on the aircraft can be deployed, providing main lift for a morphing aircraft to realize the stable flight. Aerodynamic characteristics of the deployed morphing wing are calculated by using CFD software. The static deformation of the wing under the air loads is also analyzed by using the finite element method. The results show that the used SMP material can provide enough strength and stiffness for the application. Finally, preliminary testing is conducted to investigate the recovery performances of SMP and its reinforced composites. During the test, the deployment and the wind-resistant ability of the morphing wing are dramatically improved by adding reinforced phase to the SMP.

A Bayesian approach to distinguishing interdigitated tongue muscles from limited diffusion magnetic resonance imaging.

PubMed

Ye, Chuyang; Murano, Emi; Stone, Maureen; Prince, Jerry L

2015-10-01

The tongue is a critical organ for a variety of functions, including swallowing, respiration, and speech. It contains intrinsic and extrinsic muscles that play an important role in changing its shape and position. Diffusion tensor imaging (DTI) has been used to reconstruct tongue muscle fiber tracts. However, previous studies have been unable to reconstruct the crossing fibers that occur where the tongue muscles interdigitate, which is a large percentage of the tongue volume. To resolve crossing fibers, multi-tensor models on DTI and more advanced imaging modalities, such as high angular resolution diffusion imaging (HARDI) and diffusion spectrum imaging (DSI), have been proposed. However, because of the involuntary nature of swallowing, there is insufficient time to acquire a sufficient number of diffusion gradient directions to resolve crossing fibers while the in vivo tongue is in a fixed position. In this work, we address the challenge of distinguishing interdigitated tongue muscles from limited diffusion magnetic resonance imaging by using a multi-tensor model with a fixed tensor basis and incorporating prior directional knowledge. The prior directional knowledge provides information on likely fiber directions at each voxel, and is computed with anatomical knowledge of tongue muscles. The fiber directions are estimated within a maximum a posteriori (MAP) framework, and the resulting objective function is solved using a noise-aware weighted ℓ1-norm minimization algorithm. Experiments were performed on a digital crossing phantom and in vivo tongue diffusion data including three control subjects and four patients with glossectomies. On the digital phantom, effects of parameters, noise, and prior direction accuracy were studied, and parameter settings for real data were determined. The results on the in vivo data demonstrate that the proposed method is able to resolve interdigitated tongue muscles with limited gradient directions. The distributions of the computed fiber directions in both the controls and the patients were also compared, suggesting a potential clinical use for this imaging and image analysis methodology. Copyright © 2015 Elsevier Ltd. All rights reserved.

Diffusion tensor imaging analysis of sequential spreading of disease in amyotrophic lateral sclerosis confirms patterns of TDP-43 pathology.

PubMed

Kassubek, Jan; Müller, Hans-Peter; Del Tredici, Kelly; Brettschneider, Johannes; Pinkhardt, Elmar H; Lulé, Dorothée; Böhm, Sarah; Braak, Heiko; Ludolph, Albert C

2014-06-01

Diffusion tensor imaging can identify amyotrophic lateral sclerosis-associated patterns of brain alterations at the group level. Recently, a neuropathological staging system for amyotrophic lateral sclerosis has shown that amyotrophic lateral sclerosis may disseminate in a sequential regional pattern during four disease stages. The objective of the present study was to apply a new methodological diffusion tensor imaging-based approach to automatically analyse in vivo the fibre tracts that are prone to be involved at each neuropathological stage of amyotrophic lateral sclerosis. Two data samples, consisting of 130 diffusion tensor imaging data sets acquired at 1.5 T from 78 patients with amyotrophic lateral sclerosis and 52 control subjects; and 55 diffusion-tensor imaging data sets at 3.0 T from 33 patients with amyotrophic lateral sclerosis and 22 control subjects, were analysed by a tract of interest-based fibre tracking approach to analyse five tracts that become involved during the course of amyotrophic lateral sclerosis: the corticospinal tract (stage 1); the corticorubral and the corticopontine tracts (stage 2); the corticostriatal pathway (stage 3); the proximal portion of the perforant path (stage 4); and two reference pathways. The statistical analyses of tracts of interest showed differences between patients with amyotrophic lateral sclerosis and control subjects for all tracts. The significance level of the comparisons at the group level was lower, the higher the disease stage with corresponding involved fibre tracts. Both the clinical phenotype as assessed by the amyotrophic lateral sclerosis functional rating scale-revised and disease duration correlated significantly with the resulting staging scheme. In summary, the tract of interest-based technique allowed for individual analysis of predefined tract structures, thus making it possible to image in vivo the disease stages in amyotrophic lateral sclerosis. This approach can be used not only for individual clinical work-up purposes, but enlarges the spectrum of potential non-invasive surrogate markers as a neuroimaging-based read-out for amyotrophic lateral sclerosis studies within a clinical context. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Lighting up Protons with MorphFl, a Fluorescein-Morpholine Dyad: An Experiment for the Organic Laboratory

ERIC Educational Resources Information Center

Miller, Tyson A.; Spangler, Michael; Burdette, Shawn C.

2011-01-01

A two-period organic laboratory experiment that includes fluorescence sensing is presented. The pH-sensitive sensor MorphFl is prepared using a Mannich reaction between a fluorescein derivative and the iminium ion of morpholine. During the first laboratory, students prepare MorphFl. The second session begins with characterizing the sensor using…

On the Role of Individual Items in Recognition Memory and Metacognition: Challenges for Signal Detection Theory

ERIC Educational Resources Information Center

Busey, Thomas A.; Arici, Anne

2009-01-01

The authors tested the role of individual items in recognition memory using a forced-choice paradigm with face stimuli. They constructed distractor stimuli using morphing procedures that were similar to two parent faces and then compared a studied morph against an unstudied morph that was similar to two studied parents. The similarity of the…

Diffusion tensor imaging of the sural nerve in normal controls☆

PubMed Central

Kim, Boklye; Srinivasan, Ashok; Sabb, Brian; Feldman, Eva L; Pop-Busui, Rodica

2016-01-01

Objective To develop a diffusion tensor imaging (DTI) protocol for assessing the sural nerve in healthy subjects. Methods Sural nerves in 25 controls were imaged using DTI at 3 T with 6, 15, and 32 gradient directions. Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) were computed from nerve regions of interest co-registered with T2-weighted images. Results Coronal images with 0.5(RL)×2.0(FH)×0.5(AP) mm3 resolution successfully localized the sural nerve. FA maps showed less variability with 32 directions (0.559±0.071) compared to 15(0.590±0.080) and 6(0.659±0.109). Conclusions Our DTI protocol was effective in imaging sural nerves in controls to establish normative FA/ADC, with potential to be used non-invasively in diseased nerves of patients. PMID:24908367

A brain MRI atlas of the common squirrel monkey, Saimiri sciureus

NASA Astrophysics Data System (ADS)

Gao, Yurui; Schilling, Kurt G.; Khare, Shweta P.; Panda, Swetasudha; Choe, Ann S.; Stepniewska, Iwona; Li, Xia; Ding, Zhoahua; Anderson, Adam; Landman, Bennett A.

2014-03-01

The common squirrel monkey, Saimiri sciureus, is a New World monkey with functional and microstructural organization of central nervous system similar to that of humans. It is one of the most commonly used South American primates in biomedical research. Unlike its Old World macaque cousins, no digital atlases have described the organization of the squirrel monkey brain. Here, we present a multi-modal magnetic resonance imaging (MRI) atlas constructed from the brain of an adult female squirrel monkey. In vivo MRI acquisitions include high resolution T2 structural imaging and low resolution diffusion tensor imaging. Ex vivo MRI acquisitions include high resolution T2 structural imaging and high resolution diffusion tensor imaging. Cortical regions were manually annotated on the co-registered volumes based on published histological sections.

Gap filling of 3-D microvascular networks by tensor voting.

PubMed

Risser, L; Plouraboue, F; Descombes, X

2008-05-01

We present a new algorithm which merges discontinuities in 3-D images of tubular structures presenting undesirable gaps. The application of the proposed method is mainly associated to large 3-D images of microvascular networks. In order to recover the real network topology, we need to fill the gaps between the closest discontinuous vessels. The algorithm presented in this paper aims at achieving this goal. This algorithm is based on the skeletonization of the segmented network followed by a tensor voting method. It permits to merge the most common kinds of discontinuities found in microvascular networks. It is robust, easy to use, and relatively fast. The microvascular network images were obtained using synchrotron tomography imaging at the European Synchrotron Radiation Facility. These images exhibit samples of intracortical networks. Representative results are illustrated.

An adaptive tensor voting algorithm combined with texture spectrum

NASA Astrophysics Data System (ADS)

Wang, Gang; Su, Qing-tang; Lü, Gao-huan; Zhang, Xiao-feng; Liu, Yu-huan; He, An-zhi

2015-01-01

An adaptive tensor voting algorithm combined with texture spectrum is proposed. The image texture spectrum is used to get the adaptive scale parameter of voting field. Then the texture information modifies both the attenuation coefficient and the attenuation field so that we can use this algorithm to create more significant and correct structures in the original image according to the human visual perception. At the same time, the proposed method can improve the edge extraction quality, which includes decreasing the flocculent region efficiently and making image clear. In the experiment for extracting pavement cracks, the original pavement image is processed by the proposed method which is combined with the significant curve feature threshold procedure, and the resulted image displays the faint crack signals submerged in the complicated background efficiently and clearly.

Spectral-spatial classification using tensor modeling for cancer detection with hyperspectral imaging

NASA Astrophysics Data System (ADS)

Lu, Guolan; Halig, Luma; Wang, Dongsheng; Chen, Zhuo Georgia; Fei, Baowei

2014-03-01

As an emerging technology, hyperspectral imaging (HSI) combines both the chemical specificity of spectroscopy and the spatial resolution of imaging, which may provide a non-invasive tool for cancer detection and diagnosis. Early detection of malignant lesions could improve both survival and quality of life of cancer patients. In this paper, we introduce a tensor-based computation and modeling framework for the analysis of hyperspectral images to detect head and neck cancer. The proposed classification method can distinguish between malignant tissue and healthy tissue with an average sensitivity of 96.97% and an average specificity of 91.42% in tumor-bearing mice. The hyperspectral imaging and classification technology has been demonstrated in animal models and can have many potential applications in cancer research and management.

Face Hallucination with Linear Regression Model in Semi-Orthogonal Multilinear PCA Method

NASA Astrophysics Data System (ADS)

Asavaskulkiet, Krissada

2018-04-01

In this paper, we propose a new face hallucination technique, face images reconstruction in HSV color space with a semi-orthogonal multilinear principal component analysis method. This novel hallucination technique can perform directly from tensors via tensor-to-vector projection by imposing the orthogonality constraint in only one mode. In our experiments, we use facial images from FERET database to test our hallucination approach which is demonstrated by extensive experiments with high-quality hallucinated color faces. The experimental results assure clearly demonstrated that we can generate photorealistic color face images by using the SO-MPCA subspace with a linear regression model.

Full Tensor Diffusion Imaging Is Not Required To Assess the White-Matter Integrity in Mouse Contusion Spinal Cord Injury

PubMed Central

Tu, Tsang-Wei; Kim, Joong H.; Wang, Jian

2010-01-01

Abstract In vivo diffusion tensor imaging (DTI) derived indices have been demonstrated to quantify accurately white-matter injury after contusion spinal cord injury (SCI) in rodents. In general, a full diffusion tensor analysis requires the acquisition of diffusion-weighted images (DWI) along at least six independent directions of diffusion-sensitizing gradients. Thus, DTI measurements of the rodent central nervous system are time consuming. In this study, diffusion indices derived using the two-direction DWI (parallel and perpendicular to axonal tracts) were compared with those obtained using six-direction DTI in a mouse model of SCI. It was hypothesized that the mouse spinal cord ventral-lateral white-matter (VLWM) tracts, T8–T10 in this study, aligned with the main magnet axis (z) allowing the apparent diffusion coefficient parallel and perpendicular to the axis of the spine to be derived with diffusion-weighting gradients in the z and y axes of the magnet coordinate respectively. Compared with six-direction full tensor DTI, two-direction DWI provided comparable diffusion indices in mouse spinal cords. The measured extent of spared white matter after injury, estimated by anisotropy indices, using both six-direction DTI and two-direction DWI were in close agreement and correlated well with histological staining and behavioral assessment. The results suggest that the two-direction DWI derived indices may be used, with significantly reduced imaging time, to estimate accurately spared white matter in mouse SCI. PMID:19715399

The evolutionary history of colour polymorphism in Ischnura damselflies.

PubMed

Sánchez-Guillén, Rosa A; Cordero-Rivera, Adolfo; Rivas-Torres, Anais; Wellenreuther, Maren; Bybee, Seth; Hansson, Bengt; Velasquez-Vélez, María I; Realpe, Emilio; Chávez-Ríos, Jesús R; Villalobos, Fabricio; Dumont, Henri

2018-05-10

A major challenge in evolutionary biology consists of understanding how genetic and phenotypic variation is created and maintained. In the present study, we investigated the origin(s) and evolutionary patterns of the female-limited colour polymorphism in ischnuran damselflies. These consist of the presence of one to three colour morphs: one androchrome morph with a colouration that is similar to the male, and two gynochrome morphs (infuscans and aurantiaca) with female-specific colouration. We (i) documented the colour and mating system of 44 of the 75 taxa within the genus Ischnura, (ii) reconstructed the evolutionary history of colour and mating system to identify the ancestral state, (iii) evaluated the stability of the colour morph status over time, and (iv) tested for a correlation between colour and mating system. We found that the ances tral female colour of Ischnura was monomorphic and aurantiaca and that colour morph status changed over time; characterised by many gains and losses across the species tree. Our results further showed that colour polymorphism is significantly more frequent among polyandric species, whereas monandric species tend to be monomorphic. Research on some Ischnura species has shown that colour morphs have evolved to reduce male mating harassment, and our finding that the same phenotypic morphs have evolved multiple times (convergent evolution) suggests that several species in this genus might be experiencing similar selective pressures. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Differences in pollination success between local and foreign flower color phenotypes: a translocation experiment with Gentiana lutea (Gentianaceae).

PubMed

Guitián, Javier A; Sobral, Mar; Veiga, Tania; Losada, María; Guitián, Pablo; Guitián, José M

2017-01-01

The adaptive maintenance of flower color variation is frequently attributed to pollinators partly because they preferentially visit certain flower phenotypes. We tested whether Gentiana lutea -which shows a flower color variation (from orange to yellow) in the Cantabrian Mountains range (north of Spain)-is locally adapted to the pollinator community. We transplanted orange-flowering individuals to a population with yellow-flowering individuals and vice versa, in order to assess whether there is a pollination advantage in the local morph by comparing its visitation rate with the foreign morph. Our reciprocal transplant experiment did not show clear local morph advantage in overall visitation rate: local orange flowers received more visits than foreign yellow flowers in the orange population, while both local and foreign flowers received the same visits in the yellow population; thus, there is no evidence of local adaptation in Gentiana lutea to the pollinator assemblage. However, some floral visitor groups (such as Bombus pratorum , B. soroensis ancaricus and B. lapidarius decipiens ) consistently preferred the local morph to the foreign morph whereas others (such as Bombus terrestris ) consistently preferred the foreign morph. We concluded that there is no evidence of local adaptation to the pollinator community in each of the two G. lutea populations studied. The consequences for local adaptation to pollinator on G. lutea flower color would depend on the variation along the Cantabrian Mountains range in morph frequency and pollinator community composition.

Differences in pollination success between local and foreign flower color phenotypes: a translocation experiment with Gentiana lutea (Gentianaceae)

PubMed Central

Sobral, Mar; Veiga, Tania; Guitián, Pablo; Guitián, José M.

2017-01-01

Background The adaptive maintenance of flower color variation is frequently attributed to pollinators partly because they preferentially visit certain flower phenotypes. We tested whether Gentiana lutea—which shows a flower color variation (from orange to yellow) in the Cantabrian Mountains range (north of Spain)—is locally adapted to the pollinator community. Methods We transplanted orange-flowering individuals to a population with yellow-flowering individuals and vice versa, in order to assess whether there is a pollination advantage in the local morph by comparing its visitation rate with the foreign morph. Results Our reciprocal transplant experiment did not show clear local morph advantage in overall visitation rate: local orange flowers received more visits than foreign yellow flowers in the orange population, while both local and foreign flowers received the same visits in the yellow population; thus, there is no evidence of local adaptation in Gentiana lutea to the pollinator assemblage. However, some floral visitor groups (such as Bombus pratorum, B. soroensis ancaricus and B. lapidarius decipiens) consistently preferred the local morph to the foreign morph whereas others (such as Bombus terrestris) consistently preferred the foreign morph. Discussion We concluded that there is no evidence of local adaptation to the pollinator community in each of the two G. lutea populations studied. The consequences for local adaptation to pollinator on G. lutea flower color would depend on the variation along the Cantabrian Mountains range in morph frequency and pollinator community composition. PMID:28194308

DTI segmentation by statistical surface evolution.

PubMed

Lenglet, Christophe; Rousson, Mikaël; Deriche, Rachid

2006-06-01

We address the problem of the segmentation of cerebral white matter structures from diffusion tensor images (DTI). A DTI produces, from a set of diffusion-weighted MR images, tensor-valued images where each voxel is assigned with a 3 x 3 symmetric, positive-definite matrix. This second order tensor is simply the covariance matrix of a local Gaussian process, with zero-mean, modeling the average motion of water molecules. As we will show in this paper, the definition of a dissimilarity measure and statistics between such quantities is a nontrivial task which must be tackled carefully. We claim and demonstrate that, by using the theoretically well-founded differential geometrical properties of the manifold of multivariate normal distributions, it is possible to improve the quality of the segmentation results obtained with other dissimilarity measures such as the Euclidean distance or the Kullback-Leibler divergence. The main goal of this paper is to prove that the choice of the probability metric, i.e., the dissimilarity measure, has a deep impact on the tensor statistics and, hence, on the achieved results. We introduce a variational formulation, in the level-set framework, to estimate the optimal segmentation of a DTI according to the following hypothesis: Diffusion tensors exhibit a Gaussian distribution in the different partitions. We must also respect the geometric constraints imposed by the interfaces existing among the cerebral structures and detected by the gradient of the DTI. We show how to express all the statistical quantities for the different probability metrics. We validate and compare the results obtained on various synthetic data-sets, a biological rat spinal cord phantom and human brain DTIs.

Subcortical pathways serving cortical language sites: initial experience with diffusion tensor imaging fiber tracking combined with intraoperative language mapping.

PubMed

Henry, Roland G; Berman, Jeffrey I; Nagarajan, Srikantan S; Mukherjee, Pratik; Berger, Mitchel S

2004-02-01

The combination of mapping functional cortical neurons by intraoperative cortical stimulation and axonal architecture by diffusion tensor MRI fiber tracking can be used to delineate the pathways between functional regions. In this study the authors investigated the feasibility of combining these techniques to yield connectivity associated with motor speech and naming. Diffusion tensor MRI fiber tracking provides maps of axonal bundles and was combined with intraoperative mapping of eloquent cortex for a patient undergoing brain tumor surgery. Tracks from eight stimulated sites in the inferior frontal cortex including mouth motor, speech arrest, and anomia were generated from the diffusion tensor MRI data. The regions connected by the fiber tracking were compared to foci from previous functional imaging reports on language tasks. Connections were found between speech arrest, mouth motor, and anomia sites and the SMA proper and cerebral peduncle. The speech arrest and a mouth motor site were also seen to connect to the putamen via the external capsule. This is the first demonstration of delineation of subcortical pathways using diffusion tensor MRI fiber tracking with intraoperative cortical stimulation. The combined techniques may provide improved preservation of eloquent regions during neurological surgery, and may provide access to direct connectivity information between functional regions of the brain.

Subcortical pathways serving cortical language sites: initial experience with diffusion tensor imaging fiber tracking combined with intraoperative language mapping

PubMed Central

Henry, Roland G.; Berman, Jeffrey I.; Nagarajan, Srikantan S.; Mukherjee, Pratik; Berger, Mitchel S.

2014-01-01

The combination of mapping functional cortical neurons by intraoperative cortical stimulation and axonal architecture by diffusion tensor MRI fiber tracking can be used to delineate the pathways between functional regions. In this study the authors investigated the feasibility of combining these techniques to yield connectivity associated with motor speech and naming. Diffusion tensor MRI fiber tracking provides maps of axonal bundles and was combined with intraoperative mapping of eloquent cortex for a patient undergoing brain tumor surgery. Tracks from eight stimulated sites in the inferior frontal cortex including mouth motor, speech arrest, and anomia were generated from the diffusion tensor MRI data. The regions connected by the fiber tracking were compared to foci from previous functional imaging reports on language tasks. Connections were found between speech arrest, mouth motor, and anomia sites and the SMA proper and cerebral peduncle. The speech arrest and a mouth motor site were also seen to connect to the putamen via the external capsule. This is the first demonstration of delineation of subcortical pathways using diffusion tensor MRI fiber tracking with intraoperative cortical stimulation. The combined techniques may provide improved preservation of eloquent regions during neurological surgery, and may provide access to direct connectivity information between functional regions of the brain. PMID:14980564

Autism spectrum disorder: does neuroimaging support the DSM-5 proposal for a symptom dyad? A systematic review of functional magnetic resonance imaging and diffusion tensor imaging studies.

PubMed

Pina-Camacho, Laura; Villero, Sonia; Fraguas, David; Boada, Leticia; Janssen, Joost; Navas-Sánchez, Francisco J; Mayoral, Maria; Llorente, Cloe; Arango, Celso; Parellada, Mara

2012-07-01

A systematic review of 208 studies comprising functional magnetic resonance imaging and diffusion tensor imaging data in patients with 'autism spectrum disorder' (ASD) was conducted, in order to determine whether these data support the forthcoming DSM-5 proposal of a social communication and behavioral symptom dyad. Studies consistently reported abnormal function and structure of fronto-temporal and limbic networks with social and pragmatic language deficits, of temporo-parieto-occipital networks with syntactic-semantic language deficits, and of fronto-striato-cerebellar networks with repetitive behaviors and restricted interests in ASD patients. Therefore, this review partially supports the DSM-5 proposal for the ASD dyad.

Kronecker-Basis-Representation Based Tensor Sparsity and Its Applications to Tensor Recovery.

PubMed

Xie, Qi; Zhao, Qian; Meng, Deyu; Xu, Zongben

2017-08-02

It is well known that the sparsity/low-rank of a vector/matrix can be rationally measured by nonzero-entries-number ($l_0$ norm)/nonzero- singular-values-number (rank), respectively. However, data from real applications are often generated by the interaction of multiple factors, which obviously cannot be sufficiently represented by a vector/matrix, while a high order tensor is expected to provide more faithful representation to deliver the intrinsic structure underlying such data ensembles. Unlike the vector/matrix case, constructing a rational high order sparsity measure for tensor is a relatively harder task. To this aim, in this paper we propose a measure for tensor sparsity, called Kronecker-basis-representation based tensor sparsity measure (KBR briefly), which encodes both sparsity insights delivered by Tucker and CANDECOMP/PARAFAC (CP) low-rank decompositions for a general tensor. Then we study the KBR regularization minimization (KBRM) problem, and design an effective ADMM algorithm for solving it, where each involved parameter can be updated with closed-form equations. Such an efficient solver makes it possible to extend KBR to various tasks like tensor completion and tensor robust principal component analysis. A series of experiments, including multispectral image (MSI) denoising, MSI completion and background subtraction, substantiate the superiority of the proposed methods beyond state-of-the-arts.

Information geometry and its application to theoretical statistics and diffusion tensor magnetic resonance imaging

NASA Astrophysics Data System (ADS)

Wisniewski, Nicholas Andrew

This dissertation is divided into two parts. First we present an exact solution to a generalization of the Behrens-Fisher problem by embedding the problem in the Riemannian manifold of Normal distributions. From this we construct a geometric hypothesis testing scheme. Secondly we investigate the most commonly used geometric methods employed in tensor field interpolation for DT-MRI analysis and cardiac computer modeling. We computationally investigate a class of physiologically motivated orthogonal tensor invariants, both at the full tensor field scale and at the scale of a single interpolation by doing a decimation/interpolation experiment. We show that Riemannian-based methods give the best results in preserving desirable physiological features.

Escape from Tumor Cell Dormancy

DTIC Science & Technology

2012-10-01

equipped with a Photometrics Quant EM S12SC camera and BD CARV II spinning disc confocal (Biovision Technologies). Images were acquired using MetaMorph ...Herein, these issues are addressed using a novel organotypic bioreactor in which tumor cells can be followed for weeks to months, the process of...probe this critical question. We proposed to use a novel ex vivo liver bioreactor to study this question. We adapted this liver bioreactor to the

Irradiation of the prostate and pelvic lymph nodes with an adaptive algorithm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, A. B.; Chen, J.; Nguyen, T. B.

2012-02-15

Purpose: The simultaneous treatment of pelvic lymph nodes and the prostate in radiotherapy for prostate cancer is complicated by the independent motion of these two target volumes. In this work, the authors study a method to adapt intensity modulated radiation therapy (IMRT) treatment plans so as to compensate for this motion by adaptively morphing the multileaf collimator apertures and adjusting the segment weights. Methods: The study used CT images, tumor volumes, and normal tissue contours from patients treated in our institution. An IMRT treatment plan was then created using direct aperture optimization to deliver 45 Gy to the pelvic lymphmore » nodes and 50 Gy to the prostate and seminal vesicles. The prostate target volume was then shifted in either the anterior-posterior direction or in the superior-inferior direction. The treatment plan was adapted by adjusting the aperture shapes with or without re-optimizing the segment weighting. The dose to the target volumes was then determined for the adapted plan. Results: Without compensation for prostate motion, 1 cm shifts of the prostate resulted in an average decrease of 14% in D-95%. If the isocenter is simply shifted to match the prostate motion, the prostate receives the correct dose but the pelvic lymph nodes are underdosed by 14% {+-} 6%. The use of adaptive morphing (with or without segment weight optimization) reduces the average change in D-95% to less than 5% for both the pelvic lymph nodes and the prostate. Conclusions: Adaptive morphing with and without segment weight optimization can be used to compensate for the independent motion of the prostate and lymph nodes when combined with daily imaging or other methods to track the prostate motion. This method allows the delivery of the correct dose to both the prostate and lymph nodes with only small changes to the dose delivered to the target volumes.« less

A Variational Framework for Exemplar-Based Image Inpainting

DTIC Science & Technology

2010-04-01

Physical Review 106(4), 620–30 (1957) 37. Jia, J., Tang, C.K.: Inference of segmented color and texture description by tensor voting . IEEE Trans. on PAMI 26...use of other patch error functions based on the comparison of structure tensors , which could provide a more robust estimation of the morpho- logical

The different faces of one’s self: an fMRI study into the recognition of current and past self-facial appearances

PubMed Central

Apps, Matthew A. J.; Tajadura-Jiménez, Ana; Turley, Grainne; Tsakiris, Manos

2013-01-01

Mirror self-recognition is often considered as an index of self-awareness. Neuroimaging studies have identified a neural circuit specialised for the recognition of one’s own current facial appearance. However, faces change considerably over a lifespan, highlighting the necessity for representations of one’s face to continually be updated. We used fMRI to investigate the different neural circuits involved in the recognition of the childhood and current, adult, faces of one’s self. Participants viewed images of either their own face as it currently looks morphed with the face of a familiar other or their childhood face morphed with the childhood face of the familiar other. Activity in areas which have a generalised selectivity for faces, including the inferior occipital gyrus, the superior parietal lobule and the inferior temporal gyrus, varied with the amount of current self in an image. Activity in areas involved in memory encoding and retrieval, including the hippocampus and the posterior cingulate gyrus, and areas involved in creating a sense of body ownership, including the temporo-parietal junction and the inferior parietal lobule, varied with the amount of childhood self in an image. We suggest that the recognition of one’s own past or present face is underpinned by different cognitive processes in distinct neural circuits. Current self-recognition engages areas involved in perceptual face processing, whereas childhood self-recognition recruits networks involved in body ownership and memory processing. PMID:22940117

The different faces of one's self: an fMRI study into the recognition of current and past self-facial appearances.

PubMed

Apps, Matthew A J; Tajadura-Jiménez, Ana; Turley, Grainne; Tsakiris, Manos

2012-11-15

Mirror self-recognition is often considered as an index of self-awareness. Neuroimaging studies have identified a neural circuit specialised for the recognition of one's own current facial appearance. However, faces change considerably over a lifespan, highlighting the necessity for representations of one's face to continually be updated. We used fMRI to investigate the different neural circuits involved in the recognition of the childhood and current, adult, faces of one's self. Participants viewed images of either their own face as it currently looks morphed with the face of a familiar other or their childhood face morphed with the childhood face of the familiar other. Activity in areas which have a generalised selectivity for faces, including the inferior occipital gyrus, the superior parietal lobule and the inferior temporal gyrus, varied with the amount of current self in an image. Activity in areas involved in memory encoding and retrieval, including the hippocampus and the posterior cingulate gyrus, and areas involved in creating a sense of body ownership, including the temporo-parietal junction and the inferior parietal lobule, varied with the amount of childhood self in an image. We suggest that the recognition of one's own past or present face is underpinned by different cognitive processes in distinct neural circuits. Current self-recognition engages areas involved in perceptual face processing, whereas childhood self-recognition recruits networks involved in body ownership and memory processing. Copyright © 2012 Elsevier Inc. All rights reserved.

Diffusion-tensor imaging of white matter tracts in patients with cerebral neoplasm.

PubMed

Witwer, Brian P; Moftakhar, Roham; Hasan, Khader M; Deshmukh, Praveen; Haughton, Victor; Field, Aaron; Arfanakis, Konstantinos; Noyes, Jane; Moritz, Chad H; Meyerand, M Elizabeth; Rowley, Howard A; Alexander, Andrew L; Badie, Behnam

2002-09-01

Preserving vital cerebral function while maximizing tumor resection is a principal goal in surgical neurooncology. Although functional magnetic resonance imaging has been useful in the localization of eloquent cerebral cortex, this method does not provide information about the white matter tracts that may be involved in invasive, intrinsic brain tumors. Recently, diffusion-tensor (DT) imaging techniques have been used to map white matter tracts in the normal brain. The aim of this study was to demonstrate the role of DT imaging in preoperative mapping of white matter tracts in relation to cerebral neoplasms. Nine patients with brain malignancies (one pilocytic astrocytoma, five oligodendrogliomas, one low-grade oligoastrocytoma, one Grade 4 astrocytoma, and one metastatic adenocarcinoma) underwent DT imaging examinations prior to tumor excision. Anatomical information about white matter tract location, orientation, and projections was obtained in every patient. Depending on the tumor type and location, evidence of white matter tract edema (two patients), infiltration (two patients), displacement (five patients), and disruption (two patients) could be assessed with the aid of DT imaging in each case. Diffusion-tensor imaging allowed for visualization of white matter tracts and was found to be beneficial in the surgical planning for patients with intrinsic brain tumors. The authors' experience with DT imaging indicates that anatomically intact fibers may be present in abnormal-appearing areas of the brain. Whether resection of these involved fibers results in subtle postoperative neurological deficits requires further systematic study.

Interpretative bias in spider phobia: Perception and information processing of ambiguous schematic stimuli.

PubMed

Haberkamp, Anke; Schmidt, Filipp

2015-09-01

This study investigates the interpretative bias in spider phobia with respect to rapid visuomotor processing. We compared perception, evaluation, and visuomotor processing of ambiguous schematic stimuli between spider-fearful and control participants. Stimuli were produced by gradually morphing schematic flowers into spiders. Participants rated these stimuli related to their perceptual appearance and to their feelings of valence, disgust, and arousal. Also, they responded to the same stimuli within a response priming paradigm that measures rapid motor activation. Spider-fearful individuals showed an interpretative bias (i.e., ambiguous stimuli were perceived as more similar to spiders) and rated spider-like stimuli as more unpleasant, disgusting, and arousing. However, we observed no differences between spider-fearful and control participants in priming effects for ambiguous stimuli. For non-ambiguous stimuli, we observed a similar enhancement for phobic pictures as has been reported previously for natural images. We discuss our findings with respect to the visual representation of morphed stimuli and to perceptual learning processes. Copyright © 2015 Elsevier B.V. All rights reserved.

Genetically distinct colour morphs of European perch Perca fluviatilis in Lake Constance differ in susceptibility to macroparasites.

PubMed

Roch, S; Behrmann-Godel, J; Brinker, A

2015-01-21

The unusual yellow-finned morph of European perch Perca fluviatilis found in Lake Constance suffers more severely from macroparasite infections, including the tapeworm Triaenophorus nodulosus and the gill worm Ancyrocephalus percae, than conspecifics elsewhere. Microsatellite analysis of yellow-finned P. fluviatilis and red-finned variant recently discovered in Lake Constance revealed significant genetic differentiation. Red-finned P. fluviatilis and fish with mixed fin colour, suggested backcrosses between red and yellow-finned colour morphs, exhibit better resilience to parasite infection, suggesting that the inability of the yellow-finned morph to reject macroparasites may have a genetic basis. © 2015 The Fisheries Society of the British Isles.

Application of SMP composite in designing a morphing wing

NASA Astrophysics Data System (ADS)

Yu, Kai; Yin, Weilong; Liu, Yanju; Leng, Jinsong

2008-11-01

A new concept of a morphing wing based on shape memory polymer (SMP) and its reinforced composite is proposed in this paper. SMP used in this study is a thermoset styrene-based resin in contrast to normal thermoplastic SMP. In our design, the wing winded on the airframe can be deployed during heating, which provides main lift for a morphing aircraft to realize stable flight. Aerodynamic characteristics of the deployed morphing wing are calculated by using CFD software. The static deformation of the wing under the air loads is also analyzed by using the finite element method. The results show that the used SMP material can provide enough strength and stiffness for the application.

Diffusion tensor imaging using multiple coils for mouse brain connectomics.

PubMed

Nouls, John C; Badea, Alexandra; Anderson, Robert B J; Cofer, Gary P; Allan Johnson, G

2018-06-01

The correlation between brain connectivity and psychiatric or neurological diseases has intensified efforts to develop brain connectivity mapping techniques on mouse models of human disease. The neural architecture of mouse brain specimens can be shown non-destructively and three-dimensionally by diffusion tensor imaging, which enables tractography, the establishment of a connectivity matrix and connectomics. However, experiments on cohorts of animals can be prohibitively long. To improve throughput in a 7-T preclinical scanner, we present a novel two-coil system in which each coil is shielded, placed off-isocenter along the axis of the magnet and connected to a receiver circuit of the scanner. Preservation of the quality factor of each coil is essential to signal-to-noise ratio (SNR) performance and throughput, because mouse brain specimen imaging at 7 T takes place in the coil-dominated noise regime. In that regime, we show a shielding configuration causing no SNR degradation in the two-coil system. To acquire data from several coils simultaneously, the coils are placed in the magnet bore, around the isocenter, in which gradient field distortions can bias diffusion tensor imaging metrics, affect tractography and contaminate measurements of the connectivity matrix. We quantified the experimental alterations in fractional anisotropy and eigenvector direction occurring in each coil. We showed that, when the coils were placed 12 mm away from the isocenter, measurements of the brain connectivity matrix appeared to be minimally altered by gradient field distortions. Simultaneous measurements on two mouse brain specimens demonstrated a full doubling of the diffusion tensor imaging throughput in practice. Each coil produced images devoid of shading or artifact. To further improve the throughput of mouse brain connectomics, we suggested a future expansion of the system to four coils. To better understand acceptable trade-offs between imaging throughput and connectivity matrix integrity, studies may seek to clarify how measurement variability, post-processing techniques and biological variability impact mouse brain connectomics. Copyright © 2018 John Wiley & Sons, Ltd.

Multilinear Graph Embedding: Representation and Regularization for Images.

PubMed

Chen, Yi-Lei; Hsu, Chiou-Ting

2014-02-01

Given a set of images, finding a compact and discriminative representation is still a big challenge especially when multiple latent factors are hidden in the way of data generation. To represent multifactor images, although multilinear models are widely used to parameterize the data, most methods are based on high-order singular value decomposition (HOSVD), which preserves global statistics but interprets local variations inadequately. To this end, we propose a novel method, called multilinear graph embedding (MGE), as well as its kernelization MKGE to leverage the manifold learning techniques into multilinear models. Our method theoretically links the linear, nonlinear, and multilinear dimensionality reduction. We also show that the supervised MGE encodes informative image priors for image regularization, provided that an image is represented as a high-order tensor. From our experiments on face and gait recognition, the superior performance demonstrates that MGE better represents multifactor images than classic methods, including HOSVD and its variants. In addition, the significant improvement in image (or tensor) completion validates the potential of MGE for image regularization.

Negative frequency-dependent selection maintains a dramatic flower color polymorphism in the rewardless orchid Dactylorhiza sambucina (L.) Soò

PubMed Central

Gigord, Luc D. B.; Macnair, Mark R.; Smithson, Ann

2001-01-01

The orchid Dactylorhiza sambucina shows a stable and dramatic flower-color polymorphism, with both yellow- and purple-flowered individuals present in natural populations throughout the range of the species in Europe. The evolutionary significance of flower-color polymorphisms found in many rewardless orchid species has been discussed at length, but the mechanisms responsible for their maintenance remain unclear. Laboratory experiments have suggested that behavioral responses by pollinators to lack of reward availability might result in a reproductive advantage for rare-color morphs. Consequently, we performed an experiment varying the relative frequency of the two color morphs of D. sambucina to test whether rare morph advantage acted in the natural habitat of the species. We show here clear evidence from this manipulative experiment that rare-color morphs have reproductive advantage through male and female components. This is the first demonstration, to our knowledge, that negative frequency-dependent selection through pollinator preference for rare morphs can cause the maintenance of a flower-color polymorphism. PMID:11353863

Separation of metadata and pixel data to speed DICOM tag morphing.

PubMed

Ismail, Mahmoud; Philbin, James

2013-01-01

The DICOM information model combines pixel data and metadata in single DICOM object. It is not possible to access the metadata separately from the pixel data. There are use cases where only metadata is accessed. The current DICOM object format increases the running time of those use cases. Tag morphing is one of those use cases. Tag morphing includes deletion, insertion or manipulation of one or more of the metadata attributes. It is typically used for order reconciliation on study acquisition or to localize the issuer of patient ID (IPID) and the patient ID attributes when data from one domain is transferred to a different domain. In this work, we propose using Multi-Series DICOM (MSD) objects, which separate metadata from pixel data and remove duplicate attributes, to reduce the time required for Tag Morphing. The time required to update a set of study attributes in each format is compared. The results show that the MSD format significantly reduces the time required for tag morphing.

Analysis and design of lattice materials for large cord and curvature variations in skin panels of morphing wings

NASA Astrophysics Data System (ADS)

Vigliotti, Andrea; Pasini, Damiano

2015-03-01

In the past few decades, several concepts for morphing wings have been proposed with the aim of improving the structural and aerodynamic performance of conventional aircraft wings. One of the most interesting challenges in the design of a morphing wing is represented by the skin, which needs to meet specific deformation requirements. In particular when morphing involves changes of cord or curvature, the skin is required to undergo large recoverable deformation in the actuation direction, while maintaining the desired shape and strength in the others. One promising material concept that can meet these specifications is represented by lattice materials. This paper examines the use of alternative planar lattices in the embodiment of a skin panel for cord and camber morphing of an aircraft wing. We use a structural homogenization scheme capable of capturing large geometric nonlinearity, to examine the structural performance of lattice skin concepts, as well as to tune their mechanical properties in desired directions.

A zero torsional stiffness twist morphing blade as a wind turbine load alleviation device

NASA Astrophysics Data System (ADS)

Lachenal, X.; Daynes, S.; Weaver, P. M.

2013-06-01

This paper presents the design, analysis and realization of a zero stiffness twist morphing wind turbine blade. The morphing blade is designed to actively twist as a means of alleviating the gust loads which reduce the fatigue life of wind turbine blades. The morphing structure exploits an elastic strain energy balance within the blade to enable large twisting deformations with modest actuation requirements. While twist is introduced using the warping of the blade skin, internal pre-stressed members ensure that a constant strain energy balance is achieved throughout the deformation, resulting in a zero torsional stiffness structure. The torsional stability of the morphing blade is characterized by analysing the elastic strain energy in the device. Analytical models of the skin, the pre-stressed components and the complete blade are compared to their respective finite element models as well as experimental results. The load alleviation potential of the adaptive structure is quantified using a two-dimensional steady flow aerodynamic model which is experimentally validated with wind tunnel measurements.

Colour assortative pairing in a colour polymorphic lizard is independent of population morph diversity

NASA Astrophysics Data System (ADS)

Pérez i de Lanuza, Guillem; Font, Enrique; Carretero, Miguel Ángel

2016-10-01

Previous work with a colour polymorphic population of Podarcis muralis (Lacertidae) revealed that lizards pair by ventral colour, favouring the same colour (i.e. homomorphic) pairs. Such assortative pairing, which probably results in colour assortative mating, can have consequences for the genetic structure of the population and potentially promote speciation. The population previously studied, located in the Pyrenees, encompasses white, yellow and orange animals, as well as intermediate white-orange and yellow-orange morphs. However, other Pyrenean populations of P. muralis have less ventral colour morphs. Our aim in this study is to test the generality of the assortative colour pairing system, extending our previous analyses to populations with different morph compositions and frequencies. The results show that the assortative pattern of pairing is similar in all the populations analysed and, hence, independent of morph composition and not restricted to pentamorphic populations. This suggests that assortative pairing by colour is a general phenomenon for colour polymorphic populations of P. muralis.

Image Corruption Detection in Diffusion Tensor Imaging for Post-Processing and Real-Time Monitoring

PubMed Central

Li, Yue; Shea, Steven M.; Lorenz, Christine H.; Jiang, Hangyi; Chou, Ming-Chung; Mori, Susumu

2013-01-01

Due to the high sensitivity of diffusion tensor imaging (DTI) to physiological motion, clinical DTI scans often suffer a significant amount of artifacts. Tensor-fitting-based, post-processing outlier rejection is often used to reduce the influence of motion artifacts. Although it is an effective approach, when there are multiple corrupted data, this method may no longer correctly identify and reject the corrupted data. In this paper, we introduce a new criterion called “corrected Inter-Slice Intensity Discontinuity” (cISID) to detect motion-induced artifacts. We compared the performance of algorithms using cISID and other existing methods with regard to artifact detection. The experimental results show that the integration of cISID into fitting-based methods significantly improves the retrospective detection performance at post-processing analysis. The performance of the cISID criterion, if used alone, was inferior to the fitting-based methods, but cISID could effectively identify severely corrupted images with a rapid calculation time. In the second part of this paper, an outlier rejection scheme was implemented on a scanner for real-time monitoring of image quality and reacquisition of the corrupted data. The real-time monitoring, based on cISID and followed by post-processing, fitting-based outlier rejection, could provide a robust environment for routine DTI studies. PMID:24204551

Monitoring In-Vivo the Mammary Gland Microstructure during Morphogenesis from Lactation to Post-Weaning Using Diffusion Tensor MRI.

PubMed

Nissan, Noam; Furman-Haran, Edna; Shapiro-Feinberg, Myra; Grobgeld, Dov; Degani, Hadassa

2017-09-01

Lactation and the return to the pre-conception state during post-weaning are regulated by hormonal induced processes that modify the microstructure of the mammary gland, leading to changes in the features of the ductal / glandular tissue, the stroma and the fat tissue. These changes create a challenge in the radiological workup of breast disorder during lactation and early post-weaning. Here we present non-invasive MRI protocols designed to record in vivo high spatial resolution, T 2 -weighted images and diffusion tensor images of the entire mammary gland. Advanced imaging processing tools enabled tracking the changes in the anatomical and microstructural features of the mammary gland from the time of lactation to post-weaning. Specifically, by using diffusion tensor imaging (DTI) it was possible to quantitatively distinguish between the ductal / glandular tissue distention during lactation and the post-weaning involution. The application of the T 2 -weighted imaging and DTI is completely safe, non-invasive and uses intrinsic contrast based on differences in transverse relaxation rates and water diffusion rates in various directions, respectively. This study provides a basis for further in-vivo monitoring of changes during the mammary developmental stages, as well as identifying changes due to malignant transformation in patients with pregnancy associated breast cancer (PABC).

Iterative image reconstruction for multienergy computed tomography via structure tensor total variation regularization

NASA Astrophysics Data System (ADS)

Zeng, Dong; Bian, Zhaoying; Gong, Changfei; Huang, Jing; He, Ji; Zhang, Hua; Lu, Lijun; Feng, Qianjin; Liang, Zhengrong; Ma, Jianhua

2016-03-01

Multienergy computed tomography (MECT) has the potential to simultaneously offer multiple sets of energy- selective data belonging to specific energy windows. However, because sufficient photon counts are not available in the specific energy windows compared with that in the whole energy window, the MECT images reconstructed by the analytical approach often suffer from poor signal-to-noise (SNR) and strong streak artifacts. To eliminate this drawback, in this work we present a penalized weighted least-squares (PWLS) scheme by incorporating the new concept of structure tensor total variation (STV) regularization to improve the MECT images quality from low-milliampere-seconds (low-mAs) data acquisitions. Henceforth the present scheme is referred to as `PWLS- STV' for simplicity. Specifically, the STV regularization is derived by penalizing the eigenvalues of the structure tensor of every point in the MECT images. Thus it can provide more robust measures of image variation, which can eliminate the patchy artifacts often observed in total variation regularization. Subsequently, an alternating optimization algorithm was adopted to minimize the objective function. Experiments with a digital XCAT phantom clearly demonstrate that the present PWLS-STV algorithm can achieve more gains than the existing TV-based algorithms and the conventional filtered backpeojection (FBP) algorithm in terms of noise-induced artifacts suppression, resolution preservation, and material decomposition assessment.

Ultrasound backscatter tensor imaging (BTI): analysis of the spatial coherence of ultrasonic speckle in anisotropic soft tissues.

PubMed

Papadacci, Clement; Tanter, Mickael; Pernot, Mathieu; Fink, Mathias

2014-06-01

The assessment of fiber architecture is of major interest in the progression of myocardial disease. Recent techniques such as magnetic resonance diffusion tensor imaging (MR-DTI) or ultrasound elastic tensor imaging (ETI) can derive the fiber directions by measuring the anisotropy of water diffusion or tissue elasticity, but these techniques present severe limitations in a clinical setting. In this study, we propose a new technique, backscatter tensor imaging (BTI), which enables determination of the fiber directions in skeletal muscles and myocardial tissues, by measuring the spatial coherence of ultrasonic speckle. We compare the results to ultrasound ETI. Acquisitions were performed using a linear transducer array connected to an ultrasonic scanner mounted on a motorized rotation device with angles from 0° to 355° by 5° increments to image ex vivo bovine skeletal muscle and porcine left ventricular myocardial samples. At each angle, multiple plane waves were transmitted and the backscattered echoes recorded. The coherence factor was measured as the ratio of coherent intensity over incoherent intensity of backscattered echoes. In skeletal muscle, maximal/minimal coherence factor was found for the probe parallel/perpendicular to the fibers. In myocardium, the coherence was assessed across the entire myocardial thickness, and the position of maxima and minima varied transmurally because of the complex fibers distribution. In ETI, the shear wave speed variation with the probe angle was found to follow the coherence variation. Spatial coherence can thus reveal the anisotropy of the ultrasonic speckle in skeletal muscle and myocardium. BTI could be used on any type of ultrasonic scanner with rotating phased-array probes or 2-D matrix probes for noninvasive evaluation of myocardial fibers.

Ultrasound Backscatter Tensor Imaging (BTI): Analysis of the spatial coherence of ultrasonic speckle in anisotropic soft tissues

PubMed Central

Papadacci, Clement; Tanter, Mickael; Pernot, Mathieu; Fink, Mathias

2014-01-01

The assessment of fiber architecture is of major interest in the progression of myocardial disease. Recent techniques such as Magnetic Resonance (MR) Diffusion Tensor Imaging or Ultrasound Elastic Tensor Imaging (ETI) can derive the fiber directions by measuring the anisotropy of water diffusion or tissue elasticity, but these techniques present severe limitations in clinical setting. In this study, we propose a new technique, the Backscatter Tensor Imaging (BTI) which enables determining the fibers directions in skeletal muscles and myocardial tissues, by measuring the spatial coherence of ultrasonic speckle. We compare the results to ultrasound ETI. Acquisitions were performed using a linear transducer array connected to an ultrasonic scanner mounted on a motorized rotation device with angles from 0° to 355° by 5° increments to image ex vivo bovine skeletal muscle and porcine left ventricular myocardial samples. At each angle, multiple plane waves were transmitted and the backscattered echoes recorded. The coherence factor was measured as the ratio of coherent intensity over incoherent intensity of backscattered echoes. In skeletal muscle, maximal/minimal coherence factor was found for the probe parallel/perpendicular to the fibers. In myocardium, the coherence was assessed across the entire myocardial thickness, and the position of maxima and minima varied transmurally due to the complex fibers distribution. In ETI, the shear wave speed variation with the probe angle was found to follow the coherence variation. Spatial coherence can thus reveal the anisotropy of the ultrasonic speckle in skeletal muscle and myocardium. BTI could be used on any type of ultrasonic scanner with rotative phased-array probes or 2-D matrix probes for non-invasive evaluation of myocardial fibers. PMID:24859662

Blooming Knit Flowers: Loop-Linked Soft Morphing Structures for Soft Robotics.

PubMed

Han, Min-Woo; Ahn, Sung-Hoon

2017-04-01

A loop-linked structure, which is capable of morphing in various modes, including volumetric transformation, is developed based on knitting methods. Morphing flowers (a lily-like, a daffodil-like, gamopetalous, and a calla-like flower) are fabricated using loop patterning, and their blooming motion is demonstrated by controlling a current that selectively actuates the flowers petals. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Altay falcon: Origin, morphology and distribution

USGS Publications Warehouse

Ellis, D.H.

1995-01-01

The systematic position of the Altay falcon (Falco altaicus lorenzi) is perhaps the most enigmatic question lingering in falcon taxonomy. First reported to science in 1811, it has been treated as a race of the gyrfalcon (F. rusticolus), as a race of the saker (F. cherrug), as two separate species (F. lorenzi and F. altaicus), and as one to three color morphs of either the saker or the gyrfalcon. Ironically, two or even more of these explanations may be correct. Of 53 specimens examined, at least two are misidentified gyrfalcons, a score I dismiss as typical sakers, but a sizeable group (N = 34) is retained as representing what I consider to be the true Altay falcon type. Three adult color morphs exist: red, brown and grey. The red-backed morph closely resembles some eastern sakers. The chocolate morph resembles the black gyrfalcon from Labrador. The grey morph resembles the grey morph of the gyrfalcon. Ecological, geographical and morphological information contribute to the conclusion that this core group represents a gyrfalcon-saker hybrid that is very likely being swamped into obscurity through back crosses with the saker. The breeding range reported herein (Altay-Sayan Mountains) is greatly contracted from that previously reported. The true identify of the Altay falcon will be resolved by molecular genetics.

Composite corrugated structures for morphing wing skin applications

NASA Astrophysics Data System (ADS)

Thill, C.; Etches, J. A.; Bond, I. P.; Potter, K. D.; Weaver, P. M.

2010-12-01

Composite corrugated structures are known for their anisotropic properties. They exhibit relatively high stiffness parallel (longitudinal) to the corrugation direction and are relatively compliant in the direction perpendicular (transverse) to the corrugation. Thus, they offer a potential solution for morphing skin panels (MSPs) in the trailing edge region of a wing as a morphing control surface. In this paper, an overview of the work carried out by the present authors over the last few years on corrugated structures for morphing skin applications is first given. The second part of the paper presents recent work on the application of corrugated sandwich structures. Panels made from multiple unit cells of corrugated sandwich structures are used as MSPs in the trailing edge region of a scaled morphing aerofoil section. The aerofoil section features an internal actuation mechanism that allows chordwise length and camber change of the trailing edge region (aft 35% chord). Wind tunnel testing was carried out to demonstrate the MSP concept but also to explore its limitations. Suggestions for improvements arising from this study were deduced, one of which includes an investigation of a segmented skin. The overall results of this study show that the MSP concept exploiting corrugated sandwich structures offers a potential solution for local morphing wing skins for low speed and small air vehicles.

Approaching morphing wing concepts on the basis of micro aerial vehicles

NASA Astrophysics Data System (ADS)

Boller, C.; Kuo, C.-M.; Qin, N.

2007-04-01

Morphing wings have been discussed since the early days of smart structures. Concepts and demonstrations started mainly in the context of real existing fixed wing aircraft. The complexity of existing aircraft and the limitations in terms of energy required and thus resulting cost made morphing wings mainly impossible to be successfully integrated into existing aircraft designs. Going however to smaller scaled aircraft where designs are less or possibly even not defined at all makes demonstration of morphing wings much more feasible. This paper will therefore discuss some morphing wing issues for micro aerial vehicle (MAV) designs where an MAV is considered to be an air vehicle of around 30 to 50 cm in span and a weight of less than 250 grams. At first the aerodynamics in terms of different wing shapes for such a small type of aircraft will be discussed followed by a design procedure on how to successfully design and analyse a morphing wing MAV. A more detailed description will then be given with regard to adaptively changing a wing's thickness where the actuation principles applied will be outlined in terms of conventional mechanical as well as smart structural solutions. Experimental results achieved in real flight tests will be described and discussed.

Wing shape variation associated with mimicry in butterflies.

PubMed

Jones, Robert T; Le Poul, Yann; Whibley, Annabel C; Mérot, Claire; ffrench-Constant, Richard H; Joron, Mathieu

2013-08-01

Mimetic resemblance in unpalatable butterflies has been studied by evolutionary biologists for over a century, but has largely focused on the convergence in wing color patterns. In Heliconius numata, discrete color-pattern morphs closely resemble comimics in the distantly related genus Melinaea. We examine the possibility that the shape of the butterfly wing also shows adaptive convergence. First, simple measures of forewing dimensions were taken of individuals in a cross between H. numata morphs, and showed quantitative differences between two of the segregating morphs, f. elegans and f. silvana. Second, landmark-based geometric morphometric and elliptical Fourier outline analyses were used to more fully characterize these shape differences. Extension of these techniques to specimens from natural populations suggested that, although many of the coexisting morphs could not be discriminated by shape, the differences we identified between f. elegans and f. silvana hold in the wild. Interestingly, despite extensive overlap, the shape variation between these two morphs is paralleled in their respective Melinaea comimics. Our study therefore suggests that wing-shape variation is associated with mimetic resemblance, and raises the intriguing possibility that the supergene responsible for controlling the major switch in color pattern between morphs also contributes to wing shape differences in H. numata. © 2013 The Author(s). Evolution © 2013 The Society for the Study of Evolution.

Tensor tomography on Cartan–Hadamard manifolds

NASA Astrophysics Data System (ADS)

Lehtonen, Jere; Railo, Jesse; Salo, Mikko

2018-04-01

We study the geodesic x-ray transform on Cartan–Hadamard manifolds, generalizing the x-ray transforms on Euclidean and hyperbolic spaces that arise in medical and seismic imaging. We prove solenoidal injectivity of this transform acting on functions and tensor fields of any order. The functions are assumed to be exponentially decaying if the sectional curvature is bounded, and polynomially decaying if the sectional curvature decays at infinity. This work extends the results of Lehtonen (2016 arXiv:1612.04800) to dimensions n ≥slant 3 and to the case of tensor fields of any order.

Simultaneous two-view epipolar geometry estimation and motion segmentation by 4D tensor voting.

PubMed

Tong, Wai-Shun; Tang, Chi-Keung; Medioni, Gérard

2004-09-01

We address the problem of simultaneous two-view epipolar geometry estimation and motion segmentation from nonstatic scenes. Given a set of noisy image pairs containing matches of n objects, we propose an unconventional, efficient, and robust method, 4D tensor voting, for estimating the unknown n epipolar geometries, and segmenting the static and motion matching pairs into n independent motions. By considering the 4D isotropic and orthogonal joint image space, only two tensor voting passes are needed, and a very high noise to signal ratio (up to five) can be tolerated. Epipolar geometries corresponding to multiple, rigid motions are extracted in succession. Only two uncalibrated frames are needed, and no simplifying assumption (such as affine camera model or homographic model between images) other than the pin-hole camera model is made. Our novel approach consists of propagating a local geometric smoothness constraint in the 4D joint image space, followed by global consistency enforcement for extracting the fundamental matrices corresponding to independent motions. We have performed extensive experiments to compare our method with some representative algorithms to show that better performance on nonstatic scenes are achieved. Results on challenging data sets are presented.

White matter fiber tracking computation based on diffusion tensor imaging for clinical applications.

PubMed

Dellani, Paulo R; Glaser, Martin; Wille, Paulo R; Vucurevic, Goran; Stadie, Axel; Bauermann, Thomas; Tropine, Andrei; Perneczky, Axel; von Wangenheim, Aldo; Stoeter, Peter

2007-03-01

Fiber tracking allows the in vivo reconstruction of human brain white matter fiber trajectories based on magnetic resonance diffusion tensor imaging (MR-DTI), but its application in the clinical routine is still in its infancy. In this study, we present a new software for fiber tracking, developed on top of a general-purpose DICOM (digital imaging and communications in medicine) framework, which can be easily integrated into existing picture archiving and communication system (PACS) of radiological institutions. Images combining anatomical information and the localization of different fiber tract trajectories can be encoded and exported in DICOM and Analyze formats, which are valuable resources in the clinical applications of this method. Fiber tracking was implemented based on existing line propagation algorithms, but it includes a heuristic for fiber crossings in the case of disk-shaped diffusion tensors. We successfully performed fiber tracking on MR-DTI data sets from 26 patients with different types of brain lesions affecting the corticospinal tracts. In all cases, the trajectories of the central spinal tract (pyramidal tract) were reconstructed and could be applied at the planning phase of the surgery as well as in intraoperative neuronavigation.

Mild traumatic brain injury: is diffusion imaging ready for primetime in forensic medicine?

PubMed

Grossman, Elan J; Inglese, Matilde; Bammer, Roland

2010-12-01

Mild traumatic brain injury (MTBI) is difficult to accurately assess with conventional imaging because such approaches usually fail to detect any evidence of brain damage. Recent studies of MTBI patients using diffusion-weighted imaging and diffusion tensor imaging suggest that these techniques have the potential to help grade tissue damage severity, track its development, and provide prognostic markers for clinical outcome. Although these results are promising and indicate that the forensic diagnosis of MTBI might eventually benefit from the use of diffusion-weighted imaging and diffusion tensor imaging, healthy skepticism and caution should be exercised with regard to interpreting their meaning because there is no consensus about which methods of data analysis to use and very few investigations have been conducted, of which most have been small in sample size and examined patients at only one time point after injury.

Shell colour, temperature, (micro)habitat structure and predator pressure affect the behaviour of Cepaea nemoralis

NASA Astrophysics Data System (ADS)

Rosin, Zuzanna M.; Kwieciński, Zbigniew; Lesicki, Andrzej; Skórka, Piotr; Kobak, Jarosław; Szymańska, Anna; Osiejuk, Tomasz S.; Kałuski, Tomasz; Jaskulska, Monika; Tryjanowski, Piotr

2018-06-01

Although shell colour polymorphism of the land snail Cepaea nemoralis is a well-known phenomenon, proximate and ultimate factors driving its evolution remain uncertain. Polymorphic species show variation in behavioural responses to selective forces. Therefore, we estimated effects of various environmental factors (temperature, humidity, food availability, (micro)habitat structure and predatory pressure) on behavioural response (frequency of locomotion, climbing and hiding) of C. nemoralis morphs, in experimental and natural conditions. In the experimental part of study, the frequency of locomotion was negatively affected by temperature and the presence of food and positively influenced by the presence of light. Morphs significantly differed in behavioural responses to environmental variability. Pink mid-banded and yellow five-banded morphs climbed less often and hide in shelter more often than yellow and pink unbanded individuals when temperature was low and food was absent. Snails fed most often at moderate temperature compared to low and high temperatures. Field investigations partially confirmed differences among morphs in frequency of climbing, but not in terms of probability of hiding in sheltered sites. In natural colonies, temperature and (micro)habitat structure significantly affected frequency of climbing as well as hiding in shelter. Snails more often hid in sheltered sites where thrushes preyed on Cepaea. Tendency of unbanded morphs to climb trees may have evolved under avian predatory pressure as thrushes forage on a ground. Tendency of banded morphs to hide in sheltered sites may reflect prey preferences for cryptic background. The results implicate that differential behaviour of C. nemoralis morphs compensate for their morphological and physiological limitations of adaptation to habitat.

Shell colour, temperature, (micro)habitat structure and predator pressure affect the behaviour of Cepaea nemoralis.

PubMed

Rosin, Zuzanna M; Kwieciński, Zbigniew; Lesicki, Andrzej; Skórka, Piotr; Kobak, Jarosław; Szymańska, Anna; Osiejuk, Tomasz S; Kałuski, Tomasz; Jaskulska, Monika; Tryjanowski, Piotr

2018-05-09

Although shell colour polymorphism of the land snail Cepaea nemoralis is a well-known phenomenon, proximate and ultimate factors driving its evolution remain uncertain. Polymorphic species show variation in behavioural responses to selective forces. Therefore, we estimated effects of various environmental factors (temperature, humidity, food availability, (micro)habitat structure and predatory pressure) on behavioural response (frequency of locomotion, climbing and hiding) of C. nemoralis morphs, in experimental and natural conditions. In the experimental part of study, the frequency of locomotion was negatively affected by temperature and the presence of food and positively influenced by the presence of light. Morphs significantly differed in behavioural responses to environmental variability. Pink mid-banded and yellow five-banded morphs climbed less often and hide in shelter more often than yellow and pink unbanded individuals when temperature was low and food was absent. Snails fed most often at moderate temperature compared to low and high temperatures. Field investigations partially confirmed differences among morphs in frequency of climbing, but not in terms of probability of hiding in sheltered sites. In natural colonies, temperature and (micro)habitat structure significantly affected frequency of climbing as well as hiding in shelter. Snails more often hid in sheltered sites where thrushes preyed on Cepaea. Tendency of unbanded morphs to climb trees may have evolved under avian predatory pressure as thrushes forage on a ground. Tendency of banded morphs to hide in sheltered sites may reflect prey preferences for cryptic background. The results implicate that differential behaviour of C. nemoralis morphs compensate for their morphological and physiological limitations of adaptation to habitat.

Language Dysfunction After Stroke and Damage to White Matter Tracts Evaluated Using Diffusion Tensor Imaging

PubMed Central

Breier, J.I.; Hasan, K.M.; Zhang, W.; Men, D.; Papanicolaou, A.C.

2011-01-01

BACKGROUND AND PURPOSE Knowledge of the anatomic basis of aphasia after stroke has both theoretic and clinical implications by informing models of cortical connectivity and providing data for diagnosis and prognosis. In this study we use diffusion tensor imaging to address the relationship between damage to specific white matter tracts and linguistic deficits after left hemisphere stroke. MATERIALS AND METHODS Twenty patients aged 38–77 years with a history of stroke in the left hemisphere underwent diffusion tensor imaging, structural MR imaging, and language testing. All of the patients were premorbidly right handed and underwent imaging and language testing at least 1 month after stroke. RESULTS Lower fractional anisotropy (FA) values in the superior longitudinal and arcuate fasciculi of the left hemisphere, an indication of greater damage to these tracts, were correlated with decreased ability to repeat spoken language. Comprehension deficits after stroke were associated with lower FA values in the arcuate fasciculus of the left hemisphere. The findings for repetition were independent of MR imaging ratings of the degree of damage to cortical areas of the left hemisphere involved in language function. There were no findings for homotopic tracts in the right hemisphere. CONCLUSION This study provides support for a specific role for damage to the superior longitudinal and arcuate fasciculi in the left hemisphere in patients with deficits in repetition of speech in aphasia after stroke. PMID:18039757

Floral polymorphism and the fitness implications of attracting pollinating and florivorous insects.

PubMed

de Jager, Marinus L; Ellis, Allan G

2014-01-01

Floral polymorphism is frequently attributed to pollinator-mediated selection. Multiple studies, however, have revealed the importance of non-pollinating visitors in floral evolution. Using the polymorphic annual daisy Ursinia calenduliflora, this study investigated the importance of different insect visitors, and their effects on fitness, in the maintenance of floral polymorphism. The spatial structure of a discrete floral polymorphism was characterized based on the presence/absence of anthocyanin floret spots in U. calenduliflora. A 3-year observational study was then conducted in polymorphic populations to investigate differences in visitation rates of dominant visitors to floral morphs. Experiments were performed to explore the floral preference of male and female Megapalpus capensis (the dominant insect visitor) and their effectiveness as pollinators. Next, floral damage by antagonistic florivores and the reproductive success of the two floral morphs were surveyed in multiple populations and years. Floral polymorphism in U. calenduliflora was structured spatially, as were insect visitation patterns. Megapalpus capensis males were the dominant visitors and exhibited strong preference for the spotted morph in natural and experimental observations. While this may indicate potential fitness benefits for the spotted morph, female fitness did not differ between floral morphs. However, as M. capensis males are very efficient at exporting U. calenduliflora pollen, their preference may likely increase the reproductive fitness of the spotted morph through male fitness components. The spotted morph, however, also suffered significantly greater costs due to ovule predation by florivores than the spotless morph. The results suggest that pollinators and florivores may potentially exert antagonistic selection that could contribute to the maintenance of floral polymorphism across the range of U. calenduliflora. The relative strength of selection imposed by each agent is potentially determined by insect community composition and abundance at each site, highlighting the importance of community context in the evolution of floral phenotypes.

Evidence for Sexual Dimorphism in the Plated Dinosaur Stegosaurus mjosi (Ornithischia, Stegosauria) from the Morrison Formation (Upper Jurassic) of Western USA.

PubMed

Saitta, Evan Thomas

2015-01-01

Conclusive evidence for sexual dimorphism in non-avian dinosaurs has been elusive. Here it is shown that dimorphism in the shape of the dermal plates of Stegosaurus mjosi (Upper Jurassic, western USA) does not result from non-sex-related individual, interspecific, or ontogenetic variation and is most likely a sexually dimorphic feature. One morph possessed wide, oval plates 45% larger in surface area than the tall, narrow plates of the other morph. Intermediate morphologies are lacking as principal component analysis supports marked size- and shape-based dimorphism. In contrast, many non-sex-related individual variations are expected to show intermediate morphologies. Taphonomy of a new quarry in Montana (JRDI 5ES Quarry) shows that at least five individuals were buried in a single horizon and were not brought together by water or scavenger transportation. This new site demonstrates co-existence, and possibly suggests sociality, between two morphs that only show dimorphism in their plates. Without evidence for niche partitioning, it is unlikely that the two morphs represent different species. Histology of the new specimens in combination with studies on previous specimens indicates that both morphs occur in fully-grown individuals. Therefore, the dimorphism is not a result of ontogenetic change. Furthermore, the two morphs of plates do not simply come from different positions on the back of a single individual. Plates from all positions on the body can be classified as one of the two morphs, and previously discovered, isolated specimens possess only one morph of plates. Based on the seemingly display-oriented morphology of plates, female mate choice was likely the driving evolutionary mechanism rather than male-male competition. Dinosaur ornamentation possibly served similar functions to the ornamentation of modern species. Comparisons to ornamentation involved in sexual selection of extant species, such as the horns of bovids, may be appropriate in predicting the function of some dinosaur ornamentation.

Mechanisms and actuators for rotorcraft blade morphing

NASA Astrophysics Data System (ADS)

Vocke, Robert D., III

The idea of improved fight performance through changes in the control surfaces dates back to the advent of aviation with the Wright brothers' pioneering work on "wing warping," but it was not until the recent progress in material and actuator development that such control surfaces seemed practical for modern aircraft. This has opened the door to a new class of aircraft that have the ability to change shape or morph, which are being investigated due to the potential to have a single platform serve multiple mission objectives, as well as improve performance characteristics. While the majority of existing research for morphing aircraft has focused on fixedwing aircraft, rotary-wing aircraft have begun to receive more attention. The purpose of this body of work is to investigate the current state of morphing actuation technology for rotorcraft and improve upon it. Specifically, this work looks at two types of morphing: Pneumatic Artificial Muscle (PAM) actuated trailing edge flaps and conformal variable diameter morphing. First, active camber changes through the use of PAM powered trailing edge flaps were investigated due to the potential for reductions in power requirements and vibration/noise levels. A PAM based antagonistic actuation system was developed utilizing a novel combination of mechanism geometry and PAM bias contraction optimization to overcome the natural extension stiffening characteristics of PAMs. In open-loop bench-top testing against a "worst-case" constant torsional loading, the system demonstrated actuation authority suitable for both primary control and vibration/noise reduction. Additionally, closed-loop test data indicated that the system was capable of tracking complex waveforms consistent with those needed for rotorcraft control. This system demonstrated performance on-par with the state of the art pneumatic trailing edge flap actuators, yet with a much smaller footprint and impact on the rotor-blade. The second morphing system developed in this work is a conformal variable diameter rotor system suitable for implementation on a modern tilt-rotor aircraft, which can reduce power requirements in both cruise and hover configurations. An initial prototype variable span airfoil was constructed using a silicone elastomer matrix composite skin and a plastic rapid prototyped morphing substructure. Benchtop and wind tunnel tests verified the ability of this system to increase active wing area by 100%. The prototype technology was then matured for use in the harsh rotor blade environment, with a much stiffer polyurethane skin and a titanium substructure. Coupon testing verified the efficacy of this approach, and a final conceptual design was completed using the stiffness-tuning characteristics of the morphing substructure to create a self-actuating morphing blade tip.

Distribution of Flower Morphs, Ploidy Level and Sexual Reproduction of the Invasive Weed Oxalis pes-caprae in the Western Area of the Mediterranean Region

PubMed Central

Castro, Sílvia; Loureiro, João; Santos, Conceição; Ater, Mohammed; Ayensa, Garbiñe; Navarro, Luis

2007-01-01

Background and Aims Oxalis pes-caprae is a widespread invasive weed in regions with a Mediterranean climate. In its native habitat (southern Africa) this species has been reported as heterostylous with trimorphic flowers and a self- and morph-incompatible reproductive system. In most of the areas invaded, only a pentaploid short-styled morphotype that reproduces mainly asexually by bulbils is reported, but this has only been confirmed empirically. This study aims to analyse the floral morph proportions in a wide distribution area, test the sexual female success, and explain the causes of low sexual reproduction of this species in the western area of the Mediterranean Basin. Methods Fifty-five populations of O. pes-caprae were sampled in the Iberian Peninsula and Morocco to evaluate the floral morph ratio and individual fruit set. In plants from a dimorphic population, hand-pollination experiments were performed to evaluate the effect of the pollen source on pollen tube growth through the style. The ploidy level and genome size of individuals of each floral morph were analysed using flow cytometry. Key Results From the populations studied 89·1 % were monomorphic, with most of them containing the short-styled (SS) floral morph, and 10·9 % were dimorphic containing long-styled (LS) and SS morphs. In some of these, isoplethy was verified but no fruit production was observed in any population. A sterile form was also recorded in several populations. Hand-pollination experiments revealed that pollen grains germinated over recipient stigmas. In intermorph crossings, pollen tubes were able to develop and fruit initiation was observed in some cases, while in intramorph pollinations, pollen tube development was sporadic and no fruit initiation was observed. All individuals within each floral form presented the same DNA ploidy level: SS plants were pentaploid and LS and the sterile form were tetraploid. Conclusions The low or null sexual reproduction success of this species in the area of invasion studied seems related with the high frequency of monomorphic populations, the unequal proportion of floral morphs in dimorphic populations and the presence of different ploidy levels between SS and LS morphs. The discovery of the occurrence of an LS floral morph and a sterile form, whose invading capacity in these areas is as yet unknown, will be valuable information for management programmes. PMID:17218342

Determination of multiple sclerosis plaque size with diffusion-tensor MR Imaging: comparison study with healthy volunteers.

PubMed

Kealey, Susan M; Kim, Youngjoo; Whiting, Wythe L; Madden, David J; Provenzale, James M

2005-08-01

To use diffusion-tensor magnetic resonance (MR) imaging to measure involvement of normal-appearing white matter (WM) immediately adjacent to multiple sclerosis (MS) plaques and thus redefine actual plaque size on diffusion-tensor images through comparison with T2-weighted images of equivalent areas in healthy volunteers. Informed consent was not required given the retrospective nature of the study on an anonymized database. The study complied with requirements of the Health Insurance Portability and Accountability Act. Twelve patients with MS (four men, eight women; mean age, 35 years) and 14 healthy volunteers (six men, eight women; mean age, 25 years) were studied. The authors obtained fractional anisotropy (FA) values in MS plaques and in the adjacent normal-appearing WM in patients with MS and in equivalent areas in healthy volunteers. They placed regions of interest (ROIs) around the periphery of plaques and defined the total ROIs (ie, plaques plus peripheral ROIs) as abnormal if their mean FA values were at least 2 standard deviations below those of equivalent ROIs within equivalent regions in healthy volunteers. The combined area of the plaque and the peripheral ROI was compared with the area of the plaque seen on T2-weighted MR images by means of a Student paired t test (P = .05). The mean plaque size on T2-weighted images was 72 mm2 +/- 21 (standard deviation). The mean plaque FA value was 0.285 +/- 0.088 (0.447 +/- 0.069 in healthy volunteers [P < .001]; mean percentage reduction in FA in MS plaques, 37%). The mean plaque size on FA maps was 91 mm2 +/- 35, a mean increase of 127% compared with the size of the original plaque on T2-weighted images (P = .03). A significant increase in plaque size was seen when normal-appearing WM was interrogated with diffusion-tensor MR imaging. This imaging technique may represent a more sensitive method of assessing disease burden and may have a future role in determining disease burden and activity.

Interactive Volume Rendering of Diffusion Tensor Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hlawitschka, Mario; Weber, Gunther; Anwander, Alfred

As 3D volumetric images of the human body become an increasingly crucial source of information for the diagnosis and treatment of a broad variety of medical conditions, advanced techniques that allow clinicians to efficiently and clearly visualize volumetric images become increasingly important. Interaction has proven to be a key concept in analysis of medical images because static images of 3D data are prone to artifacts and misunderstanding of depth. Furthermore, fading out clinically irrelevant aspects of the image while preserving contextual anatomical landmarks helps medical doctors to focus on important parts of the images without becoming disoriented. Our goal wasmore » to develop a tool that unifies interactive manipulation and context preserving visualization of medical images with a special focus on diffusion tensor imaging (DTI) data. At each image voxel, DTI provides a 3 x 3 tensor whose entries represent the 3D statistical properties of water diffusion locally. Water motion that is preferential to specific spatial directions suggests structural organization of the underlying biological tissue; in particular, in the human brain, the naturally occuring diffusion of water in the axon portion of neurons is predominantly anisotropic along the longitudinal direction of the elongated, fiber-like axons [MMM+02]. This property has made DTI an emerging source of information about the structural integrity of axons and axonal connectivity between brain regions, both of which are thought to be disrupted in a broad range of medical disorders including multiple sclerosis, cerebrovascular disease, and autism [Mos02, FCI+01, JLH+99, BGKM+04, BJB+03].« less

A novel measure of reliability in Diffusion Tensor Imaging after data rejections due to subject motion.

PubMed

Sairanen, V; Kuusela, L; Sipilä, O; Savolainen, S; Vanhatalo, S

2017-02-15

Diffusion Tensor Imaging (DTI) is commonly challenged by subject motion during data acquisition, which often leads to corrupted image data. Currently used procedure in DTI analysis is to correct or completely reject such data before tensor estimations, however assessing the reliability and accuracy of the estimated tensor in such situations has evaded previous studies. This work aims to define the loss of data accuracy with increasing image rejections, and to define a robust method for assessing reliability of the result at voxel level. We carried out simulations of every possible sub-scheme (N=1,073,567,387) of Jones30 gradient scheme, followed by confirming the idea with MRI data from four newborn and three adult subjects. We assessed the relative error of the most commonly used tensor estimates for DTI and tractography studies, fractional anisotropy (FA) and the major orientation vector (V1), respectively. The error was estimated using two measures, the widely used electric potential (EP) criteria as well as the rotationally variant condition number (CN). Our results show that CN and EP are comparable in situations with very few rejections, but CN becomes clearly more sensitive to depicting errors when more gradient vectors and images were rejected. The error in FA and V1 was also found depend on the actual FA level in the given voxel; low actual FA levels were related to high relative errors in the FA and V1 estimates. Finally, the results were confirmed with clinical MRI data. This showed that the errors after rejections are, indeed, inhomogeneous across brain regions. The FA and V1 errors become progressively larger when moving from the thick white matter bundles towards more superficial subcortical structures. Our findings suggest that i) CN is a useful estimator of data reliability at voxel level, and ii) DTI preprocessing with data rejections leads to major challenges when assessing brain tissue with lower FA levels, such as all newborn brain, as well as the adult superficial, subcortical areas commonly traced in precise connectivity analyses between cortical regions. Copyright © 2016 Elsevier Inc. All rights reserved.

Contemporary imaging of mild TBI: the journey toward diffusion tensor imaging to assess neuronal damage.

PubMed

Fox, W Christopher; Park, Min S; Belverud, Shawn; Klugh, Arnett; Rivet, Dennis; Tomlin, Jeffrey M

2013-04-01

To follow the progression of neuroimaging as a means of non-invasive evaluation of mild traumatic brain injury (mTBI) in order to provide recommendations based on reproducible, defined imaging findings. A comprehensive literature review and analysis of contemporary published articles was performed to study the progression of neuroimaging findings as a non-invasive 'biomarker' for mTBI. Multiple imaging modalities exist to support the evaluation of patients with mTBI, including ultrasound (US), computed tomography (CT), single photon emission computed tomography (SPECT), positron emission tomography (PET), and magnetic resonance imaging (MRI). These techniques continue to evolve with the development of fractional anisotropy (FA), fiber tractography (FT), and diffusion tensor imaging (DTI). Modern imaging techniques, when applied in the appropriate clinical setting, may serve as a valuable tool for diagnosis and management of patients with mTBI. An understanding of modern neuroanatomical imaging will enhance our ability to analyse injury and recognize the manifestations of mTBI.

Assessment of diffusion tensor image quality across sites and vendors using the American College of Radiology head phantom.

PubMed

Wang, Zhiyue J; Seo, Youngseob; Babcock, Evelyn; Huang, Hao; Bluml, Stefan; Wisnowski, Jessica; Holshouser, Barbara; Panigrahy, Ashok; Shaw, Dennis W W; Altman, Nolan; McColl, Roderick W; Rollins, Nancy K

2016-05-08

The purpose of this study was to explore the feasibility of assessing quality of diffusion tensor imaging (DTI) from multiple sites and vendors using American College of Radiology (ACR) phantom. Participating sites (Siemens (n = 2), GE (n= 2), and Philips (n = 4)) reached consensus on parameters for DTI and used the widely available ACR phantom. Tensor data were processed at one site. B0 and eddy current distortions were assessed using grid line displacement on phantom Slice 5; signal-to-noise ratio (SNR) was measured at the center and periphery of the b = 0 image; fractional anisotropy (FA) and mean diffusivity (MD) were assessed using phantom Slice 7. Variations of acquisition parameters and deviations from specified sequence parameters were recorded. Nonlinear grid line distortion was higher with linear shimming and could be corrected using the 2nd order shimming. Following image registration, eddy current distortion was consistently smaller than acquisi-tion voxel size. SNR was consistently higher in the image periphery than center by a factor of 1.3-2.0. ROI-based FA ranged from 0.007 to 0.024. ROI-based MD ranged from 1.90 × 10-3 to 2.33 × 10-3 mm2/s (median = 2.04 × 10-3 mm2/s). Two sites had image void artifacts. The ACR phantom can be used to compare key qual-ity measures of diffusion images acquired from multiple vendors at multiple sites.

Multiple Echo Diffusion Tensor Acquisition Technique (MEDITATE) on a 3T clinical scanner

PubMed Central

Baete, Steven H.; Cho, Gene; Sigmund, Eric E.

2013-01-01

This paper describes the concepts and implementation of an MRI method, Multiple Echo Diffusion Tensor Acquisition Technique (MEDITATE), which is capable of acquiring apparent diffusion tensor maps in two scans on a 3T clinical scanner. In each MEDITATE scan, a set of RF-pulses generates multiple echoes whose amplitudes are diffusion-weighted in both magnitude and direction by a pattern of diffusion gradients. As a result, two scans acquired with different diffusion weighting strengths suffice for accurate estimation of diffusion tensor imaging (DTI)-parameters. The MEDITATE variation presented here expands previous MEDITATE approaches to adapt to the clinical scanner platform, such as exploiting longitudinal magnetization storage to reduce T2-weighting. Fully segmented multi-shot Cartesian encoding is used for image encoding. MEDITATE was tested on isotropic (agar gel), anisotropic diffusion phantoms (asparagus), and in vivo skeletal muscle in healthy volunteers with cardiac-gating. Comparisons of accuracy were performed with standard twice-refocused spin echo (TRSE) DTI in each case and good quantitative agreement was found between diffusion eigenvalues, mean diffusivity, and fractional anisotropy derived from TRSE-DTI and from the MEDITATE sequence. Orientation patterns were correctly reproduced in both isotropic and anisotropic phantoms, and approximately so for in vivo imaging. This illustrates that the MEDITATE method of compressed diffusion encoding is feasible on the clinical scanner platform. With future development and employment of appropriate view-sharing image encoding this technique may be used in clinical applications requiring time-sensitive acquisition of DTI parameters such as dynamical DTI in muscle. PMID:23828606

Comparison of diffusion tensor imaging tractography of language tracts and intraoperative subcortical stimulations.

PubMed

Leclercq, Delphine; Duffau, Hugues; Delmaire, Christine; Capelle, Laurent; Gatignol, Peggy; Ducros, Mathieu; Chiras, Jacques; Lehéricy, Stéphane

2010-03-01

Diffusion tensor (DT) imaging tractography is increasingly used to map fiber tracts in patients with surgical brain lesions to reduce the risk of postoperative functional deficit. There are few validation studies of DT imaging tractography in these patients. The aim of this study was to compare DT imaging tractography of language fiber tracts by using intraoperative subcortical electrical stimulations. The authors included 10 patients with low-grade gliomas or dysplasia located in language areas. The MR imaging examination included 3D T1-weighted images for anatomical coregistration, FLAIR, and DT images. Diffusion tensors and fiber tracts were calculated using in-house software. Four tracts were reconstructed in each patient including the arcuate fasciculus, the inferior occipitofrontal fasciculus, and 2 premotor fasciculi (the subcallosal medialis fiber tract and cortical fibers originating from the medial and lateral premotor areas). The authors compared fiber tracts reconstructed using DT imaging with those evidenced using intraoperative subcortical language mapping. Seventeen (81%) of 21 positive stimulations were concordant with DT imaging fiber bundles (located within 6 mm of a fiber tract). Four positive stimulations were not located in the vicinity of a DT imaging fiber tract. Stimulations of the arcuate fasciculus mostly induced articulatory and phonemic/syntactic disorders and less frequently semantic paraphasias. Stimulations of the inferior occipitofrontal fasciculus induced semantic paraphasias. Stimulations of the premotor-related fasciculi induced dysarthria and articulatory planning deficit. There was a good correspondence between positive stimulation sites and fiber tracts, suggesting that DT imaging fiber tracking is a reliable technique but not yet optimal to map language tracts in patients with brain lesions. Negative tractography does not rule out the persistence of a fiber tract, especially when invaded by the tumor. Stimulations of the different tracts induced variable language disorders that were specific to each fiber tract.

A framework for incorporating DTI Atlas Builder registration into Tract-Based Spatial Statistics and a simulated comparison to standard TBSS.

PubMed

Leming, Matthew; Steiner, Rachel; Styner, Martin

2016-02-27

Tract-based spatial statistics (TBSS) 6 is a software pipeline widely employed in comparative analysis of the white matter integrity from diffusion tensor imaging (DTI) datasets. In this study, we seek to evaluate the relationship between different methods of atlas registration for use with TBSS and different measurements of DTI (fractional anisotropy, FA, axial diffusivity, AD, radial diffusivity, RD, and medial diffusivity, MD). To do so, we have developed a novel tool that builds on existing diffusion atlas building software, integrating it into an adapted version of TBSS called DAB-TBSS (DTI Atlas Builder-Tract-Based Spatial Statistics) by using the advanced registration offered in DTI Atlas Builder 7 . To compare the effectiveness of these two versions of TBSS, we also propose a framework for simulating population differences for diffusion tensor imaging data, providing a more substantive means of empirically comparing DTI group analysis programs such as TBSS. In this study, we used 33 diffusion tensor imaging datasets and simulated group-wise changes in this data by increasing, in three different simulations, the principal eigenvalue (directly altering AD), the second and third eigenvalues (RD), and all three eigenvalues (MD) in the genu, the right uncinate fasciculus, and the left IFO. Additionally, we assessed the benefits of comparing the tensors directly using a functional analysis of diffusion tensor tract statistics (FADTTS 10 ). Our results indicate comparable levels of FA-based detection between DAB-TBSS and TBSS, with standard TBSS registration reporting a higher rate of false positives in other measurements of DTI. Within the simulated changes investigated here, this study suggests that the use of DTI Atlas Builder's registration enhances TBSS group-based studies.

APPROXIMATING SYMMETRIC POSITIVE SEMIDEFINITE TENSORS OF EVEN ORDER*

PubMed Central

BARMPOUTIS, ANGELOS; JEFFREY, HO; VEMURI, BABA C.

2012-01-01

Tensors of various orders can be used for modeling physical quantities such as strain and diffusion as well as curvature and other quantities of geometric origin. Depending on the physical properties of the modeled quantity, the estimated tensors are often required to satisfy the positivity constraint, which can be satisfied only with tensors of even order. Although the space P02m of 2mth-order symmetric positive semi-definite tensors is known to be a convex cone, enforcing positivity constraint directly on P02m is usually not straightforward computationally because there is no known analytic description of P02m for m > 1. In this paper, we propose a novel approach for enforcing the positivity constraint on even-order tensors by approximating the cone P02m for the cases 0 < m < 3, and presenting an explicit characterization of the approximation Σ2m ⊂ Ω2m for m ≥ 1, using the subset Ω2m⊂P02m of semi-definite tensors that can be written as a sum of squares of tensors of order m. Furthermore, we show that this approximation leads to a non-negative linear least-squares (NNLS) optimization problem with the complexity that equals the number of generators in Σ2m. Finally, we experimentally validate the proposed approach and we present an application for computing 2mth-order diffusion tensors from Diffusion Weighted Magnetic Resonance Images. PMID:23285313

Ultrasound elastic tensor imaging: comparison with MR diffusion tensor imaging in the myocardium

NASA Astrophysics Data System (ADS)

Lee, Wei-Ning; Larrat, Benoît; Pernot, Mathieu; Tanter, Mickaël

2012-08-01

We have previously proven the feasibility of ultrasound-based shear wave imaging (SWI) to non-invasively characterize myocardial fiber orientation in both in vitro porcine and in vivo ovine hearts. The SWI-estimated results were in good correlation with histology. In this study, we proposed a new and robust fiber angle estimation method through a tensor-based approach for SWI, coined together as elastic tensor imaging (ETI), and compared it with magnetic resonance diffusion tensor imaging (DTI), a current gold standard and extensively reported non-invasive imaging technique for mapping fiber architecture. Fresh porcine (n = 5) and ovine (n = 5) myocardial samples (20 × 20 × 30 mm3) were studied. ETI was firstly performed to generate shear waves and to acquire the wave events at ultrafast frame rate (8000 fps). A 2.8 MHz phased array probe (pitch = 0.28 mm), connected to a prototype ultrasound scanner, was mounted on a customized MRI-compatible rotation device, which allowed both the rotation of the probe from -90° to 90° at 5° increments and co-registration between two imaging modalities. Transmural shear wave speed at all propagation directions realized was firstly estimated. The fiber angles were determined from the shear wave speed map using the least-squares method and eigen decomposition. The test myocardial sample together with the rotation device was then placed inside a 7T MRI scanner. Diffusion was encoded in six directions. A total of 270 diffusion-weighted images (b = 1000 s mm-2, FOV = 30 mm, matrix size = 60 × 64, TR = 6 s, TE = 19 ms, 24 averages) and 45 B0 images were acquired in 14 h 30 min. The fiber structure was analyzed by the fiber-tracking module in software, MedINRIA. The fiber orientation in the overlapped myocardial region which both ETI and DTI accessed was therefore compared, thanks to the co-registered imaging system. Results from all ten samples showed good correlation (r2 = 0.81, p < 0.0001) and good agreement (3.05° bias) between ETI and DTI fiber angle estimates. The average ETI-estimated fractional anisotropy (FA) values decreased from subendocardium to subepicardium (p < 0.05, unpaired, one-tailed t-test, N = 10) by 33%, whereas the corresponding DTI-estimated FA values presented a change of -10% (p > 0.05, unpaired, one-tailed t-test, N = 10). In conclusion, we have demonstrated that the fiber orientation estimated by ETI, which assesses the shear wave speed (and thus the stiffness), was comparable to that measured by DTI, which evaluates the preferred direction of water diffusion, and have validated this concept within the myocardium. Moreover, ETI was shown capable of mapping the transmural fiber angles with as few as seven shear wave propagation directions.

An Exploration into Diffusion Tensor Imaging in the Bovine Ocular Lens

PubMed Central

Vaghefi, Ehsan; Donaldson, Paul J.

2013-01-01

We describe our development of the diffusion tensor imaging modality for the bovine ocular lens. Diffusion gradients were added to a spin-echo pulse sequence and the relevant parameters of the sequence were refined to achieve good diffusion weighting in the lens tissue, which demonstrated heterogeneous regions of diffusive signal attenuation. Decay curves for b-value (loosely summarizes the strength of diffusion weighting) and TE (determines the amount of magnetic resonance imaging-obtained signal) were used to estimate apparent diffusion coefficients (ADC) and T2 in different lens regions. The ADCs varied by over an order of magnitude and revealed diffusive anisotropy in the lens. Up to 30 diffusion gradient directions, and 8 signal acquisition averages, were applied to lenses in culture in order to improve maps of diffusion tensor eigenvalues, equivalent to ADC, across the lens. From these maps, fractional anisotropy maps were calculated and compared to known spatial distributions of anisotropic molecular fluxes in the lens. This comparison suggested new hypotheses and experiments to quantitatively assess models of circulation in the avascular lens. PMID:23459990

Tensor discriminant color space for face recognition.

PubMed

Wang, Su-Jing; Yang, Jian; Zhang, Na; Zhou, Chun-Guang

2011-09-01

Recent research efforts reveal that color may provide useful information for face recognition. For different visual tasks, the choice of a color space is generally different. How can a color space be sought for the specific face recognition problem? To address this problem, this paper represents a color image as a third-order tensor and presents the tensor discriminant color space (TDCS) model. The model can keep the underlying spatial structure of color images. With the definition of n-mode between-class scatter matrices and within-class scatter matrices, TDCS constructs an iterative procedure to obtain one color space transformation matrix and two discriminant projection matrices by maximizing the ratio of these two scatter matrices. The experiments are conducted on two color face databases, AR and Georgia Tech face databases, and the results show that both the performance and the efficiency of the proposed method are better than those of the state-of-the-art color image discriminant model, which involve one color space transformation matrix and one discriminant projection matrix, specifically in a complicated face database with various pose variations.

Non-lambertian reflectance modeling and shape recovery of faces using tensor splines.

PubMed

Kumar, Ritwik; Barmpoutis, Angelos; Banerjee, Arunava; Vemuri, Baba C

2011-03-01

Modeling illumination effects and pose variations of a face is of fundamental importance in the field of facial image analysis. Most of the conventional techniques that simultaneously address both of these problems work with the Lambertian assumption and thus fall short of accurately capturing the complex intensity variation that the facial images exhibit or recovering their 3D shape in the presence of specularities and cast shadows. In this paper, we present a novel Tensor-Spline-based framework for facial image analysis. We show that, using this framework, the facial apparent BRDF field can be accurately estimated while seamlessly accounting for cast shadows and specularities. Further, using local neighborhood information, the same framework can be exploited to recover the 3D shape of the face (to handle pose variation). We quantitatively validate the accuracy of the Tensor Spline model using a more general model based on the mixture of single-lobed spherical functions. We demonstrate the effectiveness of our technique by presenting extensive experimental results for face relighting, 3D shape recovery, and face recognition using the Extended Yale B and CMU PIE benchmark data sets.

Second Harmonic Generation of Unpolarized Light

NASA Astrophysics Data System (ADS)

Ding, Changqin; Ulcickas, James R. W.; Deng, Fengyuan; Simpson, Garth J.

2017-11-01

A Mueller tensor mathematical framework was applied for predicting and interpreting the second harmonic generation (SHG) produced with an unpolarized fundamental beam. In deep tissue imaging through SHG and multiphoton fluorescence, partial or complete depolarization of the incident light complicates polarization analysis. The proposed framework has the distinct advantage of seamlessly merging the purely polarized theory based on the Jones or Cartesian susceptibility tensors with a more general Mueller tensor framework capable of handling partial depolarized fundamental and/or SHG produced. The predictions of the model are in excellent agreement with experimental measurements of z -cut quartz and mouse tail tendon obtained with polarized and depolarized incident light. The polarization-dependent SHG produced with unpolarized fundamental allowed determination of collagen fiber orientation in agreement with orthogonal methods based on image analysis. This method has the distinct advantage of being immune to birefringence or depolarization of the fundamental beam for structural analysis of tissues.

On the construction of a ground truth framework for evaluating voxel-based diffusion tensor MRI analysis methods.

PubMed

Van Hecke, Wim; Sijbers, Jan; De Backer, Steve; Poot, Dirk; Parizel, Paul M; Leemans, Alexander

2009-07-01

Although many studies are starting to use voxel-based analysis (VBA) methods to compare diffusion tensor images between healthy and diseased subjects, it has been demonstrated that VBA results depend heavily on parameter settings and implementation strategies, such as the applied coregistration technique, smoothing kernel width, statistical analysis, etc. In order to investigate the effect of different parameter settings and implementations on the accuracy and precision of the VBA results quantitatively, ground truth knowledge regarding the underlying microstructural alterations is required. To address the lack of such a gold standard, simulated diffusion tensor data sets are developed, which can model an array of anomalies in the diffusion properties of a predefined location. These data sets can be employed to evaluate the numerous parameters that characterize the pipeline of a VBA algorithm and to compare the accuracy, precision, and reproducibility of different post-processing approaches quantitatively. We are convinced that the use of these simulated data sets can improve the understanding of how different diffusion tensor image post-processing techniques affect the outcome of VBA. In turn, this may possibly lead to a more standardized and reliable evaluation of diffusion tensor data sets of large study groups with a wide range of white matter altering pathologies. The simulated DTI data sets will be made available online (http://www.dti.ua.ac.be).

Interpolation of orientation distribution functions in diffusion weighted imaging using multi-tensor model.

PubMed

Afzali, Maryam; Fatemizadeh, Emad; Soltanian-Zadeh, Hamid

2015-09-30

Diffusion weighted imaging (DWI) is a non-invasive method for investigating the brain white matter structure and can be used to evaluate fiber bundles. However, due to practical constraints, DWI data acquired in clinics are low resolution. This paper proposes a method for interpolation of orientation distribution functions (ODFs). To this end, fuzzy clustering is applied to segment ODFs based on the principal diffusion directions (PDDs). Next, a cluster is modeled by a tensor so that an ODF is represented by a mixture of tensors. For interpolation, each tensor is rotated separately. The method is applied on the synthetic and real DWI data of control and epileptic subjects. Both experiments illustrate capability of the method in increasing spatial resolution of the data in the ODF field properly. The real dataset show that the method is capable of reliable identification of differences between temporal lobe epilepsy (TLE) patients and normal subjects. The method is compared to existing methods. Comparison studies show that the proposed method generates smaller angular errors relative to the existing methods. Another advantage of the method is that it does not require an iterative algorithm to find the tensors. The proposed method is appropriate for increasing resolution in the ODF field and can be applied to clinical data to improve evaluation of white matter fibers in the brain. Copyright © 2015 Elsevier B.V. All rights reserved.

Quantifying deficits in the perception of fear and anger in morphed facial expressions after bilateral amygdala damage.

PubMed

Graham, Reiko; Devinsky, Orrin; Labar, Kevin S

2007-01-07

Amygdala damage has been associated with impairments in perceiving facial expressions of fear. However, deficits in perceiving other emotions, such as anger, and deficits in perceiving emotion blends have not been definitively established. One possibility is that methods used to index expression perception are susceptible to heuristic use, which may obscure impairments. To examine this, we adapted a task used to examine categorical perception of morphed facial expressions [Etcoff, N. L., & Magee, J. J. (1992). Categorical perception of facial expressions. Cognition, 44(3), 227-240]. In one version of the task, expressions were categorized with unlimited time constraints. In the other, expressions were presented with limited exposure durations to tap more automatic aspects of processing. Three morph progressions were employed: neutral to anger, neutral to fear, and fear to anger. Both tasks were administered to a participant with bilateral amygdala damage (S.P.), age- and education-matched controls, and young controls. The second task was also administered to unilateral temporal lobectomy patients. In the first version, S.P. showed impairments relative to normal controls on the neutral-to-anger and fear-to-anger morphs, but not on the neutral-to-fear morph. However, reaction times suggested that speed-accuracy tradeoffs could account for results. In the second version, S.P. showed impairments on all morph types relative to all other subject groups. A third experiment showed that this deficit did not extend to the perception of morphed identities. These results imply that when heuristics use is discouraged on tasks utilizing subtle emotion transitions, deficits in the perception of anger and anger/fear blends, as well as fear, are evident with bilateral amygdala damage.

Computed tomography landmark-based semi-automated mesh morphing and mapping techniques: generation of patient specific models of the human pelvis without segmentation.

PubMed

Salo, Zoryana; Beek, Maarten; Wright, David; Whyne, Cari Marisa

2015-04-13

Current methods for the development of pelvic finite element (FE) models generally are based upon specimen specific computed tomography (CT) data. This approach has traditionally required segmentation of CT data sets, which is time consuming and necessitates high levels of user intervention due to the complex pelvic anatomy. The purpose of this research was to develop and assess CT landmark-based semi-automated mesh morphing and mapping techniques to aid the generation and mechanical analysis of specimen-specific FE models of the pelvis without the need for segmentation. A specimen-specific pelvic FE model (source) was created using traditional segmentation methods and morphed onto a CT scan of a different (target) pelvis using a landmark-based method. The morphed model was then refined through mesh mapping by moving the nodes to the bone boundary. A second target model was created using traditional segmentation techniques. CT intensity based material properties were assigned to the morphed/mapped model and to the traditionally segmented target models. Models were analyzed to evaluate their geometric concurrency and strain patterns. Strains generated in a double-leg stance configuration were compared to experimental strain gauge data generated from the same target cadaver pelvis. CT landmark-based morphing and mapping techniques were efficiently applied to create a geometrically multifaceted specimen-specific pelvic FE model, which was similar to the traditionally segmented target model and better replicated the experimental strain results (R(2)=0.873). This study has shown that mesh morphing and mapping represents an efficient validated approach for pelvic FE model generation without the need for segmentation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Shape, colour plasticity, and habitat use indicate morph-specific camouflage strategies in a marine shrimp.

PubMed

Duarte, Rafael C; Stevens, Martin; Flores, Augusto A V

2016-10-18

Colour and shape polymorphisms are important features of many species and may allow individuals to exploit a wider array of habitats, including through behavioural differences among morphs. In addition, differences among individuals in behaviour and morphology may reflect different strategies, for example utilising different approaches to camouflage. Hippolyte obliquimanus is a small shrimp species inhabiting different shallow-water vegetated habitats. Populations comprise two main morphs: homogeneous shrimp of variable colour (H) and transparent individuals with coloured stripes (ST). These morphs follow different distribution patterns between their main algal habitats; the brown weed Sargassum furcatum and the pink-red weed Galaxaura marginata. In this study, we first investigated morph-specific colour change and habitat selection, as mechanisms underlying camouflage and spatial distribution patterns in nature. Then, we examined habitat fidelity, mobility, and morphological traits, further indicating patterns of habitat use. H shrimp are capable of changing colour in just a few days towards their algal background, achieving better concealment in the more marginal, and less preferred, red weed habitat. Furthermore, laboratory trials showed that habitat fidelity is higher for H shrimp, whereas swimming activity is higher for the ST morph, aligned to morphological evidence indicating these two morphs comprise a more benthic (H) and a more pelagic (ST) life-style, respectively. Results suggest that H shrimp utilise a camouflage strategy specialised to a limited number of backgrounds at any one time, whereas ST individuals comprise a phenotype with more generalist camouflage (transparency) linked to a more generalist background utilisation. The coexistence within a population of distinct morphotypes with apparently alternative strategies of habitat use and camouflage may reflect differential responses to substantial seasonal changes in macroalgal cover. Our findings also demonstrate how colour change, behaviour, morphology, and background use all interact in achieving camouflage.

Body size evolution of a shell-brooding cichlid fish from Lake Tanganyika.

PubMed

Takahashi, T; Ota, K

2016-12-01

The substrate-brooding cichlid fish Telmatochromis temporalis in Lake Tanganyika demonstrates a simple example of ecological speciation between normal and dwarf morphs through divergent natural selection on body size. The dwarf morph most likely evolved from the ancestral normal morph; therefore, elucidating the evolution of its small body size is a key to understanding this ecological speciation event. Previous studies suggest that the small body size of the dwarf morph is an adaptation to the use of empty snail shells as shelters (males) and spawning sites (females), but this idea has not been fully evaluated. Combining original and previously published information, this study compared likelihood values to determine the primary factor that would be responsible for regulating the body size of the dwarf morph. Male body size is most likely regulated by the ability to turn within shells, which may influence the predation avoidance of adult fish. Females are smaller than males, and their body size is most likely regulated by the ability to lay eggs in the small spaces within shells close to the shell apices where predation risk on eggs is lower. This study provides new evidence supporting the hypothesis that different natural selection factors affected body size of the different sexes of the dwarf morph, which has not been reported in other animal species. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

Planform, aero-structural, and flight control optimization for tailless morphing aircraft

NASA Astrophysics Data System (ADS)

Molinari, Giulio; Arrieta, Andres F.; Ermanni, Paolo

2015-04-01

Tailless airplanes with swept wings rely on variations of the spanwise lift distribution to provide controllability in roll, pitch and yaw. Conventionally, this is achieved utilizing multiple control surfaces, such as elevons, on the wing trailing edge. As every flight condition requires different control moments (e.g. to provide pitching moment equilibrium), these surfaces are practically permanently displaced. Due to their nature, causing discontinuities, corners and gaps, they bear aerodynamic penalties, mostly in terms of shape drag. Shape adaptation, by means of chordwise morphing, has the potential of varying the lift of a wing section by deforming its profile in a way that minimizes the resulting drag. Furthermore, as the shape can be varied differently along the wingspan, the lift distribution can be tailored to each specific flight condition. For this reason, tailless aircraft appear as a prime choice to apply morphing techniques, as the attainable benefits are potentially significant. In this work, we present a methodology to determine the optimal planform, profile shape, and morphing structure for a tailless aircraft. The employed morphing concept is based on a distributed compliance structure, actuated by Macro Fiber Composite (MFC) piezoelectric elements. The multidisciplinary optimization is performed considering the static and dynamic aeroelastic behavior of the resulting structure. The goal is the maximization of the aerodynamic efficiency while guaranteeing the controllability of the plane, by means of morphing, in a set of flight conditions.

Morphing the feature-based multi-blocks of normative/healthy vertebral geometries to scoliosis vertebral geometries: development of personalized finite element models.

PubMed

Hadagali, Prasannaah; Peters, James R; Balasubramanian, Sriram

2018-03-01

Personalized Finite Element (FE) models and hexahedral elements are preferred for biomechanical investigations. Feature-based multi-block methods are used to develop anatomically accurate personalized FE models with hexahedral mesh. It is tedious to manually construct multi-blocks for large number of geometries on an individual basis to develop personalized FE models. Mesh-morphing method mitigates the aforementioned tediousness in meshing personalized geometries every time, but leads to element warping and loss of geometrical data. Such issues increase in magnitude when normative spine FE model is morphed to scoliosis-affected spinal geometry. The only way to bypass the issue of hex-mesh distortion or loss of geometry as a result of morphing is to rely on manually constructing the multi-blocks for scoliosis-affected spine geometry of each individual, which is time intensive. A method to semi-automate the construction of multi-blocks on the geometry of scoliosis vertebrae from the existing multi-blocks of normative vertebrae is demonstrated in this paper. High-quality hexahedral elements were generated on the scoliosis vertebrae from the morphed multi-blocks of normative vertebrae. Time taken was 3 months to construct the multi-blocks for normative spine and less than a day for scoliosis. Efforts taken to construct multi-blocks on personalized scoliosis spinal geometries are significantly reduced by morphing existing multi-blocks.

A novel registration-based methodology for prediction of trabecular bone fabric from clinical QCT: A comprehensive analysis

PubMed Central

Reyes, Mauricio; Zysset, Philippe

2017-01-01

Osteoporosis leads to hip fractures in aging populations and is diagnosed by modern medical imaging techniques such as quantitative computed tomography (QCT). Hip fracture sites involve trabecular bone, whose strength is determined by volume fraction and orientation, known as fabric. However, bone fabric cannot be reliably assessed in clinical QCT images of proximal femur. Accordingly, we propose a novel registration-based estimation of bone fabric designed to preserve tensor properties of bone fabric and to map bone fabric by a global and local decomposition of the gradient of a non-rigid image registration transformation. Furthermore, no comprehensive analysis on the critical components of this methodology has been previously conducted. Hence, the aim of this work was to identify the best registration-based strategy to assign bone fabric to the QCT image of a patient’s proximal femur. The normalized correlation coefficient and curvature-based regularization were used for image-based registration and the Frobenius norm of the stretch tensor of the local gradient was selected to quantify the distance among the proximal femora in the population. Based on this distance, closest, farthest and mean femora with a distinction of sex were chosen as alternative atlases to evaluate their influence on bone fabric prediction. Second, we analyzed different tensor mapping schemes for bone fabric prediction: identity, rotation-only, rotation and stretch tensor. Third, we investigated the use of a population average fabric atlas. A leave one out (LOO) evaluation study was performed with a dual QCT and HR-pQCT database of 36 pairs of human femora. The quality of the fabric prediction was assessed with three metrics, the tensor norm (TN) error, the degree of anisotropy (DA) error and the angular deviation of the principal tensor direction (PTD). The closest femur atlas (CTP) with a full rotation (CR) for fabric mapping delivered the best results with a TN error of 7.3 ± 0.9%, a DA error of 6.6 ± 1.3% and a PTD error of 25 ± 2°. The closest to the population mean femur atlas (MTP) using the same mapping scheme yielded only slightly higher errors than CTP for substantially less computing efforts. The population average fabric atlas yielded substantially higher errors than the MTP with the CR mapping scheme. Accounting for sex did not bring any significant improvements. The identified fabric mapping methodology will be exploited in patient-specific QCT-based finite element analysis of the proximal femur to improve the prediction of hip fracture risk. PMID:29176881

morph

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodall, John; Iannacone, Mike; Athalye, Anish

2013-08-01

Morph is a framework and domain-specific language (DSL) that helps parse and transform structured documents. It currently supports several file formats including XML, JSON, and CSV, and custom formats are usable as well.

Novel deployable morphing wing based on SMP composite

NASA Astrophysics Data System (ADS)

Yu, Kai; Sun, Shouhua; Liu, Liwu; Zhang, Zhen; Liu, Yanju; Leng, Jinsong

2009-07-01

In this paper, a novel kind of deployable morphing wing base on shape memory polymer (SMP) composite is designed and tested. While the deployment of the morphing wing still relies on the mechanisms to ensure the recovery force and the stability performance, the deploying process tends to be more steady and accurate by the application of SMP composite, which overcomes the inherent drawbacks of the traditional one, such as harmful impact to the flight balance, less accuracy during the deployment and complex mechanical masses. On the other hand, SMP composite is also designed as the wing's filler. During its shape recovery process, SMP composite stuffed in the wing helps to form an aerofoil for the wing and withstand the aerodynamic loads, leading to the compressed aerofoil recovering its original shape. To demonstrate the feasibility and the controllability of the designed deployable morphing wing, primary tests are also conducted, including the deploying speed of the morphing wing and SMP filler as the main testing aspects. Finally, Wing's deformation under the air loads is also analyzed by using the finite element method to validate the flight stability.

Structural design of morphing trailing edge actuated by SMA

NASA Astrophysics Data System (ADS)

Wang, Qi; Xu, Zhiwei; Zhu, Qian

2013-09-01

In this paper, the morphing trailing edge is designed to achieve the up and down deflection under the aerodynamic load. After a detailed and accurate computational analysis to determine the SMA specifications and layout programs, a solid model is created in CATIA and the structures of the morphing wing trailing edge are produced by CNC machining. A set of DSP measurement and control system is designed to accomplish the controlling experiment of the morphing wing trailing edge. At last, via the force analysis, the trailing edge is fabricated with four sections of aluminum alloy, and the arrangement scheme of SMA wires is determined. Experiment of precise control integral has been performed to survey the control effect. The experiment consists of deflection angle tests of the third joint and the integral structure. Primarily, the ultimate deflection angle is tested in these two experiments. Therefore, the controlling experiment of different angles could be performed within this range. The results show that the deflection error is less than 4%and response time is less than 6.7 s, the precise controlling of the morphing trailing edge is preliminary realized.

Biomechanics of smart wings in a bat robot: morphing wings using SMA actuators.

PubMed

Colorado, J; Barrientos, A; Rossi, C; Bahlman, J W; Breuer, K S

2012-09-01

This paper presents the design of a bat-like micro aerial vehicle with actuated morphing wings. NiTi shape memory alloys (SMAs) acting as artificial biceps and triceps muscles are used for mimicking the morphing wing mechanism of the bat flight apparatus. Our objective is twofold. Firstly, we have implemented a control architecture that allows an accurate and fast SMA actuation. This control makes use of the electrical resistance measurements of SMAs to adjust morphing wing motions. Secondly, the feasibility of using SMA actuation technology is evaluated for the application at hand. To this purpose, experiments are conducted to analyze the control performance in terms of nominal and overloaded operation modes of the SMAs. This analysis includes: (i) inertial forces regarding the stretchable wing membrane and aerodynamic loads, and (ii) uncertainties due to impact of airflow conditions over the resistance-motion relationship of SMAs. With the proposed control, morphing actuation speed can be increased up to 2.5 Hz, being sufficient to generate lift forces at a cruising speed of 5 m s(-1).

Combining the boundary shift integral and tensor-based morphometry for brain atrophy estimation

NASA Astrophysics Data System (ADS)

Michalkiewicz, Mateusz; Pai, Akshay; Leung, Kelvin K.; Sommer, Stefan; Darkner, Sune; Sørensen, Lauge; Sporring, Jon; Nielsen, Mads

2016-03-01

Brain atrophy from structural magnetic resonance images (MRIs) is widely used as an imaging surrogate marker for Alzheimers disease. Their utility has been limited due to the large degree of variance and subsequently high sample size estimates. The only consistent and reasonably powerful atrophy estimation methods has been the boundary shift integral (BSI). In this paper, we first propose a tensor-based morphometry (TBM) method to measure voxel-wise atrophy that we combine with BSI. The combined model decreases the sample size estimates significantly when compared to BSI and TBM alone.

Development of new anatomy reconstruction software to localize cardiac isochrones to the cardiac surface from the 12 lead ECG.

PubMed

van Dam, Peter M; Gordon, Jeffrey P; Laks, Michael M; Boyle, Noel G

2015-01-01

Non-invasive electrocardiographic imaging (ECGI) of the cardiac muscle can help the pre-procedure planning of the ablation of ventricular arrhythmias by reducing the time to localize the origin. Our non-invasive ECGI system, the cardiac isochrone positioning system (CIPS), requires non-intersecting meshes of the heart, lungs and torso. However, software to reconstruct the meshes of the heart, lungs and torso with the capability to check and prevent these intersections is currently lacking. Consequently the reconstruction of a patient specific model with realistic atrial and ventricular wall thickness and incorporating blood cavities, lungs and torso usually requires additional several days of manual work. Therefore new software was developed that checks and prevents any intersections, and thus enables the use of accurate reconstructed anatomical models within CIPS. In this preliminary study we investigated the accuracy of the created patient specific anatomical models from MRI or CT. During the manual segmentation of the MRI data the boundaries of the relevant tissues are determined. The resulting contour lines are used to automatically morph reference meshes of the heart, lungs or torso to match the boundaries of the morphed tissue. Five patients were included in the study; models of the heart, lungs and torso were reconstructed from standard cardiac MRI images. The accuracy was determined by computing the distance between the segmentation contours and the morphed meshes. The average accuracy of the reconstructed cardiac geometry was within 2mm with respect to the manual segmentation contours on the MRI images. Derived wall volumes and left ventricular wall thickness were within the range reported in literature. For each reconstructed heart model the anatomical heart axis was computed using the automatically determined anatomical landmarks of the left apex and the mitral valve. The accuracy of the reconstructed heart models was well within the accuracy of the used medical image data (pixel size <1.5mm). For the lungs and torso the number of triangles in the mesh was reduced, thus decreasing the accuracy of the reconstructed mesh. A novel software tool has been introduced, which is able to reconstruct accurate cardiac anatomical models from MRI or CT within only a few hours. This new anatomical reconstruction tool might reduce the modeling errors within the cardiac isochrone positioning system and thus enable the clinical application of CIPS to localize the PVC/VT focus to the ventricular myocardium from only the standard 12 lead ECG. Copyright © 2015 Elsevier Inc. All rights reserved.

Pressure-actuated cellular structures.

PubMed

Pagitz, M; Lamacchia, E; Hol, J M A M

2012-03-01

Shape changing structures will play an important role in future engineering designs since rigid structures are usually only optimal for a small range of service conditions. Hence, a concept for reliable and energy-efficient morphing structures that possess a large strength to self-weight ratio would be widely applicable. We propose a novel concept for morphing structures that is inspired by the nastic movement of plants. The idea is to connect prismatic cells with tailored pentagonal and/or hexagonal cross sections such that the resulting cellular structure morphs into given target shapes for certain cell pressures. An efficient algorithm for computing equilibrium shapes as well as cross-sectional geometries is presented. The potential of this novel concept is demonstrated by several examples that range from a flagellum like propulsion device to a morphing aircraft wing.

The morphing of geographical features by Fourier transformation.

PubMed

Li, Jingzhong; Liu, Pengcheng; Yu, Wenhao; Cheng, Xiaoqiang

2018-01-01

This paper presents a morphing model of vector geographical data based on Fourier transformation. This model involves three main steps. They are conversion from vector data to Fourier series, generation of intermediate function by combination of the two Fourier series concerning a large scale and a small scale, and reverse conversion from combination function to vector data. By mirror processing, the model can also be used for morphing of linear features. Experimental results show that this method is sensitive to scale variations and it can be used for vector map features' continuous scale transformation. The efficiency of this model is linearly related to the point number of shape boundary and the interceptive value n of Fourier expansion. The effect of morphing by Fourier transformation is plausible and the efficiency of the algorithm is acceptable.

The role of calcium and predation on plate morph evolution in the three-spined stickleback (Gasterosteus aculeatus).

PubMed

Smith, Carl; Spence, Rowena; Barber, Iain; Przybylski, Mirosław; Wootton, Robert J

2014-09-01

While the genetic basis to plate morph evolution of the three-spined stickleback (Gasterosteus aculeatus) is well described, the environmental variables that select for different plate and spine morphs are incompletely understood. Using replicate populations of three-spined sticklebacks on North Uist, Scotland, we previously investigated the role of predation pressure and calcium limitation on the adaptive evolution of stickleback morphology and behavior. While dissolved calcium proved a significant predictor of plate and spine morph, predator abundance did not. Ecol. Evol., xxx, 2014 and xxx performed a comparable analysis to our own to address the same question. They failed to detect a significant effect of dissolved calcium on morphological evolution, but did establish a significant effect of predation; albeit in the opposite direction to their prediction.

Registration of High Angular Resolution Diffusion MRI Images Using 4th Order Tensors⋆

PubMed Central

Barmpoutis, Angelos; Vemuri, Baba C.; Forder, John R.

2009-01-01

Registration of Diffusion Weighted (DW)-MRI datasets has been commonly achieved to date in literature by using either scalar or 2nd-order tensorial information. However, scalar or 2nd-order tensors fail to capture complex local tissue structures, such as fiber crossings, and therefore, datasets containing fiber-crossings cannot be registered accurately by using these techniques. In this paper we present a novel method for non-rigidly registering DW-MRI datasets that are represented by a field of 4th-order tensors. We use the Hellinger distance between the normalized 4th-order tensors represented as distributions, in order to achieve this registration. Hellinger distance is easy to compute, is scale and rotation invariant and hence allows for comparison of the true shape of distributions. Furthermore, we propose a novel 4th-order tensor re-transformation operator, which plays an essential role in the registration procedure and shows significantly better performance compared to the re-orientation operator used in literature for DTI registration. We validate and compare our technique with other existing scalar image and DTI registration methods using simulated diffusion MR data and real HARDI datasets. PMID:18051145

Diffusion tensor imaging with tract-based spatial statistics reveals local white matter abnormalities in preterm infants.

PubMed

Anjari, Mustafa; Srinivasan, Latha; Allsop, Joanna M; Hajnal, Joseph V; Rutherford, Mary A; Edwards, A David; Counsell, Serena J

2007-04-15

Infants born preterm have a high incidence of neurodevelopmental impairment in later childhood, often associated with poorly defined cerebral white matter abnormalities. Diffusion tensor imaging quantifies the diffusion of water within tissues and can assess microstructural abnormalities in the developing preterm brain. Tract-based spatial statistics (TBSS) is an automated observer-independent method of aligning fractional anisotropy (FA) images from multiple subjects to allow groupwise comparisons of diffusion tensor imaging data. We applied TBSS to test the hypothesis that preterm infants have reduced fractional anisotropy in specific regions of white matter compared to term-born controls. We studied 26 preterm infants with no evidence of focal lesions on conventional magnetic resonance imaging (MRI) at term equivalent age and 6 healthy term-born control infants. We found that the centrum semiovale, frontal white matter and the genu of the corpus callosum showed significantly lower FA in the preterm group. Infants born at less than or equal to 28 weeks gestational age (n=11) displayed additional reductions in FA in the external capsule, the posterior aspect of the posterior limb of the internal capsule and the isthmus and middle portion of the body of the corpus callosum. This study demonstrates that TBSS provides an observer-independent method of identifying white matter abnormalities in the preterm brain at term equivalent age in the absence of focal lesions.

Effects of Orientation and Anisometry of Magnetic Resonance Imaging Acquisitions on Diffusion Tensor Imaging and Structural Connectomes.

PubMed

Tudela, Raúl; Muñoz-Moreno, Emma; López-Gil, Xavier; Soria, Guadalupe

2017-01-01

Diffusion-weighted imaging (DWI) quantifies water molecule diffusion within tissues and is becoming an increasingly used technique. However, it is very challenging as correct quantification depends on many different factors, ranging from acquisition parameters to a long pipeline of image processing. In this work, we investigated the influence of voxel geometry on diffusion analysis, comparing different acquisition orientations as well as isometric and anisometric voxels. Diffusion-weighted images of one rat brain were acquired with four different voxel geometries (one isometric and three anisometric in different directions) and three different encoding orientations (coronal, axial and sagittal). Diffusion tensor scalar measurements, tractography and the brain structural connectome were analyzed for each of the 12 acquisitions. The acquisition direction with respect to the main magnetic field orientation affected the diffusion results. When the acquisition slice-encoding direction was not aligned with the main magnetic field, there were more artifacts and a lower signal-to-noise ratio that led to less anisotropic tensors (lower fractional anisotropic values), producing poorer quality results. The use of anisometric voxels generated statistically significant differences in the values of diffusion metrics in specific regions. It also elicited differences in tract reconstruction and in different graph metric values describing the brain networks. Our results highlight the importance of taking into account the geometric aspects of acquisitions, especially when comparing diffusion data acquired using different geometries.

DOE Office of Scientific and Technical Information (OSTI.GOV)

OWEN,STEVEN J.

A method for decomposing a volume with a prescribed quadrilateral surface mesh, into a hexahedral-dominated mesh is proposed. With this method, known as Hex-Morphing (H-Morph), an initial tetrahedral mesh is provided. Tetrahedral are transformed and combined starting from the boundary and working towards the interior of the volume. The quadrilateral faces of the hexahedra are treated as internal surfaces, which can be recovered using constrained triangulation techniques. Implementation details of the edge and face recovery process are included. Examples and performance of the H-Morph algorithm are also presented.

A FSI Enabled Practical Rotorcraft Flow Simulator for Morphing Blade Innovation

DTIC Science & Technology

2015-05-08

morphing surface at different azimuthal angles . It can be found that the morphing surfaces do not deform at 0º and 22.5º, because the shock is...Apparently, due to the superposition of two speeds, the position and strength of shock change at different azimuthal angles . As shown in Figure 30, the...meters. The observer is stationary and the blade rotates periodically. This set up follows what would essentially be a wind tunnel set up. The blade

Comparison of quality control software tools for diffusion tensor imaging.

PubMed

Liu, Bilan; Zhu, Tong; Zhong, Jianhui

2015-04-01

Image quality of diffusion tensor imaging (DTI) is critical for image interpretation, diagnostic accuracy and efficiency. However, DTI is susceptible to numerous detrimental artifacts that may impair the reliability and validity of the obtained data. Although many quality control (QC) software tools are being developed and are widely used and each has its different tradeoffs, there is still no general agreement on an image quality control routine for DTIs, and the practical impact of these tradeoffs is not well studied. An objective comparison that identifies the pros and cons of each of the QC tools will be helpful for the users to make the best choice among tools for specific DTI applications. This study aims to quantitatively compare the effectiveness of three popular QC tools including DTI studio (Johns Hopkins University), DTIprep (University of North Carolina at Chapel Hill, University of Iowa and University of Utah) and TORTOISE (National Institute of Health). Both synthetic and in vivo human brain data were used to quantify adverse effects of major DTI artifacts to tensor calculation as well as the effectiveness of different QC tools in identifying and correcting these artifacts. The technical basis of each tool was discussed, and the ways in which particular techniques affect the output of each of the tools were analyzed. The different functions and I/O formats that three QC tools provide for building a general DTI processing pipeline and integration with other popular image processing tools were also discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterizing dielectric tensors of anisotropic materials from a single measurement

NASA Astrophysics Data System (ADS)

Smith, Paula Kay

Ellipsometry techniques look at changes in polarization states to measure optical properties of thin film materials. A beam reflected from a substrate measures the real and imaginary parts of the index of the material represented as n and k, respectively. Measuring the substrate at several angles gives additional information that can be used to measure multilayer thin film stacks. However, the outstanding problem in standard ellipsometry is that it uses a limited number of incident polarization states (s and p). This limits the technique to isotropic materials. The technique discussed in this paper extends the standard process to measure anisotropic materials by using a larger set of incident polarization states. By using a polarimeter to generate several incident polarization states and measure the polarization properties of the sample, ellipsometry can be performed on biaxial materials. Use of an optimization algorithm in conjunction with biaxial ellipsometry can more accurately determine the dielectric tensor of individual layers in multilayer structures. Biaxial ellipsometry is a technique that measures the dielectric tensors of a biaxial substrate, single-layer thin film, or multi-layer structure. The dielectric tensor of a biaxial material consists of the real and imaginary parts of the three orthogonal principal indices (n x + ikx, ny +iky and nz + i kz) as well as three Euler angles (alpha, beta and gamma) to describe its orientation. The method utilized in this work measures an angle-of-incidence Mueller matrix from a Mueller matrix imaging polarimeter equipped with a pair of microscope objectives that have low polarization properties. To accurately determine the dielectric tensors for multilayer samples, the angle-of-incidence Mueller matrix images are collected for multiple wavelengths. This is done in either a transmission mode or a reflection mode, each incorporates an appropriate dispersion model. Given approximate a priori knowledge of the dielectric tensor and film thickness, a Jones reflectivity matrix is calculated by solving Maxwell's equations at each surface. Converting the Jones matrix into a Mueller matrix provides a starting point for optimization. An optimization algorithm then finds the best fit dielectric tensor based on the measured angle-of-incidence Mueller matrix image. This process can be applied to polarizing materials, birefringent crystals and the multilayer structures of liquid crystal displays. In particular, the need for such accuracy in liquid crystal displays is growing as their applications in industry evolve.

Evaluation of glymphatic system activity with the diffusion MR technique: diffusion tensor image analysis along the perivascular space (DTI-ALPS) in Alzheimer's disease cases.

PubMed

Taoka, Toshiaki; Masutani, Yoshitaka; Kawai, Hisashi; Nakane, Toshiki; Matsuoka, Kiwamu; Yasuno, Fumihiko; Kishimoto, Toshifumi; Naganawa, Shinji

2017-04-01

The activity of the glymphatic system is impaired in animal models of Alzheimer's disease (AD). We evaluated the activity of the human glymphatic system in cases of AD with a diffusion-based technique called diffusion tensor image analysis along the perivascular space (DTI-ALPS). Diffusion tensor images were acquired to calculate diffusivities in the x, y, and z axes of the plane of the lateral ventricle body in 31 patients. We evaluated the diffusivity along the perivascular spaces as well as projection fibers and association fibers separately, to acquire an index for diffusivity along the perivascular space (ALPS-index) and correlated them with the mini mental state examinations (MMSE) score. We found a significant negative correlation between diffusivity along the projection fibers and association fibers. We also observed a significant positive correlation between diffusivity along perivascular spaces shown as ALPS-index and the MMSE score, indicating lower water diffusivity along the perivascular space in relation to AD severity. Activity of the glymphatic system may be evaluated with diffusion images. Lower diffusivity along the perivascular space on DTI-APLS seems to reflect impairment of the glymphatic system. This method may be useful for evaluating the activity of the glymphatic system.

Impaired functional but preserved structural connectivity in limbic white matter tracts in youth with conduct disorder or oppositional defiant disorder plus psychopathic traits.

PubMed

Finger, Elizabeth Carrie; Marsh, Abigail; Blair, Karina Simone; Majestic, Catherine; Evangelou, Iordanis; Gupta, Karan; Schneider, Marguerite Reid; Sims, Courtney; Pope, Kayla; Fowler, Katherine; Sinclair, Stephen; Tovar-Moll, Fernanda; Pine, Daniel; Blair, Robert James

2012-06-30

Youths with conduct disorder or oppositional defiant disorder and psychopathic traits (CD/ODD+PT) are at high risk of adult antisocial behavior and psychopathy. Neuroimaging studies demonstrate functional abnormalities in orbitofrontal cortex and the amygdala in both youths and adults with psychopathic traits. Diffusion tensor imaging in psychopathic adults demonstrates disrupted structural connectivity between these regions (uncinate fasiculus). The current study examined whether functional neural abnormalities present in youths with CD/ODD+PT are associated with similar white matter abnormalities. Youths with CD/ODD+PT and comparison participants completed 3.0 T diffusion tensor scans and functional magnetic resonance imaging scans. Diffusion tensor imaging did not reveal disruption in structural connections within the uncinate fasiculus or other white matter tracts in youths with CD/ODD+PT, despite the demonstration of disrupted amygdala-prefrontal functional connectivity in these youths. These results suggest that disrupted amygdala-frontal white matter connectivity as measured by fractional anisotropy is less sensitive than imaging measurements of functional perturbations in youths with psychopathic traits. If white matter tracts are intact in youths with this disorder, childhood may provide a critical window for intervention and treatment, before significant structural brain abnormalities solidify. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Comparison of Single-Shot Echo-Planar and Line Scan Protocols for Diffusion Tensor Imaging1

PubMed Central

Kubicki, Marek; Maier, Stephan E.; Westin, Carl-Frederik; Mamata, Hatsuho; Ersner-Hershfield, Hal; Estepar, Raul; Kikinis, Ron; Jolesz, Ferenc A.

2009-01-01

Rationale and Objectives Both single-shot diffusion-weighted echo-planar imaging (EPI) and line scan diffusion imaging (LSDI) can be used to obtain magnetic resonance diffusion tensor data and to calculate directionally invariant diffusion anisotropy indices, ie, indirect measures of the organization and coherence of white matter fibers in the brain. To date, there has been no comparison of EPI and LSDI. Because EPI is the most commonly used technique for acquiring diffusion tensor data, it is important to understand the limitations and advantages of LSDI relative to EPI. Materials and Methods Five healthy volunteers underwent EPI and LSDI diffusion on a 1.5 Tesla magnet (General Electric Medical Systems, Milwaukee, WI). Four-mm thick coronal sections, covering the entire brain, were obtained. In addition, one subject was tested with both sequences over four sessions. For each image voxel, eigenvectors and eigenvalues of the diffusion tensor were calculated, and fractional anisotropy (FA) was derived. Several regions of interest were delineated, and for each, mean FA and estimated mean standard deviation were calculated and compared. Results Results showed no significant differences between EPI and LSDI for mean FA for the five subjects. When inter-session reproducibility for one subject was evaluated, there was a significant difference between EPI and LSDI in FA for the corpus callosum and the right uncinate fasciculus. Moreover, errors associated with each FA measure were larger for EPI than for LSDI. Conclusion Results indicate that both EPI- and LSDI-derived FA measures are sufficiently robust. However, when higher accuracy is needed, LSDI provides smaller error and smaller inter-subject and inter-session variability than EPI. PMID:14974598

Measuring sexual dimorphism with a race-gender face space.

PubMed

Hopper, William J; Finklea, Kristin M; Winkielman, Piotr; Huber, David E

2014-10-01

Faces are complex visual objects, and faces chosen to vary in 1 regard may unintentionally vary in other ways, particularly if the correlation is a property of the population of faces. Here, we present an example of a correlation that arises from differences in the degree of sexual dimorphism. In Experiment 1, paired similarity ratings were collected for a set of 40 real face images chosen to vary in terms of gender and race (Asian vs. White). Multidimensional scaling (MDS) placed these stimuli in a "face space," with different attributes corresponding to different dimensions. Gender was found to vary more for White faces, resulting in a negative or positive correlation between gender and race when only considering male or only considering female faces. This increased sexual dimorphism for White faces may provide an alternative explanation for differences in face processing between White and Asian faces (e.g., the own-race bias, face attractiveness biases, etc.). Studies of face processing that are unconfounded by this difference in the degree of sexual dimorphism require stimuli that are decorrelated in terms of race and gender. Decorrelated faces were created using a morphing technique, spacing the morphs uniformly around a ring in the 2-dimensional (2D) race-gender plane. In Experiment 2, paired similarity ratings confirmed the 2D positions of the morph faces. In Experiment 3, race and gender category judgments varied uniformly for these decorrelated stimuli. Our results and stimuli should prove useful for studying sexual dimorphism and for the study of face processing more generally.

Intrinsic network connectivity and own body perception in gender dysphoria.

PubMed

Feusner, Jamie D; Lidström, Andreas; Moody, Teena D; Dhejne, Cecilia; Bookheimer, Susan Y; Savic, Ivanka

2017-08-01

Gender dysphoria (GD) is characterized by incongruence between one's identity and gender assigned at birth. The biological mechanisms of GD are unclear. We investigated brain network connectivity patterns involved in own body perception in the context of self in GD. Twenty-seven female-to-male (FtM) individuals with GD, 27 male controls, and 27 female controls underwent resting state fMRI. We compared functional connections within intrinsic connectivity networks involved in self-referential processes and own body perception -default mode network (DMN) and salience network - and visual networks, using independent components analyses. Behavioral correlates of network connectivity were also tested using self-perception ratings while viewing own body images morphed to their sex assigned at birth, and to the sex of their gender identity. FtM exhibited decreased connectivity of anterior and posterior cingulate and precuneus within the DMN compared with controls. In FtM, higher "self" ratings for bodies morphed towards the sex of their gender identity were associated with greater connectivity of the anterior cingulate within the DMN, during long viewing times. In controls, higher ratings for bodies morphed towards their gender assigned at birth were associated with right insula connectivity within the salience network, during short viewing times. Within visual networks FtM showed weaker connectivity in occipital and temporal regions. Results suggest disconnectivity within networks involved in own body perception in the context of self in GD. Moreover, perception of bodies in relation to self may be reflective rather than reflexive, as a function of mesial prefrontal processes. These may represent neurobiological correlates to the subjective disconnection between perception of body and self-identification.

The morphing of geographical features by Fourier transformation

PubMed Central

Liu, Pengcheng; Yu, Wenhao; Cheng, Xiaoqiang

2018-01-01

This paper presents a morphing model of vector geographical data based on Fourier transformation. This model involves three main steps. They are conversion from vector data to Fourier series, generation of intermediate function by combination of the two Fourier series concerning a large scale and a small scale, and reverse conversion from combination function to vector data. By mirror processing, the model can also be used for morphing of linear features. Experimental results show that this method is sensitive to scale variations and it can be used for vector map features’ continuous scale transformation. The efficiency of this model is linearly related to the point number of shape boundary and the interceptive value n of Fourier expansion. The effect of morphing by Fourier transformation is plausible and the efficiency of the algorithm is acceptable. PMID:29351344

The role of calcium and predation on plate morph evolution in the three-spined stickleback (Gasterosteus aculeatus)

PubMed Central

Smith, Carl; Spence, Rowena; Barber, Iain; Przybylski, Mirosław; Wootton, Robert J

2014-01-01

While the genetic basis to plate morph evolution of the three-spined stickleback (Gasterosteus aculeatus) is well described, the environmental variables that select for different plate and spine morphs are incompletely understood. Using replicate populations of three-spined sticklebacks on North Uist, Scotland, we previously investigated the role of predation pressure and calcium limitation on the adaptive evolution of stickleback morphology and behavior. While dissolved calcium proved a significant predictor of plate and spine morph, predator abundance did not. Ecol. Evol., xxx, 2014 and xxx performed a comparable analysis to our own to address the same question. They failed to detect a significant effect of dissolved calcium on morphological evolution, but did establish a significant effect of predation; albeit in the opposite direction to their prediction. PMID:25478147

Preliminary aeroelastic assessment of a large aeroplane equipped with a camber-morphing aileron

NASA Astrophysics Data System (ADS)

Pecora, Rosario; Amoroso, Francesco; Palumbo, Rita; Arena, Maurizio; Amendola, Gianluca; Dimino, Ignazio

2017-04-01

The development of adaptive morphing wings has been individuated as one of the crucial topics in the greening of the next generation air transport. Research programs have been lunched and are still running worldwide to exploit the potentials of morphing concepts in the optimization of aircraft efficiency and in the consequent reduction of fuel burn. In the framework of CRIAQ MDO 505, a joint Canadian and Italian research project, an innovative camber morphing architecture was proposed for the aileron of a reference civil transportation aircraft; aileron shape adaptation was conceived to increase roll control effectiveness as well as to maximize overall wing efficiency along a typical flight mission. Implemented structural solutions and embedded systems were duly validated by means of ground tests carried out on a true scale prototype. Relying upon the experimental modes of the device in free-free conditions, a rational analysis was carried out in order to investigate the impacts of the morphing aileron on the aeroelastic stability of the reference aircraft. Flutter analyses were performed in compliance with EASA CS-25 airworthiness requirements and referring -at first- to nominal aileron functioning. In this way, safety values for aileron control harmonic and degree of mass-balance were defined to avoid instabilities within the flight envelope. Trade-off analyses were finally addressed to justify the robustness of the adopted massbalancing as well as the persistence of the flutter clearance in case of relevant failures/malfunctions of the morphing system components.

Spatial Distribution of Flower Color Induced by Interspecific Sexual Interaction

PubMed Central

Takahashi, Yuma; Takakura, Koh-ichi; Kawata, Masakado

2016-01-01

Understanding the mechanisms shaping the spatiotemporal distribution of species has long been a central concern of ecology and evolutionary biology. Contemporary patterns of plant assemblies suggest that sexual interactions among species, i.e., reproductive interference, lead to the exclusive distributions of closely related species that share pollinators. However, the fitness consequences and the initial ecological/evolutionary responses to reproductive interference remain unclear in nature, since reproductive isolation or allopatric distribution has already been achieved in the natural community. In Japan, three species of blue-eyed grasses (Sisyrinchium) with incomplete reproductive isolation have recently colonized and occur sympatrically. Two of them are monomorphic with white flowers, whereas the other exhibits heritable color polymorphism (white and purple morphs). Here we investigated the effects of the presence of two monomorphic species on the distribution and reproductive success of color morphs. The frequency and reproductive success of white morphs decreased in area where monomorphic species were abundant, while those of purple morphs did not. The rate of hybridization between species was higher in white morphs than in the purple ones. Resource competition and habitat preference seemed not to contribute to the spatial distribution and reproductive success of two morphs. Our results supported that color-dependent reproductive interference determines the distribution of flower color polymorphism in a habitat, implying ecological sorting promoted by pollinator-mediated reproductive interference. Our study helps us to understand the evolution and spatial structure of flower color in a community. PMID:27723785

Life-history trade-offs mediate 'personality' variation in two colour morphs of the pea aphid, Acyrthosiphon pisum.

PubMed

Schuett, Wiebke; Dall, Sasha R X; Kloesener, Michaela H; Baeumer, Jana; Beinlich, Felix; Eggers, Till

2015-01-01

Life-history trade-offs are considered a major driving force in the emergence of consistent behavioural differences (personality variation); but empirical tests are scarce. We investigated links between a personality trait (escape response), life-history and state variables (growth rate, size and age at first reproduction, age-dependent reproductive rates, lifetime reproductive success, life span) in red and green colour morphs of clonal pea aphids, Acyrthosiphon pisum. Escape response (dropping/non-dropping off a plant upon a predatory attack) was measured repeatedly to classify individuals as consistent droppers, consistent nondroppers or inconsistents. Red morphs experienced stronger trade-offs between early reproduction and life span than green morphs; and red consistent (non)droppers had highest lifetime reproductive success. Red droppers followed a risk-averse life-history strategy (high late reproduction), red nondroppers a risk-prone strategy (high early reproduction), while reproductive rates were equivalent for all green behavioural types and red inconsistents. This suggests that red morphs suffer the highest costs of dropping (they are most conspicuous to predators), which 'equivalates' fitness payoffs to both risk-takers (red non-droppers) and risk-averse red droppers. The strong trade-off also means that committing to a particular lifestyle (being consistent) maximises fitness. Our study suggests that life-history trade-offs likely mediate personality variation but effects might depend on interactions with other organismal characteristics (here: colour morph). © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.

Cellular and ultrastructural characterization of the grey-morph phenotype in southern right whales (Eubalaena australis)

PubMed Central

Eroh, Guy D.; Clayton, Fred C.; Florell, Scott R.; Cassidy, Pamela B.; Chirife, Andrea; Marón, Carina F.; Valenzuela, Luciano O.; Campbell, Michael S.; Seger, Jon; Rowntree, Victoria J.; Leachman, Sancy A.

2017-01-01

Southern right whales (SRWs, Eubalena australis) are polymorphic for an X-linked pigmentation pattern known as grey morphism. Most SRWs have completely black skin with white patches on their bellies and occasionally on their backs; these patches remain white as the whale ages. Grey morphs (previously referred to as partial albinos) appear mostly white at birth, with a splattering of rounded black marks; but as the whales age, the white skin gradually changes to a brownish grey color. The cellular and developmental bases of grey morphism are not understood. Here we describe cellular and ultrastructural features of grey-morph skin in relation to that of normal, wild-type skin. Melanocytes were identified histologically and counted, and melanosomes were measured using transmission electron microscopy. Grey-morph skin had fewer melanocytes when compared to wild-type skin, suggesting reduced melanocyte survival, migration, or proliferation in these whales. Grey-morph melanocytes had smaller melanosomes relative to wild-type skin, normal transport of melanosomes to surrounding keratinocytes, and normal localization of melanin granules above the keratinocyte nuclei. These findings indicate that SRW grey-morph pigmentation patterns are caused by reduced numbers of melanocytes in the skin, as well as by reduced amounts of melanin production and/or reduced sizes of mature melanosomes. Grey morphism is distinct from piebaldism and albinism found in other species, which are genetic pigmentation conditions resulting from the local absence of melanocytes, or the inability to synthesize melanin, respectively. PMID:28170433

Conceptual design and multidisciplinary optimization of in-plane morphing wing structures

NASA Astrophysics Data System (ADS)

Inoyama, Daisaku; Sanders, Brian P.; Joo, James J.

2006-03-01

In this paper, the topology optimization methodology for the synthesis of distributed actuation system with specific applications to the morphing air vehicle is discussed. The main emphasis is placed on the topology optimization problem formulations and the development of computational modeling concepts. For demonstration purposes, the inplane morphing wing model is presented. The analysis model is developed to meet several important criteria: It must allow large rigid-body displacements, as well as variation in planform area, with minimum strain on structural members while retaining acceptable numerical stability for finite element analysis. Preliminary work has indicated that addressed modeling concept meets the criteria and may be suitable for the purpose. Topology optimization is performed on the ground structure based on this modeling concept with design variables that control the system configuration. In other words, states of each element in the model are design variables and they are to be determined through optimization process. In effect, the optimization process assigns morphing members as 'soft' elements, non-morphing load-bearing members as 'stiff' elements, and non-existent members as 'voids.' In addition, the optimization process determines the location and relative force intensities of distributed actuators, which is represented computationally as equal and opposite nodal forces with soft axial stiffness. Several different optimization problem formulations are investigated to understand their potential benefits in solution quality, as well as meaningfulness of formulation itself. Sample in-plane morphing problems are solved to demonstrate the potential capability of the methodology introduced in this paper.

Variation in the Visual Habitat May Mediate the Maintenance of Color Polymorphism in a Poeciliid Fish

PubMed Central

Hurtado-Gonzales, Jorge L.; Loew, Ellis R.; Uy, J. Albert C.

2014-01-01

The conspicuousness of animal signals is influenced by their contrast against the background. As such, signal conspicuousness will tend to vary in nature because habitats are composed of a mosaic of backgrounds. Variation in attractiveness could result in variation in conspecific mate choice and risk of predation, which, in turn, may create opportunities for balancing selection to maintain distinct polymorphisms. We quantified male coloration, the absorbance spectrum of visual pigments and the photic environment of Poecilia parae, a fish species with five distinct male color morphs: a drab (i.e., grey), a striped, and three colorful (i.e., blue, red and yellow) morphs. Then, using physiological models, we assessed how male color patterns can be perceived in their natural visual habitats by conspecific females and a common cichlid predator, Aequidens tetramerus. Our estimates of chromatic and luminance contrasts suggest that the three most colorful morphs were consistently the most conspicuous across all habitats. However, variation in the visual background resulted in variation in which morph was the most conspicuous to females at each locality. Likewise, the most colorful morphs were the most conspicuous morphs to cichlid predators. If females are able to discriminate between conspicuous prospective mates and those preferred males are also more vulnerable to predation, variable visual habitats could influence the direction and strength of natural and sexual selection, thereby allowing for the persistence of color polymorphisms in natural environments. PMID:24987856

Context-dependent crypsis: a prey's perspective of a color polymorphic predator.

PubMed

Rodríguez-Morales, D; Rico-Gray, V; García-Franco, J G; Ajuria-Ibarra, H; Hernández-Salazar, L T; Robledo-Ospina, L E; Rao, D

2018-05-12

Many animals use body coloration as a strategy to communicate with conspecifics, prey, and predators. Color is a trade-off for some species, since they should be visible to conspecifics but cryptic to predators and prey. Some flower-dwelling predators, such as crab spiders, are capable of choosing the color of flowers where they ambush flower visitors and pollinators. In order to avoid being captured, visitors evaluate flowers visually before landing. The crab spider Mecaphesa dubia is a polymorphic species (white/purple color morphs), which inhabits the flower heads of a dune plant, Palafoxia lindenii. Using full-spectrum photography of spiders and flowers, we evaluated how honeybees perceived the spiders at different distances. Using visual modeling, we obtained the chromatic and achromatic contrasts of the spiders on flower heads as perceived by honeybees. Purple morphs were found mainly on the receptacle area and white morphs were equally likely to be found in the flowers and receptacle. According to theoretical modeling, white morphs were visible to honeybees from a distance of 10 cm in receptacle area but appeared to be cryptic in the flower area. Purple morphs were cryptic on the receptacle and less so when they were on the flowers. Spiders on flower heads are predicted to be more easily detected by honeybees using chromatic contrast. Our study shows that the conspicuousness of flower dwelling spiders to honeybees depends on the color morph, the distance of observation, and the position of spider on the flower head.

Cellular and ultrastructural characterization of the grey-morph phenotype in southern right whales (Eubalaena australis).

PubMed

Eroh, Guy D; Clayton, Fred C; Florell, Scott R; Cassidy, Pamela B; Chirife, Andrea; Marón, Carina F; Valenzuela, Luciano O; Campbell, Michael S; Seger, Jon; Rowntree, Victoria J; Leachman, Sancy A

2017-01-01

Southern right whales (SRWs, Eubalena australis) are polymorphic for an X-linked pigmentation pattern known as grey morphism. Most SRWs have completely black skin with white patches on their bellies and occasionally on their backs; these patches remain white as the whale ages. Grey morphs (previously referred to as partial albinos) appear mostly white at birth, with a splattering of rounded black marks; but as the whales age, the white skin gradually changes to a brownish grey color. The cellular and developmental bases of grey morphism are not understood. Here we describe cellular and ultrastructural features of grey-morph skin in relation to that of normal, wild-type skin. Melanocytes were identified histologically and counted, and melanosomes were measured using transmission electron microscopy. Grey-morph skin had fewer melanocytes when compared to wild-type skin, suggesting reduced melanocyte survival, migration, or proliferation in these whales. Grey-morph melanocytes had smaller melanosomes relative to wild-type skin, normal transport of melanosomes to surrounding keratinocytes, and normal localization of melanin granules above the keratinocyte nuclei. These findings indicate that SRW grey-morph pigmentation patterns are caused by reduced numbers of melanocytes in the skin, as well as by reduced amounts of melanin production and/or reduced sizes of mature melanosomes. Grey morphism is distinct from piebaldism and albinism found in other species, which are genetic pigmentation conditions resulting from the local absence of melanocytes, or the inability to synthesize melanin, respectively.

Context-dependent crypsis: a prey's perspective of a color polymorphic predator

NASA Astrophysics Data System (ADS)

Rodríguez-Morales, D.; Rico-Gray, V.; García-Franco, J. G.; Ajuria-Ibarra, H.; Hernández-Salazar, L. T.; Robledo-Ospina, L. E.; Rao, D.

2018-06-01

Many animals use body coloration as a strategy to communicate with conspecifics, prey, and predators. Color is a trade-off for some species, since they should be visible to conspecifics but cryptic to predators and prey. Some flower-dwelling predators, such as crab spiders, are capable of choosing the color of flowers where they ambush flower visitors and pollinators. In order to avoid being captured, visitors evaluate flowers visually before landing. The crab spider Mecaphesa dubia is a polymorphic species (white/purple color morphs), which inhabits the flower heads of a dune plant, Palafoxia lindenii. Using full-spectrum photography of spiders and flowers, we evaluated how honeybees perceived the spiders at different distances. Using visual modeling, we obtained the chromatic and achromatic contrasts of the spiders on flower heads as perceived by honeybees. Purple morphs were found mainly on the receptacle area and white morphs were equally likely to be found in the flowers and receptacle. According to theoretical modeling, white morphs were visible to honeybees from a distance of 10 cm in receptacle area but appeared to be cryptic in the flower area. Purple morphs were cryptic on the receptacle and less so when they were on the flowers. Spiders on flower heads are predicted to be more easily detected by honeybees using chromatic contrast. Our study shows that the conspicuousness of flower dwelling spiders to honeybees depends on the color morph, the distance of observation, and the position of spider on the flower head.

Real-time image-based B-mode ultrasound image simulation of needles using tensor-product interpolation.

PubMed

Zhu, Mengchen; Salcudean, Septimiu E

2011-07-01

In this paper, we propose an interpolation-based method for simulating rigid needles in B-mode ultrasound images in real time. We parameterize the needle B-mode image as a function of needle position and orientation. We collect needle images under various spatial configurations in a water-tank using a needle guidance robot. Then we use multidimensional tensor-product interpolation to simulate images of needles with arbitrary poses and positions using collected images. After further processing, the interpolated needle and seed images are superimposed on top of phantom or tissue image backgrounds. The similarity between the simulated and the real images is measured using a correlation metric. A comparison is also performed with in vivo images obtained during prostate brachytherapy. Our results, carried out for both the convex (transverse plane) and linear (sagittal/para-sagittal plane) arrays of a trans-rectal transducer indicate that our interpolation method produces good results while requiring modest computing resources. The needle simulation method we present can be extended to the simulation of ultrasound images of other wire-like objects. In particular, we have shown that the proposed approach can be used to simulate brachytherapy seeds.

High Resolution Global Topography of Eros from NEAR Imaging and LIDAR Data

NASA Technical Reports Server (NTRS)

Gaskell, Robert W.; Konopliv, A.; Barnouin-Jha, O.; Scheeres, D.

2006-01-01

Principal Data Products: Ensemble of L-maps from SPC, Spacecraft state, Asteroid pole and rotation. Secondary Products: Global topography model, inertia tensor, gravity. Composite high resolution topography. Three dimensional image maps.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klima, Matej; Kucharik, MIlan; Shashkov, Mikhail Jurievich

We analyze several new and existing approaches for limiting tensor quantities in the context of deviatoric stress remapping in an ALE numerical simulation of elastic flow. Remapping and limiting of the tensor component-by-component is shown to violate radial symmetry of derived variables such as elastic energy or force. Therefore, we have extended the symmetry-preserving Vector Image Polygon algorithm, originally designed for limiting vector variables. This limiter constrains the vector (in our case a vector of independent tensor components) within the convex hull formed by the vectors from surrounding cells – an equivalent of the discrete maximum principle in scalar variables.more » We compare this method with a limiter designed specifically for deviatoric stress limiting which aims to constrain the J 2 invariant that is proportional to the specific elastic energy and scale the tensor accordingly. We also propose a method which involves remapping and limiting the J 2 invariant independently using known scalar techniques. The deviatoric stress tensor is then scaled to match this remapped invariant, which guarantees conservation in terms of elastic energy.« less

Comments on "A Closed-Form Solution to Tensor Voting: Theory and Applications".

PubMed

Maggiori, Emmanuel; Lotito, Pablo; Manterola, Hugo Luis; del Fresno, Mariana

2014-12-01

We comment on a paper that describes a closed-form formulation to Tensor Voting, a technique to perceptually group clouds of points, usually applied to infer features in images. The authors proved an analytic solution to the technique, a highly relevant contribution considering that the original formulation required numerical integration, a time-consuming task. Their work constitutes the first closed-form expression for the Tensor Voting framework. In this work we first observe that the proposed formulation leads to unexpected results which do not satisfy the constraints for a Tensor Voting output, hence they cannot be interpreted. Given that the closed-form expression is said to be an analytic equivalent solution, unexpected outputs should not be encountered unless there are flaws in the proof. We analyzed the underlying math to find which were the causes of these unexpected results. In this commentary we show that their proposal does not in fact provide a proper analytic solution to Tensor Voting and we indicate the flaws in the proof.

Joint Data Management for MOVINT Data-to-Decision Making

DTIC Science & Technology

2011-07-01

flux tensor , aligned motion history images, and related approaches have been shown to be versatile approaches [12, 16, 17, 18]. Scaling these...methods include voting , neural networks, fuzzy logic, neuro-dynamic programming, support vector machines, Bayesian and Dempster-Shafer methods. One way...Information Fusion, 2010. [16] F. Bunyak, K. Palaniappan, S. K. Nath, G. Seetharaman, “Flux tensor constrained geodesic active contours with sensor fusion

Electrical impedance tomography in anisotropic media with known eigenvectors

NASA Astrophysics Data System (ADS)

Abascal, Juan-Felipe P. J.; Lionheart, William R. B.; Arridge, Simon R.; Schweiger, Martin; Atkinson, David; Holder, David S.

2011-06-01

Electrical impedance tomography is an imaging method, with which volumetric images of conductivity are produced by injecting electrical current and measuring boundary voltages. It has the potential to become a portable non-invasive medical imaging technique. Until now, most implementations have neglected anisotropy even though human tissues like bone, muscle and brain white matter are markedly anisotropic. The recovery of an anisotropic conductivity tensor is uniquely determined by boundary measurements only up to a diffeomorphism that fixes the boundary. Nevertheless, uniqueness can be restored by providing information about the diffeomorphism. There are uniqueness results for two constraints: one eigenvalue and a multiple scalar of a general tensor. A useable constraint for medical applications is when the eigenvectors of the underlying tissue are known, which can be approximated from MRI or estimated from DT-MRI, although the eigenvalues are unknown. However there is no known theoretical result guaranteeing uniqueness for this constraint. In fact, only a few previous inversion studies have attempted to recover one or more eigenvalues assuming certain symmetries while ignoring nonuniqueness. In this work, the aim was to undertake a numerical study of the feasibility of the recovery of a piecewise linear finite element conductivity tensor in anisotropic media with known eigenvectors from the complete boundary data. The work suggests that uniqueness holds for this constraint, in addition to proposing a methodology for the incorporation of this prior for general conductivity tensors. This was carried out by performing an analysis of the Jacobian rank and by reconstructing four conductivity distributions: two diagonal tensors whose eigenvalues were linear and sinusoidal functions, and two general tensors whose eigenvectors resembled physiological tissue, one with eigenvectors spherically orientated like a spherical layered structure, and a sample of DT-MRI data of brain white matter. The Jacobian with respect to three eigenvalues was full-rank and it was possible to recover three eigenvalues for the four simulated distributions. This encourages further theoretical study of the uniqueness for this constraint and supports the use of this as a relevant usable method for medical applications.

Three-dimensional model-based object recognition and segmentation in cluttered scenes.

PubMed

Mian, Ajmal S; Bennamoun, Mohammed; Owens, Robyn

2006-10-01

Viewpoint independent recognition of free-form objects and their segmentation in the presence of clutter and occlusions is a challenging task. We present a novel 3D model-based algorithm which performs this task automatically and efficiently. A 3D model of an object is automatically constructed offline from its multiple unordered range images (views). These views are converted into multidimensional table representations (which we refer to as tensors). Correspondences are automatically established between these views by simultaneously matching the tensors of a view with those of the remaining views using a hash table-based voting scheme. This results in a graph of relative transformations used to register the views before they are integrated into a seamless 3D model. These models and their tensor representations constitute the model library. During online recognition, a tensor from the scene is simultaneously matched with those in the library by casting votes. Similarity measures are calculated for the model tensors which receive the most votes. The model with the highest similarity is transformed to the scene and, if it aligns accurately with an object in the scene, that object is declared as recognized and is segmented. This process is repeated until the scene is completely segmented. Experiments were performed on real and synthetic data comprised of 55 models and 610 scenes and an overall recognition rate of 95 percent was achieved. Comparison with the spin images revealed that our algorithm is superior in terms of recognition rate and efficiency.

Color plumage polymorphism and predator mimicry in brood parasites

PubMed Central

2013-01-01

Background Plumage polymorphism may evolve during coevolution between brood parasites and their hosts if rare morph(s), by contravening host search image, evade host recognition systems better than common variant(s). Females of the parasitic common cuckoo (Cuculus canorus) are a classic example of discrete color polymorphism: gray females supposedly mimic the sparrowhawk (Accipiter nisus), while rufous females are believed to mimic the kestrel (Falco tinnunculus). Despite many studies on host responses to adult cuckoos comprehensive tests of the “hawk mimicry” and “kestrel mimicry” hypotheses are lacking so far. Results We tested these hypotheses by examining host responses to stuffed dummies of the sparrowhawk, kestrel, cuckoo and the innocuous turtle dove (Streptopelia turtur) as a control at the nest. Our experimental data from an aggressive cuckoo host, the great reed warbler (Acrocephalus arundinaceus), showed low effectiveness of cuckoo-predator mimicry against more aggressive hosts regardless of the type of model and the degree of perfection of the mimic. Specifically, warblers discriminated gray cuckoos from sparrowhawks but did not discriminate rufous cuckoos from kestrels. However, both gray and rufous cuckoos were attacked vigorously and much more than control doves. The ratio of aggression to gray vs. rufous cuckoo was very similar to the ratio between frequencies of gray vs. rufous cuckoo morphs in our study population. Conclusions Overall, our data combined with previous results from other localities suggest polymorphism dynamics are not strongly affected by local predator model frequencies. Instead, hosts responses and discrimination abilities are proportional, other things being equal, to the frequency with which hosts encounter various cuckoo morphs near their nests. This suggests that female cuckoo polymorphism is a counter-adaptation to thwart a specific host adaptation, namely an ability to not be fooled by predator mimicry. We hypothesize the dangerousness of a particular model predator (sparrowhawks are more dangerous to adult birds than kestrels) may be another important factor responsible for better discrimination between the gray cuckoo and its model rather than between the rufous cuckoo and its model. We also provide a review of relevant existing literature, detailed discussion of plumage polymorphism in cuckoos, methodological recommendations and new ideas for future work. PMID:23663311

Changes in predator community structure shifts the efficacy of two warning signals in Arctiid moths.

PubMed

Nokelainen, Ossi; Valkonen, Janne; Lindstedt, Carita; Mappes, Johanna

2014-05-01

Polymorphism in warning coloration is puzzling because positive frequency-dependent selection by predators is expected to promote monomorphic warning signals in defended prey. We studied predation on the warning-coloured wood tiger moth (Parasemia plantaginis) by using artificial prey resembling white and yellow male colour morphs in five separate populations with different naturally occurring morph frequencies. We tested whether predation favours one of the colour morphs over the other and whether that is influenced either by local, natural colour morph frequencies or predator community composition. We found that yellow specimens were attacked less than white ones regardless of the local frequency of the morphs indicating frequency-independent selection, but predation did depend on predator community composition: yellows suffered less attacks when Paridae were abundant, whereas whites suffered less attacks when Prunellidae were abundant. Our results suggest that spatial heterogeneity in predator community composition can generate a geographical mosaic of selection facilitating the evolution of polymorphic warning signals. This is the first time this mechanism gains experimental support. Altogether, this study sheds light on the evolution of adaptive coloration in heterogeneous environments. © 2013 The Authors. Journal of Animal Ecology © 2013 British Ecological Society.

Dynamics of colour polymorphism in a changing environment: fire melanism and then what?

PubMed

Karlsson, Magnus; Caesar, Sofia; Ahnesjö, Jonas; Forsman, Anders

2008-01-01

Studies of whether disturbance events are associated with the changing genetic compositions of natural populations may provide insights into the importance of local selection events in maintaining diversity, and might inform plans for the conservation and protection of that diversity. We examined the dynamics of a colour pattern polymorphism in a natural population of pygmy grasshoppers Tetrix subulata (Orthoptera: Tetrigidae) inhabiting a previously burnt clear-cut area. Data on morph frequencies for wild-caught and captive-reared individuals indicated that the initial dominance of black phenotypes following the fire event was followed by an increased diversity of the polymorphism. This was manifested as the appearance of a novel morph, a decreased incidence of the black morph, and a more even distribution of individuals across alternative morphs following the recurrence of vegetation. We also found that the colour patterns of captive-reared individuals resembled those of their parents and that the degree of within-clutch diversity increased between generations. Our comparisons of morph frequencies across generations and between environments within generations point to a genetic determination of colour pattern, and indicate that the polymorphism is influenced more strongly by selection than by plasticity or migration.

The nonlinear aeroelastic characteristics of a folding wing with cubic stiffness

NASA Astrophysics Data System (ADS)

Hu, Wei; Yang, Zhichun; Gu, Yingsong; Wang, Xiaochen

2017-07-01

This paper focuses on the nonlinear aeroelastic characteristics of a folding wing in the quasi-steady condition (namely at fixed folding angles) and during the morphing process. The structure model of the folding wing is formulated by the Lagrange equations, and the constraint equation is used to describe the morphing strategy. The aerodynamic influence coefficient matrices at several folding angles are calculated by the Doublet Lattice method, and described as rational functions in the Laplace domain by the rational function approximation, and then the Kriging agent model technique is adopted to interpolate the coefficient matrices of the rational functions, and the aerodynamics model of the folding wing during the morphing process is built. The aeroelastic responses of the folding wing with cubic stiffness are simulated, and the results show that the motion types of aeroelastic responses in the quasi-steady condition and during the morphing process are all sensitive to the initial condition and folding angle. During the morphing process, the transition of the motion types is observed. And apart from the period of transition, the aeroelastic response at some folding angles may exhibit different motion types, which can be found from the results in the quasi-steady condition.

Centroid-moment tensor solutions for October-December 2000

NASA Astrophysics Data System (ADS)

Dziewonski, A. M.; Ekström, G.; Maternovskaya, N. N.

2003-04-01

Centroid-moment tensor solutions are presented for 263 earthquakes that occurred during the fourth quarter of 2000. The solutions are obtained using corrections for a spherical earth structure represented by the whole mantle shear velocity model SH8/U4L8 of Dziewonski and Woodward [A.M. Dziewonski, R.L. Woodward, Acoustic imaging at the planetary scale, in: H. Emert, H.-P. Harjes (Eds.), Acoustical Imaging, Plenum Press, New York, vol. 19, 1992, pp. 785-797]. The model of an elastic attenuation of Durek and Ekström [Bull. Seism. Soc. Am. 86 (1996) 144] is used to predict the decay of the waveforms.

Diffusion tensor imaging of hemispheric asymmetries in the developing brain.

PubMed

Wilde, Elisabeth A; McCauley, Stephen R; Chu, Zili; Hunter, Jill V; Bigler, Erin D; Yallampalli, Ragini; Wang, Zhiyue J; Hanten, Gerri; Li, Xiaoqi; Ramos, Marco A; Sabir, Sharjeel H; Vasquez, Ana C; Menefee, Deleene; Levin, Harvey S

2009-02-01

Diffusion tensor imaging (DTI) was performed in 39 right-handed children to examine structural hemispheric differences and the impact of age, socioeconomic status, and sex on these differences. Apparent diffusion coefficient (ADC) values were smaller in the left than in the right temporal, prefrontal, anterior internal capsular and the thalamic regions, and fractional anisotropy (FA) values were larger in the left than in the right internal capsule, thalamus, and cingulate. Significant region-by-sex interactions disclosed that the relation of DTI asymmetries to performance depended on sex including the relation of temporal lobes to reading comprehension and the relation of frontal lobes to solving applied mathematical problems.

Diffusion tensor imaging demonstrates brainstem and cerebellar abnormalities in congenital central hypoventilation syndrome.

PubMed

Kumar, Rajesh; Macey, Paul M; Woo, Mary A; Alger, Jeffry R; Harper, Ronald M

2008-09-01

Congenital central hypoventilation syndrome (CCHS) patients show reduced breathing drive during sleep, decreased hypoxic and hypercapnic ventilatory responses, and autonomic and affective deficits, suggesting both brainstem and forebrain injuries. Forebrain damage was previously described in CCHS, but methodological limitations precluded detection of brainstem injury, a concern because genetic mutations in CCHS target brainstem autonomic nuclei. To assess brainstem and cerebellar areas, we used diffusion tensor imaging-based measures, namely axial diffusivity, reflecting water diffusion parallel to fibers, and sensitive to axonal injury, and radial diffusivity, measuring diffusion perpendicular to fibers, and indicative of myelin injury. Diffusion tensor imaging was performed in 12 CCHS and 26 controls, and axial and radial diffusivity maps were compared between groups using analysis of covariance (covariates; age and gender). Increased axial diffusivity in CCHS appeared within the lateral medulla and clusters with injury extended from the dorsal midbrain through the periaqueductal gray, raphé, and superior cerebellar decussation, ventrally to the basal-pons. Cerebellar cortex and deep nuclei, and the superior and inferior cerebellar peduncles showed increased radial diffusivity. Midbrain, pontine, and lateral medullary structures, and the cerebellum and its fiber systems are injured in CCHS, likely contributing to the characteristics found in the syndrome.

Microstructural white matter tract alteration in Prader-Willi syndrome: A diffusion tensor imaging study.

PubMed

Rice, Lauren J; Lagopoulos, Jim; Brammer, Michael; Einfeld, Stewart L

2017-09-01

Prader-Willi Syndrome (PWS) is a genetic disorder characterized by infantile hypotonia, hyperphagia, hypogonadism, growth hormone deficiency, intellectual disability, and severe emotional and behavioral problems. The brain mechanisms that underpin these disturbances are unknown. Diffusion tensor imaging (DTI) enables in vivo investigation of the microstructural integrity of white matter pathways. To date, only one study has used DTI to examine white matter alterations in PWS. However, that study used selected regions of interest, rather than a whole brain analysis. In the present study, we used diffusion tensor and magnetic resonance (T 1-weighted) imaging to examine microstructural white matter changes in 15 individuals with PWS (17-30 years) and 15 age-and-gender-matched controls. Whole-brain voxel-wise statistical analysis of FA was carried out using tract-based spatial statistics (TBSS). Significantly decreased fractional anisotropy was found localized to the left hemisphere in individuals with PWS within the splenium of the corpus callosum, the internal capsule including the posterior thalamic radiation and the inferior frontal occipital fasciculus (IFOF). Reduced integrity of these white matter pathways in individuals with PWS may relate to orientating attention, emotion recognition, semantic processing, and sensorimotor dysfunction. © 2017 Wiley Periodicals, Inc.

Diffusion MRI and its role in neuropsychology

PubMed Central

Mueller, Bryon A; Lim, Kelvin O; Hemmy, Laura; Camchong, Jazmin

2015-01-01

Diffusion Magnetic Resonance Imaging (dMRI) is a popular method used by neuroscientists to uncover unique information about the structural connections within the brain. dMRI is a non-invasive imaging methodology in which image contrast is based on the diffusion of water molecules in tissue. While applicable to many tissues in the body, this review focuses exclusively on the use of dMRI to examine white matter in the brain. In this review, we begin with a definition of diffusion and how diffusion is measured with MRI. Next we introduce the diffusion tensor model, the predominant model used in dMRI. We then describe acquisition issues related to acquisition parameters and scanner hardware and software. Sources of artifacts are then discussed, followed by a brief review of analysis approaches. We provide an overview of the limitations of the traditional diffusion tensor model, and highlight several more sophisticated non-tensor models that better describe the complex architecture of the brain’s white matter. We then touch on reliability and validity issues of diffusion measurements. Finally, we describe examples of ways in which dMRI has been applied to studies of brain disorders and how identified alterations relate to symptomatology and cognition. PMID:26255305

Innovative anisotropic phantoms for calibration of diffusion tensor imaging sequences.

PubMed

Kłodowski, Krzysztof; Krzyżak, Artur Tadeusz

2016-05-01

The paper describes a novel type of anisotropic phantoms designed for b-matrix spatial distribution diffusion tensor imaging (BSD-DTI). Cubic plate anisotropic phantom, cylinder capillary phantom and water reference phantom are described as a complete set necessary for calibration, validation and normalization of BSD-DTI. An innovative design of the phantoms basing on enclosing the anisotropic cores in glass balls filled with liquid made for the first time possible BSD calibration with usage of echo planar imaging (EPI) sequence. Susceptibility artifacts prone to occur in EPI sequences were visibly reduced in the central region of the phantoms. The phantoms were designed for usage in a clinical scanner's head coil, but can be scaled for other coil or scanner types. The phantoms can be also used for a pre-calibration of imaging of other types of phantoms having more specific applications. Copyright © 2015 Elsevier Inc. All rights reserved.

High Efficiency, Low Distortion 3D Diffusion Tensor Imaging with Variable Density Spiral Fast Spin Echoes (3D DW VDS RARE)

PubMed Central

Frank, Lawrence R.; Jung, Youngkyoo; Inati, Souheil; Tyszka, J. Michael; Wong, Eric C.

2009-01-01

We present an acquisition and reconstruction method designed to acquire high resolution 3D fast spin echo diffusion tensor images while mitigating the major sources of artifacts in DTI - field distortions, eddy currents and motion. The resulting images, being 3D, are of high SNR, and being fast spin echoes, exhibit greatly reduced field distortions. This sequence utilizes variable density spiral acquisition gradients, which allow for the implementation of a self-navigation scheme by which both eddy current and motion artifacts are removed. The result is that high resolution 3D DTI images are produced without the need for eddy current compensating gradients or B0 field correction. In addition, a novel method for fast and accurate reconstruction of the non-Cartesian data is employed. Results are demonstrated in the brains of normal human volunteers. PMID:19778618

Diagnosis of Lumbar Foraminal Stenosis using Diffusion Tensor Imaging.

PubMed

Eguchi, Yawara; Ohtori, Seiji; Suzuki, Munetaka; Oikawa, Yasuhiro; Yamanaka, Hajime; Tamai, Hiroshi; Kobayashi, Tatsuya; Orita, Sumihisa; Yamauchi, Kazuyo; Suzuki, Miyako; Aoki, Yasuchika; Watanabe, Atsuya; Kanamoto, Hirohito; Takahashi, Kazuhisa

2016-02-01

Diagnosis of lumbar foraminal stenosis remains difficult. Here, we report on a case in which bilateral lumbar foraminal stenosis was difficult to diagnose, and in which diffusion tensor imaging (DTI) was useful. The patient was a 52-year-old woman with low back pain and pain in both legs that was dominant on the right. Right lumbosacral nerve compression due to a massive uterine myoma was apparent, but the leg pain continued after a myomectomy was performed. No abnormalities were observed during nerve conduction studies. Computed tomography and magnetic resonance imaging indicated bilateral L5 lumbar foraminal stenosis. DTI imaging was done. The extraforaminal values were decreased and tractography was interrupted in the foraminal region. Bilateral L5 vertebral foraminal stenosis was treated by transforaminal lumbar interbody fusion and the pain in both legs disappeared. The case indicates the value of DTI for diagnosing vertebral foraminal stenosis.

Diffusion-weighted imaging and diffusion tensor imaging of asymptomatic lumbar disc herniation.

PubMed

Sakai, Toshinori; Miyagi, Ryo; Yamabe, Eiko; Fujinaga, Yasunari; N Bhatia, Nitin; Yoshioka, Hiroshi

2014-01-01

Diffusion-weighted imaging (DWI) and diffusion tensor imaging (DTI) were performed on a healthy 31-year-old man with asymptomatic lumbar disc herniation. Although the left S1 nerve root was obviously entrapped by a herniated mass, neither DWI nor DTI showed any significant findings for the nerve root. Decreased apparent diffusion coefficient (ADC) values and increased fractional anisotropy (FA) values were found. These results are contrary to those in previously published studies of symptomatic patients, in which a combination of increased ADC and decreased FA seem to have a relationship with nerve injury and subsequent symptoms, such as leg pain or palsy. Our results seen in an asymptomatic subject suggest that the compressed nerve with no injury, such as edema, demyelination, or persistent axonal injury, may be indicated by a combination of decreased ADC and increased FA. ADC and FA could therefore be potential tools to elucidate the pathomechanism of radiculopathy.

Segmentation of the pectoral muscle in breast MR images using structure tensor and deformable model

NASA Astrophysics Data System (ADS)

Lee, Myungeun; Kim, Jong Hyo

2012-02-01

Recently, breast MR images have been used in wider clinical area including diagnosis, treatment planning, and treatment response evaluation, which requests quantitative analysis and breast tissue segmentation. Although several methods have been proposed for segmenting MR images, segmenting out breast tissues robustly from surrounding structures in a wide range of anatomical diversity still remains challenging. Therefore, in this paper, we propose a practical and general-purpose approach for segmenting the pectoral muscle boundary based on the structure tensor and deformable model. The segmentation work flow comprises four key steps: preprocessing, detection of the region of interest (ROI) within the breast region, segmenting the pectoral muscle and finally extracting and refining the pectoral muscle boundary. From experimental results we show that the proposed method can segment the pectoral muscle robustly in diverse patient cases. In addition, the proposed method will allow the application of the quantification research for various breast images.

Compression of hyper-spectral images using an accelerated nonnegative tensor decomposition

NASA Astrophysics Data System (ADS)

Li, Jin; Liu, Zilong

2017-12-01

Nonnegative tensor Tucker decomposition (NTD) in a transform domain (e.g., 2D-DWT, etc) has been used in the compression of hyper-spectral images because it can remove redundancies between spectrum bands and also exploit spatial correlations of each band. However, the use of a NTD has a very high computational cost. In this paper, we propose a low complexity NTD-based compression method of hyper-spectral images. This method is based on a pair-wise multilevel grouping approach for the NTD to overcome its high computational cost. The proposed method has a low complexity under a slight decrease of the coding performance compared to conventional NTD. We experimentally confirm this method, which indicates that this method has the less processing time and keeps a better coding performance than the case that the NTD is not used. The proposed approach has a potential application in the loss compression of hyper-spectral or multi-spectral images

Motion-induced phase error estimation and correction in 3D diffusion tensor imaging.

PubMed

Van, Anh T; Hernando, Diego; Sutton, Bradley P

2011-11-01

A multishot data acquisition strategy is one way to mitigate B0 distortion and T2∗ blurring for high-resolution diffusion-weighted magnetic resonance imaging experiments. However, different object motions that take place during different shots cause phase inconsistencies in the data, leading to significant image artifacts. This work proposes a maximum likelihood estimation and k-space correction of motion-induced phase errors in 3D multishot diffusion tensor imaging. The proposed error estimation is robust, unbiased, and approaches the Cramer-Rao lower bound. For rigid body motion, the proposed correction effectively removes motion-induced phase errors regardless of the k-space trajectory used and gives comparable performance to the more computationally expensive 3D iterative nonlinear phase error correction method. The method has been extended to handle multichannel data collected using phased-array coils. Simulation and in vivo data are shown to demonstrate the performance of the method.

Brain white matter fiber estimation and tractography using Q-ball imaging and Bayesian MODEL.

PubMed

Lu, Meng

2015-01-01

Diffusion tensor imaging allows for the non-invasive in vivo mapping of the brain tractography. However, fiber bundles have complex structures such as fiber crossings, fiber branchings and fibers with large curvatures that tensor imaging (DTI) cannot accurately handle. This study presents a novel brain white matter tractography method using Q-ball imaging as the data source instead of DTI, because QBI can provide accurate information about multiple fiber crossings and branchings in a single voxel using an orientation distribution function (ODF). The presented method also uses graph theory to construct the Bayesian model-based graph, so that the fiber tracking between two voxels can be represented as the shortest path in a graph. Our experiment showed that our new method can accurately handle brain white matter fiber crossings and branchings, and reconstruct brain tractograhpy both in phantom data and real brain data.

Development of emotional facial recognition in late childhood and adolescence.

PubMed

Thomas, Laura A; De Bellis, Michael D; Graham, Reiko; LaBar, Kevin S

2007-09-01

The ability to interpret emotions in facial expressions is crucial for social functioning across the lifespan. Facial expression recognition develops rapidly during infancy and improves with age during the preschool years. However, the developmental trajectory from late childhood to adulthood is less clear. We tested older children, adolescents and adults on a two-alternative forced-choice discrimination task using morphed faces that varied in emotional content. Actors appeared to pose expressions that changed incrementally along three progressions: neutral-to-fear, neutral-to-anger, and fear-to-anger. Across all three morph types, adults displayed more sensitivity to subtle changes in emotional expression than children and adolescents. Fear morphs and fear-to-anger blends showed a linear developmental trajectory, whereas anger morphs showed a quadratic trend, increasing sharply from adolescents to adults. The results provide evidence for late developmental changes in emotional expression recognition with some specificity in the time course for distinct emotions.

A supergene determines highly divergent male reproductive morphs in the ruff

PubMed Central

dos Remedios, Natalie; Farrell, Lindsay L.; McRae, Susan B.; Morgan, Tawna C.; Karlionova, Natalia; Pinchuk, Pavel; Verkuil, Yvonne I.; Kitaysky, Alexander S.; Wingfield, John C.; Piersma, Theunis; Zeng, Kai; Slate, Jon; Blaxter, Mark; Lank, David B.; Burke, Terry

2015-01-01

Three strikingly different alternative male mating morphs (aggressive “Independents”, semi-cooperative “Satellites” and female mimic “Faeders”) coexist as a balanced polymorphism in the ruff, Philomachus pugnax, a lek-breeding wading bird1,2,3. Major differences in body size, ornamentation, and aggressive and mating behaviour are inherited as an autosomal polymorphism4,5. We show that development into Satellites and Faeders is determined by a supergene6,7,8 consisting of divergent alternative, dominant, non-recombining haplotypes of an inversion on chromosome 11, which contains 125 predicted genes. Independents are homozygous for the ancestral sequence. One breakpoint of the inversion disrupts the essential Centromere protein N (CENP-N) gene, and pedigree analysis confirms lethality of inversion homozygotes. We describe novel behavioural, testes size, and steroid metabolic differences among morphs, and identify polymorphic genes within the inversion that are likely to contribute to the differences among morphs in reproductive traits. PMID:26569125

Development of SMA Actuated Morphing Airfoil for Wind Turbine Load Alleviation

NASA Astrophysics Data System (ADS)

Karakalas, A.; Machairas, T.; Solomou, A.; Riziotis, V.; Saravanos, D.

Wind turbine rotor upscaling has entered a range of rotor diameters where the blade structure cannot sustain the increased aerodynamic loads without novel load alleviation concepts. Research on load alleviation using morphing blade sections is presented. Antagonistic shape memory alloy (SMA) actuators are implemented to deflect the section trailing edge (TE) to target shapes and target time-series relating TE movement with changes in lift coefficient. Challenges encountered by the complex thermomechanical response of morphing section and the enhancement of SMA transient response to achieve frequencies meaningful for aerodynamic load alleviation are addressed. Using a recently developed finite element for SMA actuators [1], actuator configurations are considered for fast cooling and heating cycles. Numerical results quantify the attained ranges of TE angle movement, the moving time period and the developed stresses. Estimations of the attained variations of lift coefficient vs. time are also presented to assess the performance of the morphing section.

HRTEM low dose: the unfold of the morphed graphene, from amorphous carbon to morphed graphenes.

PubMed

Calderon, H A; Okonkwo, A; Estrada-Guel, I; Hadjiev, V G; Alvarez-Ramírez, F; Robles Hernández, F C

We present experimental evidence under low-dose conditions transmission electron microscopy for the unfolding of the evolving changes in carbon soot during mechanical milling. The milled soot shows evolving changes as a function of the milling severity or time. Those changes are responsible for the transformation from amorphous carbon to graphenes, graphitic carbon, and highly ordered structures such as morphed graphenes, namely Rh6 and Rh6-II. The morphed graphenes are corrugated layers of carbon with cross-linked covalently nature and sp 2 - or sp 3 -type allotropes. Electron microscopy and numerical simulations are excellent complementary tools to identify those phases. Furthermore, the TEAM 05 microscope is an outstanding tool to resolve the microstructure and prevent any damage to the sample. Other characterization techniques such as XRD, Raman, and XPS fade to convey a true identification of those phases because the samples are usually blends or mixes of the mentioned phases.

Shape memory alloy-actuated bistable composites for morphing structures

NASA Astrophysics Data System (ADS)

Chillara, Venkata Siva C.; Dapino, Marcelo J.

2018-03-01

Laminated composites with orthogonally-applied mechanical prestress have been shown to exhibit two stable shapes where each shape is influenced by only one prestrained lamina. The application of mechanical prestress is associated with an irreversible non-zero stress state; when combined with smart materials with controllable stress-states, this results in multifunctionality in morphing composites. This study presents an experimental characterization of the shape transition or snap-through in mechanically-prestressed bistable laminates. Measurements, conducted using tensile testing and 3D motion capture, show that snap-through in these laminates is a multi-stage phenomenon. An active bistable morphing composite is demonstrated using NiTi shape memory wire actuators in push-pull configuration; activation of one wire resets the second wire as the composite morphs. The set of shape memory actuators not only actuate the composite in both directions, but also act as dampers that enable vibration-free shape transition.

Mechanical vibrations from tadpoles' flapping tails transform salamander's carnivorous morphology.

PubMed

Michimae, Hirofumi; Nishimura, Kinya; Wakahara, Masami

2005-03-22

Some prey or predator organisms exhibit striking rapid morphological plastic changes with distinct morphology under the condition of predator or prey presence. Remote chemicals propagating from the inducing agents are the prevalent induction cues for most examples of induction of distinct morphs. Sonic and visual cues, as well as chemical cues, are known as triggers for induction of behavioural plasticity. Here we show that hydraulic vibration originating from flapping tails of anuran tadpoles is a key cue in relation to induction of a distinct carnivorous morphology, a broad-headed morph, in larval salamander Hynobius retardatus, which is able to efficiently capture and handle prey. This result was further supported by the fact that simple mechanical vibrations of tail-like vinyl fins were able to induce the morph without any biological cues. Induction of the morph triggered by hydraulic vibration provides a novel concept for understanding the proximate mechanisms of induction of morphological changes.

NASA's Morphing Project Research Summaries in Fiscal Year 2002

NASA Technical Reports Server (NTRS)

McGowan, Anna-Maria R.; Waszak, Martin R.

2005-01-01

The Morphing Project at the National Aeronautics and Space Agency s (NASA) Langley Research Center (LaRC) is part of the Breakthrough Vehicle Technologies Project, Vehicle Systems Program that conducts fundamental research on advanced technologies for future flight vehicles. The objectives of the Morphing Project are to develop and assess the advanced technologies and integrated component concepts to enable efficient, multi-point adaptability of flight vehicles; primarily through the application of adaptive structures and adaptive flow control to substantially alter vehicle performance characteristics. This document is a compilation of research summaries and other information on the project for fiscal year 2002. The focus is to provide a brief overview of the project content, technical results and lessons learned. At the time of publication, the Vehicle Systems Program (which includes the Morphing Project) is undergoing a program re-planning and reorganization. Accordingly, the programmatic descriptions of this document pertain only to the program as of fiscal year 2002.

What is Falco Altaicus Menzbier?

USGS Publications Warehouse

Ellis, D.H.

1995-01-01

The systematics of the Altay falcon (Falco altaicus/lorenzi) remains enigmatic. First reported in 1811, it has been treated as a gyrfalcon (F. rusticolus), a saker (F. cherrug), and two separate species (F. lorenzi and F. altaicus). Of 53 'altaicus' specimens examined, at least two are misidentified gyrfalcons, many are typical sakers, but 34 (the core group) are considered to be the true Altay falcon type. Adults have red, brown, and gray color morphs. The red (backed) morph closely resembles some eastern sakers; the chocolate and gray morphs resemble respective gyrfalcon morphs. While the true affinities of the Altay falcon will be resolved by molecular genetics, the ecological, geographical, and morphological information suggest that the core group represents a gyrfalcon-saker cross that is being swamped through back crosses with the saker. The breeding range of the core group (i.e., the Altay and Sayan Mountains) is much smaller than previously reported.

Shape Optimization and Modular Discretization for the Development of a Morphing Wingtip

NASA Astrophysics Data System (ADS)

Morley, Joshua

Better knowledge in the areas of aerodynamics and optimization has allowed designers to develop efficient wingtip structures in recent years. However, the requirements faced by wingtip devices can be considerably different amongst an aircraft's flight regimes. Traditional static wingtip devices are then a compromise between conflicting requirements, resulting in less than optimal performance within each regime. Alternatively, a morphing wingtip can reconfigure leading to improved performance over a range of dissimilar flight conditions. Developed within this thesis, is a modular morphing wingtip concept that centers on the use of variable geometry truss mechanisms to permit morphing. A conceptual design framework is established to aid in the development of the concept. The framework uses a metaheuristic optimization procedure to determine optimal continuous wingtip configurations. The configurations are then discretized for the modular concept. The functionality of the framework is demonstrated through a design study on a hypothetical wing/winglet within the thesis.

Diazotrophic diversity in the Caribbean coral, Montastraea cavernosa.

PubMed

Olson, Nathan D; Lesser, Michael P

2013-12-01

Previous research on the Caribbean coral Montastraea cavernosa reported the presence of cyanobacterial endosymbionts and nitrogen fixation in orange, but not brown, colonies. We compared the diversity of nifH gene sequences between these two color morphs at three locations in the Caribbean and found that the nifH sequences recovered from M. cavernosa were consistent with previous studies on corals where members of both the α-proteobacteria and cyanobacteria were recovered. A number of nifH operational taxonomic units (OTUs) were significantly more abundant in the orange compared to the brown morphs, and one specific OTU (OTU 17), a cyanobacterial nifH sequence similar to others from corals and sponges and related to the cyanobacterial genus Cyanothece, was found in all orange morphs of M. cavernosa at all locations. The nifH diversity reported here, from a community perspective, was not significantly different between orange and brown morphs of M. cavernosa.

Rotation covariant image processing for biomedical applications.

PubMed

Skibbe, Henrik; Reisert, Marco

2013-01-01

With the advent of novel biomedical 3D image acquisition techniques, the efficient and reliable analysis of volumetric images has become more and more important. The amount of data is enormous and demands an automated processing. The applications are manifold, ranging from image enhancement, image reconstruction, and image description to object/feature detection and high-level contextual feature extraction. In most scenarios, it is expected that geometric transformations alter the output in a mathematically well-defined manner. In this paper we emphasis on 3D translations and rotations. Many algorithms rely on intensity or low-order tensorial-like descriptions to fulfill this demand. This paper proposes a general mathematical framework based on mathematical concepts and theories transferred from mathematical physics and harmonic analysis into the domain of image analysis and pattern recognition. Based on two basic operations, spherical tensor differentiation and spherical tensor multiplication, we show how to design a variety of 3D image processing methods in an efficient way. The framework has already been applied to several biomedical applications ranging from feature and object detection tasks to image enhancement and image restoration techniques. In this paper, the proposed methods are applied on a variety of different 3D data modalities stemming from medical and biological sciences.

White matter degeneration in schizophrenia: a comparative diffusion tensor analysis

NASA Astrophysics Data System (ADS)

Ingalhalikar, Madhura A.; Andreasen, Nancy C.; Kim, Jinsuh; Alexander, Andrew L.; Magnotta, Vincent A.

2010-03-01

Schizophrenia is a serious and disabling mental disorder. Diffusion tensor imaging (DTI) studies performed on schizophrenia have demonstrated white matter degeneration either due to loss of myelination or deterioration of fiber tracts although the areas where the changes occur are variable across studies. Most of the population based studies analyze the changes in schizophrenia using scalar indices computed from the diffusion tensor such as fractional anisotropy (FA) and relative anisotropy (RA). The scalar measures may not capture the complete information from the diffusion tensor. In this paper we have applied the RADTI method on a group of 9 controls and 9 patients with schizophrenia. The RADTI method converts the tensors to log-Euclidean space where a linear regression model is applied and hypothesis testing is performed between the control and patient groups. Results show that there is a significant difference in the anisotropy between patients and controls especially in the parts of forceps minor, superior corona radiata, anterior limb of internal capsule and genu of corpus callosum. To check if the tensor analysis gives a better idea of the changes in anisotropy, we compared the results with voxelwise FA analysis as well as voxelwise geodesic anisotropy (GA) analysis.

Learning to represent spatial transformations with factored higher-order Boltzmann machines.

PubMed

Memisevic, Roland; Hinton, Geoffrey E

2010-06-01

To allow the hidden units of a restricted Boltzmann machine to model the transformation between two successive images, Memisevic and Hinton (2007) introduced three-way multiplicative interactions that use the intensity of a pixel in the first image as a multiplicative gain on a learned, symmetric weight between a pixel in the second image and a hidden unit. This creates cubically many parameters, which form a three-dimensional interaction tensor. We describe a low-rank approximation to this interaction tensor that uses a sum of factors, each of which is a three-way outer product. This approximation allows efficient learning of transformations between larger image patches. Since each factor can be viewed as an image filter, the model as a whole learns optimal filter pairs for efficiently representing transformations. We demonstrate the learning of optimal filter pairs from various synthetic and real image sequences. We also show how learning about image transformations allows the model to perform a simple visual analogy task, and we show how a completely unsupervised network trained on transformations perceives multiple motions of transparent dot patterns in the same way as humans.

Quantitative assessments of traumatic axonal injury in human brain: concordance of microdialysis and advanced MRI.

PubMed

Magnoni, Sandra; Mac Donald, Christine L; Esparza, Thomas J; Conte, Valeria; Sorrell, James; Macrì, Mario; Bertani, Giulio; Biffi, Riccardo; Costa, Antonella; Sammons, Brian; Snyder, Abraham Z; Shimony, Joshua S; Triulzi, Fabio; Stocchetti, Nino; Brody, David L

2015-08-01

Axonal injury is a major contributor to adverse outcomes following brain trauma. However, the extent of axonal injury cannot currently be assessed reliably in living humans. Here, we used two experimental methods with distinct noise sources and limitations in the same cohort of 15 patients with severe traumatic brain injury to assess axonal injury. One hundred kilodalton cut-off microdialysis catheters were implanted at a median time of 17 h (13-29 h) after injury in normal appearing (on computed tomography scan) frontal white matter in all patients, and samples were collected for at least 72 h. Multiple analytes, such as the metabolic markers glucose, lactate, pyruvate, glutamate and tau and amyloid-β proteins, were measured every 1-2 h in the microdialysis samples. Diffusion tensor magnetic resonance imaging scans at 3 T were performed 2-9 weeks after injury in 11 patients. Stability of diffusion tensor imaging findings was verified by repeat scans 1-3 years later in seven patients. An additional four patients were scanned only at 1-3 years after injury. Imaging abnormalities were assessed based on comparisons with five healthy control subjects for each patient, matched by age and sex (32 controls in total). No safety concerns arose during either microdialysis or scanning. We found that acute microdialysis measurements of the axonal cytoskeletal protein tau in the brain extracellular space correlated well with diffusion tensor magnetic resonance imaging-based measurements of reduced brain white matter integrity in the 1-cm radius white matter-masked region near the microdialysis catheter insertion sites. Specifically, we found a significant inverse correlation between microdialysis measured levels of tau 13-36 h after injury and anisotropy reductions in comparison with healthy controls (Spearman's r = -0.64, P = 0.006). Anisotropy reductions near microdialysis catheter insertion sites were highly correlated with reductions in multiple additional white matter regions. We interpret this result to mean that both microdialysis and diffusion tensor magnetic resonance imaging accurately reflect the same pathophysiological process: traumatic axonal injury. This cross-validation increases confidence in both methods for the clinical assessment of axonal injury. However, neither microdialysis nor diffusion tensor magnetic resonance imaging have been validated versus post-mortem histology in humans. Furthermore, future work will be required to determine the prognostic significance of these assessments of traumatic axonal injury when combined with other clinical and radiological measures. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A model-based reconstruction for undersampled radial spin echo DTI with variational penalties on the diffusion tensor

PubMed Central

Knoll, Florian; Raya, José G; Halloran, Rafael O; Baete, Steven; Sigmund, Eric; Bammer, Roland; Block, Tobias; Otazo, Ricardo; Sodickson, Daniel K

2015-01-01

Radial spin echo diffusion imaging allows motion-robust imaging of tissues with very low T2 values like articular cartilage with high spatial resolution and signal-to-noise ratio (SNR). However, in vivo measurements are challenging due to the significantly slower data acquisition speed of spin-echo sequences and the less efficient k-space coverage of radial sampling, which raises the demand for accelerated protocols by means of undersampling. This work introduces a new reconstruction approach for undersampled DTI. A model-based reconstruction implicitly exploits redundancies in the diffusion weighted images by reducing the number of unknowns in the optimization problem and compressed sensing is performed directly in the target quantitative domain by imposing a Total Variation (TV) constraint on the elements of the diffusion tensor. Experiments were performed for an anisotropic phantom and the knee and brain of healthy volunteers (3 and 2 volunteers, respectively). Evaluation of the new approach was conducted by comparing the results to reconstructions performed with gridding, combined parallel imaging and compressed sensing, and a recently proposed model-based approach. The experiments demonstrated improvement in terms of reduction of noise and streaking artifacts in the quantitative parameter maps as well as a reduction of angular dispersion of the primary eigenvector when using the proposed method, without introducing systematic errors into the maps. This may enable an essential reduction of the acquisition time in radial spin echo diffusion tensor imaging without degrading parameter quantification and/or SNR. PMID:25594167

Quantification of diffusion tensor imaging in normal white matter maturation of early childhood using an automated processing pipeline.

PubMed

Loh, K B; Ramli, N; Tan, L K; Roziah, M; Rahmat, K; Ariffin, H

2012-07-01

The degree and status of white matter myelination can be sensitively monitored using diffusion tensor imaging (DTI). This study looks at the measurement of fractional anistropy (FA) and mean diffusivity (MD) using an automated ROI with an existing DTI atlas. Anatomical MRI and structural DTI were performed cross-sectionally on 26 normal children (newborn to 48 months old), using 1.5-T MRI. The automated processing pipeline was implemented to convert diffusion-weighted images into the NIfTI format. DTI-TK software was used to register the processed images to the ICBM DTI-81 atlas, while AFNI software was used for automated atlas-based volumes of interest (VOIs) and statistical value extraction. DTI exhibited consistent grey-white matter contrast. Triphasic temporal variation of the FA and MD values was noted, with FA increasing and MD decreasing rapidly early in the first 12 months. The second phase lasted 12-24 months during which the rate of FA and MD changes was reduced. After 24 months, the FA and MD values plateaued. DTI is a superior technique to conventional MR imaging in depicting WM maturation. The use of the automated processing pipeline provides a reliable environment for quantitative analysis of high-throughput DTI data. Diffusion tensor imaging outperforms conventional MRI in depicting white matter maturation. • DTI will become an important clinical tool for diagnosing paediatric neurological diseases. • DTI appears especially helpful for developmental abnormalities, tumours and white matter disease. • An automated processing pipeline assists quantitative analysis of high throughput DTI data.

Mesh morphing for finite element analysis of implant positioning in cementless total hip replacements.

PubMed

Bah, Mamadou T; Nair, Prasanth B; Browne, Martin

2009-12-01

Finite element (FE) analysis of the effect of implant positioning on the performance of cementless total hip replacements (THRs) requires the generation of multiple meshes to account for positioning variability. This process can be labour intensive and time consuming as CAD operations are needed each time a specific orientation is to be analysed. In the present work, a mesh morphing technique is developed to automate the model generation process. The volume mesh of a baseline femur with the implant in a nominal position is deformed as the prosthesis location is varied. A virtual deformation field, obtained by solving a linear elasticity problem with appropriate boundary conditions, is applied. The effectiveness of the technique is evaluated using two metrics: the percentages of morphed elements exceeding an aspect ratio of 20 and an angle of 165 degrees between the adjacent edges of each tetrahedron. Results show that for 100 different implant positions, the first and second metrics never exceed 3% and 3.5%, respectively. To further validate the proposed technique, FE contact analyses are conducted using three selected morphed models to predict the strain distribution in the bone and the implant micromotion under joint and muscle loading. The entire bone strain distribution is well captured and both percentages of bone volume with strain exceeding 0.7% and bone average strains are accurately computed. The results generated from the morphed mesh models correlate well with those for models generated from scratch, increasing confidence in the methodology. This morphing technique forms an accurate and efficient basis for FE based implant orientation and stability analysis of cementless hip replacements.

Germination season and watering regime, but not seed morph, affect life history traits in a cold desert diaspore-heteromorphic annual.

PubMed

Lu, Juan J; Tan, Dun Y; Baskin, Jerry M; Baskin, Carol C

2014-01-01

Seed morph, abiotic conditions and time of germination can affect plant fitness, but few studies have tested their combined effects on plasticity of plant life history traits. Thus, we tested the hypothesis that seed morph, germination season and watering regime influence phenotypic expression of post-germination life history traits in the diaspore-heteromorphic cold desert winter annual/spring ephemeral Diptychocarpus strictus. The two seed morphs were sown in watered and non-watered plots in late summer, and plants derived from them were watered or not-watered throughout the study. Seed morph did not affect phenology, growth and morphology, survival, dry mass accumulation and allocation or silique and seed production. Seeds in watered plots germinated in autumn (AW) and spring (SW) but only in spring for non-watered plots (SNW). A high percentage of AW, SW and SNW plants survived and reproduced, but flowering date and flowering period of autumn- vs. spring-germinated plants differed. Dry mass also differed with germination season/watering regime (AW > SW > SNW). Number of siliques and seeds increased with plant size (AW > SW > SNW), whereas percent dry mass allocated to reproduction was higher in small plants: SNW > SW > AW. Thus, although seed morph did not affect the expression of life history traits, germination season and watering regime significantly affected phenology, plant size and accumulation and allocation of biomass to reproduction. Flexibility throughout the life cycle of D. strictus is an adaptation to the variation in timing and amount of rainfall in its cold desert habitat.

Localization and Divergent Profiles of Estrogen Receptors and Aromatase in the Vocal and Auditory Networks of a Fish with Alternative Mating Tactics

PubMed Central

Fergus, Daniel J.; Bass, Andrew H.

2013-01-01

Estrogens play a salient role in the development and maintenance of both male and female nervous systems and behaviors. The plainfin midshipman (Porichthys notatus), a teleost fish, has two male reproductive morphs that follow alternative mating tactics and diverge in multiple somatic, hormonal and neural traits, including the central control of morph-specific vocal behaviors. After we identified duplicate estrogen receptors (ERβ1 and ERβ2) in midshipman, we developed antibodies to localize protein expression in the central vocal-acoustic networks and saccule, the auditory division of the inner ear. As in other teleost species, ERβ1 and ERβ2 were robustly expressed in the telencephalon and hypothalamus in vocal-acoustic and other brain regions shown previously to exhibit strong expression of ERα and aromatase (estrogen synthetase, CYP19) in midshipman. Like aromatase, ERβ1 label co-localized with glial fibrillary acidic protein (GFAP) in telencephalic radial glial cells. Quantitative PCR revealed similar patterns of transcript abundance across reproductive morphs for ERβ1, ERβ2, ERα and aromatase in the forebrain and saccule. In contrast, transcript abundance for ERs and aromatase varied significantly between morphs in and around the sexually polymorphic vocal motor nucleus (VMN). Together, the results suggest that VMN is the major estrogen target within the estrogen-sensitive hindbrain vocal network that directly determines the duration, frequency and amplitude of morph-specific vocalizations. Comparable regional differences in steroid receptor abundances likely regulate morph-specific behaviors in males and females of other species exhibiting alternative reproductive tactics. PMID:23460422

Using Matrix and Tensor Factorizations for the Single-Trial Analysis of Population Spike Trains.

PubMed

Onken, Arno; Liu, Jian K; Karunasekara, P P Chamanthi R; Delis, Ioannis; Gollisch, Tim; Panzeri, Stefano

2016-11-01

Advances in neuronal recording techniques are leading to ever larger numbers of simultaneously monitored neurons. This poses the important analytical challenge of how to capture compactly all sensory information that neural population codes carry in their spatial dimension (differences in stimulus tuning across neurons at different locations), in their temporal dimension (temporal neural response variations), or in their combination (temporally coordinated neural population firing). Here we investigate the utility of tensor factorizations of population spike trains along space and time. These factorizations decompose a dataset of single-trial population spike trains into spatial firing patterns (combinations of neurons firing together), temporal firing patterns (temporal activation of these groups of neurons) and trial-dependent activation coefficients (strength of recruitment of such neural patterns on each trial). We validated various factorization methods on simulated data and on populations of ganglion cells simultaneously recorded in the salamander retina. We found that single-trial tensor space-by-time decompositions provided low-dimensional data-robust representations of spike trains that capture efficiently both their spatial and temporal information about sensory stimuli. Tensor decompositions with orthogonality constraints were the most efficient in extracting sensory information, whereas non-negative tensor decompositions worked well even on non-independent and overlapping spike patterns, and retrieved informative firing patterns expressed by the same population in response to novel stimuli. Our method showed that populations of retinal ganglion cells carried information in their spike timing on the ten-milliseconds-scale about spatial details of natural images. This information could not be recovered from the spike counts of these cells. First-spike latencies carried the majority of information provided by the whole spike train about fine-scale image features, and supplied almost as much information about coarse natural image features as firing rates. Together, these results highlight the importance of spike timing, and particularly of first-spike latencies, in retinal coding.

Using Matrix and Tensor Factorizations for the Single-Trial Analysis of Population Spike Trains

PubMed Central

Onken, Arno; Liu, Jian K.; Karunasekara, P. P. Chamanthi R.; Delis, Ioannis; Gollisch, Tim; Panzeri, Stefano

2016-01-01

Advances in neuronal recording techniques are leading to ever larger numbers of simultaneously monitored neurons. This poses the important analytical challenge of how to capture compactly all sensory information that neural population codes carry in their spatial dimension (differences in stimulus tuning across neurons at different locations), in their temporal dimension (temporal neural response variations), or in their combination (temporally coordinated neural population firing). Here we investigate the utility of tensor factorizations of population spike trains along space and time. These factorizations decompose a dataset of single-trial population spike trains into spatial firing patterns (combinations of neurons firing together), temporal firing patterns (temporal activation of these groups of neurons) and trial-dependent activation coefficients (strength of recruitment of such neural patterns on each trial). We validated various factorization methods on simulated data and on populations of ganglion cells simultaneously recorded in the salamander retina. We found that single-trial tensor space-by-time decompositions provided low-dimensional data-robust representations of spike trains that capture efficiently both their spatial and temporal information about sensory stimuli. Tensor decompositions with orthogonality constraints were the most efficient in extracting sensory information, whereas non-negative tensor decompositions worked well even on non-independent and overlapping spike patterns, and retrieved informative firing patterns expressed by the same population in response to novel stimuli. Our method showed that populations of retinal ganglion cells carried information in their spike timing on the ten-milliseconds-scale about spatial details of natural images. This information could not be recovered from the spike counts of these cells. First-spike latencies carried the majority of information provided by the whole spike train about fine-scale image features, and supplied almost as much information about coarse natural image features as firing rates. Together, these results highlight the importance of spike timing, and particularly of first-spike latencies, in retinal coding. PMID:27814363

Colour polymorphic lures exploit innate preferences for spectral versus luminance cues in dipteran prey.

PubMed

White, Thomas E; Kemp, Darrell J

2017-08-14

Theory predicts that colour polymorphism may be favored by variation in the visual context under which signals are perceived. The context encompasses all environmental determinants of light availability and propagation, but also the dynamics of perception in receivers. Color vision involves the neural separation of information into spectral versus luminance channels, which often differentially guide specific tasks. Here we explicitly tested whether this discrete perceptual basis contributes to the maintenance of polymorphism in a prey-luring system. The orb-weaving spider Gasteracantha fornicata is known to attract a broad community of primarily dipteran prey due to their conspicuous banded dorsal signal. They occur in two morphs ("white" and "yellow") which should, respectively, generate greater luminance and color contrast in the dipteran eye. Given that arthropods often rely upon luminance-versus-spectral cues for relatively small-versus-large stimulus detection, we predicted a switch in relative attractiveness among morphs according to apparent spider size. Our experimental tests used colour-naïve individuals of two known prey species (Drosophila hydei and Musca domestica) in replicate Y-maze choice trials designed to manipulate the apparent size of spider models via the distance at which they are viewed. Initial trials confirmed that flies were attracted to each G. fornicata morph in single presentations. When given a simultaneous choice between morphs against a viewing background typical of those encountered in nature, flies exhibited no preference regardless of the visual angle subtended by models. However, when backgrounds were adjusted to nearer the extremes of those of each morph in the wild, flies were more attracted by white morphs when presented at longer range (consistent with a reliance on achromatic cues), yet were unbiased in their close-range choice. While not fully consistent with predictions (given the absence of a differential preference for stimuli at close range), our results demonstrate an effect of apparent stimulus size upon relative morph attractiveness in the direction anticipated from present knowledge of fly visual ecology. This implies the potential tuning of G. fornicata morph signal structure according to a perceptual feature that is likely common across their breadth of arthropod prey, and complements recent observational work in suggesting a candidate mechanism for the maintenance of deceptive polymorphism through the exploitation of different visual channels in prey.

Symmetric Positive 4th Order Tensors & Their Estimation from Diffusion Weighted MRI⋆

PubMed Central

Barmpoutis, Angelos; Jian, Bing; Vemuri, Baba C.; Shepherd, Timothy M.

2009-01-01

In Diffusion Weighted Magnetic Resonance Image (DW-MRI) processing a 2nd order tensor has been commonly used to approximate the diffusivity function at each lattice point of the DW-MRI data. It is now well known that this 2nd-order approximation fails to approximate complex local tissue structures, such as fibers crossings. In this paper we employ a 4th order symmetric positive semi-definite (PSD) tensor approximation to represent the diffusivity function and present a novel technique to estimate these tensors from the DW-MRI data guaranteeing the PSD property. There have been several published articles in literature on higher order tensor approximations of the diffusivity function but none of them guarantee the positive semi-definite constraint, which is a fundamental constraint since negative values of the diffusivity coefficients are not meaningful. In our methods, we parameterize the 4th order tensors as a sum of squares of quadratic forms by using the so called Gram matrix method from linear algebra and its relation to the Hilbert’s theorem on ternary quartics. This parametric representation is then used in a nonlinear-least squares formulation to estimate the PSD tensors of order 4 from the data. We define a metric for the higher-order tensors and employ it for regularization across the lattice. Finally, performance of this model is depicted on synthetic data as well as real DW-MRI from an isolated rat hippocampus. PMID:17633709

Differences in Gaussian diffusion tensor imaging and non-Gaussian diffusion kurtosis imaging model-based estimates of diffusion tensor invariants in the human brain.

PubMed

Lanzafame, S; Giannelli, M; Garaci, F; Floris, R; Duggento, A; Guerrisi, M; Toschi, N

2016-05-01

An increasing number of studies have aimed to compare diffusion tensor imaging (DTI)-related parameters [e.g., mean diffusivity (MD), fractional anisotropy (FA), radial diffusivity (RD), and axial diffusivity (AD)] to complementary new indexes [e.g., mean kurtosis (MK)/radial kurtosis (RK)/axial kurtosis (AK)] derived through diffusion kurtosis imaging (DKI) in terms of their discriminative potential about tissue disease-related microstructural alterations. Given that the DTI and DKI models provide conceptually and quantitatively different estimates of the diffusion tensor, which can also depend on fitting routine, the aim of this study was to investigate model- and algorithm-dependent differences in MD/FA/RD/AD and anisotropy mode (MO) estimates in diffusion-weighted imaging of human brain white matter. The authors employed (a) data collected from 33 healthy subjects (20-59 yr, F: 15, M: 18) within the Human Connectome Project (HCP) on a customized 3 T scanner, and (b) data from 34 healthy subjects (26-61 yr, F: 5, M: 29) acquired on a clinical 3 T scanner. The DTI model was fitted to b-value =0 and b-value =1000 s/mm(2) data while the DKI model was fitted to data comprising b-value =0, 1000 and 3000/2500 s/mm(2) [for dataset (a)/(b), respectively] through nonlinear and weighted linear least squares algorithms. In addition to MK/RK/AK maps, MD/FA/MO/RD/AD maps were estimated from both models and both algorithms. Using tract-based spatial statistics, the authors tested the null hypothesis of zero difference between the two MD/FA/MO/RD/AD estimates in brain white matter for both datasets and both algorithms. DKI-derived MD/FA/RD/AD and MO estimates were significantly higher and lower, respectively, than corresponding DTI-derived estimates. All voxelwise differences extended over most of the white matter skeleton. Fractional differences between the two estimates [(DKI - DTI)/DTI] of most invariants were seen to vary with the invariant value itself as well as with MK/RK/AK values, indicating substantial anatomical variability of these discrepancies. In the HCP dataset, the median voxelwise percentage differences across the whole white matter skeleton were (nonlinear least squares algorithm) 14.5% (8.2%-23.1%) for MD, 4.3% (1.4%-17.3%) for FA, -5.2% (-48.7% to -0.8%) for MO, 12.5% (6.4%-21.2%) for RD, and 16.1% (9.9%-25.6%) for AD (all ranges computed as 0.01 and 0.99 quantiles). All differences/trends were consistent between the discovery (HCP) and replication (local) datasets and between estimation algorithms. However, the relationships between such trends, estimated diffusion tensor invariants, and kurtosis estimates were impacted by the choice of fitting routine. Model-dependent differences in the estimation of conventional indexes of MD/FA/MO/RD/AD can be well beyond commonly seen disease-related alterations. While estimating diffusion tensor-derived indexes using the DKI model may be advantageous in terms of mitigating b-value dependence of diffusivity estimates, such estimates should not be referred to as conventional DTI-derived indexes in order to avoid confusion in interpretation as well as multicenter comparisons. In order to assess the potential and advantages of DKI with respect to DTI as well as to standardize diffusion-weighted imaging methods between centers, both conventional DTI-derived indexes and diffusion tensor invariants derived by fitting the non-Gaussian DKI model should be separately estimated and analyzed using the same combination of fitting routines.

White matter changes in preclinical Alzheimer's disease: a magnetic resonance imaging-diffusion tensor imaging study on cognitively normal older people with positive amyloid β protein 42 levels.

PubMed

Molinuevo, José Luis; Ripolles, Pablo; Simó, Marta; Lladó, Albert; Olives, Jaume; Balasa, Mircea; Antonell, Anna; Rodriguez-Fornells, Antoni; Rami, Lorena

2014-12-01

The aim of this study was to use diffusion tensor imaging measures to determine the existence of white matter microstructural differences in the preclinical phases of Alzheimer's disease, assessing cognitively normal older individuals with positive amyloid β protein (Aβ42) levels (CN_Aβ42+) on the basis of normal cognition and cerebrospinal fluid Aβ42 levels below 500 pg/mL. Nineteen CN_Aβ42+ and 19 subjects with Aβ42 levels above 500 pg/mL (CN_Aβ42-) were included. We encountered increases in axial diffusivity (AxD) in CN_Aβ42+ relative to CN_Aβ42- in the corpus callosum, corona radiata, internal capsule, and superior longitudinal fasciculus bilaterally, and also in the left fornix, left uncinate fasciculus, and left inferior fronto-occipital fasciculus. However, no differences were found in other diffusion tensor imaging indexes. Cognitive reserve scores were positively associated with AxD exclusively in the CN_Aβ42+ group. The finding of AxD alteration together with preserved fractional anisotropy, mean diffusivity, and radial diffusivity indexes in the CN_Aβ42+ group may indicate that, subtle axonal changes may be happening in the preclinical phases of Alzheimer's disease, whereas white matter integrity is still widely preserved. Copyright © 2014 Elsevier Inc. All rights reserved.

DWI filtering using joint information for DTI and HARDI.

PubMed

Tristán-Vega, Antonio; Aja-Fernández, Santiago

2010-04-01

The filtering of the Diffusion Weighted Images (DWI) prior to the estimation of the diffusion tensor or other fiber Orientation Distribution Functions (ODF) has been proved to be of paramount importance in the recent literature. More precisely, it has been evidenced that the estimation of the diffusion tensor without a previous filtering stage induces errors which cannot be recovered by further regularization of the tensor field. A number of approaches have been intended to overcome this problem, most of them based on the restoration of each DWI gradient image separately. In this paper we propose a methodology to take advantage of the joint information in the DWI volumes, i.e., the sum of the information given by all DWI channels plus the correlations between them. This way, all the gradient images are filtered together exploiting the first and second order information they share. We adapt this methodology to two filters, namely the Linear Minimum Mean Squared Error (LMMSE) and the Unbiased Non-Local Means (UNLM). These new filters are tested over a wide variety of synthetic and real data showing the convenience of the new approach, especially for High Angular Resolution Diffusion Imaging (HARDI). Among the techniques presented, the joint LMMSE is proved a very attractive approach, since it shows an accuracy similar to UNLM (or even better in some situations) with a much lighter computational load. Copyright 2009 Elsevier B.V. All rights reserved.

Helical structure of the cardiac ventricular anatomy assessed by diffusion tensor magnetic resonance imaging with multiresolution tractography.

PubMed

Poveda, Ferran; Gil, Debora; Martí, Enric; Andaluz, Albert; Ballester, Manel; Carreras, Francesc

2013-10-01

Deeper understanding of the myocardial structure linking the morphology and function of the heart would unravel crucial knowledge for medical and surgical clinical procedures and studies. Several conceptual models of myocardial fiber organization have been proposed but the lack of an automatic and objective methodology prevented an agreement. We sought to deepen this knowledge through advanced computer graphical representations of the myocardial fiber architecture by diffusion tensor magnetic resonance imaging. We performed automatic tractography reconstruction of unsegmented diffusion tensor magnetic resonance imaging datasets of canine heart from the public database of the Johns Hopkins University. Full-scale tractographies have been built with 200 seeds and are composed by streamlines computed on the vector field of primary eigenvectors at the diffusion tensor volumes. We also introduced a novel multiscale visualization technique in order to obtain a simplified tractography. This methodology retains the main geometric features of the fiber tracts, making it easier to decipher the main properties of the architectural organization of the heart. Output analysis of our tractographic representations showed exact correlation with low-level details of myocardial architecture, but also with the more abstract conceptualization of a continuous helical ventricular myocardial fiber array. Objective analysis of myocardial architecture by an automated method, including the entire myocardium and using several 3-dimensional levels of complexity, reveals a continuous helical myocardial fiber arrangement of both right and left ventricles, supporting the anatomical model of the helical ventricular myocardial band described by F. Torrent-Guasp. Copyright © 2013 Sociedad Española de Cardiología. Published by Elsevier Espana. All rights reserved.

Muscle changes detected with diffusion-tensor imaging after long-distance running.

PubMed

Froeling, Martijn; Oudeman, Jos; Strijkers, Gustav J; Maas, Mario; Drost, Maarten R; Nicolay, Klaas; Nederveen, Aart J

2015-02-01

To develop a protocol for diffusion-tensor imaging (DTI) of the complete upper legs and to demonstrate feasibility of detection of subclinical sports-related muscle changes in athletes after strenuous exercise, which remain undetected by using conventional T2-weighted magnetic resonance (MR) imaging with fat suppression. The research was approved by the institutional ethics committee review board, and the volunteers provided written consent before the study. Five male amateur long-distance runners underwent an MR examination (DTI, T1-weighted MR imaging, and T2-weighted MR imaging with fat suppression) of both upper legs 1 week before, 2 days after, and 3 weeks after they participated in a marathon. The tensor eigenvalues (λ1, λ2, and λ3), the mean diffusivity, and the fractional anisotropy (FA) were derived from the DTI data. Data per muscle from the three time-points were compared by using a two-way mixed-design analysis of variance with a Bonferroni posthoc test. The DTI protocol allowed imaging of both complete upper legs with adequate signal-to-noise ratio and within a 20-minute imaging time. After the marathon, T2-weighted MR imaging revealed grade 1 muscle strains in nine of the 180 investigated muscles. The three eigenvalues, mean diffusivity, and FA were significantly increased (P < .05) in the biceps femoris muscle 2 days after running. Mean diffusivity and eigenvalues λ1 and λ2 were significantly (P < .05) increased in the semitendinosus and gracilis muscles 2 days after the marathon. A feasible method for DTI measurements of the upper legs was developed that fully included frequently injured muscles, such as hamstrings, in one single imaging session. This study also revealed changes in DTI parameters that over time were not revealed by qualitative T2-weighted MR imaging with fat suppression. © RSNA, 2014.

PFC neurons reflect categorical decisions about ambiguous stimuli.

PubMed

Roy, Jefferson E; Buschman, Timothy J; Miller, Earl K

2014-06-01

We examined whether PFC neuron activity reflects categorical decisions in monkeys categorizing ambiguous stimuli. A morphing system was used to systematically vary stimulus shape and precisely define category boundaries. Ambiguous stimuli were centered on a category boundary, that is, they were a mix of 50% of two prototypes and therefore had no category information, so monkeys guessed at their category membership. We found that the monkeys' trial-by-trial decision about the category membership of an ambiguous image was reflected in PFC activity. Activity to the same ambiguous image differed significantly, depending on which category the monkey had assigned it to. This effect only occurred when that scheme was behaviorally relevant. These indicate that PFC activity reflects categorical decisions.

Eyeglasses Lens Contour Extraction from Facial Images Using an Efficient Shape Description

PubMed Central

Borza, Diana; Darabant, Adrian Sergiu; Danescu, Radu

2013-01-01

This paper presents a system that automatically extracts the position of the eyeglasses and the accurate shape and size of the frame lenses in facial images. The novelty brought by this paper consists in three key contributions. The first one is an original model for representing the shape of the eyeglasses lens, using Fourier descriptors. The second one is a method for generating the search space starting from a finite, relatively small number of representative lens shapes based on Fourier morphing. Finally, we propose an accurate lens contour extraction algorithm using a multi-stage Monte Carlo sampling technique. Multiple experiments demonstrate the effectiveness of our approach. PMID:24152926

Morphing of spatial objects in real time with interpolation by functions of radial and orthogonal basis

NASA Astrophysics Data System (ADS)

Kosnikov, Yu N.; Kuzmin, A. V.; Ho, Hoang Thai

2018-05-01

The article is devoted to visualization of spatial objects’ morphing described by the set of unordered reference points. A two-stage model construction is proposed to change object’s form in real time. The first (preliminary) stage is interpolation of the object’s surface by radial basis functions. Initial reference points are replaced by new spatially ordered ones. Reference points’ coordinates change patterns during the process of morphing are assigned. The second (real time) stage is surface reconstruction by blending functions of orthogonal basis. Finite differences formulas are applied to increase the productivity of calculations.

Mechanical properties of shape memory polymers for morphing aircraft applications

NASA Astrophysics Data System (ADS)

Keihl, Michelle M.; Bortolin, Robert S.; Sanders, Brian; Joshi, Shiv; Tidwell, Zeb

2005-05-01

This investigation addresses basic characterization of a shape memory polymer (SMP) as a suitable structural material for morphing aircraft applications. Tests were performed for monotonic loading in high shear at constant temperature, well below, or just above the glass transition temperature. The SMP properties were time-and temperature-dependent. Recovery by the SMP to its original shape needed to be unfettered. Based on the testing SMPs appear to be an attractive and promising component in the solution for a skin material of a morphing aircraft. Their multiple state abilities allow them to easily change shape and, once cooled, resist large loads.

Monitoring the bending and twist of morphing structures

NASA Astrophysics Data System (ADS)

Smoker, J.; Baz, A.

2008-03-01

This paper presents the development of the theoretical basis for the design of sensor networks for determining the 2-dimensioal shape of morphing structures by monitoring simultaneously the bending and twist deflections. The proposed development is based on the non-linear theory of finite elements to extract the transverse linear and angular deflections of a plate-like structure. The sensors outputs are wirelessly transmitted to the command unit to simultaneously compute maps of the linear and angular deflections and maps of the strain distribution of the entire structure. The deflection and shape information are required to ascertain that the structure is properly deployed and that its surfaces are operating wrinkle-free. The strain map ensures that the structure is not loaded excessively to adversely affect its service life. The developed theoretical model is validated experimentally using a prototype of a variable cambered span morphing structure provided with a network of distributed sensors. The structure/sensor network system is tested under various static conditions to determine the response characteristics of the proposed sensor network as compared to other conventional sensor systems. The presented theoretical and experimental techniques can have a great impact on the safe deployment and effective operation of a wide variety of morphing and inflatable structures such as morphing aircraft, solar sails, inflatable wings, and large antennas.

The melanocortin system regulates body pigmentation and social behaviour in a colour polymorphic cichlid fish†

PubMed Central

Maguire, Sean M.; Harris, Rayna M.; Rodriguez, Agosto A.; DeAngelis, Ross S.; Flores, Stephanie A.; Hofmann, Hans A.

2017-01-01

The melanocortin system is a neuroendocrine system that regulates a range of physiological and behavioural processes. We examined the extent to which the melanocortin system simultaneously regulates colour and behaviour in the cichlid fish Astatotilapia burtoni. We found that yellow males are more aggressive than blue males, in line with previous studies. We then found that exogenous α-melanocyte-stimulating hormone (α-MSH) increases yellowness of the body and dispersal of xanthophore pigments in both morphs. However, α-MSH had a morph-specific effect on aggression, with only blue males showing an increase in the rate of aggression. Exogenous agouti signalling peptide (ASIP), a melanocortin antagonist, did not affect coloration but reduced the rate of aggression in both colour morphs. Blue males had higher cortisol levels than yellow males. Neural gene expression of melanocortin receptors (mcr) and ligands was not differentially regulated between colour morphs. In the skin, however, mc1r and pro-opiomelanocortin (pomc) β were upregulated in blue males, while asip 1 was upregulated in yellow males. The effects of α-MSH on behaviour and body coloration, combined with morph-specific regulation of the stress response and the melanocortin system, suggest that the melanocortin system contributes to the polymorphism in behaviour and coloration in A. burtoni. PMID:28356453

A genetic approach to the rock-paper-scissors game.

PubMed

Barreto, Wendell P; Marquitti, Flavia M D; de Aguiar, Marcus A M

2017-05-21

Polymorphisms are usually associated with defenses and mating strategies, affecting the individual's fitness. Coexistence of different morphs is, therefore, not expected, since the fittest morph should outcompete the others. Nevertheless, coexistence is observed in many natural systems. For instance, males of the side-blotched lizards (Uta stansburiana) present three morphs with throat colors orange, yellow and blue, which are associated with mating strategies and territorial behavior. The three male morphs compete for females in a system that is well described by the rock-paper-scissors dynamics of game theory. Previous studies have modeled the lizards as hermaphroditic populations whose individual's behavior were determined only by their phenotypes. Here we consider an extension of this dynamical system where diploidy and sexual reproduction are explicitly taken into account. Similarly to the lizards we represent the genetic system by a single locus with three alleles, o, y, and b in a diploid chromosome with dominance of o over y and of y over b. We show that this genotypic description of the dynamics results in the same equilibrium phenotype frequencies as the phenotypic models, but affects the stability of the system, changing the parameter region where coexistence of the three morphs is possible in a rock-paper-scissors game. Copyright © 2017 Elsevier Ltd. All rights reserved.

Design and Fabrication of a Composite Morphing Radiator Panel Using High Conductivity Fibers

NASA Technical Reports Server (NTRS)

Wescott, Matthew T.; McQuien, J. Scott; Bertagne, Christopher L.; Whitcomb, John D.; Hart, Darren J.; Erickson, Lisa R.

2017-01-01

Upcoming crewed space missions will involve large internal and external heat loads and require advanced thermal control systems to maintain a desired internal environment temperature. Radiators with at least 12:1 turndown ratios (the ratio between the maximum and minimum heat rejection rates) will be needed. However, current technologies are only able to achieve turndown ratios of approximately 3:1. A morphing radiator capable of altering shape could significantly increase turndown capabilities. Shape memory alloys offer qualities that may be well suited for this endeavor; their temperature-dependent phase changes could offer radiators the ability to passively control heat rejection. In 2015, a morphing radiator prototype was constructed and tested in a thermal vacuum environment, where it successfully demonstrated the morphing behavior and variable heat rejection. Newer composite prototypes have since been designed and manufactured using two distinct types of SMA materials. These models underwent temperature cycling tests in a thermal vacuum chamber and a series of fatigue tests to characterize the lifespan of these designs. The focus of this paper is to present the design approach and testing of the morphing composite facesheet. The discussion includes: an overall description of the project background, definition of performance requirements, composite materials selection, use of analytic and numerical design tools, facesheet fabrication, and finally fatigue testing with accompanying results.

Tensor-Dictionary Learning with Deep Kruskal-Factor Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stevens, Andrew J.; Pu, Yunchen; Sun, Yannan

We introduce new dictionary learning methods for tensor-variate data of any order. We represent each data item as a sum of Kruskal decomposed dictionary atoms within the framework of beta-process factor analysis (BPFA). Our model is nonparametric and can infer the tensor-rank of each dictionary atom. This Kruskal-Factor Analysis (KFA) is a natural generalization of BPFA. We also extend KFA to a deep convolutional setting and develop online learning methods. We test our approach on image processing and classification tasks achieving state of the art results for 2D & 3D inpainting and Caltech 101. The experiments also show that atom-rankmore » impacts both overcompleteness and sparsity.« less

Full-Wave Tomographic and Moment Tensor Inversion Based on 3D Multigrid Strain Green’s Tensor Databases

DTIC Science & Technology

2014-04-30

grade metamorphic rocks on the southern slope of the Himalaya is imaged as a band of high velocity anomaly...velocity structures closely follow the geological features. As an indication of resolution, the ductile extrusion of high-grade metamorphic rocks on...MATERIEL COMMAND KIRTLAND AIR FORCE BASE, NM 87117-5776 DTIC COPY NOTICE AND SIGNATURE PAGE Using Government drawings, specifications, or other data

Image Based Synthesis for Airborne Minefield Data

DTIC Science & Technology

2005-12-01

Jia, and C-K. Tang, "Image repairing: robust image synthesis by adaptive ND tensor voting ", Proceedings of the IEEE, Computer Society Conference on...utility is capable to synthesize a single frame data as well as list of frames along a flight path. The application is developed in MATLAB -6.5 using the

T1, diffusion tensor, and quantitative magnetization transfer imaging of the hippocampus in an Alzheimer's disease mouse model.

PubMed

Whittaker, Heather T; Zhu, Shenghua; Di Curzio, Domenico L; Buist, Richard; Li, Xin-Min; Noy, Suzanna; Wiseman, Frances K; Thiessen, Jonathan D; Martin, Melanie

2018-07-01

Alzheimer's disease (AD) pathology causes microstructural changes in the brain. These changes, if quantified with magnetic resonance imaging (MRI), could be studied for use as an early biomarker for AD. The aim of our study was to determine if T 1 relaxation, diffusion tensor imaging (DTI), and quantitative magnetization transfer imaging (qMTI) metrics could reveal changes within the hippocampus and surrounding white matter structures in ex vivo transgenic mouse brains overexpressing human amyloid precursor protein with the Swedish mutation. Delineation of hippocampal cell layers using DTI color maps allows more detailed analysis of T 1 -weighted imaging, DTI, and qMTI metrics, compared with segmentation of gross anatomy based on relaxation images, and with analysis of DTI or qMTI metrics alone. These alterations are observed in the absence of robust intracellular Aβ accumulation or plaque deposition as revealed by histology. This work demonstrates that multiparametric quantitative MRI methods are useful for characterizing changes within the hippocampal substructures and surrounding white matter tracts of mouse models of AD. Copyright © 2018. Published by Elsevier Inc.

Centroid-moment tensor solutions for January-March, 2000

NASA Astrophysics Data System (ADS)

Dziewonski, A. M.; Ekström, G.; Maternovskaya, N. N.

2000-10-01

Centroid-moment tensor solutions are presented for 250 earthquakes that occurred during the first quarter of 2000. The solutions are obtained using corrections for aspherical earth structure represented by a whole mantle shear velocity model SH8/U4L8 of Dziewonski and Woodward [Dziewonski, A.M., Woodward, R.L., 1992. Acoustic imaging at the planetary scale. In: Emert, H., Harjes, H.-P. (Eds.), Acoustical Imaging. Plenum Press, Reading MA, Vol. 19, pp. 785-797]. A model of an elastic attenuation of Durek and Ekström [Durek, J.J., Ekström, G., 1996. Bull. Seism. Soc. Am. 86, 144-158] is used to predict the decay of the waveforms.

Correlations of diffusion tensor imaging values and symptom scores in patients with schizophrenia.

PubMed

Michael, Andrew M; Calhoun, Vince D; Pearlson, Godfrey D; Baum, Stefi A; Caprihan, Arvind

2008-01-01

Abnormalities in white matter (WM) brain regions are attributed as a possible biomarker for schizophrenia (SZ). Diffusion tensor imaging (DTI) is used to capture WM tracts. Psychometric tests that evaluate the severity of symptoms of SZ are clinically used in the diagnosis process. In this study we investigate the correlates of scalar DTI measures, such as fractional anisotropy, mean diffusivity, axial diffusivity, and radial diffusivity with behavioral test scores. The correlations were found by different schemes: mean correlation with WM atlas regions and multiple regression of DTI values with test scores. The corpus callosum, superior longitudinal fasciculus right and inferior longitudinal fasciculus left were found to be having high correlations with test scores.

Advanced Pediatric Brain Imaging Research and Training Program

DTIC Science & Technology

2013-10-01

diffusion tensor imaging and perfusion ( arterial spin labeling) MRI data and to relate measures of global and regional brain microstructural organization...AD_________________ Award Number: W81XWH-11-2-0198 TITLE: Advanced Pediatric Brain Imaging...September 2013 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Advanced Pediatric Brain Imaging Research and Training Program 5b. GRANT NUMBER W81XWH

Bio-image warehouse system: concept and implementation of a diagnosis-based data warehouse for advanced imaging modalities in neuroradiology.

PubMed

Minati, L; Ghielmetti, F; Ciobanu, V; D'Incerti, L; Maccagnano, C; Bizzi, A; Bruzzone, M G

2007-03-01

Advanced neuroimaging techniques, such as functional magnetic resonance imaging (fMRI), chemical shift spectroscopy imaging (CSI), diffusion tensor imaging (DTI), and perfusion-weighted imaging (PWI) create novel challenges in terms of data storage and management: huge amounts of raw data are generated, the results of analysis may depend on the software and settings that have been used, and most often intermediate files are inherently not compliant with the current DICOM (digital imaging and communication in medicine) standard, as they contain multidimensional complex and tensor arrays and various other types of data structures. A software architecture, referred to as Bio-Image Warehouse System (BIWS), which can be used alongside a radiology information system/picture archiving and communication system (RIS/PACS) system to store neuroimaging data for research purposes, is presented. The system architecture is conceived with the purpose of enabling to query by diagnosis according to a predefined two-layered classification taxonomy. The operational impact of the system and the time needed to get acquainted with the web-based interface and with the taxonomy are found to be limited. The development of modules enabling automated creation of statistical templates is proposed.

Susceptibility-Weighted Imaging and Quantitative Susceptibility Mapping in the Brain

PubMed Central

Liu, Chunlei; Li, Wei; Tong, Karen A.; Yeom, Kristen W.; Kuzminski, Samuel

2015-01-01

Susceptibility-weighted imaging (SWI) is a magnetic resonance imaging (MRI) technique that enhances image contrast by using the susceptibility differences between tissues. It is created by combining both magnitude and phase in the gradient echo data. SWI is sensitive to both paramagnetic and diamagnetic substances which generate different phase shift in MRI data. SWI images can be displayed as a minimum intensity projection that provides high resolution delineation of the cerebral venous architecture, a feature that is not available in other MRI techniques. As such, SWI has been widely applied to diagnose various venous abnormalities. SWI is especially sensitive to deoxygenated blood and intracranial mineral deposition and, for that reason, has been applied to image various pathologies including intracranial hemorrhage, traumatic brain injury, stroke, neoplasm, and multiple sclerosis. SWI, however, does not provide quantitative measures of magnetic susceptibility. This limitation is currently being addressed with the development of quantitative susceptibility mapping (QSM) and susceptibility tensor imaging (STI). While QSM treats susceptibility as isotropic, STI treats susceptibility as generally anisotropic characterized by a tensor quantity. This article reviews the basic principles of SWI, its clinical and research applications, the mechanisms governing brain susceptibility properties, and its practical implementation, with a focus on brain imaging. PMID:25270052

Quantifying facial expression signal and intensity use during development.

PubMed

Rodger, Helen; Lao, Junpeng; Caldara, Roberto

2018-06-12

Behavioral studies investigating facial expression recognition during development have applied various methods to establish by which age emotional expressions can be recognized. Most commonly, these methods employ static images of expressions at their highest intensity (apex) or morphed expressions of different intensities, but they have not previously been compared. Our aim was to (a) quantify the intensity and signal use for recognition of six emotional expressions from early childhood to adulthood and (b) compare both measures and assess their functional relationship to better understand the use of different measures across development. Using a psychophysical approach, we isolated the quantity of signal necessary to recognize an emotional expression at full intensity and the quantity of expression intensity (using neutral expression image morphs of varying intensities) necessary for each observer to recognize the six basic emotions while maintaining performance at 75%. Both measures revealed that fear and happiness were the most difficult and easiest expressions to recognize across age groups, respectively, a pattern already stable during early childhood. The quantity of signal and intensity needed to recognize sad, angry, disgust, and surprise expressions decreased with age. Using a Bayesian update procedure, we then reconstructed the response profiles for both measures. This analysis revealed that intensity and signal processing are similar only during adulthood and, therefore, cannot be straightforwardly compared during development. Altogether, our findings offer novel methodological and theoretical insights and tools for the investigation of the developing affective system. Copyright © 2018 Elsevier Inc. All rights reserved.

Automatic construction of patient-specific finite-element mesh of the spine from IVDs and vertebra segmentations

NASA Astrophysics Data System (ADS)

Castro-Mateos, Isaac; Pozo, Jose M.; Lazary, Aron; Frangi, Alejandro F.

2016-03-01

Computational medicine aims at developing patient-specific models to help physicians in the diagnosis and treatment selection for patients. The spine, and other skeletal structures, is an articulated object, composed of rigid bones (vertebrae) and non-rigid parts (intervertebral discs (IVD), ligaments and muscles). These components are usually extracted from different image modalities, involving patient repositioning. In the case of the spine, these models require the segmentation of IVDs from MR and vertebrae from CT. In the literature, there exists a vast selection of segmentations methods, but there is a lack of approaches to align the vertebrae and IVDs. This paper presents a method to create patient-specific finite element meshes for biomechanical simulations, integrating rigid and non-rigid parts of articulated objects. First, the different parts are aligned in a complete surface model. Vertebrae extracted from CT are rigidly repositioned in between the IVDs, initially using the IVDs location and then refining the alignment using the MR image with a rigid active shape model algorithm. Finally, a mesh morphing algorithm, based on B-splines, is employed to map a template finite-element (volumetric) mesh to the patient-specific surface mesh. This morphing reduces possible misalignments and guarantees the convexity of the model elements. Results show that the accuracy of the method to align vertebrae into MR, together with IVDs, is similar to that of the human observers. Thus, this method is a step forward towards the automation of patient-specific finite element models for biomechanical simulations.

Task-irrelevant emotion facilitates face discrimination learning.

PubMed

Lorenzino, Martina; Caudek, Corrado

2015-03-01

We understand poorly how the ability to discriminate faces from one another is shaped by visual experience. The purpose of the present study is to determine whether face discrimination learning can be facilitated by facial emotions. To answer this question, we used a task-irrelevant perceptual learning paradigm because it closely mimics the learning processes that, in daily life, occur without a conscious intention to learn and without an attentional focus on specific facial features. We measured face discrimination thresholds before and after training. During the training phase (4 days), participants performed a contrast discrimination task on face images. They were not informed that we introduced (task-irrelevant) subtle variations in the face images from trial to trial. For the Identity group, the task-irrelevant features were variations along a morphing continuum of facial identity. For the Emotion group, the task-irrelevant features were variations along an emotional expression morphing continuum. The Control group did not undergo contrast discrimination learning and only performed the pre-training and post-training tests, with the same temporal gap between them as the other two groups. Results indicate that face discrimination improved, but only for the Emotion group. Participants in the Emotion group, moreover, showed face discrimination improvements also for stimulus variations along the facial identity dimension, even if these (task-irrelevant) stimulus features had not been presented during training. The present results highlight the importance of emotions for face discrimination learning. Copyright © 2015 Elsevier Ltd. All rights reserved.

Life-history evolution and the microevolution of intermediary metabolism: activities of lipid-metabolizing enzymes in life-history morphs of a wing-dimorphic cricket.

PubMed

Zera, Anthony J; Zhao, Zhangwu

2003-03-01

Although a considerable amount of information is available on the ecology, genetics, and physiology of life-history traits, much more limited data are available on the biochemical and genetic correlates of life-history variation within species. Specific activities of five enzymes of lipid biosynthesis and two enzymes of amino acid catabolism were compared among lines selected for flight-capable (LW[f]) versus flightless (SW) morphs of the cricket Gryllus firmus. These morphs, which exist in natural populations, differ genetically in ovarian growth (100-400% higher in SW) and aspects of flight capability including the size of wings and flight muscles, and the concentration of triglyceride flight fuel (40% greater in LW[f]). Consistently higher activity of each enzyme in LW(f) versus SW-selected lines, and strong co-segregation between morph and enzyme activity, demonstrated genetically based co-variance between wing morph and enzyme activity. Developmental profiles of enzyme activities strongly paralleled profiles of triglyceride accumulation during adulthood and previous measures of in vivo lipid biosynthesis. These data strongly imply that genetically based elevation in activities of lipogenic enzymes, and enzymes controlling the conversion of amino acids into lipids, is an important cause underlying the elevated accumulation of triglyceride in the LW(f) morph, a key biochemical component of the trade-off between elevated early fecundity and flight capability. Global changes in lipid and amino-acid metabolism appear to have resulted from microevolutionary alteration of regulators of metabolism. Finally, strong genotype x environment (diet) interactions were observed for most enzyme activities. Future progress in understanding the functional causes of life-history evolution requires a more detailed synthesis of the fields of life-history evolution and metabolic biochemistry. Wing polymorphism is a powerful experimental model in such integrative studies.

Balancing selection maintains cryptic colour morphs.

PubMed

Wellenreuther, Maren

2017-11-01

Animals display incredibly diverse colour patterns, a testament to evolution's endless innovation in shaping life. In many species, the interplay between males and females in the pursuit of mates has driven the evolution of a myriad of colour forms, from the flashy peacock tail feathers to the tiniest colour markings in damselflies. In others, colour provides crypsis by allowing to blend into the background and to escape the eyes of predators. While the obvious benefits of this dazzling diversity for reproduction and survival seem straightforward, its maintenance is not. Theory predicts that genetic drift and various forms of selection reduce variation over time, making the persistence of colour variants over generations a puzzle. In this issue of Molecular Ecology, Lindtke et al. () study the cryptic colour morphs of Timema cristinae walking sticks to shed light on the genetic architecture and mechanisms that allow colour polymorphism maintenance over long timescales. By combining genome-wide data with phenotyping information from natural populations, they were able to map the green and melanistic colour to one genomic region with highly reduced effective recombination rate between two main chromosomal variants, consistent with an inversion polymorphism. These two main chromosomal variants showed geographically widespread heterozygote excess, and genomic signatures consistent with long-term balancing selection. A younger chromosomal variant was detected for the third morph, the green-striped colour morphs, in the same genomic regions as the melanistic and the green-unstriped morphs. Together, these results suggest that the genetic architecture of cryptic T. cristinae morphs is caused by nonrecombining genomic blocks that have been maintained over extended time periods by balancing selection making this study one of the few available empirical examples documenting that balancing selection of various forms may play an important role in maintaining adaptive genetic variation in nature. © 2017 John Wiley & Sons Ltd.

Genetic mapping of the female mimic morph locus in the ruff

PubMed Central

2013-01-01

Background Ruffs (Aves: Philomachus pugnax) possess a genetic polymorphism for male mating behaviour resulting in three permanent alternative male reproductive morphs: (i) territorial ‘Independents’, (ii) non-territorial ‘Satellites’, and (iii) female-mimicking ‘Faeders’. Development into independent or satellite morphs has previously been shown to be due to a single-locus, two-allele autosomal Mendelian mode of inheritance at the Satellite locus. Here, we use linkage analysis to map the chromosomal location of the Faeder locus, which controls development into the Faeder morph, and draw further conclusions about candidate genes, assuming shared synteny with other birds. Results Segregation data on the Faeder locus were obtained from captive-bred pedigrees comprising 64 multi-generation families (N = 381). There was no evidence that the Faeder locus was linked to the Satellite locus, but it was linked with microsatellite marker Ppu020. Comparative mapping of ruff microsatellite markers against the chicken (Gallus gallus) and zebra finch (Taeniopygia guttata) genomes places the Ppu020 and Faeder loci on a region of chromosome 11 that includes the Melanocortin-1 receptor (MC1R) gene, which regulates colour polymorphisms in numerous birds and other vertebrates. Melanin-based colouration varies with life-history strategies in ruffs and other species, thus the MC1R gene is a strong candidate to play a role in alternative male morph determination. Conclusion Two unlinked loci appear to control behavioural development in ruffs. The Faeder locus is linked to Ppu020, which, assuming synteny, is located on avian chromosome 11. MC1R is a candidate gene involved in alternative male morph determination in ruffs. PMID:24256185

An allelic series at pax7a is associated with colour polymorphism diversity in Lake Malawi cichlid fish.

PubMed

Roberts, Reade B; Moore, Emily C; Kocher, Thomas D

2017-05-01

Despite long-standing interest in the evolution and maintenance of discrete phenotypic polymorphisms, the molecular genetic basis of such polymorphism in the wild is largely unknown. Female sex-associated blotched colour polymorphisms found in cichlids of Lake Malawi, East Africa, represent a highly successful polymorphic phenotype, found and maintained in four genera across the geographic expanse of the lake. Previously, we identified an association with an allelic variant of the paired-box transcription factor gene pax7a and blotched colour morphs in Lake Malawi cichlid fishes. Although a diverse range of blotched phenotypes are present in Lake Malawi cichlid species, they all appeared to result from an allele of pax7a that produces increased levels of transcript. Here, we examine the developmental and genetic basis of variation among blotched morphs. First, we confirm that pax7a-associated blotch morphs result primarily from modulation of melanophore development and survival. From laboratory crosses and natural population studies, we identify at least three alleles of pax7a associated with discrete subtypes of blotched morphs, in addition to the ancestral pax7a allele. Genotypes at pax7a support initial evolution of a novel pax7a allele to produce the blotched class of morphs, followed by subsequent evolution of that pax7a blotched allele to produce additional alleles associated with discrete colour morphs. Variant alleles of pax7a produce different levels of pax7a transcript, correlating with pigmentation phenotype at the cellular level. This naturally selected allelic series should serve as a case study for understanding the molecular genetic control of pax7a expression and the evolution of sex-associated alleles. © 2016 John Wiley & Sons Ltd.

Weighted Mean of Signal Intensity for Unbiased Fiber Tracking of Skeletal Muscles: Development of a New Method and Comparison With Other Correction Techniques.

PubMed

Giraudo, Chiara; Motyka, Stanislav; Weber, Michael; Resinger, Christoph; Thorsten, Feiweier; Traxler, Hannes; Trattnig, Siegfried; Bogner, Wolfgang

2017-08-01

The aim of this study was to investigate the origin of random image artifacts in stimulated echo acquisition mode diffusion tensor imaging (STEAM-DTI), assess the role of averaging, develop an automated artifact postprocessing correction method using weighted mean of signal intensities (WMSIs), and compare it with other correction techniques. Institutional review board approval and written informed consent were obtained. The right calf and thigh of 10 volunteers were scanned on a 3 T magnetic resonance imaging scanner using a STEAM-DTI sequence.Artifacts (ie, signal loss) in STEAM-based DTI, presumably caused by involuntary muscle contractions, were investigated in volunteers and ex vivo (ie, human cadaver calf and turkey leg using the same DTI parameters as for the volunteers). An automated postprocessing artifact correction method based on the WMSI was developed and compared with previous approaches (ie, iteratively reweighted linear least squares and informed robust estimation of tensors by outlier rejection [iRESTORE]). Diffusion tensor imaging and fiber tracking metrics, using different averages and artifact corrections, were compared for region of interest- and mask-based analyses. One-way repeated measures analysis of variance with Greenhouse-Geisser correction and Bonferroni post hoc tests were used to evaluate differences among all tested conditions. Qualitative assessment (ie, images quality) for native and corrected images was performed using the paired t test. Randomly localized and shaped artifacts affected all volunteer data sets. Artifact burden during voluntary muscle contractions increased on average from 23.1% to 77.5% but were absent ex vivo. Diffusion tensor imaging metrics (mean diffusivity, fractional anisotropy, radial diffusivity, and axial diffusivity) had a heterogeneous behavior, but in the range reported by literature. Fiber track metrics (number, length, and volume) significantly improved in both calves and thighs after artifact correction in region of interest- and mask-based analyses (P < 0.05 each). Iteratively reweighted linear least squares and iRESTORE showed equivalent results, but WMSI was faster than iRESTORE. Muscle delineation and artifact load significantly improved after correction (P < 0.05 each). Weighted mean of signal intensity correction significantly improved STEAM-based quantitative DTI analyses and fiber tracking of lower-limb muscles, providing a robust tool for musculoskeletal applications.

Taste bud development and patterning in sighted and blind morphs of Astyanax mexicanus.

PubMed

Varatharasan, Nirupa; Croll, Roger P; Franz-Odendaal, Tamara

2009-12-01

In the blind cave-dwelling morph of A. mexicanus, the eye degenerates while other sensory systems, such as gustation, are expanded compared to their sighted (surface-dwelling) ancestor. This study compares the development of taste buds along the jaws of each morph. To determine whether cavefish have an altered onset or rate of taste bud development, we fluorescently labeled basal and receptor cells within taste buds over a developmental series. Our results show that taste bud number increases during development in both morphs. The rate of development is, however, accelerated in cavefish; a small difference in taste bud number exists at 5 dpf reaching threefold by 22 dpf. The expansion of taste buds in cavefish is, therefore, detectable after the onset of eye degeneration. This study provides important insights into the timing of taste bud expansion in cavefish as well as enhances our understanding of taste bud development in teleosts in general. (c) 2009 Wiley-Liss, Inc.

Diffusion tensor imaging of cingulum bundle and corpus callosum in schizophrenia vs. bipolar disorder.

PubMed

Nenadić, Igor; Hoof, Anna; Dietzek, Maren; Langbein, Kerstin; Reichenbach, Jürgen R; Sauer, Heinrich; Güllmar, Daniel

2017-08-30

Both schizophrenia and bipolar disorder show abnormalities of white matter, as seen in diffusion tensor imaging (DTI) analyses of major brain fibre bundles. While studies in each of the two conditions have indicated possible overlap in anatomical location, there are few direct comparisons between the disorders. Also, it is unclear whether phenotypically similar subgroups (e.g. patients with bipolar disorder and psychotic features) might share white matter pathologies or be rather similar. Using region-of-interest (ROI) analysis of white matter with diffusion tensor imaging (DTI) at 3 T, we analysed fractional anisotropy (FA), radial diffusivity (RD), and apparent diffusion coefficient (ADC) of the corpus callosum and cingulum bundle in 33 schizophrenia patients, 17 euthymic (previously psychotic) bipolar disorder patients, and 36 healthy controls. ANOVA analysis showed significant main effects of group for RD and ADC (both elevated in schizophrenia). Across the corpus callosum ROIs, there was not group effect on FA, but for RD (elevated in schizophrenia, lower in bipolar disorder) and ADC (higher in schizophrenia, intermediate in bipolar disorder). Our findings show similarities and difference (some gradual) across regions of the two major fibre tracts implicated in these disorders, which would be consistent with a neurobiological overlap of similar clinical phenotypes. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Motor programme activating therapy influences adaptive brain functions in multiple sclerosis: clinical and MRI study.

PubMed

Rasova, Kamila; Prochazkova, Marie; Tintera, Jaroslav; Ibrahim, Ibrahim; Zimova, Denisa; Stetkarova, Ivana

2015-03-01

There is still little scientific evidence for the efficacy of neurofacilitation approaches and their possible influence on brain plasticity and adaptability. In this study, the outcome of a new kind of neurofacilitation approach, motor programme activating therapy (MPAT), was evaluated on the basis of a set of clinical functions and with MRI. Eighteen patients were examined four times with standardized clinical tests and diffusion tensor imaging to monitor changes without therapy, immediately after therapy and 1 month after therapy. Moreover, the strength of effective connectivity was analysed before and after therapy. Patients underwent a 1-h session of MPAT twice a week for 2 months. The data were analysed by nonparametric tests of association and were subsequently statistically evaluated. The therapy led to significant improvement in clinical functions, significant increment of fractional anisotropy and significant decrement of mean diffusivity, and decrement of effective connectivity at supplementary motor areas was observed immediately after the therapy. Changes in clinical functions and diffusion tensor images persisted 1 month after completing the programme. No statistically significant changes in clinical functions and no differences in MRI-diffusion tensor images were observed without physiotherapy. Positive immediate and long-term effects of MPAT on clinical and brain functions, as well as brain microstructure, were confirmed.

Topology synthesis and size optimization of morphing wing structures

NASA Astrophysics Data System (ADS)

Inoyama, Daisaku

This research demonstrates a novel topology and size optimization methodology for synthesis of distributed actuation systems with specific applications to morphing air vehicle structures. The main emphasis is placed on the topology and size optimization problem formulations and the development of computational modeling concepts. The analysis model is developed to meet several important criteria: It must allow a rigid-body displacement, as well as a variation in planform area, with minimum strain on structural members while retaining acceptable numerical stability for finite element analysis. Topology optimization is performed on a semi-ground structure with design variables that control the system configuration. In effect, the optimization process assigns morphing members as "soft" elements, non-morphing load-bearing members as "stiff' elements, and non-existent members as "voids." The optimization process also determines the optimum actuator placement, where each actuator is represented computationally by equal and opposite nodal forces with soft axial stiffness. In addition, the configuration of attachments that connect the morphing structure to a non-morphing structure is determined simultaneously. Several different optimization problem formulations are investigated to understand their potential benefits in solution quality, as well as meaningfulness of the formulations. Extensions and enhancements to the initial concept and problem formulations are made to accommodate multiple-configuration definitions. In addition, the principal issues on the external-load dependency and the reversibility of a design, as well as the appropriate selection of a reference configuration, are addressed in the research. The methodology to control actuator distributions and concentrations is also discussed. Finally, the strategy to transfer the topology solution to the sizing optimization is developed and cross-sectional areas of existent structural members are optimized under applied aerodynamic loads. That is, the optimization process is implemented in sequential order: The actuation system layout is first determined through multi-disciplinary topology optimization process, and then the thickness or cross-sectional area of each existent member is optimized under given constraints and boundary conditions. Sample problems are solved to demonstrate the potential capabilities of the presented methodology. The research demonstrates an innovative structural design procedure from a computational perspective and opens new insights into the potential design requirements and characteristics of morphing structures.

Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

PubMed

Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

2014-01-01

Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

Robust photometric invariant features from the color tensor.

PubMed

van de Weijer, Joost; Gevers, Theo; Smeulders, Arnold W M

2006-01-01

Luminance-based features are widely used as low-level input for computer vision applications, even when color data is available. The extension of feature detection to the color domain prevents information loss due to isoluminance and allows us to exploit the photometric information. To fully exploit the extra information in the color data, the vector nature of color data has to be taken into account and a sound framework is needed to combine feature and photometric invariance theory. In this paper, we focus on the structure tensor, or color tensor, which adequately handles the vector nature of color images. Further, we combine the features based on the color tensor with photometric invariant derivatives to arrive at photometric invariant features. We circumvent the drawback of unstable photometric invariants by deriving an uncertainty measure to accompany the photometric invariant derivatives. The uncertainty is incorporated in the color tensor, hereby allowing the computation of robust photometric invariant features. The combination of the photometric invariance theory and tensor-based features allows for detection of a variety of features such as photometric invariant edges, corners, optical flow, and curvature. The proposed features are tested for noise characteristics and robustness to photometric changes. Experiments show that the proposed features are robust to scene incidental events and that the proposed uncertainty measure improves the applicability of full invariants.

A decision tree for differentiating multiple system atrophy from Parkinson's disease using 3-T MR imaging.

PubMed

Nair, Shalini Rajandran; Tan, Li Kuo; Mohd Ramli, Norlisah; Lim, Shen Yang; Rahmat, Kartini; Mohd Nor, Hazman

2013-06-01

To develop a decision tree based on standard magnetic resonance imaging (MRI) and diffusion tensor imaging to differentiate multiple system atrophy (MSA) from Parkinson's disease (PD). 3-T brain MRI and DTI (diffusion tensor imaging) were performed on 26 PD and 13 MSA patients. Regions of interest (ROIs) were the putamen, substantia nigra, pons, middle cerebellar peduncles (MCP) and cerebellum. Linear, volumetry and DTI (fractional anisotropy and mean diffusivity) were measured. A three-node decision tree was formulated, with design goals being 100 % specificity at node 1, 100 % sensitivity at node 2 and highest combined sensitivity and specificity at node 3. Nine parameters (mean width, fractional anisotropy (FA) and mean diffusivity (MD) of MCP; anteroposterior diameter of pons; cerebellar FA and volume; pons and mean putamen volume; mean FA substantia nigra compacta-rostral) showed statistically significant (P < 0.05) differences between MSA and PD with mean MCP width, anteroposterior diameter of pons and mean FA MCP chosen for the decision tree. Threshold values were 14.6 mm, 21.8 mm and 0.55, respectively. Overall performance of the decision tree was 92 % sensitivity, 96 % specificity, 92 % PPV and 96 % NPV. Twelve out of 13 MSA patients were accurately classified. Formation of the decision tree using these parameters was both descriptive and predictive in differentiating between MSA and PD. • Parkinson's disease and multiple system atrophy can be distinguished on MR imaging. • Combined conventional MRI and diffusion tensor imaging improves the accuracy of diagnosis. • A decision tree is descriptive and predictive in differentiating between clinical entities. • A decision tree can reliably differentiate Parkinson's disease from multiple system atrophy.

Spin echo versus stimulated echo diffusion tensor imaging of the in vivo human heart

PubMed Central

von Deuster, Constantin; Stoeck, Christian T.; Genet, Martin; Atkinson, David

2015-01-01

Purpose To compare signal‐to‐noise ratio (SNR) efficiency and diffusion tensor metrics of cardiac diffusion tensor mapping using acceleration‐compensated spin‐echo (SE) and stimulated echo acquisition mode (STEAM) imaging. Methods Diffusion weighted SE and STEAM sequences were implemented on a clinical 1.5 Tesla MR system. The SNR efficiency of SE and STEAM was measured (b = 50–450 s/mm2) in isotropic agar, anisotropic diffusion phantoms and the in vivo human heart. Diffusion tensor analysis was performed on mean diffusivity, fractional anisotropy, helix and transverse angles. Results In the isotropic phantom, the ratio of SNR efficiency for SE versus STEAM, SNRt(SE/STEAM), was 2.84 ± 0.08 for all tested b‐values. In the anisotropic diffusion phantom the ratio decreased from 2.75 ± 0.05 to 2.20 ± 0.13 with increasing b‐value, similar to the in vivo decrease from 2.91 ± 0.43 to 2.30 ± 0.30. Diffusion tensor analysis revealed reduced deviation of helix angles from a linear transmural model and reduced transverse angle standard deviation for SE compared with STEAM. Mean diffusivity and fractional anisotropy were measured to be statistically different (P < 0.001) between SE and STEAM. Conclusion Cardiac DTI using motion‐compensated SE yields a 2.3–2.9× increase in SNR efficiency relative to STEAM and improved accuracy of tensor metrics. The SE method hence presents an attractive alternative to STEAM based approaches. Magn Reson Med 76:862–872, 2016. © 2015 The Authors. Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. PMID:26445426

Stimulus-category competition, inhibition, and affective devaluation: a novel account of the uncanny valley

PubMed Central

Ferrey, Anne E.; Burleigh, Tyler J.; Fenske, Mark J.

2015-01-01

Stimuli that resemble humans, but are not perfectly human-like, are disliked compared to distinctly human and non-human stimuli. Accounts of this “Uncanny Valley” effect often focus on how changes in human resemblance can evoke different emotional responses. We present an alternate account based on the novel hypothesis that the Uncanny Valley is not directly related to ‘human-likeness’ per se, but instead reflects a more general form of stimulus devaluation that occurs when inhibition is triggered to resolve conflict between competing stimulus-related representations. We consider existing support for this inhibitory-devaluation hypothesis and further assess its feasibility through tests of two corresponding predictions that arise from the link between conflict-resolving inhibition and aversive response: (1) that the pronounced disliking of Uncanny-type stimuli will occur for any image that strongly activates multiple competing stimulus representations, even in the absence of any human-likeness, and (2) that the negative peak of an ‘Uncanny Valley’ should occur at the point of greatest stimulus-related conflict and not (in the presence of human-likeness) always closer to the ‘human’ end of a perceptual continuum. We measured affective responses to a set of line drawings representing non-human animal–animal morphs, in which each continuum midpoint was a bistable image (Experiment 1), as well as to sets of human-robot and human-animal computer-generated morphs (Experiment 2). Affective trends depicting classic Uncanny Valley functions occurred for all continua, including the non-human stimuli. Images at continua midpoints elicited significantly more negative affect than images at endpoints, even when the continua included a human endpoint. This illustrates the feasibility of the inhibitory-devaluation hypothesis and the need for further research into the possibility that the strong dislike of Uncanny-type stimuli reflects the negative affective consequences of cognitive inhibition. PMID:25821439

Stimulus-category competition, inhibition, and affective devaluation: a novel account of the uncanny valley.

PubMed

Ferrey, Anne E; Burleigh, Tyler J; Fenske, Mark J

2015-01-01

Stimuli that resemble humans, but are not perfectly human-like, are disliked compared to distinctly human and non-human stimuli. Accounts of this "Uncanny Valley" effect often focus on how changes in human resemblance can evoke different emotional responses. We present an alternate account based on the novel hypothesis that the Uncanny Valley is not directly related to 'human-likeness' per se, but instead reflects a more general form of stimulus devaluation that occurs when inhibition is triggered to resolve conflict between competing stimulus-related representations. We consider existing support for this inhibitory-devaluation hypothesis and further assess its feasibility through tests of two corresponding predictions that arise from the link between conflict-resolving inhibition and aversive response: (1) that the pronounced disliking of Uncanny-type stimuli will occur for any image that strongly activates multiple competing stimulus representations, even in the absence of any human-likeness, and (2) that the negative peak of an 'Uncanny Valley' should occur at the point of greatest stimulus-related conflict and not (in the presence of human-likeness) always closer to the 'human' end of a perceptual continuum. We measured affective responses to a set of line drawings representing non-human animal-animal morphs, in which each continuum midpoint was a bistable image (Experiment 1), as well as to sets of human-robot and human-animal computer-generated morphs (Experiment 2). Affective trends depicting classic Uncanny Valley functions occurred for all continua, including the non-human stimuli. Images at continua midpoints elicited significantly more negative affect than images at endpoints, even when the continua included a human endpoint. This illustrates the feasibility of the inhibitory-devaluation hypothesis and the need for further research into the possibility that the strong dislike of Uncanny-type stimuli reflects the negative affective consequences of cognitive inhibition.

Rotation Covariant Image Processing for Biomedical Applications

PubMed Central

Reisert, Marco

2013-01-01

With the advent of novel biomedical 3D image acquisition techniques, the efficient and reliable analysis of volumetric images has become more and more important. The amount of data is enormous and demands an automated processing. The applications are manifold, ranging from image enhancement, image reconstruction, and image description to object/feature detection and high-level contextual feature extraction. In most scenarios, it is expected that geometric transformations alter the output in a mathematically well-defined manner. In this paper we emphasis on 3D translations and rotations. Many algorithms rely on intensity or low-order tensorial-like descriptions to fulfill this demand. This paper proposes a general mathematical framework based on mathematical concepts and theories transferred from mathematical physics and harmonic analysis into the domain of image analysis and pattern recognition. Based on two basic operations, spherical tensor differentiation and spherical tensor multiplication, we show how to design a variety of 3D image processing methods in an efficient way. The framework has already been applied to several biomedical applications ranging from feature and object detection tasks to image enhancement and image restoration techniques. In this paper, the proposed methods are applied on a variety of different 3D data modalities stemming from medical and biological sciences. PMID:23710255

Radio-telemetric evidence of migration in the gregarious but not the solitary morph of the Mormon cricket (Anabrus simplex: Orthoptera: Tettigoniidae)

NASA Astrophysics Data System (ADS)

Lorch, Patrick D.; Gwynne, D. T.

The Mormon cricket, Anabrus simplex, is one of just a few species of katydids (or bushcrickets, Orthoptera: Tettigoniidae) that, like migratory locusts, appear to have solitary and migratory morphs. Using radio telemetry we studied movements of individuals of two morphs of this flightless species. Individuals within each migratory band had similar rates of movements along similar directional headings whereas solitary individuals moved little and showed little evidence of directionality in movement. Our results also add to other recent radio-telemetry studies showing that flightless insects of 1-2g in mass can be tracked successfully using these methods.

Enhanced ICBM Diffusion Tensor Template of the Human Brain

PubMed Central

Zhang, Shengwei; Peng, Huiling; Dawe, Robert J.; Arfanakis, Konstantinos

2010-01-01

Development of a diffusion tensor (DT) template that is representative of the micro-architecture of the human brain is crucial for comparisons of neuronal structural integrity and brain connectivity across populations, as well as for the generation of a detailed white matter atlas. Furthermore, a DT template in ICBM space may simplify consolidation of information from DT, anatomical and functional MRI studies. The previously developed “IIT DT brain template” was produced in ICBM-152 space, based on a large number of subjects from a limited age-range, using data with minimal image artifacts, and non-linear registration. That template was characterized by higher image sharpness, provided the ability to distinguish smaller white matter fiber structures, and contained fewer image artifacts, than several previously published DT templates. However, low-dimensional registration was used in the development of that template, which led to a mismatch of DT information across subjects, eventually manifested as loss of local diffusion information and errors in the final tensors. Also, low-dimensional registration led to a mismatch of the anatomy in the IIT and ICBM-152 templates. In this work, a significantly improved DT brain template in ICBM-152 space was developed, using high-dimensional non-linear registration and the raw data collected for the purposes of the IIT template. The accuracy of inter-subject DT matching was significantly increased compared to that achieved for the development of the IIT template. Consequently, the new template contained DT information that was more representative of single-subject human brain data, and was characterized by higher image sharpness than the IIT template. Furthermore, a bootstrap approach demonstrated that the variance of tensor characteristics was lower in the new template. Additionally, compared to the IIT template, brain anatomy in the new template more accurately matched ICBM-152 space. Finally, spatial normalization of a number of DT datasets through registration to the new and existing IIT templates was improved when using the new template. PMID:20851772