Descriptive Analysis on the Impacts of Universal Zero-Markup Drug Policy on a Chinese Urban Tertiary Hospital

PubMed Central

Yang, Dong

2016-01-01

Background Universal Zero-Markup Drug Policy (UZMDP) mandates no price mark-ups on any drug dispensed by a healthcare institution, and covers the medicines not included in the China’s National Essential Medicine System. Five tertiary hospitals in Beijing, China implemented UZMDP in 2012. Its impacts on these hospitals are unknown. We described the effects of UZMDP on a participating hospital, Jishuitan Hospital, Beijing, China (JST). Methods This retrospective longitudinal study examined the hospital-level data of JST and city-level data of tertiary hospitals of Beijing, China (BJT) 2009–2015. Rank-sum tests and join-point regression analyses were used to assess absolute changes and differences in trends, respectively. Results In absolute terms, after the UZDMP implementation, there were increased annual patient-visits and decreased ratios of medicine-to-healthcare-charges (RMOH) in JST outpatient and inpatient services; however, in outpatient service, physician work-days decreased and physician-workload and inflation-adjusted per-visit healthcare charges increased, while the inpatient physician work-days increased and inpatient mortality-rate reduced. Interestingly, the decreasing trend in inpatient mortality-rate was neutralized after UZDMP implementation. Compared with BJT and under influence of UZDMP, JST outpatient and inpatient services both had increasing trends in annual patient-visits (annual percentage changes[APC] = 8.1% and 6.5%, respectively) and decreasing trends in RMOH (APC = -4.3% and -5.4%, respectively), while JST outpatient services had increasing trend in inflation-adjusted per-visit healthcare charges (APC = 3.4%) and JST inpatient service had decreasing trend in inflation-adjusted per-visit medicine-charges (APC = -5.2%). Conclusion Implementation of UZMDP seems to increase annual patient-visits, reduce RMOH and have different impacts on outpatient and inpatient services in a Chinese urban tertiary hospital. PMID:27627811

Descriptive Analysis on the Impacts of Universal Zero-Markup Drug Policy on a Chinese Urban Tertiary Hospital.

PubMed

Tian, Wei; Yuan, Jiangfan; Yang, Dong; Zhang, Lanjing

2016-01-01

Universal Zero-Markup Drug Policy (UZMDP) mandates no price mark-ups on any drug dispensed by a healthcare institution, and covers the medicines not included in the China's National Essential Medicine System. Five tertiary hospitals in Beijing, China implemented UZMDP in 2012. Its impacts on these hospitals are unknown. We described the effects of UZMDP on a participating hospital, Jishuitan Hospital, Beijing, China (JST). This retrospective longitudinal study examined the hospital-level data of JST and city-level data of tertiary hospitals of Beijing, China (BJT) 2009-2015. Rank-sum tests and join-point regression analyses were used to assess absolute changes and differences in trends, respectively. In absolute terms, after the UZDMP implementation, there were increased annual patient-visits and decreased ratios of medicine-to-healthcare-charges (RMOH) in JST outpatient and inpatient services; however, in outpatient service, physician work-days decreased and physician-workload and inflation-adjusted per-visit healthcare charges increased, while the inpatient physician work-days increased and inpatient mortality-rate reduced. Interestingly, the decreasing trend in inpatient mortality-rate was neutralized after UZDMP implementation. Compared with BJT and under influence of UZDMP, JST outpatient and inpatient services both had increasing trends in annual patient-visits (annual percentage changes[APC] = 8.1% and 6.5%, respectively) and decreasing trends in RMOH (APC = -4.3% and -5.4%, respectively), while JST outpatient services had increasing trend in inflation-adjusted per-visit healthcare charges (APC = 3.4%) and JST inpatient service had decreasing trend in inflation-adjusted per-visit medicine-charges (APC = -5.2%). Implementation of UZMDP seems to increase annual patient-visits, reduce RMOH and have different impacts on outpatient and inpatient services in a Chinese urban tertiary hospital.

Diversification Management at Tertiary Education Level: A Review

ERIC Educational Resources Information Center

Takwate, Kwaji Tizhe

2016-01-01

This paper examines the concept of management of diversification at tertiary education level in view of the growth of national secondary education system which vested high scramble for tertiary education was made in relation to question of access and expansion. This paper examines management of diversification at tertiary education level as a…

Disease patterns and clinical outcomes of patients admitted in intensive care units of tertiary referral hospitals of Tanzania.

PubMed

Sawe, Hendry R; Mfinanga, Juma A; Lidenge, Salum J; Mpondo, Boniventura C T; Msangi, Silas; Lugazia, Edwin; Mwafongo, Victor; Runyon, Michael S; Reynolds, Teri A

2014-09-23

In sub-Saharan Africa the availability of intensive care unit (ICU) services is limited by a variety of factors, including lack of financial resources, lack of available technology and well-trained staff. Tanzania has four main referral hospitals, located in zones so as to serve as tertiary level referral centers. All the referral hospitals have some ICU services, operating at varying levels of equipment and qualified staff. We analyzed and describe the disease patterns and clinical outcomes of patients admitted in ICUs of the tertiary referral hospitals of Tanzania. This was a retrospective analysis of ICU patient records, for three years (2009 to 2011) from all tertiary referral hospitals of Tanzania, namely Muhimbili National Hospital (MNH), Kilimanjaro Christian Medical Centre (KCMC), Mbeya Referral Hospital (MRH) and Bugando Medical Centre (BMC). MNH is the largest of the four referral hospitals with 1300 beds, and MRH is the smallest with 480 beds. The ratio of hospital beds to ICU beds is 217:1 at MNH, 54:1 at BMC, 39:1 at KCMC, and 80:1 at MRH. KCMC had no infusion pumps. None of the ICUs had a point-of-care (POC) arterial blood gas (ABG) analyzer. None of the ICUs had an Intensive Care specialist or a nutritionist. A masters-trained critical care nurse was available only at MNH. From 2009-2011, the total number of patients admitted to the four ICUs was 5627, male to female ratio 1.4:1, median age of 34 years. Overall, Trauma (22.2%) was the main disease category followed by infectious disease (19.7%). Intracranial injury (12.5%) was the leading diagnosis in all age groups, while pneumonia (11.7%) was the leading diagnosis in pediatric patients (<18 years). Patients with tetanus (2.4%) had the longest median length ICU stay: 8 (5,13) days. The overall in-ICU mortality rate was 41.4%. The ICUs in tertiary referral hospitals of Tanzania are severely limited in infrastructure, personnel, and resources, making it difficult or impossible to provide optimum care

Management for the children with otitis media with effusion in the tertiary hospital.

PubMed

Choung, Yun-Hoon; Shin, You Ree; Choi, Seong Jun; Park, Keehyun; Park, Hun Yi; Lee, Jong Bin; Han, Dong Hee; Kahng, Hison

2008-12-01

Recently, new evidence-based recommendations have been introduced for diagnosing and managing otitis media with effusion (OME) in children. However, there are some difficulties to follow the general guidelines in the tertiary hospitals. The purpose is to evaluate the efficiency of antibiotics or antihistamines for treatment of children with OME in the tertiary hospital with a randomized prospective clinical study. Eighty-four children with OME who had been diagnosed in the tertiary hospital were randomized to receive 5 different medications for 2 weeks. We prescribed antibiotics (amoxicillin-clavulanate syrup) in Group I (n=16), antibiotics/steroids (prednisolone) in Group II (n=18), antibiotics/antihistamines (ebastine) in Group III (n=15), antibiotics/steroids/antihistamines in Group IV (n=17), and mucolytics (ivy leaf extract) in Group V (n=17) for control. We followed-up children every 2 weeks and evaluated the state of OME at 3 months. Thirty six (42.9%) of 84 children were resolved within average 6.9 weeks after the treatments. Thirty-six (42.9%) were treated with ventilation tube insertion and 12 patients (14.3%) were observed. There was no difference in the resolution rates of OME among the five different protocols (P>0.05). There was no difference in the resolution rates among groups who used steroids, antihistamines, steroids and antihistamines, or other medications to manage 42 children with allergies (P>0.05). In the tertiary hospital, the cure rate of children with OME was not as high as well-known, and antibiotics or anti-allergic medications were not more effective than control. We may, therefore, need any other guidelines which are different from the previous evidence-based recommendations, including early operation in the tertiary hospitals.

Epidemiology and molecular typing of VRE bloodstream isolates in an Irish tertiary care hospital.

PubMed

Ryan, L; O'Mahony, E; Wrenn, C; FitzGerald, S; Fox, U; Boyle, B; Schaffer, K; Werner, G; Klare, I

2015-10-01

Ireland has the highest rate of vancomycin-resistant Enterococcus faecium (VREfm) isolated from blood of nosocomial patients in Europe, which rose from 33% (110/330) in 2007 to 45% (178/392) in 2012. No other European country had a VREfm rate from blood cultures of >25%. Our aim was to elucidate the reasons for this significantly higher rate in Ireland. The epidemiology and molecular typing of VRE from bloodstream infections (BSIs) was examined in a tertiary care referral hospital and isolates were compared with those from other tertiary care referral centres in the region. The most common source of VRE BSIs was intra-abdominal sepsis, followed by line-related infection and febrile neutropenia. Most of the isolates were positive for vanA; 52% (43/83) possessed the esp gene and 12% (10/83) possessed the hyl gene. Genotyping by SmaI macrorestriction analysis (PFGE) of isolates revealed clonal relatedness between bloodstream isolates and environmental isolates. VRE BSI isolates from two other tertiary care hospitals in the Dublin region showed relatedness by PFGE analysis. MLST revealed four STs (ST17, ST18, ST78 and ST203), all belonging to the clonal complex of hospital-associated strains. Irish VRE BSI isolates have virulence factor profiles as previously reported from Europe. Typing analysis shows the spread of individual clones within the hospital and between regional tertiary care hospitals. Apart from transmission of VRE within the hospital and transfer of colonized patients between Irish hospitals, no other explanation for the persistently high VREfm BSI rate in Ireland has been found. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Current Trends of Using Antimicrobial Drugs in the ICU at a Tertiary Level Teaching Hospital in Mymensingh.

PubMed

Saha, S K; Shaha, K C; Haque, M F; Khatun, S; Akhter, S M; Akhter, H

2016-10-01

The aim of the present study was to investigate the current trends of using antimicrobial drugs in the ICU at a tertiary level teaching hospital in Mymensingh. The study of prescribing patterns seeks to monitor, evaluate and suggest modifications in clinicians prescribing habits so as to make medical care rational. It was an observational type of descriptive study, conducted in the Mymensingh medical college hospital, Mymensingh, during the study period of June 2016 to September 2016.The study was approved by the institutional ethical committee. Most patients in the ICU belonged to the older age group >60 years. Male patients were more than the female patients in ICU. Average duration of stay in ICU was 4.35 days. Admissions in ICU were common due to respiratory system related diseases and the present study showed that 31.68% of the reported cases belong to the respiratory system. Average number of drugs per prescription was 6.46. Average number of anti-microbial drugs per prescription was 1.38. Cephalosporin group and individually ceftriaxone was the most frequently prescribed antimicrobial group and agent respectively in the ICU. Most commonly used antimicrobial combination was Cephalosporin and Metronidazole (43.33%) followed by Carbapenem (Meropenem) and Metronidazole (13.33%). Most antimicrobial agents were prescribed without bacteriological culture and sensivity testing evidence. There is a need for motivating the physicians to prescribe antimicrobial agents with supportive bacteriological evidences.

[Association between occupational stress and presenteeism among medical staff at grade A tertiary hospitals in Shanghai, China].

PubMed

Dai, Junming; Hua, Yujie; Zhang, Hao; Huang, Li; Fu, Hua

2015-10-01

To investigate the current status of occupational stress and presenteeism among medical staff at grade A tertiary hospitals in Shanghai, China, and to analyze the association between occupational stress and presenteeism. A total of 2356 healthcare workers from eight grade A tertiary hospitals in Shanghai were investigated by stratified random sampling. All the subjects were asked to complete self-administered questionnaires with informed consent. The occupational stress was assessed by the occupational stress core questionnaire. The presenteeism was evaluated by the Stanford Presenteeism Scale. In all subjects, the average score of presenteeism was 15.23 ± 3.89, and 72.5% felt occupational stress in self-evaluation. There were significant differences in the score of presenteeism between subjects with different ages, education levels, occupations, lengths of service, job titles, and shifts (all P<0.05). There were significant differences in the score of presenteeism and the rate of high presenteeism between subjects with different indices of occupational stress, including job demand, control, social support, and demand-control ratio (P<0.01). High job demand and high demand-control ratio were risk factors for high presenteeism (OR=2.56, 95% CI=2.01~3.27; OR=1.53, 95% CI=1.23~1.90). High social support was a protective factor for high presenteeism (OR=0.23, 95% CI=0.18~0.29). The intensity of occupational stress in medical staff from grade A tertiary hospitals is positively correlated with the level of presenteeism. It is important to promote social support to reduce the loss of work efficiency due to presenteeism.

A third of patients treated at a tertiary-level surgical service could be treated at a secondary-level facility.

PubMed

Van Straten, S; Stannard, C; Bulabula, J; Boodhia, K; Paul, K; Leong, J; Klipin, M J

2017-08-25

South Africa (SA) has an overburdened public healthcare system. Some patients admitted to Charlotte Maxeke Johannesburg Academic Hospital (CMJAH), SA, may not require tertiary care, but the numbers and details are uncertain. Clinical research in SA is limited by scarce skills and limited access to data. To determine the proportion of and length of stay for secondary-, tertiary- and quaternary-level patients discharged from the Department of Surgery at CMJAH over 1 year. This is a retrospective analysis of electronic discharge (ED) summaries from the Department of Surgery at CMJAH between 1 April 2015 and 1 April 2016. An SQL query of the database generated a .csv file of all discharges with the following fields: database reference number, length of stay and level of care. The details of each record were verified by MBBCh V students, using a defined level-ofcare template and the full discharge summary. The data were reviewed by a senior clinician. There were 3 007 discharge summaries - 97 were not classifiable, two were test records and one was a duplicate. These 100 records were excluded. There were no primary-level records. Secondary-level patients represented 29% (854) of those discharged and 19% of total bed days. Tertiary- and quaternary-level patients together represented 71% of the total and 81% of bed days. The average length of stay was 4.31 days for secondary, 6.98 days for tertiary and 9.77 days for quaternary level-of-care allocation. Almost one-third (29%) of patients discharged from CMJAH's Department of Surgery were deemed suitable for secondarylevel care. These patients had a shorter length of stay and comprised 19% of total bed days. Students and electronic databases represent an important research resource.

Examining the characteristics of workplace violence in one non-tertiary hospital.

PubMed

Chapman, Rose; Styles, Irene; Perry, Laura; Combs, Shane

2010-02-01

This study sought to determine the prevalence and characteristics of workplace violence directed at a volunteer sample of nurses at one non-tertiary hospital. Respondents' reasons for not reporting these incidents were also investigated. Incidents of workplace violence are increasing worldwide. However, no studies have investigated this phenomenon from the perspective of nurses in Western Australian non-tertiary hospitals. Survey. A survey was distributed to all 332 nurses working in several areas of one non-tertiary hospital in Western Australia to determine their experiences of workplace violence over a 12 month period. Of the 113 nurses who agreed to participate in this study, 75% reported experiencing workplace violence in the previous twelve months. When asked about their most recent incident, 50% of the nurses said they had reported it verbally, mostly to more senior staff. Only 16% of the nurses completed an official incident report. Reasons for not reporting included the view that WPV is just part of the job and the perception that management would not be responsive. This study showed that for this sample of nurses violent events are occurring at a rate that is similar to those reported in other studies. This finding should be of great concern to the organisation and the community in general. Organisations are obliged to improve the safety of the workplace environment for both staff and patients. The findings of our study may be of help to healthcare institutions in developing education programmes for nurses, patients and their friends and relatives to reduce the impact and frequency of workplace violence.

An assessment of the safe delivery incentive program at a tertiary level hospital in Nepal.

PubMed

Baral, G

2012-05-01

Maternity incentive program of Nepal known as Safe Delivery Incentive Program (SDIP) was introduced nationwide in 2005 with the intention of increasing utilization of professional care at childbirth. The program provided both childbirth service as well as 'cash' to women giving birth in a health facility in addition to incentives to health provider for each delivery attended, either at home or the facility. Due to a lack of uniformity in its implementation and administrative delays, the program was reformed and even extended to many not-for-profit health institutions in early 2007, and implemented as a 'Safer Mother Program' popularly known as "Aama-Suraksha-Karyakram" since January 2009. This is a system research with observational and analytical components. Plausibility design is selected to evaluate the performance-based funding (PBF) as a system level intervention of maternity care using two instruments: Pay-For-Performance and Conditional-Cash-Transfer. It uses interrupted time-series to control for the natural trend. Research tools used are interviews, the focus group discussions and literature review. Numerical data are presented in simple graphs. While online random number generator was used partly, the purposive sampling was used for qualitative data. There is a gross discrepancy in non-targeted service delivery at the tertiary level health facility. Overflooding of maternity cases has hampered gynecological admission and surgical management delaying subspecialty care and junior physicians' training. With the same number and quality of physical facility and human resource, the additional program has put more strains to service providers and administrators. There should be adequate planning and preparation at all levels of health facilities; implementing a new program should not adversely affect another existing service delivery system. For the optional implementation, hospital organogram should be revised; and physical facilities and the low-risk birthing

A THIRD OF PATIENTS TREATED AT A TERTIARY LEVEL SURGICAL SERVICE COULD BE TREATED AT A SECONDARY LEVEL FACILITY.

PubMed

Van Straten, S K; Stannard, C J; Bulabula, J; Paul, K; Leong, J; Klipin, M

2017-06-01

South Africa has an overburdened public healthcare system. Some admissions to Charlotte Maxeke Johannesburg Academic Hospital (CMJAH) may not require tertiary care. The numbers and details thereof are uncertain. Clinical research is limited by skills and access to data. A retrospective analysis of Electronic Discharge (ED) summaries from the Department of Surgery at CMJAH between 01 April 2015 and 01 April 2016. An SQL-query of the database generated a .csv file of all discharges with the fields database reference number, length of stay and level of care. The details and level of care of each record were verified by MBBCh 5 medical students using a defined level of care template with review of the full discharge summary. The data was reviewed by a senior clinician. There were 3007 discharge summaries, 97 were not classifiable, two were test records and one was a duplicate. These 100 records were excluded. There were no primary level records. Secondary level patients represented 29% (854) of patients discharged and 19% of total bed days. Tertiary and quaternary together represented 71% of the total patients and 81% of bed days. The average length of stay was 4.31 days for secondary, 6.98 days for tertiary and 9.77 days for quaternary level of care allocation. Almost a third (29%) of patients discharged from CMJAH Department of Surgery were deemed suitable for secondary level care. These admissions have a shorter length of stay and comprise 19% of total bed days. Students and electronic databases are useful research resources.

Cost effectiveness of screening of all newly recruited employees for diabetes at a tertiary care hospital.

PubMed

Ali, Niloufer Sultan; Khuwaja, Ali Khan

2007-01-01

Diabetes Mellitus is a disease which remains asymptomatic for long duration of time and usually diagnosed either when gets complicated or by routine or opportunistic screening. The practice of universal screening is not recommended, particularly in constraint resources. However, we embarked with a study to assess the yield of recommended screening for Type 2 diabetes in all the newly recruited employees at a tertiary care hospital in Karachi. All the information required for this study was collected from medical records of all newly recruited employees of nursing services department of a tertiary care hospital of Karachi, Pakistan, over a period of 5 months (August 2004 to December 2004). Out of 360 subjects, 326, whose information was found to be complete, were included for final analysis. Mean age of the study subjects was 25.3 +/- 4.7 years and their mean casual plasma glucose level was 99.1 +/- 16.3 mg/dl. 315 (96.6%) study subjects had casual plasma glucose level of 139 mg/dl or less. Only 10 (3.1%) study subjects had casual plasma glucose levels between 140 to 199 mg/dl. Just one employee, 41 years old, was found to have casual plasma glucose level of 213 mg/dl. In this study, screening of all individuals for diabetes had a very low yield. Recommendation of universal screening for diabetes does not represent a good use of resources and perhaps not cost-effective. However, periodic screening of high risk individuals should be warranted.

Implementation of subcutaneous insulin protocol for non-critically ill hospitalized patients in andalusian tertiary care hospitals.

PubMed

Martínez-Brocca, María Asunción; Morales, Cristóbal; Rodríguez-Ortega, Pilar; González-Aguilera, Beatriz; Montes, Cristina; Colomo, Natalia; Piédrola, Gonzalo; Méndez-Muros, Mariola; Serrano, Isabel; Ruiz de Adana, Maria Soledad; Moreno, Alberto; Fernández, Ignacio; Aguilar, Manuel; Acosta, Domingo; Palomares, Rafael

2015-02-01

In 2009, the Andalusian Society of Endocrinology and Nutrition designed a protocol for subcutaneous insulin treatment in hospitalized non-critically ill patients (HIP). To analyze implementation of HIP at tertiary care hospitals from the Andalusian Public Health System. A descriptive, multicenter study conducted in 8 tertiary care hospitals on a random sample of non-critically ill patients with diabetes/hyperglycemia (n=306) hospitalized for ≥48 hours in 5 non-surgical (SM) and 2 surgical (SQ) departments. Type 1 and other specific types of diabetes, pregnancy and nutritional support were exclusion criteria. 288 patients were included for analysis (62.5% males; 70.3±10.3 years; 71.5% SM, 28.5% SQ). A scheduled subcutaneous insulin regimen based on basal-bolus-correction protocol was started in 55.9% (95%CI: 50.5-61.2%) of patients, 63.1% SM vs. 37.8% SQ (P<.05). Alternatives to insulin regimen based on basal-bolus-correction included sliding scale insulin (43.7%), diet (31.3%), oral antidiabetic drugs (17.2%), premixed insulin (1.6%), and others (6.2%). For patients previously on oral antidiabetic drugs, in-hospital insulin dose was 0.32±0.1 IU/kg/day. In patients previously on insulin, in-hospital insulin dose was increased by 17% [-13-53], and in those on insulin plus oral antidiabetic drugs, in-hospital insulin dose was increased by 26.4% [-6-100]. Supplemental insulin doses used for<40 IU/day and 40-80 IU/day were 72.2% and 56.7% respectively. HbA1c was measured in 23.6% of patients (95CI%: 18.8-28.8); 27.7% SM vs. 13.3% SQ (P<.05). Strategies are needed to improve implementation of the inpatient subcutaneous insulin protocol, particularly in surgical departments. Sliding scale insulin is still the most common alternative to insulin regimen based on basal-bolus-correction scheduled insulin. Metabolic control assessment during hospitalization should be encouraged. Copyright © 2014 SEEN. Published by Elsevier España, S.L.U. All rights reserved.

Seroprevalence of coeliac disease in at-risk subjects at the main tertiary hospital, southwest of Saudi Arabia.

PubMed

Al-Hakami, Ahmed M

2016-03-01

Coeliac disease (CD) is a gluten-induced autoimmune inflammation of small bowel villi, leading to atrophy and malabsorption. The current study aims to assess the prevalence of CD in high-risk subjects in the Aseer region, southwest of Saudi Arabia and to investigate the associated presentations. This is a retrospective case-finding study of the laboratory records for a 3-year period (2009-2012) at the main tertiary hospital (Aseer Central Hospital). Serum anti-tissue transglutaminase (atTG) and endomysial antibody (EmA) levels were determined along with small intestinal histopathological examination. The proportion of cases that tested positive for at least one coeliac antibody marker was 18.4% (58/315). Forty cases underwent endoscopic examination during the analysis, among which 22 were confirmed to have CD. The individual antibody positivity for atTG and EmA was 17.5% and 15.6%, respectively. The most common clinical condition (47%) associated with these markers was type 1 diabetes mellitus (T1DM). Interestingly, gastrointestinal presentations constituted only 11.5%. The rate of CD among hospital requests, including non-gastrointestinal symptomatic patients, at the Aseer main tertiary hospital seems to be high. Determining the prevalence of CD and also investigating the high-risk group commonly affected by CD warrant more screening studies. Copyright © 2016 Arab Journal of Gastroenterology. Published by Elsevier B.V. All rights reserved.

Immunization Status of NICU Graduates at a Tertiary Care Children's Hospital.

PubMed

Macintosh, Janelle L B; Huggins, Leslie J; Eden, Lacey M; Merrill, Katreena Collette; Luthy, Karlen E Beth

2017-04-01

Approximately 500,000 infants are born prematurely each year in the United States. Immunization of infants in a neonatal intensive care unit (NICU) set a precedence for future immunizations. The objectives of this study were to determine the current rates of immunization and identify variables associated with immunizations of NICU graduates who were aged 60 days or older at time of discharge. This descriptive pilot study utilized retrospective paper medical record review in one tertiary children's hospital. The relationships between immunization status and study variables were examined using t tests and logistic regression. Of 43 infants discharged at least 60 days of age or older from the NICU, 74.4% were fully immunized in accordance with American Academy of Pediatrics (AAP) recommendations. Significant predictors were age at discharge for immunization and steroid use for nonimmunization. Immunization needs to be a priority in order to give NICU infants every advantage regarding their future health status. Nurses need to implement hospital policies ensuring immunizations of NICU graduates. Future studies should focus on samples from diverse hospitals and levels of NICUs. Qualitative studies exploring and describing parent and provider knowledge of current AAP guidelines will strengthen our understanding of potential barriers to immunization.

Assessing surgical research at the teaching hospital level.

PubMed

McBride, Kate E; Young, Jane M; Bannon, Paul G; Solomon, Michael J

2017-01-01

To undertake a comprehensive needs assessment to determine the baseline of surgical research activity at a tertiary referral hospital in Sydney, Australia. The comprehensive needs assessment comprised three components: a retrospective audit of the hospital ethics committee records to identify surgical research activity; a survey of all 17 surgical departments about the availability of 10 potential research resources and a survey of surgical staff to ascertain perceptions of research culture at the organizational, team and individual levels. Of all research studies submitted to the hospital ethics committee in a 2-year period, only 9% were identified as surgical studies. Among the 17 surgical departments, there was wide variation in activity with only four defined as being 'research active'. On average, 52% of potential resources for surgical research were found to be in place within surgical departments. Only five departments were considered to be adequately research resourced (≥75% potential resources in place). Surgical research culture was rated 'moderate' at the organizational and team level, and 'low' at the individual level. Medical staff rated research capacity significantly higher at the team and individual levels compared to nursing staff. Collectively, the baseline results indicate there is considerable opportunity to enhance surgical research at the hospital level and to use this information to guide new and innovative approaches in the future. © 2016 Royal Australasian College of Surgeons.

Unlicensed and off-label use of drugs in pediatric surgical units at tertiary care hospitals of Pakistan.

PubMed

Aamir, Muhammad; Khan, Jamshaid Ali; Shakeel, Faisal; Asim, Syed Muhammad

2017-08-01

Background Unlicensed and off-label prescribing practice is global dilemma around the world. This pioneering study was designed to determine unlicensed and off-label use of drug in surgical wards of tertiary care hospitals of Pakistan. Objective To assess unlicensed and off-label use of drugs in pediatric surgical unit at three tertiary care hospitals in Peshawar, Pakistan. Setting Two government and one private tertiary care hospitals in Pakistan. Method Drug profiles of 895 patients from three different clinical settings were evaluated for unlicensed and off-label use of drugs using Micromedex DRUGDEX. Main outcome measure Characteristics of the unlicensed and off-label drug prescriptions. Result Total of 3168 prescribed drugs were analyzed in this study. Indication (38.7%) and dose (34.8%) were the most frequent off-label categories. In comparison with the corresponding reference categories, infants and children, male patients and having less than five prescribed drugs were significant predictors of unlicensed prescriptions. In comparison with the corresponding reference categories, significant predictors of off-label drug prescribing were children younger than two year, children between 2-12 years, patient staying at hospital less than 5 days and patients having less than five prescribed drugs. Conclusion The prevalence of unlicensed and off-label drug prescriptions are high at pediatric surgical ward of tertiary care hospitals. More awareness of the efficacy and safety of drugs are required in pediatrics. In addition, new formulations with advanced dosing for children are also required to minimize the risk of adverse outcomes.

Determinants of the direct cost of heart failure hospitalization in a public tertiary hospital.

PubMed

Parissis, John; Athanasakis, Kostas; Farmakis, Dimitrios; Boubouchairopoulou, Nadia; Mareti, Christina; Bistola, Vasiliki; Ikonomidis, Ignatios; Kyriopoulos, John; Filippatos, Gerasimos; Lekakis, John

2015-02-01

Heart failure (HF) is the first reason for hospital admission in the elderly and represents a major financial burden, the greatest part of which results from hospitalization costs. We sought to analyze current HF hospitalization-related expenditure and identify predictors of cost in a public tertiary hospital in Europe. We performed a retrospective chart review of 197 consecutive patients, aged 56±16years, 80% male, with left ventricular ejection fraction (LVEF) of 30±10%, hospitalized for HF in a major university hospital in Athens, Greece. The survey involved the number of hospitalization days, laboratory investigations and medical therapies. Patients who were hospitalized in CCU/ICU or underwent interventional procedures or device implantations were excluded from analysis. Costs were estimated based on the Greek healthcare system perspective in 2013. Patients were hospitalized for a median of 7 days with a total direct cost of €3198±3260/patient. The largest part of the expenses (79%) was attributed to hospitalization (ward), while laboratory investigations and medical treatment accounted for 17% and 4%, respectively. In multivariate analysis, pre-admission New York Heart Association NYHA class (p=0.001), serum creatinine (p=0.003) and NT-proBNP (p=0.004) were significant independent predictors of hospitalization cost. Direct cost of HF hospitalization is high particularly in patients with more severe symptoms, profound neurohormonal activation and renal dysfunction. Strategies to lower hospitalization rates are warranted in the current setting of financial constraints faced by many European countries. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Off-label and unlicensed drug use in hospitalized newborns in a Saudi tertiary care hospital: a cohort study.

PubMed

Mazhar, Faizan; Akram, Shahzad; Haider, Nafis; Hadi, Muhammad Abdul; Sultana, Jabeen

2018-06-01

Objective To determine the extent of off-label and unlicensed prescribing in hospitalized newborns and to identify patient-related risk factors associated with off-label prescribing. Methods A prospective cohort study was conducted between January and March 2016 at a neonatology department of a tertiary-care hospital in the Eastern province. All consecutive admissions to all neonatal care levels meeting the inclusion and exclusion criteria were eligible for enrollment. All prescriptions were classified as off-label or unlicensed according to drug product monograph. Clinical and prescription data were extracted using a pilot-tested structured data collection sheet. Results During the study period 583 prescriptions were made for 138 newborns, of which 29.7% (173/583) and 12.9% (75/583) were classified as off-label and unlicensed drugs respectively for use in neonates. Thirty-four percent (47/138) of patients received at least one off-label/unlicensed medicine. Mechanical ventilation, admission to the neonatal intensive care unit and length of hospital stay were identified as independent risk factors associated with prescribing of at least one off-label medication. Conclusion Use of off-label and unlicensed drugs in hospitalized newborns seems to be a common practice in this Saudi hospital. Future research should evaluate safety and efficacy of off-label and/or unlicensed use of drugs in neonates.

Molecular epidemiology and spatiotemporal analysis of hospital-acquired Acinetobacter baumannii infection in a tertiary care hospital in southern Thailand.

PubMed

Chusri, S; Chongsuvivatwong, V; Rivera, J I; Silpapojakul, K; Singkhamanan, K; McNeil, E; Doi, Y

2017-01-01

Acinetobacter baumannii is a major hospital-acquired pathogen in Thailand that has a negative effect on patient survival. The nature of its transmission is poorly understood. To investigate the genotypic and spatiotemporal pattern of A. baumannii infection at a hospital in Thailand. The medical records of patients infected with A. baumannii at an 800-bed tertiary care hospital in southern Thailand between January 2010 and December 2011 were reviewed retrospectively. A. baumannii was identified at the genomospecies level. Carbapenemase genes were identified among carbapenem-resistant isolates associated with A. baumannii infection. A spatiotemporal analysis was performed by admission ward, time of infection and pulsed-field gel electrophoresis (PFGE) groups of A. baumannii. Nine PFGE groups were identified among the 197 A. baumannii infections. All A. baumannii isolates were assigned to International Clonal Lineage II. bla OXA-23 was the most prevalent carbapenemase gene. Outbreaks were observed mainly in respiratory and intensive care units. The association between PFGE group and hospital unit was significant. Spatiotemporal analysis identified 20 clusters of single PFGE group infections. Approximately half of the clusters involved multiple hospital units simultaneously. A. baumannii transmitted both within and between hospital wards. Better understanding and control of the transmission of A. baumannii are needed. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Difference between Japanese Secondary and Tertiary Medical Facilities Regarding Changes in the Hospitalization of Children for Pneumonia after the Introduction of the Pneumococcal Conjugate Vaccine.

PubMed

Haro, Kaoru; Ogawa, Masato; Hoshina, Takayuki; Kojiro, Masumi; Kusuhara, Koichi

2017-05-24

This study aimed to compare hospitalization of children for pneumonia between secondary and tertiary medical facilities, which hospitalize many children without and with underlying diseases, respectively, after the introduction of the pneumococcal conjugate vaccine (PCV). Our retrospective study included children admitted to the Department of Pediatrics at Kitakyushu General Hospital, a secondary medical facility, and the Hospital of the University of Occupational and Environment Health, Japan, a tertiary medical facility, from 2009 to 2013 for pneumonia. We compared the change in the rate of hospitalization for pneumonia after the introduction of the 7-valent PCV between the secondary and tertiary medical facilities. Hospitalization of patients with pneumonia declined by 28.8% in our secondary medical facility. In particular, hospitalization for pneumonia other than confirmed mycoplasmal or viral pneumonia was significantly reduced by 49.2%. In contrast, hospitalization of patients with pneumonia did not decline in our tertiary medical facility. After the introduction of PCV, hospitalization of children for pneumonia was not reduced at the tertiary medical facility. Various other pathogens besides pneumococcus may be associated with the development of pneumonia in children with underlying diseases.

Comparison of stress and burnout among anesthesia and surgical residents in a tertiary care teaching hospital in North India.

PubMed

Gandhi, K; Sahni, N; Padhy, S K; Mathew, P J

2017-10-23

The residents undergoing training at hospitals in our country face challenges in terms of infrastructure and high workload with undefined working hours. The aim of the study was to compare the stress and burnout levels in trainee doctors doing residency in surgical fields and anesthesia at a tertiary care academic center in North India. A comparative, observational study was conducted in a tertiary care teaching hospital in North India. After Ethics Committee approval, 200 residents (100 each from surgical branches and anesthesia) were required to fill a questionnaire with information about age, sex, year of residency, marital status, and the Perceived Stress Scale-10, and Burnout Clinical Subtype Questionnaire-12. Burnout and perceived stress were compared between residents of anesthesia and surgical specialties. Residents of both surgical and anesthesia branches scored high in perceived stress, namely 21 and 18, respectively. The score was significantly higher in surgical residents (P = 0.03) and increased progressively with the year of residency. The majority of residents (90% surgical, 80% anesthesia) felt that they were being overloaded with work. However, only 20%-30% of respondents felt that there was lack of development of individual skills and still fewer (<10%) reported giving up in view of difficulties. There is high level of stress and overload dimension of burnout among the residents of anesthesia and surgical branches at our tertiary care academic institution and the surgical residents score marginally higher than anesthesia residents.

Practices and challenges of infectious waste management: A qualitative descriptive study from tertiary care hospitals in Pakistan

PubMed Central

Kumar, Ramesh; Shaikh, Babar Tasneem; Somrongthong, Ratana; Chapman, Robert S

2015-01-01

Background and Objective: Infectious waste management practices among health care workers in the tertiary care hospitals have been questionable. The study intended to identify issues that impede a proper infectious waste management. Methods: Besides direct observation, in-depths interviews were conducted with the hospital administrators and senior management involved in healthcare waste management during March 2014. We looked at the processes related to segregation, collection, storage and disposal of hospital waste, and identified variety of issues in all the steps. Results: Serious gaps and deficiencies were observed related to segregation, collection, storage and disposal of the hospital wastes, hence proving to be hazardous to the patients as well as the visitors. Poor safety, insufficient budget, lack of trainings, weak monitoring and supervision, and poor coordination has eventually resulted in improper waste management in the tertiary hospitals of Rawalpindi. Conclusion: Study has concluded that the poor resources and lack of healthcare worker’s training in infectious waste results in poor waste management at hospitals. PMID:26430405

[Triage evaluation making in a pediatric emergency department of a tertiary hospital].

PubMed

Pascual-Fernández, Ma Cristina; Ignacio-Cerro, Ma Carmen; Jiménez-Carrascosa, Ma Amalia

2014-03-01

Evaluation triage level assignments depending level of the professionals' education and experience in the unit. This was a retrospective and observational study to triages making from January to March 2012 in Pediatric Emergency Department of tertiary hospital in Madrid. The collection data included variables from Pediatric Canadian Triage with five levels, triage tool using in the unit. 6443 triages were evaluated. The most common mistakes was: not to register pain level, 1445 (22.4%); not to register hydration level, 377 (5.9%); principal symptoms inappropriate, 232 (3.6%). Didn't indicate pain level 140 (5.6%) nurses with 12 hour formal training on triage; 492 (14.5%) with training in the unit, and 92 (16.3%) without training in the last year (p < 0.001). Among the nurses working in the unit more than 7 years did not register pain level 472 (12.3%), identified inappropriate principal symptoms 197 (5%) and did not register hydration level 296 (7.7%). The triage education favors better adaptation in the triage assignment. The most common errors are: not to register level pain and hydration when it's needed for the principal symptoms.

Assessment of maternal risk factors associated with low birth weight neonates at a tertiary hospital, Nanded, Maharashtra.

PubMed

Domple, Vijay Kishanrao; Doibale, Mohan K; Nair, Abhilasha; Rajput, Pinkesh S

2016-01-01

To assess the maternal risk factors associated with low birth weight (LBW) neonates at a tertiary hospital, Nanded, Maharashtra. This study was carried out in a tertiary care hospital in Nanded city of Maharashtra between January 2014 and July 2014 among 160 cases (LBW-birth weight ≤2499 g) and 160 controls (normal birth weight-birth weight >2499. Data collection was done by using predesigned questionnaire and also related health documents were checked and collected the expected information during the interview after obtaining informed consent from mothers. The data were analyzed by Epi Info 7 Version. The present study found the significant association among gestational age, sex of baby, type of delivery, maternal age, religion, education of mother and husband, occupation of mother and husband, type of family, maternal height, weight gain, hemoglobin level, planned/unplanned delivery, bad obstetric history, interval between pregnancies, previous history of LBW, underlying disease, tobacco chewing, timing of first antenatal care (ANC) visit, total number of ANC visit, and iron and folic acid (IFA) tablets consumption with LBW. No significant association was found among maternal age, residence, caste, consanguinity of marriage, socioeconomic status, gravida, birth order, multiple pregnancy, and smoking with LBW in our study. It was concluded that hemoglobin level, weight gain during pregnancy, gestational age, planned/unplanned delivery, bad obstetric history, and IFA tablets consumption during pregnancy were independent risk factors for LBW.

[Delirium in Patients Over 60 Years of Age in a Tertiary Level Public Hospital in the City of Pereira (Colombia): Under-Diagnosed and Under-Recorded].

PubMed

César Sánchez, Julio; Isabel González, Martha; César Gutiérrez, Julio

2013-06-01

Delirium is a common disorder in the hospitalized geriatric population and it has a great importance on the clinical outcome of inpatients; however, delirium is not diagnosed properly. To clarify the state of delirium diagnosis and records in a tertiary level public hospital in the city of Pereira. A cross-sectional descriptive study was performed by searching the clinical records of hospitalized patients older than 60 years 2010 and 2011, using the ICD-10 classification as a filter, and verifying the diagnostic criteria of DSM-IV in the clinical records. In the years 2010 and 2011, 5325 patients older than 60 years were hospitalized (19.3%). According to the official statistical records; 0.08% of them were reported with an unspecified diagnosis of delirium (F059). In the clinical records search 455 additional delirium patients were found using the same criteria (40.2%), of which 90.1% had delirium, and only 29.5% were classified with the code F059. The diagnoses and recording of delirium patients over 60 years old patients are underestimated, which is demonstrated by the incongruence of the data obtained from the official records and those obtained from the clinical records. This fact increases the risk and vulnerability of patients with undetected delirium or diagnosed but not reported delirium in hospital statistical sources. Liaison psychiatry is a necessity in third level health institutions, as well as a program of continued education for the health staff about prevention, diagnosis criteria and treatment of delirium. Copyright © 2013 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Awareness about basic life support and emergency medical services and its associated factors among students in a tertiary care hospital in South India.

PubMed

Aroor, Akshatha Rao; Saya, Rama Prakash; Attar, Nazir Rahim; Saya, Ganesh Kumar; Ravinanthanan, Manikandan

2014-07-01

The knowledge and skills about the basic life support (BLS) and the advanced life support are the most important determining factors of the cardiopulmonary resuscitation (CPR) success rates. To determine the level of awareness on BLS and skills among undergraduate and postgraduate students of medical and dental profession, as well as nursing students and interns in a tertiary care hospital. This descriptive cross-sectional study was conducted in a tertiary care hospital in South India. The awareness level on BLS and factors associated which include age, sex, level of training (undergraduate, internship, and postgraduate groups), course of study (nursing, dental, and medical groups), and previous exposure to BLS were assessed by using a structured questionnaire. The association of these variables with awareness level was assessed by independent t test, analysis of variance, and linear regression analysis. Among 520 study subjects, 229 were students, 171 were interns, and 120 were postgraduate students. The overall mean score of awareness was 4.16 ± 1.40 (score range: 0-10). Age, sex, level of training, course of study, and previous exposure to BLS were significantly associated with awareness level in univariate analysis (P < 0.05). Linear regression model also showed that all the above variables were significantly associated with awareness level (P < 0.05). About 322 (61.9%) subjects attributed lack of awareness about BLS to lack of available professional training. About 479 (92.1%) responded that BLS training should be a part of medical curriculum. Awareness level on BLS is below average indicating the importance of professional training at all levels in a tertiary care health institution.

Hospital discharge summary scorecard: a quality improvement tool used in a tertiary hospital general medicine service.

PubMed

Singh, G; Harvey, R; Dyne, A; Said, A; Scott, I

2015-12-01

We assessed the impact of completion and feedback of discharge summary scorecards on the quality of discharge summaries written by interns in a general medicine service of a tertiary hospital. The scorecards significantly improved summary quality in the first three rotations of the intern year and could be readily adopted by other units as a quality improvement intervention for optimizing clinical handover to primary care providers. © 2015 Royal Australasian College of Physicians.

Factors contributing to nursing team work in an acute care tertiary hospital.

PubMed

Polis, Suzanne; Higgs, Megan; Manning, Vicki; Netto, Gayle; Fernandez, Ritin

Effective nursing teamwork is an essential component of quality health care and patient safety. Understanding which factors foster team work ensures teamwork qualities are cultivated and sustained. This study aims to investigate which factors are associated with team work in an Australian acute care tertiary hospital across all inpatient and outpatient settings. All nurses and midwives rostered to inpatient and outpatient wards in an acute care 600 bed hospital in Sydney Australia were invited to participate in a cross sectional survey between September to October 2013. Data were collected, collated, checked and analysed using Statistical Package for the Social Sciences (SPSS) Version 21. Factors reporting a significant correlation with where p < 0.05 were analysed in a multiple regression model. A total of 501 surveys were returned. Nursing teamwork scores ranged between 3.32 and 4.08. Teamwork subscale Shared Mental Model consistently rated the highest. Mean scores for overall communication between nurses and team leadership were 3.6 (S.D. 0.57) and 3.8 (SD 0.6) respectively. Leadership and communication between nurses were significant predictors of team work p < 0.001. Our findings describe factors predictive of teamwork in an acute care tertiary based hospital setting across inpatient and outpatient specialty units. Our findings are of particular relevance in identifying areas of nurse education and workforce planning to improve nursing team work.

Characteristics of patients with diabetes screened for tuberculosis in a tertiary care hospital in South India

PubMed Central

Kumpatla, S.; Sekar, A.; Achanta, S.; Sharath, B. N.; Kumar, A. M. V.; Harries, A. D.

2013-01-01

Setting: Tertiary care hospital for diabetes mellitus (DM) in Tamil Nadu, South India. Objective: To compare the socio-demographic, clinical and biochemical characteristics in DM patients with and without tuberculosis (TB). Design: A descriptive study involving a review of routinely maintained records to capture the results of screening of DM patients for TB between March and December 2012. DM patients were first asked whether they already had TB, and if not they were screened for TB symptoms, followed by investigations for and possible diagnosis of TB. Results: Of 7083 DM patients, 38 already had TB. Of the remainder, 125 (1.8%) had TB symptoms; 71 were investigated and 12 were newly diagnosed with TB. Of the 50 TB patients, 64% had smear-positive pulmonary TB (PTB). DM-TB patients were older, and had lower education level and economic status, a higher frequency of alcohol use, lower body mass index, a longer duration of DM, a greater likelihood of receiving insulin and poorer glycaemic control. Conclusion: Screening of DM patients for TB was feasible in a tertiary care hospital. The yield of new TB cases was low and merits further investigation. Socio-demographic and clinical characteristics were different in patients with DM and TB compared to those with DM only. PMID:26393064

Pylephlebitis: incidence and prognosis in a tertiary hospital.

PubMed

Belhassen-García, Moncef; Gomez-Munuera, Mercedes; Pardo-Lledias, Javier; Velasco-Tirado, Virginia; Perez-Persona, Ernesto; Galindo-Perez, Inmaculada; Alvela-Suárez, Lucia; Romero-Alegría, Angela; Muñoz-Bellvis, Luis; Cordero-Sánchez, Miguel

2014-01-01

Septic thrombophlebitis of the portal vein or its branches, most often secondary to intra-abdominal infection is known as pylephlebitis. The frequency and the prognosis of this complication are unknown. The aim of this study was to determine the global and relative incidence of the most frequent intra-abdominal infections and the real prognosis of this disease. An observational retrospective study was conducted in a tertiary care hospital (University Hospital of Salamanca, Spain) from January 1999 to December 2008. A total of 7796 patients with intra-abdominal infection were evaluated, of whom 13 (0.6%) had been diagnosed with pylephlebitis. Diverticulitis was the most frequent underlying process, followed by biliary infection. Early mortality was 23%. Survivors had no recurrences, but one of them developed portal cavernomatosis. Pylephlebitis is a rare complication of intra-abdominal infection, with a high early mortality, but with a good prognosis for survivors. Copyright © 2013 Elsevier España, S.L. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Phenotypic and genotypic characteristics of carbapenem-resistant Enterobacteriaceae in a tertiary-level reference hospital in Turkey.

PubMed

Baran, Irmak; Aksu, Neriman

2016-04-06

Enterobacteriaceae are among the most common pathogens that are responsible for serious community-acquired, hospital-acquired, and health-care associated infections. The emergence and spread of carbapenem-resistant Enterobacteriaceae (CRE) have become an increasing concern for healthcare services worldwide. Infections caused by these bacteria have been associated with significant morbidity and mortality and treatment options have been limited. The rapid and accurate detection of carbapenem resistance in these bacteria is important for infection control. The aim of this study was to investigate the phenotypic and genotypic features of CRE strains isolated in a tertiary-level reference hospital in Turkey. A total of 181 CRE strains were included in the study. Antimicrobial susceptibility rates were tested using Vitek 2 system. Modified Hodge test (MHT) was performed using meropenem and ertapenem discs. Metallo-β-lactamase antimicrobial gradient test (E-test MBL strips) were used for evaluation of metallo-β-lactamase production. A multiplex PCR was used for detection of carbapenems resistance genes (IMP, VIM, KPC, NDM-1 and OXA-48). The OXA-48 gene was detected in 86 strains, NDM-1 gene in six strains, VIM gene in one strain. IMP and KPC genes were not identified. Three strains produced both OXA-48 and NDM-1 and one strain produced both OXA-48 and VIM. In two patients more than one genus of OXA-48 positive CREs was isolated. Ninety-two of the isolates were multidrug-resistant. One hundred and ten isolates were MHT with meropenem (MEM-MHT) positive and 109 isolates were MHT with ertapenem (ERT-MHT) positive. Nine of the isolates were positive with E-test MBL strips. The sensitivity of MEM-MHT and ERT-MHT for detection of OXA-48 was 70.9 and 70.6 %, respectively. MEM-MHT was found highly discriminative for OXA-48 Escherichia coli (p < 0.001). The sensitivity of E-test MBL for NDM-1 was 66.7 %. A statistically significant correlation was observed between OXA-48

Characteristics of Infective Endocarditis in a Tertiary Hospital in East China.

PubMed

Xu, Huimin; Cai, Siyu; Dai, Haibin

2016-01-01

The epidemiology, clinical presentation, and treatment of infective endocarditis (IE) has significantly changed over the past few years in developed countries. However, relevant data from developing countries are different and remain scarce. The objective of this study was to evaluate the clinical presentations, treatment and outcomes of IE patients in a tertiary hospital in East China over an 8-year period. This was a retrospective observational study of consecutive cases of definite or possible IE as per the modified Duke criteria between January 2008 and December 2015. A total of 135 definite and 39 probable IE cases were identified. The mean age was 47.8 ± 15.7 years, with a male preponderance (1.9: 1). Degenerative valve disease accounted for 30.5% cases of IE, followed by congenital heart disease (29.9%) and rheumatic heart disease (14.9%). Native cardiac valves were present in 93.7% of the IE patients. Echocardiography and blood culture were performed in all patients, of whom 55.2% were found to have large vegetations (≥10 mm) and the positive rate of blood culture was 60.3%. Streptococcus remained the chief causative agent that was identified in 61.9% of culture-positive patients. Glycopeptide antibacterials and cephalosporins were the most frequently used antimicrobial drugs for IE therapy. Seventy-six (43.7%) of the IE patients were surgically treated. The mortality rate during hospital stay was 10.9%. Our data reflected clinical and microbiological profile, and treatment of IE in a tertiary hospital located in the East China.

Characteristics of Infective Endocarditis in a Tertiary Hospital in East China

PubMed Central

Xu, Huimin; Cai, Siyu

2016-01-01

The epidemiology, clinical presentation, and treatment of infective endocarditis (IE) has significantly changed over the past few years in developed countries. However, relevant data from developing countries are different and remain scarce. The objective of this study was to evaluate the clinical presentations, treatment and outcomes of IE patients in a tertiary hospital in East China over an 8-year period. This was a retrospective observational study of consecutive cases of definite or possible IE as per the modified Duke criteria between January 2008 and December 2015. A total of 135 definite and 39 probable IE cases were identified. The mean age was 47.8 ± 15.7 years, with a male preponderance (1.9: 1). Degenerative valve disease accounted for 30.5% cases of IE, followed by congenital heart disease (29.9%) and rheumatic heart disease (14.9%). Native cardiac valves were present in 93.7% of the IE patients. Echocardiography and blood culture were performed in all patients, of whom 55.2% were found to have large vegetations (≥10 mm) and the positive rate of blood culture was 60.3%. Streptococcus remained the chief causative agent that was identified in 61.9% of culture-positive patients. Glycopeptide antibacterials and cephalosporins were the most frequently used antimicrobial drugs for IE therapy. Seventy-six (43.7%) of the IE patients were surgically treated. The mortality rate during hospital stay was 10.9%. Our data reflected clinical and microbiological profile, and treatment of IE in a tertiary hospital located in the East China. PMID:27861628

Evaluation of nutritional care of hospitalized children in a tertiary pediatric hospital.

PubMed

De Longueville, Caroline; Robert, Martine; Debande, Marjorie; Podlubnai, Sylviane; Defourny, Sophie; Namane, Sid-Ali; Pace, Aude; Brans, Camille; Cayrol, Elodie; Goyens, Philippe; De Laet, Corinne

2018-06-01

Hospitalized children are at risk of malnutrition. The aim of the present study was to evaluate a clinical practice in a tertiary hospital. The nutritional team developed a specific software for screening of malnutrition and risk of malnutrition (Evalnut) that provides also recommendations for the nutritional management of the patient. The data recorded into this program and the tool itself were analyzed and optimizations are highlighted. A retrospective study analyzed the data collected in 2015 during 4931 consecutive hospitalizations (3984 children) at the University Children's Hospital Queen Fabiola. Pivot tables analysis (Excel) of the database of the screening tool was compared with the clinical practice of the dietitians. First data processing excluded records with abnormal or missing values. Impact of nutritional care analysis needs at least 2 evaluations and a positive patient's height trend. In case of height equality, only length of hospital stays less than 2 weeks were kept. This study highlighted inaccurate database records related to imperfections of the computer program, missing or erroneous measures and incomplete encoding. First analysis on 3219 valid hospitalizations showed statistical correlations. Prevalence of malnutrition on admission was 33%, split into 14,5% acute malnutrition, 15% chronic malnutrition and 3,5% mixed malnutrition. Overall, 30,3% of the children were categorized at risk of developing malnutrition during their stay. Positive impact of nutritional management on the resulting nutritional status was demonstrated on the second data selection (352 hospitalizations): WFH median (interquartile range) increased from 96,1% (87,1-106,4) on admission to 96,9% (89,1-106,1) (p < 0,01) on discharge. An optimization of the existing software was finally proposed. In our hospital, the dietitians are the most aware on the importance of nutritional assessment and management during hospitalization. Encouraging results are obtained. Inclusion of

Extent, Nature, and Risk Factors of Workplace Violence in Public Tertiary Hospitals in China: A Cross-Sectional Survey

PubMed Central

Liu, He; Zhao, Siqi; Jiao, Mingli; Wang, Jingtao; Peters, David H.; Qiao, Hong; Zhao, Yuchong; Li, Ye; Song, Lei; Xing, Kai; Lu, Yan; Wu, Qunhong

2015-01-01

Using a cross-sectional survey design from 11 public tertiary hospitals (a specialist hospital, four Chinese medicine hospitals, and six general hospitals) in the urban areas of Heilongjiang, we determined the nature of workplace violence that medical staff have encountered in Chinese hospitals and identified factors associated with those experiences of violence. A total of 1129 health workers participated. The specialist hospital had the highest prevalence of physical violence (35.4%), while the general hospitals had the highest prevalence of non-physical violence (76%). Inexperienced medical staff (p < 0.001) were more likely to suffer non-physical violence than physical violence in Chinese medicine hospitals compared to experienced staff. Medical units (p = 0.001) had a high risk of non-physical violence, while surgical units (p = 0.005) had a high risk of physical violence. In general hospitals, staff with higher levels of anxiety about workplace violence were more vulnerable to both physical violence (1.67, 95% CI 1.36–2.10) and non-physical violence (1.309, 95% CI 1.136–1.508) compared to those with lower levels of anxiety, while rotating shift workers had a higher odds of physical violence (2.2, 95% CI 1.21–4.17) and non-physical violence (1.65, 95% CI 1.13–2.41) compared to fixed day shift workers. Thus, prevention should focus not only on high-risk sections of hospitals, but also on the nature of the hospital itself. PMID:26086703

[Experience of the surgical management of the esophageal achalasia in a tertiary care hospital].

PubMed

Barajas-Fregoso, Elpidio Manuel; Romero-Hernández, Teodoro; Sánchez-Fernández, Patricio Rogelio; Fuentes-Orozco, Clotilde; González-Ojeda, Alejandro; Macías-Amezcua, Michel Dassaejv

2015-01-01

Achalasia is a primary esophageal motor disorder. The most common symptoms are: dysphagia, chest pain, reflux and weight loss. The esophageal manometry is the standard for diagnosis. The aim of this paper is to determine the effectiveness of the surgical management in patients with achalasia in a tertiary care hospital. A case series consisting of achalasia patients, treated surgically between January and December of 2011. Clinical charts were reviewed to obtain data and registries of the type of surgical procedure, morbidity and mortality. Fourteen patients were identified, with an average age of 49.1 years. The most common symptoms were: dysphagia, vomiting, weight loss and pyrosis. Eight open approaches were performed and six by laparoscopy, with an average length of cardiomyotomy of 9.4 cm. Eleven patients received an antireflux procedure. The effectiveness of procedures performed was 85.7 %. Surgical management offered at this tertiary care hospital does not differ from that reported in other case series, giving effectiveness and safety for patients with achalasia.

A Qualitative Study of Psychosocial Problems among Parents of Children with Cerebral Palsy Attending Two Tertiary Care Hospitals in Western India

PubMed Central

Panchal, Dhara Antani

2014-01-01

Objective. To explore the psychosocial problems faced by the parents of children with cerebral palsy (CP) in rural and urban settings. Design. Qualitative research design using focus group discussions (FGDs) was used for the study. Setting. Two FGDs comprising one at a rural tertiary level care hospital and the other at an urban tertiary level care hospital were conducted. Participants. A total of thirteen parents participated in the two FGDs. Main Outcome Measured. Psychosocial problems experienced by the parents of children suffering from CP were measured. Results. The problems experienced by the mothers were associated with common themes such as disturbed social relationships, health problems, financial problems, moments of happiness, worries about future of the child, need for more support services, and lack of adequate number of trained physiotherapists. All the parents had children with problems since birth and most had approached various health care providers for a cure for their child. Conclusions. A wide range of psychosocial problems are experienced by the parents of children with CP. Studies like this can provide valuable information for designing a family centered care programme for children with CP. PMID:24967331

[Level of training in autistic spectrum disorders among hospital paediatricians].

PubMed

Martínez-Cayuelas, Elena; Ibáñez-Micó, Salvador; Ceán-Cabrera, Lourdes; Domingo-Jiménez, Rosario; Alarcón-Martínez, Helena; Martínez-Salcedo, Eduardo

2017-06-01

Training in autistic spectrum disorders is crucial in order to achieve an early diagnosis. However, the number of papers describing this training is limited. This study describes this level of knowledge among paediatricians from tertiary care hospitals in different regions of Spain and detects areas that need improvement. A total of one hundred and fifty-seven (157) paediatricians working in tertiary healthcare hospitals located in three different regions in Spain consented to complete an online questionnaire divided in three sections (socio-demographic, knowledge about childhood autism, and opinion). Data were analysed using SPSS version 15. The total mean score of participating paediatricians in the questionnaire was 20.34 (± 2.43 SD) out of a total possible score of 23. Approximately two-thirds (65%) of paediatricians scored more or equal to the mean score. The knowledge gap was found to be higher with symptoms of repetitive behaviour patterns, concept of autism, and comorbidity, with no statistical significance. There were no differences in paediatrician scores within different socio-demographic groups. Just under two-thirds (64%) of paediatricians subscribed to the opinion that their own knowledge about autism is limited, and there is a significant lack of knowledge about facilities in every region. There is a sufficient level of knowledge about autism among paediatricians in tertiary healthcare, although a lack of awareness about the management of these patients, with poor coordination between the different specialists that are involved in their treatment. Efforts should focus on achieving a better coordination between these specialists, and update the knowledge gaps identified. Copyright © 2016 Asociación Española de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

Causes of prolonged hospitalization among general internal medicine patients of a tertiary care center.

PubMed

Ruangkriengsin, Darat; Phisalprapa, Pochamana

2014-03-01

Unnecessary days of prolonged hospitalization may lead to the increase in hospital-related complications and costs, especially in tertiary care center Currently, there have not been many studies about the causes of prolonged hospitalization. Some identified causes could, however, be prevented and improved. To identify the prevalence, causes, predictive factors, prognosis, and economic burden of prolonged hospitalization in patients who had been in general internal medicine wards of the tertiary care center for 7 days or more. Retrospective chart review study was conducted among all patients who were admitted for 7 days or more in general internal medicine wards of Siriraj Hospital, the largest tertiary care center in Thailand. The period of this study was from 1 August 2012 to 30 September 2012. Demographic data, principle diagnosis, comorbid diseases, complications, discharge status, total costs of admission and percentage of reimbursement were collected. The causes of prolonged hospitalization at day 7, 14, 30, and 90 were assessed. Five hundred and sixty-two charts were reviewed. The average length of stay was 25.9 days. The two most common causes of prolonged admission at day 7 were treatment of main diagnosed disease with stable condition (27.6%) and waiting for completion of intravenous antibiotics administration with stable condition (19.5%). The causes of prolonged hospitalization at day 14 were unstable condition from complications (22.6%) and those waiting for completion of intravenous antibiotics administration with stable condition (15.8%). The causes of prolonged admission at day 30 were unstable conditions from complications (25.6%), difficulty weaning or ventilator dependence (17.6%), and caregiver problems (15.2%). The causes of prolonged hospitalization at day 90 were unstable condition from complications (30.0%), caregiver problems (30.0%), and palliative care (25.0%). Poor outcomes were shown in the patients admitted more than 90 days. Percentage

Patients' assessment of quality of care in public tertiary hospitals with and without accreditation: comparative cross-sectional study.

PubMed

Aboshaiqah, Ahmad E; Alonazi, Wadi B; Patalagsa, Joel Gonzales

2016-11-01

To compare patients' assessment of quality of care provided by public tertiary hospitals grouped according to accreditation status. Healthcare institutions worldwide are increasingly adopting accreditation as continuing initiative aimed at improving structures, processes and outcomes associated with quality of care. Patients being recipients of health care need to participate in assessing the quality of care they experienced while confined for therapeutic management. Comparative, cross-sectional. Data were collected from patients confined in public tertiary hospitals (n = 517 in four with accreditation and n = 542 in four without accreditation) in Riyadh, Saudi Arabia between February 2011-June 2011. Patients rated key performance indicators grouped under the dimensions of structure, process and outcome. Mann-Whitney U-test, Spearman Correlation Coefficient and coefficient of determination were used in analysing data. Patients in accredited public tertiary hospitals perceived structure, outcome and overall quality of care statistically higher than patients in non-accredited hospitals. No statistical differences were found in process (access and communication) indicators. Accreditation status is marginally associated with structure; outcome; and overall quality of care. The proportion of variance in the ranks of accreditation status explained the proportion of variance in the ranks of structure; outcome; and overall quality of care. The results apparently showed better structure, outcome and overall quality of care in accredited hospitals. Accreditation's association in the overall quality of care apparently remained unclear. Further studies are needed to appreciate the contribution of accreditation. © 2016 John Wiley & Sons Ltd.

Healthcare associated infections in Paediatric Intensive Care Unit of a tertiary care hospital in India: Hospital stay & extra costs.

PubMed

Sodhi, Jitender; Satpathy, Sidhartha; Sharma, D K; Lodha, Rakesh; Kapil, Arti; Wadhwa, Nitya; Gupta, Shakti Kumar

2016-04-01

Healthcare associated infections (HAIs) increase the length of stay in the hospital and consequently costs as reported from studies done in developed countries. The current study was undertaken to evaluate the impact of HAIs on length of stay and costs of health care in children admitted to Paediatric Intensive Care Unit (PICU) of a tertiary care hospital in north India. This prospective study was done in the seven bedded PICU of a large multi-specialty tertiary care hospital in New Delhi, India. A total of 20 children with HAI (cases) and 35 children without HAI (controls), admitted to the PICU during the study period (January 2012 to June 2012), were matched for gender, age, and average severity of illness score. Each patient's length of stay was obtained prospectively. Costs of healthcare were estimated according to traditional and time driven activity based costing methods approach. The median extra length of PICU stay for children with HAI (cases), compared with children with no HAI (controls), was seven days (IQR 3-16). The mean total costs of patients with and without HAI were ' 2,04,787 (US$ 3,413) and ' 56,587 (US$ 943), respectively and the mean difference in the total cost between cases and controls was ' 1,48,200 (95% CI 55,716 to 2,40,685, p<0.01). This study highlights the effect of HAI on costs for PICU patients, especially costs due to prolongation of hospital stay, and suggests the need to develop effective strategies for prevention of HAI to reduce costs of health care.

[Classification and monitoring of the appropriateness of emergency admissions in a tertiary hospital].

PubMed

López-Picazo Ferrer, J J; Tomás García, N; Cubillana Herrero, J D; Gómez Company, J A; de Dios Cánovas García, J

2014-01-01

To measure the appropriateness of hospital admissions, to classify its Clinical Services (CS) according to the level of inappropriateness, and to determine the usefulness of applying rapid assessment techniques (lot quality assurance sampling) in these types of measurements. A descriptive, retrospective study was conducted in a tertiary hospital to assess the clinical records of emergency admissions to the 12 CS with a higher volume of admissions, using the Appropriateness Evaluation Protocol (AEP). A four-level («A» to «D») increasingly inadequate admissions scale was constructed setting both standard and threshold values in every stratum. Every CS was classified in one of them using lot quality assurance sampling (LQAS). A total of 156 cases (13 cases from every CS) were assessed. The assessment effort (devoted time) was also estimated. There were 22.4±6.3% of inadequate admissions. In the CS classification, 9 (75%) got a good or acceptable appropriateness level, and only 1 (8%) got an inacceptable level. The time devoted was estimated at 17 hours. AEP is useful to assess the admission appropriateness and may be included in the «Emergencies» process management, although its variability prevents the use for external comparisons. If both LQAS and the appropriateness classification level and the global estimation (by unifying lot samples) are combined, the monitoring is affordable without a great effort. To extend these tools to other quality indicators requiring direct observation or clinical records, manual assessment could improve the monitoring efficiency. Copyright © 2013 SECA. Published by Elsevier Espana. All rights reserved.

[Status of subjective well-being for medical staff in a tertiary hospital].

PubMed

Deng, Yunlong; Liu, Yan; Xu, Shaorong; Zhao, Min; Li, Junping; Xiong, Yan

2016-06-28

To investigate the status of subjective well-being (SWB) for medical staffs who contact with patients directly in a tertiary hospital.
 Staffs from a tertiary hospital in Hunan province were investigated the SWB Scale (SWBS-cc20) from 2012 to 2014.
 The scores of SWB for medical staffs are high (81.67±12.33). Among the 10 sub-dimensions of SWB, medical staffs performed the best in family atmosphere, personal growth, and interpersonal adaptation, while performed the worst in physical health, mental health and material contentment. Title, job nature, education and occupation significantly affected the status of SWB. Staffs who directly connected with patients have less scores of SWB than those who do not (t=-4.80, P<0.001). Moreover, they perform better in contentment (OR=0.079, 95% CI 1.278 to 2.214, P<0.001), but worse in mental health (OR=1.315, 95% CI 1.023 to 1.690, P<0.05) and physical health (OR=1.313, 95% CI 1.029 to 1.677, P<0.05).
 Medical staffs have high scores of SWB. Staffs who directly connected with patients have less scores of SWB than those who do not. Moreover, they perform better in contentment, but worse in mental health and physical health.

Reverse transport of children from a tertiary pediatric hospital.

PubMed

McPherson, Mona L; Jefferson, Larry S; Smith, E O'Brian; Sitler, Garry C; Graf, Jeanine M

2007-01-01

The purpose of this study was to determine the epidemiology and resources used and to study the potential savings of pediatric reverse transport patients. A case control study was performed with patients undergoing a reverse or outbound transport from a large, pediatric hospital. Twenty-five children undergoing reverse transport were compared with matched controls. Lengths of stay and costs were compared between the reverse transport and matched control patients. Fifty-two percent of the reverse transport patients returned home, whereas 32% went home for end-of-life care and 16% went to other facilities. The average reverse transport was more than 400 miles and cost $6,064. The reverse transport of these patients did not save pediatric intensive care unit (PICU) days but did result in a shorter hospital stay compared with the matched controls (10 vs. 19 days, P = .03). Decreased utilization of bed days came from less use of intermediate care unit resources. Pediatric patients undergo reverse transports for a variety of reasons, often for end-of-life care. The ability to reverse transport pediatric patients may not save PICU bed days but may offer pediatric tertiary care hospitals a means to provide more intermediate care bed availability.

An Investigation of Tertiary-Level Learning in Some Practical Physics Courses

ERIC Educational Resources Information Center

Wang, Weili; Coll, Richard K.

2005-01-01

Experimental physics is seen as an essential part of tertiary physics education. Students are supposed to develop practical skills and advance from closed "cookbook" experiments to open experiment and design experiment procedures independently. As a consequence tertiary practical physics courses increase in the level of challenge…

The economic effect of a tertiary hospital-based heart failure program.

PubMed

Gregory, Douglas; DeNofrio, David; Konstam, Marvin A

2005-08-16

This study was designed to determine the economic effect of a tertiary heart failure (HF) program at an academic medical center. Most hospitals use cross-sectional financial models to analyze the economic contribution of clinical programs for a budget period. We estimated the incremental value of a tertiary hospital HF program on the basis of the longitudinal utilization of a sample of HF patients. The primary data source was a sample of 82 HF patients referred for cardiac transplant evaluation at an academic medical center during calendar years 2000 to 2001. Cumulative recurrent rates of utilization, cost, and reimbursement for hospital services were computed as functions of time using reliability models. The economic contribution of patients transplanted was contrasted with those not transplanted. Mean hospitalizations and outpatient encounters per patient at the end of the first year of follow-up for those transplanted were 2.1 (95% confidence interval [CI] 1.6 to 2.7) and 11.9 (95% CI 9.2 to 15.4), compared with 1.1 (95% CI 0.8 to 1.6) and 6.0 (95% CI 4.8 to 7.6), respectively, for those not transplanted. Mean revenue and direct cost per patient were 194,470 dollars (95% CI 136,683 dollars to 276,689 dollars) and 146,623 dollars (95% CI 96,377 dollars to 233,065 dollars), respectively, for transplanted patients and 43,587 dollars (95% CI 28,149 dollars to 67,503 dollars) and 33,424 dollars (95% CI 21,584 dollars to 51,760 dollars), respectively, for non-transplanted patients. The point estimates of first-year contribution margins per patient for transplanted and non-transplanted patients were 47,847 dollars and 10,163 dollars, respectively. Newly evaluated patients for cardiac transplantation at an academic medical center generated substantial incident demands for inpatient and outpatient services over a two-year follow-up period. The estimated contribution margin associated with these services was positive. Hospitals without cardiac transplantation that serve

Clinicians and their cameras: policy, ethics and practice in an Australian tertiary hospital.

PubMed

Burns, Kara; Belton, Suzanne

2013-09-01

Medical photography illustrates what people would prefer to keep private, is practiced when people are vulnerable, and has the power to freeze a moment in time. Given it is a sensitive area of health, lawful and ethical practice is paramount. This paper recognises and seeks to clarify the possibility of widespread clinician-taken medical photography in a tertiary hospital in northern Australia, examining the legal and ethical implications of this practice. A framework of Northern Territory law, state Department of Health policy and human rights theory were used to argue the thesis. Clinicians from 13 purposively chosen wards were asked to participate in an anonymous survey and confidential in-depth interviews. Questions were generated from the literature and local knowledge on the topics of 'occurrence', 'image use', 'quality of consent', 'cameras and technology', 'confidentiality', 'data storage and security', 'hospital policy and law' and 'cultural issues'. One hundred and seventy surveys and eights interviews were analysed using descriptive statistics and theme and content analysis, then triangulated for similarity, difference and unique responses. Forty-eight percent of clinicians surveyed take medical photographs, with the majority using hospital-owned cameras. However, one-fifth of clinicians reported photographing with personal mobile phones. Non-compliance with written consent requirements articulated in policy was endemic, with most clinicians surveyed obtaining only verbal consent. Labeling, storage, copyright and cultural issues were generally misunderstood, with a significant number of clinicians risking the security of patient information by storing images on personal devices. If this tertiary hospital does not develop a clinical photography action plan to address staff lack of knowledge, and noncompliance with policy and mobile phone use, patients' data is at risk of being distributed into the public domain where unauthorised publication may cause

Primary Immunodeficiency Diseases in Oman: 10-Year Experience in a Tertiary Care Hospital.

PubMed

Al-Tamemi, Salem; Naseem, Shafiq Ur Rehman; Al-Siyabi, Nabila; El-Nour, Ibtisam; Al-Rawas, Abdulhakim; Dennison, David

2016-11-01

Primary immunodeficiency (PID) diseases are rare, complex medical disorders that often are overlooked in clinical settings. There are emerging reports of PID from Middle Eastern populations. This study describes the features of PID patients in a tertiary care setting in Oman and compares them with regional and worldwide reports. Sultan Qaboos University Hospital (SQUH) is an academic tertiary care-level hospital for specialized healthcare, including PID patients. At the time of diagnosis, patients' sociodemographics, clinical features, laboratory investigations, and management were entered in electronic form. This study included patients seen between August 2005 and July 2015. One hundred forty patients were registered with a minimum estimated population prevalence of 7.0/100,000. The male/female ratio was 1.6:1, the median age of onset of symptoms was 8 months, and diagnosis was 21 months with a delay of 13 months. Family history was positive in 44 %, consanguinity was present in 76 %, death of a previous sibling was present in 36 %, and there was an overall mortality in 18 %, with an 85 % probability of survival 10 years following diagnosis. The most common type of immunodeficiency was phagocytic disorders (35.0 %), followed by predominantly antibody disorders (20.7 %), combined immunodeficiency (17.8 %), other well-defined PID syndromes (15.0 %), immune dysregulation syndromes (3.5 %), complement deficiencies (3.5 %), and unclassified immunodeficiency (4.2 %). The commonest presenting infection was pneumonia (47.1 %). PID is not a rare condition in Oman. The prevalence is in concordance with reports from the region but higher than in Western populations. The findings of the current study would help to improve the awareness and management of, and policy making for PID.

Factors affecting satisfaction level with the food services in a military hospital.

PubMed

Sahin, Bayram; Demir, Cesim; Celik, Yusuf; Teke, A Kadir

2006-10-01

To determine the factors affecting general satisfaction level of patients with the food services in a military hospital in Turkey. The study was carried out in a military hospital providing tertiary health care services with the capacity of 1000 hospital bed. A questionnaire was used as data collection tool on measuring satisfaction of the patients with the food services. The results showed that of 374 patients 51.3% evaluated food service quality adequate, 32.4% said that the food quality was inadequate, and 16.3% stated that they were uncertain. A logistic regression model was estimated in determining the most important and statistically significant factors affecting patient satisfaction with hospital foods and food services. The results showed that patient-specific demographic characteristics were insignificant in explaining satisfaction level with food services, but the variables of taste (OR = 9.853, p = 0.000) and appearance (OR = 2.687, p = 0.014) of the food were statistically significant and important determinants of patient satisfaction with the foods served at the hospital. The results of this study would be helpful in making decision on increasing the level of satisfaction of patients with the food services for hospital managers and the food (nutrition) departments. On the other hand, the results can also be used in benchmarking the hospital's food services quality with other hospitals, and in monitoring improvements in food services quality in the future.

Resistance patterns of multidrug resistant Acinetobacter baumannii in an ICU of a tertiary care hospital, Malaysia

PubMed Central

Janahiraman, Sivakami; Aziz, Muhammad Nazri; Hoo, Fan Kee; P’ng, Hon Shen; Boo, Yang Liang; Ramachandran, Vasudevan; Shamsuddin, Ahmad Fuad

2015-01-01

Backgrounds & Objective: Antimicrobial resistance is a major health problem worldwide in hospitals. The main contributing factors are exposures to broad-spectrum antimicrobials and cross-infections. Understanding the extent and type of antimicrobial use in tertiary care hospitals will aid in developing national antimicrobial stewardship priorities. Methods: In this study, we have analyzed the antimicrobial agents’ usage for acquisition of multidrug resistant using retrospective, cross-sectional, single-centre study in a multidisciplinary ICU at tertiary care hospital. Results: Acinetobacter baumannii (ACB) was isolated in various specimens from 662 patients. From these, 136 patients who were diagnosed with Ventilator-associated pneumonia (VAP) caused by ACB were included into the study. In our study, MDR strain accounts for 51% of all VAP cases caused by ACB. The development of ACB VAP were 10.5 + 6.4 days for MDR strains compared to susceptible organism (7.8 + 4.5 days) and had significantly longer ICU stay. Conclusion: The study concludes that prudent use of antimicrobial agents is important to reduce acquisition of MDR ACB. PMID:26870101

Profile of infective endocarditis at a tertiary-care hospital in Japan over a 14-year period: characteristics, outcome and predictors for in-hospital mortality.

PubMed

Hase, Ryota; Otsuka, Yoshihito; Yoshida, Kazuki; Hosokawa, Naoto

2015-04-01

The aims of this study were to describe the epidemiological features and clinical characteristics of infective endocarditis (IE) at a tertiary-care hospital in Japan and to identify the factors associated with in-hospital mortality. A retrospective observational study was conducted at a 925-bed tertiary-care teaching hospital in Japan. All adult patients diagnosed with definite IE between August 2000 and July 2014 according to the modified Duke criteria were included. A total of 180 patients (60.6% men; mean age, 69.1 years) with definite IE were included. The most common pathogen was Staphylococcus aureus (27.2%). Nine patients (5.0%) had culture-negative IE. Transthoracic and transoesophageal echocardiography were performed in 180 (100%) and 132 patients (73.3%), respectively, and vegetations were detected in 128 patients (71.1%). Surgical therapy was performed in 31 patients (17.2%). Overall, the in-hospital mortality rate was 26.1%. The independent predictors of in-hospital mortality were methicillin-resistant S. aureus (MRSA), vascular phenomena, health care-associated IE and heart failure. MRSA, vascular phenomena, health care-associated IE and heart failure were independent predictors of in-hospital mortality. The unique characteristics in our cohort were the very high mean age, low rate of culture-negative IE, high rate of definite IE without detected vegetations and predominance of S. aureus. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Knowledge, attitude and practice of standard precautions of infection control by hospital workers in two tertiary hospitals in Nigeria

PubMed Central

Pondei, Kemebradikumo; Adetunji, Babatunde; Chima, George; Isichei, Christian; Gidado, Sanusi

2015-01-01

Background: Standard precautions are recommended to prevent transmission of infection in hospitals. However, their implementation is dependent on the knowledge and attitudes of healthcare workers (HCW). This study describes the knowledge, attitude and practice (KAP) of standard precautions of infection control among HCW of two tertiary hospitals in Nigeria is described. Methods: A cross-sectional study was undertaken in 2011/2012 among HCW in two tertiary hospitals in Nigeria. Data was collected via a structured self-administered questionnaire assessing core elements of KAP of standard precautions. Percentage KAP scores were calculated and professional differences in median percentage KAP scores were ascertained. Results: A total of 290 HCW participated in the study (76% response rate), including 111 (38.3%) doctors, 147 (50.7%) nurses and 32 (11%) laboratory scientists. Overall median knowledge and attitude scores toward standard precautions were above 90%, but median practice score was 50.8%. The majority of the HCW had poor knowledge of injection safety and complained of inadequate resources to practise standard precautions. House officers, laboratory scientists and junior cadres of nurses had lower knowledge and compliance with standard precautions than more experienced doctors and nurses. Conclusion: Our results suggest generally poor compliance with standard precautions of infection control among HCW in Nigeria. Policies that foster training of HCW in standard precautions and guarantee regular provision of infection control and prevention resources in health facilities are required in Nigeria. PMID:28989394

Do doctors have hidden distress; a study conducted at tertiary care hospital at Lahore.

PubMed

Atif, Khaula; Khan, Habib Ullah; Malik, Adeela Farid

2016-01-01

Toanalyse the prevalence of distress in doctors serving in a tertiary care hospital and studying the factors having significant impact on the subject. The cross-sectional study was conducted at the Combined Military Hospital, Lahore, from February to December 2014, and comprised doctors serving for at least six months who volunteered to fill out the standardised General Health Questionnaire-12Demographic features and level of job satisfaction were taken as independent variables. Outcome variable was the questionnaire score. SPSS 20 was used for data analysis. The mean questionnaire score of the 97 respondents in the study was 12.27±6.397. Of them, 19(19.6%) and 11(11.3%) had distress and severe distress respectively. Marital status (p=0.006), age (p=0.029), income per month (p=0.010) and levels of job satisfaction (p=0.001) had significant impact on the scores. Variables having insignificant impact were gender (p=0.529), number of children (p=0.220), education (p=0.816), service years (p=0.155), current employment (p=0.504), nature of job (p=0.531), working hours (p=0.632), additional duties (p=0.663), and socioeconomic class (p=0.935). Almost one-third of the doctors had distress under the significant impact of multiple factors.

[Governance of tertiary referral hospitals in the Democratic Republic of the Congo: a critical interpretive synthesis of the literature].

PubMed

Karemere, H; Kahindo, J B; Ribesse, N; Macq, J

2013-01-01

Because hospitals are complex enterprises requiring adaptive systems, it is appropriate to apply the theory and terminology of governance or even better adaptive governance to the interpretation of their management. This study focused on understanding hospital governance in Logo, Bunia, and Katana, three hospitals in two regions of the eastern DRC, which has been characterized by intermittent armed conflict since 1996. In such a context of war and continuous insecurity, how can governance be interpreted for hospitals required to adapt to a constantly changing environment to be able to continue to provide health care? A critical interpretive synthesis of the literature, identified by searching for keywords related to governance. The concepts of governance, adaptive governance, performance, leadership, and complex adaptive system concepts are defined. The interpretation of the concepts helps us to better understand (1) the hospital as a complex adaptive system, (2) the governance of tertiary referral hospitals, (3) analysis of hospital performance, and (4) leadership for good governance of these hospitals. The interpretation of these concepts raises several questions about their application to the eastern DRC. Conclusion. This critical interpretive synthesis opens the door to a new way of exploring tertiary hospitals and their governance in the eastern DRC.

Six-month outcome in patients with myocardial infarction initially admitted to tertiary and nontertiary hospitals. RESCATE Investigators. Recursos Empleados en el Síndrome Coronario Agudo y Tiempos de Espera.

PubMed

Marrugat, J; Sanz, G; Masiá, R; Valle, V; Molina, L; Cardona, M; Sala, J; Serés, L; Szescielinski, L; Albert, X; Lupón, J; Alonso, J

1997-11-01

The aim of the present study was to ascertain whether the degree of accessibility to coronary angiography and revascularization results in differing usages or outcomes, or both, in the setting of a high coverage national health system. The selective use of coronary angiography and revascularization procedures in the management of acute myocardial infarction (MI) remains controversial. A cohort of 1,460 consecutive patients with a first MI admitted to four referral teaching hospitals (one with tertiary facilities) were followed up for 6 months after admission. Only patients initially admitted to each of the study hospitals were retained for analysis in the original hospital's cohort. End points were 6-month mortality and readmission for reinfarction, unstable angina, heart failure or severe ventricular arrhythmia. Patients admitted to the tertiary hospital were more likely to undergo coronary angiography (adjusted relative risk 4.22, 95% confidence interval [CI] 3.37 to 5.45) than those admitted to the nontertiary sites (use rate: 22.1% for nontertiary care, 55.5% for tertiary care). Revascularization procedures were performed in 21.2% of patients in the tertiary hospital and in 8.3% in the nontertiary hospitals (p < 0.0001). Median delay for emergency coronary angiography was shorter in the tertiary hospital (within 1 vs. 2 days, p < 0.0001). Six-month mortality or readmission rates were similar (23.7% and 24.7% for tertiary and nontertiary care, respectively). After adjustment for comorbidity and disease severity, the relative risk of death or readmission for the tertiary hospital was 1.03 (95% CI 0.69 to 1.53) times that of the nontertiary hospitals. Selective use of coronary angiography and revascularization procedures may be as effective as less restricted use in the management of acute MI.

Experience of Oesophageal atresia management in a tertiary Bangladeshi hospital.

PubMed

Islam, Md Kabirul

2018-01-16

Background and aim: This study has been conducted to determine the clinical presentations and surgical outcome of patients with OA admitted in a tertiary level hospital in Bangladesh. A prospective analysis was conducted for 32 patients with confirmed OA between July 2007 and June 2015. Of them surgical correction was done in 25 cases. The other 7, in whom surgery could not be done, were excluded from the study. Of the 25 cases, that had been operated, 15 were full term and 52% were more than 48 hours old. Type-C OA with TOF was the commonest type (96%). 24 cases were operated through Right Thoracotomy. Of them 52% were done by Single Lung (left) ventilation. 'Division of the fistula' with 'end to end anastomosis' was done in all of them. Only 1 patient had a Gastric pull up surgery. Of the 25 cases, 16 survived (64%). In follow up all the patients were found thriving and showed no problem in swallowing. Our study which shows 64% survival is a great achievement for us but not satisfactory in international standard. However, the experience and encouragement that we are gathering, will guide us to achieve better result in near future.

Abusive Head Trauma at a Tertiary Care Children's Hospital in Mexico City. A Preliminary Study

ERIC Educational Resources Information Center

Diaz-Olavarrieta, Claudia; Garcia-Pina, Corina A.; Loredo-Abdala, Arturo; Paz, Francisco; Garcia, Sandra G.; Schilmann, Astrid

2011-01-01

Objectives: Determine the prevalence, clinical signs and symptoms, and demographic and family characteristics of children attending a tertiary care hospital in Mexico City, Mexico, to illustrate the characteristics of abusive head trauma among this population. Methods: This is a cross-sectional descriptive study of infants and children under 5,…

Pregnancy of unknown location: Outcome in a tertiary care hospital.

PubMed

Amer, Nuzhat; Amer, Muhammad; Kolkaila, Mohamed Abdoh; Yaqoob, Shahida

2015-10-01

To find out the outcome of a cohort of women with pregnancy of unknown location presenting to a tertiary care hospital. The prospective study was conducted from January to December, 2011, at Early Pregnancy Assessment Unit, King Faisal Military Hospital, Khamis Mushait, Saudi Arabia. Data was collected for women with early pregnancy or with history of amenorrhoea, bleeding or pain. These women were investigated with serum beta-human chorionic gonadotrophin levels twice weekly and transvaginal ultrasonography weekly. Expectant management was done for failing pregnancy of unknown location while medical or surgical management was considered for persistent pregnancy of unknown location and ectopic pregnancy. During study period, 7215 patients were admitted, and, of them, 2212(30.6%) were patients with early pregnancy. Meeting the inclusion criteria were 183(2.53%) patients who formed the study sample. There were 131(71.6%) patients presenting with amenorrhoea, 90(49.2%) had bleeding and 93(50.8%) presented with pain. Outcome of 100(54.6%) patients was failing pregnancy of unknown location, 58(31.7%) had intrauterine pregnancy, 14(7.7%) converted to ectopic pregnancy, while 11(6%) had persistent pregnancy of unknown location. All patients with persistent pregnancy of unknown location and 5(36%) patients with ectopic pregnancy were medically treated. Five (36%) patients having ectopic pregnancy were managed surgically. Management of choice for asymptomatic patients having pregnancy of unknown location is expectant management. Most of the patients suspected to have Most of the patients with persistent pregnancy of unknown location and ectopic pregnancy can be managed medically.

HIGH LEVELS OF MONOAROMATIC COMPOUNDS LIMIT THE USE OF SOLID-PHASE MICROEXTRACTION OF METHYL TERTIARY BUTYL ETHER AND TERTIARY BUTYL ALCOHOL

EPA Science Inventory

Recently, two papers reported the use of solid-phase microextraction (SPME) with polydimethylsiloxane(PDMS)/Carboxen fibers to determine trace levels of methyl tertiary butyl ether (MTBE) and tertiary butyl alcohol (tBA) in water. Attempts were made to apply this technique to th...

Missed or Delayed Cervical Spine or Spinal Cord Injuries Treated at a Tertiary Referral Hospital in Rwanda.

PubMed

Nkusi, Agabe Emmy; Muneza, Sévérien; Hakizimana, David; Nshuti, Steven; Munyemana, Paulin

2016-03-01

This study was aimed at 1) reporting cases of missed cervical spine injuries treated at a tertiary-level hospital, King Faisal Hospital, Rwanda (KFH-R), and 2) identifying the causes of delaying the diagnosis. We prospectively collected data from patients with a missed or delayed cervical spine and/or cord injury treated at King Faisal Hospital, Kigali for a 12-month period (January 2012 to December 2012). The total number of cervical spine injury patients treated at our center was retrieved from the hospital admission registry. Forty-two patients with cervical spine or spinal cord injuries were treated at KFH-R in 2012, and 4 of them had a missed or delayed diagnosis. Clinical and radiologic findings of all 4 patients are presented, and the reasons for delaying diagnosis are identified. This study found that the cervical spine injuries were missed in 9.5% of the cervical spine trauma patients and resulted in a longer hospital stay for all 4 patients and severe disability in 1 patient (25%). The reasons for missed diagnoses in this study were 1) lack of cervical spine radiographic evaluation, 2) inadequate cervical spine radiographs to show the level of injury, 3) poor sensitivity of cervical spine plain radiography, 4) poor physical examination, 5) the presence of a distracting injury, and 6) poor sensitivity of radiographs and computed tomography scans for soft tissue injuries. Copyright © 2016 Elsevier Inc. All rights reserved.

[Nutritional status at the time of admission among patients admitted to a tertiary-care paediatric hospital].

PubMed

Durá Travé, Teodoro; San Martín García, Isabel; González Benavides, Aida; Vaquero Iñigo, Ibone; Herranz Aguirre, Mercedes; Iceta Elízaga, Ainhoa

2015-06-01

To analyze the nutrition status of the pediatric patients at the time of hospital admission throughout a calendar year in a tertiary level hospital and to identify those patients and/or groups of pathologies with a higher risk of malnutrition. Retrospective evaluation of nutrition status of 852 patients hospitalized in 2013 in a pediatric hospital (462 males and 390 females). Sex, age, body mass index at the moment of admission and days of hospitalization and diagnosis codified according to the International Classification of Diseases were registered. The prevalence of malnutrition patients registered at the moment of admission was 8.2%. Excess body weight (overweight and obesity) was detected in 18% of the patients. The diseases of the nervous system (22.9%), together with the diseases of the respiratory system, the infectious diseases (18.6%), the congenital malformations (11.4%) and the diseases of the genitorurinary system (8.6%) account for 84.4% of the cases with malnutrition. The overall prevalence rate for malnutrition in pediatric patients at the moment of admission in our hospital was 8.2%, being this figure similar to those published in occidental countries. It should be mandatory to accomplish an initial screening and follow up during hospitalization of younger patients and those suffering from diseases of the nervous and/or respiratory system and, especially, from congenital diseases. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

[Prevalence of depressive and anxiety disorders in cardiovascular outpatients from 14 tertiary general hospitals of 5 Chinese cities].

PubMed

Li, Guo; Jiang, Ronghuan; Guo, Chengjun; Liu, Meiyan; Zhang, Lijun

2014-12-01

To explore the prevalence of depression and (or) anxiety disorders among cardiovascular outpatients of tertiary general hospitals of five Chinese cities. A hospital-based cross-sectional survey was conducted in the cardiovascular out-patient departments of 14 tertiary general hospitals in five Chinese cities. The patients aged 18 years and over were recruited consecutively, who were conscious and with informed consent, and can finish the questionnaire independently. All the subjects were screened with Hospital Anxiety Depression Scale (HADS). The subjects with HADS score of 8 and over were interviewed and diagnosed by psychiatrists using mini international neuropsychiatric interview (MINI). The physicians made the diagnosis and management without knowing the results of MINI and HADS score. Subjects who refused MINI were defined as the case of loss of follow-up. A total 2 123 subjects were included in the survey. The adjusted prevalence rate of depressive and anxiety disorder was 4.05% (86/2 123), the depressive and/or anxiety disorder was 14.27 % (303/2 123), depressive and anxiety disorder and mixed depressive or anxiety disorder was 14.37% (305/2 123) according to MINI. The adjusted prevalence of lifetime depressive and anxiety disorder was 5.37% (114/2 123), depressive and/or anxiety disorder was 16.91% (359/2 123), depressive and anxiety disorder and mixed depressive-anxiety disorder was 17.00% (361/2 123). There is a high prevalence of depressive and anxiety disorder among cardiovascular outpatients from tertiary general hospitals in China. Therefore, doctors must pay attention to this disorder and try to reduce the impact of this disorder in cardiovascular patients.

Frequency and predictors of seasonal influenza vaccination and reasons for refusal among patients at a large tertiary referral hospital.

PubMed

Masnick, Max; Leekha, Surbhi

2015-07-01

We assessed frequency and predictors of seasonal influenza vaccination acceptance among inpatients at a large tertiary referral hospital, as well as reasons for vaccination refusal. Over 5 seasons, >60% of patients unvaccinated on admission refused influenza vaccination while hospitalized; "believes not at risk" was the reason most commonly given.

Determinants and influencing mechanism of outpatient satisfaction: a survey on tertiary hospitals in the People’s Republic of China

PubMed Central

Yu, Wenya; Li, Meina; Xue, Chen; Wang, Jingrui; Liu, Jiazhen; Chen, Haiping; Zhang, Lulu

2016-01-01

Objective Most patients in the People’s Republic of China prefer tertiary hospitals when seeking medical services. The aim of this study was to assess outpatient satisfaction with tertiary hospitals in the People’s Republic of China, test overall and subscale satisfaction, and explore whether sociodemographic characteristics lead to different degrees of satisfaction and whether subscale outpatient satisfaction contributes to overall satisfaction. Methods A closed questionnaire was given out to investigate outpatients’ sociodemographic characteristics, overall satisfaction, and various subtypes of satisfaction, and a 5-point Likert scale was employed to measure the degree of outpatient satisfaction. Descriptive analysis, Kruskal–Wallis test, Spearman’s rank correlation coefficient, and logistic regression analysis were employed for statistical analysis. Results Response rate was 92.48% (971/1,050). Outpatients’ sociodemographic characteristics (including sex, age, occupation, monthly income, residence, and marital status) were related to various subtypes of satisfaction to varying degrees. Outpatients who were male, older, married, with low or middle incomes, living in Shanghai or other areas of the People’s Republic of China, medical staff, or students were more satisfied with various subtypes of satisfaction than those without these characteristics. In further analyses, satisfaction with their medical needs being met by doctors had the strongest relation to overall satisfaction, followed by satisfaction with doctors’ service attitudes, medical costs, waiting time, prescription, and diagnosis and treatment time. Satisfaction with environment had the weakest contribution to overall satisfaction. Conclusion This study gave some suggestions for tertiary hospitals in advanced areas of the People’s Republic of China. Outpatient sociodemographic characteristics should be paid more attention by medical staff to improve the degree of satisfaction

Students' Conceptions of the Particulate Nature of Matter at Secondary and Tertiary Level

ERIC Educational Resources Information Center

Ayas, Alipasa; Ozmen, Haluk; Calik, Muammer

2010-01-01

The aim of the present study is to elicit students' understanding of the particulate nature of matter via a cross-age study ranging from secondary to tertiary educational levels. A questionnaire with five-item open-ended questions was administered to 166 students from the secondary to tertiary levels of education. In light of the findings, it can…

Inpatient antibiotic consumption in a regional secondary hospital in New Zealand.

PubMed

Hopkins, C J

2014-02-01

Reporting of antibiotic consumption in hospitals is a crucial component of antibiotic stewardship, but data from Australasian secondary hospitals are scarce. The hypothesis of this audit is that antibiotic consumption in secondary hospitals would be lower than in tertiary centres. The study aims to present the first published audit of antibiotic consumption from a secondary hospital in New Zealand compared with two tertiary centres. Hospital population-level data were retrospectively accessed to identify all systemic antibiotics dispensed to adult inpatients at Taranaki District Health Board during 2011. Consumption was calculated in defined daily doses per 100 inpatient-days and per 100 admissions, stratified by drug class. Comparison was against published data from two tertiary centres. Total consumption was lower, but that of high-risk antibiotic classes was higher than both tertiary centres. The relative consumption of lincosamides was 4.0 and 2.6 times higher than the two tertiary centres, with an associated 14% incidence of Clostridium difficile associated diarrhoea within 3 months. Our secondary hospital appears to consume the wrong types of antibiotic rather than too much. Data from all Australasian hospitals, stratified by clinical service area and hospital level, are required for clinically relevant benchmarking. © 2014 The Author; Internal Medicine Journal © 2014 Royal Australasian College of Physicians.

Explaining the uptake of paediatric guidelines in a Kenyan tertiary hospital--mixed methods research.

PubMed

Irimu, Grace W; Greene, Alexandra; Gathara, David; Kihara, Harrison; Maina, Christopher; Mbori-Ngacha, Dorothy; Zurovac, Dejan; Santau, Migiro; Todd, Jim; English, Mike

2014-03-10

Evidence-based standards for management of the seriously sick child have existed for decades, yet their translation in clinical practice is a challenge. The context and organization of institutions are known determinants of successful translation, however, research using adequate methodologies to explain the dynamic nature of these determinants in the quality-of-care improvement process is rarely performed. We conducted mixed methods research in a tertiary hospital in a low-income country to explore the uptake of locally adapted paediatric guidelines. The quantitative component was an uncontrolled before and after intervention study that included an exploration of the intervention dose-effect relationship. The qualitative component was an ethnographic research based on the theoretical perspective of participatory action research. Interpretive integration was employed to derive meta-inferences that provided a more complete picture of the overall study results that reflect the complexity and the multifaceted ontology of the phenomenon studied. The improvement in health workers' performance in relation to the intensity of the intervention was not linear and was characterized by improved and occasionally declining performance. Possible root causes of this performance variability included challenges in keeping knowledge and clinical skills updated, inadequate commitment of the staff to continued improvement, limited exposure to positive professional role models, poor teamwork, failure to maintain professional integrity and mal-adaptation to institutional pressures. Implementation of best-practices is a complex process that is largely unpredictable, attributed to the complexity of contextual factors operating predominantly at professional and organizational levels. There is no simple solution to implementation of best-practices. Tackling root causes of inadequate knowledge translation in this tertiary care setting will require long-term planning, with emphasis on

Analysis of orbital malignancies presenting in a tertiary care hospital in Pakistan

PubMed Central

Khan, Asad Aslam; Sarwar, Suhail; Sadiq, Mohammad Ali A; Ahmad, Imran; Tariq, Nayab; Sibghat-ul-Noor

2017-01-01

Objective: To determine the frequencies of various orbital malignancies amongst orbital lesions in patients presenting in a tertiary care hospital in Pakistan. Methods: A retrospective analysis of 666 orbital cases with an established histopathological diagnosis of malignant tumors treated in Mayo Hospital Lahore from 1996 to 2015 (20 years). Results: About 66% of the malignant tumors were primary, 25% secondary, 8% haematopoietic and 1% metastatic. Almost 50% of the cases were children. Retinoblastoma is the commonest tumor (43% overall and 87% among children). Squamous cell carcinoma is the second commonest (15.6% overall and 31% among adults). These are then followed by Adenoid cystic carcinoma of Lacrimal Gland (9%), Lymphoma/Leukaemia (8%) and Rhabdomyosarcoma (6.3%). Conclusion: Frequencies of various orbital malignancies show geographical variation in both paediatric and adult population. PMID:28367175

Reducing waiting time and raising outpatient satisfaction in a Chinese public tertiary general hospital-an interrupted time series study.

PubMed

Sun, Jing; Lin, Qian; Zhao, Pengyu; Zhang, Qiongyao; Xu, Kai; Chen, Huiying; Hu, Cecile Jia; Stuntz, Mark; Li, Hong; Liu, Yuanli

2017-08-22

It is globally agreed that a well-designed health system deliver timely and convenient access to health services for all patients. Many interventions aiming to reduce waiting times have been implemented in Chinese public tertiary hospitals to improve patients' satisfaction. However, few were well-documented, and the effects were rarely measured with robust methods. We conducted a longitudinal study of the length of waiting times in a public tertiary hospital in Southern China which developed comprehensive data collection systems. Around an average of 60,000 outpatients and 70,000 prescribed outpatients per month were targeted for the study during Oct 2014-February 2017. We analyzed longitudinal time series data using a segmented linear regression model to assess changes in levels and trends of waiting times before and after the introduction of waiting time reduction interventions. Pearson correlation analysis was conducted to indicate the strength of association between waiting times and patient satisfactions. The statistical significance level was set at 0.05. The monthly average length of waiting time decreased 3.49 min (P = 0.003) for consultations and 8.70 min (P = 0.02) for filling prescriptions in the corresponding month when respective interventions were introduced. The trend shifted from baseline slight increasing to afterwards significant decreasing for filling prescriptions (P =0.003). There was a significant negative correlation between waiting time of filling prescriptions and outpatient satisfaction towards pharmacy services (r = -0.71, P = 0.004). The interventions aimed at reducing waiting time and raising patient satisfaction in Fujian Provincial Hospital are effective. A long-lasting reduction effect on waiting time for filling prescriptions was observed because of carefully designed continuous efforts, rather than a one-time campaign, and with appropriate incentives implemented by a taskforce authorized by the hospital managers. This

Validity of subjective global assessment as a screening method for hospital malnutrition. Prevalence of malnutrition in a tertiary hospital.

PubMed

Moriana, Miriam; Civera, Miguel; Artero, Ana; Real, Jose T; Caro, Juan; Ascaso, Juan F; Martinez-Valls, Jose F

2014-04-01

Hospital malnutrition is a highly prevalent problem that affects patient morbidity and mortality resulting in longer hospital stays and increased healthcare costs. Although there is no single nutritional screening method, subjective global assessment (SGA) may be a useful, inexpensive, and easily reproducible tool. A cross-sectional, observational, randomized study was conducted in 197 patients in a tertiary hospital. SGA, anthropometric data, and biochemical parameters were used to assess the nutritional status of study patients. Fifty percent of subjects were malnourished according to SGA. A higher prevalence of malnutrition was found in medical (53%) as compared to surgical departments (47%). Half the subjects (50%) had malnutrition by SGA, but only 37.8% received nutritional treatment during their hospital stay. Mean hospital stay was longer for patients malnourished (13.5 days) or at risk of malnutrition (12.1 days) as compared to well nourished subjects (6.97 days). SGA significantly correlated (P<.012) with anthropometric and biochemical malnutrition parameters. Prevalence of hospital malnutrition is very high in both medical and surgical departments and is inadequately treated. SGA is a useful tool for screening hospital malnutrition because of its high degree of correlation with anthropometric and biochemical parameters. Copyright © 2013 SEEN. Published by Elsevier Espana. All rights reserved.

Outcomes of in-hospital, out of intensive care and operation theatre cardiac arrests in a tertiary referral hospital.

PubMed

Chakravarthy, Murali; Mitra, Sona; Nonis, Latha

2012-01-01

Cardiac arrest in the hospital wards may not receive as much attention as it does in the operation theatre and intensive care unit (ICU). The experience and the qualifications of personnel in the ward may not be comparable to those in the other vital areas of the hospital. The outcome of cardiac arrest from the ward areas is a reasonable surrogate of training of the ward nurses and technicians in cardiopulmonary resuscitation. We conducted an audit to assess the issues surrounding the resuscitation of cardiac arrest in areas other than operation theatre and ICU in a tertiary referral hospital. AIMS OF THE AUDIT: To assess the outcomes of cardiac arrest in a tertiary referral hospital. Areas such as wards, dialysis room and emergency room were considered for the audit. This is a retrospective observational audit of the case records of all the adult patients who were resuscitated from 'code blue'. Data for 2 years from 2007 was analysed by a research fellow unconnected with the resuscitations. Twenty-two thousand three hundred and forty-four patients were admitted as in-patients to the hospital during the 2 years, starting May 2007 through May 2009. One hundred code blue calls were received during this time. Twenty-two of the total calls received were false. Among the 78 confirmed cardiac arrests 69 occurred in the wards, 2 in emergency room, 1 in cardiac catheterisation laboratory and 3 in dialysis room. Twenty-eight patients were declared dead after unsuccessful cardiopulmonary resuscitation. Among the 50 who were resuscitated with a return of spontaneous rhythm 26 died. Twenty-four patients were discharged (survival rate of 30%). The survival decreased significantly as the age progressed beyond 60. The resuscitation rates were better in day shifts in contrast to the night. Higher survival was noted in patients who received resuscitation in less than a minute. A overall survival to discharge rate of 30% was noted in this audit. Higher survival rates might be

Outcomes of in-hospital, out of intensive care and operation theatre cardiac arrests in a tertiary referral hospital

PubMed Central

Chakravarthy, Murali; Mitra, Sona; Nonis, Latha

2012-01-01

Objective Cardiac arrest in the hospital wards may not receive as much attention as it does in the operation theatre and intensive care unit (ICU). The experience and the qualifications of personnel in the ward may not be comparable to those in the other vital areas of the hospital. The outcome of cardiac arrest from the ward areas is a reasonable surrogate of training of the ward nurses and technicians in cardiopulmonary resuscitation. We conducted an audit to assess the issues surrounding the resuscitation of cardiac arrest in areas other than operation theatre and ICU in a tertiary referral hospital. Aims of the audit To assess the outcomes of cardiac arrest in a tertiary referral hospital. Areas such as wards, dialysis room and emergency room were considered for the audit. Methods This is a retrospective observational audit of the case records of all the adult patients who were resuscitated from ‘code blue’. Data for 2 years from 2007 was analysed by a research fellow unconnected with the resuscitations. Results Twenty-two thousand three hundred and forty-four patients were admitted as in-patients to the hospital during the 2 years, starting May 2007 through May 2009. One hundred code blue calls were received during this time. Twenty-two of the total calls received were false. Among the 78 confirmed cardiac arrests 69 occurred in the wards, 2 in emergency room, 1 in cardiac catheterisation laboratory and 3 in dialysis room. Twenty-eight patients were declared dead after unsuccessful cardiopulmonary resuscitation. Among the 50 who were resuscitated with a return of spontaneous rhythm 26 died. Twenty-four patients were discharged (survival rate of 30%). The survival decreased significantly as the age progressed beyond 60. The resuscitation rates were better in day shifts in contrast to the night. Higher survival was noted in patients who received resuscitation in less than a minute. Conclusion A overall survival to discharge rate of 30% was noted in this

Prevalence and causes of blindness at a tertiary hospital in Douala, Cameroon

PubMed Central

Eballé, André Omgbwa; Mvogo, Côme Ebana; Koki, Godefroy; Mounè, Nyouma; Teutu, Cyrille; Ellong, Augustin; Bella, Assumpta Lucienne

2011-01-01

Purpose The aim of this study was to determine the prevalence and causes of bilateral and unilateral blindness in the town of Douala and its environs based on data from the ophthalmic unit of a tertiary hospital in Douala. Methods We conducted a retrospective epidemiological survey of consultations at the eye unit of the Douala General Hospital over the last 20 years (from January 1, 1990 to December 31, 2009). Results Out of the 1927 cases of blindness, 1000 were unilateral, corresponding to a hospital prevalence of 1.84% and 927 cases were bilateral, corresponding to a hospital prevalence of 1.71%. No statistically significant difference was noted between the two (P = 0.14). The leading causes of bilateral blindness were cataract (50.1%), glaucoma (19.7%), and diabetic retinopathy (7.8%) while the leading causes of unilateral blindness were cataract (40.4%), glaucoma (14.1%), and retinal detachment (9.1%). Cataract (51.2%), cortical blindness (16.3%), and congenital glaucoma (10%) were the leading causes of bilateral blindness in children aged less than 10 years. Conclusion Blindness remains a public health problem in the Douala region with a hospital prevalence which is relatively higher than the national estimate given by the National Blindness Control Program. PMID:21966211

Lessons learned from the development of health applications in a tertiary hospital.

PubMed

Park, Joong-Yeol; Lee, Guna; Shin, Soo-Yong; Kim, Jeong Hun; Han, Hye-Won; Kwon, Tae-Wan; Kim, Woo Sung; Lee, Jae Ho

2014-03-01

Adoption of smart devices for hospital use has been increasing with the development of health applications (apps) for patient point-of-care and hospital management. To promote the use of health apps, we describe the lessons learned from developing 12 health apps in the largest tertiary hospital in Korea. We reviewed and analyzed 12 routinely used apps in three categories-Smart Clinic, Smart Patient, and Smart Hospital-based on target users and functions. The log data for each app were collected from the date of release up until December 2012. Medical personnel accessed a mobile electronic medical record app classified as Smart Clinic an average of 452 times per day. Smart Hospital apps are actively used to communicate with each other. Patients logged on to a mobile personal health record app categorized as Smart Patient an average of 222 times per day. As the mobile trend, the choice of supporting operating system (OS) is more difficult. By developing these apps, a monitoring system is needed for evaluation. We described the lessons learned regarding OS support, device choice, and developmental strategy. The OS can be chosen according to market share or hospital strategic plan. Smartphones were favored compared with tablets. Alliance with an information technology company can be the best way to develop apps. Health apps designed for smart devices can be used to improve healthcare. However, to develop health apps, hospitals must define their future goals and carefully consider all the aspects.

Factors associated with patients' choice of physician in the Korean population: Database analyses of a tertiary hospital.

PubMed

Kim, Kidong; Ahn, Soyeon; Lee, Banghyun; Lee, Kibeom; Yoo, Sooyoung; Lee, Kyogu; Suh, Dong Hoon; No, Jae Hong; Kim, Yong Beom

2018-01-01

This study aimed to determine the factors influencing patients' choice of physician at the first visit through database analysis of a tertiary hospital in South Korea. We collected data on the first treatments performed by physicians who had treated patients for at least 3 consecutive years over 10 years (from 2003 to 2012) from the database of Seoul National University's affiliated tertiary hospital. Ultimately, we obtained data on 524,012 first treatments of 319,004 patients performed by 115 physicians. Variables including physicians' age and medical school and patients' age were evaluated as influencing factors for the number of first treatments performed by each physician in each year using a Poisson regression through generalized estimating equations with a log link. The number of first treatments decreased over the study period. Notably, the relative risk for first treatments was lower among older physicians than among younger physicians (relative risk 0.96; 95% confidence interval 0.95 to 0.98). Physicians graduating from Seoul National University (SNU) also had a higher risk for performing first treatments than did those not from SNU (relative risk 1.58; 95% confidence interval 1.18 to 2.10). Finally, relative risk was also higher among older patients than among younger patients (relative risk 1.03; 95% confidence interval 1.01 to 1.04). This study systematically demonstrated that physicians' age, whether the physician graduated from the highest-quality university, and patients' age all related to patients' choice of physician at the first visit in a tertiary university hospital. These findings might be due to Korean cultural factors.

Distinguishing between tertiary and secondary facilities: a case study of cardiac diagnostic-related groups (DRGs).

PubMed

Rouse, Paul; Arulambalam, Ajit; Correa, Ralph; Ullman, Cornelia

2010-05-14

To develop a classification of tertiary cardiac DRGs in order to investigate differences in tertiary/secondary product mix across New Zealand district health boards (DHBs). 67 DRGs from 85,442 cardiac cases were analysed using cost weights and patient comorbidity complexity levels, which were used as a proxy for complexity. The research found high variability of severity within some DRGs. 5 DHBs are the main providers of 27 DRGs which are high cost and identified as tertiary by several ADHB clinicians; the same 5 DHBs have on average higher severity by DRG than the other DHBs. NZ tertiary hospitals have a product mix of DRGs with higher complexity than secondary hospitals. Funding based on case weights needs to recognise the additional resource requirements for this higher complexity.

Socioeconomic factors affecting patients’ utilization of primary care services at a Tertiary Teaching Hospital in Riyadh, Saudi Arabia

PubMed Central

Alsubaie, Abdulaziz M.; Almohaimede, Khaled A.; Aljadoa, Abdulrahman F.; Jarallah, Osamah J.; Althnayan, Yasser I.; Alturki, Yousef A.

2016-01-01

Background: Primary care services utilization is dependent on socioeconomic factors. It is proven that variation in socioeconomic factors result in discrepancies in the use of such services. Admittedly, research is limited on the socioeconomic factors affecting the utilization of primary care services in Saudi Arabia. Objectives: The aim of this research was to study the effect of the main socioeconomic factors affecting patients' utilization of primary care services at a tertiary teaching hospital, Riyadh, Saudi Arabia. Materials and Methods: A cross-sectional study was conducted from January to February 2014 in a primary care clinic of a tertiary teaching hospital in Riyadh city; subjects selected using a random consecutive sampling technique. A self-administered questionnaire in Arabic was given to the participants to collect the data which comprised sociodemographic data, utilization measures, and health needs. The data were analyzed using SPSS version 21. Results: A total of 358 subjects participated in the study. The main factors that best determine the utilization of primary health care clinic in a tertiary teaching hospital were the possession of a health insurance (P = 0.046, odds ratio [OR] = 8.333), and bad self-health-perception (P < 0.014, OR: 2.088). Chronic illness was also associated with higher utilization (OR = 2.003). Conclusion: Our results reveal that chronic health problems, self-health-perception, and health insurance are the most significant socioeconomic factors affecting the utilization of primary care services. PMID:26929723

Prevalence of antibodies against Treponema pallidum among HIV-positive patients in a tertiary care hospital in Mexico.

PubMed

Mata-Marín, José Antonio; Sandoval-Sánchez, Juan Joel; Huerta-García, Gloria; Arroyo-Anduiza, Carla Ileana; Alcalá-Martínez, Enrique; Mata-Marín, Luis Alberto; Sandoval-Ramirez, Jorge Luis; Gaytán-Martínez, Jesús

2015-02-01

Our objective was to determine the seroprevalence of syphilis among HIV-infected patients in a tertiary care hospital in Mexico City. A cross-sectional study was developed, and 318 HIV-positive patients were evaluated from January to February 2013 at Hospital de Infectología, National Medical Center 'La Raza' (a tertiary care hospital specialising in infectious diseases in Mexico City). Laboratory data were screened for the detection of antibodies against Treponema pallidum. Patients completed a questionnaire relating to socio-demographic data and factors associated with syphilis. Of the 318 patients, 83% were men. The mean age ± SD was 36 ± 11 years; 52% were men who have sex with men and 47% had undertaken higher education. The overall seroprevalence of syphilis among these patients was 25% (95% confidence interval 21%, 30%). Men who have sex with men had a significantly higher seroprevalence (30% vs. 15%, p = 0.009). We conclude that, in Mexico, there is a high seroprevalence of syphilis antibodies in HIV-infected patients and that men who have sex with men are the group most affected. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Patterns of Hospital Performance on the Hospital-Wide 30-Day Readmission Metric: Is the Playing Field Level?

PubMed

Hoyer, Erik H; Padula, William V; Brotman, Daniel J; Reid, Natalie; Leung, Curtis; Lepley, Diane; Deutschendorf, Amy

2018-01-01

significantly worse HWR performance. Hospice service (aOR 0.64, 95% CI 0.50-0.82, p < 0.001) and having a higher proportion of total discharges being surgical cases (aOR 0.62, 95% CI 0.50-0.76, p < 0.001) were associated with better performance. The study approach was not intended to be an alternate readmission metric to compete with the existing CMS metric, which would require a re-examination of patient-level data combined with hospital-level data. A number of hospital-level characteristics (such as academic tertiary care center status) were significantly associated with worse performance on the CMS-calculated HWR metric, which may have important health policy implications. Until the reasons for readmission variability can be addressed, reporting the current HWR metric as an indicator of hospital quality should be reevaluated.

Muddy puddles - the microbiology of puddles located outside tertiary university teaching hospitals.

PubMed

Furukawa, M; McCaughan, J; Stirling, J; Millar, B C; Bell, J; Goldsmith, C E; Reid, A; Misawa, N; Moore, J E

2018-04-01

In the British Isles, the frequency of rain results in the formation of puddles on footpaths and roads in/around hospitals. No data are available demonstrating the microbiological composition of such puddles and therefore a study was undertaken to examine the microbiology of puddles in the grounds of two tertiary university-teaching hospitals (18 sites) and compared with control puddles from non-hospital rural environments (eight sites), estimating (i) total viable count; (ii) identification of organisms in puddles; (iii) enumeration of Escherichia coli: (iv) detection of Extended Spectrum β-Lactamase producing organisms and (v) direct antimicrobial susceptibility testing. A mean count of 2·3 × 10 3  CFU per ml and 1·0 × 10 9  CFU per ml was obtained for hospital and non-hospital puddles respectively. Isolates (n = 77; 54 hospital and 23 non-hospital) were isolated comprising of 23 species among 17 genera (hospital sites), where the majority (10/16; 62·5%) of genera identified were Gram-negative approximately, a fifth (20·6%) were shared by hospital and non-hospital rural samples. Escherichia coli was detected in half of the hospital puddles and under-half (37·5%) of the rural puddles extended spectrum β-lactamase organisms were not detected in any samples examined. Rainwater puddles from the hospital and non-hospital environments contain a diverse range of bacteria, which are capable of causing infections. This study demonstrated the presence of a wide diversity of bacterial taxa associated with rainwater puddles around hospitals, many of which are capable of causing human disease. Of clinical significance is the presence of Pseudomonas aeruginosa isolated from a hospital puddle, particularly for patients with cystic fibrosis. The presence of potentially disease-causing bacteria in puddles in and around hospitals identifies a new potential environmental reservoir of bacteria. Furthermore work is now needed to define their potential of entering or

Socioeconomic status and utilization of amblyopia services at a tertiary pediatric hospital in Canada.

PubMed

Sharma, Abhishek; Wong, Agnes M F; Colpa, Linda; Chow, Amy H Y; Jin, Ya-Ping

2016-12-01

To evaluate whether socioeconomic status is associated with equal utilization of amblyopia services at The Hospital for Sick Children (SickKids), a pediatric tertiary hospital in Canada. This is a retrospective, cross-sectional study. The medical records of children aged under 7 years diagnosed with amblyopia at SickKids from 2007 to 2009 were reviewed. Socioeconomic status was derived from patients' residential postal codes through linking with income data in the 2006 Canadian census report. Patients were divided into 5 income quintiles to compare with amblyopia service utilization. The main outcome measure was the observed distribution of amblyopia patients by socioeconomic status versus the expected distribution of 20% for each quintile. The analyses included 336 patients. Children with amblyopia at SickKids were more likely to come from the richest neighbourhood (32.5%), whereas children from each of the 3 lowest quintiles (14.6%-15.5%) were less likely to present at SickKids. These results differed significantly from the expected 20% for each quintile (p < 0.0001). All types of amblyopia were significantly under-represented for children from the lower socioeconomic groups. When analyses were stratified by travel distance to the hospital, a significant inequality between the lower and higher income quintiles remained for nonmetropolitan Toronto patients, but not for metropolitan Toronto patients. Despite a publicly funded health-care system in Canada, children from lower socioeconomic neighbourhoods in distant areas utilize the amblyopia services in a tertiary pediatric centre less often than those from higher socioeconomic status. Copyright © 2016 Canadian Ophthalmological Society. All rights reserved.

Hospital-associated methicillin-resistant Staphylococcus aureus: A cross-sectional analysis of risk factors in South African tertiary public hospitals

PubMed Central

Kuonza, Lazarus; Musekiwa, Alfred; Iyaloo, Samantha; Perovic, Olga

2017-01-01

Introduction Hospital-associated methicillin-resistant S. aureus (HA-MRSA) remains a significant cause of morbidity and mortality worldwide. We conducted a study to determine risk factors for HA-MRSA in order to inform control strategies in South Africa. Methods We used surveillance data collected from five tertiary hospitals in Gauteng and Western Cape provinces during 2014 for analysis. A case of HA-MRSA was defined as isolation of MRSA from a blood culture 48 hours after admission and/or if the patient was hospitalised in the six months prior to the current culture. Multivariable logistic regression modelling was used to determine risk factors for HA-MRSA. Results Of the 9971 patients with positive blood cultures, 7.7% (772) had S. aureus bacteraemia (SAB). The overall prevalence of MRSA among those with SAB was 30.9% (231/747; 95% confidence interval [CI] 27.6%– 34.3%). HA-MRSA infections accounted for 28.3% of patients with SAB (207/731; 95% CI 25.1%– 31.7%). Burns (adjusted odds ratio [aOR] 12.7; 95% CI 4.7–34.4), age ≤1 month (aOR 8.7; 95% CI 3.0–24.6), residency at a long-term care facility (aOR 5.2; 95% CI, 1.5–17.4), antibiotic use within two months of the current SAB episode (aOR 5.1; 95% CI 2.8–9.1), hospital stay of 13 days or more (aOR 2.8; 95% CI 1.3–5.6) and mechanical ventilation (aOR 2.2; 95% CI 1.07–4.6), were independent risk factors for HA-MRSA infection. Conclusion The prevalence of MRSA remains high in South African tertiary public hospitals. Several identified risk factors of HA-MRSA infections should be considered when instituting infection and prevention strategies in public-sector hospitals, including intensifying the implementation of antimicrobial stewardship programmes. There is an urgent need to strengthen infection prevention and control in burn wards, neonatal wards, and intensive care units which house mechanically ventilated patients. PMID:29145465

Patterns of Debate in Tertiary Level Asynchronous Text-Based Conferencing

ERIC Educational Resources Information Center

Coffin, Caroline; Painter, Clare; Hewings, Ann

2005-01-01

Argumentation can be defined at different levels and serve different purposes, but its role in knowledge understanding and construction has given it a central place in education, particularly at tertiary level. The advent of computer-supported text-based conferences has created new sites where such educational dialogues can take place, but the…

Head and Neck Tuberculosis: Scenario in a Tertiary Care Hospital of North Eastern India

PubMed Central

Das, Debajit; Bhuyan, Uttal Taranga; Saikia, Nabajyoti

2016-01-01

Introduction Tuberculosis has affected mankind since time immemorial and with emergence of AIDS both extrapulmonary and pulmonary tuberculosis presents increased morbidity and mortality along with an increased financial burden upon the developing nations. Materials and Methods The study is a hospital based observational study of one year duration carried out in the Department of ENT in a tertiary care hospital of North Eastern India. Results Total of 63 cases were detected. Females comprised 60.3% of the study population as against 39.7% males. Most commonly affected age group were of 15 to 24 years age (57.1%). Cervical tubercular lymphadenitis was the most common lesion 90.5% (57 cases) followed by laryngeal tuberculosis 7.9% (5 cases) and tubercular otitis media with mastoiditis 1.6% (1 case). Level II lymph node was mostly affected either single or in groups (75.4%) followed by level III node (57.9%). Successful outcome of the treatment with Category I regimen was achieved in 96.8% of the cases. Conclusion Head and neck tuberculosis is not an uncommon disease and though cervical lymphadenitis is the most common presentation, isolated involvement of the larynx, ear and other subsites are not an entirely unknown entity. The clinical presentation of tuberculosis of the head and neck region can be varied and often misleading. It is therefore important for the clinician to be aware of the condition and consider it in their differential diagnosis. PMID:26894099

A tertiary hospital audit of the use of medical imaging in the 24 h preceding death.

PubMed

Liu, D; Weil, J; Boughey, M; Sutherland, T

2016-02-01

This study aims to investigate the number, modality and indication for imaging studies performed on acute hospital inpatients in the 24 h prior to death. Data were obtained from retrospective analysis of deceased patients from a university affiliated tertiary hospital over a 2-year period and it was found that around one in five inpatients received medical imaging in the last 24 h of their life (364 of 1855, 19.6%). © 2016 Royal Australasian College of Physicians.

Audit of anesthetic trainees' 'hands-on' operating room experience in an Australian tertiary children's hospital.

PubMed

Hogan, Bridget; Keating, Matthew; Chambers, Neil A; von Ungern-Sternberg, Britta

2016-05-01

There are no internationally accepted guidelines about what constitutes adequate clinical exposure during pediatric anesthetic training. In Australia, no data have been published on the level of experience obtained by anesthetic trainees in pediatric anesthesia. There is, however, a new ANZCA (Australian and New Zealand College of Anaesthetists) curriculum that quantifies new training requirements. To quantify our trainees' exposure to clinical work in order to assess compliance with new curriculum and to provide other institutions with a benchmark for pediatric anesthetic training. We performed a prospective audit to estimate and quantify our anesthetic registrars' exposure to pediatric anesthesia during their 6-month rotation at our institution, a tertiary pediatric hospital in Perth, Western Australia. Our data suggest that trainees at our institution will achieve the new ANZCA training standards comfortably, in terms of the required volume and breadth of exposure. Experience, however, of some advanced pediatric anesthetic procedures appears limited. Experience gained at our hospital easily meets the new College requirements. Experience of fiber-optic intubation and regional blocks would appear insufficient to develop sufficient skills or confidence. The study provides other institutions with information to benchmark against their own trainee experience. © 2016 John Wiley & Sons Ltd.

Herpes–Zoster Infection in a Tertiary Hospital in Brazil

PubMed Central

Antoniolli, Luciana; Azambuja, Aline; Rodrigues, Camila; Borges, Rafael; Goldani, Luciano

2017-01-01

Abstract Background herpes zoster (HZ) is a common infection with potential complications requiring hospital care, especially for patients with multiple comorbities. However, there is little information on HZ from hospital registries. Methods we searched for hospital-based records of B02 code (ICD-10) between March 2000 and January 2017 at Hospital de Clínicas de Porto Alegre, a tertiary, university hospital in south Brazil. To avoid misclassifications, we considered clinical evaluation for the diagnosis of cutaneous HZ and postherpetic neuralgia (PHN), ophthalmological evaluation for ophthalmic HZ and the combination of clinical, radiologic and cerebrospinal fluid analysis for HZ meningo-encephalitis (ME). We analyzed conditions associated with immune dysregulation, complications, length of hospital stay, and mortality. Chi-square test and Kaplan-Meier estimator were used for statistical analyses. P < 0.05 was considered statistically significant. Results there were 847 records for this period, of which 801 were confirmed according to our criteria and included in the analysis. Most patients were women (n = 448; 60%), with an average of 48.8 years, standard deviation of 22.2. There were more diagnoses in the inpatients group (74.4%), and fewer in the emergency room (22.4%) and outpatient (3.3%). The median length of hospital stay was 7 days (2-10, P25-P75) when HZ was the main reason for admission. Most patients presented cutaneous HZ (n = 743, 92.8%). There were fewer cases of PHN (6.1%), ophthalmic HZ (7.6%) and ME (4.1%). Seventy percent had some kind of immune dysregulation; more frequently AIDS (31%), use of immunosuppressive agents (18.7%) and malignant disease (16.2%). We followed the subjects for a median of 28.2 (2.8-77.5) months. During this period, there were 105 (13.1%) deaths. Five were related to HZ ME. The 30-day overall mortality rate was 1.5%. There was no statistical difference in cumulative survival (graph 1, P = 0.05) or incidence of

Effectiveness of Using Games in Tertiary-Level Mathematics Classrooms

ERIC Educational Resources Information Center

Afari, Ernest; Aldridge, Jill M.; Fraser, Barry J.

2012-01-01

The primary focus of this study was to investigate the effectiveness of games when used in tertiary-level mathematics classes in the United Arab Emirates. Our study incorporated a mixed-method approach that involved surveys (to assess students' perceptions of the learning environment and attitudes towards mathematics), interviews, observations of…

Improving mental health service users' with medical co-morbidity transition between tertiary medical hospital and primary care services: a qualitative study.

PubMed

Cranwell, Kate; Polacsek, Meg; McCann, Terence V

2016-07-26

Mental health service users have high rates of medical co-morbidity but frequently experience problems accessing and transitioning between tertiary medical and primary care services. The aim of this study was to identify ways to improve service users' with medical co-morbidity care and experience during their transition between tertiary medical hospitals and primary care services. Experience-based co-design (EBCD) qualitative study incorporating a focus group discussion. The study took place in a large tertiary medical service, incorporating three medical hospitals, and primary care services, in Melbourne, Australia. A purposive sample of service users and their caregivers and tertiary medical and primary care clinicians participated in the focus group discussion, in August 2014. A semi-structured interview guide was used to inform data collection. A thematic analysis of the data was undertaken. Thirteen participants took part in the focus group interview, comprising 5 service users, 2 caregivers and 6 clinicians. Five themes were abstracted from the data, illustrating participants' perspectives about factors that facilitated (clinicians' expertise, engagement and accessibility enhancing transition) and presented as barriers (improving access pathways; enhancing communication and continuity of care; improving clinicians' attitudes; and increasing caregiver participation) to service users' progress through tertiary medical and primary care services. A sixth theme, enhancing service users' transition, incorporated three strategies to enhance their transition through tertiary medical and primary care services. EBCD is a useful approach to collaboratively develop strategies to improve service users' with medical co-morbidity and their caregivers' transition between tertiary medical and primary care services. A whole-of-service approach, incorporating policy development and implementation, change of practice philosophy, professional development education and support for

Prevalence of Clostridium difficile infection and colonization in a tertiary hospital and elderly community of North-Eastern Peninsular Malaysia.

PubMed

Zainul, N H; Ma, Z F; Besari, A; Siti Asma, H; Rahman, R A; Collins, D A; Hamid, N; Riley, T V; Lee, Y Y

2017-10-01

Little is known about Clostridium difficile infection (CDI) in Asia. The aims of our study were to explore (i) the prevalence, risk factors and molecular epidemiology of CDI and colonization in a tertiary academic hospital in North-Eastern Peninsular Malaysia; (ii) the rate of carriage of C. difficile among the elderly in the region; (iii) the awareness level of this infection among the hospital staffs and students. For stool samples collected from hospital inpatients with diarrhea (n = 76) and healthy community members (n = 138), C. difficile antigen and toxins were tested by enzyme immunoassay. Stool samples were subsequently analyzed by culture and molecular detection of toxin genes, and PCR ribotyping of isolates. To examine awareness among hospital staff and students, participants were asked to complete a self-administered questionnaire. For the hospital and community studies, the prevalence of non-toxigenic C. difficile colonization was 16% and 2%, respectively. The prevalence of CDI among hospital inpatients with diarrhea was 13%. Out of 22 C. difficile strains from hospital inpatients, the toxigenic ribotypes 043 and 017 were most common (both 14%). In univariate analysis, C. difficile colonization in hospital inpatients was significantly associated with greater duration of hospitalization and use of penicillin (both P < 0·05). Absence of these factors was a possible reason for low colonization in the community. Only 3% of 154 respondents answered all questions correctly in the awareness survey. C. difficile colonization is prevalent in a Malaysian hospital setting but not in the elderly community with little or no contact with hospitals. Awareness of CDI is alarmingly poor.

Estimation of Need for Palliative Care among Noncancer Patients Attending a Tertiary Care Hospital.

PubMed

Prasad, Parvathy; Sarkar, Sonali; Dubashi, Biswajit; Adinarayanan, S

2017-01-01

Palliative care services, until recently, were mainly restricted to cancer patients with incurable diseases. Hence, evaluative studies of palliative care are sparse in areas other than oncology. To estimate what proportion of patients attending the Departments of Neurology, Cardiology, and Nephrology of Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Puducherry, required palliative care and to identify the palliative care needs of those patients. This was an exploratory descriptive study conducted in the three departments of JIPMER. There was no predetermined sample size for the study. The participants were all adult inpatients and outpatients who were in need of palliative care in the departments of Cardiology, Nephrology, and Neurology on the day of study. Percentage distribution was used to analyze the categorical variables such as education, gender, age, patients in need of palliative care, and their needs. The study showed that one in ten non-cancer patients in tertiary care hospitals may require palliative care services. Apart from issues in physical domain, a substantial proportion of participants also had issues in the psychological, emotional, and financial domains. This study highlights the need for incorporation and initiation of palliative care services in other non-cancer specialties in tertiary care hospitals to ensure holistic management of such cases. Counseling service has also to be rendered as part of palliative care since a good share of the patients had psychological and emotional issues.

Sexually Transmitted Infections: Experience in a Multidisciplinary Clinic in a Tertiary Hospital (2010-2013).

PubMed

Moreno-Ribera, N; Fuertes-de Vega, I; Blanco-Arévalo, J L; Bosch-Mestres, J; González-Cordón, A; Estrach-Panella, T; García-de Olalla, P; Alsina-Gibert, M

2016-04-01

The number of consultations for sexually transmitted infections (STIs) is increasing in Spain. The aim of this study was to describe and analyze the epidemiological, behavioral, clinical, and microbiological characteristics of patients registered at the STI unit of a tertiary hospital. This was a retrospective, single-center descriptive study carried out between 2010 and 2013 in a multidisciplinary unit specialized in STIs, situated in a tertiary hospital. Epidemiological, clinical, and behavioral data were gathered using a face-to-face interview and a standardized questionnaire. Samples were collected for microbiology analysis. The study included 546 patients: 96% were men, 41% had human immunodeficiency virus (HIV) infection, and 56% were men who have sex with men. The reasons for consultation were the following: urethritis; genital, anal, or perianal ulcers; proctitis; oral ulcers; sexual contact with a person with a known STI; and high-risk sexual contact. The most common microbiological diagnoses were Neisseria gonorrhoeae in urethritis, Treponema pallidum in genital and anal or perianal ulcers, and Chlamydia trachomatis lymphogranuloma venereum serovars in proctitis. The highest prevalences of the main STIs studied occurred in homosexual men with HIV infection. This study confirms the increase in the incidence of STIs in recent years and the epidemiological characteristics of the HIV/STI epidemic in Spain. Copyright © 2015 AEDV. Published by Elsevier España, S.L.U. All rights reserved.

Industrial accident-related ocular emergencies in a tertiary hospital in Singapore.

PubMed

Ngo, C S; Leo, S W

2008-04-01

We present a review of industrial accident-related ocular trauma, from the perspective of the emergency setting of a tertiary hospital in Singapore. A retrospective analysis of patients seen by Tan Tock Seng Hospital's emergency ophthalmology service over a six-month period was performed. Data on clinical presentation, cause of injury, use of protective eyewear and subsequent losses of days-of-work were collected via a standardised telephone interview and review of case-sheets. A total of 300 persons presented with a diagnosis of industrial accident-related ocular trauma, out of the 1,460 patients seen during the study period. 95.7 percent were non-residents and the average age was 31 years. 99.3 percent were males. 66.0 percent were provided with protective eyewear, while 44.7 percent of those were non-compliant. The most common types of injuries were superficial foreign body (71.3 percent), chemical injury (10 percent) and blunt trauma (4 percent), while severe injury requiring admission and emergency surgery occurred in 15 cases. Average loss of days of work was 3.4 days. Industrial accident-related ocular trauma comprises a relatively large proportion of the patients requiring ophthalmic review at the emergency service level in Singapore. These patients are mainly young, non-resident men and the injuries were generally minor. These are largely preventable with the use of well-fitting protective eyewear and strict compliance. This would greatly reduce the unnecessary loss of workdays. Therefore, there is a need to review the design, and reinforce the strict implementation of occupational eye safety programmes, especially among non-resident workers.

Utilization of arterial blood gas measurements in a large tertiary care hospital.

PubMed

Melanson, Stacy E F; Szymanski, Trevor; Rogers, Selwyn O; Jarolim, Petr; Frendl, Gyorgy; Rawn, James D; Cooper, Zara; Ferrigno, Massimo

2007-04-01

We describe the patterns of utilization of arterial blood gas (ABG) tests in a large tertiary care hospital. To our knowledge, no hospital-wide analysis of ABG test utilization has been published. We analyzed 491 ABG tests performed during 24 two-hour intervals, representative of different staff shifts throughout the 7-day week. The clinician ordering each ABG test was asked to fill out a utilization survey. The most common reasons for requesting an ABG test were changes in ventilator settings (27.6%), respiratory events (26.4%), and routine (25.7%). Of the results, approximately 79% were expected, and a change in patient management (eg, a change in ventilator settings) occurred in 42% of cases. Many ABG tests were ordered as part of a clinical routine or to monitor parameters that can be assessed clinically or through less invasive testing. Implementation of practice guidelines may prove useful in controlling test utilization and in decreasing costs.

[Efficacy and safety of tertiary hospital guided and community-driven family self-help cardiac rehabilitation model].

PubMed

Ding, R J; Gao, L M; Chu, L; Xie, W L; Wang, X R; Tang, Q; Wang, H L; Hu, D Y

2017-03-24

Objective: To explore the efficacy and safety of tertiary hospital guided and community-driven family self-help cardiac rehabilitation model. Methods: This study was a prospective randomized controlled study, 80 patients from Beijing Electrical Power Hospital and Beijing Jingmei Group General Hospital with acute coronary syndrome were included from June to December 2015 and divided into 2 groups. Patients in rehabilitation group ( n =52) received tertiary hospital(Peiking University Peoples' Hospital) guided and community-driven family self-help cardiac rehabilitation for 3 months, and patients in control group ( n =28) received routine secondary treatment for 3 months. Following parameters including 6 minutes walk distance, score of life quality (evaluated by Short Form-12), score of anxiety (evaluated by Generalized Anxiety Disorder-7), score of depression (evaluated by Perceived Health Questionnaire-9), self-management competency (evaluated by questionnaire) were collected at baseline and after treatment for 3 months. Results: Compared with control group, 6 minutes walk distance was longer in rehabilitation group((60.2±6.8) meters vs. (24.9±10.5)meters, P <0.01). The difference values between after and before intervention of life quality scores((0.14±3.90)scores vs.(-7.44±5.85)scores, P >0.05), anxiety scores((-0.16±2.12 ) scores vs.(0.70±1.13)scores, P >0.05) and depression scores((-1.17±2.79) scores vs.(0.60±0.36)scores, P >0.05) were similar between the 2 groups. The amplification of patients with regular exercise (50.26% vs. 0, P <0.05), limit sugary foods usually and always (53.22% vs. 3.98%, P <0.05), eat 200-400 g fruits usually and always (78.61 % vs. 0, P <0.05), eat 300-500 g vegetables usually and always (9.74% vs. 0, P <0.05), and answering very confident to questions such as let the physicians know about your diseases (40.17% vs. 5.00%, P <0.05), know how to take medicines (44.52% vs. 5.00%, P <0.05), know how much exercise was right for

Family practice obstetrics in a teaching hospital. Does a tertiary care environment make a difference?

PubMed Central

Jordan, J. M.; Gaspar, D.

1995-01-01

OBJECTIVE: To determine referral rates, to study the nature of consultations with obstetricians, and to examine how both patient and physician characteristics affect referrals. DESIGN: Case series. Retrospective review of hospital records. SETTING: Victoria Hospital, a tertiary care centre affiliated with the University of Western Ontario in London, Ont. PARTICIPANTS: Five hundred forty-two women admitted consecutively for delivery under the care of family physicians from October 1, 1990, to September 31, 1991. OUTCOME MEASURE: The number and types of obstetrical consultations obtained for the study population. RESULTS: Of the 50.7% of cases requiring consultation, half were delivered by obstetricians. The most common reasons for consultation were failure to progress in labour, induction of labour, posterior presentation, fetal distress, and pregnancy-induced hypertension. The most common reasons for obstetricians to attend delivery were to perform forceps rotations and cesarean sections. CONCLUSIONS: Parity and risk classification were the two most important factors for predicting whether consultation would occur. The high rate of consultation in this study might relate to ease of access to consultation in a tertiary care environment. More study is needed to examine the reasons for consultation because it seems that some of the situations for which obstetricians were consulted could have been safely managed by family physicians. PMID:7787491

Accountability of Tertiary Education at the National Level: A Chimera?

ERIC Educational Resources Information Center

Lindsay, Alan; O'Byrne, Garry

1979-01-01

The concept of accountability and its application to Australian higher education are discussed. It is suggested that due to political, financial, and educational characteristics of tertiary education at the national system level there are fundamental and insoluble problems associated with achieving accountability. (SF)

Availability of antidotes and key emergency drugs in tertiary care hospitals of Punjab and assessment of the knowledge of health care professionals in the management of poisoning cases.

PubMed

Arslan, Naheed; Khiljee, Sonia; Bakhsh, Allah; Ashraf, Muhammad; Maqsood, Iram

2016-03-01

This study was conducted to evaluate the availability of antidotes/key emergency drugs in tertiary care hospitals of the Punjab province, and to assess the knowledge of health care professionals in the stocking and administration of antidotes in the proper management of poisoning cases. Seventeen (n=17) tertiary care hospitals of Punjab Pakistan were selected. Two performas (A and B) were designed for 26 antidotes/key emergency drugs and given to the hospital pharmacists and physicians respectively. It was observed that Activated Charcoal, being the universal antidote was found only in 6 hospitals (41%). Digoxin Immune Fab, Edentate Calcium disodium and Glucagon were not available in emergency department of any hospital and even not included in the formulary of any hospital. About 80% pharmacists were aware of the method of preparation of Activated Charcoal and 85% physicians were familiar with its route of administration. Data showed that tertiary care hospitals of Punjab do not stock antidotes according to national drug policy. Moreover the study strongly suggests the development of health care centers and professional by organizing antidote awareness programs, continuous education and record keeping of poisonous cases and availability of emergency drugs around the clock.

Evaluation of day care versus inpatient cataract surgery performed at a Jiangsu public Tertiary A hospital.

PubMed

Zhuang, Min; Cao, Juan; Cui, Minglan; Yuan, Songtao; Liu, Qinghuai; Fan, Wen

2018-06-05

High cataract incidence and low cataract surgical rate are serious public health problems in China, despite the fact that efficient day care cataract surgery has been implemented in some public Tertiary A hospitals in China. In this study, we compared not only clinical outcomes, hospitalization time and total costs but also payment manners between day care and inpatient procedures for cataract surgery in a Jiangsu public Tertiary A hospital to put forward several instructional suggestions for the improvement of government medical policies. In total, 4151 day care cases and 2509 inpatient cases underwent the same cataract surgery in the day care ward and ordinary ward respectively, and were defined as two groups. General information, complications, postoperative best corrected visual acuity (BCVA), hospitalization time, total costs and especially payment method were analyzed to compare day care versus inpatient. The general data display no significant differences (P > 0.05), and no significant difference between complications and postoperative BCVA were observed between the two groups (P > 0.05). The period of stay in hospital was significantly different (P < 0.001). The total costs were lower for day care than for inpatients (P < 0.001). To avoid sampling error, we analyzed the data of payment manner for each patient among this period. Day care patients tended to pay for the procedure using the Urban Employees Basic Medical Insurance (UEBMI) method, while inpatients tended to use the Out-of-Pocket Medical Treatment (OMT) payment method (P < 0.001). Day surgery of cataract is more cost-effective and efficient than inpatient surgery with equivalent clinical outcomes. As an efficient therapeutic regimen, day care surgery should be further promoted and supported by the government policies.

Physician job satisfaction in Saudi Arabia: insights from a tertiary hospital survey.

PubMed

Aldrees, Turki; Al-Eissa, Sami; Badri, Motasim; Aljuhayman, Ahmed; Zamakhshary, Mohammed

2015-01-01

Job satisfaction refers to the extent to which people like or dislike their job. Job satisfaction varies across professions. Few studies have explored this issue among physicians in Saudi Arabia. The objective of this study is to determine the level and factors associated with job satisfaction among Saudi and non-Saudi physicians. In this cross-sectional study conducted in a major tertiary hospital in Riyadh, a 5-point Likert scale structured questionnaire was used to collect data on a wide range of socio-demographic, practice environment characteristics and level and consequences of job satisfaction from practicing physicians (consultants or residents) across different medical specialties. Logistic regression models were fitted to determine factors associated with job satisfaction. Of 344 participants, 300 (87.2%) were Saudis, 252 (73%) males, 255 (74%) married, 188 (54.7%) consultants and age [median (IQR)] was 32 (27-42.7) years. Overall, 104 (30%) respondents were dissatisfied with their jobs. Intensive care physicians were the most dissatisfied physicians (50%). In a multiple logistic regression model, income satisfaction (odds ratio [OR]=0.448 95% CI 0.278-0.723, P < .001) was the only factor independently associated with dissatisfaction. Factors adversely associated with physicians job satisfaction identified in this study should be addressed in governmental strategic planning aimed at improving the healthcare system and patient care.

The role of the neonatal nurse practitioner in the community hospital level I nursery.

PubMed

Hatch, Julie

2012-01-01

Neonatal nurse practitioners (NNPs) have played a significant role in providing medical coverage to many of the country's Level III neonatal intensive care units (NICUs). Extensive education and experience are required for a nurse practitioner (NP) to become competent in caring for these critically ill newborns. The NNP can take this competence and experience and expand her role out into the community Level I nurseries. Clinical care of the infants and close communication with parents, pediatricians, and the area tertiary center provide a community service with the goal of keeping parents and babies together in the community hospital without compromising the health of the baby. The NNP service, with 24-hour nursery and delivery coverage, supports an ongoing obstetric service to the community hospital. The NNP's experience enables her to provide a neonatal service that encompasses a multitude of advanced practice nursing roles.

Referrals to integrative medicine in a tertiary hospital: findings from electronic health record data and qualitative interviews.

PubMed

Griffin, Kristen H; Nate, Kent C; Rivard, Rachael L; Christianson, Jon B; Dusek, Jeffery A

2016-07-25

To examine patterns of, and decision-making processes, informing referrals for inpatient access to integrative medicine (IM) services at a large, acute care hospital. Retrospective electronic health record review and structured qualitative interviews. A 630-bed tertiary care hospital with an IM service available to inpatients. IM referrals of all inpatients aged ≥18 years between July 2012 and December 2014 were identified using the hospital's electronic health record. Fifteen physicians, 15 nurses and 7 administrators were interviewed to better understand roles and perspectives in referring patients for IM services. In the study hospital, primary sources of referrals for IM services were the orthopaedic and neuroscience/spine service lines. While the largest absolute number of IM referrals was made for patients with lengths of stay of 3 days or fewer, a disproportionate number of total IM referrals was made for patients with long lengths of stay (≥10 days), compared with a smaller percentage of patients in the hospital with lengths of stay ≥10 days. Physicians and nurses were more likely to refer patients who displayed strong symptoms (eg, pain and anxiety) and/or did not respond to conventional therapies. IM referrals were predominantly nurse-initiated. A built-in delay in the time from referral initiation to service delivery discouraged referrals of some patients. Conventional providers refer patients for IM services when these services are available in a tertiary hospital. Referral patterns are influenced by patient characteristics, operational features and provider perspectives. Nurses play a key role in the referral process. Overcoming cultural and knowledge differences between conventional and IM providers is likely to be a continuing challenge to providing IM in inpatient settings. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Hearing Screening in a Tertiary Care Hospital in India

PubMed Central

Shah, Neha; Patel, Kalpesh B.; Vishwakarma, Rajesh

2015-01-01

Introduction: To study the incidence of hearing loss among children and to determine and confirm the distribution of common risk factors in children with hearing loss presenting at a tertiary care hospital in India. Materials and Methods: Babies underwent hearing screening using Transient Evoked Otoacoustic Emission (TEOAE) and Automated Auditory Brainstem Response (AABR) from November 2009 to September 2011. It was a cross-sectional study carried out at our institute involving 500 babies (≤2 y). To identify the high risk babies, Joint Committee on Infant Hearing (2007) High risk registry was used. Results: In our study 110 (22%) babies belonged to high risk category and 11(2.2%) of total screened babies had significant hearing loss. Total number of babies who passed the initial screening with TEOAE was 284 (56.8%). On diagnostic AABR screening of TEOAE REFERRED babies, the babies with no risk factor showed normal AABR tracings whereas from among those with one or multiple risk factors (110 babies), 11(10%) showed different levels of hearing impairment. Hearing loss was highly associated with Neonatal Intensive Care Unit (NICU) admission i.e. 8/11(72.7%), followed by Low Birth Weight (LBW) and hypoxia (6/11 i.e. 54.5% each). Conclusion: Hearing loss is more common in those babies with risk factors (majority being NICU admission, LBW and hypoxia). OAE and ABR screening of infants at risk for significant hearing loss is a clinically efficient and cost effective approach for early detection of significant hearing loss. PMID:25954639

Point Prevalence of Chronic Wounds at a Tertiary Hospital in Nigeria.

PubMed

Iyun, Ayodele O; Ademola, Samuel A; Olawoye, Olayinka A; Michael, Afie I; Oluwatosin, Odunayo M

2016-02-01

Chronic wounds are a drain on resources both for the patient and health institution. Management of chronic wounds based on evidence-based practice requires baseline data for adequate planning. This study was carried out to determine the point prevalence of chronic wounds in a tertiary hospital (University College Hospital, Ibadan, Nigeria) and utilize this information for subsequent wound care planning. The study was carried out within a 1-month period and included all patients seen in the hospital with chronic wounds. The data obtained was entered into a designed form and was subsequently analyzed. There were 48 patients with 78 wounds representing approximately 11% of patients seen in the Department of Plastic, Reconstructive, and Aesthetic Surgery each month. Their ages ranged from 3 months to 80 years; the median age was 48 years. The male to female ratio was 1.6 to 1. The duration of the wounds ranged from 6 weeks to 780 weeks; the median duration of the wounds was 10 weeks. The area of the wounds ranged from 1 cm(2) -1,248 cm(2) (median 24 cm(2)). The most common chronic wounds were diabetic wounds, followed by pressure ulcers, postinfection ulcers, posttraumatic ulcers, burn wounds, malignant ulcers, and venous ulcers. The point prevalence data serves as a basis for wound care planning. This, in turn, should result in improved wound management grounded in evidence-based practices.

A Description of Weekend Physiotherapy Services in Three Tertiary Hospitals in the Greater Toronto Area

PubMed Central

Hill, Kylie

2010-01-01

ABSTRACT Purpose: The aims of this study were (1) to describe the cardiorespiratory physiotherapy weekend service (PWS) at three tertiary hospitals in the Greater Toronto Area (GTA) and (2) to compare measures of staff burden among the clinical service areas in one of the hospitals that had a programme-based management structure. Method: Two focus-group meetings were held with physiotherapists from hospitals within the GTA. Thereafter, variables characterizing the PWS were collected over 8 months, using a standardized data-collection form. Results: A total of 632 data-collection forms were received. Response rates exceeded 75% at each hospital. Workload variables, including the number of patient visits, new referrals per hour, and the proportion of staff completing unpaid overtime, differed between the hospitals (p<0.002). There was no difference in any variable when data were compared between Saturday, Sunday, and statutory holidays (p>0.13). Workload measures varied between clinical service areas at the hospital that provided PWS using a programme-based approach. Conclusions: These findings highlight the important shortcomings of a programme-based management approach to providing PWS and may constitute a catalyst for change. PMID:21359048

Imprudent Gastro-protective Approach in Majority of Specialists’ Clinics of a Tertiary Hospital

PubMed Central

Patel, Hardik Rameshbhai

2016-01-01

Introduction One out of four prescriptions in out-patient departments contains a gastro-protective drug (APUD) - PPI/ H2 Blockers/ Antacids/ Ulcer Protective’s. These drugs should be prescribed only when there is a justified indication. To assess the prescriptions of gastro-protective agents for appropriateness and rationality, in a tertiary care hospital setup. Materials and Methods It was a cross-sectional observational study conducted from Aug 2013 to Dec 2013 at OPDs of a Tertiary Care Teaching Hospital, Pune. A total of 260 prescriptions containing gastro-protective agents were analysed for appropriateness and rationality. Rationality of drug use was assessed by referring to standard textbooks and guidelines. Cost difference data was analysed by Wilcoxon signed rank test using GraphPad Prism 6. Results Most common class of gastro-protective agents was Proton pump inhibitors (PPIs)-73.77% (Pantoprazole & Dexrabeprazole). Only 37.3% prescriptions had an adequate indication for these drugs {GI prophylaxis (29.6%) and Acid Peptic Disease treatment (7.7%)}. Two irrational Fixed dose combinations found in the study were PPI with prokinetic agent (n=65) and Proton Pump Inhibitor + NSAID combination (n=2). Formulation, spelling and strength errors were found with 75 prescribed drugs. Medication instructions were lacking with most of the drugs. Drug interactions with co-prescribed drugs could be anticipated in 79 cases. Injudicious use of anti-peptic ulcer agents significantly increased the cost of prescriptions (p<0.0001). Conclusion Anti-ulcer drugs are overenthusiastically prescribed by all specialties which can predispose to adverse effects, drug interactions, increased cost and even erroneous prescriptions. PMID:27134889

Methicillin-resistant Staphylococcus aureus bacteraemia at a tertiary teaching hospital.

PubMed

Cheong, I; Samsudin, L M; Law, G H

1996-01-01

Between July and December 1994, 25 patients with MRSA bacteraemia were treated at the Hospital Kuala Lumpur, a tertiary hospital in Malaysia with 3000 beds. The patients included 15 males and 10 females whose mean age was 46.7 years (range 13-75). The sources of their MRSA were: Urology/Nephrology, 11; General ICU, six; Orthopaedic, four; Medicine, three; Surgery, one. Their underlying diseases were: end-stage and chronic renal failure, 11; burns, three; acute necrotising pancreatitis, two; haematological malignancies, two; and one each of fracture of the neck of the femur, pustular psoriasis, alcoholic cirrhosis, liver abscess, peptic ulcer (antrectomy), choledochol cyst, and abdominal aneurysm with gangrene of the legs. Six patients were also diabetic. A total of 19 infections were considered nosocomial. The duration of hospital stay ranged from one to 60 days, mean 16 days. On the day of blood culture, 20 patients (80%) were febrile and 15(60%) had leucocytosis. A total of 14 patients were considered to have received prolonged broad-spectrum antibiotics before the bacteraemia; of these, 11 had had either a third-generation cephalosporin and/or a quinolone. The primary foci of infection were: vascular access dialysis catheters, six; infected AV fistulae, three; non-surgical wounds, five; orthopaedic pin, one; multiple venous lines and catheters, nine; unknown, one. The sensitivities to anti-MRSA antibiotics were: vancomycin, 100%; fusidic acid, 96%; rifampicin, 96%; ciprofloxacin and perfloxacin 28% each. In all, 13 patients (52%) eventually died; nine of these deaths were directly attributed to MRSA bacteraemia. The microbiological eradication rate was 88%. Mortality was significantly associated with duration of hospital stay and failure to remove the infected catheters/peripheral lines after the development of MRSA bacteraemia.

[How do Turkish immigrants evaluate cultural sensitivity in a German tertiary hospital?].

PubMed

Giese, Arnd; Uyar, Müberra; Henning, Bernhard F; Uslucan, Haci H; Westhoff, Timm; Pagonas, Nikolaos

2015-01-01

Culturally adequate medical care is a goal in Germany, but quantitative data concerning inpatients is lacking. Inpatients of a German tertiary hospital: Turkish migrants (T) and Germans (G) were interviewed in their respective native language. 121 T and 121 G were interviewed. 97.5% of T were Muslims, 82.6% of G were Christians. 88.5% of T judged religion as "important" or "very important" (G: 35.8%). 50.8% of T saw their opportunity to pray in the hospital as "bad" or "very bad" (G: 0.9%). Keeping to Islamic dietary rules in the hospital was "difficult" or "very difficult" for 90% of T. For 79.0% of female T care by a same-sex staff was "important" or "very important" (female G: 36.3%, male T: 40.0%, male G: 7.7%). The presence of a same-sex person during examinations or treatments was "much" or "very much" appreciated by 69.7% of female T, if same-sex care was impossible (female G: 25.4%, male T: 28.9%, male G: 6.1%). A retrospective analysis revealed that 5.8% of all 8988 hospital admissions during the period of study recruitment were Turkish migrants. To meet the needs of Turkish migrants German hospitals should improve the opportunity for Muslims to pray. Additionally, the cooperation with local imams should be sought. Precise descriptions of food ingredients or an adapted menu could help T to deal with Muslim dietary commandments. A culturally sensitive hospital should take into account that female as well as male T prefer to be cared of by same-sex physicians and nurses. Georg Thieme Verlag Stuttgart.

Distribution of 16S rRNA Methylases Among Different Species of Aminoglycoside-Resistant Enterobacteriaceae in a Tertiary Care Hospital in Poland.

PubMed

Piekarska, Katarzyna; Zacharczuk, Katarzyna; Wołkowicz, Tomasz; Rzeczkowska, Magdalena; Bareja, Elżbieta; Olak, Monika; Gierczyński, Rafał

2016-01-01

Aminoglycosides are a group of antimicrobial agents still the most commonly used in the treatment of life-threatening bacterial infections in human and animals. The emergence and spread of 16S rRNA methylases, which confer high-level resistance to the majority of clinically relevant aminoglycosides, constitute a major public health concern. Our goal was to evaluate the distribution of 16S rRNA methylases among different species of Enterobacteriaceae during a five month-long survey in a tertiary hospital in Warszawa, Poland. In the survey, a total of 1770 non-duplicate clinical isolates were collected from all hospital wards in a tertiary hospital in Warszawa, Poland. The survey was conducted between 19 April and 19 September 2010. The ability to produce 16S rRNA methylase was examined by determining MICs for gentamicin, kanamycin, amikacin by means of the agar dilution method. The isolates resistant to high concentration of aminoglycosides were PCR tested for genes: armA, rmtA, rmtB and rmtC. PCR products were subjected to DNA sequencing by the Sanger method. The genetic similarity of the ArmA-producing isolates was analysed by pulsed-filed gel electrophoresis (PFGE). ArmA was the only 16S rRNA methylase detected in 20 of 1770 tested isolates. The overall prevalence rate of ArmA was 1.13%. In K. pneumoniae (n = 742), P. mirabilis (n = 130), and E. cloacae (n = 253) collected in the survey, the prevalence of ArmA was 0.4%, 0.8% and 5.9%, respectively. The PFGE revealed both horizontal and clonal spread of the armA gene in the hospital. The prevalence of 16S rRNA methylase ArmA reported in this study is significantly higher than observed in other countries in Europe.

Fungal Profile of Vulvovaginal Candidiasis in a Tertiary Care Hospital.

PubMed

Kalaiarasan, Krishnapriya; Singh, Rakesh; Chaturvedula, Latha

2017-03-01

Vulvovaginal Candidiasis (VVC) is a common medical health problem of adult women. It is most commonly caused by Candida albicans . But there is a change in fungal profile. Sabouraud's Dextrose Agar (SDA) is the most common culture medium used where mixed fungal infection may be missed. It can be detected easily by using chromogenic culture medium. To know the fungal profile of vulvovaginal candidiasis using Candida CHROMagar and antifungal susceptibility pattern in patients attending tertiary care hospital. Culture confirmed cases of VVC presented at Department of Obstetrics and Gynaecology of Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER), Puducherry, India, from July 2015 to December 2015 were included in the cross-sectional study. Two high vaginal swabs were collected and inoculated on SDA and Candida CHROMagar (Hi-Media, Mumbai, India). After overnight incubation the colonies were counted and colour of the colonies were recorded from Candida CHROMagar. Candida spp. were identified by sugar fermentation and assimilation tests and other conventional tests. Antifungal susceptibility tests were performed by the disc diffusion method using fluconazole (25 μg) and voriconazole (1μg) as per the Clinical and Laboratory Standards Institute (CLSI - M44-A2) guidelines. A total of 50 culture confirmed (23.7%) cases were detected from 211 clinically suspected VVC cases. Candida glabrata (45.1%) was the most common isolate, followed by Candida tropicalis (23.5%) , Candida albicans (17.6%) , Candida krusei (9.8%) and Candida parapsilosis (3.9%) . One mixed infection of C. glabrata and C. albicans was identified on Candida CHROMagar. Mixed fungal infection was observed in 2% of positive culture and 0.5% of VVC cases. The antifungal susceptibility testing revealed that 15.7% and 9.8% isolates of Candida spp. were resistant and Susceptible Dose Dependent (S-DD) respectively to fluconazole. The increase resistant against fluconazole was because of

Anesthesia-related and perioperative mortality: An audit of 8493 cases at a tertiary pediatric teaching hospital in South Africa.

PubMed

Meyer, Heidi M; Thomas, Jenny; Wilson, Graeme S; de Kock, Marianna

2017-10-01

This study aimed to quantify the incidence of anesthesia-related and perioperative mortality at a large tertiary pediatric hospital in South Africa. This study included all children aged <18 years who died prior to discharge from hospital and within 30 days of their last anesthetic at the Red Cross War Memorial Children's Hospital between January 1, 2015 to December 31, 2015. A panel of three senior anesthetists reviewed each death to reach a consensus as to whether: (i) anesthesia caused the death; (ii) anesthesia may have contributed to or influenced the timing of death; or (iii) anesthesia was entirely unrelated to the death. There were 47 deaths within 30 days of anesthesia prior to discharge from hospital during this 12-month period. The in-hospital mortality within 24 h of administration of anesthesia was 16.5 per 10 000 cases (95% confidence intervals [CI]=7.8-25.1) and within 30 days of administration of anesthesia was 55.3 per 10 000 cases (95% CI=39.5-71.2). Age under 1 year (OR 4.5; 95% CI=2.5-8.0, P=.012) and cardiac surgery and interventional cardiology procedures (OR 2.5; 95% CI=1.2-5.2, P<.01) were both independent predictors of increased risk of perioperative mortality. The overall 24-h and 30-day anesthesia-related and in-hospital perioperative mortality rates in our study are comparable with other similar studies from tertiary pediatric centers. © 2017 John Wiley & Sons Ltd.

Explaining the uptake of paediatric guidelines in a Kenyan tertiary hospital – mixed methods research

PubMed Central

2014-01-01

Background Evidence-based standards for management of the seriously sick child have existed for decades, yet their translation in clinical practice is a challenge. The context and organization of institutions are known determinants of successful translation, however, research using adequate methodologies to explain the dynamic nature of these determinants in the quality-of-care improvement process is rarely performed. Methods We conducted mixed methods research in a tertiary hospital in a low-income country to explore the uptake of locally adapted paediatric guidelines. The quantitative component was an uncontrolled before and after intervention study that included an exploration of the intervention dose-effect relationship. The qualitative component was an ethnographic research based on the theoretical perspective of participatory action research. Interpretive integration was employed to derive meta-inferences that provided a more complete picture of the overall study results that reflect the complexity and the multifaceted ontology of the phenomenon studied. Results The improvement in health workers’ performance in relation to the intensity of the intervention was not linear and was characterized by improved and occasionally declining performance. Possible root causes of this performance variability included challenges in keeping knowledge and clinical skills updated, inadequate commitment of the staff to continued improvement, limited exposure to positive professional role models, poor teamwork, failure to maintain professional integrity and mal-adaptation to institutional pressures. Conclusion Implementation of best-practices is a complex process that is largely unpredictable, attributed to the complexity of contextual factors operating predominantly at professional and organizational levels. There is no simple solution to implementation of best-practices. Tackling root causes of inadequate knowledge translation in this tertiary care setting will require long

Biomedical waste management: study on the awareness and practice among healthcare workers in a tertiary teaching hospital.

PubMed

Joseph, L; Paul, H; Premkumar, J; Paul, R; Michael, J S

2015-01-01

Bio-medical waste has a higher potential of infection and injury to the healthcare worker, patient and the surrounding community. Awareness programmes on their proper handling and management to healthcare workers can prevent the spread of infectious diseases and epidemics. This study was conducted in a tertiary care hospital to assess the impact of training, audits and education/implementations from 2009 to 2012 on awareness and practice of biomedical waste segregation. Our study reveals focused training, strict supervision, daily surveillance, audits inspections, involvement of hospital administrators and regular appraisals are essential to optimise the segregation of biomedical waste.

[Relationship between occupational stress, recovery experience, and physiological health of nurses in a municipal grade A tertiary hospital].

PubMed

He, L; Zhang, C L; Yang, T; Lan, Y J

2017-06-20

Objective: To examine the relationship between recovery experience, occupational stress, and physiological health of nurses in a municipal grade A tertiary hospital. Methods: A total of 296 in-service nurses from 7 municipal grade A tertiary hospitals were selected from October 2015 to February 2016. Individual characteristics of the subjects were collected using a self-made questionnaire. The recovery experience, occupational stress, and physiological health of the subjects were assessed based on the physiological health dimensions in the Chinese version of Recovery Experience Questionnaire (REQ-C) , Job Content Questionnaire (JCQ) , and Quality of Work Life (QWL7-32) . Results: The mean recovery experience score of nurses from the municipal grade A tertiary hospital was 45.04±7.72, and 51.35% of the nurses had satisfactory recovery experience. Occupational stress was identified in 81.76% of the nurses. Based on the four categories of occupational stress, 65 nurses were identified with high-strain jobs (21.95%) , 56 with relaxed (low-strain) jobs (18.92%) , 49 with passive jobs (16.55%) , and 126 with active jobs (42.57%) . In addition, the mean physiological health score of the nurses was 21.20±4.24. Physiological health was negatively correlated with occupational stress ( r =-0.173, P <0.05) , but positively correlated with recovery experience ( r =0.198, P <0.01) . Recovery experience was negatively correlated with occupational stress ( r =-0.116, P <0.05) . Job demand was the major contributor to occupational stress, where subjects with high-demand active jobs had the poorest recovery experience ( F =2.610, P <0.05) and physiological health ( F =8.166, P <0.01) . Conclusion: Job demand has a great impact on the occupational stress of nurses, where increased job demand can lead to stronger stress response, reduced recovery experience, and poorer physiological health.

Efficacy and Safety of Deferasirox in Pediatric Patients of Thalassemia at a Tertiary Care Teaching Hospital.

PubMed

Thakor, Dhaval R; Desai, Chetna K; Kapadia, Jigar D; Dikshit, Ram K; Mehariya, K M

2017-01-01

To evaluate efficacy, safety and utilization pattern of deferasirox in paediatric patients of transfusion dependant β Thalassemia Major at a tertiary care teaching hospital in Gujarat. This observational, prospective-retrospective, single centre, continuous study was conducted in a tertiary care teaching hospital among paediatric patients of transfusion dependent β Thalassemia Major. Patients treated with deferasirox for not more than 12 weeks were enrolled. Details of blood transfusions, relevant investigations performed every 3 weeks and 3 months and drugs used were recorded in a pretested case record form. Parents were provided with a diary to record the details of ADRs. Data were analyzed for demographic characteristics, number and mean volume of blood transfusions, changes in serum ferritin and iron levels, number and types of ADRs and progression, causality, severity and preventability of ADRs. Of the 60 patients enrolled, one patient was lost to follow up and four withdrew their consent. Of the remaining 55 patients, 36 were boys and 19 were girls (mean age: 6 ± 3.14 years), including patients of 1-3 years (11), 4-6 years (24), 7-10 years (12) and 11-12 years (8). Thirty six patients were born of consanguineous marriages. Adherence to blood transfusion guidelines and deferasirox prescribing and administration guidelines was observed. A serial and significant decrease in mean serum ferritin and serum iron at 3 weeks and 3 months with deferasirox treatment was observed in all age groups except that of 11-12 years. A total of 117 ADRs were observed in 52 patients from 19498 doses, most common being diarrhea (24), raised serum creatinine (15), raised hepatic enzymes (14), abdominal pain (14) and rashes (14). A reduction in dose was required in 32 cases, while a temporary stoppage was indicated in 41 cases. Deferasirox was the possible and probable cause of 65 and 51 ADRs respectively as assessed by WHO-UMC scale. Majority of ADRs were definitely preventable

Pattern of episiotomy use & its immediate complications among vaginal deliveries in 18 tertiary care hospitals in India

PubMed Central

Singh, Shalini; Thakur, Tushita; Chandhiok, Nomita; Dhillon, Balwan Singh

2016-01-01

Background & objectives: In developed countries, efforts have been made to restrict episiotomy practice. However, in developing countries the episiotomy rates continue to be high. This study was conducted to evaluate the pattern of episiotomy use and its immediate complications among women delivering at tertiary level public hospitals in India. Methods: Prospective data of all women undergoing vaginal delivery including instrumental delivery were collected daily from the labour room registers of the 18 tertiary care hospitals on a structured proforma. Weekly data from all sites were sent to a central unit for compilation and analysis. Odds ratio was used to compare the proportion of genital trauma among women with and without episiotomy both in nulliparous and multiparous women. Results: Among 1,20,243 vaginal deliveries, episiotomy was performed in 63.4 per cent (n=76,305) cases. Nulliparaous women were 8.8 times more likely to undergo episiotomy than multiparous women. The various genital tract injuries reported were first degree perineal tear (n=4805, 3.9%), second degree perineal tear (n=1082, 0.9%), third and fourth degree perineal tear (n=186, 0.2%), anterior vaginal trauma requiring suturing (n=490, 0.4%), extension of episiotomy/vaginal laceration/excessive bleeding from episiotomy or tear (n=177, 0.15%), vulval/vaginal haematoma (n=70, 0.06%) and cervical tear (n=108, 0.08%). The combined rate of third and fourth degree perineal tears was observed to be significantly lower (P<0.001) among nullipara who received episiotomy (0.13%) compared to those who delivered without episiotomy (0.62%). Interpretations & conclusions: Significantly lower rates of third or fourth degree perineal tear were seen among nulliparous women undergoing episiotomy. The risk and benefit of episiotomy and its complications need to be evaluated through randomized clinical trials in the Indian context. PMID:27377504

Ocular knowledge and practice among type 2 diabetic patients in a tertiary care hospital in Bangladesh.

PubMed

Ahmed, Kazi Rumana; Jebunessa, Fatema; Hossain, Sharmin; Chowdhury, Hasina Akhter

2017-09-19

Diabetes mellitus is likely to have a major effect on vision, and adequate knowledge of its ocular manifestations is of substantial importance to diabetic patients. The study aimed to assess the ocular knowledge and practices among Type 2 diabetic patients of Bangladesh. This cross-sectional study included 122 diabetic patients from the outpatient department (OPD) of the apex diabetic healthcare hospital of the country under the sponsorship of the Diabetic Association of Bangladesh (BIRDEM). A questionnaire was used for collecting data on knowledge on and practices relating to diabetes mellitus with particular emphasis on ocular issues. A predefined score was used for categorizing levels of knowledge and practices as poor, average, and good. Of the 122 respondents, 63%, 55%, 40%, 44%, and 30% reported, blindness, retinopathy, cataracts, glaucoma, and double vision respectively, as complications of diabetes mellitus. About 50% were aware of the need for eye screening for people with the complications. Only 8% monitored their blood glucose levels daily, 15% monitored weekly, and 10% reported checking their blood pressure daily and 43% took their medications as prescribed. The level of diabetic knowledge was poor, moderate and good, respectively, among 24%, 56%, and 20% of the respondents, whereas the practice standards showed that 47%, 31%, and 22% had poor, average, and good levels respectively. The knowledge score was significantly associated with the practice score (r = 0.460, p = 0.001). The results indicate that the ocular knowledge and practices among diabetic patients attending a tertiary-care hospital in Bangladesh is average. Health and eye-care practitioners need to expand diabetic health education and promotion among diabetic patients.

Bacterial bloodstream infections in a tertiary infectious diseases hospital in Northern Vietnam: aetiology, drug resistance, and treatment outcome.

PubMed

Dat, Vu Quoc; Vu, Hieu Ngoc; Nguyen The, Hung; Nguyen, Hoa Thi; Hoang, Long Bao; Vu Tien Viet, Dung; Bui, Chi Linh; Van Nguyen, Kinh; Nguyen, Trung Vu; Trinh, Dao Tuyet; Torre, Alessandro; van Doorn, H Rogier; Nadjm, Behzad; Wertheim, Heiman F L

2017-07-12

Bloodstream infections (BSIs) are associated with high morbidity and mortality worldwide. However their aetiology, antimicrobial susceptibilities and associated outcomes differ between developed and developing countries. Systematic data from Vietnam are scarce. Here we present aetiologic data on BSI in adults admitted to a large tertiary referral hospital for infectious diseases in Hanoi, Vietnam. A retrospective study was conducted at the National Hospital for Tropical Diseases between January 2011 and December 2013. Cases of BSI were determined from records in the microbiology department. Case records were obtained where possible and clinical findings, treatment and outcome were recorded. BSI were classified as community acquired if the blood sample was drawn ≤48 h after hospitalization or hospital acquired if >48 h. A total of 738 patients with BSI were included for microbiological analysis. The predominant pathogens were: Klebsiella pneumoniae (17.5%), Escherichia coli (17.3%), Staphylococcus aureus (14.9%), Stenotrophomonas maltophilia (9.6%) and Streptococcus suis (7.6%). The overall proportion of extended spectrum beta-lactamase (ESBL) production among Enterobacteriaceae was 25.1% (67/267 isolates) and of methicillin-resistance in S. aureus (MRSA) 37% (40/108). Clinical data was retrieved for 477 (64.6%) patients; median age was 48 years (IQR 36-60) with 27.7% female. The overall case fatality rate was 28.9% and the highest case fatality was associated with Enterobacteriaceae BSI (34.7%) which accounted for 61.6% of all BSI fatalities. Enterobacteriaceae (predominantly K. pneumoniae and E. coli) are the most common cause of both community and hospital acquired bloodstream infections in a tertiary referral clinic in northern Vietnam.

Reorganization increases long-term sickness absence at all levels of hospital staff: panel data analysis of employees of Norwegian public hospitals.

PubMed

Ingelsrud, Mari H

2014-09-19

The Norwegian specialist health service has undergone many processes of reorganization during the last three decades. Changes are mainly initiated to increase the efficiency and quality of health care serving an ageing population under the condition of a diminishing labour supply. The aim of this study is to investigate the effects of reorganization on long-term sickness absence among different levels of hospital staff. The study draws on panel data on employees of Norwegian public hospitals in 2005 and 2007 (N = 106,715). National register data on individual employees' days of medically certified long-term (>16 days) sickness absence were linked with survey measures of actual reorganization executed at each hospital in each year. The surveys, answered by hospital administration staff, measured five types of reorganization: merging units, splitting up units, creating new units, shutting down units and reallocation of employees. The variation in sickness absence days was analysed using random and fixed effects Poisson regression with level of reorganization as the main explanatory variable. The fixed effects analysis shows that increasing the degree of organizational change at a hospital from a low to a moderate or high degree leads to an increase in the number of days of long-term sickness absence of respectively 9% (95% CI: 1.03-1.15) and 8% (95% CI: 1.02-1.15). There are few significant differences between employees in different education categories. Only physicians have a significantly higher relative increase in days of long-term sickness absence than the control group with lower tertiary education. Increased long-term sickness absence is a risk following reorganization. This risk affects all levels of hospital staff.

Urgent tracheostomy: four-year experience in a tertiary hospital.

PubMed

Costa, Liliana; Matos, Ricardo; Júlio, Sara; Vales, Fernando; Santos, Margarida

2016-01-01

Urgent airway management is one of the most important responsibilities of otolaryngologists, often requiring a multidisciplinary approach. Urgent surgical airway intervention is indicated when an acute airway obstruction occurs or there are intubation difficulties. In these situations, surgical tracheostomy becomes extremely important. We retrospectively studied the patients who underwent surgical tracheostomy from 2011 to 2014 by an otolaryngologist team at the operating theater of the emergency department of a tertiary hospital. Indications, complications and clinical evolution of the patients were reviewed. The study included 56 patients (44 men and 12 women) with a median age of 55 years. The procedure was performed under local anesthesia in 21.4% of the patients. Two (3.6%) patients were subjected to conversion from cricothyrostomy to tracheostomy. Head and neck neoplasm was indicated in 44.6% of the patients, deep neck infection in 19.6%, and bilateral vocal fold paralysis in 10.7%. Stridor was the most frequent signal (51.8%). Of the 56 patients, 15 were transferred to another hospital. Among the other 41 patients, 21 were decannulated (average time: 4 months), and none of them were cancer patients. Complications occurred in 5 (12.2%) patients: hemorrhage in 3, surgical wound infection in 1, and cervico-thoracic subcutaneous emphysema in 1. No death was related to the procedure. Urgent tracheostomy is a life-saving procedure for patients with acute airway obstruction or with difficult intubation. It is a safe and effective procedure, with a low complication rate, and should be performed before the patient's clinical status turns into a surgical emergency situation.

Listeriosis at a Tertiary Care Hospital in Beijing, China: High Prevalence of Nonclustered Healthcare-Associated Cases Among Adult Patients

PubMed Central

Wang, Huan-ling; Ghanem, Khalil G.; Wang, Peng; Yang, Shuang; Li, Tai-sheng

2013-01-01

Background. Listeriosis is an emerging infectious disease associated with high mortality. There are few published reports from East Asia and developing countries. Our goal was to describe the clinical characteristics and outcomes of patients diagnosed with Listeria monocytogenes at a tertiary care hospital in Beijing, China. Methods. Peking Union Medical College Hospital (PUMCH), an 1800-bed hospital, consists of 2 campuses that house different medical departments. We retrospectively reviewed all culture-proven cases of listeriosis occurring at PUMCH between 1999 and 2011. Point estimates and 95% confidence intervals are presented. Results. There were 38 patients with listeriosis: 5 neonatal, 8 maternal, and 25 nonmaternal. The median age of the adult nonmaternal patients was 47 (range, 18–79) years with a female predominance (72%). Forty percent (n = 10) had an underlying rheumatic disease. Forty-four percent of cases (n = 11) were healthcare-associated infections occurring a median of 20 (range, 3–44) days after hospital admission. Only 2 of the 11 healthcare-associated cases clustered in space and time. One healthcare-associated case occurred in a patient receiving KHI-272 therapy, an oral, irreversible dual EGFR/HER2 inhibitor. The neonatal and maternal listeriosis cases were similar to those reported in the literature. Conclusions. Nonclustered healthcare-associated cases of L. monocytogenes occurred at a large tertiary care hospital in Beijing, China. The source of these infections is unclear. Although rare, in the setting of immunosuppression, Listeria should be considered in the differential diagnosis of healthcare-associated infections, even in the absence of a point-source outbreak. PMID:23175565

Listeriosis at a tertiary care hospital in beijing, china: high prevalence of nonclustered healthcare-associated cases among adult patients.

PubMed

Wang, Huan-Ling; Ghanem, Khalil G; Wang, Peng; Yang, Shuang; Li, Tai-Sheng

2013-03-01

Listeriosis is an emerging infectious disease associated with high mortality. There are few published reports from East Asia and developing countries. Our goal was to describe the clinical characteristics and outcomes of patients diagnosed with Listeria monocytogenes at a tertiary care hospital in Beijing, China. Peking Union Medical College Hospital (PUMCH), an 1800-bed hospital, consists of 2 campuses that house different medical departments. We retrospectively reviewed all culture-proven cases of listeriosis occurring at PUMCH between 1999 and 2011. Point estimates and 95% confidence intervals are presented. There were 38 patients with listeriosis: 5 neonatal, 8 maternal, and 25 nonmaternal. The median age of the adult nonmaternal patients was 47 (range, 18-79) years with a female predominance (72%). Forty percent (n = 10) had an underlying rheumatic disease. Forty-four percent of cases (n = 11) were healthcare-associated infections occurring a median of 20 (range, 3-44) days after hospital admission. Only 2 of the 11 healthcare-associated cases clustered in space and time. One healthcare-associated case occurred in a patient receiving KHI-272 therapy, an oral, irreversible dual EGFR/HER2 inhibitor. The neonatal and maternal listeriosis cases were similar to those reported in the literature. Nonclustered healthcare-associated cases of L. monocytogenes occurred at a large tertiary care hospital in Beijing, China. The source of these infections is unclear. Although rare, in the setting of immunosuppression, Listeria should be considered in the differential diagnosis of healthcare-associated infections, even in the absence of a point-source outbreak.

Nurses’ Perceptions of Spirituality and Spiritual Care at Five Tertiary Care Hospitals in Riyadh, Saudi Arabia: A Cross-Sectional Study

PubMed Central

Kaddourah, Bayan; Abu-Shaheen, Amani; Al-Tannir, Mohamad

2018-01-01

Objectives To identify the perceptions towards spirituality and spiritual care among nurses at tertiary care hospitals in Riyadh, Saudi Arabia. Methods A cross-sectional study was conducted on nurses at five tertiary care hospitals in Riyadh. The data were collected using the Spirituality and Spiritual Care Rating Scale (SSCRS). Results We recruited 978 nurses, of which 896 (91.6%) were female. The mean SSCRS score was 3.8±0.5 (the spirituality and spiritual care statements fell within the ‘agree’ category). A statistically significant difference was found only between perceptions of spirituality and spiritual care among nurses and their nursing experience duration. Conclusions The findings of this study revealed that nurses were oriented to spirituality, and respected the importance of providing spiritual care to their patients. The nurses believed that spirituality exists in all religions and spiritual care means showing concern while treating the patients by focusing on respecting patients’ religious beliefs. PMID:29657685

Cost analysis of in-patient cancer chemotherapy at a tertiary care hospital.

PubMed

Wani, Mohammad Ashraf; Tabish, S A; Jan, Farooq A; Khan, Nazir A; Wafai, Z A; Pandita, K K

2013-01-01

Cancer remains a major health problem in all communities worldwide. Rising healthcare costs associated with treating advanced cancers present a significant economic challenge. It is a need of the hour that the health sector should devise cost-effective measures to be put in place for better affordability of treatments. To achieve this objective, information generation through indigenous hospital data on unit cost of in-patient cancer chemotherapy in medical oncology became imperative and thus hallmark of this study. The present prospective hospital based study was conducted in Medical Oncology Department of tertiary care teaching hospital. After permission from the Ethical Committee, a prospective study of 6 months duration was carried out to study the cost of treatment provided to in-patients in Medical Oncology. Direct costs that include the cost of material, labor and laboratory investigations, along with indirect costs were calculated, and data analyzed to compute unit cost of treatment. The major cost components of in-patient cancer chemotherapy are cost of drugs and materials as 46.88% and labor as 48.45%. The average unit cost per patient per bed day for in-patient chemotherapy is Rs. 5725.12 ($125.96). This includes expenditure incurred both by the hospital and the patient (out of pocket). The economic burden of cancer treatment is quite high both for the patient and the healthcare provider. Modalities in the form of health insurance coverage need to be established and strengthened for pooling of resources for the treatment and transfer of risks of these patients.

[Streptococcal toxic shock syndrome: ten years' experience at a tertiary hospital].

PubMed

Vallalta-Morales, Manuel; Salavert-Lletí, Miguel; Artero-Mora, Arturo; Mahiques-Santos, Laura; Solaz-Moreno, Elena; Pérez-Bellés, Carmen

2005-11-01

In the last two decades there has been a reported increase in the incidence of streptococcal toxic shock syndrome (STSS). The objective of this study was to determine the clinical and epidemiological characteristics of this infection. Retrospective study of all cases of STSS diagnosed at a single tertiary hospital over the last ten years. We report 13 cases of STSS (8 men, mean age 62 years). The mean annual incidence was 0.19 episodes/100,000 population from 1994 to 1998 and 0.53 episodes/100,000 population from 1999 to 2003 (p = 0.059). All patients had at least one underlying disease and there were no intravenous drug users. The most common portals of entry were the skin and soft tissues (85%) and all but one patient had a positive blood culture. Two cases were nosocomial and five patients required surgery (amputation and/or debridement). There was a high mortality rate (85%) and a rapid course from onset to death; nine patients died within four days after establishing the diagnosis. The incidence of SSTS has increased over the last five years at our hospital. Elderly patients with underlying medical conditions were more susceptible to acquiring this infection. Early mortality was very high.

Medical Device-Associated Candida Infections in a Rural Tertiary Care Teaching Hospital of India.

PubMed

Deorukhkar, Sachin C; Saini, Santosh

2016-01-01

Health care associated infections (HCAIs) add incrementally to the morbidity, mortality, and cost expected of the patient's underlying diseases alone. Approximately, about half all cases of HCAIs are associated with medical devices. As Candida medical device-associated infection is highly drug resistant and can lead to serious life-threatening complications, there is a need of continuous surveillance of these infections to initiate preventive and corrective measures. The present study was conducted at a rural tertiary care hospital of India with an aim to evaluate the rate of medical device-associated Candida infections. Three commonly encountered medical device-associated infections (MDAI), catheter-associated urinary tract infection (CA-UTI), intravascular catheter-related blood stream infections (CR-BSI), and ventilator-associated pneumonia (VAP), were targeted. The overall rate of MDAI in our hospital was 2.1 per 1000 device days. The rate of Candida related CA-UTI and CR-BSI was noted as 1.0 and 0.3, respectively. Untiring efforts taken by team members of Hospital Acquired Infection Control Committee along with maintenance of meticulous hygiene of the hospital and wards may explain the low MDAI rates in our institute. The present surveillance helped us for systematic generation of institutional data regarding MDAI with special reference to role of Candida spp.

Current status of nutritional support for hospitalized children: a nationwide hospital-based survey in South Korea.

PubMed

Kim, Seung; Lee, Eun Hye; Yang, Hye Ran

2018-06-01

The prevalence of malnutrition among hospitalized children ranges between 12% and 24%. Although the consequences of hospital malnutrition are enormous, it is often unrecognized and untreated. The aim of this study was to identify the current status of in-hospital nutrition support for children in South Korea by carrying out a nationwide hospital-based survey. Out of 345 general and tertiary hospitals in South Korea, a total of 53 institutes with pediatric gastroenterologists and more than 10 pediatric inpatients were selected. A questionnaire was developed by the nutrition committee of the Korean Society of Pediatric Gastroenterology, Hepatology and Nutrition. The questionnaires were sent to pediatric gastroenterologists in each hospital. Survey was performed by e-mails. Forty hospitals (75.5%) responded to the survey; 23 of them were tertiary hospitals, and 17 of them were general hospitals. Only 21 hospitals (52.5%) had all the required nutritional support personnel (including pediatrician, nutritionist, pharmacist, and nurse) assigned to pediatric patients. Routine nutritional screening was performed in 22 (55.0%) hospitals on admission, which was lower than that in adult patients (65.8%). Nutritional screening tools varied among hospitals; 33 of 40 (82.5%) hospitals used their own screening tools. The most frequently used nutritional assessment parameters were weight, height, hemoglobin, and serum albumin levels. In our nationwide hospital-based survey, the most frequently reported main barriers of nutritional support in hospitals were lack of manpower and excessive workload, followed by insufficient knowledge and experience. Although this nationwide hospital-based survey targeted general and tertiary hospitals with pediatric gastroenterologists, manpower and medical resources for nutritional support were still insufficient for hospitalized children, and nutritional screening was not routinely performed in many hospitals. More attention to hospital malnutrition

Treatment of self-poisoning at a tertiary-level hospital in Bangladesh: cost to patients and government.

PubMed

Verma, Vasundhara; Paul, Sujat; Ghose, Aniruddha; Eddleston, Michael; Konradsen, Flemming

2017-12-01

Approximately 10 000 people die from suicide annually in Bangladesh, many from pesticide poisoning. We aimed to estimate financial costs to patients and health services of treating patients with self-poisoning. Data on direct costs to families, sources of funds for treatment and family wealth were collected prospectively over a one-month period in 2016 at the tertiary Chittagong Medical College Hospital, Bangladesh. Aggregate operational costs to the government were calculated using annual budget, bed occupancy and length-of-stay data. Agrochemicals were the most common substances ingested (58.8%). Median duration of stay and of illness was 2 and 5 days, respectively. Median total cost to patients was conservatively estimated at US$ 98.40, highest in agrochemical poisoning (US$ 179.50), with the greatest cost due to medicines and equipment. Misdiagnosis as organophosphorus poisoning in 17.0% of agrochemical cases resulted in increased cost to patients. Only 51.9% of patients had indicators of wealth; 78.1% borrowed money to cover costs. Conservatively estimated median healthcare costs (US$ 21.30 per patient) were markedly lower than costs to patients. Cost to patients of treating a case of agrochemical poisoning was approximately three times the cost of one month's essential items basket. Incorrect diagnosis at admission costs families substantial sums of money and increased length of stay; it costs the national government an estimated US$ 80 428.80 annually. Widespread access to a list of pesticides used in self-poisoning plus greater focus on training doctors to better manage different forms of agrochemical poisoning should reduce the financial burden to patients and healthcare systems. © 2017 John Wiley & Sons Ltd.

Microbiological profile and risk factors for in-hospital mortality of infective endocarditis in tertiary care hospitals of south Vietnam.

PubMed

Tran, Hoang M; Truong, Vien T; Ngo, Tam M N; Bui, Quoc P V; Nguyen, Hoang C; Le, Trung T Q; Mazur, Wojciech; Chung, Eugene; Cafardi, John M; Pham, Khanh P N; Duong, Hoang H N; Nguyen, Thach; Nguyen, Vu T; Pham, Vinh N

2017-01-01

We aimed to evaluate the microbiological characteristics and risk factors for mortality of infective endocarditis in two tertiary hospitals in Ho Chi Minh City, south Vietnam. A retrospective study of 189 patients (120 men, 69 women; mean age 38 ± 18 years) with the diagnosis of probable or definite infective endocarditis (IE) according to the modified Duke Criteria admitted to The Heart Institute or Tam Duc Hospital between January 2005 and December 2014. IE was related to a native valve in 165 patients (87.3%), and prosthetic valve in 24 (12.7%). Of the 189 patients in our series, the culture positive rate was 70.4%. The most common isolated pathogens were Streptococci (75.2%), Staphylococci (9.8%) followed by gram negative organism (4.5%). The sensitivity rate of Streptococci to ampicillin, ceftriaxone or vancomycin was 100%. The rate of methicillin resistant Staphylococcus aureus was 40%. There was a decrease in penicillin sensitivity for Streptococci over three eras: 2005-2007 (100%), 2008-2010 (94%) and 2010-2014 (84%). The in-hospital mortality rate was 6.9%. Logistic regression analysis found prosthetic valve and NYHA grade 3 or 4 heart failure and vegetation size of more than 15 mm as strong predictors of in-hospital mortality. Streptococcal species were the major pathogen of IE in the recent years with low rates of antimicrobial resistance. Prosthetic valve involvement, moderate or severe heart failure and vegetation size of more than 15 mm were independent predictors for in-hospital mortality in IE.

Tertiary paediatric hospital health professionals' attitudes to lesbian, gay, bisexual and transgender parents seeking health care for their children.

PubMed

Nicol, Pam; Chapman, Rose; Watkins, Rochelle; Young, Jeanine; Shields, Linda

2013-12-01

To ascertain health professionals' knowledge, attitudes and beliefs towards lesbian, gay, bisexual and transgender parents seeking health care for their children in a paediatric tertiary hospital setting which practises family-centred care. Lesbian, gay, bisexual and transgender parents are often reluctant to disclose their sexual orientation to health professionals for fear of discrimination and compromised quality of care. Staff knowledge, attitudes and beliefs can influence disclosure by parents, but little is known about knowledge, attitudes and beliefs in paediatric tertiary hospital staff towards lesbian, gay, bisexual and transgender parents accessing care for their children. Descriptive comparative study of health staff using a cross-sectional survey. A set of validated anonymous questionnaires was used to assess knowledge about homosexuality, attitudes towards lesbians and gay men, and gay affirmative practice. Three open-ended questions were also used to assess beliefs about encouraging disclosure of lesbian, gay, bisexual and transgender parenting roles and how this may impact on care. Of the 646 staff surveyed, 212 (32.8%) responded. Knowledge and attitudes were significantly associated with professional group, gender, Caucasian race, political voting behaviour, presence of religious beliefs, the frequency of attendance at religious services, the frequency of praying, and having a friend who was openly lesbian, gay, bisexual and transgender. This study highlighted that staff working in a tertiary paediatric hospital setting, with family-centred care models in place, held attitudes and beliefs that may impact on the experience of hospitalisation for lesbian, gay, bisexual and transgender parents, and the quality of care received by their children. To promote equitable care to all families, organisations should ensure that family-centred care policies and guidelines are adopted and appropriately implemented. In addition to formal education, affirmative

Work related stress and its anticipated solutions among post-graduate medical resident doctors: a cross-sectional survey conducted at a tertiary municipal hospital in Mumbai, India.

PubMed

Rajan, Pavithra; Bellare, Bharati

2011-03-01

It is now known that resident doctors registered for postgraduate studies are prone to work related stress and eventual burnout. Though stress can happen in any profession, reduced performance of resident doctors due to vocational stress could cause an increase in medical errors and thus affect the quality of life of the patients. Resident doctors at a Municipal hospital in India form a unique population as number of stresses they undergo are many and varied. To study the prevalence of work-related stress and its anticipated solutions among the resident doctors registered for postgraduate studies in clinical subjects at a tertiary Municipal hospital. A stratified sampling cross-sectional survey was conducted at the Inpatient, Outpatient, and Intensive Care Units at a tertiary Municipal hospital in Mumbai, India. Data collection was done using a validated 20-point questionnaire to assess the factors causing stress and their anticipated solutions. Simple percentage analysis of stress questionnaire. 71 resident doctors completed the survey. The major stressors in this cohort were inadequate hostel/quarter facilities (92.1%), and the need to perform extra duties (80.0%). Also, non-conducive environment for clinical training and studies (81.7%), inadequate study (78.9%) and break (81.2%), threat from deadly infections (74.6%), and overburdening with work (69.0%) were the other major stress causing factors. The perceived stress busters were good music (40.8%) and family and friends (40.8%). Eighty-seven percent of the respondents perceived regular physical exercise to be an effective mode of stress management and 83.8% expressed their need to have a simple therapeutic gymnasium established within the campus with a qualified trainer. There is a high level of work related stress among the resident doctors registered for postgraduate clinical studies at a tertiary Municipal hospital in Mumbai. One of the perceived stress busters is regular physical exercise that is

Clinical presentation and treatment outcome of molar pregnancy: Ten years experience at a Tertiary Care Hospital in Dammam, Saudi Arabia.

PubMed

Al-Talib, Ayman A

2016-01-01

To study the clinical presentation and treatment outcome of molar pregnancy at a Tertiary Care Hospital in Dammam, Saudi Arabia. Reviewed medical records of all molar pregnancy cases among all the deliveries at a tertiary care hospital in Dammam from 2005 to 2014, after approval by institutional ethical review committee. Data abstracted included patient's age, parity, presenting symptoms, gestational age at diagnosis, uterine size, ultrasonographic findings, BhCG level at the time of diagnosis and at follow-up after evacuation, and blood loss during evacuation. Data was entered and analyzed using Excel; frequency distribution for categorical variables and descriptive statistics for continuous variables were computed. Of a total of 25,000 deliveries in ten years, 22 cases of complete molar pregnancy were encountered: 0.9 cases of molar pregnancy per 1000 pregnancies. Majority of patients (63.7%) were older than 35 years, and were nulliparous (45.5%). The commonest symptom was vaginal bleeding (86.4%) followed by hyperemesis gravidarum (41.0%); Hyperthyroidism was seen in 1 patient (4.5%). Ovarian enlargement by theca-lutin cyst was seen in 3 patients (13.6%). The majority of patients (63.6%) had normal BhCG within 9 weeks (63 days) after suction curettage. The majority of the cases followed a benign course. Aged older than 35 years seems a risk factor and vaginal bleeding is the commonest presenting symptom. Early booking of pregnant women to antenatal care clinics and routine first trimester ultrasound made diagnosis easier and earlier before complications appear.

Transfer from primary maternity unit to tertiary hospital in New Zealand - timing, frequency, reasons, urgency and outcomes: Part of the Evaluating Maternity Units study.

PubMed

Grigg, Celia P; Tracy, Sally K; Tracy, Mark; Schmied, Virginia; Monk, Amy

2015-09-01

to examine the transfers from primary maternity units to a tertiary hospital in New Zealand by describing the frequency, timing, reasons and outcomes of those who had antenatal or pre-admission birthplace plan changes, and transfers in labour or postnatally. mixed methods prospective (concurrent) cohort study, which analysed transfer and clinical outcome data (407 primary unit cohort, 285 tertiary hospital cohort), and data from the six week postpartum survey (571 respondents). well, pregnant women booked to give birth in a tertiary maternity hospital or primary maternity unit in one region in New Zealand (2010-2012). All women received midwifery continuity of care, regardless of their intended or actual birthplace. fewer than half of the women who planned a primary unit birth gave birth there (191 or 46.9%). A change of plan may have been made either antenatally or before admission in labour; and transfers were made after admission to the primary unit in labour or during the postnatal stay (about 48 hours). Of the 117 (28.5%) planning a primary unit birth who changed their planned birthplace type antenatally 73 (62.4%) were due to a clinical indication. Earthquakes accounted for 28.1% of birthplace change (during the research period major earthquakes occurred in the study region). Most (73.8%) labour changes occurred before admission in labour to the primary unit. For the 76 women who changed plan at this stage the most common reasons to do so were a rapid labour (25.0%) or prolonged rupture of membranes (23.7%). Transfers in labour from primary unit to tertiary hospital occurred for 27 women (12.6%) of whom 26 (96.3%) were having their first baby. "Slow progress" of labour accounted for 21 (77.8%) of these and 17 (62.9%) were classified as 'non-emergency'. The average transfer time for 'emergency' transfers was 58 minutes. The average time for all labour transfers from specialist consultation to birth was 4.5 hours. Nine postnatal transfers (maternal or neonatal

The impact of reducing intensive care unit length of stay on hospital costs: evidence from a tertiary care hospital in Canada.

PubMed

Evans, Jessica; Kobewka, Daniel; Thavorn, Kednapa; D'Egidio, Gianni; Rosenberg, Erin; Kyeremanteng, Kwadwo

2018-02-23

To use theoretical modelling exercises to determine the effect of reduced intensive care unit (ICU) length of stay (LOS) on total hospital costs at a Canadian centre. We conducted a retrospective cost analysis from the perspective of one tertiary teaching hospital in Canada. Cost, demographic, clinical, and LOS data were retrieved through case-costing, patient registry, and hospital abstract systems of The Ottawa Hospital Data Warehouse for all new in-patient ward (30,483) and ICU (2,239) encounters between April 2012 and March 2013. Aggregate mean daily variable direct (VD) costs for ICU vs ward encounters were summarized by admission day number, LOS, and cost centre. The mean daily VD cost per ICU patient was $2,472 (CAD), accounting for 67.0% of total daily ICU costs per patient and $717 for patients admitted to the ward. Variable direct cost is greatest on the first day of ICU admission ($3,708), and then decreases by 39.8% to plateau by the fifth day of admission. Reducing LOS among patients with ICU stays ≥ four days could potentially result in an annual hospital cost saving of $852,146 which represents 0.3% of total in-patient hospital costs and 1.2% of ICU costs. Reducing ICU LOS has limited cost-saving potential given that ICU costs are greatest early in the course of admission, and this study does not support the notion of reducing ICU LOS as a sole cost-saving strategy.

Clinicomycological Characterization of Superficial Mycoses from a Tertiary Care Hospital in Nepal.

PubMed

Khadka, Sundar; Sherchand, Jeevan Bahadur; Pokharel, Dinesh Binod; Pokhrel, Bharat Mani; Mishra, Shyam Kumar; Dhital, Subhash; Rijal, Basista

2016-01-01

Background . Superficial mycosis is a common fungal infection worldwide, mainly caused by dermatophytes. However, the prevalence of species varies geographically. In addition, fungal treatment is best guided according to species isolated. This study was carried out to determine the clinical as well as mycological profile of superficial mycoses in a tertiary care hospital, Nepal. Methods . This was a prospective case-control laboratory based study conducted over a period of six months from January to June 2014 at Tribhuvan University Teaching Hospital, Nepal. A total of 200 specimens were collected from the patients suspected of superficial mycoses. The specimens were macroscopically as well as microscopically examined. The growth was observed up to 4 weeks. Results. Out of total 200 specimens from the patients suspected of superficial mycoses, tinea corporis 50 (25%) was most common clinical types. KOH mount was positive in 89 (44.5%) and culture was positive in 111 (55.5%). Trichophyton mentagrophytes 44 (39.6%) was the most common isolate. Conclusions. The diagnostic yields of KOH mount and culture were found to be complementary to each other. Thus both the methods added with clinical findings are equally important to establish superficial mycosis.

Awareness of the role of general practitioners in primary care among outpatient populations: evidence from a cross-sectional survey of tertiary hospitals in China.

PubMed

Liu, Xiaojun; Tan, Anran; Towne, Samuel D; Hou, Zhaoxun; Mao, Zongfu

2018-03-16

General practitioners (GPs) are highly underutilised in China with many patients going directly to hospitals when seeking routine care. Multiple countries around the world have successfully used GPs in routine care, and as such, China may benefit from the use of GPs. This study examines the status of, and factors associated with, knowledge related to GPs among outpatient populations from China's tertiary hospitals. This is a cross-sectional survey study. The questionnaires were completed by 565 outpatients from four tertiary hospitals in China during 2016. Convenience sampling on different floors and throughout the outpatient building was carried out. We used the logistic regression models to identify GP-related knowledge among different populations. Overall, 50.27% of respondents said they had never heard of GPs. This was also true among females (adjusted OR (AOR)=1.57, 95% CI 1.43 to 2.71), older adults (AOR 46-65 =1.61, 95% CI 1.39 to 2.98; AOR >65 =2.01, 95% CI 1.62 to 3.59), those with lower education level (AOR Bachelor's degree =0.61, 95% CI 0.20 to 0.81; AOR ≥Master's degree =0.49, 95% CI 0.23 to 0.76), rural residents (AOR=1.51, 95% CI 1.35 to 2.82) and those with chronic disease (AOR without chronic disease =0.61, 95% CI 0.22 to 0.71). What is more, less than one-in-ten (9.03%) outpatients were able to accurately describe what a GP was, with less than 30% accurately describing a GP among those receiving GPs' services. Outpatients who could have received less costly health services from GPs in primary medical institutions were more likely to choose costlier specialist physicians in tertiary hospitals, which is likely linked to limited knowledge about GPs. Policy makers should invest in outreach efforts to improve public awareness of GPs, while at the same time conducting continued surveillance of these efforts to evaluate progress towards this goal. © Article author(s) (or their employer(s) unless otherwise stated in the text of the

Comparision between bed side testing of blood glucose by glucometer vs centralized testing in a tertiary care hospital.

PubMed

Baig, Ayaz; Siddiqui, Imran; Jabbar, Abdul; Azam, Syed Iqbal; Sabir, Salman; Alam, Shahryar; Ghani, Farooq

2007-01-01

To determine the accuracy, turnaround time and cost effectiveness of bedside monitoring of blood glucose levels by non-laboratory health care workers and centralized testing of blood glucose by automated analyzer in a tertiary care hospital. The study was conducted in Section of Chemical Pathology, Department of Pathology and Microbiology and Section of Endocrinology Department of Medicine, Aga Khan University and Hospital Karachi, from April 2005 to March 2006. One hundred and ten patients were included in the study. The blood glucose levels were analyzed on glucometer (Precision Abbott) by finger stick, using Biosensor Technology. At the same time venous blood was obtained to analyze glucose in clinical laboratory on automated analyzer (SYNCHRON CX7) by glucose oxidase method. We observed good correlation between bed side glucometer and laboratory automated analyzer for glucose values between 3.3 mmol/L (60 mg/dl) and 16.7 (300 mg/dl). A significant difference was observed for glucose values less than 3.3 mmol/L (p = 0.002) and glucose values more than 16.67 mmol/l (p = 0.049). Mean Turnaround time for glucometer and automated analyzer were 0.08 hours and 2.49 hours respectively. The cost of glucose testing with glucometer was 48.8% lower than centralized lab based testing. Bedside glucometer testing, though less expensive does not have good accuracy in acutely ill patient with either very high or very low blood glucose levels.

[Current status of job burnout in clinical nurses in a grade A tertiary hospital and related influencing factors].

PubMed

Ye, L Y; Fan, C L; Wang, L G; Tao, T; Gao, W B; Li, Y H

2017-10-20

Objective: To investigate the current status of job burnout in clinical nurses in a grade A tertiary hospitalin Shaoxing,China and related influencing factors. Methods: In October 2016, the Nursing Burnout Scale (NBS)was used for the investigation of 304 clinical nurses in a grade A tertiary hospital.The contents of the investigation included general data(including age,education background,working years,marital status, frequency of night shifts,professional title, and way of employment), characteristics of working environment,burnout, personality characteristics,coping strategy,and psychosomatic symptoms.SPSS 18.0 was used to conduct Pearson correlation analysis of the scores of each dimension of NBS. A multivariate regression analysis was performed with the demographic features of clinical nurses as the independent variable and the scores of each dimension of NBS as the dependent variable. Results: Among the clinical nurses in this grade A tertiary hospital, the incidence rate of severe burnout was 74%.The Pearson correlation analysis showed that burnout,pessimistic personality,negative coping,and psychosomatic symptoms were positively correlated with working environment( r =0.530,0.316,0.116,and 0.502); pessimistic personality and psychosomatic symptoms were positively correlated with burnout( r =0.618 and 0.675); psychosomatic symptoms were positively correlated withpessimistic personality( r =0.540); negative coping was negatively correlated with pessimistic personality( r =-0.145).The multivariate linear regression analysis showed that department(Department of Internal Medicine or Department of Surgery, B =-0.364 and -0.428)and frequency of night shifts(<6 times/month and 6 - 10 times/month, B =0.199 and 0.256)were influencing factors for the score of working environment; department(Department of Internal Medicine or Department of Surgery, B =-0.350 and -0.360)was an influencing factor for the score of burnout; 1 - 3 working years( B =-0.238)was an influencing

A multilevel model of methicillin-resistant Staphylococcus aureus acquisition within the hierarchy of an Australian tertiary hospital.

PubMed

Kong, Fiona; Paterson, David L; Coory, Michael; Clements, Archie C A

2012-11-01

Hospitals without universal single room accommodations typically contain multibed cubicles within wards. In this study, we examined whether the variation in a patient's risk for acquiring methicillin-resistant Staphylococcus aureus (MRSA) in a major tertiary hospital was greatest at the bed, cubicle, or ward level, and quantified the risk of MRSA acquisition associated with exposure to MRSA-colonized/infected patients within the same bed, cubicle, and ward at differently distributed lag times. Nested tri-level hierarchical logistic regression models with random effects were used for non-multiresistant MRSA (nmMRSA) and multiresistant MRSA (mMRSA). The models were internally validated. Receiver operating characteristic curves were used to compare the models' predictive capability The odds of new nmMRSA acquisition were 6.06-fold (95% credible intervals [CrI], 3.93- to 9.34-fold) greater in bed-weeks when a nmMRSA-colonized/infected patient was in the same cubicle 2 weeks earlier. The odds of mMRSA acquisition were 5.12-fold (95% CrI, 4.02- to 6.51-fold) greater in bed-weeks when a colonized/infected patient was in the same ward 2 weeks earlier. The between-cluster variance was highest at the ward level. Patients were at greater risk if there was a colonized/infected patient in the same cubicle or ward 2 weeks earlier. Our findings indicate that focusing on the relevant cubicles and wards during this high-risk period can help target infection control resources more efficiently. Copyright © 2012 Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved.

Laryngoscope Illuminance in a Tertiary Care Medical Center: Industry Standards and Implications for Quality Laryngoscopy.

PubMed

Murphy, Michael K; Volsky, Peter G; Darrow, David H

2015-11-01

To test the hypothesis that a substantial proportion of laryngoscopes exhibit substandard illuminance by comparing laryngoscope illuminance in a tertiary-level medical center to established standards and identifying features associated with poor illuminance. Cross-sectional observational study. Academic tertiary care medical center (level 1 trauma center, specialty cardiac hospital, and general hospital). Laryngoscopes from main, cardiac, and outpatient operating rooms; emergency department; and code carts were tested using a standard technique. Illuminance (lux) was chosen as the outcome measure. Benchmarks were derived from the International Standards Organization and medical literature. Light types included incandescent bulb, light-emitting diode, and xenon. Personnel were surveyed regarding maintenance practices. Across all hospitals, 691 laryngoscopes were tested. Mean (SD) illuminance was 810 (700) lux for incandescent bulb-on-blade designs (n = 237), 1860 (1220) lux for incandescent bulb in-handle designs (n = 79), 4730 (3210) lux for LED (n = 354), and 28,800 (34,500) lux for xenon (n = 21). Seven percent of units failed to turn on (n = 45). Using an established threshold of 867 lux, 28% of devices (47% of incandescent, 12% of LED, and 10% of xenon) were substandard. All laryngoscopes were cleaned according to standard protocols following use; no preventive maintenance was reported. Twenty-eight percent of laryngoscopes in a tertiary care hospital exhibit substandard illuminance; these results corroborate the findings of our inaugural study on this subject. Consequently, our hospital is instituting changes to reduce the likelihood of substandard performance by laryngoscopes in circulation. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2015.

[Environmental noise levels in 2 intensive care units in a tertiary care centre].

PubMed

Ornelas-Aguirre, José Manuel; Zárate-Coronado, Olivia; Gaxiola-González, Fabiola; Neyoy-Sombra, Venigna

2017-04-03

The World Health Organisation (WHO) has established a maximum noise level of 40 decibels (dB) for an intensive care unit. The aim of this study was to compare the noise levels in 2 different intensive care units at a tertiary care centre. Using a cross-sectional design study, an analysis was made of the maximum noise level was within the intensive coronary care unit and intensive care unit using a digital meter. A measurement was made in 4 different points of each room, with 5minute intervals, for a period of 60minutes 7:30, 14:30, and 20:30. The means of the observations were compared with descriptive statistics and Mann-Whitney U. An analysis with Kruskal-Wallis test was performed to the mean noise level. The noise observed in the intensive care unit had a mean of 64.77±3.33dB (P=.08), which was similar to that in the intensive coronary care unit, with a mean of 60.20±1.58dB (P=.129). Around 25% or more of the measurements exceeded the level recommended by the WHO by up to 20 points. Noise levels measured in intensive care wards exceed the maximum recommended level for a hospital. It is necessary to design and implement actions for greater participation of health personnel in the reduction of environmental noise. Copyright © 2017 Instituto Nacional de Cardiología Ignacio Chávez. Publicado por Masson Doyma México S.A. All rights reserved.

Enabling student placement through strategic partnerships between a health-care organization and tertiary institutions.

PubMed

Henderson, Amanda; Heel, Alison; Twentyman, Michelle

2007-01-01

Nursing management needs to demonstrate its commitment to clinical education for undergraduate nursing students. The vision for the nursing leadership and management team at Princess Alexandra Hospital is to guide and support the development of hospital clinicians, at all levels in the organization, to effectively facilitate undergraduate students' learning during their clinical practical experiences. This paper examines the evolution of the meaning, commitment and practices that have been intrinsic to the development of strategic partnerships between the health-care organization and tertiary institutions to ensure that hospital staff who consistently facilitate student learning in the clinical context are well supported. The partnerships are based on open channels of communication between the health-care organization and the tertiary institutions whereby each party identifies its needs and priorities. This has resulted in increased hospital staff satisfaction through greater involvement by them in the placements of students, and enhanced understanding of clinicians of the student placement process that has contributed to improved satisfaction and outcomes for the students.

Burnout and quality of life in nurses of a tertiary care hospital in Pakistan.

PubMed

Naz, Shahana; Hashmi, Ali Madeeh; Asif, Aftab

2016-05-01

To determine the relationship of burnout and quality of life among nurses of different departments at a tertiary care hospital. The observational, cross-sectional study was conducted at Mayo Hospital, Lahore, from November 2013 to May2014, and comprised nurses recruited by convenience sampling. Maslach Burnout Inventory was used to assess burnout and World Health Organisation Quality of life instrument's BREF version was used to assess quality of life of the subjects. Data was analysed using SPSS 16. Of the 106 nurses with a mean age of 35.5±7 years, 83(79%) were experiencing severe burnout and a low quality of life. Nurses of Surgery and Obstetrics/Gynaecology departments who worked longer hours on the night shift scored higher on burnout and lower on quality of life. Burnout in nurses was very common because of increasing workload and can negatively affect their quality of life leading to compromised patient care.

Determinants of mortality and prolonged hospital stay among dengue patients attending tertiary care hospital: a cross-sectional retrospective analysis

PubMed Central

Khan, Amer Hayat; Sarriff, Azmi; Adnan, Azreen Syazril; Khan, Yusra Habib

2017-01-01

Objectives Dengue imposes substantial economic, societal and personal burden in terms of hospital stay, morbidity and mortality. Early identification of dengue cases with high propensity of increased hospital stay and death could be of value in isolating patients in need of early interventions. The current study was aimed to determine the significant factors associated with dengue-related prolonged hospitalisation and death. Design Cross-sectional retrospective study. Setting Tertiary care teaching hospital. Participants Patients with confirmed dengue diagnosis were stratified into two categories on the basis of prolonged hospitalisation (≤3 days and >3 days) and mortality (fatal cases and non-fatal cases). Clinico-laboratory characteristics between these categories were compared by using appropriate statistical methods. Results Of 667 patients enrolled, 328 (49.2%) had prolonged hospitalisation. The mean hospital stay was 4.88±2.74 days. Multivariate analysis showed that dengue haemorrhagic fever (OR 2.3), elevated alkaline phosphatase (ALP) (OR 2.3), prolonged prothrombin time (PT) (OR 1.7), activated partial thromboplastin time (aPTT) (OR 1.9) and multiple-organ dysfunctions (OR 2.1) were independently associated with prolonged hospitalisation. Overall case fatality rate was 1.1%. Factors associated with dengue mortality were age >40 years (p=0.004), secondary infection (p=0.040), comorbidities (p<0.05), acute kidney injury (p<0.001), prolonged PT (p=0.022), multiple-organ dysfunctions (p<0.001), haematocrit >20% (p=0.001), rhabdomyolosis (p<0.001) and respiratory failure (p=0.007). Approximately half of the fatal cases in our study had prolonged hospital stay of greater than three days. Conclusions The results underscore the high proportion of dengue patients with prolonged hospital stay. Early identification of factors relating to prolonged hospitalisation and death will have obvious advantages in terms of appropriate decisions about treatment and

Intensity of interprofessional collaboration among intensive care nurses at a tertiary hospital.

PubMed

Serrano-Gemes, G; Rich-Ruiz, M

To measure the intensity of interprofessional collaboration (IPC) in nurses of an intensive care unit (ICU) at a tertiary hospital, to check differences between the dimensions of the Intensity of Interprofessional Collaboration Questionnaire, and to identify the influence of personal variables. A cross-sectional descriptive study was conducted with 63 intensive care nurses selected by simple random sampling. Explanatory variables: age, sex, years of experience in nursing, years of experience in critical care, workday type and work shift type; variable of outcome: IPC. The IPC was measured by: Intensity of Interprofessional Collaboration Questionnaire. Descriptive and bivariate statistical analysis (IPC and its dimensions with explanatory variables). 73.8% were women, with a mean age of 46.54 (±6.076) years. The average years experience in nursing and critical care was 23.03 (±6.24) and 14.25 (±8.532), respectively. 77% had a full time and 95.1% had a rotating shift. 62.3% obtained average IPC values. Statistically significant differences were found (P<.05) between IPC (overall score) and overall assessment with years of experience in critical care. This study shows average levels of IPC; the nurses with less experience in critical care obtained higher IPC and overall assessment scores. Copyright © 2016 Sociedad Española de Enfermería Intensiva y Unidades Coronarias (SEEIUC). Publicado por Elsevier España, S.L.U. All rights reserved.

Paediatric mild head injury: is routine admission to a tertiary trauma hospital necessary?

PubMed

Tallapragada, Krishna; Peddada, Ratna Soundarya; Dexter, Mark

2018-03-01

Previous studies have shown that children with isolated linear skull fractures have excellent clinical outcomes and low risk of surgery. We wish to identify other injury patterns within the spectrum of paediatric mild head injury, which need only conservative management. Children with low risk of evolving neurosurgical lesions could be safely managed in primary hospitals. We retrospectively analysed all children with mild head injury (i.e. admission Glasgow coma score 13-15) and skull fracture or haematoma on a head computed tomography scan admitted to Westmead Children's Hospital, Sydney over the years 2009-2014. Data were collected regarding demographics, clinical findings, mechanism of injury, head computed tomography scan findings, neurosurgical intervention, outcome and length of admission. Wilcoxon paired test was used with P value <0.05 considered significant. Four hundred and ten children were analysed. Three hundred and eighty-one (93%) children were managed conservatively, 18 (4%) underwent evacuation of extradural haematoma (TBI surgery) and 11 (3%) needed fracture repair surgery. Two children evolved a surgical lesion 24 h post-admission. Only 17 of 214 children transferred from peripheral hospitals needed neurosurgery. Overall outcomes: zero deaths, one needed brain injury rehabilitation and 63 needed child protection unit intervention. Seventy-five percentage of children with non-surgical lesions were discharged within 2 days. Eighty-three percentage of road transfers were discharged within 3 days. Children with small intracranial haematomas and/or skull fractures who need no surgery only require brief inpatient symptomatic treatment and could be safely managed in primary hospitals. Improved tertiary hospital transfer guidelines with protocols to manage clinical deterioration could have cost benefit without risking patient safety. © 2017 Royal Australasian College of Surgeons.

Auditing surgical service provision at a South African tertiary institution: Implications for the development of district services.

PubMed

Laing, G L; Skinner, D L; Bruce, J L; Aldous, C; Govindasamy, V; Thomson, S R; Clarke, D L

2017-11-01

The optimal management of resources within South African state hospitals has been hampered by a paucity of data due to a lack of robust auditing information systems. This study reviews the use of a Hybrid Electronic Medical Record (HEMR) system to capture and aggregate data pertaining to the inpatient service demands on a South African tertiary surgical service. This dataset was used to analyse the appropriateness of tertiary surgical resource utilisation. The HEMR system was implemented at Greys Hospital, in the city of Pietermaritzburg, Kwa-Zulu Natal, South Africa on 1 January 2013. Inpatient data pertaining to surgical admissions and operative interventions were captured prospectively. Following an 18-month study period, the data were extracted, aggregated and analysed. The district referral hospitals were mapped, and district surgical procedures performed within the tertiary center were identified and quantified. Results: 7314 patients were admitted and managed by the tertiary surgical service during the study period. The median patient age was 33 years (IQR 6.5-42.4 years). 59.7% were male and 40.3% were female. General, trauma and paediatric surgical admissions constituted 54.8%, 28.6% and 16.6% respectively. Emergency admissions constituted 62.4% and elective admissions 37.6%. Referral sources were captured for 6653 (91%) of the cohort. 4338 (65.2%) patients were referred from district hospitals. The district hospital (Northdale) closest to Greys Hospital was responsible for 1675 (25.2%) of surgical referrals. 4174 operative procedures were performed during the study period, 54.7% performed as an emergency, 34.1% electively and 11.2% semi-electively. The median waiting time for emergency operative intervention was 535 minutes (IQR 130-663). A total of 1272 (30.5%) operative procedures performed were assessed as district-level operations. The time intervals of 07:00-07:59 and 17:00-17:59 were identified as the time periods during which the least number of

Severe Plasmodium knowlesi Malaria in a Tertiary Care Hospital, Sabah, Malaysia

PubMed Central

William, Timothy; Menon, Jayaram; Rajahram, Giri; Chan, Leslie; Ma, Gordon; Donaldson, Samantha; Khoo, Serena; Fredrick, Charlie; Jelip, Jenarun; Anstey, Nicholas M.

2011-01-01

The simian parasite Plasmodium knowlesi causes severe human malaria; the optimal treatment remains unknown. We describe the clinical features, disease spectrum, and response to antimalarial chemotherapy, including artemether-lumefantrine and artesunate, in patients with P. knowlesi malaria diagnosed by PCR during December 2007–November 2009 at a tertiary care hospital in Sabah, Malaysia. Fifty-six patients had PCR-confirmed P. knowlesi monoinfection and clinical records available for review. Twenty-two (39%) had severe malaria; of these, 6 (27%) died. Thirteen (59%) had respiratory distress; 12 (55%), acute renal failure; and 12, shock. None experienced coma. Patients with uncomplicated disease received chloroquine, quinine, or artemether-lumefantrine, and those with severe disease received intravenous quinine or artesunate. Parasite clearance times were 1–2 days shorter with either artemether-lumefantrine or artesunate treatment. P. knowlesi is a major cause of severe and fatal malaria in Sabah. Artemisinin derivatives rapidly clear parasitemia and are efficacious in treating uncomplicated and severe knowlesi malaria. PMID:21762579

Methicillin-resistant Staphylococcus aureus (MRSA) in a tertiary surgical and trauma hospital in Benghazi, Libya.

PubMed

Buzaid, Najat; Elzouki, Abdel-Naser; Taher, Ibrahim; Ghenghesh, Khalifa Sifaw

2011-10-13

Methicillin resistant Staphylococcus aureus (MRSA) is a multidrug resistant organism that threatens the continued effectiveness of antibiotics worldwide and causes a threat almost exclusively in hospitals and long-term care settings. This study investigated the prevalence of MRSA strains and their sensitivity patterns against various antibiotics used for treating hospitalized patients in a major tertiary surgical hospital in Benghazi, Libya. We investigated 200 non-duplicate S. aureus strains isolated from different clinical specimens submitted to the Microbiology Laboratory at Aljala Surgical and Trauma Hospital, Benghazi, Libya from April to July 2007. Isolates were tested for methicillin resistance by the oxacillin disc-diffusion assay according to Clinical and Laboratory Standards Institute guidelines. MRSA strains were tested for antimicrobial resistance (i.e., vancomycin, ciprofloxacin, erythromycin, chloramphenicol and fusidic acid) using commercial discs. Information on patient demographics and clinical disease was also collected. Of the isolates examined 31% (62/200) were MRSA. No significant differences were observed in the prevalence of MRSA among S. aureus from females or males or from different age groups. Most MRSA were isolated from burns and surgical wound infections. Antibiotic resistance patterns of 62 patients with MRSA to vancomycin, ciprofloxacin, fusidic acid, chloramphenicol and erythromycin were 17.7%, 33.9%, 41.9%, 38.7% and 46.8% of cases, respectively. MRSA prevalence in our hospital was high and this may be the case for other hospitals in Libya. A sound surveillance program of nosocomial infections is urgently needed to reduce the incidence of infections due to MRSA and other antimicrobial-resistant pathogens in Libyan hospitals.

Rates, levels, and determinants of electronic health record system adoption: a study of hospitals in Riyadh, Saudi Arabia.

PubMed

Aldosari, Bakheet

2014-05-01

Outside a small number of OECD countries, little information exists regarding the rates, levels, and determinants of hospital electronic health record (EHR) system adoption. This study examines EHR system adoption in Riyadh, Saudi Arabia. Respondents from 22 hospitals were surveyed regarding the implementation, maintenance, and improvement phases of EHR system adoption. Thirty-seven items were graded on a three-point scale of preparedness/completion. Measured determinants included hospital size, level of care, ownership, and EHR system development team composition. Eleven of the hospitals had implemented fully functioning EHR systems, eight had systems in progress, and three had not adopted a system. Sixteen different systems were being used across the 19 adopting hospitals. Differential adoption levels were positively related to hospital size and negatively to the level of care (secondary versus tertiary). Hospital ownership (nonprofit versus private) and development team composition showed mixed effects depending on the particular adoption phase being considered. Adoption rates compare favourably with those reported from other countries and other districts in Saudi Arabia, but wide variations exist among hospitals in the levels of adoption of individual items. General weaknesses in the implementation phase concern the legacy of paper data systems, including document scanning and data conversion; in the maintenance phase concern updating/maintaining software; and in the improvement phase concern the communication and exchange of health information. This study is the first to investigate the level and determinants of EHR system adoption for public, other nonprofit, and private hospitals in Saudi Arabia. Wide interhospital variations in adoption bear implications for policy-making and funding intervention. Identified areas of weakness require action to increase the degree of adoption and usefulness of EHR systems. Copyright © 2014 Elsevier Ireland Ltd. All rights

Family caregivers in public tertiary care hospitals in Bangladesh: Risks and opportunities for infection control

PubMed Central

Islam, M. Saiful; Luby, Stephen P.; Sultana, Rebeca; Rimi, Nadia Ali; Zaman, Rashid Uz; Uddin, Main; Nahar, Nazmun; Rahman, Mahmudur; Hossain, M. Jahangir; Gurley, Emily S.

2015-01-01

Background Family caregivers are integral to patient care in Bangladeshi public hospitals. This study explored family caregivers’ activities and their perceptions and practices related to disease transmission and prevention in public hospitals. Methods Trained qualitative researchers conducted a total of 48 hours of observation in 3 public tertiary care hospitals and 12 in-depth interviews with family caregivers. Results Family caregivers provided care 24 hours a day, including bedside nursing, cleaning care, and psychologic support. During observations, family members provided 2,065 episodes of care giving, 75% (1,544) of which involved close contact with patients. We observed family caregivers washing their hands with soap on only 4 occasions. The majority of respondents said diseases are transmitted through physical contact with surfaces and objects that have been contaminated with patient secretions and excretions, and avoiding contact with these contaminated objects would help prevent disease. Conclusion Family caregivers are at risk for hospital-acquired infection from their repeated exposure to infectious agents combined with their inadequate hand hygiene and knowledge about disease transmission. Future research should explore potential strategies to improve family caregivers’ knowledge about disease transmission and reduce family caregiver exposures, which may be accomplished by improving care provided by health care workers. PMID:24406254

Family caregivers in public tertiary care hospitals in Bangladesh: risks and opportunities for infection control.

PubMed

Islam, M Saiful; Luby, Stephen P; Sultana, Rebeca; Rimi, Nadia Ali; Zaman, Rashid Uz; Uddin, Main; Nahar, Nazmun; Rahman, Mahmudur; Hossain, M Jahangir; Gurley, Emily S

2014-03-01

Family caregivers are integral to patient care in Bangladeshi public hospitals. This study explored family caregivers' activities and their perceptions and practices related to disease transmission and prevention in public hospitals. Trained qualitative researchers conducted a total of 48 hours of observation in 3 public tertiary care hospitals and 12 in-depth interviews with family caregivers. Family caregivers provided care 24 hours a day, including bedside nursing, cleaning care, and psychologic support. During observations, family members provided 2,065 episodes of care giving, 75% (1,544) of which involved close contact with patients. We observed family caregivers washing their hands with soap on only 4 occasions. The majority of respondents said diseases are transmitted through physical contact with surfaces and objects that have been contaminated with patient secretions and excretions, and avoiding contact with these contaminated objects would help prevent disease. Family caregivers are at risk for hospital-acquired infection from their repeated exposure to infectious agents combined with their inadequate hand hygiene and knowledge about disease transmission. Future research should explore potential strategies to improve family caregivers' knowledge about disease transmission and reduce family caregiver exposures, which may be accomplished by improving care provided by health care workers. Copyright © 2014 Association for Professionals in Infection Control and Epidemiology, Inc. All rights reserved.

Bloodstream infections at a tertiary referral hospital in Yangon, Myanmar.

PubMed

Myat, Tin Ohn; Prasad, Namrata; Thinn, Kyi Kyi; Win, Kyu Kyu; Htike, Wah Win; Zin, Khwar Nyo; Murdoch, David R; Crump, John A

2014-11-01

Data regarding characteristics of bloodstream infections in Myanmar are limited. Blood culture results from all outpatients and inpatients were extracted from records of the Clinical Microbiology Laboratory, Yangon General Hospital, for the period 2005 through 2013. Of 3865 blood cultures performed, 449 (11.6%) were positive for a pathogenic organism. Gram-negative bacteria was the most common organism group, accounting for 246 (55.5%) of 449 isolations. Staphylococcus aureus was the most common isolate, detected in 171 (38.1%) of 449 blood cultures. From 2005-2008 to 2009-2013 the proportion of all pathogenic isolates that were Gram-positive declined from 52.8% (167/316) to 20.3% (27/133) (p<0.001), whereas the proportion of Gram-negative bacteria rose from 45.6% (144/316) to 78.9% (105/133) (p<0.001), with non-fermentative bacilli accounting for much of this increase. Antimicrobial susceptibility testing demonstrated a high prevalence resistance of S. aureus to first-line antimicrobials such as erythromycin, penicillin and oxacillin. More than half of tested Escherichia coli and Citrobacter species showed resistance to amoxicillin-clavulanic acid, ceftriaxone or gentamicin. Bloodstream infections are common among patients receiving blood culture at a tertiary hospital in Yangon, Myanmar. Our findings suggest that antimicrobial resistance among invasive bacteria is common, similar to patterns described elsewhere in the region, and highlight the need for locally adapted antimicrobial guidelines for sepsis management. © The Author 2014. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Comparison of two public sector tertiary care hospitals' management in reducing direct medical cost burden on breast carcinoma patients in Lahore, Pakistan.

PubMed

Hameed Khaliq, Imran; Zahid Mahmood, Hafiz; Akhter, Naveed; Danish Sarfraz, Muhammad; Asim, Khadija; Masood Gondal, Khalid

2018-01-01

Breast cancer is one of the major causes of death incurring highest morbidity and mortality amongst women of Pakistan. The purpose of this study was to assess and compare the role of two public sector tertiary care hospitals' management in reducing out of pocket (OOP) expenses on direct medical costs borne by breast carcinoma patients' household from diagnosis through treatment. Moreover, the study intended to explore the reasons of opting private diagnostic facilities by the said patients during the services taken from the foresaid tertiary care centers. A purposive sample of 164 primary breast carcinoma patients was recruited for data collection of this cross-sectional study. Face to face interviews and semistructured questionnaires were adopted as method of data gathering tools. Major cost components of direct medical costs were used to compare the financial strain on the patients' households of both targeted hospitals. In addition, information was collected regarding the reasons of opting private diagnostic centers for investigations. Frequency, percentages, median and inter quartile range (IQR) were calculated for the data. Non-parametric variables were compared using the Mann-Whitney U test. It was observed that overall direct medical cost borne by the breast carcinoma patients' households in Jinnah hospital (median US$1153.93 / Rs. 118,589) was significantly higher than Mayo hospital (median US$427.93 /Rs. 43,978), p<0.001; r=0.623. Moreover, spending on almost all of the components of direct medical cost were found smaller in case of Mayo hospital's patients as compared to Jinnah hospital. This study indicates that OOP direct medical cost burden was found considerably less in Mayo hospital as compared to Jinnah hospital. The OOP expenditures on chemotherapy were overwhelmingly high. However, high spending on privately opted investigations procedures was the common issue of the patients under treatment in both hospitals.

Utilization of physiotherapy in the continuum of stroke care at a tertiary hospital in Ibadan, Nigeria.

PubMed

Olaleye, Olubukola Adebisi; Lawal, Zainab Iyabo

2017-03-01

To investigate the pattern of referral for and utilisation of physiotherapy in the continuum of stroke care at a tertiary hospital in Ibadan, Nigeria. Referral notes and medical records of patients admitted in the University College Hospital, Ibadan with a clinical diagnosis of stroke between January, 2009 and December, 2013 were retrospectively reviewed. Information on age, sex, type of stroke, length of hospital stay, referral for physiotherapy and utilisation of physiotherapy were retrieved. Data were summarised using descriptive statistics and analysed using Chi-square test. A total of 783 patients with stroke were admitted in the hospital during the period under study. The in-patient mortality rate was 37.2%. The mean Length of Hospital Stay (LoHS) was 16.17±12.34 days. Referral rate for physiotherapy was high (75.8%) and the mean time from admission to referral for physiotherapy was three days. Majority of patients referred utilised physiotherapy (63.4%) and mean number of physiotherapy sessions received during in-patient care was 8.69±6.45. There was a significant association between LoHS and utilisation of in-patientphysiotherapy (p=0.02). The referral rate of stroke patients for physiotherapy was relatively high. Utilisation of in-patient physiotherapy reduced length of hospital stay among patients with stroke. Utilisation of out-patient physiotherapy was low. Strategies to enhance out-patient utilisation should be explored.

Impact of an educational program on antibiotic use in a tertiary care hospital in a developing country.

PubMed

Thamlikitkul, V; Danchaivijitr, S; Kongpattanakul, S; Ckokloikaew, S

1998-09-01

A multi-cross-sectional study was conducted in a 2000-bed tertiary care university hospital in Bangkok, Thailand, from September 1993 to May 1994 to assess the effectiveness of an educational program on the use of antibiotics. Data on the study covered antibiotic usage both in-patients and out-patients. Data were collected for a 24-hour period every 2 weeks for 7 days for each 3-month period. The target population were residents, general practitioners, and sixth-year medical students. The educational program provided information derived from the data of inappropriate use of antibiotics during the pre-intervention period and guidelines on the use of antibiotics which were agreed to by a consensus among the faculty in all clinical departments. The study revealed: (1) the prevalence of antibiotic use and the cost of antibiotics during post-intervention period was significantly decreased by 20%; (2) the use of antibiotic prophylaxis for obstetrics patients and patients undergoing cataract surgery decreased significantly; (3) there was a shift from second or third generation cephalosporins to cefazolin for surgical prophylaxis; (4) the duration of perioperative antibiotic prophylaxis was reduced to under 2 days; (5) there was a shift from netilmicin or amikacin to gentamicin for the treatment of community acquired infection; and (6) the mortality, median length of hospital stay, and nosocomial infection rate among the patients who received antibiotics during the post-intervention period were not significantly different from those during the pre-intervention period. These results suggest that this educational program comprising information feedback and antibiotic usage guidelines was effective in improving antibiotic use at this tertiary care university hospital in Thailand.

Beta-Lactam Antibiotic Sensitization and Its Relationship to Allergic Diseases in Tertiary Hospital Nurses

PubMed Central

Han, Eui-Ryoung; Lim, Seong-Wook; Lim, Seong-Ryoon; Kim, Ji-Na; Park, Sin-Young; Chae, Su-Kyoung; Lim, Hye-Hyeun; Seol, Young-Ae; Bae, You-In; Won, Young-Ho

2010-01-01

Purpose Skin allergies through type 1 and 4 hypersensitivity reactions are the most frequent manifestations of drug allergies. We had previously experienced a case of a nurse with cefotiam-induced contact urticaria syndrome. To aid in preventing the progression of drug-induced allergic disease in nurses, we conducted a survey of tertiary hospital nurses who were likely to have been exposed professionally to antibiotics. Methods All 539 staff nurses at a tertiary hospital were asked to respond to a questionnaire regarding antibiotic exposure. Of the 457 nurses (84.8%) who responded, 427 (79.2%) received a physical examination of the hands and 318 (59.0%) received skin prick tests with the β-lactam antibiotics cefotiam, cefoperazone, ceftizoxime, flomoxef, piperacillin and penicillin G. Results A positive response to at least one of the antibiotics occurred in 8 (2.6%) of the 311 subjects included in the analysis and stages 1 and 2 contact urticaria syndrome were observed in 38 (8.9%) and 3 (0.7%) of 427 nurses, respectively. The frequencies of a positive antibiotic skin test (6.9 versus 1.3%, χ2=7.15, P=0.018), stage 1 contact urticaria syndrome (14.4 versus 7.4%, χ2=4.33, P=0.038) and drug allergy (15.3 versus 3.6%, χ2=18.28, P=0.000) were higher in subjects with a positive skin allergy history than in those without. Allergic rhinitis (P=0.02, OR=3.86, CI=1.23-12.06), night cough (P=0.04, OR=3.12, CI=1.03-9.41) and food allergy (P=0.00, OR=9.90, CI=3.38-29.98) were significant risk factors for drug allergy. Conclusions Antibiotic sensitization and drug allergy occurred more frequently in nurses with a positive skin allergy history. Atopy may be an important risk factor for drug allergy. PMID:20358025

Laryngoscope illuminance in a tertiary children's hospital: implications for quality laryngoscopy.

PubMed

Volsky, Peter G; Murphy, Michael K; Darrow, David H

2014-07-01

Laryngoscopes are used by otolaryngologists in a variety of hospital emergency and critical care settings. However, only rarely have quality-related aspects of laryngoscope function and application been studied. To compare the illuminance of laryngoscopes commonly used in a hospital setting to established standards and to assess the potential effects of maintenance practices on laryngoscope illuminance. Observational study of laryngoscope light output and cross-sectional survey of individuals charged with laryngoscope maintenance in a tertiary care children's hospital. Illuminance was chosen as the unit of measurement (lux). Laryngoscopes in the operating room, emergency department, and pediatric intensive care unit were tested according to a standard technique. Illuminance standards for laryngoscopes, published by the International Organization for Standardization (ISO) (500 lux) and in the medical literature (867 lux) were used as benchmarks. Mean laryngoscope illuminance by type of laryngoscope and light source and percentage of laryngoscopes with illuminance below established standards as well as nonfunctioning units. Maintenance practices were evaluated as a secondary outcome. A total of 319 laryngoscopes were tested; 283 were incandescent bulb units used by anesthesiologists, emergency physicians, and intensivists and 36 were xenon light units used by otolaryngologists. Mean (SD) illuminance was 1330 (1160) lux in the incandescent group and 16,600 (13,000) lux in the xenon group (P < .001). Substandard illuminance was observed only in the incandescent group, in 29% to 43% of laryngoscopes; 5% of the incandescent group did not turn on at all. Maintenance of laryngoscopes was performed on a reactive rather than a preventive basis. At our facility, approximately one-third of incandescent laryngoscopes exhibited substandard light output. On the basis of these findings, our hospital has converted all of its incandescent laryngoscopes to light-emitting diode (LED

Direct and indirect cost of myasthenia gravis: A prospective study from a tertiary care teaching hospital in India.

PubMed

Sonkar, Kamlesh Kumar; Bhoi, Sanjeev Kumar; Dubey, Deepanshu; Kalita, Jayantee; Misra, Usha Kant

2017-04-01

Myasthenia gravis (MG) requires lifelong treatment. The cost of management MG is very high in developed countries but there is no information on the cost of management of MG in the developing countries. This study reports the direct and indirect cost and predictors of cost of MG in a tertiary care teaching hospital in India. In a prospective hospital based study, from a tertiary hospital in India 66 consecutive patient during 2014-2015 were included. The age of the patients ranged between 6 and 75years. The severity of MG was assessed by myasthenia gravis foundation association (MGFA) class (MGFA) I-V. The patient data was collected s and their direct cost was calculated from the computerized Hospital information system. The indirect cost was calculated from patient's memory, checking the bills of transportation and wages loss by the patient or the care giver. Total annual cost of MG ranged between INR (4560-532227) with median INR 61390.5 (US$911.64). The median cost of outpatient department (OPD) consultation of 16 patients was INR 20439.9 (US$303.53), of 50 admitted patients was INR 44311.8 (US$658.03) and 21 intensive care unit (ICU) patients was INR 59574.3 (US$ 884.6) and the direct cost of thymectomy was INR 45000 (US$ 668.25). Direct cost was related to indirect cost (r=0.55; p=0.0001). Predictors of patient outcome were severity of MG, ICU admission, and thymectomy. The total median cost for management of myasthenia gravis was INR 61390.5 (4560-532227, US$911.64) per year, and the cost was mainly determined by the severity of MG. Copyright © 2016 Elsevier Ltd. All rights reserved.

Profile of catering staff at a tertiary care hospital in Mumbai.

PubMed

Bobhate, Prateek S; R Shrivastava, Saurabh; Gupta, Pankaj

2011-01-01

Food borne illnesses, even today, continue to be a major public health problem in both developing and developed nations. Food handlers play an important role in ensuring food safety throughout the chain of production, processing, storage and preparation.Health of food handlers is of great importance for maintaining hygienic quality of food prepared and served by them. Thus, the present study was conducted to study socio-demographic characteristics, morbidity pattern and immunization status of catering staff at a tertiary care hospital in Mumbai A cross sectional study was conducted from August 2010 to November 2010. Out of the total of 162 food handlers working in 11 food service establishments, 137 were interviewed face to face using a semi-structured questionnaire, while remaining 25 food handlers were excluded because of either their absence or not giving consent. The food handlers were assessed clinically for personal hygiene and investigated for hemoglobin, stool routine and sputum AFB examination. 82 (59.8%) food handlers were from the age group 10 - 29 years, 113 (82.5%) male, 95 (69%) married, 59 (43.1%) educated up to primary level. Only 7 (5.1%) had ever received a dose of typhoid vaccine. 103 (75.2%) had an addiction, majority consuming gutkha 59 (57.3%). Dental caries 32 (23.4%) was the most common morbidity identified. Entamoeba histolytica was isolated in 13 (9.5%) subjects. This study has confirmed an association between educational status and personal hygiene suggesting the need for greater personal hygiene in this group. Preemployment and periodical medical examination should be encouraged.

Assessment of new drugs in a tertiary hospital using a standardized tool.

PubMed

González-Bueno, J; Chamorro-de-Vega, E; Alfaro-Lara, E R; Galván-Banqueri, M; Santos-Ramos, B

2013-01-01

To describe the profile of new drugs evaluated by the Pharmacy and Therapeutics committee in a tertiary hospital using a standardized tool, the Guideline for the Introduction of New Drugs in the Formulary (GINF form), as main objective. Retrospective observational study of drugs was assessed during 2008-2011. Variables related to the drug, the request, and the result of the evaluation were collected based on information contained in the GINF form and in the assessment reports. 63 of 75 assessed drugs (84%) were included in the hospital formulary. Only one drug (1%) was included without any restrictions. The rest of them were included as therapeutic equivalents (23%) or under specific recommendations (61%). Half of the drugs (6) not included had insufficient evidence of effectiveness compared with current treatments. Haematology and Medical Oncology were found to be the most active medical services in the application process. There was a high prevalence of drugs that had more than one advanced clinical trial (phase III and/or phase IV). Furthermore, 28% of assessed drugs were associated with a financial burden of more than ?10,000 per year for our hospital. Highquality information was provided by applicants to the P&T committee for drugs that were finally included. However, the relationship between the information provided to the P&T committee and its decision was not statistical significance. The requests received were primarily related to drugs intended for parenteral use and most of them were antineoplastic drugs. The medical departments most heavily represented were Haematology and Oncology. Copyright © 2013 SEFH. Published by AULA MEDICA. All rights reserved.

Neonatal Transport - Experience of a Tertiary Care Hospital of Bangladesh.

PubMed

Dey, S K; Sharker, S; Jahan, I; Moni, S C; Shabuj, K H; Chisti, M J; Mannan, M A; Shahidullah, M

2017-01-01

Safe transportation is mostly an unnoticed neonatal health issue in Bangladesh and no documentation is available regarding the existing practices. So this study was intended to document transport status of the referred newborn to a tertiary care hospital. This observational study included 150 out born neonates over 12 months period transported from various places to NICU, Bangabandhu Sheikh Mujib Medical University (BSMMU) from May 2015 to April 2016. A structured data collection form was used to record information categorized into pre-transport, during transport and at admission. At admission detailed clinical assessment of the baby was done and recorded. Outcome was determined as discharge or death. Of 150 transported neonates, two-third were preterm 115(77%) & LBW 113(75%). Common indications for referral were prematurity and sepsis. Most of the patients were referred from private hospital 107(71%). Majority of newborns (86%) were referred from hospitals of Dhaka city while only 14% were referred from outside Dhaka. Referral notes were supplied in most of the cases 134(89%) but comprehensive information was obtainable only in 3 cases. Although main transport vehicle was ambulance 130(87%), medical personnel accompanied the sick baby only in 6(4%) of cases. The distance traveled was less than 10 kilometers (kms) in 95(63%) and more than 100 km in 10(7%) of enrolled neonates. Transport time was less than 1 hour in 72(48%), 1-6 hours in 66(44%) and more than 6 hours in 12(8%) of cases. Nearly two third of newborn were transported after office period, 107(72%). At admission 21(14%) babies had hypothermia, 8(7.62%) hypoglycemia, 16(11%), poor perfusion 28(19%), low saturation 27(18%). Hyperthermia & hyperglycemia were observed in 8(5%) & 7(5%) cases respectively. Of the total 150 babies referred, 17(11%) died. While comparing with discharged newborn, died newborn were more frequent sufferer of hypothermia (p value 0.007) and low saturation (p value 0.049) at

Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt.

PubMed

Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; El-Mahallawy, Hadir Ahmed; Amin, Magdy Aly; El Din Ashour, Seif

2015-03-12

Pseudomonas aeruginosa is an important nosocomial pathogen, commonly causing infections in immunocompromised patients. The aim of this study was to examine the genetic relatedness of metallo-beta-lactamase (MBL) producing carbapenem resistant Pseudomonas aeruginosa clinical isolates collected from 2 tertiary hospitals in Cairo, Egypt using Multi Locus sequence typing (MLST). Phenotypic and genotypic detection of metallo-beta-lactamase for forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were carried out. DNA sequencing and MLST were done. The bla VIM-2 gene was highly prevalent (28/33 strains, 85%) among 33 MBL-positive P.aeruginosa isolates. MLST revealed eleven distinct Sequence Types (STs). A unique ST233 clone producing VIM-2 was documented by MLST in P.aeruginosa strains isolated from Cairo university hospitals. The high prevalence of VIM-2 producers was not due to the spread of a single clone. The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones.

Educational Module Intervention for Radiographers to Reduce Repetition Rate of Routine Digital Chest Radiography in Makkah Region of Saudi Arabia Tertiary Hospitals: Protocol of a Quasi-Experimental Study.

PubMed

Almalki, Abdullah A; Abdul Manaf, Rosliza; Hanafiah Juni, Muhamad; Kadir Shahar, Hayati; Noor, Noramaliza Mohd; Gabbad, Abdelsafi

2017-09-26

Repetition of an image is a critical event in any radiology department. When the repetition rate of routine digital chest radiographs is high, radiation exposure of staff and patients is increased. In addition, repetition consumes the equipment's life span, thus affecting the annual budget of the department. The aim of this study is to determine the impact of a printed educational module on reducing the repetition rate of routine digital chest radiography among radiographers in Makkah Region tertiary hospitals. A quasi-experimental time series with a control group will be conducted in Makkah Region tertiary hospitals for 8 months starting in the second quarter of 2017. Four hospitals out of 5 in the region will be selected; 2 of them will be selected as the control group and the other 2 as the intervention group. Stratification and a simple random sampling technique will be used to sample 56 radiographers in each group. Pre- and postintervention assessments will be conducted to determine the radiographer knowledge, motivation, and skills and repetition rate of chest radiographs. Radiographs of the chest performed by sampled radiographers in the selected hospitals will be collected for 2 weeks before and after the intervention. A piloted questionnaire will be distributed and collected by a researcher in both groups. One-way multivariate analysis of variance and 2-way repeated multivariate analysis of variance will be used to analyze the data. It is expected that the repetition rate in the intervention group will decline after implementing the intervention and the change will be statistically significant (P<.05). Furthermore, it is expected that the knowledge, motivation, and skill levels in the intervention group will increase significantly among radiographers after implementation of the intervention (P<.05). Meanwhile, knowledge, motivation, and skills in the control group will not change. A quasi-experimental time series with a control will be conducted to

Direct hospital costs of total laparoscopic hysterectomy compared with fast-track open hysterectomy at a tertiary hospital: a retrospective case-controlled study.

PubMed

Rhou, Yoon J J; Pather, Selvan; Loadsman, John A; Campbell, Neil; Philp, Shannon; Carter, Jonathan

2015-12-01

To assess the direct intraoperative and postoperative costs in women undergoing total laparoscopic hysterectomy and fast-track open hysterectomy. A retrospective review of the direct hospital-related costs in a matched cohort of women undergoing total laparoscopic hysterectomy (TLH) and fast-track open hysterectomy (FTOH) at a tertiary hospital. All costs were calculated, including the cost of advanced high-energy laparoscopic devices. The effect of the learning curve on cost in laparoscopic hysterectomy was also assessed, as was the hospital case-weighted cost, which was compared with the actual cost. Fifty women were included in each arm of the study. TLH had a higher intraoperative cost, but a lower postoperative cost than FTOH (AUD$3877 vs AUD$2776 P < 0.001, AUD$3965 vs AUD$6233 P < 0.001). The total cost of TLH was not different from FTOH (AUD$7842 vs AUD$9009 P = 0.068) and after a learning curve; TLH cost less than FTOH (AUD$6797 vs AUD$8647, P < 0.001). The use of high-energy devices did not impact on the cost benefit of TLH, and hospital case-weight-based funding correlated poorly with actual cost. Despite the use of fast-track recovery protocols, the cost of TLH is no different to FTOH and after a learning curve is cheaper than open hysterectomy. Judicious use of advanced energy devices does not impact on the cost, and hospital case-weight-based funding model in our hospital is inaccurate when compared to directly calculated hospital costs. © 2013 The Authors ANZJOG © 2013 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

Disaster content in Australian tertiary postgraduate emergency nursing courses: a survey.

PubMed

Ranse, Jamie; Shaban, Ramon Z; Considine, Julie; Hammad, Karen; Arbon, Paul; Mitchell, Belinda; Lenson, Shane

2013-05-01

Emergency nurses play a pivotal role in disaster relief during the response to, and recovery of both in-hospital and out-of-hospital disasters. Postgraduate education is important in preparing and enhancing emergency nurses' preparation for disaster nursing practice. The disaster nursing content of Australian tertiary postgraduate emergency nursing courses has not been compared across courses and the level of agreement about suitable content is not known. To explore and describe the disaster content in Australian tertiary postgraduate emergency nursing courses. A retrospective, exploratory and descriptive study of the disaster content of Australian tertiary postgraduate emergency nursing courses conducted in 2009. Course convenors from 12 universities were invited to participate in a single structured telephone survey. Data was analysed using descriptive statistics. Ten of the twelve course convenors from Australian tertiary postgraduate emergency nursing courses participated in this study. The content related to disasters was varied, both in terms of the topics covered and duration of disaster content. Seven of these courses included some content relating to disaster health, including types of disasters, hospital response, nurses' roles in disasters and triage. The management of the dead and dying, and practical application of disaster response skills featured in only one course. Three courses had learning objectives specific to disasters. The majority of courses had some disaster content but there were considerable differences in the content chosen for inclusion across courses. The incorporation of core competencies such as those from the International Council of Nurses and the World Health Organisation, may enhance content consistency in curriculum. Additionally, this content could be embedded within a proposed national education framework for disaster health. Copyright © 2013 College of Emergency Nursing Australasia Ltd. Published by Elsevier Ltd. All rights

Self esteem and organizational commitment among health information management staff in tertiary care hospitals in Tehran.

PubMed

Sadoughi, Farahnaz; Ebrahimi, Kamal

2014-12-12

Self esteem (SE) and organizational commitment (OC)? have significant impact on the quality of work life. This study aims to gain a better understanding of the relationships between SE and OC among health information management staff in tertiary care hospitals in Tehran (Iran). This was a descriptive correlational and cross sectional study conducted on the health information management staff of tertiary care hospitals in Tehran, Iran. A total of 155 participants were randomly selected from 400 staff. Data were collected by two standard questionnaires. The SE and OC was measured using Eysenck SE scale and Meyer and Allen's three component model, respectively. The collected data were analyzed with the SPSS (version 16) using statistical tests of of independent T-test, Pearson Correlation coefficient, one way ANOVA and F tests. The OC and SE of the employees' were 67.8?, out of 120 (weak) and 21.0 out of 30 (moderate), respectively. The values for affective commitment, normative commitment, and continuance commitment were respectively 21.3 out of 40 (moderate), 23.9 out of 40 (moderate), and 22.7 out of 40 (moderate). The Pearson correlation coefficient test showed a significant OC and SE was statistically significant (P<0.05). The one way ANOVA test (P<0.05) did not show any significant difference between educational degree and work experience with SE and OC. This research showed that SE and OC ?are moderate. SE and OC have strong correlation with turnover, critical thinking, job satisfaction, and individual and organizational improvement. Therefore, applying appropriate human resource policies is crucial to reinforce these measures.

Chicken pox outbreak in the Intensive Care Unit of a tertiary care hospital: Lessons learnt the hard way.

PubMed

Sarit, Sharma; Shruti, Sharma; Deepinder, Chhina; Chhina, R S

2015-12-01

Varicella-zoster virus (VZV) causes 2 clinically and epidemiologically distinct forms of diseases. Chickenpox (varicella) is the disease that results from primary infection with the VZV. Herpes zoster (HZ) results from the reactivation of VZV latently infecting the dorsal root ganglia. We are reporting an outbreak of varicella infection among the health care workers (HCWs) in the Intensive Care Unit (ICU) of a tertiary care hospital. We found transmission of varicella among eight HCWs of pulmonary ICU. They had a history of contact with a patient having HZ infection. Investigation of the outbreak was conducted as per guidelines. Better dissemination of information on disease transmission, isolation of infected patients inside the hospital, and adequate protection (including vaccination) for susceptible employees are important to prevent such outbreaks.

Indications and outcome of pediatric tracheostomy: results from a Nigerian tertiary hospital.

PubMed

Adoga, Adeyi A; Ma'an, Nuhu D

2010-01-12

There is a change in the concept of pediatric tracheostomy. This study investigates the indications and outcomes of pediatric tracheostomy in a Nigerian teaching hospital finding out whether there is also a change in the trend in our environment as compared to other centers. A retrospective chart review of 46 patients aged between 2 months and 15 years who presented to our Otorhinolaryngological facility and had tracheostomy between January 2000 and December 2008. The age range was 2 months to 15 years. There were 29 males and 17 females. Thirty two (69.6%) patients were in the age range 6-10 years. Forty tracheostomies (87%) were performed as emergency while 6 (13%) as elective procedures. The commonest indication for tracheostomy was upper airway obstruction (n = 29, 63%). Transverse skin incision was employed in all the cases. No intra-operative complication was recorded. The post-operative complication rate was 15.2%. The duration of tracheostomy ranged from 5 days to 3 months. All the patients were successfully decannulated. The overall mortality was 8 (17.4%). There was no tracheostomy related mortality. There is no increase in the incidence of tracheostomy in patients under 1 year of age and the commonest indication for the procedure in Nigeria has remained relief of upper airway obstruction. Pediatric tracheostomy is safe when performed in the tertiary hospital setting.

Management of potentially life-threatening emergencies at 74 primary level hospitals in Mongolia: results of a prospective, observational multicenter study.

PubMed

Mendsaikhan, Naranpurev; Gombo, Davaa; Lundeg, Ganbold; Schmittinger, Christian; Dünser, Martin W

2017-05-08

While the capacities to care for and epidemiology of emergency and critically ill patients have been reported for secondary and tertiary level hospitals in Mongolia, no data exist for Mongolian primary level hospitals. In this prospective, observational multicenter study, 74 primary level hospitals of Mongolia were included. We determined the capacities of these hospitals to manage medical emergencies. Furthermore, characteristics of patients presenting with potentially life-threatening emergencies to these hospitals were evaluated during a 6 month period. An emergency/resuscitation room was available in 62.2% of hospitals. One third of the study hospitals had an operation theatre (32.4%). No hospital ran an intensive care unit or had trained emergency/critical care physicians or nurses available. Diagnostic resources were inconsistently available (sonography, 59.5%; echocardiography, 0%). Basic emergency procedures (wound care, 97.3%; foreign body removal, 86.5%; oxygen application, 85.2%) were commonly but advanced procedures (advanced cardiac life support, 10.8%; airway management, 13.5%; mechanical ventilation, 0%; renal replacement therapy, 0%) rarely available. During 6 months, 14,545 patients were hospitalized in the 74 study hospitals, of which 8.7% [n = 1267; median age, 34 (IQR 18-53) years; male gender, 54.4%] were included in the study. Trauma (excl. brain trauma) (20.4%), acute abdomen (16.9%) and heart failure (9.6%) were the most common conditions. Five-hundred-thirty patients (41.8%) were transferred to a secondary level hospital. The hospital mortality of patients not transferred was 3.2%. Capacities of Mongolian primary level hospitals to manage life-threatening emergencies are highly limited. Trauma, surgical and medical conditions make up the most common emergencies. In view of the fact that almost half of the patients with a potentially life-threatening emergency were transferred to secondary level hospitals and the mortality of those

Application of Lean Healthcare methodology in a urology department of a tertiary hospital as a tool for improving efficiency.

PubMed

Boronat, F; Budia, A; Broseta, E; Ruiz-Cerdá, J L; Vivas-Consuelo, D

To describe the application of the Lean methodology as a method for continuously improving the efficiency of a urology department in a tertiary hospital. The implementation of the Lean Healthcare methodology in a urology department was conducted in 3 phases: 1) team training and improvement of feedback among the practitioners, 2) management by process and superspecialisation and 3) improvement of indicators (continuous improvement). The indicators were obtained from the Hospital's information systems. The main source of information was the Balanced Scorecard for health systems management (CUIDISS). The comparison with other autonomous and national urology departments was performed through the same platform with the help of the Hospital's records department (IASIST). A baseline was established with the indicators obtained in 2011 for the comparative analysis of the results after implementing the Lean Healthcare methodology. The implementation of this methodology translated into high practitioner satisfaction, improved quality indicators reaching a risk-adjusted complication index (RACI) of 0.59 and a risk-adjusted mortality rate (RAMR) of 0.24 in 4 years. A value of 0.61 was reached with the efficiency indicator (risk-adjusted length of stay [RALOS] index), with a savings of 2869 stays compared with national Benchmarking (IASIST). The risk-adjusted readmissions index (RARI) was the only indicator above the standard, with a value of 1.36 but with progressive annual improvement of the same. The Lean methodology can be effectively applied to a urology department of a tertiary hospital to improve efficiency, obtaining significant and continuous improvements in all its indicators, as well as practitioner satisfaction. Team training, management by process, continuous improvement and delegation of responsibilities has been shown to be the fundamental pillars of this methodology. Copyright © 2017 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

An Integrated Skills Approach Using Feature Movies in EFL at Tertiary Level

ERIC Educational Resources Information Center

Tuncay, Hidayet

2014-01-01

This paper presents the results of a case study based on an integrated skills approach using feature movies (DVDs) in EFL syllabi at the tertiary level. 100 students took part in the study and the data was collected through a three - section survey questionnaire: demographic items, 18 likert scale questions and an open-ended question. The data…

Bio-Medical Waste Managment in a Tertiary Care Hospital: An Overview.

PubMed

Pandey, Anita; Ahuja, Sanjiv; Madan, Molly; Asthana, Ajay Kumar

2016-11-01

Bio-Medical Waste (BMW) management is of utmost importance as its improper management poses serious threat to health care workers, waste handlers, patients, care givers, community and finally the environment. Simultaneously, the health care providers should know the quantity of waste generated in their facility and try to reduce the waste generation in day-to-day work because lesser amount of BMW means a lesser burden on waste disposal work and cost saving. To have an overview of management of BMW in a tertiary care teaching hospital so that effective interventions and implementations can be carried out for better outcome. The observational study was carried out over a period of five months from January 2016 to May 2016 in Chhatrapati Shivaji Subharti Hospital, Meerut by the Infection Control Team (ICT). Assessment of knowledge was carried out by asking set of questions individually and practice regarding awareness of BMW Management among the Health Care Personnel (HCP) was carried out by direct observation in the workplace. Further, the total BMW generated from the present setup in kilogram per bed per day was calculated by dividing the mean waste generated per day by the number of occupied beds. Segregation of BMW was being done at the site of generation in almost all the areas of the hospital in color coded polythene bags as per the hospital protocol. The different types of waste being collected were infectious solid waste in red bag, soiled infectious waste in yellow bag and sharp waste in puncture proof container and blue bag. Though awareness (knowledge) about segregation of BMW was seen in 90% of the HCP, 30%-35% did not practice. Out of the total waste generated (57912 kg.), 8686.8 kg. (15%) was infectious waste. Average infectious waste generated was 0.341 Kg per bed per day. The transport, treatment and disposal of each collected waste were outsourced and carried out by 'Synergy' waste management Pvt. Ltd. The practice of BMW Management was lacking in 30

Bio-Medical Waste Managment in a Tertiary Care Hospital: An Overview

PubMed Central

Ahuja, Sanjiv; Madan, Molly; Asthana, Ajay Kumar

2016-01-01

Introduction Bio-Medical Waste (BMW) management is of utmost importance as its improper management poses serious threat to health care workers, waste handlers, patients, care givers, community and finally the environment. Simultaneously, the health care providers should know the quantity of waste generated in their facility and try to reduce the waste generation in day-to-day work because lesser amount of BMW means a lesser burden on waste disposal work and cost saving. Aim To have an overview of management of BMW in a tertiary care teaching hospital so that effective interventions and implementations can be carried out for better outcome. Materials and Methods The observational study was carried out over a period of five months from January 2016 to May 2016 in Chhatrapati Shivaji Subharti Hospital, Meerut by the Infection Control Team (ICT). Assessment of knowledge was carried out by asking set of questions individually and practice regarding awareness of BMW Management among the Health Care Personnel (HCP) was carried out by direct observation in the workplace. Further, the total BMW generated from the present setup in kilogram per bed per day was calculated by dividing the mean waste generated per day by the number of occupied beds. Results Segregation of BMW was being done at the site of generation in almost all the areas of the hospital in color coded polythene bags as per the hospital protocol. The different types of waste being collected were infectious solid waste in red bag, soiled infectious waste in yellow bag and sharp waste in puncture proof container and blue bag. Though awareness (knowledge) about segregation of BMW was seen in 90% of the HCP, 30%-35% did not practice. Out of the total waste generated (57912 kg.), 8686.8 kg. (15%) was infectious waste. Average infectious waste generated was 0.341 Kg per bed per day. The transport, treatment and disposal of each collected waste were outsourced and carried out by ‘Synergy’ waste management Pvt. Ltd

Pattern of medical diseases and determinants of prognosis of hospitalization during 2005 Muslim pilgrimage Hajj in a tertiary care hospital. A prospective cohort study.

PubMed

Khan, Nasim A; Ishag, Adam M; Ahmad, Maha S; El-Sayed, Fifi M; Bachal, Zakeyah A; Abbas, Tahir G

2006-09-01

To document the pattern of medical diseases necessitating admission in a tertiary care hospital during Muslim pilgrimage (Hajj). To assess the risk factors associated with mortality during hospitalization. The study was conducted at Al Noor Specialist Hospital, a 550-bed tertiary care teaching hospital, in Makkah, KSA. The participants included all Hajj patients admitted in the Department of Medicine in a 5-week period (January 3 to February 6, 2005) during the 2005 (1425 AH) Hajj. Information about demographics; past medical history; pre-Hajj functional status; presence of language barrier and translator availability; diagnosis for admission and complications during hospitalization including mortality was obtained prospectively using a standardized form. Six hundred and eighty-nine patients, belonging to 49 countries, with mean age of 62 years and male:female ratio of 1.8:1 were admitted. Two hundred-twenty (31.9%) had diabetes mellitus, 256 (37.2%) had hypertension, 219 (31.8%) had cardiac disease, and 103 (14.9%) patients had chronic lung disease. Of the 449 (65.2%) patients assessed, 284 (63.2%) patients had language barrier, and translator was not available for 152 (53.5%) of them. Pre-Hajj functional status assessment of 240 patients showed that 20 (8.3%) required assistance in performing activities of daily living (ADL), and 40 (16.7%) could not walk for half kilometer without difficulty. Common causes of morbidity were: 235 (34.1%) cardiovascular, 137 (19.9%) infectious and 85 (12.3%) neurological diseases. One hundered and fourteen (16.5%) patients died, with the common causes being pneumonia (28 patients), acute coronary syndrome (21), and stroke (20). The risk factors associated with higher mortality were older age (65 +/- 1 versus 61 +/- 0.6 years, p=0.008), prior history of chronic lung disease (crude odds ratio, 1.81, p=0.034), dependence in any ADLs (4.90, p=0.025), inability to ambulate for half kilometer without difficulty (4.17, p=0.017) and non

The process, logistics and challenges of implementing clinical supervision in a generalist tertiary referral hospital.

PubMed

Brunero, Scott; Lamont, Scott

2012-03-01

Clinical supervision (CS) has been identified within nursing as a process for improving clinical practice and reducing the emotional burden of nursing practice. Little is known about its implementation across large tertiary referral hospitals. The purpose of this study is to evaluate the implementation of clinical supervision across several different nursing specialities at a teaching hospital in Sydney, Australia. Using a model of nursing implementation science, a process was developed at the study site that facilitated the development, implementation and evaluation of the project. After a 6-month study period, the CS groups were postevaluated using a survey tool developed for the project. A total of nine CS groups were in operation over the 6-month study period. A predominant focus within the sessions was one of the collegial support and developing standards of practice. The process was able to achieve wide hospital-based support for the role of CS from the senior nurse executives to junior nurses. Whilst there was overall positive support for the CS groups, logistical and resource challenges remain, in the effective roll out of CS to large numbers of nurses. © 2011 The Authors. Scandinavian Journal of Caring Sciences © 2011 Nordic College of Caring Science.

Risk factors and biofilm detection on central venous catheters of patients attended at tertiary hospital.

PubMed

Pérez-Zárate, Pamela; Aragón-Piña, Antonio; Soria-Guerra, Ruth Elena; González-Amaro, Ana María; Pérez-Urizar, José; Pérez-González, Luis Fernando; Martinez-Gutierrez, Fidel

2015-11-01

To determinate the significance of risk factors with the presence of biofilm on catheters of patients attended at tertiary hospital cares. A total of 126 patients were included, data collection by observing the handling of the CVC, clinical history and microbiological isolation methods of CVCs tips (Roll-plate, sonication and scanning electron microscopy) were evaluated. Certain factors, such as the lack of proper hand washing, the use of primary barriers and preparing medications in the same hospital service, showed an important relationship between biofilm formation in CVCs. The sonication method presented that most of the samples had isolation of multispecies 29 samples (64%); in contrast with the roll-plate method, just one sample (3%) was isolated. The importance of the strict aseptic techniques of insertion and of the handlings of CVC was highlighted, the failure of both techniques was related to the biofilm formation and was evidenced using the scanning electron microscopy. Since this tool is not available in most hospitals, we present the correlation of those evidences with other standard microbiological methods and risk factors, which are necessary for the sensible detection of the different steps of the biofilm formation on CVC and their correct interpretation with clinical evidences. Copyright © 2015 Elsevier Ltd. All rights reserved.

Initiation of a medical toxicology consult service at a tertiary care children's hospital.

PubMed

Wang, George Sam; Monte, Andrew; Hatten, Benjamin; Brent, Jeffrey; Buchanan, Jennie; Heard, Kennon J

2015-05-01

Currently, only 10% of board-certified medical toxicologists are pediatricians. Yet over half of poison center calls involve children < 6 years, poisoning continues to be a common pediatric diagnosis and bedside toxicology consultation is not common at children's hospitals. In collaboration with executive staff from Department of Pediatrics and Emergency Medicine, regional poison center, and our toxicology fellowship, we established a toxicology consulting service at our tertiary-care children's hospital. There were 139 consultations, and the service generated 13 consultations in the first month; median of 11 consultations per month thereafter (range 8-16). The service increased pediatric cases seen by the fellowship program from 30 to 94. The transition to a consult service required a culture change. Historically, call center advice was the mainstay of consulting practice and the medical staff was not accustomed to the availability of bedside medical toxicology consultations. However, after promotion of the service and full attending and fellowship coverage, consultations increased. In collaboration with toxicologists from different departments, a consultation service can be rapidly established. The service filled a clinical need that was disproportionately utilized for high acuity patients, immediately utilized by the medical staff and provided a robust pediatric population for the toxicology fellowship.

[Visa at a tertiary hospital].

PubMed

Martínez-Jiménez, S; Lluch-Colomer, A; Desongles-Corrales, T; Bernal-González, D; Santos-Rubio, M D; Alfaro-Lara, E R; Galván-Banqueri, M

2013-01-01

To analyze the visa application process and his activity at a tertiary hosipital. Descriptive study of the drug s visa activity during the period April 2011-April 2012. We designed a database and defined categories on the study variables: patients and recipes. For patients admitted to the Visa Unit, issues detected were recorded based on a previously established classification. 6738 patients were included. They involved the visa of 8,465 recipes. The visa was applied to 170 drugs and nutrition products different, being the majority Tacrolimus. During this period, we detected a total of 420 incidents being the most frequent «No clinical document» (46.67%) and the «Formal completion errors» (28.57%). This work has allowed a more detailed analysis of the activity, the types of incidents and the identification of areas for improvement. Copyright © 2013 SEFH. Published by AULA MEDICA. All rights reserved.

[Surveillance cultures after high-level disinfection of flexible endoscopes in a general hospital].

PubMed

Robles, Christian; Turín, Christie; Villar, Alicia; Huerta-Mercado, Jorge; Samalvides, Frine

2014-04-01

Flexible endoscopes are instruments with a complex structure which are used in invasive gastroenterological procedures, therefore high-level disinfection (HLD) is recommended as an appropriate reprocessing method. However, most hospitals do not perform a quality control to assess the compliance and results of the disinfection process. To evaluate the effectiveness of the flexible endoscopes’ decontamination after high-level disinfection by surveillance cultures and to assess the compliance with the reprocessing guidelines. Descriptive study conducted in January 2013 in the Gastroenterological Unit of a tertiary hospital. 30 endoscopic procedures were randomly selected. Compliance with guidelines was evaluated and surveillance cultures for common bacteria were performed after the disinfection process. On the observational assessment, compliance with the guidelines was as follows: pre-cleaning 9 (30%), cleaning 5 (16.7%), rinse 3 (10%), first drying 30 (100%), disinfection 30 (100%), final rinse 0 (0%) and final drying 30 (100%), demonstrating that only 3 of 7 stages of the disinfection process were optimally performed. In the microbiological evaluation, 2 (6.7%) of the 30 procedures had a positive culture obtained from the surface of the endoscope. Furthermore, 1 (4.2%) of the 24 biopsy forcepsgave a positive culture. The organisms isolated were different Pseudomonas species. High-level disinfection procedures were not optimally performed, finding in 6.7% positive cultures of Pseudomonas species.

An analysis of 3105 Medico Legal Cases at Tertiary Care Hospital, Rawalpindi.

PubMed

Malik, Romana; Atif, Iffat; Rashid, Farah; Abbas, Maqbool

2017-01-01

Medico legal cases are essential component of medical practice and comprise most important constituent of emergencies. The reporting of such cases is imperative to recognize theirsocioeconomic burden on any country. The present study was conducted to scrutinize different categories of medico legal cases and characteristics of the victims at casualty department oftertiary care hospital Rawalpindi. The objective of the study was to find out the frequency ofvarious categories of medico legal cases and major characteristics ofvictims at tertiary care hospital, Rawalpindi. This was a cross-sectional study on 3105 registered cases in medico legal record of the casualty department of Benazir Bhutto hospital, Rawalpindi from January 2015 to December 2015. The hospital is located on the main road in densely populated central area of the city. The data wascollected on age, sex, month-wise distribution of various medico legal cases, weapon inflicting the injury, blunt trauma or physical assault, firearm injuries and road traffic accidents. The data thus obtained was analyzed using SPSS; observations were presented in tables and graphs. Out of all 3105 registered medico legal cases, reported cases caused by Road Traffic Accident 1230 (40%) followed by blunt injury or physical assault 966 (32%) cases, 19% by sharp weapons, 5% by poisoning, and 4% by firearm injuries. In our study out of 3105 cases, almost three quarter of victims (73%) were below 30 years of age, with a decreasing frequency beyond this age, males were predominantly inflicted 2516(81%) as compared to females 589 (19%). The reported road traffic accidents cases from urban areas were high (74%) as compared to those from rural locality (37%). In cases of blunt trauma, sharp weapon injuries and firearm injuries, there was a huge preponderance of victims from rural areas (65%), (62%) and 61% respectively, with urban cases constituting less. Road traffic injuries are one of the foremost causes of medico legal cases

Male hypogonadism at a tertiary care hospital in Karachi, Pakistan.

PubMed

Ram, Nanik; Asghar, Ali; Hashmi, Fauzan; Islam, Najmul

2012-01-01

Male hypogonadism is defined as 'inadequate gonadal function, manifested by deficiency in gametogenesis and/or secretion of gonadal hormones'. Signs and symptoms of hypogonadism depend primarily on the age of onset. It can be classified according to the site primarily involved: the gonads, the hypothalamus, or the pituitary gland. The objective this study was to determine the presentation and aetiology of male hypogonadism seen in a tertiary care hospital. This cross-sectional study was conducted at Endocrine Clinics, Aga Khan University Hospital Karachi. Data of male patients with hypogonadism who attended clinics during January 2009 to August 2011 were reviewed. All male patients with clinical and biochemical evidence of hypogonadism were included in the study. Patients with Diabetes Mellitus, Metabolic Syndrome, Andropause, AIDS, Chronic Renal Failure, and Cirrhosis were excluded. Mean +/- SD were computed for quantitative variables. Frequency and percentages were computed for qualitative variables. Aetiology of male hypogonadism was categorised as primary and secondary hypogonadism. A total of 85 patients with male hypogonadism attended the endocrine clinic. Mean age of patients was 25 +/- 10 years. Clinical presentations were small genitalia (65%), absent secondary sexual characteristics (53%), not attained puberty (47%), infertility (53%), erectile dysfunction (41%) and loss of libido (29%). Seventy-three (86%) patients had hypogonadotrophic hypogonadism (secondary hypogonadism) and 12 (14%) patients had hypergonadotrophic hypogonadism (primary hypogonadism). Among the patients with hypogonadotrophic hypogonadism 38 had idiopathic hypogonadotrophic hypogonadsim, 7 had pituitary adenoma, 6 had empty sella syndrome, 3 had Kallman's syndrome, and 1 patient had haemosiderosis due to thalassaemia major; 18 patients did not undergo brain imaging. Small genitalia, absent secondary sexual characteristics and infertility were the main presenting features of hypogonad

Self Esteem and Organizational Commitment Among Health Information Management Staff in Tertiary Care Hospitals in Tehran

PubMed Central

Sadoughi, Farahnaz; Ebrahimi, Kamal

2015-01-01

Background: Self esteem (SE) and organizational commitment (OC) have significant impact on the quality of work life. Aim: This study aims to gain a better understanding of the relationships between SE and OC among health information management staff in tertiary care hospitals in Tehran (Iran). Methods: This was a descriptive correlational and cross sectional study conducted on the health information management staff of tertiary care hospitals in Tehran, Iran. A total of 155 participants were randomly selected from 400 staff. Data were collected by two standard questionnaires. The SE and OC was measured using Eysenck SE scale and Meyer and Allen’s three component model, respectively. The collected data were analyzed with the SPSS (version 16) using statistical tests of of independent T-test, Pearson Correlation coefficient, one way ANOVA and F tests. Results: The OC and SE of the employees’ were 67.8, out of 120 (weak and 21.0 out of 30 (moderate), respectively. The values for affective commitment, normative commitment, and continuance commitment were respectively 21.3 out of 40 (moderate), 23.9 out of 40 (moderate), and 22.7 out of 40 (moderate). The Pearson correlation coefficient test showed a significant OC and SE was statistically significant (P<0.05). The one way ANOVA test (P<0.05) did not show any significant difference between educational degree and work experience with SE and OC. Conclusion: This research showed that SE and OC are moderate. SE and OC have strong correlation with turnover, critical thinking, job satisfaction, and individual and organizational improvement. Therefore, applying appropriate human resource policies is crucial to reinforce these measures. PMID:25716374

Delay in presentation to the hospital and factors affecting it in breast cancer patients attending tertiary care center in Central India.

PubMed

Thakur, N A; Humne, A Y; Godale, L B

2015-01-01

Despite lower incidence of breast cancer in India, the total number of cases and the net mortality is high. To reduce this increasing load of mortality due to breast cancer we need to lay emphasis on early detection and increased use of systemic therapy. Early detection itself depends on early presentation to a health facility; thus, it is important to identify factors affecting delay in a presentation to hospital. To study the clinico-social profile of breast carcinoma patients attending a tertiary care hospital and to study the time lag since detection of lump by women and presentation to the hospital and factors affecting them. A total of 120 primary breast cancer patients visiting a tertiary care hospital over a period of 7 months (August 2010 to February 2011) were taken up for study. A detailed retrospective analysis of patients was done according to planned proforma. Maximum study subjects were in the age group of 41-50 years. Right and left breasts were equally affected. The most common histo-pathological type of breast carcinoma observed was invasive ductal carcinoma (NOS) in 105 (87.50%) cases. Majority of the cases were in stage III or stage II. The median time lag self-detection of lump in the breast by women and presentation to the hospital was 6 months. Women living in a rural area, those with lower socio-economic status and those with older age tend to assess health-care late. Carcinoma of the breast is a common cancer affecting young to middle age group with invasive ductal carcinoma being the most common histological type. Delay in presentation and late stage presentation is a major concern. Hence, proper awareness and screening programmers are needed to identify, inform and educate these categories of women.

Interactional aspects of care during hospitalization: perspectives of family caregivers of psychiatrically ill in a tertiary care setting in India.

PubMed

Dinakaran, P; Mehrotra, Seema; Bharath, Srikala

2014-12-01

There are very few studies on user-perspectives about mental health care services that explore perspectives of family caregivers in India. An exploratory study was undertaken to understand the perceived importance of various aspects of interactions with mental health service providers during hospitalization, from the perspectives of family caregivers. In addition, it also aimed at documenting their actual experience of interactional aspects of care during the hospitalization of their relatives. The study was conducted on fifty family caregivers of patients with varied psychiatric diagnoses hospitalized in a tertiary psychiatric care setting in South India. Measures of Interactional aspects of care were developed to assess perceived importance of six different interactional domains of care and the actual experience of care in these domains. Provision of informational inputs and addressing of concerns raised emerged as the domains of care given highest importance. The item pertaining to 'sharing with the caregiver about different alternatives for treatment' received negative ratings in terms of actual experience by maximum number of participants (18%). Significant differences on perceived importance of four domains of interactional aspects of care (dignity, confidentiality and fairness, addressing concerns raised, informational inputs and prompt attention and consistent care) emerged between caregiver subgroups based on educational level of the caregiver, socio-economic status, hospitalization history and broad diagnostic categories. In addition, the care givers of patients with psychoses assigned significantly more positive ratings on actual experience for all the domains of interactional aspects of care. The findings have implications for further research and practice. Copyright © 2014 Elsevier B.V. All rights reserved.

[Implementation of quality of care indicators for third-level public hospitals in Mexico].

PubMed

Saturno-Hernández, Pedro Jesús; Martínez-Nicolás, Ismael; Poblano-Verástegui, Ofelia; Vértiz-Ramírez, José de Jesús; Suárez-Ortiz, Erasto Cosme; Magaña-Izquierdo, Manuel; Kawa-Karasik, Simón

2017-01-01

To select, pilot test and implement a set of indicators for tertiary public hospitals. Quali-quantitative study in four stages: identification of indicators used internationally; selection and prioritization by utility, feasibility and reliability; exploration of the quality of sources of information in six hospitals; pilot feasibility and reliability, and follow-up measurement. From 143 indicators, 64 were selected and eight were prioritized. The scan revealed sources of information deficient. In the pilot, three indicators were feasible with reliability limited. Has conducted workshops to improve records and sources of information; nine hospitals reported measurements of a quarter. Eight priority indicators could not be measured immediately due to limitations in the data sources for its construction. It is necessary to improve mechanisms of registration and processing of data in this group of hospital.

Is copeptin level associated with 1-year mortality after out-of-hospital cardiac arrest? Insights from the Paris registry*.

PubMed

Geri, Guillaume; Dumas, Florence; Chenevier-Gobeaux, Camille; Bouglé, Adrien; Daviaud, Fabrice; Morichau-Beauchant, Tristan; Jouven, Xavier; Mira, Jean-Paul; Pène, Frédéric; Empana, Jean-Philippe; Cariou, Alain

2015-02-01

The availability of circulating biomarkers that helps to identify early out-of-hospital cardiac arrest survivors who are at increased risk of long-term mortality remains challenging. Our aim was to prospectively study the association between copeptin and 1-year mortality in patients with out-of-hospital cardiac arrest admitted in a tertiary cardiac arrest center. Retrospective monocenter study. Tertiary cardiac arrest center in Paris, France. Copeptin was assessed at admission and day 3. Pre- and intrahospital factors associated with 1-year mortality were analyzed by multivariate Cox proportional analysis. None. Two hundred ninety-eight consecutive out-of-hospital cardiac arrest patients (70.3% male; median age, 60.2 yr [49.9-71.4]) were admitted in a tertiary cardiac arrest center in Paris (France). After multivariate analysis, higher admission copeptin was associated with 1-year mortality with a threshold effect (hazard ratio(5th vs 1st quintile) = 1.64; 95% CI, 1.05-2.58; p = 0.03). Day 3 copeptin was associated with 1-year mortality in a dose-dependent manner (hazard ratio(2nd vs 1st quintile) = 1.87; 95% CI, 1.00-3.49; p = 0.05; hazard ratio(3rd vs 1st quintile) = 1.92; 95% CI, 1.02-3.64; p = 0.04; hazard ratio(4th vs 1st quintile) = 2.12; 95% CI, 1.14-3.93; p = 0.02; and hazard ratio(5th vs 1st quintile) = 2.75; 95% CI, 1.47-5.15; p < 0.01; p for trend < 0.01). For both admission and day 3 copeptin, association with 1-year mortality existed for out-of-hospital cardiac arrest of cardiac origin only (p for interaction = 0.05 and < 0.01, respectively). When admission and day 3 copeptin were mutually adjusted, only day 3 copeptin remained associated with 1-year mortality in a dose-dependent manner (p for trend = 0.01). High levels of copeptin were associated with 1-year mortality independently from prehospital and intrahospital risk factors, especially in out-of-hospital cardiac arrest of cardiac origin. Day 3 copeptin was superior to admission copeptin: this

Supply chain management with cost-containment & financial-sustainability in a tertiary care hospital.

PubMed

Chandra, Hem; Rinkoo, Arvind Vashishta; Verma, Jitendra Kumar; Verma, Shuchita; Kapoor, Rakesh; Sharma, R K

2013-01-01

Financial crunch in the present recession results in the non-availability of the right materials at the right time in large hospitals. However due to insufficient impetus towards systems development, situation remains dismal even when funds are galore. Cost incurred on materials account for approximately one-third of the total recurring expenditures in hospitals. Systems development for effective and efficient materials management is thus tantamount to cost-containment and sustainability. This scientific paper describes an innovative model, Hospital Revolving Fund (HRF), developed at a tertiary care research institute in Asia. The main idea behind inception of HRF was to ensure availability of all supplies in the hospital so that the quality of healthcare delivery was not affected. The model was conceptualized in the background of non-availability of consumables in the hospital leading to patient as well as staff dissatisfaction. Hospital supplies have been divided into two parts, approximately 3250 unit items and 1750 miscellaneous items. This division is based on cost, relative-utility and case-specific utilization. 0.1 Million USD, separated from non-planned budget, was initially used as seed money in 1998. HRF procures supplies from reputed firms on concessional rates (8-25%) and make them available to patients at much lesser rates vis-à-vis market rates, levying minimal maintenance charges. In 2009-10, total annual purchases of 14 Million USD were made. The balance sheet reflected 1.4 Million USD as fixed deposit investment. The minimal maintenance charges levied on the patients along with the interest income were sufficient to pay for all recurring expenses related to HRF. Even after these expenses, HRF boosted of 0.2 Million USD as cash-in-hand in financial year 2009-10. In-depth analysis of 'balance sheet' and 'Income and Expenditure' statement of the fund for last five financial years affirms that HRF is a self-sustainable and viable supply chain

Experience of Emergency Peripartum Hysterectomies at a Tertiary Care Hospital in Quetta, Pakistan

PubMed Central

Fatima, Mahrukh; Kasi, Pashtoon Murtaza; Baloch, Shahnaz Naseer; Afghan, Abaseen Khan

2011-01-01

Emergency peripartum hysterectomy (EPH) is associated with significant morbidity and mortality worldwide. The purpose of our paper was to determine the incidence, morbidity, and mortality of EPH done at our institution; the largest tertiary care government hospital in the city of Quetta, Pakistan. During the study period there were 12,642 deliveries, out of which 46 women had undergone an EPH, translating into an incidence of ∼4 per 1,000 births. Disturbingly, 82.6% of these patients had received no antenatal care prior to their presentation. There were 4 (8.7%) maternal deaths and 31 (67.4%) perinatal deaths. The commonest indication noted was uterine rupture in 21 (45.7%) cases. Lack of antenatal care is indeed a modifiable factor that needs to be addressed to help reduce maternal and fetal morbidity/mortality not only from emergency hysterectomies but also from all other preventable causes. PMID:21977328

Occupational Exposure to Infection: A study on Healthcare Waste Handlers of a Tertiary Care Hospital in South India.

PubMed

Shivalli, Siddharudha; Sowmyashree, H

2015-11-01

Occupational exposure to infection is an important public health concern. Such accidents are associated with a few, but pose significant risk to worker's health, family and the community. 1) To assess the knowledge and attitude of waste handlers regarding healthcare waste management in tertiary care hospital of Mangalore. 2) To assess the occupational risk of exposure to infection in their work setting. A cross-sectional study was conducted among healthcare waste handlers (involved in collection, storage and safe disposal) in a tertiary care hospital of Mangalore, India. A semi-structured and pre-tested proforma was used to assess respondents' knowledge and percentage score was calculated based on a scoring system. Chi square and independent sample t tests were applied to judge the association of study variables with knowledge and occupational risk of infection. A total of 43 healthcare waste handlers participated in the study and all were females. Almost half of them had poor knowledge (< 50% score) about healthcare waste management. As much as 41.8% of them had exposure to healthcare waste and 'needle stick injury' was the most common type. Age, literacy and experience did not significantly (p>0.05) influence the knowledge and occupational risk of infection. Respondents' knowledge regarding healthcare waste management was unsatisfactory. They were at high risk of occupational exposure to infection. It emphasizes the need of refresher training and reinforcement of personal protection measures in their work setting. © Journal of the Association of Physicians of India 2011.

Presentations and Outcome of Thyroiditis from a Tertiary Care Hospital of Karachi.

PubMed

Mahar, Saeed Ahmed; Shahid, Muhammad; Sarfaraz, Aqiba; Shaikh, Zuhaib-u-Ddin; Shaikh, Shiraz; Shahid, Nadia

2015-10-01

To assess the clinical presentations and short-term outcomes of patients with thyroiditis presenting to a tertiary care hospital in Karachi, Pakistan. Case series. Department of Endocrinology, Liaquat National Hospital, Karachi, from June 2014 to February 2015. Patients between 18 and 70 years of age with acute onset of thyroiditis confirmed on thyroid scan or clinical judgment presenting to the outpatient services were included in the study. Pregnant females, psychiatric patients and patients having other chronic illnesses were excluded from the study. A total of 26 patients with thyroiditis attended the endocrine clinic. Mean age of patients was 41.2 ± 11.12 years. There were 18 (69.2%) females. Clinical presentations were fever (65.4%), tender neck (23.1%), goiter (19.2%), localized tenderness in neck and palpable lymph nodes (26.9%). Major symptoms reported were: sore throat (69.2%), weight loss (38.5%), upper respiratory tract infection, thyroid pain, tremor, sweating and fever of unknown origin in 26.9% cases. All the patients had raised Erythrocyte Sedimentation Rate (ESR). Low Thyroid Stimulating Hormone (TSH) < 0.4 mlU/L was seen in 88.5% and 57.7% had raised Free T4 > 1.8 ng/dL. Complete recovery was seen in 88.5% patients while 11.5% had early hypothyroidism. Fever and sore throat were the main presenting features of thyroiditis patients. ESR was raised in all patients. A majority of patients had complete recovery with appropriate management; however, few cases developed hypothyroidism.

Vision Screening of Ophthalmic Nursing Staff in a Tertiary Eye Care Hospital

PubMed Central

Khan, Ruhi A.; Souru, Ches; Vaghese, Sejo; Yasir, Ziaul; Khandekar, Rajiv

2017-01-01

Objectives This study aimed to evaluate ocular healthcare-seeking behaviours and vision screening outcomes of nursing staff at a tertiary eye care hospital. Methods This study was conducted between April and September 2016 among all 500 nurses employed at the King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia. Data were collected on age, gender, use of visual aids, the presence of diabetes, a history of refractive surgery and date of last ocular health check-up. Participants were tested using a handheld Spot™ Vision Screener (Welch Allyn Inc., Skaneateles Falls, New York, USA). Results A total of 150 nurses participated in the study (response rate: 30.0%). The mean age was 41.2 ± 8.9 years old. Distance spectacles, reading spectacles and both types of spectacles were used by 37 (24.7%), 32 (21.3%) and 10 (6.7%) nurses, respectively. A total of 58 nurses (38.7%) failed the vision screening test. Visual defects were detected for the first time in 13 nurses (8.7%). With regards to regular eye checkups, 77 participants (51.3%) reported acceptable ocular healthcare-seeking behaviours; this factor was significantly associated with age and the use of visual aids (P <0.01 each). Conclusion A high proportion of participants failed the vision screening tests and only half displayed good ocular healthcare-seeking behaviours. This is concerning as ophthalmic nurses are likely to face fewer barriers to eye care services than the general population. PMID:28417032

Prevalence and risk factors for CTX-M gram-negative bacteria in hospitalized patients at a tertiary care hospital in Kilimanjaro, Tanzania.

PubMed

Sonda, Tolbert; Kumburu, Happiness; van Zwetselaar, Marco; Alifrangis, Michael; Mmbaga, Blandina T; Lund, Ole; Aarestrup, Frank M; Kibiki, Gibson

2018-05-01

Emergence and spread of extended spectrum beta-lactamase (ESBL)-producing gram-negative bacteria, mainly due to CTX-M, is a major global public health problem. Patients infected with ESBL-producing gram-negative bacteria have an increased risk of treatment failure and death. We investigated the prevalence and risk factors for CTX-M gram-negative bacteria isolated from clinical specimens of patients hospitalized at a tertiary care hospital in Kilimanjaro, Tanzania. Isolated gram-negative bacteria from inpatients admitted at Kilimanjaro Christian Medical Centre (KCMC) between August 2013 and August 2015 were fully genome sequenced. The prevalence of ESBL-producing gram-negative bacteria was determined based on the presence of bla CTX-M . The odds ratio (OR) and risk factors for ESBL-producing gram-negative bacteria due to CTX-M were assessed using logistic regression models. The overall CTX-M prevalence (95% CI) was 13.6% (10.1-18.1). Adjusted for other factors, the OR of CTX-M gram-negative bacteria for patients previously hospitalized was 0.26 (0.08-0.88), p = 0.031; the OR for patients currently on antibiotics was 4.02 (1.29-12.58), p = 0.017; the OR for patients currently on ceftriaxone was 0.14 (0.04-0.46), p = 0.001; and the OR for patients with wound infections was 0.24 (0.09-0.61), p = 0.003. The prevalence of ESBL-producing gram-negative bacteria due to CTX-M in this setting is relatively low compared to other previous reports in similar settings. However, to properly stop further spread in the hospital, we recommend setting up a hospital surveillance system that takes full advantage of the available next-generation sequencing facility to routinely screen for all types of bacterial resistance genes.

β-Lactamases in amoxicillin-clavulanate-resistant Escherichia coli strains isolated from a Chinese tertiary hospital.

PubMed

Ding, Juanjuan; Ma, Xitao; Chen, Zhuochang; Feng, Keqing

2013-08-01

A total of 52 strains were resistant to amoxicillin-clavulanate by disk diffusion method in a Chinese tertiary hospital from July 2011 to December 2011. Among these isolates, 2 isolates possessed a phenotype consistent with production of inhibitor-resistant temoniera (TEM) (IRT) β-lactamase, and the TEM-type gene was cloned into strains of Escherichia coli JM109 cells. Both had no blaTEM mutations and were identified as TEM-1 β-lactamase producers. As a result, no IRT β-lactamase was detected. Multiplex PCR detected most of these strains produced TEM-1 enzymes, and plasmid-mediated AmpC β-lactamase and oxacillinase-1 β-lactamases are important mechanisms of resistance as well. Copyright © 2013 Elsevier Inc. All rights reserved.

Severity and frequency of community-onset Clostridium difficile infection on an Australian tertiary referral hospital campus.

PubMed

Clohessy, Penny; Merif, Juan; Post, Jeffrey John

2014-12-01

Clostridium difficile infection (CDI) is increasingly being found in populations without traditional risk factors. We compared the relative frequency, risk factors, severity, and outcomes of community-onset CDI with hospital-acquired infection. This was a retrospective, observational study of CDI at a tertiary hospital campus in Sydney, Australia. Patients aged 15 years and older with a first episode of CDI from January 1 to December 31, 2011 were included. CDI was defined as the presence of diarrhoea with a positive enzyme immunoassay in conjunction with a positive cell cytotoxicity assay, toxin culture, or organism culture. Main outcome measures were onset of infection (hospital or community), risk factors, markers of severity, and outcomes for the two groups. One hundred and twenty-nine cases of CDI infection were identified, of which 38 (29%) were community-onset. The community-onset infection group were less likely to have a recent history of antibiotic use (66% vs. 98%; p<0.001) or proton pump inhibitor use (38% vs. 69%; p=0.03) than the hospital-acquired infection group. Markers of severity and outcomes were similar in the two groups, with an overall mortality of 9%. Community-onset CDI accounts for a large proportion of C. difficile infections and has a similar potential for severe disease as hospital-acquired infection. Using a history of previous antibiotic use, proton pump inhibitor use, or recent hospitalization to predict cases is unreliable. We recommend that patients with diarrhoea being investigated in emergency departments and community practice are tested for Clostridium difficile infection. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

Antimicrobial resistance pattern in a tertiary care hospital: An observational study

PubMed Central

Saravanan, Revathy; Raveendaran, Vinod

2013-01-01

Context: The number of organisms developing resistance to commonly used antibiotics is increasing among the various generations. The exact national scenario of antimicrobial resistance (AMR) is not known in India owing to the absence of a central monitoring agency. Aims: The aim of this study is to identify the group of organisms developing resistance, to know the classes of drugs against, which resistance has emerged and to assess the possible factors that can favor the development of AMR so that antibiotic policy can be formulated for the proper and effective use of antibiotics. Settings and Design: An observational study was conducted for a period of 1 year from August 2011 to July 2012 in a tertiary care hospital in Pondicherry. Subjects and Methods: Data regarding culture and sensitivity of the organisms isolated from different sources such as urine, blood, wound swab/pus, stool, sputum and tracheal aspirations were collected from the records of the Microbiology Department. Sample processing, identification of organisms to the genus and/or species level and antimicrobial sensitivity were carried out as per the Clinical and Laboratory Standards Institute guidelines on the 999 samples received. Results: Out of 999 samples, 125 (12.5%) showed significant growth of organisms exhibiting resistance to either single or multiple drugs. Out of 84 (67.2%) in-patients and 41 (32.8%) out-patient samples, Escherichia was the most common organism isolated with a total of 41 (32.8%), followed by Methicillin sensitive Staphylococcus aureus, 26 (20.8%), Klebsiella 25 (20%), Methicillin resistant Staphylococcus aureus 17 (13.6%), Pseudomonas 10 (8%), Proteus 2 (1.6%), 1 (0.8%) each of Citrobacter and Enterococci. Maximum resistance was observed with commonly used first line antimicrobials such as co-trimoxazole, ampicillin, amoxicillin, amoxyclav, fluoroquinolones, third generation cephalosporins and nalidixic acid. Least resistant or highly sensitive were amikacin

Acinetobacter baumannii: Epidemiological and Beta-Lactamase Data From Two Tertiary Academic Hospitals in Tshwane, South Africa

PubMed Central

Lowe, Michelle; Ehlers, Marthie M.; Ismail, Farzana; Peirano, Gisele; Becker, Piet J.; Pitout, Johann D. D.; Kock, Marleen M.

2018-01-01

Acinetobacter baumannii is an opportunistic pathogen that is increasingly responsible for hospital-acquired infections. The increasing prevalence of carbapenem resistant A. baumannii has left clinicians with limited treatment options. Last line antimicrobials (i.e., polymyxins and glycylcyclines) are often used as treatment options. The aim of this study was to determine the prevalence of selected β-lactamase genes from A. baumannii isolates obtained from patients with hospital-acquired infections and to determine the genetic relationship and epidemiological profiles among clinical A. baumannii isolates collected from two tertiary academic hospitals in the Tshwane region, South Africa (SA). Multiplex-PCR (M-PCR) assays were performed to detect selected resistance genes. The collected isolates’ genetic relatedness was determined by using pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). The acquired oxacillinase (OXA) genes, notably blaOXA-23-like were prevalent in the A. baumannii isolates. The M-PCR assays showed that the isolates collected from hospital A contained the OXA-23-like (96%; n = 69/72) genes and the isolates collected from hospital B contained the OXA-23-like (91%; n = 63/69) and OXA-58-like (4%; n = 3/69) genes. Colistin resistance was found in 1% of the isolates (n = 2/141) and tigecycline intermediate resistance was found in 6% of the isolates (n = 8/141). The A. baumannii isolates were genetically diverse. Molecular epidemiological data showed that specific sequence types (STs) (ST106, ST229, ST258 and ST208) were established in both hospitals, while ST848 was established in hospital A and ST502, ST339 and the novel ST1552 were established in hospital B. ST848 (established in hospital A) was predominately detected in ICU wards whereas ST208, ST339 and the novel ST1552 (established in hospital B) were detected in ICUs and the general wards. The origin of the A. baumannii isolates in the hospitals may be due to the

Effects of Glosses on Vocabulary Gain and Retention among Tertiary Level EFL Learners

ERIC Educational Resources Information Center

Azari, Foroogh; Abdullah, Faiz Sathi; Heng, Chan Swee; Hoon, Tan Bee

2012-01-01

This paper reports on a study that aimed to investigate the effects of textual glosses on the lexical development of EFL learners. Given the importance of the English language for tertiary level study, it is necessary for EFL learners to read independently and to acquire the vocabulary they need for disciplinary study. Many studies have reported…

Financial impact of tertiary care in an academic medical center.

PubMed

Huber, T S; Carlton, L M; O'Hern, D G; Hardt, N S; Keith Ozaki, C; Flynn, T C; Seeger, J M

2000-06-01

To analyze the financial impact of three complex vascular surgical procedures to both an academic hospital and a department of surgery and to examine the potential impact of decreased reimbursements. The cost of providing tertiary care has been implicated as one potential cause of the financial difficulties affecting academic medical centers. Patients undergoing revascularization for chronic mesenteric ischemia, elective thoracoabdominal aortic aneurysm repair, and treatment of infected aortic grafts at the University of Florida were compared with those undergoing elective infrarenal aortic reconstruction and carotid endarterectomy. Hospital costs and profit summaries were obtained from the Clinical Resource Management Office. Departmental costs and profit summary were estimated based on the procedural relative value units (RVUs), the average clinical cost per RVU ($33.12), surgeon charges, and the collection rate for the vascular surgery division (30.2%) obtained from the Faculty Group Practice. Surgeon work effort was analyzed using the procedural work RVUs and the estimated total care time. The analyses were performed for all payors and the subset of Medicare patients, and the potential impact of a 15% reduction in hospital and physician reimbursement was analyzed. Net hospital income was positive for all but one of the tertiary care procedures, but net losses were sustained by the hospital for the mesenteric ischemia and infected aortic graft groups among the Medicare patients. In contrast, the estimated reimbursement to the department of surgery for all payors was insufficient to offset the clinical cost of providing the RVUs for all procedures, and the estimated losses were greater for the Medicare patients alone. The surgeon work effort was dramatically higher for the tertiary care procedures, whereas the reimbursement per work effort was lower. A 15% reduction in reimbursement would result in an estimated net loss to the hospital for each of the tertiary

[Results of pulmonary embolism treatment in a tertiary hospital short stay unit. Is this the right place?].

PubMed

Rosa Salazar, V; Bernal Martínez, L; García Pino, M J; Hernández Contreras, M E; García Méndez, M M; García Pérez, B; Marras Fernández-Cid, C

2016-01-01

To determine the mean stay (MS) of patients with pulmonary embolism (PE) in a thrombosis unit (TU) with a short stay unit (SSU) in a tertiary hospital. To compare the data collected with those of other hospitals in the same region, of other regions (Autonomous Communities [AACC]), and within the same hospital in the year before the SSU opened. A descriptive retrospective observational study that included patients with a diagnosis of PE in the University Hospital Virgen de la Arrixaca (HCUVA) in 2012. These data were classified by hospital department, and used for calculating the mean stay. This was then compared with that of other hospitals in our region, with the rest of the regions, and with the data in 2007 (the last year without a TU). A total of 113patients with PE were included, 60 (53%) in the TU with an MS of 4.39, in Oncology, 7.45, and Internal Medicine (IM), 15.38days. There were no deaths in the TU and only 3 (5%) readmissions. Published data showed that the MS in all hospitals in our region was 8.25, 5.18 in our hospital, and higher in the rest of hospitals. The best AACC was the Basque Country with an MS of 6.85days. In 2007, there were 70patients with PE in the HCUVA, 34 (49%) in IM, with an MS of 8.50, Oncology 11 (31%) with an MS 9.64, and Chest Diseases 3 (4.3%) with an MS 19days, and with an overall mortality of 11% and a rate of readmissions in IM of 6%. The mean stay for a PE in the SSU of a TU was lower than in the rest of the hospital departments, lower than the rest hospitals of our region, lower than the rest of the regions, and lower than any department of our hospital before the SSU existed, without increasing the readmission or mortality rate. Copyright © 2015 SECA. Publicado por Elsevier España, S.L.U. All rights reserved.

Complications of hypospadias surgery: Experience in a tertiary hospital of a developing country

PubMed Central

Appeadu-Mensah, William; Hesse, Afua Adwo Jectey; Glover-Addy, Hope; Osei-Nketiah, Samuel; Etwire, Victor; Sarpong, Pokua Ama

2015-01-01

Background: Over 300 different operations have been described for the management of hypospadias. In recent times, the numbers of operations used in various centres have gradually reduced as the principles necessary to ensure adequate cosmetic and functional results with minimum complications are better understood. The aim of this article was to review the different types of operations used for managing hypospadias in a tertiary hospital in a developing country, to analyse the complications of surgery and discuss the factors that contribute to complications. Materials and Methods: Patient folders, theatre, and ward records were used to obtain the required information. The age at surgery, types of hypospadias at presentation, types of operations done and complications were analysed. Results and Conclusion: With three main types of operations, tubularised incised plate urethroplasty and meatal advancement and glanuloplasty incorporated for anterior hypospadias (glanular, coronal, subcoronal, distal, midpenile), and lateral based flap urethroplasty for posterior hypospadias (proximal penile, penoscrotal, scrotal, perineal), most hypospadias were corrected with acceptable complication rates. PMID:26712282

Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

PubMed

Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

2018-05-31

Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

Epidemiology of road traffic injury patients presenting to a tertiary hospital in Hyderabad, India.

PubMed

Howley, Isaac W; Gupta, Shivam; Tetali, Shailaja; Josyula, Lakshmi K; Wadhwaniya, Shirin; Gururaj, Gopalkrishna; Rao, Mohan; Hyder, Adnan A

2017-12-01

Road traffic injuries kill more people in India than in any other country in the world, and these numbers are rising with increasing population density and motorization. Official statistics regarding road traffic injuries are likely subject to underreporting. This study presents results of a surveillance program based at a public tertiary hospital in Hyderabad, India. All consenting patients who presented to the casualty ward after a road traffic injury over a 9-month period were enrolled. Interviews were performed and data abstracted from clinical records by trained research assistants. Data included demographics, injury characteristics, risk factors, safety behaviors, and outcomes. A total of 5,298 patients were enrolled; their mean age was 32.4 years (standard deviation 13.8) and 87.3% were men; 58.2% of patients were injured while riding a motorcycle or scooter, 22.5% were pedestrians, and 9.2% used motorized rickshaws. The most frequent collision type was skid or rollover (40.9%). Male victims were younger than female victims and were overrepresented among motorized 2-wheeler users. Patients were most frequently injured from 1600 to 2400. A total of 27.3% of patients were admitted. Hospital mortality was 5.3%, and 48.2% of deaths were among motorized 2-wheeler users. This is one of the few prospective, hospital-based studies of road traffic injury epidemiology in India. The patient population in this study was similar to prior hospital-based studies. When compared to government surveillance systems, this study showed motorized 2-wheeler users to be more frequently represented among the overall population and among fatalities. Further research should be done to develop interventions to decrease mortality associated with 2-wheeled vehicles in India. Copyright © 2017. Published by Elsevier Inc.

Evaluation of Health Status of Type 2 Diabetes Outpatients Receiving Care in a Tertiary Hospital in Nigeria.

PubMed

Adibe, Maxwell Ogochukwu; Anosike, Chibueze; Nduka, Sunday Odunke; Isah, Abdulmuminu

2017-09-07

The aim of this study was to determine the health status of type 2 diabetes patients in a Nigerian tertiary hospital, and examine the sociodemographic and clinical variables that predicted the health status of type 2 diabetes patients in terms of utility valuations and EuroQol Visual Analogue Scale (EQ-VAS) score. This was a cross-sectional study of 147 diabetes patients attending the University of Nigeria Teaching Hospital, Enugu State, Nigeria. The EQ-5D-5L instrument, version 2.1, was used to evaluate patients' self-reported health status, and patients who gave informed consent completed the questionnaire while waiting to see a doctor. Descriptive and multiple linear regression analyses were performed using SPSS version 20. Overall, 147 patients participated in this study, with a mean age (± standard deviation) of 56.7 years (± 10.33). Over half of the respondents were females (55.1%) and more than half were older than 60 years of age. The mean EQ-VAS and utility valuations of respondents were 72.59 ± 10.51 and 0.72 ± 0.13, respectively. The age of respondents independently and significantly predicted EQ-VAS by -2.659 per year, while the age of respondents, level of education, duration of diabetes, and presence of other illnesses independently and significantly predicted utility valuations by -0.020 per year, +0.029 per level of education, -0.008 per year, and -0.044 per illness, respectively. Less than 39% of patients experienced no problems for each of the dimensions, except self-care (68%). The results of this study revealed a relatively low health status among type 2 diabetic patients in Nigeria. Old age, duration of diabetes and the presence of other illnesses were major contributors to the negative impact on health status, while a higher level of education contributed positively to health status. Adequate family support, as well as regular and effective patient counseling and education, may be worthwhile.

Assessment of pediatric residents burnout in a tertiary academic centre

PubMed Central

Jamjoom, Roaa S.; Park, Yoon S.

2018-01-01

Objectives: To study burnout among pediatric residents at King Abdulazaiz University Hospital in Jeddah, Saudi Arabia. Methods: This is a cross-sectional survey that was administered to all pediatric residents enrolled in the Saudi Paediatric Board program (PGY1-PGY4) in a large tertiary academic hospital in the Western region of Saudi Arabia (King Abdulaziz University Hospital). The survey were sent via E-mail to 50 registered general pediatric residents. Results: Seventy percent of the pediatric residents completed the survey. More than 70% of residents experiencing severe burnout. Forty-three percent suffering emotional exhaustion, 71.8% experiencing depersonalization and 40.6% suffering from low accomplishment. Conclusion: Burnout syndrome appear to be a serious threat to resident well-being in our program. Moreover, pediatric residents in our institute experienced higher levels of depersonalization than their peers nationally and internationally. PMID:29543309

Cardiac Surgery in Jehovah's Witness Patients: Experience of a Brazilian Tertiary Hospital.

PubMed

Valle, Felipe Homem; Pivatto, Fernando; Gomes, Bruna Sessim; Freitas, Tanara Martins de; Giaretta, Vanessa; Gus, Miguel

2017-01-01

The outcomes of Jehovah's Witness (JW) patients submitted to open heart surgery may vary across countries and communities. The aim of this study was to describe the morbidity and mortality of JW patients undergoing cardiac surgery in a tertiary hospital center in Southern Brazil. A case-control study was conducted including all JW patients submitted to cardiac surgery from 2008 to 2016. Three consecutive surgical non-JW controls were matched to each selected JW patient. The preoperative risk of death was estimated through the mean EuroSCORE II. We studied 16 JW patients with a mean age of 60.6±12.1 years. The non-JW group included 48 patients with a mean age of 63.3±11.1 years (P=0.416). Isolated coronary artery bypass graft surgery was the most frequent surgery performed in both groups. Median EuroSCORE II was 1.29 (IQR: 0.66-3.08) and 1.43 (IQR: 0.72-2.63), respectively (P=0.988). The mortality tended to be higher in JW patients (18.8% vs. 4.2%, P=0.095), and there was a higher difference between the predicted and observed mortality in JW patients compared with controls (4.1 and 18.8% vs. 2.1 and 4.2%). More JW patients needed hemodialysis in the postoperative period (20.0 vs. 2.1%, P=0.039). We showed a high rate of in-hospital mortality in JW patients submitted to cardiac surgery. The EuroSCORE II may underestimate the surgical risk in these patients.

Cardiac Surgery in Jehovah's Witness Patients: Experience of a Brazilian Tertiary Hospital

PubMed Central

Valle, Felipe Homem; Pivatto Júnior, Fernando; Gomes, Bruna Sessim; de Freitas, Tanara Martins; Giaretta, Vanessa; Gus, Miguel

2017-01-01

Introduction The outcomes of Jehovah's Witness (JW) patients submitted to open heart surgery may vary across countries and communities. The aim of this study was to describe the morbidity and mortality of JW patients undergoing cardiac surgery in a tertiary hospital center in Southern Brazil. Methods A case-control study was conducted including all JW patients submitted to cardiac surgery from 2008 to 2016. Three consecutive surgical non-JW controls were matched to each selected JW patient. The preoperative risk of death was estimated through the mean EuroSCORE II. Results We studied 16 JW patients with a mean age of 60.6±12.1 years. The non-JW group included 48 patients with a mean age of 63.3±11.1 years (P=0.416). Isolated coronary artery bypass graft surgery was the most frequent surgery performed in both groups. Median EuroSCORE II was 1.29 (IQR: 0.66-3.08) and 1.43 (IQR: 0.72-2.63), respectively (P=0.988). The mortality tended to be higher in JW patients (18.8% vs. 4.2%, P=0.095), and there was a higher difference between the predicted and observed mortality in JW patients compared with controls (4.1 and 18.8% vs. 2.1 and 4.2%). More JW patients needed hemodialysis in the postoperative period (20.0 vs. 2.1%, P=0.039). Conclusion We showed a high rate of in-hospital mortality in JW patients submitted to cardiac surgery. The EuroSCORE II may underestimate the surgical risk in these patients. PMID:29211216

Evaluation of hand hygiene adherence in a tertiary hospital.

PubMed

Novoa, Ana M; Pi-Sunyer, Teresa; Sala, Maria; Molins, Eduard; Castells, Xavier

2007-12-01

Although hand hygiene is the most important measure in the prevention of nosocomial infection, adherence to recommendations among health care workers (HCW) is low. Evaluation of compliance with hand hygiene was carried out in a Spanish teaching hospital. In 2005, adherence to hand hygiene was evaluated hospital wide through direct observation, collecting data on hand hygiene carried out whenever indicated (opportunity for hand hygiene). Compliance was defined as handwashing/disinfection in an opportunity for hand hygiene according to hospital protocols. The results were analyzed using mixed effects models, with the HCW observed as the random effect. A total of 1254 opportunities for hand hygiene were observed in 247 HCWs. Mean compliance was 20%. Although few differences were observed among types of HCW, compliance varied according to hospital area (69% in the intensive care unit [ICU]) and timing with respect to patient contact (compliance after contact was twice that before contact). Multivariate analyses revealed a protective odds ratio (OR) for nonadherence in ICUs (OR, 0.04; 95% confidence interval (95% CI): 0.01-0.10) and after patient contact (OR, 0.25; 95% CI: 0.17-0.38). Low adherence observed suggests that new interventions should focus in modification of HCWs' habits and attitudes, working at several levels: individual and institutional.

Epidemiology of epistaxis in the emergency department of a southern European tertiary care hospital.

PubMed

Reis, Luis Roque; Correia, Filipe; Castelhano, Luis; Escada, Pedro

2018-05-05

Epistaxis is the most common rhinological emergency seen in the emergency department. The purpose of this study was to evaluate epidemiological data of epistaxis in a southern European tertiary care hospital. A retrospective study was conducted during the period between January 2009 and December 2015. We analyzed the distribution by cross-referencing the demographic variables, destination after medical discharge, inpatient characteristics (major comorbid diseases, medication, bleeding localization and treatment) and health-care costs with the disease. Epistaxis accounted for approximately 1 in 30 visits to the ED and 77 out of a population of 100,000 was served by that ED. Overall, 71,624 patients were treated and 2371 patients presented with epistaxis (3.31%). One-thousand three-hundred and twenty-seven cases were male and 1044 female (p <.001). The mean age was 56 years (±26). Age distribution was bimodal, with peaks among those <10 years and >70 (p <.001). Epistaxis was more common in the winter months (p < 0.001). The main referral destinations (6.8%) included outpatient (2.9%) and inpatient (1.9%) services. Hospitalization was more frequent between the ages of 60 and 80 years (p =.029), and the major comorbidity was hypertension (47.8%). Medication interfering with haemostasis was documented in 30.4%. Most inpatient epistaxis was managed in a non-interventional manner and only. 5% of patients needed surgery. The mean total health-care cost was 69.8 € per episode. Emergency epistaxis was more frequent in men, the elderly, patients with underlying comorbidities, during the winter months, and showed a higher risk of referral and hospitalization with increasing age (as a result of an aging population in western countries). The main hospital expenses for epistaxis are related to hospitalization and health care costs. Copyright © 2018 Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. Publicado por Elsevier España, S.L.U. All rights

RETINAL DISEASES IN A TERTIARY HOSPITAL IN SOUTHERN NIGERIA.

PubMed

Uhumwangho, O M; Itina, E I

2015-01-01

Retinal diseases are an important and common cause of ophthalmic consultation. To determine the pattern of retinal diseases in the ophthalmic department of a tertiary hospital in Southern Nigeria. A retrospective review of the case folders of patients with retinal pathologies seen between 2012 and 2013 was performed. Relevant demographic and clinical data was recorded. Analysis was performed for frequencies, proportions and percentages with the GraphPad Instat Software, Inc. version V2.05a program, San Diego, CA. There were 185 patients made of 94 (50.8%) males and 91 (49.2%) females with a peak age group of 61-70 years, (range 1-85 years) who made consultations for retinal diseases. Age related macular degeneration, 37(15.0%), and macula hole, 10(4.0%), were the common macula pathologies while retinal detachment, 11(4.5%), was the most common condition that required emergency vitreo-retinal surgical intervention. Diabetic retinopathy/maculopathy, 31(12.6%), hypertensive retinopathy 22(8.9%), and retinal vascular occlusion 12(4.8%), were the common retinal vascular diseases found. Bilateral visual impairment (low vision and blindness) from retinal diseases was present in 28(14.4%) persons. The common vitreo-retinal treatment options were use of intravitreal antivascular endothelial growth factors 32(13.0%), laser 16(6.5%), and vitreoretinal surgery in 22(8.9%) eyes. Retinal diseases remain an important cause of ophthalmic consultation and visual loss. Provision of facilities to manage these conditions will improve service delivery and quality of lives of affected patients.

Awareness of Patients' Rights among Inpatients of a Tertiary Care Teaching Hospital- A Cross-sectional Study.

PubMed

Agrawal, Upasana; D'Souza, Brayal C; Seetharam, Arun Mavaji

2017-09-01

The rights of a patient are a set of rules of conduct which govern the interaction between the patients' and healthcare professionals. Every patient has a right to be informed about their rights and also the responsibility of the healthcare provider. To assess awareness among inpatient about patients' rights at an academic accredited hospital. A questionnaire based cross-sectional study was carried out among 350 patients admitted to the wards of a Tertiary Care Teaching Hospital. A 21-point questionnaire was developed based on standards of the National Accreditation Board for Hospitals and Healthcare Providers (NABH) and patients' charter of rights and validated. This charter of rights is also displayed in the hospital for patient's awareness. Frequencies and percentages were depicted. Chi-square test was used for statistical analysis. Positive awareness among the patients ranged from 28% to 97.4%. Females were more aware of their rights than males for 11 out of the 21 patient rights items. Younger adults were more aware than any other age group participants. Participants who were admitted to wards of higher categories (deluxe rooms) had high degree of awareness about patients' rights and education. Patients from urban areas and higher educational status were more aware than patients coming from rural areas. The study concludes that effective measures should be taken to improve the overall awareness not only among patients but also among different stakeholders in the healthcare delivery system. Readability of the patients' rights charter with good readability score, developing and distributing patient education materials in simple language about the rights and responsibilities to the patient and their family/relatives during their stay in the hospital or at the time of registration.Continuing nursing and medical education in medical teaching institutions and hospitals should focus on patients' rights and its importance, its need for awareness and its consequences

The financial burden of cancer: estimates from patients undergoing cancer care in a tertiary care hospital.

PubMed

Zaidi, Adnan A; Ansari, Tayyaba Z; Khan, Aziz

2012-10-15

The emotional burden associated with the diagnosis of cancer is sometimes overshadowed by financial burden sustained by patient and the family. This is especially relevant for a developing country as there is limited state support for cancer treatment. We conducted this study to estimate the cost of cancer care for two major types of cancer and to assess the perception of patients and families regarding the burden of the cost for undergoing cancer treatment at a private tertiary care hospital. This cross-sectional study was conducted at day care and radiotherapy unit of Aga Khan University, Hospital (AKUH) Karachi, Pakistan. All adult patients with breast and head & neck cancers diagnosed for 3 months or more were included. Data was collected using a structured questionnaire and analysed using SPSS. Sixty seven patients were interviewed during the study period. The mean and median monthly income of these patients was 996.4 USD and 562.5 USD respectively. Comparatively the mean and median monthly cost of cancer care was 1093.13 USD and 946.42 USD respectively. The cost of the treatment either fully or partially was borne by the family in most cases (94%). The financial burden of cancer was perceived as significant by 28 (42%) patients and unmanageable by 18 (27%) patients. This perceived level of burden was associated significantly with average monthly income (p = <0.001). Our study indicates that the financial burden of cancer care is substantial and can be overwhelming. There is a desperate need for treatment support programs either by the government or other welfare organisations to support individuals and families who are already facing a difficult and challenging situation.

Increasing prevalence of infectious diseases in asylum seekers at a tertiary care hospital in Switzerland

PubMed Central

Bloch-Infanger, Constantine; Bättig, Veronika; Kremo, Jürg; Widmer, Andreas F.; Egli, Adrian; Bingisser, Roland; Battegay, Manuel; Erb, Stefan

2017-01-01

Objective The increasing number of refugees seeking asylum in Europe in recent years poses new challenges for the healthcare systems in the destination countries. The goal of the study was to describe the evolution of medical problems of asylum seekers at a tertiary care centre in Switzerland. Methods At the University Hospital Basel, we compared all asylum seekers during two 1-year time periods in 2004/05 and 2014/15 concerning demographic characteristics and reasons for referrals and hospitalizations. Results Hundred ninety five of 2’544 and 516 of 6’243 asylum seekers registered at the national asylum reception and procedure centre Basel were referred to the University Hospital Basel in 2004/05 and 2014/15, and originated mainly from Europe (62.3%, mainly Turkey) and Africa (49.1%, mainly Eritrea), respectively. Median age was similar in both study periods (26.9 and 26.2 years). Infectious diseases in asylum seekers increased from 22.6% to 36.6% (p<0.001) and were the main reasons for hospitalizations (33.3% of 45 and 55.6% of 81 hospitalized patients, p = 0.017) in 2004/05 compared to 2014/15. The leading infectious diseases in hospitalized patients were tuberculosis (n = 4) and bacterial skin infections (n = 2) in 2004/05; Malaria (n = 9), pneumonia (n = 6), Chickenpox (n = 5), other viral infections (n = 5) and bacterial skin infections (n = 5) in 2014/15. Infectious diseases like malaria, cutaneous diphtheria, louseborne-relapsing fever or scabies were only found in the second study period. Almost one third of the admitted asylum seekers required isolation precautions with median duration of 6–9.5 days in both study periods. Conclusions The changing demography of asylum seekers arriving in Switzerland in the current refugee crisis has led to a shift in disease patterns with an increase of infectious diseases and the re-emergence of migration-associated neglected infections. Physicians should be aware of these new challenges. PMID:28617860

Non-Escherichia coli versus Escherichia coli community-acquired urinary tract infections in children hospitalized in a tertiary center: relative frequency, risk factors, antimicrobial resistance and outcome.

PubMed

Marcus, Nir; Ashkenazi, Shai; Yaari, Arnon; Samra, Zmira; Livni, Gilat

2005-07-01

Currently hospitalization for children with urinary tract infections (UTIs) is reserved for severe or complicated cases. Changes may have taken place in the characteristics and causative uropathogens of hospital-treated community-acquired UTI. To study children hospitalized in a tertiary center with community-acquired UTI, compare Escherichia coli and non-E. coli UTI, define predictors for non-E. coli UTI and elucidate the appropriate therapeutic approach. A prospective clinical and laboratory study from 2001 through 2002 in a tertiary pediatric medical center. Patients were divided by results of the urine culture into E. coli and non-E. coli UTI groups, which were compared. Of 175 episodes of culture-proved UTI, 70 (40%) were caused by non-E. coli pathogens. Non-E. coli UTI was more commonly found in children who were male (P = 0.005), who had underlying renal abnormalities (P = 0.0085) and who had received antibiotic therapy in the prior month (P = 0.0009). Non-E. coli uropathogens were often resistant to antibiotics usually recommended for initial therapy for UTI, including cephalosporins and aminoglycosides; 19% were initially treated with inappropriate empiric intravenous antibiotics (compared with 2% for E. coli UTI, P = 0.0001), with a longer hospitalization. Current treatment routines are often inappropriate for hospitalized children with non-E. coli UTI, which is relatively common in this population. The defined risk factors associated with non-E. coli UTIs and its antimicrobial resistance patterns should be considered to improve empiric antibiotic therapy for these infections.

Risk factors and costs of oral cancer in a tertiary care hospital in Delhi.

PubMed

Goyal, Sandeep; Tiwari, Vijay Kumar; Nair, Kesavan Sreekantan; Raj, Sherin

2014-01-01

The present study conducted with 100 oral cancer patients at a private tertiary care hospital in Delhi demonstrated that stage III cancer was associated with longer use of tobacco and poor oral hygiene. There was also statistically significant association (p<.05) between consumption of tobacco and alcohol. More than 60% treatment expenditure was on surgery followed by accommodation (9%) and investigations (8%). The effect of tobacco was well known among patients as 76% of the patients knew that common cancer in tobacco chewer is 'oral cancer', 22% of the patients however responded that they did not know which cancer is common in tobacco chewers. 58% said that they learnt about ill effects of tobacco from media while 24% said they learnt from family and friends. Out of 78 tobacco users, 60 (77%) said that they never received help to quit tobacco while 18(23%) have received help to quit.

Distribution, genetic diversity and antibiotic resistance of clinically important bacteria from the environment of a tertiary hospital.

PubMed

Phoon, Hannah Y P; Hussin, Hazilawati; Hussain, Baizurah Mohd; Lim, Shu Yong; Woon, Jia Jie; Er, Yi Xian; Thong, Kwai Lin

2018-03-11

Hospital environments are potential reservoirs of bacteria associated with nosocomial infections. Here, we determined the distribution of cultivable environmental bacteria of clinical importance from a Malaysian tertiary hospital and to investigate their resistotypes and genotypes. Swab and fluid samples (n=358) from healthcare workers' hands, frequently touched surfaces, medical equipment, patients' immediate surroundings, ward sinks and toilets and solutions or fluids of 12 selected wards were collected. Biochemical tests, PCR and 16S rRNA sequencing were used for identification after isolation from CHROMagar TM Orientation medium. Clinically important bacteria such as Enterococcus spp., Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter spp., Pseudomonas aeruginosa, and Enterobacter spp. were further characterised by disk diffusion method and REP-PCR. The 32 Gram negative and 21 Gram positive bacteria species identified were widely distributed in the hospital environment. Staphylococci were predominant followed by Bacillus spp., and P. aeruginosa. Frequently touched surfaces, medical equipment and ward sinks and toilets were the top three sources of bacterial species. Nine S. aureus, four Acinetobacter spp., one K. pneumoniae, and one Enterobacter spp., were multidrug resistant (MDR). The ESKAPE organisms were genetically diverse and widely dispersed across the hospital wards. An MDR MRSA clone was detected in a surgical ward isolation room. The large variety of cultivable, clinically important bacteria, especially the genetically related MDR S. aureus, K. pneumoniae, Acinetobacter spp., and Enterobacter spp. from various sampling sites indicated that the surfaces and fomites in the hospital were potential exogenous sources of nosocomial infections in the hospital. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Analysis on Inpatient Health Expenditures of Renal Cell Carcinoma in a Grade-A Tertiary Hospital in Beijing.

PubMed

Liu, Xin; Mao, Yong-Hui; He, Xue-Mei; Zhang, Yan-Jing; Sun, Ying

2017-10-20

Renal cell carcinoma (RCC) is the most common type of malignant renal tumors with a growing incidence in the recent years. This study aimed to investigate the influencing factors and variation trend of hospitalization expenditures among RCC patients in a single-centered hospital in Beijing during 5 consecutive years and to find the major cost items and fluctuation tendency of inpatient medical expenditures. The information of medical expenditures among RCC patients in a Grade-A tertiary hospital during the years 2012-2016 was investigated to find the main cost items and changes affecting the medical cost structure. Gray correlation method was adopted in quantitative analysis to analyze the composition of medical expenditures, and the variation of hospitalization expense structure during the five years was studied by analyzing the degree of structural variation. The cost item constitution of the hospitalization expenditures among RCC patients was relatively stable in the sample hospital during the past five years. To be specific, drug costs accounted for the largest proportion of medical expenditures each year, with the highest of 37.81% in 2012, and showed a slowly declining tendency in the coming years. The cost item with the highest correlation degree was drug costs, with the value of 1.0000; followed by the costs of surgeries, 0.8423. Furthermore, drug costs shared the largest proportion (40.95%) of structural variation, followed by the costs of surgeries (18.35%). Drug costs are the major influencing factors of the hospitalization expenditures among RCC patients. Thus, reasonable control on excessive drugs as well as the standardization of the diagnosis and treatment behaviors is conducive in reducing medical expenditures as well as easing patients' economic burdens. Besides, the positive growth on surgery costs suggests that the labor value of medical staffs has been gradually recognized.

Pre‐pandemic planning survey of healthcare workers at a tertiary care children’s hospital: ethical and workforce issues

PubMed Central

Cowden, Jessica; Crane, Lori; Lezotte, Dennis; Glover, Jacqueline; Nyquist, Ann‐Christine

2010-01-01

Please cite this paper as: Cowden et al. (2010). Pre‐pandemic planning survey of healthcare workers at a tertiary care children’s hospital: ethical and workforce issues. Influenza and Other Respiratory Viruses 4(4), 213–222. Background  Prior to the development of written policies and procedures for pandemic influenza, worker perceptions of ethical and workforce issues must be identified. Objective  To determine the relationship between healthcare worker (HCW) reporting willingness to work during a pandemic and perception of job importance, belief that one will be asked to work, and sense of professionalism and to assess HCW’s opinions regarding specific policy issues as well as barriers and motivators to work during a pandemic. Methods  A survey was conducted in HCWs at The Children’s Hospital in Denver, Colorado, from February to June 2007. Characteristics of workers reporting willingness to work during a pandemic were compared with those who were unwilling or unsure. Importance of barriers and motivators was compared by gender and willingness to work. Results Sixty percent of respondents reported willingness to work (overall response rate of 31%). Belief one will be asked to work (OR 4·6, P < 0·0001) and having a high level of professionalism (OR 8·6, P < 0·0001) were associated with reporting willingness to work. Hospital infrastructure support staffs were less likely to report willingness to work during a pandemic than clinical healthcare professionals (OR 0·39, P < 0·001). Concern for personal safety, concern for safety of family, family’s concern for safety, and childcare issues were all important barriers to coming to work. Conclusions  Educational programs should focus on professional responsibility and the importance of staying home when ill. Targeted programs toward hospital infrastructure support and patient and family support staff stressing the essential nature of these jobs may improve willingness to work. PMID

Hospital level analysis to improve patient flow.

PubMed

Khanna, Sankalp; Boyle, Justin; Good, Norm; Bugden, Simon; Scott, Mark

2013-01-01

The complexity of hospital operations ensures that one-size-fits-all solutions seldom work. As hospitals turn to evidence based strategies to redesign flow, it is critical that they tailor the strategies to suit their individual service. This paper analyses the effect of hospital occupancy on inpatient and emergency department patient flow parameters at the Caboolture hospital in Queensland, Australia, and identifies critical levels, or choke points, that result in performance decline. The effect of weekdays and weekends on patient flow is also investigated. We compare these findings to a previous study that has analysed patient flow across Queensland hospitals grouped by size, and discover several differences in the interaction between rising occupancy and patient flow parameters including rates of patient flow, length of stay, and access block. We also identify significantly higher choke points for Caboolture hospital as compared to other similarly sized Queensland hospitals, which suggest that patient flow here can be redesigned to operate at higher levels of occupancy without degrading flow performance. The findings support arguments for hospitals to analyse patient flow at a service level to deliver optimum service improvement.

Satisfaction of care in a tertiary level diabetes clinic: correlations with diabetes knowledge, clinical outcome and health-related quality of life.

PubMed

Koves, Ildiko H; Boucher, Andrew; Ismail, Dunia; Donath, Susan; Cameron, Fergus J

2008-01-01

Patient satisfaction is regarded as an integral component of the quality of medical care. Therefore, as part of an ongoing process of outcome assessment, we analysed levels of satisfaction of care among patients and parents in our diabetes clinic and its relationship to short-term metabolic control outcome, diabetes knowledge and health-related quality of life (HRQOL). In 2004, parents and their children aged 5-18 years attending the Royal Children's Hospital (RCH) diabetes clinic completed questionnaires reporting their satisfaction with care provided, HRQOL and diabetes knowledge. Concurrent HbA(1c) levels were also recorded. The reporting profile was 83 patients, 24 fathers and 110 mothers. Generally, both patients and parents were satisfied with diabetes care provided at our tertiary centre. Satisfaction of care was not associated with the clinical outcome of metabolic control (measured by HbA(1c) levels), diabetes knowledge or HRQOL measures. Most patients and their parents in the RCH diabetes clinic appear generally satisfied with their diabetes care. The degree of satisfaction of care cannot be presumed according to clinical outcome, diabetes knowledge or HRQOL measures.

Outcome and hospital cost for infants weighing less than 500 grams: a tertiary centre experience in Taiwan.

PubMed

Hsieh, Wu-Shiun; Jeng, Suh-Fang; Hung, Yi-Li; Chen, Pau-Chung; Chou, Hung-Chieh; Tsao, Po-Nien

2007-09-01

To determine the outcome and hospital cost for infants weighing < or =500 g at a tertiary centre in Taiwan. We retrospectively reviewed the medical records of infants who were born alive with birthweight < or =500 g at the National Taiwan University Hospital from 1997 to 2004. Their outcome and hospital cost were analysed. A total of 168 infants were included for analysis that 146 of them died after compassionate care in the delivery room and 22 received postnatal resuscitation. The infants who received resuscitation were more likely to have higher birthweights, older gestational ages and multiple births compared with those who received compassionate care. After resuscitation, five of the infants died and 17 were admitted to neonatal intensive care unit (NICU) for further management. Subsequently, 12 infants died and five infants survived to discharge. Two infants were discharged against advice and died within days. After exclusion of those receiving compassionate care, the NICU survival rate was 22.7% and the long-term survival rate was 13.6%. The most common early morbidities were respiratory distress syndrome, intraventricular haemorrhage and patent ductus arteriosus, whereas the late morbidities included cholestatic jaundice, retinopathy of prematurity and chronic lung disease. The average total hospital costs for the NICU survivors with birthweight < or =500 g was US $42,411 and the average hospital cost per day was US $350. Exclusive compassionate care was given to the majority of the infants weighing < or =500 g in Taiwan. The survival rate remained low in these marginally viable infants.

Toward Better Pain Management: The Development of a "Pain Stewardship Program" in a Tertiary Children's Hospital.

PubMed

Brenn, B Randall; Choudhry, Dinesh K; Sacks, Karen; Como-Fluehr, Sandra; Strain, Robert

2016-09-01

Despite increased focus on pediatric pain, uncontrolled pain is still a problem for hospitalized pediatric inpatients. A program was designed to find patients with uncontrolled pain and develop a framework to oversee their pain management. This report details the development of a pain stewardship program with data from the first year of its activity. Hospitalized inpatients in a tertiary care pediatric center in the mid-Atlantic region were included in the study. Pain scores are recorded every 4 hours in the hospital electronic health record. A report was constructed to find all patients with an average pain score ≥7 in the preceding 12 hours. The charts of these patients were reviewed by our anesthesia pain service, and all patients were grouped into 1 of the following action categories: (1) no action required; (2) telephone call to the patient's attending physician; (3) one-time consultation; (4) consultation with ongoing management; or (5) patient was already on the anesthesia pain service. Demographic data, pain regimens, and outcomes were recorded in a prospectively collected database. There were 843 records on 441 unique patients. Only 22% required action to be taken by the anesthesia pain service. The pain stewardship database revealed that patients with sickle cell disease or abdominal pain required more frequent attention. An electronic health record-based pain stewardship program is an important step in identifying all children in the hospital with undermanaged pain, and it provides a warning system that may improve patient care, outcomes, and satisfaction. Copyright © 2016 by the American Academy of Pediatrics.

Clinical and microbiological profile of a retrospective cohort of enteric fever in 2 Spanish tertiary hospitals.

PubMed

Sánchez-Montalvá, Adrián; Martínez-Pérez, Ángela; Pérez-Molina, José Antonio; González-López, Juan José; Lopez-Vélez, Rogelio; Salvador, Fernando; Sánchez, Irene; Planes, Anna M; Molina, Israel

2015-05-01

Enteric fever in high-income countries is diagnosed mainly in patients returning from endemic countries. We assess the clinical, microbiological, and prognosis aspects of enteric fever in 2 Spanish tertiary hospitals. A retrospective observational study was conducted at Vall d'Hebron University Hospital and Ramón y Cajal University Hospital in Spain. We reviewed medical records of all patients who were diagnosed with enteric fever from January 2000 to January 2014 at these hospitals. We identified 47 patients with enteric fever episodes. According to their travel history, 35 (74.5%) patients had travelled to highly endemic countries. Imported enteric fever was acquired mainly in Asia (70.3%). Imported infections were implicated in travelers (48.6%), visiting friends and relatives (40%) and immigrants (11.4%). We found that 12 patients were diagnosed with enteric fever without a travel history (autochthonous infection). The resistance profile of the isolates showed decreased ciprofloxacin susceptibility in 66.7% of the imported group and 8.3% of the autochthonous group (P = 0.001). Salmonella strains from patients returning from Asia had an increased risk of having decreased ciprofloxacin susceptibility (odds ratio, 52.25; 95% confidence interval: 8.6-317.7). Patients with imported enteric fever are at higher risk for having a Salmonella strain with decreased ciprofloxacin susceptibility, especially in patients returning from Asia. Initial treatment with third-generation cephalosporin or azithromycin is strongly recommended until a drug-susceptibility test is available. Prevention strategies such as pretravel counseling and immunization before travel may be beneficial.

Level of Motivation Amongst Health Personnel Working in A Tertiary Care Government Hospital of New Delhi, India

PubMed Central

Jaiswal, Poonam; Singhal, Ashok K.; Gadpayle, Adesh K.; Sachdeva, Sandeep; Padaria, Rabindra

2014-01-01

Aims: To assess the level and factors of motivation amongst permanent government employees working in a tertiary health care institution. Material and Methods: A sample of 200 health personnel (50 in each category) i.e. doctors, nurses, technician, and support staff were contacted through face to face interview. Motivation was measured as the degree to which an individual possessed various identified motivation domains like Drive, Control, Challenge, Relationship and Rewards. Each domain was represented by 4 dimensions- accordingly a closed-ended statement represented each of these dimensions and responses were assessed on a Likert based scale. Data management was done using SPSS, ver. 19. Results: The average age for different health personnel were: Doctors 48.68 (±8.53), nurses 40.72 (±7.76), technician 38.4 (±10.65) and support staff 43.24 (±9.52) years. The average year of work experience was: Doctor 19.09 (±9.77), nurses 17.2 (±8.420), technician 14.84 (±10.45), support staff 18.24 (±10.28). A comparison of overall motivation index (mean score) revealed that nurse had highest level (3.47), followed by support staff (3.46), doctor (3.45) and technician (3.43). Based on their individual mean scores, the healthcare providers were categorised into three different levels of motivation and it was found that majority of the health personnel i.e.70% of support staff, 62% nurse, 56% doctor and technician, had high to very high level of motivation index. The mean scores for all the five factors as well as their respective ranks were also found out and it was deduced that “relationship” assumed first rank for doctors (mean score: 3.71) and technician (mean score: 3.75), whereas “control” assumed greatest significance for nurses (mean score, 3.62) and support staff (mean scores, 3.61). Based upon the mean scores, “reward” assumed third rank among all the four categories. Kruskal-Wallis test was applied to test if the different categories of health

Incidence, duration and cost of futile treatment in end-of-life hospital admissions to three Australian public-sector tertiary hospitals: a retrospective multicentre cohort study.

PubMed

Carter, Hannah E; Winch, Sarah; Barnett, Adrian G; Parker, Malcolm; Gallois, Cindy; Willmott, Lindy; White, Ben P; Patton, Mary Anne; Burridge, Letitia; Salkield, Gayle; Close, Eliana; Callaway, Leonie; Graves, Nicholas

2017-10-16

To estimate the incidence, duration and cost of futile treatment for end-of-life hospital admissions. Retrospective multicentre cohort study involving a clinical audit of hospital admissions. Three Australian public-sector tertiary hospitals. Adult patients who died while admitted to one of the study hospitals over a 6-month period in 2012. Incidences of futile treatment among end-of-life admissions; length of stay in both ward and intensive care settings for the duration that patients received futile treatments; health system costs associated with futile treatments; monetary valuation of bed days associated with futile treatment. The incidence rate of futile treatment in end-of-life admissions was 12.1% across the three study hospitals (range 6.0%-19.6%). For admissions involving futile treatment, the mean length of stay following the onset of futile treatment was 15 days, with 5.25 of these days in the intensive care unit. The cost associated with futile bed days was estimated to be $AA12.4 million for the three study hospitals using health system costs, and $A988 000 when using a decision maker's willingness to pay for bed days. This was extrapolated to an annual national health system cost of $A153.1 million and a decision maker's willingness to pay of $A12.3 million. The incidence rate and cost of futile treatment in end-of-life admissions varied between hospitals. The overall impact was substantial in terms of both the bed days and cost incurred. An increased awareness of these economic costs may generate support for interventions designed to reduce futile treatments. We did not include emotional hardship or pain and suffering, which represent additional costs. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Prevalence of Clostridium difficile infection among the patients attending a tertiary care teaching hospital.

PubMed

Segar, Lavanya; Easow, Joshy M; Srirangaraj, Sreenivasan; Hanifah, Mohammad; Joseph, Noyal M; Seetha, K S

2017-01-01

Clostridium difficile, a most important nosocomial enteric pathogen, is recognized globally as responsible for antibiotic-associated diarrhea and colitis. It is associated with considerable morbidity and mortality due to widespread use of antibiotics. The study was done to determine the prevalence of C. difficile infection (CDI) among the patients attending a tertiary care teaching hospital in Puducherry. We performed a prospective cohort study in Mahatma Gandhi Medical College and Research Institute. Around 150 patients were evaluated along with the patient details. C. difficile toxin detection was done as per the standard algorithm using the C. Diff Quik Chek Complete® assay (TECHLAB, Blacksburg, VA, USA). Analysis was done using statistics software (SPSS 16.0, SPSS Inc., Chicago, IL, USA). The prevalence of CDI was found to be 4%. More toxin-positive cases were between 50 and 60 years of age, and there was no difference in gender. Intensive Care Unit showed more toxin-positive cases; however, there was no significant association between the occurrence of CDI and the primary diagnosis of the patients. The prevalence of CDI in our hospital was found to be 4%, which was relatively lower compared to other Indian studies. However, awareness of the risk factors may assist in identifying patients at higher risk for CDI, guide implementation of appropriate preventive measures, and modulate potential intervention measure during management.

Evaluation of patients' satisfaction after laparoscopic surgery in a tertiary hospital in Cameroon (Africa).

PubMed

Fouogue, Jovanny Tsuala; Tchounzou, Robert; Fouelifack, Florent Ymele; Fouedjio, Jeanne Hortence; Dohbit, Julius Sama; Sando, Zacharie; Mboudou, Emile Telesphore

2017-01-01

Access to laparoscopy is low in Cameroon where customers' satisfaction has not been reported so far. We assessed patients' satisfaction with the process of care during laparoscopic surgery in a new tertiary hospital. A questionnaire was addressed to consenting patients (guardians for patients under 18) with complete medical records who underwent laparoscopy at the Douala Gynaeco-Obstetric and Paediatric Hospital (Cameroon) from November 1, 2015 to July 31, 2016. The following modified Likert's scale was used to assess satisfaction: very weak: 0-2.5; weak 2.6-5; good: 5.1-7.5; very good: 7.6-10. Only descriptive statistics were used. Response rate was 90% (45/50). Of the 45 respondents, 39 (86.7%) were female, 14(31.1%) were referred and 39 (86.7%) paid by direct cash deposit. Mean age was 36.8±11.9 years. Laparoscopies were carried out in emergency for 3 (6.7%) patients. Digestive abnormalities indicated 13 (28.9%) laparoscopies while gynaecologic diseases accounted for 32 (71.1%) cases. Perception of the overall care process was good with a mean satisfaction score of 6.8 ± 1.4. Scores in categories were: 0% (Very weak); 13.3% (weak); 57.8% (good) and 28.9% (very good). Specifically mean satisfaction scores were: 7.8 ± 1.0 with doctors' care; 7.1 ± 1.3 with hospital administration; 7.0 ± 1.2 with nursing and 4.7 ± 1.4 with the costs. Main complaints were: long waiting time (73.3%), constraining geographical access (66.7%) and expensiveness (48.9%). Patients were globally satisfied with the process of care but financial and geographical barriers should be addressed.

Neonatal arterial hypertension in nephro-urological malformations in a tertiary care hospital.

PubMed

Lanzarini, V V; Furusawa, E A; Sadeck, L; Leone, C R; Vaz, F A C; Koch, V H

2006-09-01

An increase in the survival of neonates with antenatal diagnosis of malformations was achieved by the recent technical advances in neonatal intensive care units. The aim of this article is to describe the experience with neonatal arterial hypertension, in newborns with nephro-urological malformations, in a tertiary care referral Nursery, in a period of 4 years. Newborn medical records from the Nursery Annex to the Maternity of Hospital das Clinicas, School of Medicine, University of Sao Paulo, with the diagnosis of nephro-urological malformations and systemic arterial hypertension (SAH) at hospital discharge, in a period from January 1999 to January 2003, were retrospectively analysed. Among 10.278 live newborns in the studied period, 15 (0.15%) newborns were compatible with our inclusion criteria. Of these 15 newborns, 12 (80%) were male and three were premature (20%). In relation to aetiology, 13 (87%) showed urological malformations, 1 (6%) chronic renal insufficiency secondary to kidney dysplasia and one (6%) autosomal recessive polycystic kidney disease. SAH control was achieved with monotherapy in eight patients (53%), five patients (33%) needed an association of two drugs (calcium-channel blocker and angiotensin converting enzyme (ACE) inhibitor), one child used three types of antihypertensive drugs (calcium-channel blocker, ACE inhibitor and hydrochlorothiazide) for pressoric control and one child's blood pressure (BP) was controlled exclusively by peritoneal dialysis. The incidence of nephro-urological malformations in our service during the studied period was 0.89%. SAH incidence among these newborns was 19%. Our data reinforce previous studies pointing to the necessity to consider children with nephro-urological malformations as a risk group for SAH, who should have the BP evaluated since the neonatal period.

Listeriosis in pregnancy: a secular trend in a tertiary referral hospital in Barcelona.

PubMed

Sisó, C; Goncé, A; Bosch, J; Salvia, M D; Hernández, S; Figueras, F

2012-09-01

The purpose of this study was to describe the variation in listeriosis infection incidence during pregnancy over a 25-year period based on salient clinical and laboratory features compiled in a tertiary referral hospital and to depict the clinical characteristics of these cases. A cohort was created of all cases of listeriosis in pregnant women or their neonates (early-onset form) diagnosed between 1985 and 2010. Forty-three cases of perinatal listeriosis were diagnosed among the 82,320 hospitalised pregnant women (incidence 0.5‰). Whereas the incidence remained almost constant at 0.24‰ until 2000, an increasing incidence was observed from then on, reaching 0.86‰ during the last years of the study period. A four-fold increase in listeriosis rate during pregnancy has occurred in recent years, with poorer outcome for those cases occurring before 28 weeks and for those in which early antibiotic treatment was not provided. These results should raise the awareness of the agencies and professionals involved in prenatal care.

Questionnaire survey about use of an online appointment booking system in one large tertiary public hospital outpatient service center in China

PubMed Central

2014-01-01

Background As a part of nationwide healthcare reforms, the Chinese government launched web-based appointment systems (WAS) to provide a solution to problems around outpatient appointments and services. These have been in place in all Chinese public tertiary hospitals since 2009. Methods Questionnaires were collected from both patients and doctors in one large tertiary public hospital in Shanghai, China.Data were analyzed to measure their satisfaction and views about the WAS. Results The 1000 outpatients randomly selected for the survey were least satisfied about the waiting time to see a doctor. Even though the WAS provided a much more convenient booking method, only 17% of patients used it. Of the 197 doctors surveyed, over 90% thought it was necessary to provide alternative forms of appointment booking systems for outpatients. However, about 80% of those doctors who were not associated professors would like to provide an ‘on-the-spot’ appointment option, which would lead to longer waits for patients. Conclusions Patients were least satisfied about the waiting times. To effectively reduce appointment-waiting times is therefore an urgent issue. Despite the benefits of using the WAS, most patients still registered via the usual method of queuing, suggesting that hospitals and health service providers should promote and encourage the use of the WAS. Furthermore, Chinese health providers need to help doctors to take others’ opinions or feedback into consideration when treating patients to minimize the gap between patients’ and doctors’ opinions. These findings may provide useful information for both practitioners and regulators, and improve recognition of this efficient and useful booking system, which may have far-reaching and positive implications for China’s ongoing reforms. PMID:24912568

Microbiological Surveillance of Operation Theatres: Five Year Retrospective Analysis from a Tertiary Care Hospital in North India

PubMed Central

Najotra, Dipender Kaur; Malhotra, Aneeta Singh; Slathia, Poonam; Raina, Shivani; Dhar, Ashok

2017-01-01

Introduction: Microbiological contamination of air and environment in the operation theaters (OTs) are major risk factor for surgical site and other hospital-associated infections. Objectives: The aim was to identify bacterial colonization of surfaces and equipment and to determine the microbial contamination of air in the OTs of a tertiary care hospital. Materials and Methods: Five years (January 2010–December 2014) retrospective analysis of the data obtained from routine microbiological surveillance of the five OTs of the hospital was done. Surface samples were taken with wet swabs from different sites and equipment. Bacterial species were isolated and identified by conventional methods. Air quality surveillance of OTs was done by settle plate method. Results: A total of 4387 samples were collected from surfaces and articles of various OTs. Out of these only 195 (4.4%), samples showed bacterial growth and yielded 210 isolates. The predominant species isolated was Bacillus with 184 (87.6%) isolates followed by coagulase-negative Staphylococcus 17 (8.1%), Staphylococcus aureus 6 (2.9%), and Enteroccoccus spp. 3 (1.4%). Analysis of the OT air samples showed least colony forming unit (cfu) rate of air (27 cfu/m3) in ophthalmology OT and highest rate of 133 cfu/m3 in general surgery OT. Conclusion: The study shows that OTs of our hospital showed a very low bacterial contamination rate on surface swabbing and a cfu count per m3 of air well within permissible limits. PMID:28904915

The public's rating of hospitals.

PubMed

Boscarino, J A

1988-01-01

Increasingly, hospital administrators have been concerned about the public's perception of the facility. Nationwide, they have engaged marketing firms to study how consumers rate their local facilities in comparison to others. This type of information has been important to develop effective marketing and advertising programs (Steiber and Boscarino 1985). In this study, hospital ratings were analyzed for 65 short-term (nongovernment), medical and surgical hospitals across the United States. These hospitals represented different regions of the country (east, west, north, south, and central), as well as urban, suburban, and rural areas. Over 14,000 consumers were surveyed in these local market surveys. The public's ratings of these local hospitals were analyzed in terms of hospital size (number of beds), inpatient census, the "urbanicity" level of the local area, the level of care provided (primary, secondary, or tertiary), geographic region, and the 1984 Health Care Financing Administration death rate reported for Medicare patients. A multivariate analysis of the data indicates that hospital ratings are significantly related to the level of care provided and to the hospital's census level. Both of these are positively related to the public's attitude toward that facility (the higher the rating, the more specialized the care provided and the higher the census at that facility). Other variables are also positively related to ratings for example, bed size), but this is because of the relationship of these variables to either census or care level.

Analysis of functioning and efficiency of a code blue system in a tertiary care hospital.

PubMed

Monangi, Srinivas; Setlur, Rangraj; Ramanathan, Ramprasad; Bhasin, Sidharth; Dhar, Mridul

2018-01-01

"Code blue" (CB) is a popular hospital emergency code, which is used by hospitals to alert their emergency response team of any cardiorespiratory arrest. The factors affecting the outcomes of emergencies are related to both the patient and the nature of the event. The primary objective was to analyze the survival rate and factors associated with survival and also practical problems related to functioning of a CB system (CBS). After the approval of hospital ethics committee, an analysis and audit was conducted of all patients on whom a CB had been called in our tertiary care hospital over 24 months. Data collected were demographic data, diagnosis, time of cardiac arrest and activation of CBS, time taken by CBS to reach the patient, presenting rhythm on arrival of CB team, details of cardiopulmonary resuscitation (CPR) such as duration and drugs given, and finally, events and outcomes. Chi-square test and logistic regression analysis were used to analyze the data. A total of 720 CB calls were initiated during the period. After excluding 24 patients, 694 calls were studied and analyzed. Six hundred and twenty were true calls and 74 were falls calls. Of the 620, 422 were cardiac arrests and 198 were medical emergencies. Overall survival was 26%. Survival in patients with cardiac arrests was 11.13%. Factors such as age, presenting rhythm, and duration of CPR were found to have a significant effect on survival. Problems encountered were personnel and equipment related. A CBS is effective in improving the resuscitation efforts and survival rates after inhospital cardiac arrests. Age, presenting rhythm at the time of arrest, and duration of CPR have significant effect on survival of the patient after a cardiac arrest. Technical and staff-related problems need to be considered and improved upon.

Service Quality Of Diagnostic Fine Needle Aspiration Cytology In A Tertiary Care Hospital Of Lahore (Process Measure As Patient's Perspective).

PubMed

Rizvi, Zainab; Usmani, Rabia Arshed; Rizvi, Amna; Wazir, Salim; Zahra, Taskeen; Rasool, Hafza

2017-01-01

Quality of any service is the most important aspect for the manufacturer as well as the consumer. The primary objective of any nation's health system is to provide supreme quality health care services to its patients. The objective of this study was to assess the quality of diagnostic fine needle aspiration cytology service in a tertiary care hospital. As Patient's perspectives provide valuable information on quality of process, therefore, patient's perception in terms of satisfaction with the service was measured. In this cross sectional analytical study, 291 patients undergoing fine needle aspiration cytology in Mayo Hospital were selected by systematic sampling technique. Information regarding satisfaction of patients with four dimensions of service quality process, namely "procedure, sterilization, conduct and competency of doctor" was collected through interview on questionnaire. The questionnaire was developed on SERVQUAL model, a measurement tool, for quality assessment of services provided to patients. All items were assessed on 2- point likert scale (0=dissatisfied, 1=satisfied). Frequencies and percentages of satisfied and dissatisfied patients were recorded for each item and all items in each dimension were scored. If the percentage of sum of all item scores of a dimension was ≥60, the dimension was 'good quality'. Whereas <60% was 'poor quality' dimension. Data was analysed using epi-info-3.5.1. Fisher test was applied to check statistical significance. (p-value <0.05). Out of the 4 dimensions of service quality process, Procedure (48.8%), Sterilization (51.5%) and practitioner conduct (50.9%) were perceived as 'poor' by the patients. Only practitioner competency (67.4%) was perceived as 'good'. Comparison of dimensions of service quality scoring with overall level of patient satisfaction revealed that all 4 dimensions were significantly related to patient dissatisfaction (p<.05). The study suggests that service quality of therapeutic and diagnostic

How Do Patients Perceive and Expect Quality of Surgery, Diagnostics, and Emergency Services in Tertiary Care Hospitals? An Evidence of Gap Analysis From Pakistan.

PubMed

Fatima, Iram; Humayun, Ayesha; Anwar, Muhammad Imran; Iftikhar, Adil; Aslam, Muhammad; Shafiq, Muhammad

2017-07-01

Service quality is one of the important gears to appraise services and determine the gray areas that need improvement. In countries with a resource-poor health system, the first step of measuring quality is yet to be taken. This study seeks to inform policy makers in developing contextual service quality models by identifying service quality gaps in tertiary care teaching hospitals using patients' perspective. A cross-sectional study was performed using multistage cluster sampling, and a modified version of the SERVQUAL (SERV-service, QUAL-quality) instrument was administered to determine patient's expectations and perceptions. A total of 817 completed questionnaires were obtained from patients and/or their attendants using convenience sampling. Data analysis revealed statistically significant negative quality gaps between expectations and perceptions of tangibility, reliability, empathy, assurance, responsiveness, and communication. The difference in mean expectation and perception for responsiveness across the sexes was significant ( p < 0.003; p < 0.037, respectively) as well as in perception of communication ( p < 0.026). Other dimensions and overall hospital expected and perceived quality were independent of sex. Educational status showed significant difference in expectation and perception in responsiveness ( p < 0.005), but the perception of each dimension was significantly different in different educational categories (assurance: p < 0.001; empathy: p < 0.001; reliability: p < 0.001; tangibility: p < 0.001; responsiveness: p < 0.001; communication: p < 0.001; and for overall service quality: p < 0.001). Age and service departments showed no relationship with any of the perceived or expected dimension of service quality of hospitals. Tertiary care hospitals failed to meet patients' expectations in all major areas of service quality, posing a question of how hospitals implement and evaluate their quality assurance policy.

How Do Patients Perceive and Expect Quality of Surgery, Diagnostics, and Emergency Services in Tertiary Care Hospitals? An Evidence of Gap Analysis From Pakistan

PubMed Central

Fatima, Iram; Humayun, Ayesha; Anwar, Muhammad Imran; Iftikhar, Adil; Aslam, Muhammad; Shafiq, Muhammad

2017-01-01

Objectives Service quality is one of the important gears to appraise services and determine the gray areas that need improvement. In countries with a resource-poor health system, the first step of measuring quality is yet to be taken. This study seeks to inform policy makers in developing contextual service quality models by identifying service quality gaps in tertiary care teaching hospitals using patients’ perspective. Methods A cross-sectional study was performed using multistage cluster sampling, and a modified version of the SERVQUAL (SERV-service, QUAL-quality) instrument was administered to determine patient’s expectations and perceptions. A total of 817 completed questionnaires were obtained from patients and/or their attendants using convenience sampling. Results Data analysis revealed statistically significant negative quality gaps between expectations and perceptions of tangibility, reliability, empathy, assurance, responsiveness, and communication. The difference in mean expectation and perception for responsiveness across the sexes was significant (p < 0.003; p < 0.037, respectively) as well as in perception of communication (p < 0.026). Other dimensions and overall hospital expected and perceived quality were independent of sex. Educational status showed significant difference in expectation and perception in responsiveness (p < 0.005), but the perception of each dimension was significantly different in different educational categories (assurance: p < 0.001; empathy: p < 0.001; reliability: p < 0.001; tangibility: p < 0.001; responsiveness: p < 0.001; communication: p < 0.001; and for overall service quality: p < 0.001). Age and service departments showed no relationship with any of the perceived or expected dimension of service quality of hospitals. Conclusions Tertiary care hospitals failed to meet patients’ expectations in all major areas of service quality, posing a question of how hospitals implement and evaluate their quality assurance

Excellent Patient Care Processes in Poor Hospitals? Why Hospital-Level and Patient-Level Care Quality-Outcome Relationships Can Differ.

PubMed

Finney, John W; Humphreys, Keith; Kivlahan, Daniel R; Harris, Alex H S

2016-04-01

Studies finding weak or nonexistent relationships between hospital performance on providing recommended care and hospital-level clinical outcomes raise questions about the value and validity of process of care performance measures. Such findings may cause clinicians to question the effectiveness of the care process presumably captured by the performance measure. However, one cannot infer from hospital-level results whether patients who received the specified care had comparable, worse or superior outcomes relative to patients not receiving that care. To make such an inference has been labeled the "ecological fallacy," an error that is well known among epidemiologists and sociologists, but less so among health care researchers and policy makers. We discuss such inappropriate inferences in the health care performance measurement field and illustrate how and why process measure-outcome relationships can differ at the patient and hospital levels. We also offer recommendations for appropriate multilevel analyses to evaluate process measure-outcome relationships at the patient and hospital levels and for a more effective role for performance measure bodies and research funding organizations in encouraging such multilevel analyses.

Depression and posttraumatic stress disorder among road traffic accident victims managed in a Tertiary hospital in Southern Nigeria.

PubMed

Asuquo, J E; Edet, B E; Abang, I E; Essien, E A; Osakwe, O G; Aigbomain, E J; Chigbundu, K C

2017-02-01

Psychological responses to traumatic events vary widely across different cultures but studies in the developing countries are scant. The objective of this study is to determine prevalence of depression and posttraumatic stress disorder (PTSD) among patients involved in road traffic accident (RTA) compared with that of the general population using a matched control group. The study design was case control and employed the convenient sampling technique. All consecutive attendees of the trauma clinic of a Tertiary Hospital who had been involved in RTA in the previous year and met inclusion criteria were recruited to participate in the study. Controls were drawn from patient relatives attending other clinics in the same hospital. The final sample comprised of 46 cases and controls, totaling 92 participants. A Sociodemographic questionnaire, the PTSD, and depression modules of the Mini International neuropsychiatric interview were administered to both groups by trained research assistants. The data were analyzed using IBM SPSS version 22. Statistical significance was set at 0.05. The prevalence of PTSD among cases was 41.3% compared with 13% among controls, whereas the prevalence of depression among cases was 63% compared with 30.4% among the controls. Both of these findings were statistically significant (P < 0.002). Sociodemographic variables such as age, sex, marital status, religion, level of education, and occupation did not have statistically significant relationship with neither PTSD nor depression. Mental disorders such as PTSD and depression are common in victims of RTA. They would benefit from comanagement with mental health specialists.

Workplace violence, job satisfaction, burnout, perceived organisational support and their effects on turnover intention among Chinese nurses in tertiary hospitals: a cross-sectional study

PubMed Central

Zhang, Zhong; Liu, Xinyan; Li, Li; Duan, Xiaojian; Li, Guoqiang; Lou, Fengge; Jia, Xiaoli; Fan, Lihua; Sun, Tao; Ni, Xin

2018-01-01

Objectives Our aims were to assess the relationship between workplace violence, job satisfaction, burnout, organisational support and turnover intention, and to explore factors associated with turnover intention among nurses in Chinese tertiary hospitals. Methods The purposive sampling method was used to collect data from August 2016 through January 2017. A total of 1761 nurses from 9 public tertiary hospitals in 4 provinces (municipalities) located in eastern (Beijing), central (Heilongjiang, Anhui) and western (Shaanxi) regions of China completed the questionnaires (effective response rate=85.20%). A cross-sectional study was conducted using the Workplace Violence Scale, Chinese Maslach Burnout Inventory General Survey, Minnesota Job Satisfaction Questionnaire Revised Short Version, Perceived Organizational Support-Simplified Version Scale and Turnover Intention Scale. Results A total of 1216 of 1706 (69.1%) participants had high turnover intention. During the previous 12 months, the prevalence of physical violence and psychological violence towards nurses was 9.60% and 59.64%, respectively. As expected, the level of turnover intention was negatively correlated with participants’ scores on job satisfaction (r=−0.367, p<0.001) and perceived organisational support (r=−0.379, p<0.001), respectively. Burnout was positively associated with turnover intention (r=0.444, p<0.001). Workplace violence was positively associated with turnover intention (β=0.035, p<0.001) in linear regression analysis. The total effect (β=0.53) of workplace violence on turnover intention comprised its direct effect (β=0.36) and its indirect effect (β=0.17). Conclusions Perceived organisational support served as a mediator between workplace violence, job satisfaction, burnout and turnover intention, and it had a significantly negative impact on turnover intention. Therefore, nursing managers should understand the importance of the organisation’s support and establish a reasonable

Awareness of Breast Cancer among Female Care Givers in Tertiary Cancer Hospital, China

PubMed Central

Dinegde, Negalign Getahun; Xuying, Li

2017-01-01

Objective: Breast cancer is a worldwide public health issue and most common cancer diagnosed among women including China, where advanced stages at diagnosis appears to be increasing and an ever-rising incidence twice as fast as global rates. The study was conducted to describe the awareness of breast cancer and associated factors among care giver women in tertiary Cancer Hospital, China. Methods: Institutional based cross-sectional study was conducted among 261 women selected by systematic random sampling. Information provided by the participants was converted into awareness scores for analysis using SPSS version 23. Awareness scores were dichotomized in to ‘good awareness and ‘poor awareness’ taking median score=11 as the cut-off point. Data analysis was performed using the binary logistic regression. A p-value of <0.05 was considered statistically significant. Result: The study showed that 46.7% of the respondents had good awareness. Breast lump was the most commonly known symptom of cancer by 61.7% of the respondents. Slightly more than half of the study participants acknowledged having a past history of breast cancer, drinking alcohol and having close relative with breast cancer as potential risk factors for breast cancer (63.6%, 58.6%, and 55.6% respectively). Nevertheless, a vast majority of the study participants were unable to appreciate modifiable risk factors of the disease. More than half of the participants had never/rarely checked their breasts and all of the participants wrongly answered breast cancer knowledge age related risk. Awareness level was significantly associated with entertainment preference (OR=3.57; 95%CI=1.71, 7.44) and residence setting areas (OR=2.4; 95%CI=1.04, 5.69). Conclusion: The study indicated suboptimal awareness while entertainment preference and residence setting were significantly associated with awareness level. Public awareness campaigns should be made by dissemination of information about breast cancer through

Evaluation of request forms submitted to the haematology laboratory in a Ghanaian tertiary hospital.

PubMed

Olayemi, Edeghonghon; Asiamah-Broni, Rebecca

2011-01-01

Laboratory request forms provide information about the laboratory test being requested for. They carry demographic data and other information such as location of patient, laboratory number, doctor's name, signature of the doctor, telephone number of the requesting doctor. Omission of information on the forms may lead to laboratory errors. The aim of this study was to evaluate the level of completion of laboratory request forms at the haematology department of a Ghanaian tertiary hospital. Three thousand request forms submitted to the haematology department between January and April 2010 were retrieved and studied. The information provided on each request form was recorded in a spread sheet and analyzed. The patient's age and sex were missing in 25.6% and 32.7% of the forms respectively. About half of the request forms did not have the patient's location. No clinical detail was provided on 22.7% of the forms. Doctors were more likely to sign their request forms and provide a name but they all failed to provide an address or a contact telephone number. This study demonstrates that, the standard of completion of request forms was poor. Essential information required on the forms was often missing. This can lead to limited advice given by laboratory physicians and may increase the potential for errors. Conversely, provision of all the information needed on the forms will aid laboratory diagnosis and enhance patient care and save time and resources. There should be closer interaction between clinicians and laboratory personnel to improve quality of services.

Treatment of patients with a history of penicillin allergy in a large tertiary-care academic hospital.

PubMed

Picard, Matthieu; Bégin, Philippe; Bouchard, Hugues; Cloutier, Jonathan; Lacombe-Barrios, Jonathan; Paradis, Jean; Des Roches, Anne; Laufer, Brian; Paradis, Louis

2013-01-01

Prescribing antibiotics to patients with a history of penicillin allergy is common in clinical practice. Opting for non-beta-lactam antibiotics has its inconveniences and is often unnecessary, because most of these patients are in fact not allergic. This study aimed to determine how physicians in a large Canadian tertiary-care academic hospital without allergists on staff treat patients with a history of penicillin allergy. A retrospective study was conducted during a 1-year period among all patients hospitalized in the intensive care unit, coronary care unit, and internal medicine wards. Files of patients with a record of penicillin allergy were reviewed to assess the need for antibiotics during their hospitalization and the decision-making process underlying the choice of antibiotic. The additional costs of alternative antibiotics were calculated. The files of 1738 patients admitted over a 1-year period were hand reviewed. A history of penicillin allergy was found in 172 patients (9.9%). The allergic reaction was described in only 30% of cases and left unmentioned in 20.7%. Beta-lactam antibiotics were used on 56 occasions despite a history of penicillin allergy. The use of alternative antibiotics in place of the beta-lactam standard of care carried an additional cost of $15,672 Canadian. Alleged penicillin allergy is common among hospitalized patients and leads to substantial additional costs. Poor documentation of penicillin allergy likely reflects a lack of knowledge on this issue in the medical community, which impairs optimal treatment of these patients. Increased education on this matter is needed, and allergists on staff could be part of the solution. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Prevalence of malnutrition at the time of admission among patients admitted to a Canadian tertiary-care paediatric hospital

PubMed Central

Baxter, Jo-Anna B; Al-Madhaki, Fatma Ibrahim; Zlotkin, Stanley H

2014-01-01

BACKGROUND: Malnutrition among hospitalized children is known to negatively influence their response to therapy and to prolong their admission. It also has short- and long-term consequences for growth, development and well-being. It is commonly regarded as a condition affecting children in low-income countries; however, malnutrition has been found to be variably prevalent among hospitalized children in higher-income countries. At the time the present study was conducted, it had been >30 years since the nutritional status of Canadian hospitalized children was last published. OBJECTIVES: To determine and communicate the prevalence of malnutrition among children in a Canadian tertiary-care paediatric hospital at the time of their admission. METHODS: In the present cross-sectional study, anthropometric measures were obtained from 322 children admitted to The Hospital for Sick Children in Toronto, Ontario. Nutritional indexes (BMI for age, weight for age, weight for length/height and length/height for age) were generated from anthropometric measures using the WHO igrowup software, and summarized according to WHO definitions. RESULTS: The overall prevalence of malnutrition using BMI for age was 39.6% (95% CI 33% to 46%), of which 8.8% and 30.8% of participants were under- and overnourished, respectively. Furthermore, 6.9% (95% CI 3% to 13%) were determined to be acutely malnourished (weight for length/height <−2 SD) and 13.4% (95% CI 10% to 18%) chronically malnourished (length/height for age <−2 SD). CONCLUSION: The high prevalence of overall malnutrition observed among study participants suggests that initial screening using simple anthropometric measures should be conducted on hospital admission so that patients can receive appropriate nutrition-specific care. PMID:25382997

Parental Satisfaction with Pediatric Day-Care Surgery and its Determinants in a Tertiary Care Hospital

PubMed Central

Sam, Cenita James; Arunachalam, Pavai A.; Manivasagan, Sivamani; Surya, T.

2017-01-01

Objective: The objective is to assess the level of parental satisfaction of pediatric day-care surgery and its different determinants. Materials and Methods: This is a descriptive study performed in a tertiary care hospital in India among parents of pediatric day-care surgery patients from June 2013 to March 2015. The core questionnaire for the assessment of patient satisfaction for general day care (COPS-D) was used. Variables related to surgery, overall satisfaction, one open-ended question, and socio-demographic data were also collected. Calculated sample size was 121. Results: The mean and standard deviation of parental satisfaction were estimated in eight domains of day care (COPS-D) using Likert scale 1–5. Preadmission visit had a mean of 4.63 (0.52), day of surgery 4.65 (0.58), operating room 4.76 (0.51), nursing care 4.46 (0.79), medical care 4.89 (0.48), information 4.51 (0.68), autonomy 4.64 (0.56), and discharge 4.50 (0.72). In elder children, there was less satisfaction on the information and discharge domains. Overall satisfaction was good in 88% of patients and was less than satisfactory when they had significant pain. Conclusion: Perception of quality of pediatric day-care surgery was assessed with a questionnaire and was found to be good. Variables related to surgery such as pain may be included in the questionnaire for assessing satisfaction in the day-care surgery. PMID:28974875

Women's experiences of transfer from primary maternity unit to tertiary hospital in New Zealand: part of the prospective cohort Evaluating Maternity Units study.

PubMed

Grigg, Celia P; Tracy, Sally K; Schmied, Virginia; Monk, Amy; Tracy, Mark B

2015-12-18

There is worldwide debate regarding the appropriateness and safety of different birthplaces for well women. The Evaluating Maternity Units (EMU) study's primary objective was to compare clinical outcomes for well women intending to give birth in either a tertiary level maternity hospital or a freestanding primary level maternity unit. Little is known about how women experience having to change their birthplace plans during the antenatal period or before admission to a primary unit, or transfer following admission. This paper describes and explores women's experience of these changes-a secondary aim of the EMU study. This paper utilised the six week postpartum survey data, from the 174 women from the primary unit cohort affected by birthplace plan change or transfer (response rate 73%). Data were analysed using descriptive statistics and thematic analysis. The study was undertaken in Christchurch, New Zealand, which has an obstetric-led tertiary maternity hospital and four freestanding midwife-led primary maternity units (2010-2012). The 702 study participants were well, pregnant women booked to give birth in one of these facilities, all of whom received continuity of midwifery care, regardless of their intended or actual birthplace. Of the women who had to change their planned place of birth or transfer the greatest proportion of women rated themselves on a Likert scale as unbothered by the move (38.6%); 8.8% were 'very unhappy' and 7.6% 'very happy' (quantitative analysis). Four themes were identified, using thematic analysis, from the open ended survey responses of those who experienced transfer: 'not to plan', control, communication and 'my midwife'. An interplay between the themes created a cumulatively positive or negative effect on their experience. Women's experience of transfer in labour was generally positive, and none expressed stress or trauma with transfer. The women knew of the potential for change or transfer, although it was not wanted or planned

Knowledge of Kidney Donation Among Care Givers in Two Tertiary Hospitals in Southwest Nigeria.

PubMed

Adejumo, Oluseyi A; Solarin, Adaobi U; Abiodun, Moses T; Akinbodewa, Ayodeji A

2017-05-01

One of the major challenges of kidney transplantation is shortage of kidney donors. Care givers (CGs) are potential kidney donors, but the majority of them are unwilling to donate due to inadequate knowledge on kidney donation. This study evaluated the knowledge of kidney donation and its determinants among CGs in two tertiary hospitals in Southwest Nigeria. This was a cross-sectional study that was carried out in the Kidney Care Centre (KCC), Ondo and Babcock University Teaching Hospital (BUTH), Ilishan-Remo using a self-administered pretested questionnaire that assessed knowledge of kidney donation and its determinants. Pvalue of <0.05 was taken as significant. A total of 244 respondents participated in the study. The majority were below 40 years, married, and female. The proportion of respondents with adequate knowledge of kidney donation was 63.4%. More respondents from BUTH compared to KCC had adequate knowledge of kidney donation (80% vs. 46.7%, P ≤ 0.001). Similarly, the mean knowledge score was higher in respondents from BUTH (P ≤ 0.001). Factors that determined knowledge of kidney donation were female gender (AOR: 3.43, 95% CI: 1.25-9.40, P = 0.02) and social class (AOR: 1.22, 95% CI: 0.50-2.95, P ≤ 0.001). There was positive correlation between knowledge of kidney donation among the respondents from both hospitals and their willingness to donate kidneys (r = 0.439, P ≤ 0.001). Knowledge of kidney donation was better among BUTH's respondents. Gender and social class were predictors of knowledge of kidney donation. Improving knowledge of kidney donation may improve willingness to donate among the public. © 2016 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Management of penile cancer in a Singapore tertiary hospital.

PubMed

Tan, Teck Wei; Chia, Sing Joo; Chong, Kian Tai

2017-06-01

To present our experience of managing penile squamous cell carcinoma (SCC) in a tertiary hospital in Singapore and to evaluate the prognostic value of the inflammatory markers neutrophil-lymphocyte ratio (NLR) and lymphocyte-monocyte ratio (LMR). We reviewed our prospectively maintained Institutional Review Board-approved urological cancer database to identify men treated for penile SCC at our centre between January 2007 and December 2015. For all the patients identified, we collected epidemiological and clinical data. In all, 39 patients were identified who were treated for penile SCC in our centre. The median [interquartile range (IQR)] follow-up was 34 (16.5-66) months. Although very few (23%) of our patients with high-risk clinical node-negative underwent prophylactic inguinal lymph node dissection (ILND), they still had excellent 5-year recurrence-free survival (RFS; 90%) and cancer-specific survival (CSS; 90%). At multivariate analysis, higher N stage was significantly associated with worse RFS and CSS. Patients with a high NLR (≥2.8) had significantly higher T-stage ( P  = 0.006) and worse CSS ( P  < 0.001) than those with a low NLR. Patients with a low LMR (<3.3) had significantly higher T-stage ( P  = 0.013) and worse RFS ( P  = 0.009) and CSS ( P  < 0.022) than those with a high LMR. Although very few of our patients with intermediate- and high-risk clinical node-negative SCC underwent prophylactic ILND, they still had excellent 5-year RFS and CSS. However, survival was poor in patients with node-positive disease. The pre-treatment NLR and LMR could serve as biomarkers to predict the prognosis of patients with penile cancer.

Work-related hand injuries treated at a tertiary care hospital.

PubMed

Mostafa, Nayera S; Sayed, Amany M; Osman, Amr A

2014-08-01

The hands are known to be the most commonly injured body parts in traumatic occupational injuries. They can be disabling, leading to major adverse social and economic consequences for the worker and for his or her family. The aim of the study was to describe work-related hand injuries and their potential risk factors and also investigate lines of management in relation to the type of injury. Patients who presented to the emergency room of a tertiary hospital over a 6-month period with occupational hand injuries were interviewed using a predesigned questionnaire. It included questions pertaining to the sociodemographic, occupational, and medical aspects related to the injury. A total of 163 patients were interviewed. More than 50% had injuries from cuts. Almost 60% of work-related hand injuries occurred in the absence of machines. The most common causes of hand injuries mentioned by workers were lack of concentration (68.7%), wearing no or ill-fitting gloves (63.2%), and a defect in the work place (51.5%). On examination, fingers were the most affected site (66.7%). About half of the cases were managed in the emergency room, 28.8% were managed with minor procedures, and 21.9% were managed with major procedures. Work-related hand injuries have multifactorial causes; lack of concentration was the most common in this study. Injuries from cuts were the most common and fingers were the most affected part. Modifications of the possible risk factors may reduce the incidence of acute hand injury at work.

Tertiary paediatric emergency department use in children and young people with cerebral palsy.

PubMed

Meehan, Elaine; Reid, Susan M; Williams, Katrina; Freed, Gary L; Babl, Franz E; Sewell, Jillian R; Rawicki, Barry; Reddihough, Dinah S

2015-10-01

The aim of this study was to describe the pattern of tertiary paediatric emergency department (ED) use in children and young people with cerebral palsy (CP). A retrospective analysis of ED data routinely collected at the two tertiary paediatric hospitals in Victoria, Australia, cross-matched with the Victorian Cerebral Palsy Register. Data pertaining to the ED presentations of 2183 registered individuals born 1993-2008 were obtained. Between 2008 and 2012, 37% (n = 814) of the CP cohort had 3631 tertiary paediatric ED presentations. Overall, 40% (n = 332) of presenters were residing in inner metropolitan Melbourne; 44% (n = 356) in outer Melbourne; and 13% (n = 108) in regional Victoria. Presenters were more likely than non-presenters to be younger, non-ambulant and have epilepsy. In total, 71% of presentations were triaged as Australasian Triage Scale 1-3 (urgent), and 44% resulted in a hospital admission. Disorders of the respiratory, neurological and gastrointestinal systems, and medical device problems were responsible for 72% of presentations. Many of the tertiary paediatric ED presentations in this group were appropriate based on the high admission rate and the large proportion triaged as urgent. However, there is evidence that some families are bypassing local services and travelling long distances to attend the tertiary paediatric ED, even for less urgent complaints that do not require hospital admission. Alternative pathways of care delivery, and strategies to promote the management of common problems experienced by children and young people with CP in non-paediatric EDs or primary care settings, may go some way towards reducing unnecessary tertiary paediatric ED use in this group. © 2015 The Authors. Journal of Paediatrics and Child Health © 2015 Paediatrics and Child Health Division (Royal Australasian College of Physicians).

Prevalence of intestinal parasites and bacteria among food handlers in a tertiary care hospital

PubMed Central

Zaglool, D. A.; Khodari, Y. A.; Othman, R. A. M.; Farooq, M. U.

2011-01-01

Objectives: The aim of this work is to determine the prevalence of intestinal parasites and bacteria among the food handlers. Materials and Methods: Two hundred food-handlers were subjected to a cross-sectional study working in the kitchen of a tertiary care hospital, i.e., Alnoor Specialist Hospital, Makkah, Saudi Arabia from February 2 to 27, 2009. The stool samples were examined for intestinal parasites following direct microscopic examination, formol ether concentration (Ritchie), and staining with modified acid fast staining techniques. For enteropathogenic bacteria samples were inoculated onto MacConkey's agar, deoxycholate citrate agar, xylose lysine deoxycholate agar as per the World Health Organization protocol. Fingernail materials were examined microscopically for enteropathogenic bacteria and parasites. Results: The majority (80%) of the food-handlers were young adults aged from 22 to 42 years. No intestinal parasites were detected from fingernail contents. Forty six (23%) stool specimens were positive for intestinal para¬sites. Giardia lamblia 18 (9%) was most frequent among the 10 different types of detected intestinal parasites followed by Entamoeba histolytica 9 (4.5%). No pathogenic bacteria were detected in all stool samples, whereas finger nails showed isolation of microorganisms as coagulase-negative staphylococci 79 (39.5%), followed by Staphylococcus aureus 35 (17.5%). Conclusion: The findings emphasized the importance of food handlers as potential sources of infections and suggested health institutions for appropriate hygienic and sanitary control measures. PMID:22529512

An epidemiological study of road traffic accident cases admitted in a tertiary care hospital.

PubMed

Pathak, S M; Jindal, A K; Verma, A K; Mahen, A

2014-01-01

Road traffic accidents are a leading cause of mortality and morbidity globally. In India, more than a million are injured annually and about a lakh are killed in road traffic accidents.(1) It causes the country to lose around 55,000 crores annually which is 2-3% of Gross Domestic Production (GDP).(2) This cross sectional study was conducted to elucidate the role of various factors involved in road traffic accidents. Road traffic accident cases admitted to a tertiary care hospital between 01 Oct 2009 and 28 Feb 2011 were included in the study. A total of 182 patients were studied. Information was collected through questionnaire, hospital records and on-site visit. OPD cases, comatose patients and deaths were excluded. Two-wheelers were the commonest vehicle involved in vehicular accidents. Most accidents happened at a speed of 40-60 km/h (37.9%). Most of the patients were aged between 20 and 30 years. Majority had a driving experience of less than 5 years. Monsoons witnessed 46.7% cases. Most cases occurred between 6 and 10 pm. Among severe injuries, the commonest was lower limb fractures (19.8%). There are multiple factors associated with road traffic accidents which due to the lack of road safety measures in the country are playing their role. It is the need of the hour to address this issue and formulate comprehensive, scientific and practical rules and regulations as well as evaluate its enforcement.

Assessment of cost of illness for diabetic patients in South Indian tertiary care hospital.

PubMed

Acharya, Leelavathi D; Rau, N R; Udupa, N; Rajan, M Surulivel; Vijayanarayana, K

2016-01-01

The impact of diabetes on health-care expenditures has been increasingly recognized. To formulate an effective health planning and resource allocation, it is important to determine economic burden. The objective of this study is to assess the cost of illness (COI) for diabetic inpatients with or without complications. The study was conducted in the medicine wards of tertiary care hospital after ethical approval by the Institutional Ethical Committee. A total of 116 each diabetic with or without complications were selected and relevant data were collected using COI questionnaire and data were analyzed using SPSS version 20. Mann-Whitney U test is used to assess the statistical significant difference in the cost of treatment of diabetes alone and with complications'. P ≤ 0.05 was considered statistically significant. Total COI includes the cost of treatment, investigation, consultation fee, intervention cost, transportation, days lost due to work, and hospitalization. The median of total COI for diabetic care without any complication was Rs. 22,456.97/- per patient per annum and with complication was Rs. 30,634.45/-. Patients on dialysis had to spend 7.3 times higher, and patients with cardiac intervention had to spend 7.4 times higher than diabetic patients without any complication. Treatment costs were many times higher in patients with complications and with cardiac and renal interventions. Complications in diabetic patients will increase the economic burden to family and also to the society.

Criteria-based audit on management of eclampsia patients at a tertiary hospital in Dar es Salaam, Tanzania

PubMed Central

Kidanto, Hussein Lesio; Mogren, Ingrid; Massawe, Siriel N; Lindmark, Gunilla; Nystrom, Lennarth

2009-01-01

Background Criteria-based audits have been used to improve clinical management in developed countries, but have only recently been introduced in the developing world. This study discusses the introduction of a criteria-based audit in a tertiary hospital in an African setting, assesses the quality of care among eclampsia patients and discusses possible interventions in order to improve the quality of care. Methods We conducted a criteria based audit of 389 eclampsia patients admitted to Muhimbili National Hospital (MNH), Dar es Salaam Tanzania between April 14, 2006 and December 31, 2006. Cases were assessed using evidence-based criteria for appropriate care. Results Antepartum, intrapartum and postpartum eclampsia constituted 47%, 41% and 12% of the eclampsia cases respectively. Antepartum eclampsia was mostly (73%) preterm whereas the majority (71%) of postpartum eclampsia cases ware at term. The case fatality rate for eclampsia was 7.7%. Medical histories were incomplete, the majority (75%) of management plans were not reviewed by specialists in obstetrics, specialist doctors live far from the hospital and do not spend nights in hospital even when they are on duty, monitoring of patients on magnesium sulphate was inadequate, and important biochemical tests were not routinely done. Two thirds of the patient scheduled for caesarean section did not undergo surgery within agreed time. Conclusion Potential areas for further improvement in quality of emergency care for eclampsia relate to standardizing management guidelines, greater involvement of specialists in the management of eclampsia and continued medical education on current management of eclampsia for junior staff. PMID:19323846

The development of hospital-based palliative care services in public hospitals in the Western Cape, South Africa.

PubMed

Gwyther, L; Krause, R; Cupido, C; Stanford, J; Grey, H; Credé, T; De Vos, A; Arendse, J; Raubenheimer, P

2018-02-01

With the recent approval of a South African (SA) National Policy Framework and Strategy for Palliative Care by the National Health Council, it is pertinent to reflect on initiatives to develop palliative care services in public hospitals. This article reviews the development of hospital-based palliative care services in the Western Cape, SA. Palliative care services in SA started in the non-governmental sector in the 1980s. The first SA hospital-based palliative care team was established in Charlotte Maxeke Johannesburg Academic Hospital in 2001. The awareness of the benefit of palliative care in the hospital setting led to the development of isolated pockets of excellence providing palliative care in the public health sector in SA. This article describes models for palliative care at tertiary, provincial and district hospital level, which could inform development of hospital-based palliative care as the national policy for palliative care is implemented in SA.

[Occupational exposure investigation and protective measures in a tertiary infectious disease hospital].

PubMed

Ding, H M; Zhou, X P; Huang, J Z

2018-02-20

Objective: To investigate the cause of occupational exposure among 136 nurses in a tertiary infectious disease hospital, and puts forward the prevention strategy. Methods: A total of 136 nurses exposed to occupational exposure between 2014 and 2016 were included in the study. Analysis was conducted from the years of work of nurses, exposure routes, and the pathogens. Results: The nurses suffer from the highest risk of occupational exposures (73.91%) .Nurses working for less than 5 years and interns are most likely to suffer occupational exposure (45.59% and 35.29% respectively) . Occupational exposure was mainly caused by needle injuries, in which infusion was the main route of occupational exposure (36.76%) . The improper treatment of needle pulling after infusion is the main link of needle puncture (36.76%) . Occupational exposure pathogens were mainly HBV (63.24%) . Conclusion: Nursing staff is the high-risk group of occupational exposure. Irregular operation, lack of awareness of protection, improper disposal after the needle withdrawal and poor safety assessment of the operating environment are the main causes of occupational exposure. It is suggested to strengthen the training of occupational safety and protection, enhance clinical nurses occupational safety protection consciousness, standardize medical operation, so as to prevent the occurrence of occupational exposure.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1

Awareness and practices regarding bio-medical waste management among health care workers in a tertiary care hospital in Delhi.

PubMed

Bhagawati, G; Nandwani, S; Singhal, S

2015-01-01

Health care institutions are generating large amount of Bio-Medical Waste (BMW), which needs to be properly segregated and treated. With this concern, a questionnaire based cross-sectional study was done to determine the current status of awareness and practices regarding BMW Management (BMWM) and areas of deficit amongst the HCWs in a tertiary care teaching hospital in New Delhi, India. The correct responses were graded as satisfactory (more than 80%), intermediate (50-80%) and unsatisfactory (less than 50%). Some major areas of deficit found were about knowledge regarding number of BMW categories (17%), mercury waste disposal (37.56%) and definition of BMW (47%).

Creativity and Innovation in Science and Technology: Bridging the Gap between Secondary and Tertiary Levels of Education

ERIC Educational Resources Information Center

Ramma, Yashwantrao; Samy, Martin; Gopee, Ajit

2015-01-01

Purpose: This paper stems from a study which was conducted as a means to first, find out whether there is a gap between the secondary and tertiary education levels, second identify any existing gap in Science and Technology education, and third, examine the impact of the above upon students' creativity and innovativeness at university level. The…

Implementation of Enterprise Imaging Strategy at a Chinese Tertiary Hospital.

PubMed

Li, Shanshan; Liu, Yao; Yuan, Yifang; Li, Jia; Wei, Lan; Wang, Yuelong; Fei, Xiaolu

2018-01-04

Medical images have become increasingly important in clinical practice and medical research, and the need to manage images at the hospital level has become urgent in China. To unify patient identification in examinations from different medical specialties, increase convenient access to medical images under authentication, and make medical images suitable for further artificial intelligence investigations, we implemented an enterprise imaging strategy by adopting an image integration platform as the main tool at Xuanwu Hospital. Workflow re-engineering and business system transformation was also performed to ensure the quality and content of the imaging data. More than 54 million medical images and approximately 1 million medical reports were integrated, and uniform patient identification, images, and report integration were made available to the medical staff and were accessible via a mobile application, which were achieved by implementing the enterprise imaging strategy. However, to integrate all medical images of different specialties at a hospital and ensure that the images and reports are qualified for data mining, some further policy and management measures are still needed.

How hospitals view unit-level nurse turnover data collection: analysis of a hospital survey.

PubMed

Park, Shin Hye; Boyle, Diane K

2015-02-01

The objectives of this study were to examine the quality of unit-level nurse turnover data collection among the National Database of Nursing Quality Indicators hospitals and to identify the burdens of collecting such data. Tracking and managing nurse turnover at the unit level are critical for administrators who determine managerial strategies. Little is known about the quality of and burdens of unit-level turnover data collection. Surveys from 178 hospitals were analyzed descriptively. Most hospitals strongly agreed or agreed with the quality of unit-level turnover data collection. Hospitals identified the burdens of additional time and resources needed for unit-level turnover data collection and the difficulty of obtaining specific reasons for turnover. Collecting unit-level nurse turnover data can be important and useful for administrators to improve nurse retention, workforce stability, and quality of care. We suggest that the advantages of unit-level nurse turnover data and reports can overcome the identified burdens.

A study of antimicrobial use in children admitted to pediatric medicine ward of a tertiary care hospital.

PubMed

Baidya, Sandip; Hazra, Avijit; Datta, Supratim; Das, Amal Kanti

2017-01-01

Antimicrobials are frequently used in tertiary care hospitals. We conducted an observational study on children admitted to a teaching hospital in Eastern India, to generate a profile of antimicrobial use and suspected adverse drug reactions (ADRs) attributable to them. Hospitalized children of either sex, aged between 1 month and 12 years, were studied. Baseline demographic and clinical features, duration of hospital stay, antimicrobials received in hospital along with dosing and indications and details of suspected ADRs attributable to their use were recorded. Every patient was followed up till discharge, admission to the Pediatric Intensive Care Unit, or death. Over the 1 year study period, 332 admissions were screened. The prevalence of antimicrobial use was 79.82%. The majority of the 265 children who received antimicrobials were males (61.10%) and hailed from rural and low socioeconomic background. Median age was 36 months. Six children died, 43 were transferred out, and the rest discharged. In most instances, either 2 (40%) or a single antibiotic (39.6%) was used. Ceftriaxone, co-amoxiclav, amikacin, vancomycin, and ampicillin were predominantly used. Antivirals, antimalarials, and antiprotozoals were used occasionally. Average number of antimicrobials per patient was 2.0 ± 1.27; the majority (84.1%) were by parenteral route and initial choice was usually empirical. Prescriptions were usually in generic name. The antimicrobial treatment ranged between 1 and 34 days, with a median of 7 days. Six ADRs were noted of which half were skin rash and the rest loose stools. The profile of antimicrobial use is broadly similar to earlier Indian studies. Apparent overuse of multiple antimicrobials per prescription and the parenteral route requires exploration. Antimicrobials are being used empirically in the absence of policy. ADRs to antimicrobials are occasional and usually mild. The baseline data can serve in situation analysis for antibiotic prescribing guidelines.

The Role of Tone-Management in Improving Classroom Interaction in a Tertiary-Level EFL Teaching Context.

ERIC Educational Resources Information Center

Rubdy, Rani; Hui, Leng

2003-01-01

Investigates what constitutes effective and ineffective tone management in English-as-a-Foreign-Language classrooms with specific reference to tertiary level context in China. Findings indicate that effective tone management is likely to lead to a more congenial and contingent pattern of classroom interaction, where students become symmetrical…

Clinical predictors of anticipatory emesis in patients treated with chemotherapy at a tertiary care cancer hospital.

PubMed

Qureshi, Fawad; Shafi, Azhar; Ali, Sheeraz; Siddiqui, Neelam

2016-01-01

To determine the clinical predictors of anticipatory emesis in patients treated with chemotherapy at a tertiary care cancer hospital. This was a cross-sectional study conducted on 200 patients undergoing first line chemotherapy with minimum of two cycles at inpatient department and chemotherapy bay of Shaukat Khanum Memorial Cancer Hospital and Research Centre Pakistan. Anticipatory nausea and vomiting develops before administration of chemotherapy. Clinical signs and symptoms in patients with or without anticipatory emesis were compared using chi square test statistics. The mean age of the study participants was 36.68 years (SD±12.23). The mean numbers of chemotherapy cycles administered were 3.23 (SD±1.2). Chemotherapy related nausea and vomiting was experienced by 188 (94%) patients and anticipatory nausea vomiting was reported in 90 (45%) of patients. Greater proportions of patients with anticipatory emesis were females. Fourteen (15.5%) p-value=0.031 patients with anticipatory emesis had history of anxiety and depression. Fifty nine (65.5%) p-value =< 0.0001 patients with anticipatory emesis had severe nausea after last chemotherapy cycle. Forty six (51.11%) p=<0.0001 patients had motion sickness. Female gender, history of motion sickness, anxiety and depression, severe nausea and vomiting experienced in pervious cycle of chemotherapy were clinical predictors of anticipatory nausea and vomiting.

Evaluation of prevalence and risk factors of gestational diabetes in a tertiary care hospital in Kerala.

PubMed

Mohan, Manju A; Chandrakumar, Abin

2016-01-01

The prospective study was conducted with the aim to evaluate the prevalence and risk factors of gestational diabetes mellitus in a tertiary care referral hospital in Kerala. A prospective observational study was conducted with the aim to study the prevalence, risk factors, complications, treatment pattern and cost analysis of GDM. The study was carried out in the Obstetrics & Gynecology dDepartment of Al Shifa hHospital located in northern Kerala. Over an eight-month period, 201 patients who met the inclusion criteria were enrolled for study from which prevalence of GDM was estimated at 15.9%. The study revealed higher prevalence of risk factors and complications such as age >25 years, BMI >26kg/m(2), family history of DM, past history GDM, history of big baby, gestational hypertension, vaginal candidiasis, premature rupture of membranes and hyperbilirubinemia in GDM group as compared to non-GDM group. The study also demonstrated that modern life-style was a major influencing factor for development of diabetes in the study population. The study reveals the necessity of proper screening diagnosis and management of GDM in pregnant women by the clinicians so as to prevent the future burden of type 2 diabetes. Copyright © 2015 Diabetes India. Published by Elsevier Ltd. All rights reserved.

Characteristics and management of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemase in a tertiary hospital.

PubMed

Pang, Feng; Jia, Xiu-Qin; Song, Zhen-Zhu; Li, Yan-Hua; Wang, Bin; Zhao, Qi-Gang; Wang, Chuan-Xin; Zhang, Yi; Wang, Le-Xin

2016-03-01

The emergence of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemases is rare. We report an occurrence of Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemases in a Chinese tertiary care hospital from November 2010 to December 2012. The clinical characteristics of 30 patients were described. The genetic relationship of isolates was determined by pulsed-field gel electrophoresis (PFGE). Carbapenemases were detected by modified Hodge test (MHT) and polymerase chain reactions (PCRs). Amplicons were sequenced and blasted to determine the genotype. Most infected patients were from intensive care unit and had complex and serious underlying illnesses requiring mechanical ventilation. PFGE revealed that Klebsiella pneumoniae showed two major PFGE types. Two Klebsiella oxytoca had an indistinguishable PFGE pattern, while four Enterobacter cloacae were different strains. The sequencing studies showed Enterobacteriaceae harboring IMP-4 or IMP-8 carbapenemase in the 23 infected patients. The majority of patients had infections with the carbapenemase-producing Enterobacteriaceae (CPE) strain, most were successfully treated with a range of antibiotics and discharged. It is important to maintain a high index of suspicion to screen for carbapenemase-producing Enterobacteriaceae strains. Rapid identification of these strains and implementation of stringent procedures are the key to prevent major outbreaks in a hospital setting.

Treatment of Pancreatic and Periampullary Cancers at a Community Hospital: Successful Application of Tertiary Care Treatment Standards

PubMed Central

Moesinger, Robert C.; Davis, Jan W.; Hill, Britani; Johnston, W. Cory; Gray, Carl; Johnson, Harold; Ingersoll, Leslye; Whipple, Gary; Reilly, Mark; Harris, Robert; Hansen, Vincent

2011-01-01

Background. The treatment of pancreatic cancer and other periampullary neoplasms is complex and challenging. Major high-volume cancer centers can provide excellent multidisciplinary care of these patients but almost two-thirds of pancreatic cancer patients are treated at low volume centers. There is very little published data from low volume community cancer programs in regards to the treatment of periampullary cancer. In this study, a review of comprehensive periampullary cancer care at two low volume hospitals with comparison to national standards is presented. Methods. This is a retrospective review of 70 consecutive patients with periampullary neoplasms who underwent surgery over a 5-year period (2006–2010) at two community hospitals. Results. There were 51 successful resections of 70 explorations (73%) including 34 Whipple procedures. Mortality rate was 2.9%. Comparison of these patients to national standards was made in terms of operative mortality, resectability rate, administration of adjuvant therapy, clinical trial participation and overall survival. The results in these patients were comparable to national standards. Conclusions. With adequate commitment of resources and experienced surgical and oncologic practitioners, community cancer centers can meet national tertiary care standards in terms of pancreatic and periampullary cancer care. PMID:22312532

Parents' Perceived Satisfaction of Care, Communication and Environment of the Pediatric Intensive Care Units at a Tertiary Children's Hospital.

PubMed

Abuqamar, Maram; Arabiat, Diana H; Holmes, Sandra

2016-01-01

This study aims to identify parental perceptions on pediatric intensive care-related satisfaction within three domains: environment, child's care provided and communication. In addition, it aims to identify whether parent's socio-demographics and child's clinical variables predict parents' perceived satisfaction. In this study, a total of 123 parents whose child received care in the PICU of a tertiary children's hospital in Amman completed the Arabic version of the parents satisfaction survey (PSS). A cross-sectional, descriptive-correlational design was used to collect data. All data were collected between June and October of 2013. Central tendency measures and percentages of replies for each domain revealed that at least 7 items were rated poorly satisfied. More than half of the parents were not satisfied with the noise level of the PICU, the time nurses spent at the child's bedside, as well as the way the healthcare team prepare them for the child's admission. Almost 90% of the parents believed that the nurses ignored their child's needs by not listening to parents and by responding slowly to child's needs. Stepwise regression analysis showed that that the number of hospital admissions, health insurance and the severity of illness was the main predictor of parents' satisfaction. In conclusion, the availability of health care professionals, the support and the information they share with the child's parents are all significant to parent's satisfaction and hence to better quality of care. Targeting the domains of low satisfaction reported by the parents could increase parent's satisfaction and achieve quality improvement required for this population. Copyright © 2016 Elsevier Inc. All rights reserved.

Comparison of Ramadan-specific education level in patients with diabetes seen at a Primary and a Tertiary care center of Karachi-Pakistan.

PubMed

Masood, Shabeen Naz; Alvi, Syed Faraz Danish; Ahmedani, Muhammad Yakoob; Kiran, Shazia; Zeeshan, Nimra Fatima; Basit, Abdul; Shera, A Samad

2014-01-01

To compare Ramadan-specific education level in fasting patients with diabetes at a Primary and a Tertiary care center. An observational study was conducted in the Outpatient departments of a Primary care center and a Tertiary care center in Karachi-Pakistan. Recruitment of patients started at the end of Ramadan 2011 and continued till three months after Ramadan 2011. All patients with diabetes who observed fast during the month of Ramadan 2011 were included in the study. In Primary care center, patients were attended by physicians only, while at Tertiary care center patients were seen by physicians, diabetes educator and dietician. For data collection, standardized questionnaire based interview was conducted on one to one basis by trained healthcare professionals. Same questionnaire was used at both the centers. A total of 392 and 199 patients with diabetes recruited at Primary and Tertiary care centers, respectively. Ramadan-specific diabetes education received by 213 (55%) and 123 (61.80%) patients with diabetes at Primary and Tertiary care centers, respectively. Compared to Primary care center, patients at Tertiary care centers were more aware about components of Ramadan-specific diabetes education such as signs and symptoms of hypoglycemia and hyperglycemia, dose of medicines/insulin during Ramadan fasting, dose of medicines/insulin when not fasting, self-monitoring of blood glucose, dietary modifications, physical activity, adequate nutrition and adequate hydration during Ramadan (p<0.05). It was observed that Ramadan-specific education level of patients at Tertiary care center was significantly better compared to patients at Primary care center. Copyright © 2014 Diabetes India. Published by Elsevier Ltd. All rights reserved.

Epidemiology of Surgically Managed Mandibular Condylar Fractures at a Tertiary Referral Hospital in Urban Southwest China.

PubMed

Thapa, Swosti; Wang, Jun; Hu, Hong-Tao; Zhang, Fu-Gui; Ji, Ping

2017-01-01

Mandibular condylar fracture is one of the commonest maxillofacial fractures treated by maxillofacial surgeons. Demography of the patients, causation, and characteristics of the fracture depends on various socio-economic factors. Hence, maxillofacial surgeons should be familiar with epidemiology of mandibular condylar fracture. This study retrospectively describes the demography, etiology, fracture characteristics, and hospital utilization of surgically treated mandibular condylar fractures in a tertiary referral hospital in urban China in past five years. Data of all patients who underwent surgical management between 2011 and 2015 were collected. This included aetiology, characteristics of fracture, time, age, sex, associated injuries, and hospital utilization of 166 patients with 208 mandibular condylar fractures. These patients had undergone open reduction and internal fixation with either miniplates or lag screws. Among the fracture of head of mandibular condyle, 21.28% of the patients had the fracture segments removed. These data were statistically analyzed to describe the epidemiology of mandibular condylar fracture. Most of the patients had unilateral mandibular condylar fractures (74.7%). Male patients (76.51%) outnumbered female patients (23.49%) in this cohort. The average age of the patients was 37 years. The fractures were mostly caused by fall from height (60.84%) and were located at the condylar neck (53.61%). Most of the patients had other associated maxillofacial injuries (71.08%) which were mostly located at symphysis and parasymphysis (44.59%). It took 12.58 +/- 0.35 days of hospitalization for the treatment. Fall from height was the most prevalent cause of mandibular condylar injury in mountainous urban China. The people at highest risk were middle-aged men. Mandibular condylar fracture was mostly located at the condylar neck and was usually associated with fracture at the symphysis and parasymphysis.

Prevalence of epilepsy and seizure disorders as causes of apparent life- threatening event (ALTE) in children admitted to a tertiary hospital.

PubMed

Anjos, Alessandra Marques dos; Nunes, Magda Lahorgue

2009-09-01

To determine the prevalence and describe clinical characteristics of seizure disorders and epilepsy as causes of apparent life- threatening event (ALTE) in children admitted at the emergency and followed in a tertiary hospital. Cross-sectional study with prospective data collection using specific guidelines to determine the etiology of ALTE. During the study, 30 (4.2%) children admitted to the hospital had a diagnosis of ALTE. There was a predominance of males (73%) and term infants (70%). Neonatal neurological disorders and neuropsychomotor development delay were found respectively in 13.4% and 10% of the cases. Etiological investigation revealed that 50% of the cases were idiopathic, and 13.4% were caused by epilepsy or seizure disorders. Although all patients had recurrent ALTE events, epilepsy had not been previously suspected. Epilepsy should be included in the differential diagnosis of ALTE, particularly when events are recurrent.

Dengue fever in patients admitted in tertiary care hospitals in Pakistan.

PubMed

Munir, Muhammad Arif; Alam, Syed Ejaz; Khan, Zareef Uddin; Saeed, Quaid; Arif, Ambreen; Iqbal, Rizwan; Saqib, Muhammad Arif Nadeem; Qureshi, Huma

2014-05-01

To assess the gaps in the diagnosis and management of dengue fever cases. The retrospective descriptive analytical study was done with a case record analysis of patients with dengue fever admitted from January to December 2010 at five tertiary care hospitals in different Pakistani cities. Using a questionnaire, information was gathered on demography, haematological profile, management, use of blood and platelet transfusions and the outcome. For comparison, data of serologically-confirmed dengue patients from a private laboratory in Islamabad was collected to see the age, gender and month-wise distribution of cases tested over the same period. SPSS 16 was used for statistical analysis. Out of the 841 confirmed dengue cases, 514 (79%) were males and 139 (21%) females. The overall mean age was 31.3 +/- 14.0 years. Dengue fever was seen in 653 (78%) and dengue haemorrhagic fever (DHF) in 188 (22%) patients. Most cases were between 20 and 49 years of age. A gradual increase in dengue fever and dengue haemorrhagic fever was seen from August, with a peak in October/November. Tourniquet test was done only in 20 (2.3%) cases, out of which 11 (55%) were positive and 9 (45%) were negative. Serial haematocrit was not done in any case. Total deaths were 5 (0.6%). Most cases were seen in October/November with the majority being in the 20-39 age group. Tourniquet test and serial haematocrit were infrequently used. No standard national guidelines were employed.

Quality of acute asthma care in two tertiary hospitals in a state in South Western Nigeria: A report of clinical audit.

PubMed

Desalu, Olufemi Olumuyiwa; Adeoti, Adekunle Olatayo; Ogunmola, Olarinde Jeffrey; Fadare, Joseph Olusesan; Kolawole, Tolutope Fasanmi

2016-01-01

To audit the quality of acute asthma care in two tertiary hospitals in a state in the southwestern region of Nigeria and to compare the clinical practice against the recommendations of the Global Initiative for Asthma (GINA) guideline. We carried out a retrospective analysis of 101 patients who presented with acute exacerbation of asthma to the hospital between November 2010 and October 2015. Majority of the cases were females (66.3%), <45 years of age (60.4%), and admitted in the wet season (64.4%). The median duration of hospital stay was 2 days (interquartile range; 1-3 days) and the mortality was 1.0%. At admission, 73 (72.3%) patients had their triggering factors documented and 33 (32.7%) had their severity assessed. Smoking status, medication adherence, serial oxygen saturation, and peak expiratory flow rate measurement were documented in less than half of the cases, respectively. Seventy-six (75.2%) patients had nebulized salbutamol, 89 (88.1%) had systemic corticosteroid, and 78 (77.2%) had within 1 h. On discharge, 68 (67.3%) patients were given follow-up appointment and 32 (31.7%) were reviewed within 30 days after discharge. Less than half were prescribed an inhaled corticosteroid (ICS), a self-management plan, or had their inhaler technique reviewed or controller medications adjusted. Overall, adherence to the GINA guideline was not satisfactory and was very poor among the medical officers. The quality of acute asthma care in our setting is not satisfactory, and there is a low level of compliance with most recommendations of asthma guidelines. This audit has implicated the need to address the non-performing areas and organizational issues to improve the quality of care.

Incorporating Cross-Cultural Videoconferencing to Enhance Content and Language Integrated Learning (CLIL) at the Tertiary Level

ERIC Educational Resources Information Center

Loranc-Paszylk, Barbara

2016-01-01

This paper attempts to provide evidence of cross-cultural videoconferencing affordances with reference to a Content and Language Integrated Learning (CLIL) context at the tertiary level. At the core of CLIL lie student-centered paradigms of teaching methodologies that invite task and project work and authentic and meaningful communication, while…

A Study of the Transition Pathways of School Level Scholarship Recipients into Work and Tertiary Education

ERIC Educational Resources Information Center

Hobden, Sally; Hobden, Paul

2015-01-01

School-level educational interventions targeting learners from low socioeconomic backgrounds often have the long-term goal of enabling access to, and successful completion of tertiary studies. This study tracked the progress of alumni of an educational intervention two or three years post school, in order to investigate their pathways to their…

Cost of influenza hospitalization at a tertiary care children's hospital and its impact on the cost-benefit analysis of the recommendation for universal influenza immunization in children age 6 to 23 months.

PubMed

Hall, Jennifer L; Katz, Ben Z

2005-12-01

To calculate the costs of influenza hospitalization at a tertiary care children's hospital as the basis of a cost-benefit analysis of the new influenza vaccine recommendation for children age 6 to 23 months. We reviewed the medical records of all patients admitted to Children's Memorial Hospital (CMH) in 2002 diagnosed with influenza. Total hospital costs were obtained from the Business Development Office. Thirty-five charts were analyzed. Both of the 2 patients requiring mechanical ventilation and 4 of 6 patients admitted to the intensive care unit had high-risk underlying medical conditions. Nine children were age 6 to 23 months; 4 of these 9 had no preexisting medical conditions. Had all 18 high-risk children over age 6 months been protected from influenza, approximately $350,000 in hospital charges could have been saved. Preventing the additional 4 hospitalizations in the otherwise low-risk children age 6 to 23 months for whom vaccine is currently recommended would have cost approximately $281,000 ($46/child) more than the hospital charges saved. When all children age 6 to 23 months are considered, influenza vaccination is less costly than other prophylactic measures. Addition of indirect costs, deaths, outpatient costs, and the cost of secondary cases would favor the cost:benefit ratio for influenza vaccination of all children age 6 to 23 months.

Moderating effects of coping on work stress and job performance for nurses in tertiary hospitals: a cross-sectional survey in China.

PubMed

Li, Li; Ai, Hua; Gao, Lei; Zhou, Hao; Liu, Xinyan; Zhang, Zhong; Sun, Tao; Fan, Lihua

2017-06-12

Work stress is a major problem for nurses and it can negatively influence job performance. Therefore, it is critical to explore variables that can reduce or buffer the negative effects of work stress. This study explores the moderating effects of coping strategies on the relationship between work stress and job performance for nurses in China. A cross-sectional survey of 852 nurses from four tertiary hospitals in Heilongjiang Province, China, was conducted in 2013. Descriptive statistics were reported for socioeconomic status and demographic characteristics, level of work stress, coping strategies, and job performance. Regression analysis was conducted to test the interaction between work stress and coping strategies on job performance. Three subscales of work stress were negatively related to job performance. Positive coping strategies moderated Patient Care and job performance while negative coping strategies moderated Workload and Time and performance, and between Working Environment and Resources and performance. Positive coping strategies reduce or buffer the negative effects of work stress on job performance and negative coping strategies increased the negative effects.

A tertiary care-primary care partnership model for medically complex and fragile children and youth with special health care needs.

PubMed

Gordon, John B; Colby, Holly H; Bartelt, Tera; Jablonski, Debra; Krauthoefer, Mary L; Havens, Peter

2007-10-01

To evaluate the impact of a tertiary care center special needs program that partners with families and primary care physicians to ensure seamless inpatient and outpatient care and assist in providing medical homes. Up to 3 years of preenrollment and postenrollment data were compared for patients in the special needs program from July 1, 2002, through June 30, 2005. A tertiary care center pediatric hospital and medical school serving urban and rural patients. A total of 227 of 230 medically complex and fragile children and youth with special needs who had a wide range of chronic disorders and were enrolled in the special needs program. Care coordination provided by a special needs program pediatric nurse case manager with or without a special needs program physician. Preenrollment and postenrollment tertiary care center resource utilization, charges, and payments. A statistically significant decrease was found in the number of hospitalizations, number of hospital days, and tertiary care center charges and payments, and an increase was found in the use of outpatient services. Aggregate data revealed a decrease in hospital days from 7926 to 3831, an increase in clinic visits from 3150 to 5420, and a decrease in tertiary care center payments of $10.7 million. The special needs program budget for fiscal year 2005 had a deficit of $400,000. This tertiary care-primary care partnership model improved health care and reduced costs with relatively modest institutional support.

Organisational reform in healthcare in China: impacts on the social functions of public hospitals.

PubMed

Shi, Guang; O'Rourke, Michael; Liu, Jinfeng; Zhong, Dongbo; Liu, Xiuying; Li, Jing

2003-01-01

Public hospital reform in China since the mid 1980s has had detrimental effects on hospitals' social functions, especially the provision of care for poor people. This study of hospitals in Northern China, using a range of economic measurements, indicated that there has been an overall decline in social functions since 1985, especially in secondary and tertiary level hospitals. Reason for this include the increasingly competitive medical market in China and, under the decentralisation reforms, the imperative for hospitals to generate revenue. We put forward policies to strengthen hospital social functions, including funding for essential packages of services to specifically benefit the poor and vulnerable, and increased government subsidies to support social functions in primary level hospitals where care can be more easily accessed.

Identifying research priorities with nurses at a tertiary children's hospital in the United Kingdom.

PubMed

Williams, A; Sell, D; Oulton, K; Wilson, N; Wray, J; Gibson, F

2017-03-01

The objective of this study was to undertake a research priority setting exercise with the aim of maximizing efficiency and impact in research activity undertaken by nurses at one children's tertiary healthcare institution by ensuring the clinical staff directly shaped a coherent, transparent and consensus driven nurse-led research agenda. In Round 1, the research topics of 147 nurses were elicited using a modified nominal group technique as the consensus method. The number of participants in the 24 separate discussions ranged from 3 to 21, generating lists of between 6 and 23 topics. In Round 2, nurses from the clinical areas ranked topics of importance resulting in a set of four to five priorities. In Round 3, the divisional heads of nursing consulted with staff in all of their clinical areas to each finalize their five divisional priorities. The Nursing Research Working Group discussed and refined the divisions' priorities and voted on the final list to agree the top five research priorities for the organization. A total of 269 research topics were initially generated. Following three rounds of ranking and prioritizing, five priorities were agreed at Divisional level, and from these, the five top organizational priorities were selected. These were (i) understanding and improving all aspects of the patient journey through the hospital system; (ii) play; (iii) staff wellbeing, patient care and productivity; (iv) team work - linking to a more efficient service; and (v) supporting parents/parent pathway. Divisional priorities have been disseminated widely to clinical teams to inform a patient-specific nurse-led research agenda. Organizational priorities agreed upon have been disseminated through management structures and processes to ensure engagement at all levels. A subgroup of the Nursing Research Working Group has been delegated to take this work forward so that the agreed priorities continue to contribute towards shaping nurse-led research activity, thereby

Surveillance of Candida spp Bloodstream Infections: Epidemiological Trends and Risk Factors of Death in Two Mexican Tertiary Care Hospitals

PubMed Central

Corzo-Leon, Dora E.; Alvarado-Matute, Tito; Colombo, Arnaldo L.; Cornejo-Juarez, Patricia; Cortes, Jorge; Echevarria, Juan I.; Guzman-Blanco, Manuel; Macias, Alejandro E.; Nucci, Marcio; Ostrosky-Zeichner, Luis; Ponce-de-Leon, Alfredo; Queiroz-Telles, Flavio; Santolaya, Maria E.; Thompson-Moya, Luis; Tiraboschi, Iris N.; Zurita, Jeannete; Sifuentes-Osornio, Jose

2014-01-01

Introduction Larger populations at risk, broader use of antibiotics and longer hospital stays have impacted on the incidence of Candida sp. bloodstream infections (CBSI). Objective To determine clinical and epidemiologic characteristics of patients with CBSI in two tertiary care reference medical institutions in Mexico City. Design Prospective and observational laboratory-based surveillance study conducted from 07/2008 to 06/2010. Methods All patients with CBSI were included. Identification and antifungal susceptibility were performed using CLSI M27-A3 standard procedures. Frequencies, Mann-Whitney U test or T test were used as needed. Risk factors were determined with multivariable analysis and binary logistic regression analysis. Results CBSI represented 3.8% of nosocomial bloodstream infections. Cumulative incidence was 2.8 per 1000 discharges (incidence rate: 0.38 per 1000 patient-days). C. albicans was the predominant species (46%), followed by C. tropicalis (26%). C. glabrata was isolated from patients with diabetes (50%), and elderly patients. Sixty-four patients (86%) received antifungals. Amphotericin-B deoxycholate (AmBD) was the most commonly used agent (66%). Overall mortality rate reached 46%, and risk factors for death were APACHE II score ≥16 (OR = 6.94, CI95% = 2.34–20.58, p<0.0001), and liver disease (OR = 186.11, CI95% = 7.61–4550.20, p = 0.001). Full susceptibility to fluconazole, AmBD and echinocandins among C. albicans, C. tropicalis, and C. parapsilosis was observed. Conclusions The cumulative incidence rate in these centers was higher than other reports from tertiary care hospitals from Latin America. Knowledge of local epidemiologic patterns permits the design of more specific strategies for prevention and preemptive therapy of CBSI. PMID:24830654

A Changing Paradigm in Language Planning: English-Medium Instruction Policy at the Tertiary Level in Malaysia

ERIC Educational Resources Information Center

Ali, Nor Liza

2013-01-01

The literature shows that English-medium instruction (EMI) programmes at the tertiary level in various parts of the world have positioned EMI as a language-planning tool to promote students' mastery of English. English proficiency is believed to be intertwined with the overall economic development of a country. In addition to internationalising…

Mortality, readmission and length of stay have different relationships using hospital-level versus patient-level data: an example of the ecological fallacy affecting hospital performance indicators.

PubMed

Hofstede, Stefanie N; van Bodegom-Vos, Leti; Kringos, Dionne S; Steyerberg, Ewout; Marang-van de Mheen, Perla J

2018-06-01

Ecological fallacy refers to an erroneous inference about individuals on the basis of findings for the group to which those individuals belong. Suppose analysis of a large database shows that hospitals with a high proportion of long length of stay (LOS) patients also have higher than average in-hospital mortality. This may prompt efforts to reduce mortality among patients with long LOS. But patients with long LOS may not be the ones at higher risk of death. It may be that hospitals with higher mortality (regardless of LOS) also have more long LOS patients-either because of quality problems on both counts or because of unaccounted differences in case mix. To provide more insight how the ecological fallacy influences the evaluation of hospital performance indicators, we assessed whether hospital-level associations between in-hospital mortality, readmission and long LOS reflect patient-level associations. Patient admissions from the Dutch National Medical Registration (2007-2012) for specific diseases (stroke, colorectal carcinoma, heart failure, acute myocardial infarction and hip/knee replacements in patients with osteoarthritis) were analysed, as well as all admissions. Logistic regression analysis was used to assess patient-level associations. Pearson correlation coefficients were used to quantify hospital-level associations. Overall, we observed 2.2% in-hospital mortality, 8.1% readmissions and a mean LOS of 5.9 days among 8 478 884 admissions in 95 hospitals. Of the 10 disease-specific associations tested, 2 were reversed at hospital-level, 3 were consistent and 5 were only significant at either hospital-level or patient-level. A reversed association was found for stroke: patients with long LOS had 58% lower in-hospital mortality (OR 0.42 (95% CI 0.40 to 0.44)), whereas the hospital-level association was reversed (r=0.30, p<0.01). Similar negative patient-level associations were found for each hospital, but LOS varied across hospitals, thereby resulting in a

Emergency and trauma care in Pakistan: a cross-sectional study of healthcare levels

PubMed Central

Razzak, Junaid A; Baqir, Syed M; Khan, Uzma Rahim; Heller, David; Bhatti, Junaid; Hyder, Adnan A

2015-01-01

Background The importance of emergency medical care for the successful functioning of health systems has been increasingly recognised. This study aimed to evaluate emergency and trauma care facilities in four districts of the province of Sindh, Pakistan. Method We conducted a cross-sectional health facility survey in four districts of the province of Sindh in Pakistan using a modified version of WHO’s Guidelines for essential trauma care. 93 public health facilities (81 primary care facilities, nine secondary care hospitals, three tertiary hospitals) and 12 large private hospitals were surveyed. Interviews of healthcare providers and visual inspections of essential equipment and supplies as per guidelines were performed. A total of 141 physicians providing various levels of care were tested for their knowledge of basic emergency care using a validated instrument. Results Only 4 (44%) public secondary, 3 (25%) private secondary hospitals and all three tertiary care hospitals had designated emergency rooms. The majority of primary care health facilities had less than 60% of all essential equipments overall. Most of the secondary level public hospitals (78%) had less than 60% of essential equipments, and none had 80% or more. A fourth of private secondary care facilities and all tertiary care hospitals (n=3; 100%) had 80% or more essential equipments. The average percentage score on the physician knowledge test was 30%. None of the physicians scored above 60% correct responses. Conclusions The study findings demonstrated a gap in both essential equipment and provider knowledge necessary for effective emergency and trauma care. PMID:24157684

Phenotypic Characterization and Antifungal Susceptibility Pattern to Fluconazole in Candida species Isolated from Vulvovaginal Candidiasis in a Tertiary Care Hospital

PubMed Central

Poongothai, G.K; Sinazer, Annie Rofeena; Kannaiyan, Kavitha; Gurumurthy, Hemalatha; Jaget, Nirmala; Kuthalaramalingam, Sethumadhavan

2014-01-01

Background: Vaginal candidiasis is a common gynecological finding among women worldwide. This study was carried out to determine the prevalence of vulvovaginal candidiasis (VVC) along with speciation of Candida with special reference to its antifungal susceptibility pattern to fluconazole and also to evaluate the risk factors responsible for VVC in patients attending our tertiary care hospital in Puducherry, India. Materials and Methods: This study was carried out in the tertiary care hospital in Puducherry during the period of August 2010 to September 2012.The study group consisted of 180 women between the age group of 15 to 56 years with the complaints of excessive vaginal discharge, pruritis and pain. Materials used for this study consisted of high vaginal swabs from patients with relevant history, attending Obstetrics & Gynecology department. High vaginal swabs were subjected to direct 10% KOH wet mount microscopy, Gram stain, culture onto Sabouraud’s dextrose agar (SDA) & 5% sheep blood agar and susceptibility testing to fluconazole was performed using E-test. Results: Candida was isolated in 40 (22.2 %) women & these consisted of C. albicans 26 (65%), C. glabrata 9 (22.5%), C.tropicalis 3 (7.5%) & C. parapsilosis 2 (5%). Susceptibility test carried out on the 40 isolates revealed that 35 (87.5%) Candida isolates were sensitive to fluconazole, 3 (7.5%) were moderately sensitive and 2 (2.5%) were resistant. Thirty one percent patients had itching as the presenting complaints followed by vaginal discharge (29.4%). Conclusion: The high frequency with which C. albicans was recovered in our study and its susceptibility to fluconazole supports the continued use of azole agents for empirical therapy of uncomplicated candidal vulvovaginitis in the community. PMID:24995172

Prevalence and Risk Factors for Peripheral Neuropathy among Type 2 Diabetes Mellitus Patients at a Tertiary Care Hospital in Coastal Karnataka.

PubMed

Gogia, Sonalika; Rao, Chythra R

2017-01-01

In view of the growing burden of type 2 diabetes mellitus (T2DM) globally and associated microvascular and macrovascular complications, the study was done to assess the prevalence and risk factors for diabetic neuropathy among T2DM patients attending a tertiary care hospital. T2DM patients' ≥30 years of both gender, presenting to the Medicine Department at a tertiary care hospital were included in the study. Diabetic Neuropathy Symptom (DNS) questionnaire to assess symptoms and Diabetic Neuropathy Examination (DNE) scoring to assess clinical signs were used. A total of 273 patients were included. The mean age was 57.8 ± 11.5 years. The male to female distribution was 75% (202) and 25% (71), respectively. According to DNS instrument, 41.4% patients scored positive for the presence of neuropathy while only 24.5% had neuropathy according to DNE score. The proportion of males affected by neuropathy was more than females. 43.1% males had a positive DNS score while only 27.2% of them had a positive DNE score. Duration of the disease was positively correlated with neuropathy. Neuropathy was more prevalent among people who had higher systolic and diastolic blood pressure as per DNS and DNE instruments. The present study identified a higher proportion of males to be affected by neuropathy. Hence, more detailed evaluation must be accorded to elderly male diabetic patients with longer duration of the disease. Lifestyle modifications and watchful screening need to be incorporated as part of routine patient health education during follow-up clinic visits.

Awareness of cervical cancer and Pap smear among nursing staff at a rural tertiary care hospital in Central India.

PubMed

Jain, S M; Bagde, M N; Bagde, N D

2016-01-01

Cancer cervix is the leading cause of cancer deaths in females in developing countries and one in five women suffering from cervical cancer lives in India. The aim of this study is to determine the awareness about cervical cancer and Pap smear among nurses working in a tertiary care institute. Study Setting and Design: Cross-sectional survey in a tertiary care institute. Nurses working at our institute excluding those who have worked or working in the Obstetrics and Gynecology department were provided with a pre-designed questionnaire testing their knowledge about cervical cancer. Approximately, 86% were aware about cancer cervix and 69% were aware of a pre-cancerous stage. 42.3% were not aware of any risk factor and 27.6% were not aware of any symptom of cancer cervix. 86.2% were aware about Pap smear, but only 58.6% were aware that facilities of Pap smear were available at our hospital. Knowledge about cervical cancer and awareness of Pap smear as screening test was inadequate in nursing staff. Awareness programs about cervical cancer and screening are needed to increase awareness for this preventable condition. There is a need to arrange reorientation programs to sensitize nurses and establish cytology clinics to offer facilities for easily accessible and affordable screening.

Cost Analysis of Cervical Cancer Patients with Different Medical Payment Modes Based on Gamma Model within a Grade A Tertiary Hospital.

PubMed

Wu, Suo-Wei; Chen, Tong; Pan, Qi; Wei, Liang-Yu; Wang, Qin; Song, Jing-Chen; Li, Chao; Luo, Ji

2018-02-20

Cervical cancer shows a growing incidence and medical cost in recent years that has increased severe financial pressure on patients and medical insurance institutions. This study aimed to investigate the medical economic characteristics of cervical cancer patients with different payment modes within a Grade A tertiary hospital to provide evidence and suggestions for inpatient cost control and to verify the application of Gamma model in medical cost analysis. The basic and cost information of cervical cancer cases within a Grade A tertiary hospital in the year 2011-2016 were collected. The Gamma model was adopted to analyze the differences in each cost item between medical insured patient and uninsured patients. Meanwhile, the marginal means of different cost items were calculated to estimate the influence of payment modes toward different medical cost items among cervical cancer patients in the study. A total of 1321 inpatients with cervical cancer between the 2011 and 2016 were collected through the medical records system. Of the 1321 cases, 65.9% accounted for medical insured patients and 34.1% were uninsured patients. The total inpatient medical expenditure of insured patients was RMB 29,509.1 Yuan and uninsured patients was RMB 22,114.3 Yuan, respectively. Payment modes, therapeutic options as well as the recurrence and metastasis of tumor toward the inpatient medical expenditures between the two groups were statistically significant. To the specifics, drug costs accounted for 37.7% and 33.8% of the total, surgery costs accounted for 21.5% and 25.5%, treatment costs accounted for 18.7% and 16.4%, whereas the costs of imaging and laboratory examinations accounted for 16.4% and 15.2% for the insured patient and uninsured patients, respectively. As the effects of covariates were controlled, the total hospitalization costs, drug costs, treatment costs as well as imaging and laboratory examination costs showed statistical significance. The total hospitalization

Screening for retinopathy of prematurity and treatment outcome in a tertiary hospital in Hong Kong.

PubMed

Iu, L Pl; Lai, C Hy; Fan, M Cy; Wong, I Yh; Lai, J Sm

2017-02-01

Studies on the prevalence and severity of retinopathy of prematurity in the local population are scarce. This study aimed to evaluate the prevalence, screening, and treatment outcome of retinopathy of prematurity in a tertiary hospital in Hong Kong. This cross-sectional study with internal comparison was conducted at Queen Mary Hospital, Hong Kong. The study evaluated 89 premature infants who were born at the hospital and were screened for retinopathy of prematurity, in accordance with the 2008 British Guidelines, between January 2013 and December 2013. The prevalences of retinopathy of prematurity and severe retinopathy requiring treatment were studied. The mean (± standard deviation) gestational age at birth was 30 +2 weeks ± 16.5 days (range, 24 +1 to 35 +5 weeks). The mean birth weight was 1285 g ± 328 g (range, 580 g to 2030 g). A total of 15 (16.9%) infants developed retinopathy of prematurity and three (3.4%) required treatment. In a subgroup analysis of extremely-low-birth-weight infants of <1000 g, 70.6% developed retinopathy of prematurity and 17.6% required treatment. Multivariate logistic regression analysis suggested low birth weight and patent ductus arteriosus were significantly associated with development of retinopathy of prematurity (P<0.001 and P=0.035, respectively). Among the three infants who received treatment for severe retinopathy of prematurity, all regressed successfully after one laser treatment. Retinopathy of prematurity is a significant problem among premature infants in Hong Kong, especially those with extremely low birth weight. Our screening service for retinopathy of prematurity was satisfactory and treatment results were good. Strict adherence to international screening guidelines and vigilance in infants at risk are key to successful management of retinopathy of prematurity.

Distribution and predictors of emergency department charges: the case of a tertiary hospital in Lebanon.

PubMed

Saleh, Shadi; Mourad, Yara; Dimassi, Hani; Hitti, Eveline

2016-03-18

As health care costs continue to increase worldwide, health care systems, and more specifically hospitals are facing continuous pressure to operate more efficiently. One service within the hospital sector whose cost structure has been modestly investigated is the Emergency Department (ED). The study aims to report on the distribution of ED resource use, as expressed in charges, and to determine predictors of/contributors to total ED charges at a major tertiary hospital in Lebanon. The study used data extracted from the ED discharge database for visits between July 31, 2012 and July 31, 2014. Patient visit bills were reported under six major categories: solutions, pharmacy, laboratory, physicians, facility, and radiology. Characteristics of ED visits were summarized according to patient gender, age, acuity score, and disposition. Univariate and multivariate analyses were conducted with total charges as the dependent variable. Findings revealed that the professional fee (40.9 %) followed by facility fee (26.1 %) accounted for the majority of the ED charges. While greater than 80 % of visit charges went to physician and facility fee for low acuity cases, these contributed to only 52 and 54 % of the high acuity presentations where ancillary services and solutions' contribution to the total charges increased. The total charges for males were $14 higher than females; age was a predictor of higher charges with total charges of patients greater than 60 years of age being around $113 higher than ages 0-18 after controlling for all other variables. Understanding the components and determinants of ED charges is essential to developing cost-containment interventions. Institutional modeling of charging patterns can be used to offer price estimates to ED patients who request this information and ultimately help create market competition to drive down costs.

English as a Foreign Language Instructors' Induction: Early Practices of Language Teachers Teaching at Tertiary Level

ERIC Educational Resources Information Center

Ozturk, Mustafa; Yildirim, Ali

2012-01-01

This study aimed to investigate the nature of the induction process of English as a foreign language (EFL) teachers teaching at tertiary level through individual interviews. In order to gather intended data, fifteen novice instructors teaching at four different public universities in Ankara were interviewed on a basis of two criteria: (a) having 1…

Implementation science in low-resource settings: using the interactive systems framework to improve hand hygiene in a tertiary hospital in Ghana.

PubMed

Kallam, Brianne; Pettitt-Schieber, Christie; Owen, Medge; Agyare Asante, Rebecca; Darko, Elizabeth; Ramaswamy, Rohit

2018-05-19

Low-resource clinical settings often face obstacles that challenge the implementation of recommended evidence-based practices (EBPs). Implementation science approaches are useful in identifying barriers and developing strategies to address them. Ridge Regional Hospital (RRH), a tertiary referral hospital in Accra, Ghana experienced a spike in rates of neonatal sepsis and launched a quality improvement (QI) initiative that identified poor adherence to hand hygiene in the neonatal intensive care unit as a potential source of infections. A multi-modal change package of World Health Organization-recommended solutions was created to address this issue. To ensure that the outputs of the QI effort were adopted within the organization, leaders at RRH and Kybele, Inc. used an implementation science framework called the 'Interactive Systems Framework for Dissemination and Implementation' (ISF) to create a package of locally acceptable implementation strategies. The ISF has never been used before to guide implementation in low-resource settings. Hand hygiene compliance rose from 67% to 92% overall, including a 36% increase during the night shifts-a group of healthcare workers with typically very low levels of compliance. The drastic improvement in adherence to hand hygiene suggests the potential value of the joint use of QI and implementation science to promote the creation and application of contextually appropriate EBPs in low-resource settings. Our results also suggest that using an implementation framework such as the ISF could rapidly increase the uptake of other evidence-based interventions in low-resource settings.

Clinical characteristics of hospital-onset Pneumocystis pneumonia and genotypes of Pneumocystis jirovecii in a single tertiary centre in Korea.

PubMed

Kim, Tark; Lee, Sang-Oh; Hong, Hyo-Lim; Lee, Ju Young; Kim, Sung-Han; Choi, Sang-Ho; Kim, Mi-Na; Kim, Yang Soo; Woo, Jun Hee; Sung, Heungsup

2015-02-26

Pneumocystis pneumonia (PCP) may develop as a clinical manifestation of nosocomial pneumonia by means of either reactivation of resident P. jirovecii or de novo infection. However, there have been no studies describing the clinical characteristics of hospital-onset PCP. A retrospective review of medical records was performed to identify episodes of hospital-onset PCP in a tertiary care centre in Korea between May 2007 and January 2013. We investigated whether human-to-human contact during hospitalisation contributed to PCP development by molecular analysis of the genes encoding mitochondrial large ribosomal subunit (mtLSU) rRNA and dihydropteroate synthase (DHPS) and a review of hospitalisation history. During the study period, 129 patients (130 episodes) were diagnosed with PCP. Of these, respiratory specimens from 94 patients during 95 PCP episodes were available for analysis. Sixteen episodes (16.8%) were categorised as hospital-onset PCP. There was a trend toward a higher proportion of haematological malignancy (43.8% [7/16] vs. 20.3% [16/79]; P = 0.058) in patients with hospital-onset PCP compared to patients with community-onset PCP. mtLSU genotype 1 was the most common, occurring in 41 (43.2%) patients. There were four possible cases of nosocomial transmission. Mutation in DHPS was not observed in any PCP episode. PCP can be one of the causes of nosocomial pneumonia, although the mode of acquisition and transmission of P. jirovecii remains uncertain. mtLSU genotype 1 is the predominant P. jirovecii strain in Korea.

Depressive disorder in patients attending the outpatient department of a tertiary care hospital in Colombo.

PubMed

Anandakumar, D; Ratnatunga, S S; Dayabandara, M; Hanwella, Raveen; de Silva, Varuni A

2016-01-01

Lifetime prevalence of depression varies across countries and different populations. Depression is a common comorbidity of physical illness. Patients with depression are known to present with somatic symptoms. Depression is under-diagnosed in primary care settings. Objectives To estimate the prevalence of depression in patients attending the outpatient department (OPD) of a tertiary care hospital in the Western Province of Sri Lanka. A cross-sectional descriptive study was conducted in the OPD of the National Hospital of Sri Lanka (NHSL). Sample size was 205. Every fifth patient aged between 18 and 60 years who attended the OPD was recruited until the required number was met. Centre for Epidemiologic Studies Depression Scale (CES-D) was used to identify depression. There were 114 (55.6%) females. Mean age was 50 years (SD 13.68).Overall prevalence of depression in the sample was 22.4% (95% CI 16.68-28.20). Prevalence of depression was higher among females 25.4% (95% CI 17.32-33.56) than in males 18.7% (95% CI 10.52- 26.84). Prevalence of severe depression was 15.1% (95% CI 10.18-20.07). Adjusted odds ratios showed that pain related presenting complaints were significantly associated with depression [adjusted OR 1.99 (95% CI 1.01-3.96)]. Prevalence of depression in outpatients is similar to that reported in other parts of the world. None of the patients with depression presented seeking help for depressive symptoms.

Hospital workers' perceptions of waste: a qualitative study involving photo-elicitation.

PubMed

Goff, Sarah L; Kleppel, Reva; Lindenauer, Peter K; Rothberg, Michael B

2013-10-01

To elicit sources of waste as viewed by hospital workers. Qualitative study using photo-elicitation, an ethnographic technique for prompting in-depth discussion. U.S. academic tertiary care hospital. Physicians, nurses, pharmacists, administrative support personnel, administrators and respiratory therapists. A purposive sample of personnel at an academic tertiary care hospital was invited to take up to 10 photos of waste. Participants discussed their selections using photos as prompts during in-depth interviews. Transcripts were analysed in an iterative process using grounded theory; open and axial coding was performed, followed by selective and thematic coding to develop major themes and subthemes. Twenty-one participants (nine women, average number of years in field=19.3) took 159 photos. Major themes included types of waste and recommendations to reduce waste. Types of waste comprised four major categories: Time, Materials, Energy and Talent. Participants emphasised time wastage (50% of photos) over other types of waste such as excess utilisation (2.5%). Energy and Talent were novel categories of waste. Recommendations to reduce waste included interventions at the micro-level (eg, individual/ward), meso-level (eg, institution) and macro-level (eg, payor/public policy). The waste hospital workers identified differed from previously described waste both in the types of waste described and the emphasis placed on wasted time. The findings of this study represent a possible need for education of hospital workers about known types of waste, an opportunity to assess the impact of novel types of waste described and an opportunity to intervene to reduce the waste identified.

Workplace violence, job satisfaction, burnout, perceived organisational support and their effects on turnover intention among Chinese nurses in tertiary hospitals: a cross-sectional study.

PubMed

Liu, Wenhui; Zhao, Shihong; Shi, Lei; Zhang, Zhong; Liu, Xinyan; Li, Li; Duan, Xiaojian; Li, Guoqiang; Lou, Fengge; Jia, Xiaoli; Fan, Lihua; Sun, Tao; Ni, Xin

2018-06-09

Our aims were to assess the relationship between workplace violence, job satisfaction, burnout, organisational support and turnover intention, and to explore factors associated with turnover intention among nurses in Chinese tertiary hospitals. The purposive sampling method was used to collect data from August 2016 through January 2017. A total of 1761 nurses from 9 public tertiary hospitals in 4 provinces (municipalities) located in eastern (Beijing), central (Heilongjiang, Anhui) and western (Shaanxi) regions of China completed the questionnaires (effective response rate=85.20%). A cross-sectional study was conducted using the Workplace Violence Scale, Chinese Maslach Burnout Inventory General Survey, Minnesota Job Satisfaction Questionnaire Revised Short Version, Perceived Organizational Support-Simplified Version Scale and Turnover Intention Scale. A total of 1216 of 1706 (69.1%) participants had high turnover intention. During the previous 12 months, the prevalence of physical violence and psychological violence towards nurses was 9.60% and 59.64%, respectively. As expected, the level of turnover intention was negatively correlated with participants' scores on job satisfaction (r=-0.367, p<0.001) and perceived organisational support (r=-0.379, p<0.001), respectively. Burnout was positively associated with turnover intention (r=0.444, p<0.001). Workplace violence was positively associated with turnover intention (β=0.035, p<0.001) in linear regression analysis. The total effect (β=0.53) of workplace violence on turnover intention comprised its direct effect (β=0.36) and its indirect effect (β=0.17). Perceived organisational support served as a mediator between workplace violence, job satisfaction, burnout and turnover intention, and it had a significantly negative impact on turnover intention. Therefore, nursing managers should understand the importance of the organisation's support and establish a reasonable incentive system to decrease turnover intention

The common causes leading to pancytopenia in patients presenting to tertiary care hospital.

PubMed

Das Makheja, Kirpal; Kumar Maheshwari, Bharat; Arain, Shafique; Kumar, Suneel; Kumari, Sangeeta; Vikash

2013-09-01

The objective of this study was to determine the frequency of common causes leading to Pancytopenia in patients presenting to tertiary care hospital at Karachi. A total of 62 patients with the diagnosis of Pancytopenia of more than one week duration were enrolled in the study. All patients underwent a detailed medical history and full physical examination followed by blood sampling for the investigations i.e. complete blood count with peripheral film, erythrocyte sedimentation rate (ESR), Malarial parasites (MP), liver function test, Renal function tests, PT and viral profile (HBsAg, Anti-HCV), Ultrasonography of abdomen. All patients underwent bone marrow aspiration and trephine biopsy for reporting and interpretation. Duration of study was six months, from May 2010 to November 2010. The average age of the patients was 37.76 ± 16.38years. Out of 62 patients, 36 (58%) were male and 26 (42%) were female. Megaloblastic anemia was the commonest cause that was observed in 41.9% cases followed by acute myeloid leukemia 27.4%, aplastic anemia 19.4% and erythroid hyperplasia 11.3%. Conclusion : This study concluded that most common cause of pancytopenia is Megaloblastic anemia, followed by acute myeloid leukemia and aplastic anemia. Bone marrow examination is a single useful investigation which reveals the underlying cause in patients with pancytopenia.

Does gynecologic malignancy predict likelihood of a tertiary palliative care unit hospital admission? A comparison of local, provincial and national death rates.

PubMed

Pilkey, Jana; Demers, Chantale; Chochinov, Harvey; Venkatesan, Nithya

2012-12-01

The purpose of this study was to determine whether the presence of gynecologic malignancies predicts the likelihood of a tertiary palliative care unit hospital admission. In this study, patients admitted to a specialized tertiary palliative care unit (TPCU) with gynecologic malignancies were compared to national and provincial death rates to determine if gynecologic malignancy predicts admission, and subsequent death, in a TPCU. Eighty-two gynecologic cancer patients were admitted to our TPCU over the 5- year study period. Out of all cancer deaths in the TPCU, death from ovarian cancer was 3.7% compared with 2.4% (p = 0.0068) of all cancer deaths in Manitoba and 2.3% (p = 0.0043) of all cancer deaths in Canada. Cervical cancer accounted for 1.7% of all our patients deaths compared with 0.7% (p = 0.0001) provincially and 0.6% (p = 0.0001) nationally. Uterine cancer deaths were not significantly different from the provincial and national death rates, whereas vulvar and fallopian cancers were too rare to allow for statistical analysis. Gynecologic cancers may be predictive of admission to a palliative care unit.

Prescribing pattern of analgesics in orthopedic in-patient department at tertiary care hospital in Guwahati, Assam, Northeast India

PubMed Central

Choudhury, Dwijen Kumar; Bezbaruah, Babul Kumar

2016-01-01

Objectives: The aim of this study is to evaluate the prescribing pattern of analgesics and analyze the rational use of analgesic in orthopedic in-patient department of tertiary care teaching hospital, Guwahati, Assam. Subjects and Methods: An observational and cross-sectional study was carried out for 1 month from April to May 2014. Collected data included age, sex, diagnosis and line of management during the study. The generic name and the average cost of treatment per patient were evaluated using Indian Drug Review, 2014. The prescribed drugs were assessed with respective National Model List of Essential Medicines (NLEM), 2011 and the rationality of prescriptions was determined using the World Health Organization indicators of drug utilization. The patients’ details were recorded in a predeigned data collection form and results were analyzed by descriptive statistics. Results: Out of 200 patients, 123 were male and 77 were female. The average number of analgesic per prescription was 1.46. In this study, 55.5% of patients had received single analgesic. Diclofenac was the most commonly prescribed analgesic (43.49%). During hospitalization, majority of the patients have received parenteral preparation. Gastroprotective agents and antimicrobials were frequently prescribed along with analgesics. Out of 292 analgesics prescribed, 183 (62.67%) were from the NLEM, India. Furthermore, 176 (57.19%) analgesics were prescribed by generic name. The average cost of treatment per patient was 2151.72 INR. Utilization of analgesic in terms of defined daily dose/100 bed-days was 104.01. Conclusion: The percentages of analgesics prescribing from NLEM and the use of analgesic by generic name were found satisfactory. Regular educational interventions to improve prescribing practices among physicians at different levels may further promote rational prescribing. PMID:27756947

High-risk sexual behavior among people living with HIV/AIDS attending tertiary care hospitals in district of Northern India

PubMed Central

Shukla, Mukesh; Agarwal, Monica; Singh, Jai Vir; Tripathi, Anil Kumar; Srivastava, Anand Kumar; Singh, Vijay Kumar

2016-01-01

Context: Prevention with a positive approach has been advocated as one of the main strategies to diminish the new instances of HIV and the target are those who are engaged in high-risk sexual behavior. Therefore, understanding the risky behaviors of the HIV-infected individual is important. Aims: This study aimed to assess the prevalence and the predictors of high-risk sexual behavior among people living with HIV/AIDS (PLHA). Settings and Design: A hospital-based cross-sectional study was conducted at antiretroviral therapy centers of two tertiary care hospitals in Lucknow. Materials and Methods: A total of 322 HIV-positive patients were interviewed about their sexual behaviors during last 3 months using a pretested questionnaire. Statistical Analysis Used: Probability (p) was calculated to test for statistical significance at 5% level of significance. Association between risk factors and high-risk sexual behavior was determined using bivariate analysis followed by multivariate logistic regression. Results: Prevalence of high-risk sexual behavior was 24.5%. Of these patients, multiple sexual partners were reported by 67.3% whereas about 46.9% were engaged in unprotected sex. Multivariate logistic regression analysis revealed that high-risk sexual behavior was significantly associated with nonsupporting attitude of spouse (odds ratio [OR]: 18; 95% confidence interval [CI]: 1.4–225.5; P = 0.02) and alcohol consumption (OR: 9.3; 95% CI: 2.4–35.4; P = 0.001). Conclusions: Specific intervention addressing alcohol consumption and encouragement of spouse and family support should be integrated in the routine HIV/AIDS care and treatment apart from HIV transmission and prevention knowledge. PMID:27190412

Framework of Assessment for the Evaluation of Thinking Skills of Tertiary Level Students

ERIC Educational Resources Information Center

Heng, Chan Swee; Ziguang, Yan

2015-01-01

In the 21st century, students are required to master thinking skills in order to deal with many situations that arise in the tertiary environment which later would translate into the workplace. Nowadays, thinking skills play a vital role in tertiary education. To provide an approach for teachers, this paper identifies a 4-step model that can be…

Determinants and outcome of fetal macrosomia in a Nigerian tertiary hospital.

PubMed

Olokor, Oghenefegor Edwin; Onakewhor, Joseph Ubini; Aderoba, Adeniyi Kolade

2015-01-01

To determine the incidence and risk factors of fetal macrosomia and maternal and perinatal outcome. This was a 1-year prospective case-control study of singleton pregnancies in a Nigerian tertiary hospital. Only women who gave consent were recruited for the study. The maternal and perinatal outcomes in women who delivered macrosomic infants (birth weight ≥ 4000 g) were compared with the next consecutive delivery of normal birth weight (2500-3999 g) infants. The total deliveries for the study period were 2437, of which 135 were macrosomic babies. The incidence of fetal macrosomia was 5.5%. The mean birth weights of macrosomic and nonmacrosomic babies were 4.26 ± 0.29 kg and 3.20 ± 0.38 kg, respectively, P = 0.000. Mothers with macrosomic babies were more likely to be older (P = 0.047), of higher parity (0.001), taller (P = 0.007), and weighed more at delivery (P = 0.000). Previous history of fetal macrosomia (P = 0.000) and maternal diabetes (P = 0.007) were factors strongly associated with the delivery of macrosomic infants. Pregnancies associated with fetal macrosomia had increased duration of labor (P = 0.007), interventional deliveries (P = 0.000), shoulder dystocia, and genital laceration (P = 0.000). There was no significant difference in the incidence of primary postpartum hemorrhage (P = 0.790), birth asphyxia, and perinatal mortality (P = 0.197). Fetal macrosomia is associated with maternal and fetal morbidities. The presence of the observed risk factors should elicit the suspicion of a macrosomic fetus and the need for appropriate management to reduce maternal and fetal morbidities.

Hidden Costs of Hospital Based Delivery from Two Tertiary Hospitals in Western Nepal.

PubMed

Acharya, Jeevan; Kaehler, Nils; Marahatta, Sujan Babu; Mishra, Shiva Raj; Subedi, Sudarshan; Adhikari, Bipin

2016-01-01

Hospital based delivery has been an expensive experience for poor households because of hidden costs which are usually unaccounted in hospital costs. The main aim of this study was to estimate the hidden costs of hospital based delivery and determine the factors associated with the hidden costs. A hospital based cross-sectional study was conducted among 384 post-partum mothers with their husbands/house heads during the discharge time in Manipal Teaching Hospital and Western Regional Hospital, Pokhara, Nepal. A face to face interview with each respondent was conducted using a structured questionnaire. Hidden costs were calculated based on the price rate of the market during the time of the study. The total hidden costs for normal delivery and C-section delivery were 243.4 USD (US Dollar) and 321.6 USD respectively. Of the total maternity care expenditures; higher mean expenditures were found for food & drinking (53.07%), clothes (9.8%) and transport (7.3%). For postpartum women with their husband or house head, the total mean opportunity cost of "days of work loss" were 84.1 USD and 81.9 USD for normal delivery and C-section respectively. Factors such as literate mother (p = 0.007), employed house head (p = 0.011), monthly family income more than 25,000 NRs (Nepalese Rupees) (p = 0.014), private hospital as a place of delivery (p = 0.0001), C-section as a mode of delivery (p = 0.0001), longer duration (>5days) of stay in hospital (p = 0.0001), longer distance (>15km) from house to hospital (p = 0.0001) and longer travel time (>240 minutes) from house to hospital (p = 0.007) showed a significant association with the higher hidden costs (>25000 NRs). Experiences of hidden costs on hospital based delivery and opportunity costs of days of work loss were found high. Several socio-demographic factors, delivery related factors (place and mode of delivery, length of stay, distance from hospital and travel time) were associated with hidden costs. Hidden costs can be a

Incidence & prognosis of acute kidney injury in individuals of snakebite in a tertiary care hospital in India.

PubMed

Pulimaddi, Ramulu; Parveda, Amruth Rao; Brahmanpally, Balkishan; Kalakanda, Paul Marx; Ramakrishna, K; Chinnapaka, Venkata Ramana Devi

2017-12-01

The snakebites are considered to be an occupational hazard in agriculture workers and the snake handlers, resulting in a considerable morbidity, mortality and economical implications. This study was conducted to determine the incidence, clinical presentation, renal injury and clinical outcome in snakebite victims who developed acute kidney injury (AKI). This hospital-based prospective, observational study was done on 100 cases who were admitted for the management of snakebite and found to develop AKI in a tertiary care hospital at Hyderabad, India. Renal function tests, complete blood picture, urine routine examination, ultrasound examination of abdomen and coagulation profile were done and the prognosis was assessed by noting recovery, mortality, morbidity and/or progress to chronic stage. A total of 100 patients with a mean age of 43.80±12.63 yr (range 18-70); 62 males and 38 females were studied. All had bites on lower limbs. A total of 86 patients arrived in the hospital within 24 h, and 14 arrived after 24 h. Oliguria was found in 60, bleeding tendencies in 64, haemodynamic instability noted - tachycardia in 86. Systolic blood pressure (BP) was <120 mm Hg in 68 and BP was not recordable in four patients. Twelve patients were in stage III kidney disease and needed haemodialysis. Of the 100 cases of snakebite-induced acute kidney failure, 86 recovered and six died. On follow up, after six months eight patients developed chronic kidney failure. A cascade of events tends to occur in severe haemotoxic envenomation such as bleeding disorders, hypotension/circulatory shock, intravascular haemolysis, disseminated intravascular coagulation and acute respiratory disease syndrome (ARDS). The findings of this study showed that early hospitalization, quick antisnake venom administration and adequate supporting care provided promising results.

Analysis of association between type of amblyopia and gender at a tertiary care hospital in Karachi.

PubMed

Siddiqui, Abdul Hameed; Raza, Syed Akhtar; Ghazipura, Arifa; Hussain, Muhammad Azhar; Iqbal, Sarwat; Ahsan, Kamran; Nadeem, Adnan

2016-05-01

To analyse the frequency of different types of amblyopia and its association with gender. The cross-sectional study was conducted from March 2014 to October 2014 at the Department of Ophthalmology of a tertiary care hospital inKarachi. The patients were classified into different types of amblyopia like anisometropic, strabismic, sensory deprivation and meridional amblyopia. Stratification was done according to age, gender and type of amblyopia by using SPSS version 21. Out of 130 patients, 71 were male and 59 were female. The amblyopia rate determined was anisometropic 69.23%, strabismic amblyopia 21.51% and others 9.23%. The mean age of subjects was 18.02±9 years. Type of amblyopia was independent of gender, and anisometropic amblyopia was the most common type of amblyopia found in both genders. This study found no significant association between gender and types of amblyopia and anisometropic amblyopia was the most common type of amblyopia in the data collected.

HIV counseling and testing in a tertiary care hospital in Ganjam district, Odisha, India.

PubMed

Dash, M; Padhi, S; Sahu, S; Mohanty, I; Panda, P; Parida, B; Sahoo, M K

2013-01-01

Human immunodeficiency virus (HIV) counseling and testing (HCT) conducted at integrated counseling and testing centers (ICTCs) is an entry point, cost-effective intervention in preventing transmission of HIV. To study the prevalence of HIV among ICTC attendees, sociodemographic characteristics, and risk behaviors of HIV-seropositive clients. It was hospital record-based cross-sectional study of 26,518 registered ICTC clients at a tertiary care hospital in Ganjam district, Odisha, India over a 4-year period from January 2009 to September 2012. A total of 1732 (7.5%) out of 22,897 who were tested for HIV were seropositive. Among HIV-seropositives, 1138 (65.7%) were males, while 594 (34.3%) were females. Majority (88.3%) of seropositives were between the age group of 15-49 years. Client-initiated HIV testing (12.1%) was more seropositive compared to provider-initiated (2.9%). Among discordant couples, majority (95.5%) were male partner/husband positive and female partner/wife negative. Positives were more amongst married, less educated, low socioeconomic status, and outmigrants (P<0.0001). Risk factors included heterosexual promiscuous (89.3%), parent-to-child transmission 5.8%, unknown 3.1%, infected blood transfusion 0.8%, homosexual 0.5%, and infected needles (0.5%). There is need to encourage activities that promote HCT in all health facilities. This will increase the diagnosis of new HIV cases. The data generated in ICTC provide an important clue to understand the epidemiology in a particular geographic region and local planning for care and treatment of those infected with HIV and preventive strategies for those at risk especially married, young adults, and outmigrants to reduce new infections.

HBV and HIV co-infection: Prevalence and clinical outcomes in tertiary care hospital Malaysia.

PubMed

Akhtar, Ali; Khan, Amer Hayat; Sulaiman, Syed Azhar Syed; Soo, Chow Ting; Khan, Kashifullah

2016-03-01

According to WHO, Malaysia has been classified as a concentrated epidemic country due to progression of HIV infection in the population of injecting drug users. The main objectives of current study are to determine the prevalence of HBV among HIV-positive individuals in a tertiary care hospital of Malaysia and to assess the predictors involved in the outcomes of HIV-HBV co-infected patients. A retrospective, cross-sectional study is conducted at Hospital Palau Pinang, Malaysia. The collection of socio-demographic data as well as clinical data is done with the help of data collection form. Data were analyzed after putting the collected values of required data by using statistical software SPSS version 20.0 and P > 0.05 is considered as significant. Results show that the overall prevalence of HBV was 86 (13%) including 495 (74.5%) males and 169 (25.5%) females among a total of 664 HIV-infected patients. It was observed that there is a high prevalence of HIV-HBV co-infection in males 76 (11.4%) as compared to females 10 (1.5%) (P = 0.002). The median age of the study population was 39 years. The statistical significant risk factors involved in the outcomes of HIV-HBV co-infected patients were observed in the variables of gender, age groups, and injecting drug users. The findings of the present study shows that the prevalence of HBV infection among HIV-positive patients was 13% and the risk factors involved in the outcomes of HIV-HBV co-infected patients were gender, age, and intravenous drug users. © 2015 Wiley Periodicals, Inc.

Surgical therapies for corneal perforations: 10 years of cases in a tertiary referral hospital

PubMed Central

Yokogawa, Hideaki; Kobayashi, Akira; Yamazaki, Natsuko; Masaki, Toshinori; Sugiyama, Kazuhisa

2014-01-01

Purpose To report surgical therapies for corneal perforations in a tertiary referral hospital. Methods Thirty-one eyes of 31 patients (aged 62.4±18.3 years) with surgically treated corneal perforations from January 2002 to July 2013 were included in this study. Demographic data such as cause of corneal perforation, surgical procedures, and visual outcomes were retrospectively analyzed. Results The causes of corneal perforation (n=31) were divided into infectious (n=8, 26%) and noninfectious (n=23, 74%) categories. Infectious causes included fungal ulcer, herpetic stromal necrotizing keratitis, and bacterial ulcer. The causes of noninfectious keratopathy included corneal melting after removal of a metal foreign body, severe dry eye, lagophthalmos, canaliculitis, the oral anticancer drug S-1, keratoconus, rheumatoid arthritis, neurotrophic ulcer, atopic keratoconjunctivitis, and unknown causes. Initial surgical procedures included central large corneal graft (n=17), small corneal graft (n=7), and amniotic membrane transplantation (n=7). In two cases the perforation could not be sealed during the first surgical treatment and required subsequent procedures. All infectious keratitis required central large penetrating keratoplasty to obtain anatomical cure. In contrast, several surgical options were used for the treatment of noninfectious keratitis. After surgical treatment, anatomical cure was obtained in all cases. Mean postoperative best corrected visual acuity was better at 6 months (logMAR 1.3) than preoperatively (logMAR 1.8). Conclusion Surgical therapies for corneal perforations in our hospital included central large lamellar/penetrating keratoplasty, small peripheral patch graft, and amniotic membrane transplantation. All treatments were effective. Corneal perforation due to the oral anticancer drug S-1 is newly reported. PMID:25378903

Time to presentation, pattern and immediate health effects of alleged child sexual abuse at two tertiary hospitals in Addis Ababa, Ethiopia

PubMed Central

2014-01-01

Background Children are vulnerable to abuse and violence because their level of development makes them unable to protect themselves. Such adversities during early childhood may have a negative impact on the future lives of the victims. This study was done to determine the delay to hospital presentation, clinical manifestations and immediate health effects of child sexual abuse in two tertiary care hospitals in Ethiopia. Methods We reviewed records of all cases of child sexual and physical abuse between January 2011 and December 2012. Bivariate and multivariate logistic regression models were used to test the presence and strength of association between time to reporting to hospital and, age and sex of the victim, place of residence and relation of the victim to the perpetrator. Odds ratio and 95% confidence intervals were generated. Significance was taken as p-value < 0.05. Results During the study period, we identified records of 275 children who were seen for alleged physical and sexual abuse; they accounted for 0.6% of the outpatient department (OPD) visits. The majority of the victims were cases of sexual abuse (97.3%) and most of them were female (75.7%). The mean age of the victims was 9.5 years (standard deviation (SD) = 4.2 years). The majority of the abusers were known to the victim (73.0%) and male (98.8%). Neighbors (38.95%), teachers (7.9%) and relatives (13.4%) were the most commonly reported perpetrators. The median length of time taken to present to hospital after the abuse incident was 4 days (range = 2 hours to 3 years). Male victims were 2.4 times more likely to have a delay of greater than one week to present to hospital (Adjusted Odds Ratio (AOR), 2.40; 95% Confidence interval (CI), 1.34-4.31; P-value = 0.002). Sexual abuse was associated with various immediate health effects, for example, hymenal tear, urinary tract infection and, perineal laceration or tear. Conclusion Presentation for care was often delayed. Male sex was

Level of adherence to ocular hypotensive agents and its determinant factors among glaucoma patients in Menelik II Referral Hospital, Ethiopia.

PubMed

Mehari, Tesfay; Giorgis, Abeba T; Shibeshi, Workineh

2016-08-02

Good adherence to ocular hypotensive agents is important to control intraocular pressure and hence to prevent progressive glaucomatous optic nerve head damage. Periodic investigation of adherence is crucial in glaucoma treatment. The purpose of this study was to assess level of adherence to ocular hypotensive agents and to identify factors affecting adherence among glaucoma patients at a tertiary public eye care center. The study was a hospital-based cross-sectional study that was conducted in Menelik II Referral Hospital from June 1, 2015 to July 31, 2015. A systematic random sampling technique was used to select 359 study participants from the source population. The study patients were interviewed and their medical charts were reviewed using a pretested structured questionnaire. Adherence was assessed using Morisky Medication Adherence Scale - 8 and adherence determinant factors were identified using multivariate binary logistic regression analysis. The association was declared statistically significant at p < 0.05. Among the 359 study glaucoma patients, 42.6 % were adherent to their prescribed hypotensive agents. Higher educational level (AOR = 4.60, 95 % CI: 1.01-21.03, p < 0.049), being self - employed (AOR = 6.14, 95 % CI: 1.37-27.50, p < 0.018) and taking lesser frequency of drops (AOR = 2.89, 95 % CI: 1.25-6.66, p < 0.013) were significantly associated with adherence, whereas being a farmer (AOR = 0.07, 95 % CI: 0.01-0.75, p < 0.028), having very low monthly family income (AOR = 0.22, 95 % CI: 0.06-0.77, p < 0.019) and self - purchasing of medications (AOR = 0.30, 95 % CI: 0.10-0.93, p < 0.036) were significantly associated with non-adherence. The study has identified the adherence level to the prescribed ocular hypotensive agents to be sub-optimal and is influenced by different factors among glaucoma patients of the public tertiary center. We recommend glaucoma care providers to pay due attention

Customer satisfaction survey with clinical laboratory and phlebotomy services at a tertiary care unit level.

PubMed

Koh, Young Rae; Kim, Shine Young; Kim, In Suk; Chang, Chulhun L; Lee, Eun Yup; Son, Han Chul; Kim, Hyung Hoi

2014-09-01

We performed customer satisfaction surveys for physicians and nurses regarding clinical laboratory services, and for outpatients who used phlebotomy services at a tertiary care unit level to evaluate our clinical laboratory and phlebotomy services. Thus, we wish to share our experiences with the customer satisfaction survey for clinical laboratory and phlebotomy services. Board members of our laboratory designed a study procedure and study population, and developed two types of questionnaire. A satisfaction survey for clinical laboratory services was conducted with 370 physicians and 125 nurses by using an online or paper questionnaire. The satisfaction survey for phlebotomy services was performed with 347 outpatients who received phlebotomy services by using computer-aided interviews. Mean satisfaction scores of physicians and nurses was 58.1, while outpatients' satisfaction score was 70.5. We identified several dissatisfactions with our clinical laboratory and phlebotomy services. First, physicians and nurses were most dissatisfied with the specimen collection and delivery process. Second, physicians and nurses were dissatisfied with phlebotomy services. Third, molecular genetic and cytogenetic tests were found more expensive than other tests. This study is significant in that it describes the first reference survey that offers a survey procedure and questionnaire to assess customer satisfaction with clinical laboratory and phlebotomy services at a tertiary care unit level.

Customer Satisfaction Survey With Clinical Laboratory and Phlebotomy Services at a Tertiary Care Unit Level

PubMed Central

Koh, Young Rae; Kim, Shine Young; Kim, In Suk; Chang, Chulhun L.; Lee, Eun Yup; Son, Han Chul

2014-01-01

We performed customer satisfaction surveys for physicians and nurses regarding clinical laboratory services, and for outpatients who used phlebotomy services at a tertiary care unit level to evaluate our clinical laboratory and phlebotomy services. Thus, we wish to share our experiences with the customer satisfaction survey for clinical laboratory and phlebotomy services. Board members of our laboratory designed a study procedure and study population, and developed two types of questionnaire. A satisfaction survey for clinical laboratory services was conducted with 370 physicians and 125 nurses by using an online or paper questionnaire. The satisfaction survey for phlebotomy services was performed with 347 outpatients who received phlebotomy services by using computer-aided interviews. Mean satisfaction scores of physicians and nurses was 58.1, while outpatients' satisfaction score was 70.5. We identified several dissatisfactions with our clinical laboratory and phlebotomy services. First, physicians and nurses were most dissatisfied with the specimen collection and delivery process. Second, physicians and nurses were dissatisfied with phlebotomy services. Third, molecular genetic and cytogenetic tests were found more expensive than other tests. This study is significant in that it describes the first reference survey that offers a survey procedure and questionnaire to assess customer satisfaction with clinical laboratory and phlebotomy services at a tertiary care unit level. PMID:25187892

Steroid profiling for congenital adrenal hyperplasia by tandem mass spectrometry as a second-tier test reduces follow-up burdens in a tertiary care hospital: a retrospective and prospective evaluation.

PubMed

Seo, Ja Young; Park, Hyung-Doo; Kim, Jong Won; Oh, Hyeon Ju; Yang, Jeong Soo; Chang, Yun Sil; Park, Won Soon; Lee, Soo-Youn

2014-01-01

Newborn screening for congenital adrenal hyperplasia (CAH) based on measuring 17-hydroxyprogesterone (17-OHP) by immunoassay generates a number of false-positive results, especially in preterm neonates. We applied steroid profiling by using liquid chromatography-tandem mass spectrometry (LC-MS/MS) as a second-tier test in newborns with positive CAH screening and evaluated its clinical utility in a tertiary care hospital setting. By performing a 4-year retrospective data review, we were able to test 121 dried blood spots from newborns with positive CAH screening for 17-OHP, androstenedione and cortisol levels by LC-MS/MS. We prospectively evaluated the clinical utility of steroid profiling after the implementation of steroid profiling as a second-tier test in our routine clinical practice. During the 2-year prospective study period, 104 cases with positive initial screening by FIA were tested by LC-MS/MS. Clinical and laboratory follow-up were performed for at least 6 months. The preterm neonates accounted for 50.7% (76/150) and 70.4% (88/125) of screening-positive cases in retrospective and prospective cohorts, respectively. By applying steroid profiling as a second-tier test for positive CAH screening, we eliminated all false-positive results and decreased the median follow-up time from 75 to 8 days. Our data showed that steroid profiling reduced the burden of follow-up exams by improving the positive predictive value of the CAH screening program. The use of steroid profiling as a second-tier test for positive CAH screening will improve clinical practice particularly in a tertiary care hospital setting where positive CAH screening from preterm neonates is frequently encountered.

Associations between Psychosocial Aspects of English Classroom Environments and Motivation Types of Chinese Tertiary-Level English Majors

ERIC Educational Resources Information Center

Bi, Xuefei

2015-01-01

This study involved whether psychosocial aspects of English classroom environments had associations with the English learning motivation types of Chinese tertiary-level English majors based on a case study of approximate 1,000 English majors in their first 2 years at one of the key universities located in South China. Canonical correlation…

Information and Communications Technology Use as a Catalyst for the Professional Development: Perceptions of Tertiary Level Faculty

ERIC Educational Resources Information Center

Meiki, Antoine; Nicolas, Maureen; Khairallah, Megan; Adra, Omar

2017-01-01

This study highlights the impact technology can have on the teaching-learning environment to the point of influencing and altering the educational ecosystem. A 5-point Likert scale was designed to elicit tertiary level instructors' attitudes regarding the use of ICT in their professional lives at an institution of higher education in North…

Hospital burden of road traffic injury: major concern in primary and secondary level hospitals in Bangladesh.

PubMed

Mashreky, S R; Rahman, A; Khan, T F; Faruque, M; Svanström, L; Rahman, F

2010-04-01

To assess the burden of road traffic injury (RTI) in primary and secondary level hospitals in Bangladesh, and its economic impact on affected families. Cross-sectional study. The study was carried out in February and March 2001. To estimate the burden of RTI patients and the length of stay in hospital, the discharge records of primary and secondary level hospitals were used as data sources. Records from 16 district hospitals and 45 Upazila health complexes (subdistrict level hospitals), selected at random, were included in this study. A direct interview method was adopted to estimate the patient costs of RTI; this involved interviewing patients or their attendants. In this study, patient costs included money spent by the patient for medicine, transport, food and lodging (including attendants). Approximately 33% of the beds in primary and secondary level hospitals in Bangladesh were occupied by injury-related patients, and more than 19% of the injury patients had been injured in a road traffic accident. People aged 18-45 years were the major victims of RTI, and constituted 70% of the total RTI-related admissions in primary and secondary level hospitals. More than two-thirds of RTI patients were male. The average duration of hospital stay was 5.7 days, and the average patient cost for each RTI patient was US$86 (5834 BDT). RTI is a major cause of hospital admission in Bangladesh, and represents an economic and social burden for the family and the nation. A national strategy and road safety programme need to be developed to reduce the hospital burden and minimize the economic and social impact. 2010 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

Antibiotic Susceptibility Patterns of Bacterial Isolates from Pus Samples in a Tertiary Care Hospital of Punjab, India

PubMed Central

Trojan, Rugira; Razdan, Lovely

2016-01-01

We determined the prevalence and antibiotic susceptibilities patterns of bacterial isolates from pus samples collected from patients in a tertiary care hospital of Punjab, India. E. coli was the most prevalent pathogen (51.2%) followed by Staphylococcus aureus (21%), Klebsiella pneumoniae (11.6%), Pseudomonas aeruginosa (5.8%), Citrobacter spp. (3.5%), Acinetobacter baumannii (2.3%), Proteus mirabilis (2.3%), and Streptococcus spp. (2.3%). E. coli, K. pneumoniae, A. baumannii, and Citrobacter isolates were resistant to multiple antibiotics including higher generation cephalosporins. S. aureus and Streptococcus isolates were sensitive to cloxacillin and vancomycin. However, P. aeruginosa, P. mirabilis, and Streptococcus isolates were found to be less resistant to the spectrum of antibiotics tested. Overall, our findings indicate the prevalence of resistance to different classes of antibiotics in bacterial isolates from pus infections and hence highlight the need for effective surveillance, regulator reporting, and antibiogram-guided antibiotic prescription. PMID:27872643

Antibiotic Susceptibility Patterns of Bacterial Isolates from Pus Samples in a Tertiary Care Hospital of Punjab, India.

PubMed

Trojan, Rugira; Razdan, Lovely; Singh, Nasib

2016-01-01

We determined the prevalence and antibiotic susceptibilities patterns of bacterial isolates from pus samples collected from patients in a tertiary care hospital of Punjab, India. E. coli was the most prevalent pathogen (51.2%) followed by Staphylococcus aureus (21%), Klebsiella pneumoniae (11.6%), Pseudomonas aeruginosa (5.8%), Citrobacte r spp. (3.5%), Acinetobacter baumannii (2.3%), Proteus mirabilis (2.3%), and Streptococcus spp. (2.3%). E. coli , K. pneumoniae , A. baumannii , and Citrobacter isolates were resistant to multiple antibiotics including higher generation cephalosporins. S. aureus and Streptococcus isolates were sensitive to cloxacillin and vancomycin. However, P. aeruginosa , P. mirabilis , and Streptococcus isolates were found to be less resistant to the spectrum of antibiotics tested. Overall, our findings indicate the prevalence of resistance to different classes of antibiotics in bacterial isolates from pus infections and hence highlight the need for effective surveillance, regulator reporting, and antibiogram-guided antibiotic prescription.

Perceptions and concerns of women undergoing Pap smear examination in a tertiary care hospital of India.

PubMed

Tiwari, A; Kishore, J; Tiwari, A

2011-01-01

Cervical cancer is one of the major causes of deaths due to cancer among women in India. Pap smear is one of the best methods to detect early changes in cervix. However, there is lack of data on awareness level of women about Pap smear and various risk factors for cervical cancer. To study the awareness about various risk factors for cervical cancer, health-seeking behavior and hygienic practices among women and to assess the distress experienced by these women before the Pap smear examination. This cross-sectional study was carried out on women coming for a Pap smear examination in a tertiary teaching hospital in New Delhi. A pretested interview schedule was used to get information after obtaining their informed consent. Fifty-seven percent stated that they did not consult a doctor when they noticed the symptoms the first time. Sixty-one percent did not know what a cervical cancer is and a same percentage of women did not know what a Pap smear examination was. Older age group, Muslim and literate women had higher number of abnormal Pap smear results. Women who reported being stressed in their lives had higher number of abnormal smears as compared to women who claimed to lead a stress free life. Poor hygienic practices among these women from urban areas were also associated with abnormal Pap smear results. The study concluded that factors such as poor awareness, shyness, poor hygiene, and old age could be responsible for abnormal Pap smears and this needs special attention in cancer prevention activities of the government.

Changing Trends of Skin Cancer: A Tertiary Care Hospital Study in Malwa Region of Punjab.

PubMed

Lal, Sonal Tina; Banipal, Raja Paramjeet Singh; Bhatti, Deepak John; Yadav, Hanuman Prasad

2016-06-01

Skin cancer constitutes a small but significant proportion of patients with cancer. Although the presence of eumelanin in dark skin is protective against the development of skin cancer, it is increasingly being diagnosed in the Indian population. To study the profile of skin cancer patients presenting to a tertiary hospital in Malwa area of Punjab, India. Retrospective study was done to analyse the profile of skin cancer patients who attended the institution over one year from 1(st) December 2013 to 30(th) November 2014. A comprehensive review of aetiology and related risk factors was done to correlate the environmental factors with high skin cancer prevalence in this region. Skin cancer constituted (3.18%) 84 out of 2638 patients registered with cancer of all types. The age of the patients was 62±14.2 years and ranged from 27 to 92 yrs. Basal cell carcinoma (BCC) was the most common histological type(46/84, 54.76%) followed by squamous cell carcinoma (SCC) (31/84, 36.91%) and malignant melanoma (MM) (7/84, 8.33%). Male: female ratio was found to be 0.79:1. BCC showed higher female preponderance (p<0.05). Head and Neck was the commonest site involved (p<0.05). Majority (88%) of patients were from rural area. 92% of patients were directly into the profession of agriculture with history of prolonged exposure to sunlight. Skin cancer constitutes a small but significant proportion of patients with cancers. This study highlights a paradoxically increasing trend of BCC and female preponderance. Head and neck is the most common site involved. Exposure to Ultra Violet B (UVB) radiation and higher levels of arsenic in drinking water has been reported to be associated with skin cancers. Limited studies show that levels of arsenic and pesticides were higher in the samples of drinking water in Malwa area of Punjab. Therefore a multipronged strategy to provide safe drinking water supply and discouraging the indiscriminate use of pesticides is recommended.

Study of Incidence and Prevalence of Musculoskeletal Anomalies in a Tertiary Care Hospital of Eastern India

PubMed Central

Mohanty, Biswa Bhusan; Sarangi, Rachita; Kumar, Sanjay; Mahapatra, Susanta Kumar; Chinara, Prafulla Kumar

2014-01-01

Introduction: Congenital anomalies or malformations are anatomical. Structural or functional defects present at birth leads to physical and mental disabilities. With the advent of newer drugs, infectious diseases have taken the backseat and congenital defects have emerged as an important cause of neonatal morbidity and mortality. In India, anomalies of musculoskeletal system have been most commonly reported. Aims and Objectives: With this in view, the present study was carried out to find the incidence and types of musculoskeletal defects in a tertiary care hospital in Eastern India. Various maternal factors were also correlated and analyzed. The purpose of this communication is to report these defects so as to help doctors and parents to prevent unexpected fetal loss and better parental counseling. Materials and Methods: This study was done in the Department of Obstetrics and Gynaecology in association with Department of Paediatrics of a tertiary care hospital in Odisha from for a period of 1 year. The newborns were examined within 1st three days of delivery for congenital malformations. The study group included all live borns along with still borns after 28 weeks of gestation or those dead babies whose weight was about 1kg. A thorough physical examination from head to toe was done to look for musculoskeletal defects within 24hrs of delivery. Observation and Results: Out of total 7268 babies delivered, 116 babies were found to have anomalies. Thirty two of these had musculoskeletal defects. Talipes equinovarus was the commonest anomaly observed followed by polydactyly. The ratio of male babies with musculoskeletal defects to female babies was found to be 1.28:1.The malformed babies were mainly born to term mothers (77.6%), who were mostly unbooked (62.5%) and belonged to lower or middle class. But no significant relationship could be established between these factors and defects. Most mothers were in the age group of 20-35 years and there was no history of drug

[Economic mechanisms in decreasing the level of hospitalizations].

PubMed

Kadyrov, F N

1997-01-01

Increase of the role of primary health care and decrease of hospitalizations is a pressing medical and economic problem. However, rather often it is beneficial for a medical institution to hospitalize a patient. In order to create stimuli for decreasing the level of hospitalization, medical institutions are to have a share in the economy due to non-hospitalization. Proper validation of the share of the resultant economy is needed to realize this principle.

Prevalence and risk factors of hepatitis D virus infection in patients with chronic hepatitis B infection attending the three main tertiary hospitals in Libya.

PubMed

Elzouki, Abdel-Naser; Bashir, Saleh M; Elahmer, Omar; Elzouki, Islam; Alkhattali, Fathi

2017-12-01

Globally, More than 350 million individuals are chronically infected with hepatitis B virus (HBV), and >20 million of them are co-infected with hepatitis D virus (HDV). The aim of this study was to determine the pattern of HDV infection in patients with chronic hepatitis B in three main tertiary hospitals in Tripoli and Benghazi, Libya. This cross sectional and descriptive study was conducted on 162 patients with chronic hepatitis B positive for more than six months) who were followed up at hepatitis clinics of the three main tertiary hospitals in Tripoli city (88 patients from Tripoli Medical Centre and Tripoli Central Hospital) and Benghazi city (74 patients from Aljomhoria Hospital) during the period from January 2010 to June 2012. HBV and HDV markers were detected by enzyme linked fluorescent assay (ELFA) or enzyme-linked immunosorbent assay and HBV-DNA was quantified by real-time PCR techniques. The mean age of patients was 36,92 ± 15,35. One hundred and three (63.6%) of them were males and 59 (36,4%) were females. Four patients (2,5%) were tested positive for anti-HD antibodies, all of them have had clinical and/or histological diagnosis of cirrhosis. In multivariable regression analysis, age (p = .04), elevation of serum ALT (p = .03), elevation of serum AST (p = .04), and presence of cirrhosis (p = .003) were significantly related to HDV seropositivity. Although the study demonstrated that Libya has low to moderate prevalence of HDV (2,5%), it is important for policy makers and health care providers to continue the preventive measures for HDV spread, and HBV prevention program including utilization of HBV vaccine. Furthermore, it is imperative to screen chronic HBV patients for HDV for close observation for early diagnosis of subsequent development of liver cirrhosis. Moreover, further epidemiologic and genetic studies are needed to explore the trend for HDV infection in Libya. Copyright © 2017 Pan-Arab Association of Gastroenterology

The Effect of Using Concept Maps on Student Achievement in Selected Topics in Chemistry at Tertiary Level

ERIC Educational Resources Information Center

Singh, Indra Sen; Moono, Karren

2015-01-01

The performance in chemistry at tertiary level in Zambia has not been as expected. It has therefore been a matter of concern. There has been a continuous focus on exploring new teaching strategies to improve the understanding of this difficult subject. This study investigated the effectiveness of composite use of concept maps and traditional…

A Survey on the Levels of Questioning of ELT: A Case Study in an Indonesian Tertiary Education

ERIC Educational Resources Information Center

Ashadi, Rido Imam; Lubis, Nazriani

2017-01-01

This present study focused on examining the levels of questions in Indonesia tertiary education. A survey research was conducted in one of the private universities in North Sumatra. The English summative assessment in an undergraduate education was used as target of survey. There were a collection of questions that had been administered by four…

"Digitize Me": Generating E-Learning Profiles for Media and Communication Students in a Jamaican Tertiary-Level Institution

ERIC Educational Resources Information Center

Stewart-McKoy, Michelle A.

2014-01-01

The purpose of this project was to develop an e-learning profile for a group of media and communication students enrolled in a Jamaican tertiary-level institution in order to make informed decisions most the appropriate [online] learning complement for these students. The objectives sought to determine the e-learning profile of media and…

Hospital workers' perceptions of waste: a qualitative study involving photo-elicitation

PubMed Central

Goff, Sarah L.; Kleppel, Reva; Lindenauer, Peter K.; Rothberg, Michael B.

2015-01-01

Objectives To elicit sources of waste as viewed by hospital workers Design Qualitative study using photo-elicitation, an ethnographic technique for prompting in-depth discussion Setting U.S. academic tertiary care hospital Participants Physicians, nurses, pharmacists, administrative support personnel, administrators and respiratory therapists Methods A purposive sample of personnel at an academic tertiary care hospital was invited to take up to 10 photos of waste. Participants discussed their selections using photos as prompts during in-depth interviews. Transcripts were analyzed in an iterative process using grounded theory; open and axial coding was performed, followed by selective and thematic coding to develop major themes and sub-themes. Results Twenty-one participants (9 women, average number of years in field=19.3) took 159 photos. Major themes included types of waste and recommendations to reduce waste. Types of waste comprised four major categories: Time, Materials, Energy and Talent. Participants emphasized time wastage (50% of photos) over other types of waste such as excess utilization (2.5%). Energy and Talent were novel categories of waste. Recommendations to reduce waste included interventions at the micro-level (e.g. individual/ward), meso-level (e.g. institution) and macro-level (e.g., payor/public policy). Conclusions The waste hospital workers identified differed from previously described waste both in the types of waste described and the emphasis placed on wasted time. The findings of this study represent a possible need for education of hospital workers about known types of waste, an opportunity to assess the impact of novel types of waste described and an opportunity to intervene to reduce the waste identified. PMID:23748192

Prevaccination antibody screening and immunization program for healthcare personnel against measles, mumps, rubella, and varicella in a Japanese tertiary care hospital.

PubMed

Kanamori, Hajime; Tokuda, Koichi; Ikeda, Shinobu; Endo, Shiro; Ishizawa, Chiyuki; Hirai, Yukari; Takahashi, Masami; Aoyagi, Tetsuji; Hatta, Masumitsu; Gu, Yoshiaki; Yano, Hisakazu; Weber, David J; Kaku, Mitsuo

2014-10-01

Susceptible healthcare personnel (HCP) are at high risk for acquiring and transmitting measles, mumps, rubella, and varicella (MMRV). Presumptive evidence of immunity to MMRV is recommended for HCP. The aim of this investigation was to examine the seroprevalence of MMRV in Japanese HCP and the association with history or vaccination in terms of occupational safety. To improve infection control at our hospital, we also assessed their immune status by implementing prevaccination antibody screening and an immunization program with postvaccination serological testing. We implemented seroprevalence surveys on MMRV antibodies among 243 newly and 2,664 previously hired HCP in a Japanese tertiary care hospital. Self-administered questionnaires about history of MMRV and vaccination with or without written documentation were completed for newly hired HCP. Prevaccination and postvaccination serological tests were performed using virus-specific IgG enzyme-linked immunosorbent assays. Indeed, only a few HCP accurately remembered or had written records of their disease or vaccination history. After our immunization program was implemented, the seropositivity rate reached levels as high as ~98% for measles, rubella, and varicella, and increased to ~80% for mumps. Our program was cost-effective, and no severe adverse reactions were reported. The prevaccination antibody screening for HCP would be helpful, given the lack of written vaccination records or documented disease history, and is also useful for the prevention of adverse reactions associated with unnecessary vaccination. It is important for infection control practitioners to comprehend the immune status of HCP against MMRV, and then provide an appropriate immunization program for susceptible HCP.

Educational levels of hospital nurses and surgical patient mortality.

PubMed

Aiken, Linda H; Clarke, Sean P; Cheung, Robyn B; Sloane, Douglas M; Silber, Jeffrey H

2003-09-24

Growing evidence suggests that nurse staffing affects the quality of care in hospitals, but little is known about whether the educational composition of registered nurses (RNs) in hospitals is related to patient outcomes. To examine whether the proportion of hospital RNs educated at the baccalaureate level or higher is associated with risk-adjusted mortality and failure to rescue (deaths in surgical patients with serious complications). Cross-sectional analyses of outcomes data for 232 342 general, orthopedic, and vascular surgery patients discharged from 168 nonfederal adult general Pennsylvania hospitals between April 1, 1998, and November 30, 1999, linked to administrative and survey data providing information on educational composition, staffing, and other characteristics. Risk-adjusted patient mortality and failure to rescue within 30 days of admission associated with nurse educational level. The proportion of hospital RNs holding a bachelor's degree or higher ranged from 0% to 77% across the hospitals. After adjusting for patient characteristics and hospital structural characteristics (size, teaching status, level of technology), as well as for nurse staffing, nurse experience, and whether the patient's surgeon was board certified, a 10% increase in the proportion of nurses holding a bachelor's degree was associated with a 5% decrease in both the likelihood of patients dying within 30 days of admission and the odds of failure to rescue (odds ratio, 0.95; 95% confidence interval, 0.91-0.99 in both cases). In hospitals with higher proportions of nurses educated at the baccalaureate level or higher, surgical patients experienced lower mortality and failure-to-rescue rates.

Does the physician order-entry system increase the revenue of a general hospital?

PubMed

Park, Woong-Sub; Kim, Joon S; Chae, Young Moon; Yu, Seung-Hum; Kim, Chang-Yup; Kim, Sang-A; Jung, Sang Hyuk

2003-08-01

The purpose of this study was to examine whether the physician order-entry system (POE) could increase the outpatient and inpatient revenue of hospitals. We analyzed the inpatient and outpatient revenue data of all general hospitals (212) in South Korea obtained from the Korean National Health Insurance Corporation (KNHIC) during the period from 1996 to 1999 using the mixed model for repeated measure data. Analysis of the 4-years' panel data showed that both outpatient and inpatient revenues increased significantly after POE introduction. The hospital characteristics significantly influencing inpatient revenue were the number of beds, number of physicians and the tertiary status of a hospital; whereas those for outpatient revenue were the number of beds, number of physicians, the private status of a hospital, the tertiary status of a hospital and the urban status of a hospital. The revenues from both outpatients and inpatients were found to be increased after the introduction of the POE, while controlling for population size, competition, income, hospital location, hospital size, tertiary status and public status.

Clinicodemographic Profile of Children with Seizures in a Tertiary Care Hospital: A Cross-Sectional Observational Study.

PubMed

Chaudhary, Nagendra; Gupta, Murli Manohar; Shrestha, Sandeep; Pathak, Santosh; Kurmi, Om Prakash; Bhatia, B D; Agarwal, K N

2017-01-01

Seizures are one of the common causes for hospital admissions in children with significant mortality and morbidity. This study was conducted to study the prevalence and clinicodemographic profile of children with seizures in a tertiary care hospital of western Nepal. This prospective cross-sectional study conducted over a period of 2 years included all admitted children (2 months-16 years) with seizures. Among 4962 admitted children, seizures were present in 3.4% ( n = 168) of children, with male preponderance. 138 (82.1%) children had generalized tonic-clonic seizures (GTCS) and 30 (17.9%) children had partial seizures. GTCS were more common than partial seizures in both sexes (male = 82.7%; female = 81.2%) and age groups. There was no statistical significance in the distribution of seizures (GTCS and partial seizures) with sexes ( P = 0.813) and age groups ( P = 0.955). Mean ages of children having GTCS and partial seizures were 8.2 ± 4.6 years and 8.2 ± 4.2 years, respectively. Loss of consciousness (55.4%), fever (39.9%), vomiting (35.1%), and headache (16.1%) were common complaints in seizure patients. Significant number of GTCS cases had fever ( P = 0.041) and neurocysticercosis ( n = 72; 43%) was the most common etiology in seizure patients. Idiopathic epilepsy (38 (22.6%)), meningoencephalitis (26 (15.5%)), and febrile convulsions (14 (8.33%)) were other leading disorders in children with seizures.

Mental health consumers' with medical co‐morbidity experience of the transition through tertiary medical services to primary care

PubMed Central

Cranwell, Kate; Polacsek, Meg

2016-01-01

Abstract Medical comorbidity in people with long‐term mental illness is common and often undetected; however, these consumers frequently experience problems accessing and receiving appropriate treatment in public health‐care services. The aim of the present study was to understand the lived experience of mental health consumers with medical comorbidity and their carers transitioning through tertiary medical to primary care services. An interpretative, phenomenological analysis approach was used, and semistructured, video‐recorded, qualitative interviews were used with 12 consumers and four primary caregivers. Four main themes and related subthemes were abstracted from the data, highlighting consumer's and carers’ experience of transition through tertiary medical to primary care services: (i) accessing tertiary services is difficult and time consuming; (ii) contrasting experiences of clinician engagement and support; (iii) lack of continuity between tertiary medical and primary care services; and (iv) Mental Health Hospital Admission Reduction Programme (MH HARP) clinicians facilitating transition. Our findings have implications for organisational change, expanding the role of MH HARP clinicians (whose primary role is to provide consumers with intensive support and care coordination to prevent avoidable tertiary medical hospital use), and the employment of consumer and carer consultants in tertiary medical settings, especially emergency departments. PMID:26735771

The common causes leading to pancytopenia in patients presenting to tertiary care hospital

PubMed Central

Das Makheja, Kirpal; Kumar Maheshwari, Bharat; Arain, Shafique; Kumar, Suneel; Kumari, Sangeeta; Vikash

2013-01-01

Objective: The objective of this study was to determine the frequency of common causes leading to Pancytopenia in patients presenting to tertiary care hospital at Karachi. Methods: A total of 62 patients with the diagnosis of Pancytopenia of more than one week duration were enrolled in the study. All patients underwent a detailed medical history and full physical examination followed by blood sampling for the investigations i.e. complete blood count with peripheral film, erythrocyte sedimentation rate (ESR), Malarial parasites (MP), liver function test, Renal function tests, PT and viral profile (HBsAg, Anti-HCV), Ultrasonography of abdomen. All patients underwent bone marrow aspiration and trephine biopsy for reporting and interpretation. Duration of study was six months, from May 2010 to November 2010. Results: The average age of the patients was 37.76 ± 16.38years. Out of 62 patients, 36 (58%) were male and 26 (42%) were female. Megaloblastic anemia was the commonest cause that was observed in 41.9% cases followed by acute myeloid leukemia 27.4%, aplastic anemia 19.4% and erythroid hyperplasia 11.3%. Conclusion : This study concluded that most common cause of pancytopenia is Megaloblastic anemia, followed by acute myeloid leukemia and aplastic anemia. Bone marrow examination is a single useful investigation which reveals the underlying cause in patients with pancytopenia. PMID:24353701

Incidence and risk factors of ventilator associated pneumonia in a tertiary care hospital.

PubMed

Charles, Mv Pravin; Easow, Joshy M; Joseph, Noyal M; Ravishankar, M; Kumar, Shailesh; Umadevi, Sivaraman

2013-01-01

Ventilator associated pneumonia (VAP) is a type of nosocomial pneumonia associated with increased morbidity and mortality. Knowledge about the incidence and risk factors is necessary to implement preventive measures to reduce mortality in these patients. A prospective study was conducted at a tertiary care teaching hospital for a period of 20 months from November 2009 to July 2011. Patients who were on mechanical ventilation (MV) for more than 48 hours were monitored at frequent intervals for development of VAP using clinical and microbiological criteria until discharge or death. Of the 76 patients, 18 (23.7%) developed VAP during their ICU stay. The incidence of VAP was 53.25 per 1,000 ventilator days. About 94% of VAP cases occurred within the first week of MV. Early-onset and late-onset VAP was observed in 72.2% and 27.8%, respectively. Univariate analysis showed chronic lung failure, H2 blockers usage, and supine head position were significant risk factors for VAP. Logistic regression revealed supine head position as an independent risk factor for VAP. VAP occurred in a sizeable number of patients on MV. Chronic lung failure, H2 blockers usage, and supine head position were the risk factors associated with VAP. Awareness about these risk factors can be used to inform simple and effective preventive measures.

Microsatellite Instability Occurs Rarely in Patients with Cholangiocarcinoma: A Retrospective Study from a German Tertiary Care Hospital.

PubMed

Winkelmann, Ria; Schneider, Markus; Hartmann, Sylvia; Schnitzbauer, Andreas A; Zeuzem, Stefan; Peveling-Oberhag, Jan; Hansmann, Martin Leo; Walter, Dirk

2018-05-09

Immune-modulating therapy is a promising therapy for patients with cholangiocarcinoma (CCA). Microsatellite instability (MSI) might be a favorable predictor for treatment response, but comprehensive data on the prevalence of MSI in CCA are missing. The aim of the current study was to determine the prevalence of MSI in a German tertiary care hospital. Formalin-fixed paraffin-embedded tissue samples, obtained in the study period from 2007 to 2015 from patients with CCA undergoing surgical resection with curative intention at Johann Wolfgang Goethe University hospital, were examined. All samples were investigated immunohistochemically for the presence of MSI (expression of MLH1, PMS2, MSH2, and MSH6) as well as by pentaplex polymerase chain reaction for five quasimonomorphic mononucleotide repeats ( BAT-25 , BAT-26 , NR-21 , NR-22 , and NR-24 ). In total, 102 patients were included, presenting intrahepatic ( n = 35, 34.3%), perihilar ( n = 42, 41.2%), and distal CCA ( n = 25, 24.5%). In the immunohistochemical analysis, no loss of expression of DNA repair enzymes was observed. In the PCR-based analysis, one out of 102 patients was found to be MSI-high and one out of 102 was found to be MSI-low. Thus, MSI seems to appear rarely in CCA in Germany. This should be considered when planning immune-modulating therapy trials for patients with CCA.

Complications of external cephalic version: a retrospective analysis of 1121 patients at a tertiary hospital in Sydney.

PubMed

Rodgers, R; Beik, N; Nassar, N; Brito, I; de Vries, B

2017-04-01

To report the complication rate associated with external cephalic version (ECV) at term. Single-centre retrospective study. A major tertiary hospital in Sydney, Australia. All women who underwent an ECV at Royal Prince Alfred Hospital from 1995-2013 were included. ECV was attempted on all consenting women with a breech presentation at term in the absence of contraindications. Complications were classified as minor (transient cardiotocography abnormalities, ruptured membranes, small antepartum haemorrhage) or serious (fetal death, placental abruption, fetal distress requiring emergency caesarean section, fetal bone injury, cord prolapse). ECV success rates and rate of reversion to breech were recorded. The primary outcome was the incidence of serious complications. Secondary outcome measures were the rate of minor complications and reversion to breech. Of 1121 patients that underwent ECV, five (0.45%) experienced a serious complication. There was one placental abruption, one emergency caesarean section for fetal distress and two cord prolapses. There was one fetal death attributable to a successful ECV. Forty-eight women (4.28%) experienced a minor complication. Reversion to the breech occurred in sixteen patients (3.32%). ECV at term is associated with a low rate of serious complications. Study of 1121 consecutive ECV attempts shows low rate of complications although one fetal death reported. © 2016 Royal College of Obstetricians and Gynaecologists.

Hospital-Level Factors Associated with Pediatric Emergency Department Return Visits.

PubMed

Pittsenbarger, Zachary; Thurm, Cary; Neuman, Mark; Spencer, Sandra; Simon, Harold; Gosdin, Craig; Shah, Samir; McClead, Richard; Stack, Anne; Alpern, Elizabeth

2017-07-01

Return visits (RVs) and RVs with admission (RVAs) are commonly used emergency department quality measures. Visit- and patient-level factors, including several social determinants of health, have been associated with RV rates, but hospital-specific factors have not been studied. To identify what hospital-level factors correspond with high RV and RVA rates. Multicenter mixed-methods study of hospital characteristics associated with RV and RVA rates. Pediatric Health Information System with survey of emergency department directors. Adjusted return rates were calculated with generalized linear mixed-effects models. Hospitals were categorized by adjusted RV and RVA rates for analysis. Twenty-four hospitals accounted for 1,456,377 patient visits with an overall adjusted RV rate of 3.7% and RVA rate of 0.7%. Hospitals with the highest RV rates served populations that were more likely to have government insurance and lower median household incomes and less likely to carry commercial insurance. Hospitals in the highest RV rate outlier group had lower pediatric emergency medicine specialist staffing, calculated as full-time equivalents per 10,000 patient visits: median (interquartile range) of 1.9 (1.5-2.1) versus 2.9 (2.2-3.6). There were no differences in hospital population characteristics or staffing by RVA groups. RV rates were associated with population social determinants of health and inversely related to staffing. Hospital-level variation may indicate population-level economic factors outside the control of the hospital and unrelated to quality of care. © 2017 Society of Hospital Medicine

Hospitalized Patients' Awareness Of Their Rights-A Cross Sectional Survey In A Public And Private Tertiary Care Hospitals Of Punjab, Pakistan.

PubMed

Tabassum, Tahirah; Ashraf, Mariam; Thaver, Inayat

2016-01-01

The awareness of patient's rights is negligible in developing countries where no legal framework is present to protect these rights and Pakistan is no exception. Not only is there an absence of legal structure for protection of patients' rights, but the enforcement and implementation for existing law is also questionable. Pakistan has an Islamic Charter of Medical and Health Ethics which includes the medical behaviour and physician's rights and duties towards the patients. Despite all these charters on patients' rights, there is little to no awareness regarding these rights and their practice remains low in healthcare system of Pakistan. This assessment of awareness among patients about their rights will guide in formulating recommendations to improve the existing system of healthcare delivery in the country. This descriptive cross-sectional comparative study was conducted in two hospitals in Lahore, each belonging to public and private sector. A structured questionnaire was used to collect data from patients. A total of 220 patients were selected to participate in the study, 110 belonging to each private and public hospital. The findings indicate that most of the patients (64%) were not aware of their rights. The awareness level was better in patients seeking care from private hospital than those from public hospital. Education, monthly income and type of hospital utilized were found to be positively associated with the level of awareness. Most of the patients were not satisfied with the practices of their rights, especially in public hospitals. The lack of awareness regarding the rights of a patient was more common in patients of public/government hospitals compared to private hospitals. A nation-wide healthcare education program is needed to increase awareness and practice of patients' rights in the country.

Quality of Care of Hospitalized Infective Endocarditis Patients: Report from a Tertiary Medical Center.

PubMed

Kashef, Mohammad Amin; Friderici, Jennifer; Hernandez-Montfort, Jaime; Atreya, Auras R; Lindenauer, Peter; Lagu, Tara

2017-06-01

There have been no recent studies describing the management and outcomes of patients with infective endocarditis (IE). We conducted a retrospective cohort study of adult patients admitted to a tertiary medical center from 2007 to 2011 with a Duke criteria consistent discharge diagnosis of IE. We examined concordance with guideline recommendations. Outcomes included embolic events, inhospital and 1-year mortality, length of stay (LOS) and cardiac surgery. We used descriptive statistics to describe the cohort and Fisher exact and unpaired t tests to compare native valve endocarditis (NVE) with prosthetic valve endocarditis (PVE). Of 170 patients, definite IE was present in 135 (79.4%) and possible IE in 35 (20.6%); 74.7% had NVE, and 25.3% had PVE. Mean ± standard deviation age was 60.0 ± 17.9 years. Comparing PVE to NVE, patients with PVE were less likely to have embolic events (14.0% vs. 32.3%; P = 0.03), had shorter LOS (median 12.0 days vs. 14.0 days; P = 0.047), but they did not show a statistically significant difference in inhospital mortality (20.9% vs. 12.6%; P = 0.21). Of 170, patients 27.6% (n = 47) underwent valve surgery. Most patients received timely blood cultures and antibiotics. Guideline-recommended consults were underused, with 86.5%, 54.1%, and 47.1% of patients receiving infectious disease, cardiac surgery, and cardiology consultation, respectively. As the number of consultations increased (from 0 to 3), we observed a nonsignificant trend toward reduction in 6-month readmission and 12-month mortality. IE remains a disease with significant morbidity and mortality. There are gaps in the care of IE patients, most notably underuse of specialty consultation. Journal of Hospital Medicine 2017;12:414-420. © 2017 Society of Hospital Medicine

Socio-demographic characteristics and challenges experienced by disabled patients living with HIV/AIDS in a tertiary hospital in Ibadan, Nigeria.

PubMed

Olowookere, S A; Adewole, I F

2012-09-01

HIV/AIDS is highly prevalent in sub-Saharan Africa and few studies had looked at physically and mentally challenged people living with HIV/AIDS (PLHIV) in this environment. This study aimed to describe the socio-demographic characteristics and challenges faced by these patients attending University College Hospital, Ibadan. A descriptive cross-sectional study design was done. A semi-structured interviewer administered questionnaire was administered to consecutive disabled PLHIV over a period of six months. Data obtained were analyzed using descriptive and inferential statistics. A total of ninety-nine patients were seen during the study period. The mean age of these patients was 39.9 +/- 9.4 years (range 23-60 years). There were 30 (30.3%) males and 69 (69.7%) females. Twenty-four percent had no formal education while 12% had tertiary education. All respondents had suffered stigmatization/discrimination while most were poor. Eighty-seven percent had AIDS at presentation. Musculoskeletal impairments (46.5%), hearing loss (16.2%) and visual impairment (31.3%) were the commonest disability. Over twenty-three percent had prior history of road traffic accident as the cause of disability. Physically and mentally challenged people living with HIV/AIDS are poor and highly stigmatized. They require special assistance to cope and need economic empowerment to reduce their poverty level.

Effect of Joint Commission International Accreditation on the Nursing Work Environment in a Tertiary Medical Center.

PubMed

Kagan, Ilya; Farkash-Fink, Naomi; Fish, Miri

2016-01-01

How might a tertiary hospital's nursing staff respond to the huge improvement effort required for external accreditation if they are encouraged to lead the change process themselves? This article reports the results of a concurrent evaluation of the nursing work climate at ward level, before and after accreditation by the Joint Commission International. Physician-nurse relations improved; the involvement of social workers, dieticians, and physiotherapists increased; support services responded more quickly to requests; and management-line staff relations became closer.

A qualitative study into the impact of fasting within a large tertiary hospital in Australia--the patients' perspective.

PubMed

Carey, Sharon K; Conchin, Simone; Bloomfield-Stone, Susan

2015-07-01

This qualitative study aims to explore the physical and emotional impact of fasting from the patients' perspective. Fasting patients in hospital is common practice and generally viewed as necessary for symptom management or for safety of healthcare provision. Negative impacts of repeated or prolonged fasting on nutritional status have been well researched, but little is documented as to how fasting impacts an individual patient's psyche. Qualitative descriptive design within a tertiary hospital in Sydney, Australia. Twelve patients having had prolonged periods of continuous or intermittent fasting were invited to participate in a semi-structured interview between January-September 2012. Questions for interview explored each patient's experience of fasting, including physical and emotional impacts, interpretation of communication regarding fasting and the process of recommencing on fluids or foods. An inductive thematic analysis approach was used. Analyses showed six main themes: physical impacts; emotional impacts; food as structure; nil by mouth as jargon; fear of food re-introduction; and dissatisfaction regarding unnecessary fasting. Overwhelmingly, thirst was reported as the worst physical effect of fasting. In the first few days of fasting, patients became emotionally fixated on food. This quickly dissipated leading to a lack of appetite and fear of starting to eat again. Discomfort experienced by patients coupled with lack of appetite resulting from prolonged fasting and difficulty with food re-introduction strengthens the argument for reducing fasting times in hospital. When patients are fasted, proper hydration and establishing alternate routes of medication administration should be a priority. It is well recognised that fasting for prolonged periods is detrimental to health outcomes, but this study also shows the distress that fasting can cause. Inadequate hospital systems and out-dated practices need to be replaced with evidence-based, patient

Knowledge, Attitude, and Perception of Barriers for Eye Care among Diabetic Persons Registered at Employee Health Department of a Tertiary Eye Hospital of Central Saudi Arabia.

PubMed

Al-Alawi, Abeer; Al-Hassan, Arif; Chauhan, Deepti; Al-Futais, Muneera; Khandekar, Rajiv

2016-01-01

To evaluate the level of knowledge, attitudes, and barriers to diabetic retinopathy (DR) screening among diabetic healthcare staff at a tertiary eye hospital in central Saudi Arabia. This was a descriptive survey using a closed-ended questionnaire. A. 5-grade. Likert scale was used for responses to each question. Data were collected on patient demographics and the status of diabetes. Survey responses related to knowledge, attitude, and barriers were grouped. The study sample was comprised of 45 diabetics employed at the hospital. The mean age was 49 ± 11 years and 33 diabetics were males. One-third of the study population was referred to the eye clinic for DR screening. DR screening was performed in 25% of diabetics over the previous year. Twenty-nine (64%; 95% confidence intervals: 50-78) participants had excellent knowledge of eyecare for diabetic complications. Thirteen percent of participants had a positive attitude toward periodic eye checkups. Travel distance to an eyecare unit, no referral from family physicians for annual eye checkups and the lack of availability of gender-specific eyecare professionals were the main perceived barriers. Annual DR screening needs to be promoted to primary healthcare providers and diabetic patients. Barriers should be addressed to improve the uptake of DR screening.

Knowledge, Attitude, and Perception of Barriers for Eye Care among Diabetic Persons Registered at Employee Health Department of a Tertiary Eye Hospital of Central Saudi Arabia

PubMed Central

Al-Alawi, Abeer; Al-Hassan, Arif; Chauhan, Deepti; Al-Futais, Muneera; Khandekar, Rajiv

2016-01-01

Purpose: To evaluate the level of knowledge, attitudes, and barriers to diabetic retinopathy (DR) screening among diabetic healthcare staff at a tertiary eye hospital in central Saudi Arabia. Methods: This was a descriptive survey using a closed-ended questionnaire. A. 5-grade. Likert scale was used for responses to each question. Data were collected on patient demographics and the status of diabetes. Survey responses related to knowledge, attitude, and barriers were grouped. Results: The study sample was comprised of 45 diabetics employed at the hospital. The mean age was 49 ± 11 years and 33 diabetics were males. One-third of the study population was referred to the eye clinic for DR screening. DR screening was performed in 25% of diabetics over the previous year. Twenty-nine (64%; 95% confidence intervals: 50–78) participants had excellent knowledge of eyecare for diabetic complications. Thirteen percent of participants had a positive attitude toward periodic eye checkups. Travel distance to an eyecare unit, no referral from family physicians for annual eye checkups and the lack of availability of gender-specific eyecare professionals were the main perceived barriers. Conclusion: Annual DR screening needs to be promoted to primary healthcare providers and diabetic patients. Barriers should be addressed to improve the uptake of DR screening. PMID:26957842

Hospital information systems: experience at the fully digitized Seoul National University Bundang Hospital.

PubMed

Yoo, Sooyoung; Hwang, Hee; Jheon, Sanghoon

2016-08-01

The different levels of health information technology (IT) adoption and its integration into hospital workflow can affect the maximization of the benefits of using of health IT. We aimed at sharing our experiences and the journey to the successful adoption of health IT over 13 years at a tertiary university hospital in South Korea. The integrated system of comprehensive applications for direct care, support care, and smart care has been implemented with the latest IT and a rich user information platform, achieving the fully digitized hospital. The users experience design methodology, barcode and radio-frequency identification (RFID) technologies, smartphone and mobile technologies, and data analytics were integrated into hospital workflow. Applications for user-centered electronic medical record (EMR) and clinical decision support (CDS), closed loop medication administration (CLMA), mobile EMR and dashboard system for care coordination, clinical data warehouse (CDW) system, and patient engagement solutions were designed and developed to improve quality of care, work efficiency, and patient safety. We believe that comprehensive electronic health record systems and patient-centered smart hospital applications will go a long way in ensuring seamless patient care and experience.

Acute Febrile Illness Surveillance in a Tertiary Hospital Emergency Department: Comparison of Influenza and Dengue Virus Infections

PubMed Central

Lorenzi, Olga D.; Gregory, Christopher J.; Santiago, Luis Manuel; Acosta, Héctor; Galarza, Ivonne E.; Hunsperger, Elizabeth; Muñoz, Jorge; Bui, Duy M.; Oberste, M. Steven; Peñaranda, Silvia; García-Gubern, Carlos; Tomashek, Kay M.

2013-01-01

In 2009, an increased proportion of suspected dengue cases reported to the surveillance system in Puerto Rico were laboratory negative. As a result, enhanced acute febrile illness (AFI) surveillance was initiated in a tertiary care hospital. Patients with fever of unknown origin for 2–7 days duration were tested for Leptospira, enteroviruses, influenza, and dengue virus. Among the 284 enrolled patients, 31 dengue, 136 influenza, and 3 enterovirus cases were confirmed. Nearly half (48%) of the confirmed dengue cases met clinical criteria for influenza. Dengue patients were more likely than influenza patients to have hemorrhage (81% versus 26%), rash (39% versus 9%), and a positive tourniquet test (52% versus 18%). Mean platelet and white blood cell count were lower among dengue patients. Clinical diagnosis can be particularly difficult when outbreaks of other AFI occur during dengue season. A complete blood count and tourniquet test may be useful to differentiate dengue from other AFIs. PMID:23382160

Use of smoke-less tobacco amongst the staff of tertiary care hospitals in the largest city of Pakistan.

PubMed

Valliani, Arif; Ahmed, Bilawal; Nanji, Kashmira; Valliani, Salimah; Zulfiqar, Beenish; Fakih, Misbah; Mehdi, Mehwish; Khan, Anam; Sheikh, Sana Arshad; Fatima, Nida; Ahmad, Sobia; Farah, Fariya; Saleem, Shaheera; Ather, Sana; Majid, Syed Khubaib; Hashmi, Syed Salman; Arjan, Sunil

2012-01-01

Use of smoke-less tobacco (SLT) is very common in South and South-East Asian countries. It is significantly associated with various types of cancers. The objectives of this study were to assess the proportion of hospital staff that use SLT, and to identify the factors associated with its use and their practices. In a cross-sectional study, 560 staff of two tertiary care hospitals were interviewed in the year 2009. Nurses, ward boys and technicians were counted as a paramedic staff while drivers, peons, security guards and housekeeping staff were labeled as non-paramedic staff. SLT use was considered as usage of any of the following: betel quid (paan) with or without tobacco, betel nuts with or without tobacco (gutkha) and snuff (naswar). About half (48.6%) of the hospital staff were using at least one type of SLT. Factors found to be statistically significant with SLT were being a male (OR=2.5; 95% CI=1.8-3.7); having no/fewer years of education (OR=1.7; 95% CI=1.2-2.4) and working as non-paramedic staff (OR=2.6; 95% CI=1.8-3.8). Majority of SLT users were using it on regular basis, for >5 years and keeping the tobacco products in the oral cavity for >30 minutes. About half of the users started due to peer pressure and had tried to quit this habit but failed. In this study, about half of the study participants were using SLT in different forms. We suggest educational and behavioral interventions for control of SLT usage.

[The 10-year stroke risk in hypertensive outpatients combined with diabetes in cardiovascular clinics of 36 tertiary hospitals in China].

PubMed

Bao, Bingnan; Zhou, Yingsheng; Liu, Jun; Huo, Yong

2014-12-01

To assess the estimated 10-year risk of stroke among hypertensive outpatients known with diabetes from cardiovascular clinics of 36 tertiary hospitals in China and to analyze the characteristics of the risk factors and the 10-year risk of stroke between the southern and the northern patients. A multi-center prevalence survey was conducted from October 2011 to June 2012. Hypertensive outpatients known with diabetes were enrolled from cardiovascular clinics of 36 tertiary hospitals in China. A total of 15 914 outpatients were included in the final analysis. The 10-year probability of stroke was evaluated by the Framingham stroke risk profile. According to the 10-year probability of stroke, patients were divided into low risk ( ≤ 5%), medium risk (6%∼9%) and high risk ( ≥ 10%). (1) Of all the hypertensive outpatients known with diabetes, the mean age was (64.6 ± 10.1) years and the mean systolic pressure was (138.7 ± 19.3) mmHg (1 mmHg = 0.133 kPa). Among them, 7.4% with atrial fibrillation, 11.2% with left ventricular hypertrophy, 57.2% with cardiovascular diseases, 17.1% smokers and 37.0% using mono-hypoglycemic agent. The southern patients who were older with more smokers had higher proportions of men and left ventricular hypertrophy, lower levels of systolic blood pressure, and lower proportions of other cardiovascular diseases than those of the northern patients ( all P < 0.05). (2) The mean 10-year probability of stroke was (20.9 ± 16.2) %. The southern patients had a higher mean 10-year probability of stroke than that of the northern patients [(22.4 ± 17.1) % vs (19.7 ± 15.2) %] (P < 0.01) . After adjusted by age and sex, the southern patients still had a higher mean 10-year probability of stroke (P < 0.05) . (3) All the patients had 7.7% with low risk, 17.4% with medium risk, and 74.9% with high risk. The southern patients had lower proportions of low and medium risk than those of the northern patients (6.7% vs 8.4%, 15.5% vs 18.9%), but had a

Combined Oral Contraceptive Pills: Profile of Acceptors in a Tertiary Hospital in South-South Nigeria.

PubMed

Abasiattai, A M; Utuk, M N; Ojeh, S O; Eyo, U E

2011-01-01

BACKGROUND: Combined oral contraceptive pills were the first contraceptive method to provide sexual freedom of choice for women through reliable, personal and private control of fertility. They are the most widely used hormonal contraceptives and also the most popular non-surgical method of contraception. OBJECTIVE: To review the profile of acceptors of combined oral contraceptive pills at the University of Uyo Teaching Hospital, Uyo. METHODOLOGY: An 8 year review of all clients that accepted combined oral contraceptive pills in the family planning clinic. RESULTS: There were 1,146 new contraceptive acceptors during the period of study out of which 309 (27.9%) accepted the pills. Majority of the clients were between 20 and 29 years of age (54.0%), were multiparous (72.8%), Christians (99.7%) and 61.2% had tertiary level education. Two hundred and fifty-five women (82.5%) desired to use combined oral contraceptive pills to space births while 7.8% wanted to limit child bearing. There was a high discontinuation rate among the women (45.0%) and out of these 87.9% of the clients changed to other contraceptive methods. All the clients commenced their pills within seven days of menstruation and only the low dose monophasic preparations were available in the family planning unit and thus were given to the clients. CONCLUSION: Women who accept to initiate combined oral contraceptive pills in our center are young, well educated, multiparous women who want to space their pregnancies. However, due to the high discontinuation rate among the clients, there is need for further studies evaluating reasons for the high discontinuation rate, exploring interactions between clients and providers' and also providers' attitude towards combined pills in our environment.

A descriptive study on evaluation of bio-medical waste management in a tertiary care public hospital of North India

PubMed Central

2014-01-01

Background Proper management of Biomedical waste (BMW) generated in a healthcare facility is one of the most important functions of a healthcare worker (HCW) as its improper management not only poses risk to human beings and environment, but may also invite legal action against HCW as well as hospital administration. This study was carried out to evaluate quality of BMW management in 1100-bedded hospital attached to a tertiary care public institute in North India. Methods A checklist, including 29 parameters related to various functions to be carried out at source of generation by a HCW for BMW management was prepared by researcher and used after validation to record observations in all the 70 areas of hospital. A total of 6 visits were made to each area and mean percentage score was calculated for each area and each category of waste management. Results It was found that summated mean percentage score of ‘Treatment Room of Wards’, which were used exclusively by resident doctors, was significantly lower than Operation Theatres (p value: 0.033) and ‘Central Waste Collection Points of Wards’ (p value: 0.018) for the function of ‘mutilation of recyclable waste’ and it was significantly lower than all other areas (p value: 0.006 to 0.017) for the function of ‘disinfection of waste’. Conclusion It is concluded that more emphasis needs to be laid on ‘mutilation of recyclable waste’ and disinfection of waste’ by HCWs especially resident doctors. PMID:24742274

[Changes in the demand for paediatric neurology care in a spanish tertiary care hospital over a 20-year period].

PubMed

Monge Galindo, L; López-Pisón, J; Samper Villagrasa, P; Peña Segura, J L

2014-01-01

The purpose of this study is to determine the profile of the demand for paediatric neurology care in a Spanish tertiary hospital over the past 20 years. We studied epidemiological data, reasons for consultation, diagnoses and complementary tests from all patients examined by our Paediatric Neurology Unit in its 20 years of service (from May 1990 to March 2010). We also reviewed data from patients whose first visit took place within the last five years (2005-2010) and compared them to data obtained from a prior study carried out in this Unit from 1990 to 1995. To compare the first 5 years (group 1) with the last 5 years (group 2), we calculated confidence intervals, P<.05, for the frequency distribution (%) in each category. Main reasons for consultation and principal diagnoses for the 12726 patients evaluated in the 20-year period, as well as results from group 1 (2046 patients) and group 2 (4488 patients) corresponding to first and the last 5 years of activity respectively, are presented with their confidence intervals in a series of tables. Variations in the reasons for consultation, diagnoses and complementary tests over time reflect changes determined by medical, scientific and social progress, and organisational changes specific to each hospital. This explains the difficulty of comparing different patient series studied consecutively, which are even more pronounced between different hospitals. Copyright © 2012 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

Effectiveness of an intervention package on knowledge, attitude, and practices of food handlers in a tertiary care hospital of north India: A before and after comparison study.

PubMed

Dudeja, Puja; Singh, Amarjeet; Sahni, Nancy; Kaur, Sukhpal; Goel, Sonu

2017-01-01

Food-borne illnesses have been a recognized hazard for decades. Recent promulgation of Food Safety and Standards Act (FSSA), 2006, indicates the concern of our Govt. for food safety. Research on effectiveness of food safety interventions in our country is remarkably scarce. Hence, the present study was conducted in a tertiary care hospital of north India to create evidence-based results for food safety interventions. The study was before and after intervention trial which was registered with CTRI. Data collection was paperless using a software. All food handlers ( n  = 280) working inside the hospital were recruited. Intervention package comprised Self-Instructional Manual in Hindi for food handlers, short film for sensitization of food handlers on food safety titled 'Gravy Extra', and a documentary titled 'Food Safety from farm to Fork'. Chi square test, paired t test, and Wilcoxon sign rank test were used. The mean age of food handlers was 35 ± 2 years. Majority (61.7%) of food handlers were educated less than 10th standard. Nearly 60% of them had up to five years of experience. At base line majority (68.9%) had a fair knowledge about food safety issues. There was a significant improvement in food safety knowledge and practice score of food handlers after the intervention ( p  < 0.05). Their attitude toward food safety changed in a positive direction ( p  < 0.05). The intervention package was useful in improving the knowledge, creating a positive attitude and enhancing the food safety practices of food handlers working inside a tertiary care hospital.

Factors Affecting Compliance to Antihypertensive Treatment among Adults in a Tertiary Care Hospital in Mumbai.

PubMed

Shah, Ayushi Jayesh; Singh, Vijaykumar; Patil, Subita P; Gadkari, Mithila R; Ramchandani, Varun; Doshi, Karan Janak

2018-01-01

Compliance to antihypertensive therapy reduces the risk of complications. It is important to understand the factors affecting compliance in patients so that the goal of successful treatment is not jeopardized. To determine the proportion of participants' compliant to treatment and various factors associated with compliance of antihypertensive treatment. A cross-sectional study of 330 hypertensive patients on treatment attending the outpatient department of a tertiary care hospital in Mumbai. It was conducted over 8 weeks using a validated, pretested questionnaire including information on the individual's sociodemographic profile, compliance to antihypertensive therapy and lifestyle advice assessed using a 4-point Likert scale. Data were entered into MS Excel 2007 and analyzed using SPSS 20. Participants' mean age was 55.2 ± 12.6 years. 39.4% were compliant to their treatment. Common reasons for frequently skipping the dose - forgetfulness (41.2%) and discontinued the medication when feeling well (30.3%). Factors positively associated with compliance were gender and illiteracy. The proportion of noncompliance among smokers and alcoholics was statistically significant. Forgetfulness and subjective feeling of wellness were the prevalent reasons for noncompliance. Controlling habits such as smoking and alcohol may prove as key factors for compliance.

Early Detection of Chronic Obstructive Pulmonary Disease in Apparently Healthy Attendants of Tertiary Care Hospital and Assessment of its Severity.

PubMed

Zubair, Tahira; Abbassi, Amanullah; Khan, Osama Ahsan

2017-05-01

Early detection of Chronic Obstructive Pulmonary Disease in apparently healthy attendants of tertiary care hospital and assessment of its severity. Cross-sectional, observational study. Study was conducted from January 2015 to July 2015 at Dow University Hospital, Ojha campus. Ascreening method was designed for apparently healthy individuals including attendants of patients, hospital staff, faculty and students, belonging to age group 18-60 years after excluding severe obesity and already diagnosed respiratory and cardiovascular diseases by means of history. Each participant performed pulmonary function tests via spirometer after filling a questionnaire based on various risk factors and symptoms of chronic obstructive pulmonary disease (COPD). Data was entered and analysed by SPSS-20. Out of the 517 participants, 122 (23.6%) were found to have COPD diagnosed by means of spirometry. Out of these, 23 (4.4%) had COPD stage I, 42 (8.1%) had COPD II, 34 (6.6%) had COPD III, and 23 (4.4%) had COPD IV. Exposure to smoking, wooden stoves, pesticides, biomass fuel, aerosol sprays, gas grill and vehicle exhaust were found to be statistically significant factors in relation to development of COPD. Apparently healthy individuals may have underlying COPD and active screening by means of spirometry plays vital role in early detection of COPD. Smoking and exposure to certain hazardous environmental pollutants are responsible for the development and progression of COPD.

Physicians' tobacco intervention counseling in a tertiary care hospital of South India.

PubMed

Akshaya, K M; Majra, J P

2014-10-01

The tobacco epidemic is one of the biggest public health threats in the present world with a substantial contribution to mortality and morbidity. Patients' visits to their doctors for illnesses and health check-ups offer a great opportunity to screen them for tobacco use and also counsel them to quit tobacco use. This cross sectional study was carried out in out-patient departments of General Medicine and Pulmonary Medicine of a tertiary care medical college teaching hospital in Dakshina Kannada district of Karnataka state of India between April 2012 and July 2012 among the patients aged 18 years or above who were diagnosed as suffering from tobacco related diseases. Exit interview was conducted on the patients after obtaining a written informed consent using a pre designed semi-structured questionnaire. Data was entered, analyzed using SPSS v17 and Descriptive statistics, Fisher Exact test, Bivariate and multivariable logistic regression analyses were used. The present study reveals that 305 (87.1 %), 281 (80.3 %) and 257 (73.1 %) of the 350 participants were asked, assessed and advised respectively by the treating physicians to quit tobacco use where as only 18 (15.1 %) were assisted in their efforts to quit tobacco. Physician's counseling inventions were significantly associated with patient's age, sex, education, marital status and socio economic status of the patients as well as the treating physician's experience of more than 3 years. There is a need to incorporate tobacco history taking as a vital sign during medical history taking and this should be made as a routine in medical schools.

Enteric Fever in a Tertiary Paediatric Hospital: A Retrospective Six-Year Review.

PubMed

Ahmad Hatib, Nur Adila; Chong, Chia Yin; Thoon, Koh Cheng; Tee, Nancy Ws; Krishnamoorthy, Subramania S; Tan, Natalie Wh

2016-07-01

Enteric fever is a multisystemic infection which largely affects children. This study aimed to analyse the epidemiology, clinical presentation, treatment and outcome of paediatric enteric fever in Singapore. A retrospective review of children diagnosed with enteric fever in a tertiary paediatric hospital in Singapore was conducted from January 2006 to January 2012. Patients with positive blood cultures for Salmonella typhi or paratyphi were identified from the microbiology laboratory information system. Data was extracted from their case records. Of 50 enteric fever cases, 86% were due to Salmonella typhi, with 16.3% being multidrug resistant (MDR) strains. Sixty-two percent of S. typhi isolates were of decreased ciprofloxacin susceptibility (DCS). Five cases were both MDR and DCS. The remaining 14% were Salmonella paratyphi A. There were only 3 indigenous cases. Ninety-four percent had travelled to typhoid-endemic countries, 70.2% to the Indian subcontinent and the rest to Indonesia and Malaysia. All patients infected with MDR strains had travelled to the Indian subcontinent. Anaemia was a significant finding in children with typhoid, as compared to paratyphoid fever (P = 0.04). Although all children were previously well, 14% suffered severe complications including shock, pericardial effusion and enterocolitis. None had typhoid vaccination prior to their travel to developing countries. Enteric fever is largely an imported disease in Singapore and has contributed to significant morbidity in children. The use of typhoid vaccine, as well as education on food and water hygiene to children travelling to developing countries, needs to be emphasised.

Inpatient satisfaction and usage patterns of personalized smart bedside station system for patient-centered service at a tertiary university hospital.

PubMed

Ryu, Borim; Kim, Seok; Lee, Kee-Hyuck; Hwang, Hee; Yoo, Sooyoung

2016-11-01

Bedside stations, also known as bedside terminals, are in place to enhance the quality and experience of a hospital's healthcare service delivery. The purpose of this study was to identify information needs and overall satisfaction with the personalized patient bedside system, called Smart Bedside Station (SBS) system, embedded in a tertiary general university hospital. End-user responses on the satisfaction survey and system usage logs of the SBS system were collected and analyzed. For the user opinion survey, 156 nurses and 1914 patients, their family members, or caregivers participated during the evaluation period of 2013 to 2014 in this study. All working nurses in the SBS-installed ward were answered the paper-based evaluation, for complete enumeration survey. Inpatients were voluntary participated to deliver the online questionnaire on the SBS menu. We also explored system log data including page calls and usage time from December 2013 to 2015. Regarding the relationship of overall satisfaction of the SBS with patient's characteristics, patient's education status and degree of familiarity with the smart device were statistically significant. From the analysis of system logs, Personalized My Menu(28.0%) was the most frequently used menu item (except for TV and Internet entertainment service use of 62.7%),it provides individual health information, such as laboratory test results, hospital fee check, message logs, daily medication information, and meal information. Next frequently used menus were information support(4.9%) which deliver hospital guide and health information and convenience service ordering(4.4%) such as meal order, bed sheet change. Satisfaction survey results and log data results show that the personalized service enhances the user satisfaction during hospital admission. Our post-implementation experience and subsequent assessment of SBS system is capable of providing insights into improving the hospital information system and service contents

Study of variables affecting critical value notification in a laboratory catering to tertiary care hospital.

PubMed

Agarwal, Rachna; Chhillar, Neelam; Tripathi, Chandra B

2015-01-01

During post-analytical phase, critical value notification to responsible caregiver in a timely manner has potential to improve patient safety which requires cooperative efforts between laboratory personnel and caregivers. It is widely accepted by hospital accreditors that ineffective notification can lead to diagnostic errors that potentially harm patients and are preventable. The objective of the study was to assess the variables affecting critical value notification, their role in affecting it's quality and approaches to improve it. In the present study 1,187 critical values were analysed in the Clinical Chemistry Laboratory catering to tertiary care hospital for neuropsychiatric diseases. During 25 months of study period, we evaluated critical value notification with respect to clinical care area, caregiver to whom it was notified and timeliness of notification. During the study period (25 months), the laboratory obtained 1,279 critical values in clinical chemistry. The analytes most commonly notified were sodium and potassium (20.97 & 20.8 % of total critical results). Analysis of critical value notification versus area of care showed that critical value notification was high in ICU and emergency area followed by inpatients and 64.61 % critical values were notified between 30 and 120 min after receiving the samples. It was found that failure to notify the responsible caregiver in timely manner represent an important patient safety issue and may lead to diagnostic errors. The major area of concern are notification of critical value for outpatient samples, incompleteness of test requisition forms regarding illegible writing, lack of information of treating physician and location of test ordering and difficulty in contacting the responsible caregiver.

Anaemia in pregnancy: a cross-sectional study of pregnant women in a Sahelian tertiary hospital in Northeastern Nigeria.

PubMed

Kagu, M B; Kawuwa, M B; Gadzama, G B

2007-10-01

This prospective study was carried out between June 2005 and June 2006, to determine the prevalence and determinants of anaemia among pregnant women attending a tertiary Sahelian Hospital in Northeastern Nigeria. A total of 1,040 pregnant women enrolled at their first antenatal visit were monitored through pregnancy for anaemia. The overall prevalence of anaemia, malaria parasitaemia and schistosomiasis was 72.0%, 22.1% and 3.8%, respectively. Mild, moderate and severe anaemia constituted 31.8%, 39.4% and 0.9%, respectively. Anaemia was most common among the multipara and women presenting in late stages of pregnancy. More multipara and primigravidae had malaria parasitaemia than grandmultipara. Schistosomiasis, malaria infestation and a short birth interval as well as illiteracy are additional risk factors for anaemia in pregnancy. This study confirms the high prevalence of anaemia in pregnancy in this area. Appropriate intervention strategies are necessary to reduce the prevalence of anaemia.

Clinical and microbiological characteristics of bloodstream infections in a tertiary hospital in Maceió, Alagoas, Brazil.

PubMed

Tenório, Maria Tereza Freitas; Porfírio, Zenaldo; Lopes, Antonio Carlos; Cendon, Sonia

2010-01-01

We observed the clinical and microbiological characteristics of several stages of bloodstream infections (BSI), as well as the mortality attributed to it in a tertiary hospital in the northeast of Brazil (in the city of Maceió, Alagoas). A prospective cohort of 143 patients who had at least one positive blood culture was enrolled in the study. Their clinical evolution was followed up for 30 days from October 2005 to December 2006. The relation among the qualitative variables was verified through Chi-square test. The significance level was 5%. The statistical package adopted was SPSS 15.0 for Windows. Up to the thirtieth day, 30.1% of the patients presented bacteremia and 69.9% developed sepsis. Among these, 20.3% developed severe sepsis and 10.5% septic shock. The mortality attributed to it was 37.8%. In bacteremia, sepsis, severe sepsis, and septic shock conditions, mortality rates were 9.3%, 50%, 65.5%, and 84.6%, respectively. Respiratory (32.2%) and urinary (14%) sources and the ones related to central venous catheter (14%) were prevalent. In the wards 55.12% of the cases developed sepsis, whereas in the intensive care units, the rate was 87.69% (p < 0.05). Chronic renal failure, diabetes mellitus, and neuropathy were present in 21.7%, 26.6%, and 29.4% of the cases, respectively. Coagulase-negative Staphylococcus (25.9%), Staphylococcus aureus (21%), and Klebsiella pneumoniae (14%) were the most present microorganism in the sample. The high morbidity and mortality rates in this study are attributed to the lack of knowledge on BSI characteristics and on instituted protocols for detection and treatment in early stages.

[Effect of educational level on the prognosis of acute myocardial infarction].

PubMed

Nazzal, Carolina; Corbalán, Ramón; Díaz, Claudia; Sepúlveda, Pablo; Schacht, Eliana

2015-07-01

Socioeconomic status is associated with cardiovascular mortality. To evaluate the effect of educational level, on the prognosis of patients with acute myocardial infarction in Chile. Cohort study of 3,636 patients aged 63.1 ± 13.2 years, 27% women, hospitalized in 16 centers participating in the Chilean Myocardial Infarction Registry (GEMI) between 2009 and 2012. Vital status was obtained from the National Mortality Database. Patients were divided, according to educational level, in four groups, namely none (no formal education), basic (< 8 years), secondary (8-12 years) and tertiary (> 12 years). Crude and adjusted (age, sex, cardiovascular risk factors and treatments) hazard ratios (HR) were estimated using Cox regression models. The distribution by educational level was 3.2% none, 31.8% basic, 43.0% secondary and 22.0% tertiary. During a median follow-up period of 22 months (interquartile range 11-37 years), 631 patients died (17.3%), of whom 198 died during hospitalization (5.5%). The 30 day case-fatality rate according to educational level was 3.4% in tertiary, 4.7% in secondary, 11.9% in basic, 19.1% in none (p < 0.0001). Among patients surviving the first 30 days, the case-fatality rate was 4.4%, 8.6%, 14.6% and 27.0%, respectively (p < 0.0001). The increased risk of death for groups with lower education compared with individuals with tertiary education, persisted in the multivariate analysis with a hazard ratio for secondary education 1.58 (95% confidence intervals (CI), 1.18-2.10); for basic education 1.90 (95% CI, 1.41-2.47) and for none 3.50 (95% CI, 2.35-5.21). A lower educational level was associated with a worse prognosis in patients with myocardial infarction, even after controlling for potential confounding factors.

Improved outcomes and reduced costs associated with a health-system-wide patient blood management program: a retrospective observational study in four major adult tertiary-care hospitals.

PubMed

Leahy, Michael F; Hofmann, Axel; Towler, Simon; Trentino, Kevin M; Burrows, Sally A; Swain, Stuart G; Hamdorf, Jeffrey; Gallagher, Trudi; Koay, Audrey; Geelhoed, Gary C; Farmer, Shannon L

2017-06-01

Patient blood management (PBM) programs are associated with improved patient outcomes, reduced transfusions and costs. In 2008, the Western Australia Department of Health initiated a comprehensive health-system-wide PBM program. This study assesses program outcomes. This was a retrospective study of 605,046 patients admitted to four major adult tertiary-care hospitals between July 2008 and June 2014. Outcome measures were red blood cell (RBC), fresh-frozen plasma (FFP), and platelet units transfused; single-unit RBC transfusions; pretransfusion hemoglobin levels; elective surgery patients anemic at admission; product and activity-based costs of transfusion; in-hospital mortality; length of stay; 28-day all-cause emergency readmissions; and hospital-acquired complications. Comparing final year with baseline, units of RBCs, FFP, and platelets transfused per admission decreased 41% (p < 0.001), representing a saving of AU$18,507,092 (US$18,078,258) and between AU$80 million and AU$100 million (US$78 million and US$97 million) estimated activity-based savings. Mean pretransfusion hemoglobin levels decreased 7.9 g/dL to 7.3 g/dL (p < 0.001), and anemic elective surgery admissions decreased 20.8% to 14.4% (p = 0.001). Single-unit RBC transfusions increased from 33.3% to 63.7% (p < 0.001). There were risk-adjusted reductions in hospital mortality (odds ratio [OR], 0.72; 95% confidence interval [CI], 0.67-0.77; p < 0.001), length of stay (incidence rate ratio, 0.85; 95% CI, 0.84-0.87; p < 0.001), hospital-acquired infections (OR, 0.79; 95% CI, 0.73-0.86; p < 0.001), and acute myocardial infarction-stroke (OR, 0.69; 95% CI, 0.58-0.82; p < 0.001). All-cause emergency readmissions increased (OR, 1.06; 95% CI, 1.02-1.10; p = 0.001). Implementation of a unique, jurisdiction-wide PBM program was associated with improved patient outcomes, reduced blood product utilization, and product-related cost savings. © 2017 The Authors Transfusion

Use of Rapid Ascertainment Process for Institutional Deaths (RAPID) to identify pregnancy-related deaths in tertiary-care obstetric hospitals in three departments in Haiti.

PubMed

Boyd, Andrew T; Hulland, Erin N; Grand'Pierre, Reynold; Nesi, Floris; Honoré, Patrice; Jean-Louis, Reginald; Handzel, Endang

2017-05-16

Accurate assessment of maternal deaths is difficult in countries lacking standardized data sources for their review. As a first step to investigate suspected maternal deaths, WHO suggests surveillance of "pregnancy-related deaths", defined as deaths of women while pregnant or within 42 days of termination of pregnancy, irrespective of cause. Rapid Ascertainment Process for Institutional Deaths (RAPID), a surveillance tool, retrospectively identifies pregnancy-related deaths occurring in health facilities that may be missed by routine surveillance to assess gaps in reporting these deaths. We used RAPID to review pregnancy-related deaths in six tertiary obstetric care facilities in three departments in Haiti. We reviewed registers and medical dossiers of deaths among women of reproductive age occurring in 2014 and 2015 from all wards, along with any additional available dossiers of deaths not appearing in registers, to capture pregnancy status, suspected cause of death, and timing of death in relation to the pregnancy. We used capture-recapture analyses to estimate the true number of in-hospital pregnancy-related deaths in these facilities. Among 373 deaths of women of reproductive age, we found 111 pregnancy-related deaths, 25.2% more than were reported through routine surveillance, and 22.5% of which were misclassified as non-pregnancy-related. Hemorrhage (27.0%) and hypertensive disorders (18.0%) were the most common categories of suspected causes of death, and deaths after termination of pregnancy were statistically significantly more common than deaths during pregnancy or delivery. Data were missing at multiple levels: 210 deaths had an undetermined pregnancy status, 48.7% of pregnancy-related deaths lacked specific information about timing of death in relation to the pregnancy, and capture-recapture analyses in three hospitals suggested that approximately one-quarter of pregnancy-related deaths were not captured by RAPID or routine surveillance. Across six

Discussion on a Public Hospital's Practice in Culture Shaping and Innovative Development.

PubMed

Zhang, Peiying

2015-05-01

Culture shaping is an important part of a hospital's quality management to enhance its medical service, improve doctor-patient relations, and cement its brand image (Jianping and Hong in Chinese Hospital Management 29(1):36-37, 2009). First built in 1953, Xuzhou Central Hospital is a tertiary general hospital in the Huaihai Economic Zone and has won a series of honorary titles for its reforms, innovations, and the level of medical services provided. In recent years, the hospital has increased its efforts in culture shaping through the construction of special departments, medical services, hospital culture, and professional ethics. This has resulted in substantial progress in the hospital's medical capabilities and service quality, and laid a solid foundation to achieve its ambitious goal of becoming a nationally prestigious hospital, among the best in Jiangsu and a regional healthcare center in the Huaihai Economic Zone.

Perceptions of patient safety culture among healthcare employees in tertiary hospitals of Heilongjiang province in northern China: a cross-sectional study.

PubMed

Li, Ying; Zhao, Yanming; Hao, Yanhua; Jiao, Mingli; Ma, Hongkun; Teng, Baijun; Yang, Kai; Sun, Tongbo; Wu, Qunhong; Qiao, Hong

2018-04-19

Assessing the patient safety culture is necessary for improving patient safety. Research on patient safety culture has attracted considerable attention. Currently, there is little research on patient safety culture in China generally, and in Heilongjiang in northern China specifically. The aim of the study is to explore the perception of healthcare employees about patient safety culture and to determine whether perception differs per sex, age, profession, years of experience, education level and marital status. Cross-sectional study. Thirteen tertiary hospitals in Heilongjiang, northern China. About 1024 healthcare employees. The perception of healthcare employees was measured using the safety attitude questionnaire, which include six dimensions. Higher scores represented more positive attitudes. An analysis of variance was used to compare socio-demographic differences per position, marital status and education; t-tests were used for sex, age and experience. A total of 1024 (85.33%) valid questionnaires were returned. The mean score of the six dimensions was 73.74/100; work conditions (80.19) had the highest score of all the dimensions, and safety climate (70.48) had the lowest. Across distinct dimensions, there were significant differences in perceptions of patient safety culture per sex, age, years of experience, position, marital status and education level (P < 0.05). The findings can help in assessing perceived patient safety culture among healthcare employees and identifying dimensions that require improvement. Interventions aimed at specific socio-demographic groups are necessary to improve patient safety culture.

Chronic Liver Disease is One of the Leading Causes of Death in Bangladesh: Experience by Death Audit from a Tertiary Hospital.

PubMed

Abedin, Mohammed Forhad; Hoque, Mohammad Mahfuzul; Md Sadequl Islam, Abu Saleh; Islam Chowdhury, Md Forhadul; Chandra das, Dulal; Begum, Syeda Anwara; Mamun, Ayub Al; Mamun-Al-Mahtab; Rahman, Salimur; Saha, Anup Kumar

2014-01-01

In industrialized countries, the audit has become an integral part of medical care. The experience from developing countries like Bangladesh is still inadequate. This study had been carried out to find out relation among some factors like age, sex, causes, diurenal variation, duration of hospital stay with death and errors in certification process. It was a cross-sectional study conducted at the Department of Medicine, Sir Salimullah Medical College (SSMC) and Mitford Hospital from March 2010 to August 2010. Information of consecutive 100 deaths was collected in a predesigned clinical data sheet within half an hour of every occurrence. Necessary data were collected from hospital case records (admission registrar, case files and death certificates) using structured checklist. Patients who were brought dead were excluded from the study. Among 100 deaths, 48% were males (n = 48) and 52% were females (n = 52). Within this group, 66.7% were males and 33.3% were females. First day (within 24 hours of admission) death accounted for 46% (n = 46) of all death and by the second day 23% (n = 23) of all deaths occurred. The highest underlying cause of death was cerebrovascular diseases (29% of total death), infectious disease contributed 20%, chronic liver disease 13%, malignancy 7%, poisoning 6%, cor pulmonale 5%, while others were 20%. In this studychronic liver disease was found to be one of the leading causes of death in our hospital and most of them occurred due to hepatic encephalopathy. So, early detection of hepatic encephalopathy and treatment is necessary to reduce hospital mortality. How to cite this article: Abedin MF, Hoque MM, Islam ASMS, Chowdhury MFI, Das DC, Begum SA, Mamun AA, Mahtab MA, Rahman S, Saha AK. Chronic Liver Disease is One of the Leading Causes of Death in Bangladesh: Experience by Death Audit from a Tertiary Hospital. Euroasian J Hepato-Gastroenterol 2014;4(1):14-17.

Pediatric retinal detachment in the Eastern Province of Saudi Arabia: experience of a tertiary care hospital.

PubMed

Cheema, Rizwan A; Al-Khars, Wajeeha; Al-Askar, Essam; Amin, Yasir M

2009-01-01

Because no previous studies have addressed the issue, we describe clinical characteristics and surgical outcome of patients with rhegmatogenous retinal detachment (RRD) in a pediatric population of the Eastern province of Saudi Arabia. We conducted a retrospective review of all consecutive cases of pediatric RRD (0-18 years) patients presenting at Dhahran Eye Specialist Hospital, a tertiary care hospital, in the Eastern Province of Saudi Arabia over a period of 3 years. Twenty patients were included in the study, accounting for 9.4% of all retinal detachment surgery cases performed over a period of 3 years (January 2006 to December 2008). The median age was 11.0 years, (range, birth to 18 years). Trauma, (45%) myopia/vitreoretinal degeneration (10%) and prior ocular surgery (25%) were significant risk factors for RRD. Proliferative vitreoretinopathy (PVR) more than grade C was present in 14/20 (70%) of cases. Most patients (15/20, 75%) were treated with pars plana vitrectomy and placement of an encircling buckle, while silicone oil or gas was used as tamponade in 13/20 (65%) patients. Surgery was successful in 17/20 (85%) cases in achieving retinal re-attachment. Visual acuity improved significantly following surgery (Mean preop 2.146 LogMAR, Mean postop 1.497 LogMAR) ( P= .014). Longer duration of RRD ( P =.007) and macular involvement ( P =.05) were associated with worse anatomical outcomes following surgery. Pediatric RRD in the Eastern province is often associated with predisposing pathology. Surgery is successful in achieving anatomical reattachment of the retina in a majority of cases with improvement of visual acuity.

Fresh-Frozen Plasma: Ordering Patterns and Utilization in the Operating Rooms of a Tertiary Referral Hospital.

PubMed

Meyer, Matthew J; Dzik, Walter H; Levine, Wilton C

2017-02-01

Blood product transfusion is the most commonly performed hospital procedure. Intraoperative blood product utilization varies between institutions and anesthesiologists. In the United States in 2011, nearly 4 million plasma units were transfused. A retrospective analysis of intraoperative plasma ordering patterns and utilization (thawing and transfusing) was performed at a tertiary, academic hospital between January 2015 and March 2016. Over 15 months, 46,002 operative procedures were performed. In 1540 of them, plasma was thawed or transfused: 8297 plasma units were thawed and 3306 of those units were transfused. These 3306 plasma units were transfused in 749 cases with a median of 2 plasma units (interquartile range, 2-4) transfused. The percentage of average monthly procedures with plasma thawed and none transfused was 51.3% (confidence interval, 49.0%-53.6%). The cardiac surgery service requested the greatest number of plasma units to be thawed (2143) but only transfused 712 (33.2%) of them. Of all plasma units not transfused, 45% were generated by procedures with 1 to 4 units of plasma thawed; 95.7% of these units were thawed as even integers (ie, 2, 4). For operative procedures, far more plasma was thawed than was transfused and this practice occurred across surgical specialties and anesthesiologists. Considering the plasma that was not transfused, 45% occurred in procedures with 4 or fewer units of plasma requested suggesting these low-volume requests were a primary source of potential waste. Further studies are needed to examine associations between plasma utilization and clinical outcomes.

Analysis of Drug Resistance Determinants in Klebsiella pneumoniae Isolates from a Tertiary-Care Hospital in Beijing, China

PubMed Central

Wang, Qi; Woo, Patrick C. Y.; Tan, Lin; Jing, Hua; Gao, George F.; Liu, Cui Hua

2012-01-01

Background The rates of multidrug-resistant (MDR), extensively drug-resistant (XDR) and pandrug-resistant (PDR) isolates among Enterobacteriaceae isolates, particularly Klebsiella pneumoniae, have risen substantially worldwide. Methodology/Principal Findings To better understand the molecular mechanisms of drug resistance in K. pneumoniae, we analyzed the drug resistance determinants for K. pneumoniae isolates collected from the 306 Hospital, a tertiary-care hospital in Beijing, China, for the period of September 1, 2010-October 31, 2011. Drug susceptibility testing, PCR amplification and sequencing of the drug resistance determinants were performed. Conjugation experiments were conducted to examine the natural ability of drug resistance to disseminate among Enterobacteriaceae strains using a sodium azide-resistant Escherichia coli J53 strain as a recipient. Among the 223 consecutive non-repetitive K. pneumoniae isolates included in this study, 101 (45.3%) were extended-spectrum beta-lactamases (ESBLs) positive. The rates of MDR, XDR, and PDR isolates were 61.4% (n = 137), 22.0% (n = 49), and 1.8% (n = 4), respectively. Among the tested drug resistance-associated genes, the following ones were detected at relatively high rates bla CTX-M-10 (80, 35.9%), aacC2 (73, 32.7%), dhfr (62, 27.8%), qnrS (58, 26.0%), aacA4 (57, 25.6%), aadA1 (56, 25.1%). Results from conjugation experiments indicate that many of the drug resistance genes were transmissible. Conclusions/Significance Our data give a “snapshot” of the complex genetic background responsible for drug resistance in K. pneumoniae in China and demonstrate that a high degree of awareness and monitoring of those drug resistance determinants are urgently needed in order to better control the emergence and transmission of drug-resistant K. pneumoniae isolates in hospital settings. PMID:22860106

Policy Innovation and Tertiary Education Graduation Rates: A Cross-Country Analysis

ERIC Educational Resources Information Center

Delaney, Jennifer A.; Yu, Patricia

2013-01-01

This study extends Trow's theory of higher education development to examine changes in national-level tertiary education graduation rates. Applying Trow's framework we arrive at three stages: (1) elite systems with gross tertiary graduation rates less than 15%, (2) massified systems with gross tertiary graduation rates between 15% and 50%, and (3)…

Features of central serous chorioretinopathy presenting at a tertiary care hospital in Lahore.

PubMed

Jamil, Ahmad Zeeshan; Mirza, Khurram Azam; Qazi, Zaheer Uddin Aqil; Iqbal, Wasim; Khaliq, Javed; Fawad-ur-Rahman; Ahmed, Arslan

2013-04-01

To evaluate the clinical, angiographic and optical coherence tomographic features of central serous chorioretinopathy in patients presenting at a tertiary care centre in Lahore. The observational study was conducted at the Layton Rehmatulla Benevolent Trust Eye and Cancer Hospital Lahore from July 15, 2010 to December 15, 2011. Patients who had received prior treatment for the condition and allergy to fluorescein were excluded. There were 86 eyes of 64 adult patients with central serous chorioretinopathy. The following data was recorded: history, signs and symptoms, best corrected visual acuity, fundus fluorescein angiography, and central macular thickness measurement with optical coherence tomography. Data was analyzed using SPSS 17. Mean age of patients who presented during the study duration was 39.52 +/- 8.85 years.There were 53 (82.8%) males and 11(17.2%) females. Of the total, 42 (65.6%) cases had unilateral and 22 (34.4%) cases had bilateral involvement. Chronic central serous chorioretinopathy was seen in 27 (42.2%) cases while 37 (57.8%) cases were acute presentations. Retinal pigment epithelial detachment was observed in 29 (45.3%) cases. On fundus fluorescein angiography, there were 62 (72.1%) eyes that showed ink blot pattern. Median visual acuity at presentation was 0.25. Median central macular thickness at presentation was 550.5micro. Central serous chorioretinopathy in the study sample was associated with pigment epithelial detachment, bilateral involvement, and presence of systemic diseases.

Tertiary survey in polytrauma patients should be an ongoing process.

PubMed

Ferree, Steven; Houwert, Roderick M; van Laarhoven, Jacqueline J E M; Smeeing, Diederik P J; Leenen, Luke P H; Hietbrink, Falco

2016-04-01

Due to prioritisation in the initial trauma care, non-life threatening injuries can be overlooked or temporally neglected. Polytrauma patients in particular might be at risk for delayed diagnosed injuries (DDI). Studies that solely focus on DDI in polytrauma patients are not available. Therefore the aim of this study was to analyze DDI and determine risk factors associated with DDI in polytrauma patients. In this single centre retrospective cohort study, patients were considered polytrauma when the Injury Severity Score was ≥ 16 as a result of injury in at least 2 body regions. Adult polytrauma patients admitted from 2007 until 2012 were identified. Hospital charts were reviewed to identify DDI. 1416 polytrauma patients were analyzed of which 12% had DDI. Most DDI were found during initial hospital admission after tertiary survey (63%). Extremities were the most affected regions for all types of DDI (78%) with the highest intervention rate (35%). Most prevalent DDI were fractures of the hand (54%) and foot (38%). In 2% of all patients a DDI was found after discharge, consisting mainly of injuries other than a fracture. High energy trauma mechanism (OR 1.8, 95% CI 1.2-2.7), abdominal injury (OR 1.5, 95% CI 1.1-2.1) and extremity injuries found during initial assessment (OR 2.3, 95% CI 1.6-3.3) were independent risk factors for DDI. In polytrauma patients, most DDI were found during hospital admission but after tertiary survey. This demonstrates that the tertiary survey should be an ongoing process and thus repeated daily in polytrauma patients. Most frequent DDI were extremity injuries, especially injuries of the hand and foot. Copyright © 2015 Elsevier Ltd. All rights reserved.

Relationship between occupational stress and depressive mood among interns and residents in a tertiary hospital, Seoul, Korea.

PubMed

Kim, Keon; Lee, Sunhwa; Choi, Yoon Hee

2015-06-01

Occupational stress can have a harmful effect on the individual both physically and psychologically. In Korea, occupational stress of physician is rarely demonstrated. Although it is well reported that physicians tend to have a high incidence of minor psychiatric disorders, the magnitude of the problem remains unclear. Interns and residents are thought to be under substantial amount of stress, and tend to have psychiatric disorder. In this paper, we aimed to evaluate the relationship between the occupational stress and depression of residents. The participants of this study were surgical and medical residents in a tertiary hospital in Korea. For measurement of occupational stress, we used an occupational stress scale. In addition, to evaluate the prevalence of depression, we used the Beck Depression Inventory. Female doctors showed higher degree of occupational stress than the males. The interns and chief residents showed higher degree of occupational stress than the other residents. Interestingly, in this study, most of the participants experienced a depressive mood. Compared with the general population, job demand and culture of workplace were high. Occupational stress was the only significant predictor of a depressive mood. Hospital residents experience a high degree of occupational stress leading to a depressed mood due to various risk factors. Therefore, it is essential to recognize the occupational stress of residents early, to encourage positive competition and peer and social support, and to help improve the residents' ability to cope with stress.

Results of level-II oncoplasty in breast cancer patients: an early experience from a tertiary care hospital in Pakistan.

PubMed

Qureshi, Sajida; Ghazanfar, Shahriyar; Iqbal, Sumera; Bhatti, Abu Bakar Hafeez; Quraishy, Mohammad Saeed

2014-03-01

To assess the oncologic and cosmetic outcomes for breast cancer patients who underwent breast conservation therapy using Level II oncoplasty techniques. The prospective, non-randomised and descriptive study was conducted at the Department of Surgery, Unit IV of Civil Hospital, Karachi, from December 2009 to November 2011 in which 21 consecutive women with breast carcinoma who underwent wide local excision with remodeling mammoplasty were enrolled. All patients were reviewed by the surgeon and medical oncologist every 3 months for the first year. A grading system of 5-1 (excellent to poor) was employed and those with 3 or more were considered to have acceptable results. The mean patient age was 45.38 +/- 10.09 years (range: 26-70); 11 (52.3%) were premenopausal and 10 (47.7%) were postmenopausal; and 5 (27.8%) had family history of breast cancer. The mean size of the tumour determined by histology was 59.9 +/- 3.18 mm (range: 25-150). Eight (30%) patients received preoperative chemotherapy to downsize the tumour. Three (14.2%) patients received preoperative radiotherapy. Mean operative time was 1.59 +/- 0.52 hours (range: 1-2.5 hours). Mean volume of breast tissue excised from the breast containing the tumour was 545.27 +/- 412.06 cm3 (range: 43.70-1456). Assessment of excision margins showed no tumour at the margins of 19 (90.4%) patients. Two (9.5%) patients had close but negative margins. The mean hospital stay was 7.10 +/- 3.30 days (range: 4-15). There were early complications in 4 (19%) patients. One (4.76%) patient had late complications. Two (9.5%) patients developed tumour recurrence; both had an ipsilateral tumour recurrence. None of the patients developed metastases and one died of cardiac problem. Twenty (95.2%) patients had an acceptable post-surgical cosmetic result. Level II oncoplasty was a safe option in breast conservation allowing large-sized and difficult-location tumour excision with good cosmetic outcome in the study group. There is a need to

Circulation of Highly Drug-Resistant Clostridium difficile Ribotypes 027 and 001 in Two Tertiary-Care Hospitals in Mexico.

PubMed

Martínez-Meléndez, Adrián; Tijerina-Rodríguez, Laura; Morfin-Otero, Rayo; Camacho-Ortíz, Adrián; Villarreal-Treviño, Licet; Sánchez-Alanís, Hugo; Rodríguez-Noriega, Eduardo; Baines, Simon D; Flores-Treviño, Samantha; Maldonado-Garza, Héctor Jesús; Garza-González, Elvira

2018-05-01

To assess drug susceptibility and characterize Clostridium difficile ribotypes in isolates from two tertiary-care hospitals in Mexico. Isolates were evaluated for genotyping, antimicrobial susceptibility testing and detection of mutations associated with drug resistance. PCR ribotyping was performed using a combination of gel-based and capillary electrophoresis-based approaches. MIC 50 and MIC 90 were ≥128 mg/L for ciprofloxacin, erythromycin, clindamycin, and rifampicin. There was no reduced susceptibility to metronidazole or tetracycline; however, reduced susceptibility to vancomycin (≥4 mg/L) and fidaxomicin (≥2 mg/L) was detected in 50 (40.3%) and 4 (3.2%) isolates, respectively. Furthermore, the rpoB Arg505Lys mutation was more frequently detected in isolates with high minimum inhibitory concentration (MIC) to rifampicin (≥32 mg/L) (OR = 52.5; 95% CI = 5.17-532.6; p < 0.000). Of the 124 C. difficile isolates recovered, 84 (66.7%) were of ribotype 027, 18 (14.5%) of ribotype 001, and the remainder were other ribotypes (353, 255, 220, 208, 176, 106, 076, 020, 019, 017, 014, 012, 003, and 002). Ribotypes 027 and 001 were the most frequent C. difficile isolates recovered in this study, and demonstrated higher MICs. Furthermore, we found four isolates with reduced susceptibility to fidaxomicin, raising a concern since this drug is currently unavailable in Mexican Hospitals.

Analysis of pattern of mortality in Medicine and Allied Departments at a tertiary care hospital in Islamabad: A losing battle against sepsis.

PubMed

Azim, Saad; Zahoor, Sidra; Janjua, Jamal; Majeed, Azer; Hussain, Syed Waqar

2017-01-01

To identify the pattern of mortality in medical wards of a tertiary care hospital. This retrospective study was conducted at the Khan Research Laboratories Hospital, Islamabad, Pakistan, and comprised medical records of people who died during hospital stay between December 2013 and November 2014.SPSS 11 was used for data analysis. Of the 3,228 admissions, 105(3.25%) patients expired. Of them, 41(39.04%) were men with a mean age of 55±13.48 years (range: 17-88 years) and 64±11.76 (60.9%) were women with a mean age of 61±15.5 years (range: 23-91 years). The mean length of time between admission and death was 6.58±3.7 days (range: 1-33 days). The causes of death were categorised as infectious in 37(35.23%) patients, cancer-related in 20(19.045%), pulmonary in 19(18.09%), cardiovascular in 18(17.14%), gastrointestinal and neurological in 13(12.38%) each, nephrology in 10(9.52%), autoimmune disorders in 6(5.71%) and miscellaneous in 9(8.57%). Complications of sepsis were the most common cause of death in 38(36.19%) cases. Sepsis, primarily from pneumonia, was the major cause of mortality.

Susceptibility of Rubella Among Pregnant Women Attending the Antenatal Clinic in a Tertiary Care Hospital, Jabalpur, Central India.

PubMed

Kori, Bhupesh K; Singh, Kavita N; Sharma, Ravendra K; Sharma, Bhagwati S; Badkur, Poorva; Barde, Pradip V

2017-03-01

The purpose of this study was to evaluate rubella susceptibility of pregnant women from central India as rubella infection can be devastating for the newborn if it occurs in the mother in the first trimester of pregnancy, which may lead to congenital rubella syndrome (CRS). There are very few studies about seroprevalence of rubella from India and none from central India. The study was conducted among women attending the obstetric department of a tertiary care hospital, in which 369 antenatal cases were tested for the presence of immunoglobulin G antibody for rubella and its titer. Data were analyzed using statistical tests. A total of 141 (38.2%) women were found susceptible to rubella. There was no significant difference in rubella susceptibility among different socioeconomic classes, ages, and gravidity. A large proportion of pregnant women were found to be rubella susceptible, posing immense threat of CRS to their newborns. A robust program for rubella immunization targeting young adult women is needed to avoid CRS.

Study of adverse drug reactions in patients with diabetes attending a tertiary care hospital in New Delhi, India.

PubMed

Singh, Abhishank; Dwivedi, Shridhar

2017-02-01

The present prospective observational study was carried out in a tertiary care hospital in New Delhi, India from May 2014 to June 2015 to report adverse drug reactions (ADRs) in patients with type 2 diabetes mellitus (T2DM) using antidiabetic drugs. A total of 220 patients (121 males, 99 females) were enrolled. ADRs were recorded on the prescribed form. Causality and severity assessment was done using Naranjo's probability scale and modified Hartwig and Siegel's severity scale, respectively. Commonly prescribed drugs were biguanides, peptide hormone and sulphonylurea. A total of 26 ADRs were recorded (16 in males and 10 in females). Most commonly observed ADRs were related to endocrine and gastrointestinal system. Severity assessment of ADRs showed seven (26.9%) ADRs as moderate, and 19 (73.1%) as mild. No severe reactions were observed. ADRs were mostly related to endocrine and gastrointestinal system. More information on prescribed drugs and their side effects is required for ensuring patient safety.

Understanding levels of morbidity and hospitalization in Kerala, India.

PubMed Central

Dilip, T. R.

2002-01-01

The prevalence of ailments and hospitalization in Kerala was examined using data from the 52 nd National Sample Survey Data on Health Care in Kerala in 1995-6. The survey included 24401 people from 4928 households. Age and seasonality had considerable effects on the morbidity of individuals. The burden of ill health was higher in rural areas than in urban areas. People who were more likely to have a better lifestyle had a higher level of morbidity and hospitalization. Regional differences were seen, with levels of morbidity and hospitalization higher in the comparatively developed regions of Southern Kerala than in Northern Kerala. Factors like physical accessibility of health care services and capacity to seek health care services could create artificial differences in morbidity and hospitalization among different subgroups of the population in Kerala. PMID:12378294

In vitro activity of tigecycline and comparators against gram-negative bacteria isolated from a tertiary hospital in Alexandria, Egypt.

PubMed

Mohamed, Nelly M; Youssef, Alaa A F

2011-12-01

The emergence of infections caused by multidrug-resistant Gram-negative bacteria, in particular Pseudomonas aeruginosa, Acinetobacter baumannii, and Klebsiella pneumoniae, has necessitated the search for alternative therapy by either introducing new agents or renewing interest in old agents. This study compares the in vitro activity of tigecycline (TIG), recently introduced to Egyptian market, to other potentially active antimicrobials as Colistin (COL), imipenem (IPM), levofloxacin (LEV), and piperacillin/tazobactam (PIP/TAZ) against 67 Gram-negative clinical isolates obtained from El- Meery Hospital in Alexandria, Egypt. El-Meery Hospital is a 1,500-bed tertiary teaching hospital where TIG has not been previously used. Based on MIC(90)s, TIG was found to be a comparator to IPM and COL (MIC(90)= 8 μg/ml). LEV and PIP/TAZ were less active than TIG exhibiting high MIC(90)s. TIG inhibited 100% of Escherichia coli and K. pneumoniae and 60% of Ps. aeruginosa and A. baumannii isolates. In time-kill studies against IPM-resistant isolates, TIG showed bactericidal activity after 6 hours of contact against the Enterobacteriaceae isolates and after 3 hours for the tested Ps. aeruginosa isolates at 4× and 8× MIC. Against A. baumannii, TIG exerted a bacteriostatic effect. TIG demonstrated variable ability to suppress biofilm formation affecting mainly E. coli and A. baumannii isolates. These results point TIG to be a promising agent in treatment of infections caused by strains for which adequate therapy has been limited. As far as we know, this is the first report evaluating the in vitro activity of TIG against Egyptian clinical isolates.

Psychosocial Factors in End-Stage Kidney Disease Patients at a Tertiary Hospital in Australia

PubMed Central

Bale, Charan; Jegatheesan, Dev; Pham, Linh; Huynh, Sonny; Mulay, Atul

2016-01-01

Aim. This study seeks to review the psychosocial factors affecting patients with end-stage kidney disease (ESKD) from a tertiary hospital in Australia. Methods. We audited patients with ESKD, referred to social work services from January 2012 to December 2014. All patients underwent psychosocial assessments by one, full-time renal social worker. Patient demographics, cumulative social issues, and subsequent interventions were recorded directly into a database. Results. Of the 244 patients referred, the majority were >60 years (58.6%), male (60.7%), born in Australia (62.3%), on haemodialysis (51.6%), and reliant on government financial assistance (88%). Adjustment issues (41%), financial concerns (38.5%), domestic assistance (35.2%), and treatment nonadherence (21.3%) were the predominant reasons for social work consultation. Younger age, referral prior to start of dialysis, and unemployment were significant independent predictors of increased risk of adjustment issues (p = 0.004, <0.001, and =0.018, resp.). Independent risk factors for treatment nonadherence included age and financial and employment status (p = 0.041, 0.052, and 0.008, resp.). Conclusion. Psychosocial and demographic factors were associated with treatment nonadherence and adjustment difficulties. Additional social work support and counselling, in addition to financial assistance from government and nongovernment agencies, may help to improve adjustment to the diagnosis and treatment plans as patients approach ESKD. PMID:27807482

Staff Perception on Biomedical or Health Care Waste Management: A Qualitative Study in a Rural Tertiary Care Hospital in India

PubMed Central

Joshi, Rita; Shah, Harshada; Sharma, Megha; Pathak, Ashish; Macaden, Ragini; Stålsby Lundborg, Cecilia

2015-01-01

Background Health care or biomedical waste, if not managed properly, can be of high risk to the hospital staff, the patients, the community, public health and the environment, especially in low and middle income settings where proper disposal norms are often not followed. Our aim was to explore perceptions of staff of an Indian rural tertiary care teaching hospital on hospital waste management. Method A qualitative study was conducted using 10 focus group discussions (FGDs), with different professional groups, cleaning staff, nurses, medical students, doctors and administrators. The FGD guide included the following topics: (i) role of Health Care Waste Management (HCWM) in prevention of health care associated infections, (ii) awareness of and views about HCWM-related guidelines/legislation, (iii) current HCWM practices, (iv) perception and preparedness related to improvements of the current practices, and (v) proper implementation of the available guidelines/legislation. The FGDs were recorded, transcribed verbatim, translated to English (when conducted in Hindi) and analysed using content analysis. Results Two themes were identified: Theme (A), ‘Challenges in integration of HCWM in organizational practice,’ with the categories (I) Awareness and views about HCWM, (II) Organizational practices regarding HCWM, and (III) Challenges in Implementation of HCWM; and Theme (B), ‘Interventions to improve HCWM,’ with three categories, (I) Educational and motivational interventions, (II) Organizational culture change, and (III) Policy-related interventions. Conclusion A gap between knowledge and actual practice regarding HCWM was highlighted in the perception of the hospital staff. The participants suggested organizational changes, training and monitoring to address this. The information generated is relevant not merely to the microsystem studied but to other institutions in similar settings. PMID:26023783

Blood and Blood Product Conservation: Results of Strategies to Improve Clinical Outcomes in Open Heart Surgery Patients at a Tertiary Hospital.

PubMed

Khan, Junaid H; Green, Emily A; Chang, Jimmin; Ayala, Alexandria M; Barkin, Marilyn S; Reinys, Emily E; Stanton, Jeffrey; Stanten, Russell D

2017-12-01

Blood product usage is a quality outcome for patients undergoing cardiac surgery. To address an increase in blood product usage since the discontinuation of aprotinin, blood conservation strategies were initiated at a tertiary hospital in Oakland, CA. Improving transfusion rates for open heart surgery patients requiring Cardiopulmonary bypass (CPB) involved multiple departments in coordination. Specific changes to conserve blood product usage included advanced CPB technology upgrades, and precise individualized heparin dose response titration assay for heparin and protamine management. Retrospective analysis of blood product usage pre-implementation, post-CPB changes and post-Hemostasis Management System (HMS) implementation was done to determine the effectiveness of the blood conservation strategies. Statistically significant decrease in packed red blood cells, fresh frozen plasma, cryoprecipitate, and platelet usage over the stepped implementation of both technologies was observed. New oxygenator and centrifugal pump technologies reduced active circuitry volume and caused less damage to blood cells. Individualizing heparin and protamine dosing to a patient using the HMS led to transfusion reductions as well. Overall trends toward reductions in hospital length of stay and intensive care unit stay, and as a result, blood product cost and total hospitalization cost are positive over the period of implementation of both CPB circuit changes and HMS implementation. Although they are multifactorial in nature, these trends provide positive enforcement to the changes implemented.

[Noise level in a care and teaching hospital institution].

PubMed

Mendoza-Sánchez, R S; Roque-Sánchez, R H; Moncada-González, B

1996-01-01

Noise in the environment is increasing over the years. Disturbances produced by noise are varied, some lead to serious health consequences. Noise level was registered in a teaching hospital. Levels in the wards were between 50 and 59 dB. In the Intensive Care Unit, main hallways and outpatients department levels were higher than 59 dB. Isolated peaks up to 90.0 dB (Pediatrics) were detected. The noise level recommended for a hospital is under 50.0 dB. We found that the principal source of noise came from the medical and nursing staff.

Management and outcomes of acute ST-segment-elevation myocardial infarction at a tertiary-care hospital in Sri Lanka: an observational study.

PubMed

Bandara, Ruwanthi; Medagama, Arjuna; Munasinghe, Ruwan; Dinamithra, Nandana; Subasinghe, Amila; Herath, Jayantha; Ratnayake, Mahesh; Imbulpitiya, Buddhini; Sulaiman, Ameena

2015-01-15

Sri Lanka is a developing country with a high rate of cardiovascular mortality. It is still largely dependent on thrombolysis for primary management of acute myocardial infarction. The aim of this study was to present current data on the presentation, management, and outcomes of acute ST-segment-elevation myocardial infarction (STEMI) at a tertiary-care hospital in Sri Lanka. Eighty-one patients with acute STEMI presenting to a teaching hospital in Peradeniya, Sri Lanka, were included in this observational study. Median interval between symptom onset and hospital presentation was 60 min (mean 212 min). Thrombolysis was performed in 73% of patients. The most common single reason for not performing thrombolysis was delayed presentation. Median door-to-needle time was 64 min (mean, 98 min). Only 16.9% of patients received thrombolysis within 30 min, and none underwent primary PCI. Over 98% of patients received aspirin, clopidogrel, and a statin on admission. Intravenous and oral beta blockers were rarely used. Follow-up data were available for 93.8% of patients at 1 year. One-year mortality rate was 12.3%. Coronary intervention was performed in only 7.3% of patients post infarction. Late presentation to hospital remains a critical factor in thrombolysis of STEMI patients in Sri Lanka. Thrombolysis was not performed within 30 min of admission in the majority of patients. First-contact physicians should receive further training on effective thrombolysis, and there is an urgent need to explore the ways in which PCI and post-infarction interventions can be incorporated into treatment protocols.

Dinoflagellate and calcareous nannofossil response to sea-level change in Cretaceous-Tertiary boundary sections

DOE Office of Scientific and Technical Information (OSTI.GOV)

Habib, D.; Moshkovitz, S.; Kramer, C.

1992-02-01

Stratigraphic sections in south-central Alabama were studied to test palynological evidence of sea-level change across the Cretaceous-Tertiary boundary. New evidence from both calcareous nannofossils and dinoflagellate cysts places the regional disconformity in Alabama (Type 1 sequence boundary) virtually at the K-T boundary. This suggests that sea-level fall may have contributed to mass-extinction event. Dinoflagellate diversity varies between systems tract components of coastal onlap. This parameter is useful for interpreting sea-level change in this part of the section, because dinoflagellates did not participate in the mass extinction. The iridium spikes in the roadcut near Braggs are of earliest Danian age andmore » correlate in relative magnitude with the lower values reported from directly above the K-T boundary in the Gubbio stratotype section. Iridium was concentrated in marine flooding surfaces in episodes of higher productivity of algal organic matter at the time when the iridium-enriched ocean encroached on the shelf during the first Cenozoic episode of sea-level rise.« less

Factors Relating to Acceptance of Hepatitis B Virus Vaccination by Nursing Students in a Tertiary Hospital, Pakistan

PubMed Central

Mengal, Hafeez-ur-Rehman; Howteerakul, Nopporn; Suwannapong, Nawarat; Rajatanun, Thitipat

2008-01-01

This cross-sectional study aimed at assessing the prevalence of, and factors relating to, the acceptance of hepatitis B virus (HBV) vaccination by nursing students in a tertiary hospital in Pakistan. In total, 210 nursing students of Year 2 to Year 4 were invited to participate in the study; of them, 196 (93.3%) returned completed questionnaires. Overall, the prevalence of acceptance of HBV vaccination among them was 75.0%. Of these, 37.2% (73/196) were completely vaccinated, and 25.0% (49/196) had not been vaccinated at all. More than half (27/49, 55.1%) of the unvaccinated nursing students stated that they would accept vaccination if offered. Multiple logistic regression analysis indicated three variables significantly related to acceptance of HBV vaccination: history of accidental exposure to blood or blood products, acceptable knowledge about HBV infection, and adequate budget for HBV vaccination. Health institutions should allocate adequate budgets to vaccinate their nursing students. Effective intervention programmes designed to increase knowledge about HBV infection and adhering to universally-accepted precautions are needed. PMID:18637527

The pattern of the discovery of medication errors in a tertiary hospital in Hong Kong.

PubMed

Samaranayake, N R; Cheung, S T D; Chui, W C M; Cheung, B M Y

2013-06-01

The primary goal of reducing medication errors is to eliminate those that reach the patient. We aimed to study the pattern of interceptions to tackle medication errors along the medication use processes. Tertiary care hospital in Hong Kong. The 'Swiss Cheese Model' was used to explain the interceptions targeting medication error reporting over 5 years (2006-2010). Proportions of prescribing, dispensing and drug administration errors intercepted by pharmacists and nurses; proportions of prescribing, dispensing and drug administration errors that reached the patient. Our analysis included 1,268 in-patient medication errors, of which 53.4% were related to prescribing, 29.0% to administration and 17.6% to dispensing. 34.1% of all medication errors (4.9% prescribing, 26.8% drug administration and 2.4% dispensing) were not intercepted. Pharmacy staff intercepted 85.4% of the prescribing errors. Nurses detected 83.0% of dispensing and 5.0% of prescribing errors. However, 92.4% of all drug administration errors reached the patient. Having a preventive measure at each stage of the medication use process helps to prevent most errors. Most drug administration errors reach the patient as there is no defense against these. Therefore, more interventions to prevent drug administration errors are warranted.

Occurrence of Acquired 16S rRNA Methyltransferase-Mediated Aminoglycoside Resistance in Clinical Isolates of Enterobacteriaceae within a Tertiary Referral Hospital of Northeast India

PubMed Central

Wangkheimayum, Jayalaxmi; Paul, Deepjyoti; Dhar, Debadatta; Nepram, Rajlakshmi; Chetri, Shiela; Bhowmik, Deepshikha; Chakravarty, Atanu

2017-01-01

ABSTRACT The methylation of a ribosomal target leads to a high level of resistance to all clinically relevant aminoglycoside antibiotics, so early detection of these resistance determinants will help to reduce the incidence of treatment failures as well as lessen the dissemination rate. Here, we characterized different 16S rRNA methyltransferases responsible for aminoglycoside resistance and their epidemiological background in clinical isolates of Enterobacteriaceae in a tertiary referral hospital in India. All aminoglycoside-resistant isolates were screened for different 16S rRNA methyltransferases by PCR assay, and incompatibility typing of the conjugable plasmid harboring resistance genes was performed by PCR-based replicon typing. An assay for the stability and elimination of these resistance plasmids was performed. The coexistence of extended-spectrum β-lactamases and metallo-β-lactamases was also detected, and the heterogeneity of these isolates was determined by enterobacterial repetitive intergenic consensus PCR. The PCR assay revealed the presence of armA, rmtA, rmtB, rmtC, and rmtD in single and multiple combinations, and these were carried by a diverse group of Inc plasmids. Plasmids harboring these resistance determinants were highly stable and maintained until the 55th serial passage, but SDS treatment could easily eliminate the plasmids harboring the resistance determinants. The coexistence of blaTEM, blaPER, blaGES, and blaSHV, as well as blaVIM and blaNDM, within these isolates was also detected. Strains with different clonal patterns of aminoglycoside resistance were found to spread in this hospital setting. We observed that the 16S rRNA methyltransferase genes were encoded within different Inc plasmid types, suggesting diverse origins and sources of acquisition. Therefore, the present study is of epidemiological importance and can have a role in infection control policy in hospital settings. PMID:28320725

Pre-treatment loss to follow-up among smear-positive TB patients in tertiary hospitals, Quetta, Pakistan.

PubMed

Wali, A; Kumar, A M V; Hinderaker, S G; Heldal, E; Qadeer, E; Fatima, R; Ullah, A; Safdar, N; Yaqoob, A; Anwar, K; Ul Haq, M

2017-03-21

Setting: Three public sector tertiary care hospitals in Quetta, Balochistan, Pakistan, with anecdotal evidence of gaps between the diagnosis and treatment of patients with tuberculosis (TB). Objectives: To assess the proportion of pre-treatment loss to follow-up (LTFU), defined as no documented evidence of treatment initiation or referral in TB registers, among smear-positive pulmonary TB patients diagnosed in 2015, and the associated sociodemographic factors. Design: A retrospective cohort study involving the review of laboratory and TB registers. Results: Of 1110 smear-positive TB patients diagnosed (58% female, median age 40 years, 5% from outside the province or the country), 235 (21.2%) were lost to follow-up before starting treatment. Pre-treatment LTFU was higher among males; in patients residing far away, in rural areas, outside the province or the country; and in those without a mobile phone number. Conclusion: About one fifth of the smear-positive TB patients were lost to follow-up before starting treatment. Strengthening the referral and feedback mechanisms and using information technology to improve the tracing of patients is urgently required. Further qualitative research is needed to understand the reasons for pre-treatment LTFU from the patient's perspective.

Pre-treatment loss to follow-up among smear-positive TB patients in tertiary hospitals, Quetta, Pakistan

PubMed Central

Kumar, A. M. V.; Hinderaker, S. G.; Heldal, E.; Qadeer, E.; Fatima, R.; Ullah, A.; Safdar, N.; Yaqoob, A.; Anwar, K.; Ul Haq, M.

2017-01-01

Setting: Three public sector tertiary care hospitals in Quetta, Balochistan, Pakistan, with anecdotal evidence of gaps between the diagnosis and treatment of patients with tuberculosis (TB). Objectives: To assess the proportion of pre-treatment loss to follow-up (LTFU), defined as no documented evidence of treatment initiation or referral in TB registers, among smear-positive pulmonary TB patients diagnosed in 2015, and the associated sociodemographic factors. Design: A retrospective cohort study involving the review of laboratory and TB registers. Results: Of 1110 smear-positive TB patients diagnosed (58% female, median age 40 years, 5% from outside the province or the country), 235 (21.2%) were lost to follow-up before starting treatment. Pre-treatment LTFU was higher among males; in patients residing far away, in rural areas, outside the province or the country; and in those without a mobile phone number. Conclusion: About one fifth of the smear-positive TB patients were lost to follow-up before starting treatment. Strengthening the referral and feedback mechanisms and using information technology to improve the tracing of patients is urgently required. Further qualitative research is needed to understand the reasons for pre-treatment LTFU from the patient's perspective. PMID:28775939

Healthcare waste management: qualitative and quantitative appraisal of nurses in a tertiary care hospital of India.

PubMed

Shivalli, Siddharudha; Sanklapur, Vasudha

2014-01-01

The nurse's role in healthcare waste management is crucial. (1) To appraise nurses quantitatively and qualitatively regarding healthcare waste management; (2) to elicit the determinants of knowledge and attitudes of healthcare waste management. A cross-sectional study was undertaken at a tertiary care hospital of Mangalore, India. Self-administered pretested questionnaire and "nonparticipatory observation" were used for quantitative and qualitative appraisals. Percentage knowledge score was calculated based on their total knowledge score. Nurses' knowledge was categorized as excellent (>70%), good (50-70%), and poor (<50%). Chi square test was applied to judge the association of study variables with their attitudes and knowledge. Out of 100 nurses 47 had excellent knowledge (>70% score). Most (86%) expressed the need of refresher training. No study variable displayed significant association (P > 0.05) with knowledge. Apt segregation practices were followed except in casualty. Patients and entourages misinterpreted the colored containers. Nurses' knowledge and healthcare waste management practices were not satisfactory. There is a need of refresher trainings at optimum intervals to ensure sustainability and further improvement. Educating patients and their entourages and display of segregation information board in local language are recommended.

Measles outbreak in a tertiary level hospital, Porto, Portugal, 2018: challenges in the post-elimination era.

PubMed

Sá Machado, Rita; Perez Duque, Mariana; Almeida, Soraia; Cruz, Ivo; Sottomayor, Ana; Almeida, Isabel; R Oliveira, Júlio; Antunes, Delfina

2018-05-01

A measles outbreak has been occurring in a healthcare setting in Porto, Portugal, since early March 2018, posing public health challenges for a central hospital and the community. Up to 22 April, 96 cases were confirmed, 67 in vaccinated healthcare workers, mostly between 18-39 years old. Following identification of the first cases, control measures were rapidly implemented. Concomitantly, other measles cases were notified in the Northern Region of the country. No common epidemiological link was identified.

Technology-related medication errors in a tertiary hospital: a 5-year analysis of reported medication incidents.

PubMed

Samaranayake, N R; Cheung, S T D; Chui, W C M; Cheung, B M Y

2012-12-01

Healthcare technology is meant to reduce medication errors. The objective of this study was to assess unintended errors related to technologies in the medication use process. Medication incidents reported from 2006 to 2010 in a main tertiary care hospital were analysed by a pharmacist and technology-related errors were identified. Technology-related errors were further classified as socio-technical errors and device errors. This analysis was conducted using data from medication incident reports which may represent only a small proportion of medication errors that actually takes place in a hospital. Hence, interpretation of results must be tentative. 1538 medication incidents were reported. 17.1% of all incidents were technology-related, of which only 1.9% were device errors, whereas most were socio-technical errors (98.1%). Of these, 61.2% were linked to computerised prescription order entry, 23.2% to bar-coded patient identification labels, 7.2% to infusion pumps, 6.8% to computer-aided dispensing label generation and 1.5% to other technologies. The immediate causes for technology-related errors included, poor interface between user and computer (68.1%), improper procedures or rule violations (22.1%), poor interface between user and infusion pump (4.9%), technical defects (1.9%) and others (3.0%). In 11.4% of the technology-related incidents, the error was detected after the drug had been administered. A considerable proportion of all incidents were technology-related. Most errors were due to socio-technical issues. Unintended and unanticipated errors may happen when using technologies. Therefore, when using technologies, system improvement, awareness, training and monitoring are needed to minimise medication errors. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Radioactive Waste Management in A Hospital

PubMed Central

Khan, Shoukat; Syed, AT; Ahmad, Reyaz; Rather, Tanveer A.; Ajaz, M; Jan, FA

2010-01-01

Most of the tertiary care hospitals use radioisotopes for diagnostic and therapeutic applications. Safe disposal of the radioactive waste is a vital component of the overall management of the hospital waste. An important objective in radioactive waste management is to ensure that the radiation exposure to an individual (Public, Radiation worker, Patient) and the environment does not exceed the prescribed safe limits. Disposal of Radioactive waste in public domain is undertaken in accordance with the Atomic Energy (Safe disposal of radioactive waste) rules of 1987 promulgated by the Indian Central Government Atomic Energy Act 1962. Any prospective plan of a hospital that intends using radioisotopes for diagnostic and therapeutic procedures needs to have sufficient infrastructural and manpower resources to keep its ambient radiation levels within specified safe limits. Regular monitoring of hospital area and radiation workers is mandatory to assess the quality of radiation safety. Records should be maintained to identify the quality and quantity of radioactive waste generated and the mode of its disposal. Radiation Safety officer plays a key role in the waste disposal operations. PMID:21475524

Radioactive waste management in a hospital.

PubMed

Khan, Shoukat; Syed, At; Ahmad, Reyaz; Rather, Tanveer A; Ajaz, M; Jan, Fa

2010-01-01

Most of the tertiary care hospitals use radioisotopes for diagnostic and therapeutic applications. Safe disposal of the radioactive waste is a vital component of the overall management of the hospital waste. An important objective in radioactive waste management is to ensure that the radiation exposure to an individual (Public, Radiation worker, Patient) and the environment does not exceed the prescribed safe limits. Disposal of Radioactive waste in public domain is undertaken in accordance with the Atomic Energy (Safe disposal of radioactive waste) rules of 1987 promulgated by the Indian Central Government Atomic Energy Act 1962. Any prospective plan of a hospital that intends using radioisotopes for diagnostic and therapeutic procedures needs to have sufficient infrastructural and manpower resources to keep its ambient radiation levels within specified safe limits. Regular monitoring of hospital area and radiation workers is mandatory to assess the quality of radiation safety. Records should be maintained to identify the quality and quantity of radioactive waste generated and the mode of its disposal. Radiation Safety officer plays a key role in the waste disposal operations.

Social media use profile, social skills, and nurse-patient interaction among Registered Nurses in tertiary hospitals: A structural equation model analysis.

PubMed

Mariano, Micah Celine O; Maniego, John Christian M; Manila, Hariette Lou Marie D; Mapanoo, Ram Cedrick C; Maquiran, Kerwin Miguel A; Macindo, John Rey B; Tejero, Lourdes Marie S; Torres, Gian Carlo S

2018-04-01

Social media has become increasingly important over the past decades and has been integrated in various environments, including the healthcare setting. Yet, the influence of social media use on the social skills and nurse-patient interaction of nurses is an area in nursing that requires further studies. This study determined the interrelationships among social media use profile, social skills, and nurse-patient interaction of Registered Nurses in tertiary hospitals. Employing structural equation modeling, a descriptive-correlational study was conducted among 212 consecutively-selected nurses from two tertiary hospitals. Consenting respondents completed a two-part survey composed of the respondent profile sheet and the Social Skills Inventory. The respondent profile sheet assessed demographic profile and social media use profile in terms of the mode, frequency, and duration of utilization. Three trained team members observed each nurse-patient dyad and completed the Nurse-Patient Bonding Instrument. A good fit model illustrated the negative effects of frequent social media use to patient openness (β = -0.18, p < 0.05) and engagement (β = -0.11, p ≤ 0.05). Longer use of social media on a daily basis, however, positively affected both dimensions of social skills. Accessing social media platforms using non-handheld devices showed the most influential positive effects to social skills and nurse-patient interaction. Additionally, although verbal social skills positively affected most dimensions of nurse-patient interaction, non-verbal social skills negatively influenced patient engagement (β = -0.19, p = 0.019) and nurse openness (β = -0.38, p ≤ 0.05). The structural model illustrates the effects of using social media on the social skills and nurse-patient interaction of nurses and emphasizes the need for implementing institutional policies on the judicious use and application of social media in the workplace. Further, social

A Study of Workplace Violence Experienced by Doctors and Associated Risk Factors in a Tertiary Care Hospital of South Delhi, India

PubMed Central

Kumar, Mukesh; Das, Timiresh; Pardeshi, Geeta; Kishore, Jugal; Padmanandan, Arun

2016-01-01

Introduction The increasing incidences of violence against doctors in their workplaces are an important reason for stress among these healthcare workers. Many incidences of workplace violence against doctors have been reported in the past and are also being continuously reported from different parts of the country as well as the world. Aim To determine the prevalence of workplace violence among doctors and to study the associated risk factors in a tertiary care hospital of Delhi, India. Material and Methods A cross-sectional study was conducted using a self-administered semi-structured questionnaire. The contents were: data related to the workplace, incidences at work, violence prevention policy of the institution, reporting of incidences and follow-up, education and training for violence management. A total of 151 doctors participated in the study. Results Total participants in the study were 151. The mean age of study participants was 26.73±4.24 years. Almost half (47.02%; 44.56% of males and 50.84% of females) of the doctors reported having an experience of violence during work hours in past 12 months. Among the cases, 39.4% were reported from Department of Obstetrics and Gynaecology while Surgery, Medicine and other departments reported 29.6%, 26.8% and 4.2% respectively. Patients or their relatives were perpetrators in most of the cases. Maximum (87.3%) of the reported cases were of verbal violence while 8.6% of the cases were of physical violence. Younger doctors with less work experience were more prone to physical violence. Regarding the time of violence, 35.1% of such cases occurred during afternoon while 30.1% of them took place at night. Conclusion A large number of doctors had experienced violence in past 12 months in a tertiary care hospital of South Delhi, India. Verbal violence came out to be most common form of violence experienced by the doctors. Afternoon or night hours were the timings when majority of such cases were reported. PMID:28050406

Managing serious clinical deterioration in a tertiary hospital in Hong Kong: from indicators development to multiple measures in reducing the rates.

PubMed

Ho, Jasperine Ka Yee; Lee, Quinnie; Lam, Jaden Chun Ho; Tang, Kam Shing

2017-06-01

Timely detection and management of acutely deteriorating patients can save lives. Tuen Mun Hospital (TMH), a 1800-bed acute tertiary hospital serving more than 1.06 million populations in Hong Kong, is exploring to quantitatively monitor serious clinical deterioration (SCD) and uses it to guide patient care improvement initiatives. Literature review on definition and measurement of SCD was conducted. Monthly SCD rates of TMH were first calculated according to the published methodology and benchmarked against those of international centres. A refined composite clinical indicator good for local use was compiled. In the second phase, p-control charts of SCD have been plotted based on cumulative data. TMH's performance was comparable with that of international centres. SCD on p-control charts has been plotting since January 2013. There were peaks in all 4 SCD rates during the winter surge period in 2013-2014. In the third phase, multiple measures have been taking to reduce the SCD rates including targeting the 3 main factors of winter surge situation. We are delighted to observe that the pattern did not repeat in the rate of cardiac arrest without do not attempt cardiopulmonary resuscitation (DNACPR) and rate of death without DNACPR in the same period in 2014-2015. SCD becomes a clinical governance tool to monitor the performance of clinical teams in treating acutely deteriorating patients in TMH. Any abnormal patterns or indications of special cause variations in the control charts would alert leaders to look for root causes of special cause variations and manage accordingly. We hope that this project will extend to corporate level and become a sustainable clinical indicator to guide audits, quality improvement initiatives and strategic planning. © 2016 John Wiley & Sons, Ltd.

The Effects of Hospital-Level Factors on Patients' Ratings of Physician Communication.

PubMed

Al-Amin, Mona; Makarem, Suzanne C

2016-01-01

The quality of physician-patient communication influences patient health outcomes and satisfaction with healthcare delivery. Yet, little is known about contextual factors that influence physicians' communication with their patients. The main purpose of this article is to examine organizational-level factors that influence patient perceptions of physician communication in inpatient settings. We used the Hospital Consumer Assessment of Healthcare Providers and Systems (HCAHPS) survey and American Hospital Association data to determine patients' ratings of physician communication at the hospital level, and to collect information about hospital-level factors that can potentially influence physician communication. Our sample consisted of 2,756 hospitals. We ran a regression analysis to determine the predictors of poor physician communication, measured as the percentage of patients in a hospital who reported that physicians sometimes or never communicated well. In our sample of hospitals, this percentage ranged between 0% and 21%, with 25% of hospitals receiving poor ratings from more than 6% of patients. Three organizational factors had statistically significant negative associations with physician communication: for-profit ownership, hospital size, and hospitalists providing care in the hospital, On the other hand, the number of full-time-equivalent physicians and dentists per 10,000 inpatient days, physician ownership of the hospital, Medicare share of inpatient days, and public ownership were positively associated with patients' ratings of physician communication. Physician staffing levels are an understudied area in healthcare research. Our findings indicate that physician staffing levels affect the quality of physician communication with patients. Moreover, for-profit and larger hospitals should invest more in physician communication given the role that HCAHPS plays in value-based purchasing.

The patterns and causes of neonatal mortality at a tertiary hospital in oman.

PubMed

Abdellatif, Mohamed; Ahmed, Masood; Bataclan, Maria Flordeliz; Khan, Ashfaq Ahmed; Al Battashi, Abeer; Al Maniri, Abdullah

2013-11-01

To report the patterns and causes of neonatal death from a tertiary care neonatal intensive care unit over a period of four years. This is a retrospective cohort study where four years data (January 2006 - December 2009) of all inborn neonatal admissions and deaths were collected from the neonatal intensive care unit at Sultan Qaboos University hospital on predesigned forms. All out born admissions and deaths were excluded. The causes of neonatal death were classified using Wigglesworth's classification. The number of inborn live births during the study period was 10064 and the total number of inborn neonatal admissions was 1475. The total deaths (neonatal and post neonatal) at the neonatal intensive care unit was 73 (63 inborn and 10 out born). Among the inborn, five deaths were post neonatal deaths and hence, excluded from analysis. Among the remaining inborn neonatal deaths (n=58), 34 (59%) were males and 24 (41%) were females. The number of neonatal admissions increased over the years during the study period from 248 to 356, while the number of deaths also increased from 10 deaths in 2006, to 20 deaths in 2009. The primary causes of neonatal deaths were prematurity and its complications 52% (n=30). Lethal congenital malformations lead to 17 (29%) newborn deaths, specific diagnosis in 7 newborns (12%), and birth asphyxia in four (7%) of cases. There was an increasing trend of neonatal admissions and deaths among inborn babies. Prematurity, with sepsis as its major complication and congenital malformations were the leading cause of neonatal mortality.

The Patterns and Causes of Neonatal Mortality at a Tertiary Hospital in Oman

PubMed Central

Abdellatif, Mohamed; Ahmed, Masood; Bataclan, Maria Flordeliz; Khan, Ashfaq Ahmed; Al Battashi, Abeer; Al Maniri, Abdullah

2013-01-01

Objective To report the patterns and causes of neonatal death from a tertiary care neonatal intensive care unit over a period of four years. Methods This is a retrospective cohort study where four years data (January 2006 - December 2009) of all inborn neonatal admissions and deaths were collected from the neonatal intensive care unit at Sultan Qaboos University hospital on predesigned forms. All out born admissions and deaths were excluded. The causes of neonatal death were classified using Wigglesworth's classification. Results The number of inborn live births during the study period was 10064 and the total number of inborn neonatal admissions was 1475. The total deaths (neonatal and post neonatal) at the neonatal intensive care unit was 73 (63 inborn and 10 out born). Among the inborn, five deaths were post neonatal deaths and hence, excluded from analysis. Among the remaining inborn neonatal deaths (n=58), 34 (59%) were males and 24 (41%) were females. The number of neonatal admissions increased over the years during the study period from 248 to 356, while the number of deaths also increased from 10 deaths in 2006, to 20 deaths in 2009. The primary causes of neonatal deaths were prematurity and its complications 52% (n=30). Lethal congenital malformations lead to 17 (29%) newborn deaths, specific diagnosis in 7 newborns (12%), and birth asphyxia in four (7%) of cases. Conclusion There was an increasing trend of neonatal admissions and deaths among inborn babies. Prematurity, with sepsis as its major complication and congenital malformations were the leading cause of neonatal mortality. PMID:24223246

Profile of injury cases admitted to a tertiary level hospital in south India.

PubMed

Uthkarsh, Pallavi Sarji; Suryanarayana, S P; Gautham, M S; Shivraj, N S; Murthy, N S; Pruthvish, S

2012-01-01

Injuries now rank among the leading causes of morbidity and mortality the world over. Injuries are steadily increasing in developing countries like India. Systematic and scientific efforts in injury prevention and control are yet to begin in India. Data on injuries are very essential to plan preventive and control measures. The objective of this study is to know the profile of the injury cases admitted to M S Ramaiah hospital, Bangalore, India, using a cross-sectional study design for six months, i.e. from Oct 2008 to April 2009. The mean age of the study population was 35.3 years (SD = 15.38), 69.1% were injured in road traffic accidents (RTA), 28.7% due to falls and 2.2% due to burns. Nearly 14.4% were under the influence of alcohol. Nearly 73.6% of RTA cases were two-wheeler users, 48.5% had not followed sign boards and 56.5% had not obeyed the one-way rules, 63.5% of the two-wheeler users did not use helmets. Also, 38% of two wheelers had two pillion riders, whereas 57% of four-wheeler users had not used a seat belt. Among falls, 58% occurred at home, 49% occurred due to slippery surface. Road traffic accidents were the most common cause for injuries, in which two wheelers were most commonly involved. Strict enforcement of traffic rules and education on road safety are very essential to prevent injuries.

Diagnostic Value of the Serum Anti-Toxocara IgG Titer for Ocular Toxocariasis in Patients with Uveitis at a Tertiary Hospital in Korea.

PubMed