Cyclotron resonance in bilayer graphene.

PubMed

Henriksen, E A; Jiang, Z; Tung, L-C; Schwartz, M E; Takita, M; Wang, Y-J; Kim, P; Stormer, H L

2008-02-29

We present the first measurements of cyclotron resonance of electrons and holes in bilayer graphene. In magnetic fields up to B=18 T, we observe four distinct intraband transitions in both the conduction and valence bands. The transition energies are roughly linear in B between the lowest Landau levels, whereas they follow square root[B] for the higher transitions. This highly unusual behavior represents a change from a parabolic to a linear energy dispersion. The density of states derived from our data generally agrees with the existing lowest order tight binding calculation for bilayer graphene. However, in comparing data to theory, a single set of fitting parameters fails to describe the experimental results.

Comparison of Conjugate Gradient Density Matrix Search and Chebyshev Expansion Methods for Avoiding Diagonalization in Large-Scale Electronic Structure Calculations

NASA Technical Reports Server (NTRS)

Bates, Kevin R.; Daniels, Andrew D.; Scuseria, Gustavo E.

1998-01-01

We report a comparison of two linear-scaling methods which avoid the diagonalization bottleneck of traditional electronic structure algorithms. The Chebyshev expansion method (CEM) is implemented for carbon tight-binding calculations of large systems and its memory and timing requirements compared to those of our previously implemented conjugate gradient density matrix search (CG-DMS). Benchmark calculations are carried out on icosahedral fullerenes from C60 to C8640 and the linear scaling memory and CPU requirements of the CEM demonstrated. We show that the CPU requisites of the CEM and CG-DMS are similar for calculations with comparable accuracy.

Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

NASA Astrophysics Data System (ADS)

Turek, I.; Kudrnovský, J.; Drchal, V.

2015-12-01

We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

A Sparse Self-Consistent Field Algorithm and Its Parallel Implementation: Application to Density-Functional-Based Tight Binding.

PubMed

Scemama, Anthony; Renon, Nicolas; Rapacioli, Mathias

2014-06-10

We present an algorithm and its parallel implementation for solving a self-consistent problem as encountered in Hartree-Fock or density functional theory. The algorithm takes advantage of the sparsity of matrices through the use of local molecular orbitals. The implementation allows one to exploit efficiently modern symmetric multiprocessing (SMP) computer architectures. As a first application, the algorithm is used within the density-functional-based tight binding method, for which most of the computational time is spent in the linear algebra routines (diagonalization of the Fock/Kohn-Sham matrix). We show that with this algorithm (i) single point calculations on very large systems (millions of atoms) can be performed on large SMP machines, (ii) calculations involving intermediate size systems (1000-100 000 atoms) are also strongly accelerated and can run efficiently on standard servers, and (iii) the error on the total energy due to the use of a cutoff in the molecular orbital coefficients can be controlled such that it remains smaller than the SCF convergence criterion.

Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.

PubMed

Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E

2018-05-08

We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.

Linear optical response of carbon nanotubes under axial magnetic field

NASA Astrophysics Data System (ADS)

Moradian, Rostam; Chegel, Raad; Behzad, Somayeh

2010-04-01

We considered single walled carbon naotubes (SWCNTs) as real three dimensional (3D) systems in a cylindrical coordinate. The optical matrix elements and linear susceptibility, χ(ω), in the tight binding approximation in terms of one-dimensional wave vector, kz and subband index, l are calculated. In an external axial magnetic field optical frequency dependence of linear susceptibility are investigated. We found that axial magnetic field has two effects on the imaginary part of the linear susceptibility spectrum, in agreement with experimental results. The first effect is broadening and the second, splitting. Also we found that for all metallic zigzag and armchair SWCNTs, the axial magnetic field leads to the creation of a peak with energy less than 1.5 eV, contrary to what is observed in the absence of a magnetic field.

Bandgap engineering of GaN nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ming, Bang-Ming; Yan, Hui; Wang, Ru-Zhi, E-mail: wrz@bjut.edu.cn, E-mail: yamcy@csrc.ac.cn

2016-05-15

Bandgap engineering has been a powerful technique for manipulating the electronic and optical properties of semiconductors. In this work, a systematic investigation of the electronic properties of [0001] GaN nanowires was carried out using the density functional based tight-binding method (DFTB). We studied the effects of geometric structure and uniaxial strain on the electronic properties of GaN nanowires with diameters ranging from 0.8 to 10 nm. Our results show that the band gap of GaN nanowires depends linearly on both the surface to volume ratio (S/V) and tensile strain. The band gap of GaN nanowires increases linearly with S/V, whilemore » it decreases linearly with increasing tensile strain. These linear relationships provide an effect way in designing GaN nanowires for their applications in novel nano-devices.« less

Isomer-Specific Binding Affinity of Perfluorooctanesulfonate (PFOS) and Perfluorooctanoate (PFOA) to Serum Proteins.

PubMed

Beesoon, Sanjay; Martin, Jonathan W

2015-05-05

Perfluorooctanesulfonate (PFOS) and perfluorooctanoate (PFOA) are among the most prominent contaminants in human serum, and these were historically manufactured as technical mixtures of linear and branched isomers. The isomers display unique pharmacokinetics in humans and in animal models, but molecular mechanisms underlying isomer-specific PFOS and PFOA disposition have not previously been studied. Here, ultrafiltration devices were used to examine (i) the dissociation constants (Kd) of individual PFOS and PFOA isomers with human serum albumin (HSA) and (ii) relative binding affinity of isomers in technical mixtures spiked to whole calf serum and human serum. Measurement of HSA Kd's demonstrated that linear PFOS (Kd=8(±4)×10(-8) M) was much more tightly bound than branched PFOS isomers (Kd range from 8(±1)×10(-5) M to 4(±2)×10(-4) M). Similarly, linear PFOA (Kd=1(±0.9)×10(-4) M) was more strongly bound to HSA compared to branched PFOA isomers (Kd range from 4(±2)×10(-4) M to 3(±2)×10(-4) M). The higher binding affinities of linear PFOS and PFOA to total serum protein were confirmed when both calf serum and human serum were spiked with technical mixtures. Overall, these data provide a mechanistic explanation for the longer biological half-life of PFOS in humans, compared to PFOA, and for the higher transplacental transfer efficiencies and renal clearance of branched PFOS and PFOA isomers, compared to the respective linear isomer.

Microwave emulations and tight-binding calculations of transport in polyacetylene

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.

The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

PubMed Central

Balda, Maria S.; Matter, Karl

2000-01-01

Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

Tight-binding chains with off-diagonal disorder: Bands of extended electronic states induced by minimal quasi-one-dimensionality

NASA Astrophysics Data System (ADS)

Nandy, Atanu; Pal, Biplab; Chakrabarti, Arunava

2016-08-01

It is shown that an entire class of off-diagonally disordered linear lattices composed of two basic building blocks and described within a tight-binding model can be tailored to generate absolutely continuous energy bands. It can be achieved if linear atomic clusters of an appropriate size are side-coupled to a suitable subset of sites in the backbone, and if the nearest-neighbor hopping integrals, in the backbone and in the side-coupled cluster, bear a certain ratio. We work out the precise relationship between the number of atoms in one of the building blocks in the backbone and that in the side attachment. In addition, we also evaluate the definite correlation between the numerical values of the hopping integrals at different subsections of the chain, that can convert an otherwise point spectrum (or a singular continuous one for deterministically disordered lattices) with exponentially (or power law) localized eigenfunctions to an absolutely continuous spectrum comprising one or more bands (subbands) populated by extended, totally transparent eigenstates. The results, which are analytically exact, put forward a non-trivial variation of the Anderson localization (Anderson P. W., Phys. Rev., 109 (1958) 1492), pointing towards its unusual sensitivity to the numerical values of the system parameters and, go well beyond the other related models such as the Random Dimer Model (RDM) (Dunlap D. H. et al., Phys. Rev. Lett., 65 (1990) 88).

Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

PubMed Central

Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

2001-01-01

The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

PubMed

Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

2015-06-09

The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

Recognition of Local DNA Structures by p53 Protein

PubMed Central

Brázda, Václav; Coufal, Jan

2017-01-01

p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

Self-Consistent Optimization of Excited States within Density-Functional Tight-Binding.

PubMed

Kowalczyk, Tim; Le, Khoa; Irle, Stephan

2016-01-12

We present an implementation of energies and gradients for the ΔDFTB method, an analogue of Δ-self-consistent-field density functional theory (ΔSCF) within density-functional tight-binding, for the lowest singlet excited state of closed-shell molecules. Benchmarks of ΔDFTB excitation energies, optimized geometries, Stokes shifts, and vibrational frequencies reveal that ΔDFTB provides a qualitatively correct description of changes in molecular geometries and vibrational frequencies due to excited-state relaxation. The accuracy of ΔDFTB Stokes shifts is comparable to that of ΔSCF-DFT, and ΔDFTB performs similarly to ΔSCF with the PBE functional for vertical excitation energies of larger chromophores where the need for efficient excited-state methods is most urgent. We provide some justification for the use of an excited-state reference density in the DFTB expansion of the electronic energy and demonstrate that ΔDFTB preserves many of the properties of its parent ΔSCF approach. This implementation fills an important gap in the extended framework of DFTB, where access to excited states has been limited to the time-dependent linear-response approach, and affords access to rapid exploration of a valuable class of excited-state potential energy surfaces.

Nonlinear properties of gated graphene in a strong electromagnetic field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avetisyan, A. A., E-mail: artakav@ysu.am; Djotyan, A. P., E-mail: adjotyan@ysu.am; Moulopoulos, K., E-mail: cos@ucy.ac.cy

We develop a microscopic theory of a strong electromagnetic field interaction with gated bilayer graphene. Quantum kinetic equations for density matrix are obtained using a tight binding approach within second quantized Hamiltonian in an intense laser field. We show that adiabatically changing the gate potentials with time may produce (at resonant photon energy) a full inversion of the electron population with high density between valence and conduction bands. In the linear regime, excitonic absorption of an electromagnetic radiation in a graphene monolayer with opened energy gap is also studied.

Many-body instabilities and mass generation in slow Dirac materials

NASA Astrophysics Data System (ADS)

Triola, Christopher; Zhu, Jian-Xin; Migliori, Albert; Balatsky, Alexander V.

2015-07-01

Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum: the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model, we study the many-body instabilities of these systems and identify regions of parameter space in which the system exhibits spin density wave and charge density wave order.

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.

PubMed

Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas

2015-07-14

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.

Tight-binding calculation studies of vacancy and adatom defects in graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing

2016-02-19

Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

DOE PAGES

Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

2015-06-26

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

Effects of axial magnetic field on the electronic and optical properties of boron nitride nanotube

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2011-07-01

The splitting of band structure and absorption spectrum, for boron nitride nanotubes (BNNTs) under axial magnetic field, is studied using the tight binding approximation. It is found that the band splitting ( ΔE) at the Γ point is linearly proportional to the magnetic field ( Φ/Φ0). Our results indicate that the splitting rate νii, of the two first bands nearest to the Fermi level, is a linear function of n -2 for all (n,0) zigzag BNNTs. By investigation of the dependence of band structure and absorption spectrum to the magnetic field, we found that absorption splitting is equal to band splitting and the splitting rate of band structure can be used to determine the splitting rate of the absorption spectrum.

Electronic instability and change of crystalline phase in compounds of the V3Si type at low temperature

NASA Technical Reports Server (NTRS)

Labbe, J.; Friedel, J.

1978-01-01

In V3Si, the V atoms form an array of dense linear chains; a tight-binding approximation in one dimension was used to describe the d electrons. The electronic energy calculated by this method was reduced when the lattice is deformed. This lead to a band type of the Jahn Teller effect, which may explain the cubic to tetragonal transition which was observed at low temperatures. The theory can be extended to other superconductors of the V3X type when X=Ga, Ge, Sn, etcetera, or NB3SN.

On the formation of suspended noble-metal monatomic chains

NASA Astrophysics Data System (ADS)

Hasmy, A.; Rincón, L.; Hernández, R.; Mujica, V.; Márquez, M.; González, C.

2008-09-01

We present a tight-binding molecular-dynamics investigation of the geometrical and the electronic structure of suspended monatomic noble-metal chains. We show that linear monatomic chains are formed at temperatures equal to or smaller than 500 K for Au, 200 K for Ag, and 4 K for Cu and that they are stable for at least 10 ns. We also evidence that such stability is associated with the persisting sd orbital hybridization along the chains. The study highlights fundamental limitations of conductance measurement experiments to detect these chains in the breaking process of nanowires.

Many-body instabilities and mass generation in slow Dirac materials

NASA Astrophysics Data System (ADS)

Triola, Christopher; Zhu, Jianxin; Migliori, Albert; Balatsky, Alexander

2015-03-01

Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum, the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model we study the many-body instabilities of these systems and identify regions of parameter space for which antiferromagnetic, ferromagnetic and charge density wave instabilities occur. Work Supported by USDOE BES E304.

Thermally induced charge current through long molecules

NASA Astrophysics Data System (ADS)

Zimbovskaya, Natalya A.; Nitzan, Abraham

2018-01-01

In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

PubMed Central

Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

2009-01-01

Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

Dirac topological insulator in the dz2 manifold of a honeycomb oxide

NASA Astrophysics Data System (ADS)

Lado, J. L.; Pardo, V.

2016-09-01

We show by means of ab initio calculations and tight-binding modeling that an oxide system based on a honeycomb lattice can sustain topologically nontrivial states if a single orbital dominates the spectrum close to the Fermi level. In such a situation, the low-energy spectrum is described by two Dirac equations that become nontrivially gapped when spin-orbit coupling (SOC) is switched on. We provide one specific example but the recipe is general. We discuss a realization of this starting from a conventional spin-1/2 honeycomb antiferromagnet whose states close to the Fermi energy are dz2 orbitals. Switching off magnetism by atomic substitution and ensuring that the electronic structure becomes two-dimensional is sufficient for topologicality to arise in such a system. By deriving a tight-binding Wannier Hamiltonian, we find that the gap in such a model scales linearly with SOC, opposed to other oxide-based topological insulators, where smaller gaps tend to appear by construction of the lattice. We show that the quantum spin Hall state in this system survives in the presence of off-plane magnetism and the orbital magnetic field and we discuss its Landau level spectra, showing that our recipe provides a dz2 realization of the Kane-Mele model.

Dpb11 may function with RPA and DNA to initiate DNA replication.

PubMed

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

Impact of Many-Body Effects on Landau Levels in Graphene

NASA Astrophysics Data System (ADS)

Sonntag, J.; Reichardt, S.; Wirtz, L.; Beschoten, B.; Katsnelson, M. I.; Libisch, F.; Stampfer, C.

2018-05-01

We present magneto-Raman spectroscopy measurements on suspended graphene to investigate the charge carrier density-dependent electron-electron interaction in the presence of Landau levels. Utilizing gate-tunable magnetophonon resonances, we extract the charge carrier density dependence of the Landau level transition energies and the associated effective Fermi velocity vF. In contrast to the logarithmic divergence of vF at zero magnetic field, we find a piecewise linear scaling of vF as a function of the charge carrier density, due to a magnetic-field-induced suppression of the long-range Coulomb interaction. We quantitatively confirm our experimental findings by performing tight-binding calculations on the level of the Hartree-Fock approximation, which also allow us to estimate an excitonic binding energy of ≈6 meV contained in the experimentally extracted Landau level transitions energies.

Analyte chemisorption and sensing on n- and p-channel copper phthalocyanine thin-film transistors.

PubMed

Yang, Richard D; Park, Jeongwon; Colesniuc, Corneliu N; Schuller, Ivan K; Royer, James E; Trogler, William C; Kummel, Andrew C

2009-04-28

Chemical sensing properties of phthalocyanine thin-film transistors have been investigated using nearly identical n- and p-channel devices. P-type copper phthalocyanine (CuPc) has been modified with fluorine groups to convert the charge carriers from holes to electrons. The sensor responses to the tight binding analyte dimethyl methylphosphonate (DMMP) and weak binding analyte methanol (MeOH) were compared in air and N(2). The results suggest that the sensor response involves counterdoping of pre-adsorbed oxygen (O(2)). A linear dependence of chemical response to DMMP concentration was observed in both n- and p- type devices. For DMMP, there is a factor of 2.5 difference in the chemical sensitivity between n- and p-channel CuPc thin-film transistors, even though it has similar binding strength to n- and p-type CuPc molecules as indicated by the desorption times. The effect is attributed to the difference in the analyte perturbation of electron and hole trap energies in n- and p-type materials.

Mechanistic Basis Of Calmodulin Mediated Estrogen Receptor Alpha Activation and Antiestrogen Resistance

DTIC Science & Technology

2010-06-01

for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic

Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

PubMed

Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

2016-03-14

Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

Total-energy Assisted Tight-binding Method Based on Local Density Approximation of Density Functional Theory

NASA Astrophysics Data System (ADS)

Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki

2018-06-01

A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.

Accurate modeling of defects in graphene transport calculations

NASA Astrophysics Data System (ADS)

Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

2018-01-01

We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.

DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

NASA Astrophysics Data System (ADS)

Humeniuk, Alexander; Mitrić, Roland

2017-12-01

A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.

Dpb11 may function with RPA and DNA to initiate DNA replication

PubMed Central

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

Electronic topological transitions in Zn under compression

NASA Astrophysics Data System (ADS)

Kechin, Vladimir V.

2001-01-01

The electronic structure of hcp Zn under pressure up to 10 GPa has been calculated self-consistently by means of the scalar relativistic tight-binding linear muffin-tin orbital method. The calculations show that three electronic topological transitions (ETT's) occur in Zn when the c/a axial ratio diminishes under compression. One transition occurs at c/a~=1.82 when the ``needles'' appear around the symmetry point K of the Brillouin zone. The other two transitions occur at c/a~=3, when the ``butterfly'' and ``cigar'' appear simultaneously both around the L point. It has been shown that these ETT's are responsible for a number of anomalies observed in Zn at compression.

Exciton intrachain transport induced by interchain packing configurations in conjugated polymers.

PubMed

Meng, Ruixuan; Gao, Kun; Zhang, Gaiyan; Han, Shixuan; Yang, Fujiang; Li, Yuan; Xie, Shijie

2015-07-28

Based on a tight binding model combined with a nonadiabatic dynamics approach, we theoretically investigate the exciton intrachain transport in conjugated polymers with different interchain packing configurations. We construct two different interchain packing configurations, i.e. linear and exponential forms, and simulate the dynamical processes of the exciton transport in these systems. We find that, in both cases, there exists a distribution of driving force for exciton transport, which stems from the gradient of the exciton creation energy along the chains. This finding enriches the picture of exciton transport in polymers and provides a new idea to improve the exciton transport length in polymeric photovoltaic devices.

Pressure Effects on the Magnetic Phase Transition of Mn3SnC1-xNx (x = 0, 0.5)

NASA Astrophysics Data System (ADS)

Hu, Jing-Yu; Wen, Yong-Chun; Yao, Yuan; Wang, Cong; Zhao, Qing; Jin, Chang-Qing; Yu, Ri-Cheng

2012-08-01

The electronic transport properties of Mn3SnC and Mn3SnC0.5N0.5 were measured under pressures up to 1.8 GPa. At ambient pressure, an abrupt increase of resistance occurs around the temperature of magnetic phase transition in both samples. The transition temperature Tc from paramagnetic to ferrimagnetic state decreases linearly at rates of 12.6 and 6.3K/GPa with pressure for Mn3SnC and Mn3SnC0.5N0.5, respectively. This phenomenon could be understood by the Labbe-Jardin tight binding approximation model.

Long-range correction for tight-binding TD-DFT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

2015-10-07

We present two improvements to the tight-binding approximation of time-dependent density functional theory (TD-DFTB): First, we add an exact Hartree-Fock exchange term, which is switched on at large distances, to the ground state Hamiltonian and similarly to the coupling matrix that enters the linear response equations for the calculation of excited electronic states. We show that the excitation energies of charge transfer states are improved relative to the standard approach without the long-range correction by testing the method on a set of molecules from the database in Peach et al. [J. Chem. Phys. 128, 044118 (2008)] which are known tomore » exhibit problematic charge transfer states. The degree of spatial overlap between occupied and virtual orbitals indicates where TD-DFTB and long-range corrected TD-DFTB (lc-TD-DFTB) can be expected to produce large errors. Second, we improve the calculation of oscillator strengths. The transition dipoles are obtained from Slater Koster files for the dipole matrix elements between valence orbitals. In particular, excitations localized on a single atom, which appear dark when using Mulliken transition charges, acquire a more realistic oscillator strength in this way. These extensions pave the way for using lc-TD-DFTB to describe the electronic structure of large chromophoric polymers, where uncorrected TD-DFTB fails to describe the high degree of conjugation and produces spurious low-lying charge transfer states.« less

Physical and metabolic requirements for early interaction of poliovirus and human rhinovirus with HeLa cells.

PubMed Central

Lonberg-Holm, K; Whiteley, N M

1976-01-01

Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301

Bak Conformational Changes Induced by Ligand Binding: Insight into BH3 Domain Binding and Bak Homo-Oligomerization

PubMed Central

Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.

2012-01-01

Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769

Impurity effects on electrical conductivity of doped bilayer graphene in the presence of a bias voltage

NASA Astrophysics Data System (ADS)

E, Lotfi; H, Rezania; B, Arghavaninia; M, Yarmohammadi

2016-07-01

We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength.

Schematic baryon models, their tight binding description and their microwave realization

NASA Astrophysics Data System (ADS)

Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-12-01

A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.

Magnetic susceptibilities of actinide 3d-metal intermetallic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.

1988-04-15

We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.

High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

PubMed Central

Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

2015-01-01

Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

Engineering Designed Proteins for Light Capture, Energy Transfer, and Emissive Sensing In Vivo

NASA Astrophysics Data System (ADS)

Mancini, Joshua A.

Proteins that are used for photosynthetic light harvesting and biological signaling are critical to life. These types of proteins act as scaffolds that hold small, sometimes metal-containing organic molecules in precise locations for light absorption and successive use. For signaling proteins, this energy can be used to induce a photoisomerization of the small molecule that can turn on or off a signaling cascade that controls the physiology of an organism. Alternatively, photosynthetic light-harvesting proteins funnel this energy in a directional manner towards a charge separating catalytic component that can change this light energy into chemical energy. The protein environment also serves to tune the photophysical properties of the small molecules. This is seen extensively with the linear tetrapyrroles that are used in both photosynthetic and signaling proteins. Many efforts have been made to harness these natural proteins for societal use, including improving photophysical properties and interfacing capabilities with manmade catalytic components. Several methods of achieving improvement have entailed structurally guided mutation and directed evolution. However, these methods all have their limitations due to the inherent complexity and fragility of the natural proteins. This work presents an alternative more robust method to natural proteins. My thesis states: that man-made proteins, known as maquettes, employing basic rules of protein folding, can be designed to become light harvesting and signaling proteins that can be assembled fully in vivo providing an alternative, robust, and versatile platform for meeting the diverse array of societal "green chemistry" and biomedical needs. This in vivo assembly is carried out by interacting with cyanobacterial protein and pigment machinery, both as stand-alone units and as protein fusions with natural antenna complexes. Additionally, this work offers insight for fast and tight binding of circular and linear tetrapyrroles to the maquettes both in vitro and in vivo. Design principles are also established for increasing the amount of linear tetrapyrrole attachment to the maquette as well as modulating their photophysical properties. Fast and tight binding of cofactors, high cofactor attachment yields, and control of cofactor photophysical properties are all prerequisites for the maquettes to be successful in vivo photosynthetic light harvesting and signaling proteins.

Crumbs3 Is Essential for Proper Epithelial Development and Viability

PubMed Central

Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.

2014-01-01

First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893

Opening-assisted coherent transport in the semiclassical regime

NASA Astrophysics Data System (ADS)

Zhang, Yang; Celardo, G. Luca; Borgonovi, Fausto; Kaplan, Lev

2017-02-01

We study quantum enhancement of transport in open systems in the presence of disorder and dephasing. Quantum coherence effects may significantly enhance transport in open systems even in the semiclassical regime (where the decoherence rate is greater than the intersite hopping amplitude), as long as the disorder is sufficiently strong. When the strengths of disorder and dephasing are fixed, there is an optimal opening strength at which the coherent transport enhancement is optimized. Analytic results are obtained in two simple paradigmatic tight-binding models of large systems: the linear chain and the fully connected network. The physical behavior is also reflected in the Fenna-Matthews-Olson (FMO) photosynthetic complex, which may be viewed as intermediate between these paradigmatic models.

Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

NASA Astrophysics Data System (ADS)

Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

2018-01-01

The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

PubMed

Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

2018-05-08

Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Analytic second derivative of the energy for density-functional tight-binding combined with the fragment molecular orbital method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.

2016-07-28

The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.

Linear Hyperfine Tuning of Donor Spins in Silicon Using Hydrostatic Strain

NASA Astrophysics Data System (ADS)

Mansir, J.; Conti, P.; Zeng, Z.; Pla, J. J.; Bertet, P.; Swift, M. W.; Van de Walle, C. G.; Thewalt, M. L. W.; Sklenard, B.; Niquet, Y. M.; Morton, J. J. L.

2018-04-01

We experimentally study the coupling of group V donor spins in silicon to mechanical strain, and measure strain-induced frequency shifts that are linear in strain, in contrast to the quadratic dependence predicted by the valley repopulation model (VRM), and therefore orders of magnitude greater than that predicted by the VRM for small strains |ɛ |<10-5. Through both tight-binding and first principles calculations we find that these shifts arise from a linear tuning of the donor hyperfine interaction term by the hydrostatic component of strain and achieve semiquantitative agreement with the experimental values. Our results provide a framework for making quantitative predictions of donor spins in silicon nanostructures, such as those being used to develop silicon-based quantum processors and memories. The strong spin-strain coupling we measure (up to 150 GHz per strain, for Bi donors in Si) offers a method for donor spin tuning—shifting Bi donor electron spins by over a linewidth with a hydrostatic strain of order 10-6—as well as opportunities for coupling to mechanical resonators.

Molecular dynamics study of Al and Ni 3Al sputtering by Al clusters bombardment

NASA Astrophysics Data System (ADS)

Zhurkin, Eugeni E.; Kolesnikov, Anton S.

2002-06-01

The sputtering of Al and Ni 3Al (1 0 0) surfaces induced by impact of Al ions and Al N clusters ( N=2,4,6,9,13,55) with energies of 100 and 500 eV/atom is studied at atomic scale by means of classical molecular dynamics (MD). The MD code we used implements many-body tight binding potential splined to ZBL at short distances. Special attention has been paid to model dense cascades: we used quite big computation cells with lateral periodic and damped boundary conditions. In addition, long simulation times (10-25 ps) and representative statistics (up to 1000 runs per each case) were considered. The total sputtering yields, energy and time spectrums of sputtered particles, as well as preferential sputtering of compound target were analyzed, both in the linear and non-linear regimes. The significant "cluster enhancement" of sputtering yield was found for cluster sizes N⩾13. In parallel, we estimated collision cascade features depending on cluster size in order to interpret the nature of observed non-linear effects.

Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

NASA Astrophysics Data System (ADS)

Shen, Ka

2018-04-01

We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.

Tight-binding calculation of radiation loss in photonic crystal CROW.

PubMed

Ma, Jing; Martínez, Luis Javier; Fan, Shanhui; Povinelli, Michelle L

2013-01-28

The tight binding approximation (TBA) is used to relate the intrinsic, radiation loss of a coupled resonator optical waveguide (CROW) to that of a single constituent resonator within a light cone picture. We verify the validity of the TBA via direct, full-field simulation of CROWs based on the L2 photonic crystal cavity. The TBA predicts that the quality factor of the CROW increases with that of the isolated cavity. Moreover, our results provide a method to design CROWs with low intrinsic loss across the entire waveguide band.

OLIFE: Tight Binding Code for Transmission Coefficient Calculation

NASA Astrophysics Data System (ADS)

Mijbil, Zainelabideen Yousif

2018-05-01

A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.

Electronic Structure of Alpha-Quartz and the Influence of Some Local Disorder: A Tight Binding Study,

DTIC Science & Technology

1977-01-01

An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater

Surface passivation for tight-binding calculations of covalent solids.

PubMed

Bernstein, N

2007-07-04

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

Surface passivation for tight-binding calculations of covalent solids

NASA Astrophysics Data System (ADS)

Bernstein, N.

2007-07-01

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

NASA Astrophysics Data System (ADS)

Tretiak, Sergei

2014-03-01

The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

Electrostatic Interactions in the Binding Pathway of a Transient Protein Complex Studied by NMR and Isothermal Titration Calorimetry*

PubMed Central

Meneses, Erick; Mittermaier, Anthony

2014-01-01

Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758

Electrostatic interactions during acidic phospholipid reactivation of DnaA protein, the Escherichia coli initiator of chromosomal replication.

PubMed

Kitchen, J L; Li, Z; Crooke, E

1999-05-11

The initiation of Escherichia coli chromosomal replication by DnaA protein is strongly influenced by the tight binding of the nucleotides ATP and ADP. Anionic phospholipids in a fluid bilayer promote the conversion of inactive ADP-DnaA protein to replicatively active ATP-DnaA protein in vitro, and thus likely play a key role in regulating DnaA activity. Previous studies have revealed that, during this reactivation, a specific region of DnaA protein inserts into the hydrophobic portion of the lipid bilayer in an acidic phospholipid-dependent manner. To elucidate the requirement for acidic phospholipids in the reactivation process, the contribution of electrostatic forces in the interaction of DnaA and lipid was examined. DnaA-lipid binding required anionic phospholipids, and DnaA-lipid binding as well as lipid-mediated release of DnaA-bound nucleotide were inhibited by increased ionic strength, suggesting the involvement of electrostatic interactions in these processes. As the vesicular content of acidic phospholipids was increased, both nucleotide release and DnaA-lipid binding increased in a linear, parallel manner. Given that DnaA-membrane binding, the insertion of DnaA into the membrane, and the consequent nucleotide release all require anionic phospholipids, the acidic headgroup may be necessary to recruit DnaA protein to the membrane for insertion and subsequent reactivation for replication.

Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

PubMed Central

Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

2017-01-01

Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

The stability of vacancy clusters and their effect on helium behaviors in 3C-SiC

NASA Astrophysics Data System (ADS)

Sun, Jingjing; Li, B. S.; You, Yu-Wei; Hou, Jie; Xu, Yichun; Liu, C. S.; Fang, Q. F.; Wang, Z. G.

2018-05-01

We have carried out systematical ab initio calculations to study the stability of vacancy clusters and their effect on helium behaviors in 3C-SiC. It is found that the formation energies of vacancy clusters containing only carbon vacancies are the lowest although the vacancies are not closest to each other, while the binding energies of vacancy clusters composed of both silicon and carbon vacancies in the closest neighbors to each other are the highest. Vacancy clusters can provide with free space for helium atoms to aggregate, while interstitial sites are not favorable for helium atoms to accumulate. The binding energies of vacancy clusters with helium atoms increase almost linearly with the ratio of helium to vacancy, n/m. The binding strength of vacancy cluster having the participation of the silicon vacancy with helium is relatively stronger than that without silicon vacancy. The vacancy clusters with more vacancies can trap helium atoms more tightly. With the presence of vacancy clusters in the material, the diffusivity of helium will be significantly reduced. Moreover, the three-dimension electron density is calculated to analyze the interplay of vacancy clusters with helium.

X-ray Raman scattering from molecules and solids in the framework of the Mahan-Nozières-De Dominicis model

NASA Astrophysics Data System (ADS)

Privalov, Timofei; Gel'mukhanov, Faris; Ågren, Hans

2001-10-01

We have developed a formulation of resonant x-ray Raman scattering of molecules and solids based on the Mahan-Nozières-De Dominicis model. A key step in the formulation is given by a reduction of the Keldysh-Dyson equations for the Green's function to a set of linear algebraic equations. This gave way for a tractable scheme that can be used to analyze the resonant x-ray scattering in the whole time domain. The formalism is used to investigate the role of core-hole relaxation, interference, band filling, detuning, and size of the scattering target. Numerical applications are performed with a one-dimensional tight-binding model.

Exchange and spin-orbit induced phenomena in diluted (Ga,Mn)As from first principles

NASA Astrophysics Data System (ADS)

Kudrnovský, J.; Drchal, V.; Turek, I.

2016-08-01

Physical properties induced by exchange interactions (Curie temperature and spin stiffness) and spin-orbit coupling (anomalous Hall effect, anisotropic magnetoresistance, and Gilbert damping) in the diluted (Ga,Mn)As ferromagnetic semiconductor are studied from first principles. Recently developed Kubo-Bastin transport theory and nonlocal torque operator formulation of the Gilbert damping as formulated in the tight-binding linear muffin-tin orbital method are used. The first-principles Liechtenstein mapping is employed to construct an effective Heisenberg Hamiltonian and to estimate Curie temperature and spin stiffness in the real-space random-phase approximation. Good agreement of calculated physical quantities with experiments on well-annealed samples containing only a small amount of compensating defects is obtained.

A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus

USDA-ARS?s Scientific Manuscript database

The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...

Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

PubMed Central

2011-01-01

Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588

Effects of electric and magnetic fields on the electronic properties of zigzag carbon and boron nitride nanotubes

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh; Ahmadi, Eghbal

2012-04-01

We have investigated the electronic properties of zigzag CNTs and BNNTs under the external transverse electric field and axial magnetic field, using tight binding approximation. It was found that after switching on the electric and magnetic fields, the band modification such as distortion of the degeneracy, change in energy dispersion, subband spacing and band gap size reduction occurs. The band gap of zigzag BNNTs decreases linearly with increasing the electric field strength but the band gap variation for CNTs increases first and later decreases (Metallic) or first hold constant and then decreases (semiconductor). For type (II) CNTs, at a weak magnetic field, by increasing the electric field strength, the band gap remains constant first and then decreases and in a stronger magnetic field the band gap reduction becomes parabolic. For type (III) CNTs, in any magnetic field, the band gap increases slowly until reaches a maximum value and then decreases linearly. Unlike to CNTs, the magnetic field has less effects on the BNNTs band gap variation.

First Experimental Realization of the Dirac Oscillator

NASA Astrophysics Data System (ADS)

Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-10-01

We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.

A tight binding model study of tunneling conductance spectra of spin and orbitally ordered CMR manganites

NASA Astrophysics Data System (ADS)

Panda, Saswati; Sahoo, D. D.; Rout, G. C.

2018-04-01

We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.

DFTB+ and lanthanides

NASA Astrophysics Data System (ADS)

Hourahine, B.; Aradi, B.; Frauenheim, T.

2010-07-01

DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

Objective Molecular Dynamics with Self-consistent Charge Density Functional Tight-Binding (SCC-DFTB) Method

NASA Astrophysics Data System (ADS)

Dumitrica, Traian; Hourahine, Ben; Aradi, Balint; Frauenheim, Thomas

We discus the coupling of the objective boundary conditions into the SCC density functional-based tight binding code DFTB+. The implementation is enabled by a generalization to the helical case of the classical Ewald method, specifically by Ewald-like formulas that do not rely on a unit cell with translational symmetry. The robustness of the method in addressing complex hetero-nuclear nano- and bio-fibrous systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal double-strand DNA. Work supported by NSF CMMI 1332228.

The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

NASA Astrophysics Data System (ADS)

Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

2017-05-01

We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.

Scattering matrix of arbitrary tight-binding Hamiltonians

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.

2017-03-15

A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.

Excitons in boron nitride single layer

NASA Astrophysics Data System (ADS)

Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François

2016-09-01

Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.

Tight binding simulation study on zigzag single-walled carbon nanotubes

NASA Astrophysics Data System (ADS)

Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

2018-01-01

Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.

Design of graphene nanoparticle undergoing axial compression: quantum study

NASA Astrophysics Data System (ADS)

Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

2011-03-01

We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.

Tight-binding modeling and low-energy behavior of the semi-Dirac point.

PubMed

Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E

2009-07-03

We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.

Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films

NASA Astrophysics Data System (ADS)

Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.

2018-04-01

We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.

The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

NASA Astrophysics Data System (ADS)

Kar, J. K.; Panda, Saswati; Rout, G. C.

2017-05-01

We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

DOE Office of Scientific and Technical Information (OSTI.GOV)

C Simmons; C Magee; D Smith

The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADPmore » cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.« less

DOS cones along atomic chains

NASA Astrophysics Data System (ADS)

Kwapiński, Tomasz

2017-03-01

The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin-orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears.

HIV-1 gp120 Glycoprotein Interacting with Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Non-integrin (DC-SIGN) Down-Regulates Tight Junction Proteins to Disrupt the Blood Retinal Barrier and Increase Its Permeability.

PubMed

Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang

2016-10-28

Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

DFTB3: Extension of the self-consistent-charge density-functional tight-binding method (SCC-DFTB).

PubMed

Gaus, Michael; Cui, Qiang; Elstner, Marcus

2012-04-10

The self-consistent-charge density-functional tight-binding method (SCC-DFTB) is an approximate quantum chemical method derived from density functional theory (DFT) based on a second-order expansion of the DFT total energy around a reference density. In the present study we combine earlier extensions and improve them consistently with, first, an improved Coulomb interaction between atomic partial charges, and second, the complete third-order expansion of the DFT total energy. These modifications lead us to the next generation of the DFTB methodology called DFTB3, which substantially improves the description of charged systems containing elements C, H, N, O, and P, especially regarding hydrogen binding energies and proton affinities. As a result, DFTB3 is particularly applicable to biomolecular systems. Remaining challenges and possible solutions are also briefly discussed.

A mechanistic link between gene regulation and genome architecture in mammalian development.

PubMed

Bonora, Giancarlo; Plath, Kathrin; Denholtz, Matthew

2014-08-01

The organization of chromatin within the nucleus and the regulation of transcription are tightly linked. Recently, mechanisms underlying this relationship have been uncovered. By defining the organizational hierarchy of the genome, determining changes in chromatin organization associated with changes in cell identity, and describing chromatin organization within the context of linear genomic features (such as chromatin modifications and transcription factor binding) and architectural proteins (including Cohesin, CTCF, and Mediator), a new paradigm in genome biology was established wherein genomes are organized around gene regulatory factors that govern cell identity. As such, chromatin organization plays a central role in establishing and maintaining cell state during development, with gene regulation and genome organization being mutually dependent effectors of cell identity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Improving the frequency precision of oscillators by synchronization.

PubMed

Cross, M C

2012-04-01

Improving the frequency precision by synchronizing a lattice of N oscillators with disparate frequencies is studied in the phase reduction limit. In the general case where the coupling is not purely dissipative the synchronized state consists of targetlike waves radiating from a local source, which is a region of higher-frequency oscillators. In this state the improvement of the frequency precision is shown to be independent of N for large N, but instead depends on the disorder and reflects the dependence of the frequency of the synchronized state on just those oscillators in the source region of the waves. These results are obtained by a mapping of the nonlinear phase dynamics onto the linear Anderson problem of the quantum mechanics of electrons on a random lattice in the tight-binding approximation.

Acoustic frequency filter based on anisotropic topological phononic crystals.

PubMed

Chen, Ze-Guo; Zhao, Jiajun; Mei, Jun; Wu, Ying

2017-11-08

We present a design of acoustic frequency filter based on a two-dimensional anisotropic phononic crystal. The anisotropic band structure exhibits either a directional or a combined (global + directional) bandgap at certain frequency regions, depending on the geometry. When the time-reversal symmetry is broken, it may introduce a topologically nontrivial bandgap. The induced nontrivial bandgap and the original directional bandgap result in various interesting wave propagation behaviors, such as frequency filter. We develop a tight-binding model to characterize the effective Hamiltonian of the system, from which the contribution of anisotropy is explicitly shown. Different from the isotropic cases, the Zeeman-type splitting is not linear and the anisotropic bandgap makes it possible to achieve anisotropic propagation characteristics along different directions and at different frequencies.

First-Principles Study on the Gilbert Damping Constants of Transition Metal Alloys, Fe--Ni and Fe--Pt Systems

NASA Astrophysics Data System (ADS)

Sakuma, Akimasa

2012-08-01

We adapt the tight-binding linear muffin-tin orbital (TB-LMTO) method to the torque-correlation model for the Gilbert damping constant α and perform the first-principles calculation for disordered transition metal alloys, Fe--Ni and Fe--Pt systems, within the framework of the CPA. Quantitatively, the calculated α values are about one-half of the experimental values, whereas the variations in the Fermi level dependence of α are much larger than these discrepancies. As expected, we confirm in the (Fe--Ni)1-XPtX and FePt systems that Pt atoms certainly enhance α owing to their large spin--orbit coupling. For the disordered alloys, we find that α decreases with increasing chemical degree of order in a wide range.

Sustained inhibition of intimal thickening. In vitro and in vivo effects of polymeric beta-cyclodextrin sulfate.

PubMed Central

Bachinsky, W B; Barnathan, E S; Liu, H; Okada, S S; Kuo, A; Raghunath, P N; Muttreja, M; Caron, R J; Tomaszewski, J E; Golden, M A

1995-01-01

Intimal thickening after vascular injury may be modulated in part by heparin binding growth factors. We hypothesized that placement of a therapeutic polymer in the periadventitial space capable of tightly binding growth factors might alter the vascular response to injury. We first demonstrated that incubation of rat aortic smooth muscle cells with an insoluble, sulfated polymer of beta-cyclodextrin (P-CDS) was associated with a dose-dependent inhibition of proliferation induced by fetal calf serum, fibroblast growth factor-2 (FGF-2), platelet-derived growth factor BB, or epidermal growth factor. Preincubation studies of P-CDS with FGF-2 revealed a very rapid removal of mitogenic activity. Using radiolabeled FGF-2 (0.25 microg/ml), we observed a very rapid association rate (0.34 +/- 0.07 min-1, n=4) and a very slow dissociation rate (3.3 +/- 0.2 X 10(-7) min-1) at 37 degrees C, suggesting a high affinity interaction. Using both Transwell and linear under-agarose assays, we demonstrated a significant inhibition of random migration (chemokinesis) by P-CDS. Unsulfated polymeric beta-cyclodextrin (P-CD) had little if any of these effects, suggesting that the high negative charge density of P-CDS was important for the effects. Finally, rats undergoing carotid artery balloon injury were randomized to treatment with periadventitial P-CDS or no treatment, and were killed at 4 (n=20), 14 (n=59), and 88 d (n=14). Morphometric analysis demonstrated significant and sustained inhibition of intimal thickening in P-CDS-treated rats at 14 (P < 0.01) and 88 d (P < 0.05) using absolute intimal area or intima/media area ratios. No inhibition was seen in a group of rats treated with P-CD. In P-CDS-treated rats, bromodeoxyuridine labeling studies revealed fewer labeled smooth muscle cells in the intima at 14 d (P=0.01), while staining with Evans blue revealed enhanced late endothelial cell regrowth. Thus, periadventitially applied sulfated beta-cyclodextrin polymer, which can tightly bind heparin binding growth factors, inhibits intimal thickening in vivo in a sustained fashion without using an additional delivery system. These studies suggest that cellular processes mediated by heparin binding growth factors may be modulated by P-CDS. Images PMID:8675622

Tight focusing of spatially variant vector optical fields with elliptical symmetry of linear polarization.

PubMed

Lerman, Gilad M; Levy, Uriel

2007-08-01

We study the tight-focusing properties of spatially variant vector optical fields with elliptical symmetry of linear polarization. We found the eccentricity of the incident polarized light to be an important parameter providing an additional degree of freedom assisting in controlling the field properties at the focus and allowing matching of the field distribution at the focus to the specific application. Applications of these space-variant polarized beams vary from lithography and optical storage to particle beam trapping and material processing.

cis-trans Germanium chains in the intermetallic compounds ALi{sub 1-x}In{sub x}Ge{sub 2} and A{sub 2}(Li{sub 1-x}In{sub x}){sub 2}Ge{sub 3} (A=Sr, Ba, Eu)-experimental and theoretical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

You, Tae-Soo; Bobev, Svilen, E-mail: bobev@udel.ed

Two types of strontium-, barium- and europium-containing germanides have been synthesized using high temperature reactions and characterized by single-crystal X-ray diffraction. All reported compounds also contain mixed-occupied Li and In atoms, resulting in quaternary phases with narrow homogeneity ranges. The first type comprises EuLi{sub 0.91(1)}In{sub 0.09}Ge{sub 2}, SrLi{sub 0.95(1)}In{sub 0.05}Ge{sub 2} and BaLi{sub 0.99(1)}In{sub 0.01}Ge{sub 2}, which crystallize in the orthorhombic space group Pnma (BaLi{sub 0.9}Mg{sub 0.1}Si{sub 2} structure type, Pearson code oP16). The lattice parameters are a=7.129(4)-7.405(4) A; b=4.426(3)-4.638(2) A; and c=11.462(7)-11.872(6) A. The second type includes Eu{sub 2}Li{sub 1.36(1)}In{sub 0.64}Ge{sub 3} and Sr{sub 2}Li{sub 1.45(1)}In{sub 0.55}Ge{sub 3}, whichmore » adopt the orthorhombic space group Cmcm (Ce{sub 2}Li{sub 2}Ge{sub 3} structure type, Pearson code oC28) with lattice parameters a=4.534(2)-4.618(2) A; b=19.347(8)-19.685(9) A; and c=7.164(3)-7.260(3) A. The polyanionic sub-structures in both cases feature one-dimensional Ge chains with alternating Ge-Ge bonds in cis- and trans-conformation. Theoretical studies using the tight-binding linear muffin-tin orbital (LMTO) method provide the rationale for optimizing the overall bonding by diminishing the {pi}-p delocalization along the Ge chains, accounting for the experimentally confirmed substitution of Li forIn. -- Graphical abstract: Presented are the single-crystal structures of two types of closely related intermetallics, as well as their band structures, calculated using tight-binding linear muffin-tin orbital (TB-LMTO-ASA) method. Display Omitted« less

The relationship between water binding and desiccation tolerance in tissues

NASA Technical Reports Server (NTRS)

Vertucci, C. W.; Leopold, A. C.

1987-01-01

In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.

The tightly bound nuclei in the liquid drop model

NASA Astrophysics Data System (ADS)

Sree Harsha, N. R.

2018-05-01

In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.

Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

NASA Astrophysics Data System (ADS)

Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

2013-07-01

We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.

Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

PubMed

Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

Time-dependent density-functional tight-binding method with the third-order expansion of electron density

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less

Intermediate band formation in a δ-doped like QW superlattices of GaAs/AlxGa1-xAs for solar cell design

NASA Astrophysics Data System (ADS)

Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.

2018-03-01

It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.

Time-dependent density-functional tight-binding method with the third-order expansion of electron density.

PubMed

Nishimoto, Yoshio

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.

Magnetic Moments and Hyperfine Parameters of Fe3-xCrxAl0.5Si0.5

NASA Astrophysics Data System (ADS)

Rećko, Katarzyna; Go, Anna; Satuła, Dariusz; Biernacka, Maria; Dobrzyński, Ludwik; Waliszewski, Janusz; Milczarek, Jacek J.; Szymański, Krzysztof

2012-04-01

Results of X-ray, neutron, magnetization and Mössbauer measurements on polycrystalline samples of Fe3-xCrx Al0.5Si0.5 (x=0, 0.125, 0.250, 0.375, and 0.5) alloys, crystallizing in DO3 type of structure, are presented. X-ray and neutron diffraction confirmed the phase homogeneity of all the samples. The unit cell volume has been proved to be independent of the chromium content. Neutron and Mössbauer measurements disclosed that Cr atoms occupy preferentially B-sites, while D-sites are almost entirely occupied by Al and Si. The total magnetisation as well as the individual magnetic moments μFe(A,C), μFe(B) and μCr(B,D) have been found to vary linearly with chromium concentration. Influence of local environments on the formation of magnetic moments in Fe3Al0.5Si0.5 when chromium is substituted for iron was examined using self-consistent spin-polarized tight-binding linear muffin-tin orbital method (TB-LMTO).

First-principles simulations of doping-dependent mesoscale screening of adatoms in graphene

NASA Astrophysics Data System (ADS)

Mostofi, Arash; Corsetti, Fabiano; Wong, Dillon; Crommie, Michael; Lischner, Johannes

Adsorbed atoms and molecules play an important role in controlling and tuning the functional properties of 2D materials. Understanding and predicting this phenomenon from theory is challenging because of the need to capture both the local chemistry of the adsorbate-substrate interaction and its complex interplay with the long-range screening response of the substrate. To address this challenge, we have developed a first-principles multi-scale approach that combines linear-scaling density-functional theory, continuum screening theory and large-scale tight-binding simulations. Focussing on the case of a calcium adatom on graphene, we draw comparison between the effect of (i) non-linearity, (ii) intraband and interband transitions, and (iii) the exchange-correlation potential, thus providing insight into the relative importance of these different factors on the screening response. We also determine the charge transfer from the adatom to the graphene substrate (the key parameter used in continuum screening models), showing it to be significantly larger than previous estimates. AM and FC acknowledge support of the EPSRC under Grant EP/J015059/1, and JL under Grant EP/N005244/1.

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

NASA Astrophysics Data System (ADS)

Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

2018-02-01

In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.

How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

PubMed Central

1988-01-01

We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

Theoretical study of the influence of the electric field on the electronic properties of armchair boron nitride nanoribbon

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-11-01

We have investigated the electronic properties of A-BNNRs in the external electric field using third nearest neighbor tight binding approximation including edge effects. We found that the dependence of on-site energy to the external electric field for edge atoms and center part atoms is different. By comparing the band structure in the different fields, several differences are clearly seen such as modification of energy dispersions, creation of additional band edge states and band gap reduction. By increasing the electric field the band gap reduces linearly until reaches zero and BNNRs with larger width are more sensitive than small ones. All changes in the band structure are directly reflected in the DOS spectrum. The numbers and the energies of the DOS peaks are dependent on the electric field strength.

Green functions of graphene: An analytic approach

NASA Astrophysics Data System (ADS)

Lawlor, James A.; Ferreira, Mauro S.

2015-04-01

In this article we derive the lattice Green Functions (GFs) of graphene using a Tight Binding Hamiltonian incorporating both first and second nearest neighbour hoppings and allowing for a non-orthogonal electron wavefunction overlap. It is shown how the resulting GFs can be simplified from a double to a single integral form to aid computation, and that when considering off-diagonal GFs in the high symmetry directions of the lattice this single integral can be approximated very accurately by an algebraic expression. By comparing our results to the conventional first nearest neighbour model commonly found in the literature, it is apparent that the extended model leads to a sizeable change in the electronic structure away from the linear regime. As such, this article serves as a blueprint for researchers who wish to examine quantities where these considerations are important.

Spectral densities for Frenkel exciton dynamics in molecular crystals: A TD-DFTB approach

NASA Astrophysics Data System (ADS)

Plötz, Per-Arno; Megow, Jörg; Niehaus, Thomas; Kühn, Oliver

2017-02-01

Effects of thermal fluctuations on the electronic excitation energies and intermonomeric Coulomb couplings are investigated for a perylene-tetracarboxylic-diimide crystal. To this end, time dependent density functional theory based tight binding (TD-DFTB) in the linear response formulation is used in combination with electronic ground state classical molecular dynamics. As a result, a parametrized Frenkel exciton Hamiltonian is obtained, with the effect of exciton-vibrational coupling being described by spectral densities. Employing dynamically defined normal modes, these spectral densities are analyzed in great detail, thus providing insight into the effect of specific intramolecular motions on excitation energies and Coulomb couplings. This distinguishes the present method from approaches using fixed transition densities. The efficiency by which intramolecular contributions to the spectral density can be calculated is a clear advantage of this method as compared with standard TD-DFT.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Self-Consistent Charge Density Functional Tight-Binding Study of Poly(3,4-ethylenedioxythiophene): Poly(styrenesulfonate) Ammonia Gas Sensor.

PubMed

Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal

2017-12-01

Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.

Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

PubMed

Heyduk, E; Baichoo, N; Heyduk, T

2001-11-30

The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

PubMed Central

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-01-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

PubMed

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-06-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

Universal Sign Control of Coupling in Tight-Binding Lattices

NASA Astrophysics Data System (ADS)

Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander

2016-05-01

We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.; Ring, D.M.

We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

2016-10-15

Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.

Assessment of the Density Functional Tight Binding Method for Protic Ionic Liquids

PubMed Central

2015-01-01

Density functional tight binding (DFTB), which is ∼100–1000 times faster than full density functional theory (DFT), has been used to simulate the structure and properties of protic ionic liquid (IL) ions, clusters of ions and the bulk liquid. Proton affinities for a wide range of IL cations and anions determined using DFTB generally reproduce G3B3 values to within 5–10 kcal/mol. The structures and thermodynamic stabilities of n-alkyl ammonium nitrate clusters (up to 450 quantum chemical atoms) predicted with DFTB are in excellent agreement with those determined using DFT. The IL bulk structure simulated using DFTB with periodic boundary conditions is in excellent agreement with published neutron diffraction data. PMID:25328497

Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

NASA Astrophysics Data System (ADS)

Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

2018-04-01

Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

Most of the tight positional conservation of transcription factor binding sites near the transcription start site reflects their co-localization within regulatory modules.

PubMed

Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L

2016-11-21

Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.

Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion

PubMed Central

Stefanski, Adrianne L.; McManaman, James L.

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572

Development of tight-binding based GW algorithm and its computational implementation for graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source

Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less

Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle

2010-07-23

Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less

The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

PubMed

Tsapara, Anna; Matter, Karl; Balda, Maria S

2006-03-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

PubMed Central

Tsapara, Anna; Matter, Karl; Balda, Maria S.

2006-01-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

Pseudo-magnetic fields of strongly-curved graphene nanobubbles

NASA Astrophysics Data System (ADS)

Liu, Li-Chi

2018-04-01

We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.

Surface Passivation in Empirical Tight Binding

NASA Astrophysics Data System (ADS)

He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann

2016-03-01

Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameters. This method is applied to a Si quantum well and a Si ultra-thin body transistor oxidized with SiO2 in several oxidation configurations. Comparison with ab-initio results and experiments verifies the presented method. Oxidation configurations that severely hamper the transistor performance are identified. It is also shown that the commonly used implicit H atom passivation overestimates the transistor performance.

Rapid calculation method for Frenkel-type two-exciton states in one to three dimensions

NASA Astrophysics Data System (ADS)

Ajiki, Hiroshi

2014-07-01

Biexciton and two-exciton dissociated states of Frenkel-type excitons are well described by a tight-binding model with a nearest-neighbor approximation. Such two-exciton states in a finite-size lattice are usually calculated by numerical diagonalization of the Hamiltonian, which requires an increasing amount of computational time and memory as the lattice size increases. I develop here a rapid, memory-saving method to calculate the energies and wave functions of two-exciton states by employing a bisection method. In addition, an attractive interaction between two excitons in the tight-binding model can be obtained directly so that the biexciton energy agrees with the observed energy, without the need for the trial-and-error procedure implemented in the numerical diagonalization method.

Gaussian polarizable-ion tight binding.

PubMed

Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

2016-10-14

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

Gaussian polarizable-ion tight binding

NASA Astrophysics Data System (ADS)

Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

2016-10-01

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

NASA Astrophysics Data System (ADS)

You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

2012-04-01

We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

Non-collinear magnetism with analytic Bond-Order Potentials

NASA Astrophysics Data System (ADS)

Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

2015-03-01

The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

Effects of an electric field on the electronic and optical properties of zigzag boron nitride nanotubes

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2011-02-01

We have investigated the electro-optical properties of zigzag BNNTs, under an external electric field, using the tight binding approximation. It is found that an electric field modifies the band structure and splits the band degeneracy. Also the large electric strength leads to coupling the neighbor subbands which these effects reflect in the DOS and JDOS spectrum. It has been shown that, unlike CNTs, the band gap of BNNTs can be reduced linearly by applying a transverse external electric field. Also we show that the larger diameter tubes are more sensitive than small ones. The semiconducting metallic transition can be achieved through increasing the applied fields. The number and position of peaks in the JDOS spectrum are dependent on electric field strength. It is found that at a high electric field, the two lowest subbands are oscillatory with multiple nodes at the Fermi level.

Origami rules for the construction of localized eigenstates of the Hubbard model in decorated lattices

NASA Astrophysics Data System (ADS)

Dias, R. G.; Gouveia, J. D.

2015-11-01

We present a method of construction of exact localized many-body eigenstates of the Hubbard model in decorated lattices, both for U = 0 and U → ∞. These states are localized in what concerns both hole and particle movement. The starting point of the method is the construction of a plaquette or a set of plaquettes with a higher symmetry than that of the whole lattice. Using a simple set of rules, the tight-binding localized state in such a plaquette can be divided, folded and unfolded to new plaquette geometries. This set of rules is also valid for the construction of a localized state for one hole in the U → ∞ limit of the same plaquette, assuming a spin configuration which is a uniform linear combination of all possible permutations of the set of spins in the plaquette.

First principles electronic and thermal properties of some AlRE intermetallics

NASA Astrophysics Data System (ADS)

Srivastava, Vipul; Sanyal, Sankar P.; Rajagopalan, M.

2008-10-01

A study on structural and electronic properties of non-magnetic cubic B 2-type AlRE (RE=Sc, Y, La, Ce, Pr and Lu) intermetallics has been done theoretically. The self-consistent tight binding linear muffin tin orbital method is used to describe the electronic properties of these intermetallics at ambient and at high pressure. These compounds show metallic behavior under ambient conditions. The variation of density of states under compression indicates some possibility of structural phase transformation in AlLa, AlCe and AlPr. Thermal properties like Debye temperature and Grüneisen constant are calculated at T=0 K and at ambient pressure within the Debye-Grüneisen model and compared with the others’ theoretical results. Our results are in good agreement. We have also performed a pressure-induced variation of Debye temperature and have found a decrease in Debye temperature around 40 kbar in AlRE (RE=La, Ce, Pr) intermetallics.

Solvation of fluoro-acetonitrile in water by 2D-IR spectroscopy: A combined experimental-computational study

NASA Astrophysics Data System (ADS)

Cazade, Pierre-André; Tran, Halina; Bereau, Tristan; Das, Akshaya K.; Kläsi, Felix; Hamm, Peter; Meuwly, Markus

2015-06-01

The solvent dynamics around fluorinated acetonitrile is characterized by 2-dimensional infrared spectroscopy and atomistic simulations. The lineshape of the linear infrared spectrum is better captured by semiempirical (density functional tight binding) mixed quantum mechanical/molecular mechanics simulations, whereas force field simulations with multipolar interactions yield lineshapes that are significantly too narrow. For the solvent dynamics, a relatively slow time scale of 2 ps is found from the experiments and supported by the mixed quantum mechanical/molecular mechanics simulations. With multipolar force fields fitted to the available thermodynamical data, the time scale is considerably faster—on the 0.5 ps time scale. The simulations provide evidence for a well established CF-HOH hydrogen bond (population of 25%) which is found from the radial distribution function g(r) from both, force field and quantum mechanics/molecular mechanics simulations.

Absence of metastable states in strained monoatomic cubic crystals.

NASA Astrophysics Data System (ADS)

Aguayo, Aarón; Mehl, Michael L.; de Coss, Romeo

2005-03-01

The Bain path distortion of a metal with an fcc (bcc) ground state toward the bcc (fcc) structure initially requires an increase in energy, but at some point along the Bain path the energy will again decrease until a local minimum is reached. We have studied the tetragonal distortion (Bain path) of monoatomic cubic crystals, using a combination of parametrized tight-binding and first-principles linearized augmented plane wave calculations. We show that this local minimum is unstable with respect to an elastic distortion, except in the rare case that the minimum is at the bcc (fcc) point on the Bain path. This shows that body-centered-tetragonal phases of these materials, which have been seen in epitaxially grown thin films, must be stabilized by the substrate and cannot be freestanding films. This work was partially supported by Consejo Nacional de Ciencia y Tecnolog'ia (CONACYT, M'exico) under Grant No. 43830-F.

Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

NASA Astrophysics Data System (ADS)

Venkataraman, Vijay Shankar

The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.

Efficient self-consistency for magnetic tight binding

NASA Astrophysics Data System (ADS)

Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.

2011-06-01

Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.

Modeling Tight Junction Dynamics and Oscillations

PubMed Central

Kassab, Fuad; Marques, Ricardo Paulino; Lacaz-Vieira, Francisco

2002-01-01

Tight junction (TJ) permeability responds to changes of extracellular Ca2+ concentration. This can be gauged through changes of the transepithelial electrical conductance (G) determined in the absence of apical Na+. The early events of TJ dynamics were evaluated by the fast Ca2+ switch assay (FCSA) (Lacaz-Vieira, 2000), which consists of opening the TJs by removing basal calcium (Ca2+ bl) and closing by returning Ca2+ bl to normal values. Oscillations of TJ permeability were observed when Ca2+ bl is removed in the presence of apical calcium (Ca2+ ap) and were interpreted as resulting from oscillations of a feedback control loop which involves: (a) a sensor (the Ca2+ binding sites of zonula adhaerens), (b) a control unit (the cell signaling machinery), and (c) an effector (the TJs). A mathematical model to explain the dynamical behavior of the TJs and oscillations was developed. The extracellular route (ER), which comprises the paracellular space in series with the submucosal interstitial fluid, was modeled as a continuous aqueous medium having the TJ as a controlled barrier located at its apical end. The ER was approximated as a linear array of cells. The most apical cell is separated from the apical solution by the TJ and this cell bears the Ca2+ binding sites of zonula adhaerens that control the TJs. According to the model, the control unit receives information from the Ca2+ binding sites and delivers a signal that regulates the TJ barrier. Ca2+ moves along the ER according to one-dimensional diffusion following Fick's second law. Across the TJ, Ca2+ diffusion follows Fick's first law. Our first approach was to simulate the experimental results in a semiquantitative way. The model tested against experiment results performed in the frog urinary bladder adequately predicts the responses obtained in different experimental conditions, such as: (a) TJ opening and closing in a FCSA, (b) opening by the presence of apical Ca2+ and attainment of a new steady-state, (c) the escape phase which follows the halt of TJ opening induced by apical Ca2+, (d) the oscillations of TJ permeability, and (e) the effect of Ca2+ ap concentration on the frequency of oscillations. PMID:12149284

Computational design of nanoparticle drug delivery systems for selective targeting

NASA Astrophysics Data System (ADS)

Duncan, Gregg A.; Bevan, Michael A.

2015-09-01

Ligand-functionalized nanoparticles capable of selectively binding to diseased versus healthy cell populations are attractive for improved efficacy of nanoparticle-based drug and gene therapies. However, nanoparticles functionalized with high affinity targeting ligands may lead to undesired off-target binding to healthy cells. In this work, Monte Carlo simulations were used to quantitatively determine net surface interactions, binding valency, and selectivity between targeted nanoparticles and cell surfaces. Dissociation constant, KD, and target membrane protein density, ρR, are explored over a range representative of healthy and cancerous cell surfaces. Our findings show highly selective binding to diseased cell surfaces can be achieved with multiple, weaker affinity targeting ligands that can be further optimized by varying the targeting ligand density, ρL. Using the approach developed in this work, nanomedicines can be optimally designed for exclusively targeting diseased cells and tissues.Ligand-functionalized nanoparticles capable of selectively binding to diseased versus healthy cell populations are attractive for improved efficacy of nanoparticle-based drug and gene therapies. However, nanoparticles functionalized with high affinity targeting ligands may lead to undesired off-target binding to healthy cells. In this work, Monte Carlo simulations were used to quantitatively determine net surface interactions, binding valency, and selectivity between targeted nanoparticles and cell surfaces. Dissociation constant, KD, and target membrane protein density, ρR, are explored over a range representative of healthy and cancerous cell surfaces. Our findings show highly selective binding to diseased cell surfaces can be achieved with multiple, weaker affinity targeting ligands that can be further optimized by varying the targeting ligand density, ρL. Using the approach developed in this work, nanomedicines can be optimally designed for exclusively targeting diseased cells and tissues. Electronic supplementary information (ESI) available: Movie showing simulation renderings of targeted (ρL = 1820/μm2, KD = 120 μM) nanoparticle selective binding to cancer (ρR = 256/μm2) vs. healthy (ρR = 64/μm2) cell surfaces. Target membrane proteins have linear color scale depending on binding energy ranging from white when unbound (URL = 0) to red when tightly bound (URL = UM). See DOI: 10.1039/c5nr03691g

Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

NASA Astrophysics Data System (ADS)

Jahangiri, Soran; Mosey, Nicholas J.

2018-01-01

Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

NASA Astrophysics Data System (ADS)

Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

2018-02-01

We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.

Linear Legendrian curves in T(3)

NASA Astrophysics Data System (ADS)

Ghiggini, Paolo

2006-05-01

Using convex surfaces and Kanda's classification theorem, we classify Legendrian isotopy classes of Legendrian linear curves in all tight contact structures on T(3) . Some of the knot types considered in this paper provide new examples of non transversally simple knot types.

Downstream DNA Tension Regulates the Stability of the T7 RNA Polymerase Initiation Complex

PubMed Central

Skinner, Gary M.; Kalafut, Bennett S.; Visscher, Koen

2011-01-01

Gene transcription by the enzyme RNA polymerase is tightly regulated. In many cases, such as in the lac operon in Escherichia coli, this regulation is achieved through the action of protein factors on DNA. Because DNA is an elastic polymer, its response to enzymatic processing can lead to mechanical perturbations (e.g., linear stretching and supercoiling) that can affect the operation of other DNA processing complexes acting elsewhere on the same substrate molecule. Using an optical-tweezers assay, we measured the binding kinetics between single molecules of bacteriophage T7 RNA polymerase and DNA, as a function of tension. We found that increasing DNA tension under conditions that favor formation of the open complex results in destabilization of the preinitiation complex. Furthermore, with zero ribonucleotides present, when the closed complex is favored, we find reduced tension sensitivity, implying that it is predominantly the open complex that is sensitive. This result strongly supports the “scrunching” model for T7 transcription initiation, as the applied tension acts against the movement of the DNA into the scrunched state, and introduces linear DNA tension as a potential regulatory quantity for transcription initiation. PMID:21320448

A multiple-scattering polaritonic-operator method for hybrid arrays of metal nanoparticles and quantum emitters

NASA Astrophysics Data System (ADS)

Chatzidakis, Georgios D.; Yannopapas, Vassilios

2018-05-01

We present a new technique for the study of hybrid collections of quantum emitters (atoms, molecules, quantum dots) with nanoparticles. The technique is based on a multiple-scattering polaritonic-operator formalism in conjunction with an electromagnetic coupled dipole method. Apart from collections of quantum emitters and nanoparticles, the method can equally treat the interaction of a collection of quantum emitters with a single nano-object of arbitrary shape in which case the nano-object is treated as a finite three-dimensional lattice of point scatterers. We have applied our method to the case of linear array (chain) of dimers of quantum emitters and metallic nanoparticles wherein the corresponding (geometrical and physical) parameters of the dimers are chosen so as the interaction between the emitter and the nanoparticle lies in the strong-coupling regime in order to enable the formation of plexciton states in the dimer. In particular, for a linear chain of dimers, we show that the corresponding light spectra reveal a multitude of plexciton modes resulting from the hybridization of the plexciton resonances of each individual dimer in a manner similar to the tight-binding description of electrons in solids.

Efficient parallel linear scaling construction of the density matrix for Born-Oppenheimer molecular dynamics.

PubMed

Mniszewski, S M; Cawkwell, M J; Wall, M E; Mohd-Yusof, J; Bock, N; Germann, T C; Niklasson, A M N

2015-10-13

We present an algorithm for the calculation of the density matrix that for insulators scales linearly with system size and parallelizes efficiently on multicore, shared memory platforms with small and controllable numerical errors. The algorithm is based on an implementation of the second-order spectral projection (SP2) algorithm [ Niklasson, A. M. N. Phys. Rev. B 2002 , 66 , 155115 ] in sparse matrix algebra with the ELLPACK-R data format. We illustrate the performance of the algorithm within self-consistent tight binding theory by total energy calculations of gas phase poly(ethylene) molecules and periodic liquid water systems containing up to 15,000 atoms on up to 16 CPU cores. We consider algorithm-specific performance aspects, such as local vs nonlocal memory access and the degree of matrix sparsity. Comparisons to sparse matrix algebra implementations using off-the-shelf libraries on multicore CPUs, graphics processing units (GPUs), and the Intel many integrated core (MIC) architecture are also presented. The accuracy and stability of the algorithm are illustrated with long duration Born-Oppenheimer molecular dynamics simulations of 1000 water molecules and a 303 atom Trp cage protein solvated by 2682 water molecules.

Transport gap engineering by contact geometry in graphene nanoribbons: Experimental and theoretical studies on artificial materials

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.

Conductance of three-terminal molecular bridge based on tight-binding theory

NASA Astrophysics Data System (ADS)

Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

2005-05-01

The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

Tight-Binding Study of Polarons in Two-Dimensional Systems: Implications for Organic Field-Effect Transistor Materials

NASA Astrophysics Data System (ADS)

Lei, Jie

2011-03-01

In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.

Improved nonorthogonal tight-binding Hamiltonian for molecular-dynamics simulations of silicon clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordejon, P.; Lebedenko, D.; Menon, M.

1994-08-15

We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v

Universal tight binding model for chemical reactions in solution and at surfaces. II. Water.

PubMed

Lozovoi, A Y; Sheppard, T J; Pashov, D L; Kohanoff, J J; Paxton, A T

2014-07-28

A revised water model intended for use in condensed phase simulations in the framework of the self consistent polarizable ion tight binding theory is constructed. The model is applied to water monomer, dimer, hexamers, ice, and liquid, where it demonstrates good agreement with theoretical results obtained by more accurate methods, such as DFT and CCSD(T), and with experiment. In particular, the temperature dependence of the self diffusion coefficient in liquid water predicted by the model, closely reproduces experimental curves in the temperature interval between 230 K and 350 K. In addition, and in contrast to standard DFT, the model properly orders the relative densities of liquid water and ice. A notable, but inevitable, shortcoming of the model is underestimation of the static dielectric constant by a factor of two. We demonstrate that the description of inter and intramolecular forces embodied in the tight binding approximation in quantum mechanics leads to a number of valuable insights which can be missing from ab initio quantum chemistry and classical force fields. These include a discussion of the origin of the enhanced molecular electric dipole moment in the condensed phases, and a detailed explanation for the increase of coordination number in liquid water as a function of temperature and compared with ice--leading to insights into the anomalous expansion on freezing. The theory holds out the prospect of an understanding of the currently unexplained density maximum of water near the freezing point.

A Model for Predicting Thermoelectric Properties of Bi2Te3

NASA Technical Reports Server (NTRS)

Lee, Seungwon; VonAllmen, Paul

2009-01-01

A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.

Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes

PubMed Central

Simons, Michelle; Szczelkun, Mark D.

2011-01-01

The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5′-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can ‘turnover’ in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase–nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed. PMID:21712244

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.

PubMed

Vetrano, Stefania; Danese, Silvio

2009-05-01

Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.

Theoretical studies of protein-protein and protein-DNA binding rates

NASA Astrophysics Data System (ADS)

Alsallaq, Ramzi A.

Proteins are folded chains of amino acids. Some of the amino acids (e.g. Lys, Arg, His, Asp, and Glu) carry charges under physiological conditions. Proteins almost always function through binding to other proteins or ligands, for example barnase is a ribonuclease protein, found in the bacterium Bacillus amyloliquefaceus. Barnase degrades RNA by hydrolysis. For the bacterium to inhibit the potentially lethal action of Barnase within its own cell it co-produces another protein called barstar which binds quickly, and tightly, to barnase. The biological function of this binding is to block the active site of barnase. The speeds (rates) at which proteins associate are vital to many biological processes. They span a wide range (from less than 103 to 108 M-1s-1 ). Rates greater than ˜ 106 M -1s-1 are typically found to be manifestations of enhancements by long-range electrostatic interactions between the associating proteins. A different paradigm appears in the case of protein binding to DNA. The rate in this case is enhanced through attractive surface potential that effectively reduces the dimensionality of the available search space for the diffusing protein. This thesis presents computational and theoretical models on the rate of association of ligands/proteins to other proteins or DNA. For protein-protein association we present a general strategy for computing protein-protein rates of association. The main achievements of this strategy is the ability to obtain a stringent reaction criteria based on the landscape of short-range interactions between the associating proteins, and the ability to compute the effect of the electrostatic interactions on the rates of association accurately using the best known solvers for Poisson-Boltzmann equation presently available. For protein-DNA association we present a mathematical model for proteins targeting specific sites on a circular DNA topology. The main achievements are the realization that a linear DNA with reflecting ends and specific site in the middle of the chain is kinetically indistinguishable from its circularized topology, and the ability to predict the effect of the dissociation via the ends of linear DNA on the rate of association which is to reduce the rate.* *This dissertation is a compound document (contains both a paper copy and a CD as part of the dissertation). The CD requires the following system requirements: QuickTime.

Nuclear magnetic resonance and restrained molecular dynamics studies of the interaction of an epidermal growth factor-derived peptide with protein tyrosine phosphatase 1B.

PubMed

Glover, N R; Tracey, A S

1999-04-20

The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.

Cell-cell interactions of isolated and cultured oligodendrocytes: formation of linear occluding junctions and expression of peculiar intramembrane particles.

PubMed

Massa, P T; Szuchet, S; Mugnaini, E

1984-12-01

Oligodendrocytes were isolated from lamb brain. Freshly isolated cells and cultured cells, either 1- to 4-day-old unattached or 1- to 5-week-old attached, were examined by thin section and freeze-fracture electron microscopy. Freeze-fracture of freshly isolated oligodendrocytes showed globular and elongated intramembrane particles similar to those previously described in oligodendrocytes in situ. Enrichment of these particles was seen at sites of inter-oligodendrocyte contact. Numerous gap junctions and scattered linear tight junctional arrays were apparent. Gap junctions were connected to blebs of astrocytic plasma membrane sheared off during isolation, whereas tight junctions were facing extracellular space or blebs of oligodendrocytic plasma membrane. Thin sections of cultured, unattached oligodendrocytes showed rounded cell bodies touching one another at points without forming specialized cell junctions. Cells plated on polylysine-coated aclar dishes attached, emanated numerous, pleomorphic processes, and expressed galactocerebroside and myelin basic protein, characteristic markers for oligodendrocytes. Thin sections showed typical oligodendrocyte ultrastructure but also intermediate filaments not present in unattached cultures. Freeze-fracture showed intramembrane particles similar to but more numerous, and with a different fracture face repartition, than those seen in oligodendrocytes, freshly isolated or in situ. Gap junctions were small and rare. Apposed oligodendrocyte plasma membrane formed linear tight junctions which became more numerous with time in culture. Thus, cultured oligodendrocytes isolated from ovine brains develop and maintain features characteristic of mature oligodendrocytes in situ and can be used to explore formation and maintenance of tight junctions and possibly other classes of cell-cell interactions important in the process of myelination.

Tight-binding calculation of the magnetic moment of CrAs under pressure

NASA Astrophysics Data System (ADS)

Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio

2018-03-01

We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.

Exact evaluation of the causal spectrum and localization properties of electronic states on a scale-free network

NASA Astrophysics Data System (ADS)

Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.

2018-07-01

A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.

Density functional tight-binding and infrequent metadynamics can capture entropic effects in intramolecular hydrogen transfer reactions

NASA Astrophysics Data System (ADS)

Oliveira, Luiz F. L.; Fu, Christopher D.; Pfaendtner, Jim

2018-04-01

Infrequent metadynamics uses biased simulations to estimate the unbiased kinetics of a system, facilitating the calculation of rates and barriers. Here the method is applied to study intramolecular hydrogen transfer reactions involving peroxy radicals, a class of reactions that is challenging to model due to the entropic contributions of the formation of ring structures in the transition state. Using the self-consistent charge density-functional based tight-binding (DFTB) method, we applied infrequent metadynamics to the study of four intramolecular H-transfer reactions, demonstrating that the method can qualitatively reproduce these high entropic contributions, as observed in experiments and those predicted by transition state theory modeled by higher levels of theory. We also show that infrequent metadynamics and DFTB are successful in describing the relationship between transition state ring size and kinetic coefficients (e.g., activation energies and the pre-exponential factors).

Electro-optical properties of zigzag and armchair boron nitride nanotubes under a transverse electric field: Tight binding calculations

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2012-02-01

The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. II. Application—Effect of quantum confinement and homogeneous strain on Cu conductance

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard

2014-03-01

The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.

Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices

NASA Astrophysics Data System (ADS)

Graefe, E. M.; Korsch, H. J.; Rush, A.

2016-07-01

Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuevas, F.A.; Curilef, S., E-mail: scurilef@ucn.cl; Plastino, A.R., E-mail: arplastino@ugr.es

The spread of a wave-packet (or its deformation) is a very important topic in quantum mechanics. Understanding this phenomenon is relevant in connection with the study of diverse physical systems. In this paper we apply various 'spreading measures' to characterize the evolution of an initially localized wave-packet in a tight-binding lattice, with special emphasis on information-theoretical measures. We investigate the behavior of both the probability distribution associated with the wave packet and the concomitant probability current. Complexity measures based upon Renyi entropies appear to be particularly good descriptors of the details of the delocalization process. - Highlights: > Spread ofmore » highly localized wave-packet in the tight-binding lattice. > Entropic and information-theoretical characterization is used to understand the delocalization. > The behavior of both the probability distribution and the concomitant probability current is investigated. > Renyi entropies appear to be good descriptors of the details of the delocalization process.« less

Communication: Charge-population based dispersion interactions for molecules and materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

2016-04-21

We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less

Generalized virial theorem for massless electrons in graphene and other Dirac materials

NASA Astrophysics Data System (ADS)

Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

2016-05-01

The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.

Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

NASA Astrophysics Data System (ADS)

Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

2017-03-01

Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.

Transition States and transition state analogue interactions with enzymes.

PubMed

Schramm, Vern L

2015-04-21

Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.

A Tightly Coupled Non-Equilibrium Magneto-Hydrodynamic Model for Inductively Coupled RF Plasmas

DTIC Science & Technology

2016-02-29

development a tightly coupled magneto-hydrodynamic model for Inductively Coupled Radio- Frequency (RF) Plasmas. Non Local Thermodynamic Equilibrium (NLTE...for Inductively Coupled Radio-Frequency (RF) Plasmas. Non Local Thermodynamic Equilibrium (NLTE) effects are described based on a hybrid State-to-State... thermodynamic variable. This choice allows one to hide the non-linearity of the gas (total) thermal conductivity κ and can partially alle- 2 viate numerical

Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2

PubMed Central

Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.

2009-01-01

Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464

Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

PubMed

Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

2017-11-16

The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

PubMed Central

Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

2009-01-01

8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165

Structural characterization by NMR of the natively unfolded extracellular domain of beta-dystroglycan: toward the identification of the binding epitope for alpha-dystroglycan.

PubMed

Bozzi, Manuela; Bianchi, Marzia; Sciandra, Francesca; Paci, Maurizio; Giardina, Bruno; Brancaccio, Andrea; Cicero, Daniel O

2003-11-25

Dystroglycan (DG) is an adhesion molecule playing a crucial role for tissue stability during both early embriogenesis and adulthood and is composed by two tightly interacting subunits: alpha-DG, membrane-associated and highly glycosylated, and the transmembrane beta-DG. Recently, by solid-phase binding assays and NMR experiments, we have shown that the C-terminal domain of alpha-DG interacts with a recombinant extracellular fragment of beta-DG (positions 654-750) independently from glycosylation and that the linear binding epitope is located between residues 550 and 565 of alpha-DG. In order to elucidate which moieties of beta-DG are specifically involved in the complex with alpha-DG, the ectodomain has been recombinantly expressed and purified in a labeled ((13)C,(15)N) form and studied by multidimensional NMR. Although it represents a natively unfolded protein domain, we obtained an almost complete backbone assignment. Chemical shift index, (1)H-(15)N heteronuclear single-quantum coherence and nuclear Overhauser effect (HSQC-NOESY) spectra and (3)J(HN,H)(alpha) coupling constant values confirm that this protein is highly disordered, but (1)H-(15)N steady-state NOE experiments indicate that the protein presents two regions of different mobility. The first one, between residues 659 and 722, is characterized by a limited degree of mobility, whereas the C-terminal portion, containing about 30 amino acids, is highly flexible. The binding of beta-DG(654-750) to the C-terminal region of the alpha subunit, alpha-DG(485-620), has been investigated, showing that the region of beta-DG(654-750) between residues 691 and 719 is involved in the interaction.

Antifreeze Protein Binds Irreversibly to Ice

NASA Astrophysics Data System (ADS)

Braslavsky, I.; Pertaya, N.; di Prinzio, C. L.; Wilen, L.; Thomson, E.; Wettlaufer, J. S.; Marshall, C. B.; Davies, P. L.

2006-03-01

Many organisms are protected from freezing by antifreeze proteins (AFPs), which bind to ice and prevent its growth by a mechanism not completely understood. Although it has been postulated that AFPs would have to bind irreversibly to arrest the growth of an ice crystal bathed in excess liquid water, the binding forces seem insufficient to support such a tight interaction. By putting a fluorescent tag on a fish AFP, we were able to visualize AFP binding to ice and demonstrate, by lack of recovery after photo-bleaching, that it is indeed irreversible. Because even the most avid protein/ligand interactions exhibit reversibility, this finding is key to understanding the mechanism of antifreeze proteins, which are becoming increasingly valuable in cryopreservation and improving the frost tolerance of crops.

AFRRI Reports, Second Quarter 1994

DTIC Science & Technology

1994-08-01

the antrum wete immediately placed in sterile 0.9% NaCl, kept on ice, coded, and then prepared for culture, smears, and urease assay by homogeniza...high urease specific activity (>1 |J.mol- min-1 ■ mg protein-1) plus high-affinity substrate binding (Mi- chaelis constant [K^\\ < 1 mmol/L),27 in at...031, respectively), and the characteristic bacterial growth with high-activity product.on of a urease with tight substrate binding " was found in

Triazole biotin: a tight-binding biotinidase-resistant conjugate.

PubMed

Germeroth, Anne I; Hanna, Jill R; Karim, Rehana; Kundel, Franziska; Lowther, Jonathan; Neate, Peter G N; Blackburn, Elizabeth A; Wear, Martin A; Campopiano, Dominic J; Hulme, Alison N

2013-11-28

The natural amide bond found in all biotinylated proteins has been replaced with a triazole through CuAAC reaction of an alkynyl biotin derivative. The resultant triazole-linked adducts are shown to be highly resistant to the ubiquitous hydrolytic enzyme biotinidase and to bind avidin with dissociation constants in the low pM range. Application of this strategy to the production of a series of biotinidase-resistant biotin-Gd-DOTA contrast agents is demonstrated.

Combined first-principles and model Hamiltonian study of the perovskite series R MnO 3 (R =La ,Pr ,Nd ,Sm ,Eu , and Gd )

NASA Astrophysics Data System (ADS)

Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare

2016-02-01

We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.

Structure-guided design of an engineered streptavidin with reusability to purify streptavidin-binding peptide tagged proteins or biotinylated proteins.

PubMed

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.

Structure-Guided Design of an Engineered Streptavidin with Reusability to Purify Streptavidin-Binding Peptide Tagged Proteins or Biotinylated Proteins

PubMed Central

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971

Modified Hydra Bioassay to Evaluate the Toxicity of Multiple Mycotoxins and Predict the Detoxification Efficacy of a Clay-Based Sorbent

PubMed Central

Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD

2013-01-01

Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854

Modified hydra bioassay to evaluate the toxicity of multiple mycotoxins and predict the detoxification efficacy of a clay-based sorbent.

PubMed

Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D

2014-01-01

Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. Copyright © 2012 John Wiley & Sons, Ltd.

Slow-binding inhibition of sialidase from influenza virus.

PubMed

Pegg, M S; von Itzstein, M

1994-04-01

Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.

Band-gap tuning and optical response of two-dimensional Si x C 1 - x : A first-principles real-space study of disordered two-dimensional materials

DOE PAGES

Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda; ...

2017-08-09

We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen–Baerends corrected exchange potential. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene Si xC 1–x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussedmore » in the light of the available experimental and other theoretical data. As a result, our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.« less

A high-throughput screening approach for the optoelectronic properties of conjugated polymers.

PubMed

Wilbraham, Liam; Berardo, Enrico; Turcani, Lukas; Jelfs, Kim E; Zwijnenburg, Martijn A

2018-06-25

We propose a general high-throughput virtual screening approach for the optical and electronic properties of conjugated polymers. This approach makes use of the recently developed xTB family of low-computational-cost density functional tight-binding methods from Grimme and co-workers, calibrated here to (TD-)DFT data computed for a representative diverse set of (co-)polymers. Parameters drawn from the resulting calibration using a linear model can then be applied to the xTB derived results for new polymers, thus generating near DFT-quality data with orders of magnitude reduction in computational cost. As a result, after an initial computational investment for calibration, this approach can be used to quickly and accurately screen on the order of thousands of polymers for target applications. We also demonstrate that the (opto)electronic properties of the conjugated polymers show only a very minor variation when considering different conformers and that the results of high-throughput screening are therefore expected to be relatively insensitive with respect to the conformer search methodology applied.

Interplay between topology and disorder in a two-dimensional semi-Dirac material

NASA Astrophysics Data System (ADS)

Sriluckshmy, P. V.; Saha, Kush; Moessner, Roderich

2018-01-01

We investigate the role of disorder in a two-dimensional semi-Dirac material characterized by a linear dispersion in one direction and a parabolic dispersion in the orthogonal direction. Using the self-consistent Born approximation, we show that disorder can drive a topological Lifshitz transition from an insulator to a semimetal, as it generates a momentum-independent off-diagonal contribution to the self-energy. Breaking time-reversal symmetry enriches the topological phase diagram with three distinct regimes—single-node trivial, two-node trivial, and two-node Chern. We find that disorder can drive topological transitions from both the single- and two-node trivial to the two-node Chern regime. We further analyze these transitions in an appropriate tight-binding Hamiltonian of an anisotropic hexagonal lattice by calculating the real-space Chern number. Additionally, we compute the disorder-averaged entanglement entropy which signals both the topological Lifshitz and Chern transition as a function of the anisotropy of the hexagonal lattice. Finally, we discuss experimental aspects of our results.

Angular momentum transport with twisted exciton wave packets

NASA Astrophysics Data System (ADS)

Zang, Xiaoning; Lusk, Mark T.

2017-10-01

A chain of cofacial molecules with CN or CN h symmetry supports excitonic states with a screwlike structure. These can be quantified with the combination of an axial wave number and an azimuthal winding number. Combinations of these states can be used to construct excitonic wave packets that spiral down the chain with well-determined linear and angular momenta. These twisted exciton wave packets can be created and annihilated using laser pulses, and their angular momentum can be optically modified during transit. This allows for the creation of optoexcitonic circuits in which information, encoded in the angular momentum of light, is converted into excitonic wave packets that can be manipulated, transported, and then reemitted. A tight-binding paradigm is used to demonstrate the key ideas. The approach is then extended to quantify the evolution of twisted exciton wave packets in a many-body, multilevel time-domain density functional theory setting. In both settings, numerical methods are developed that allow the site-to-site transfer of angular momentum to be quantified.

Band-gap tuning and optical response of two-dimensional Si x C 1 - x : A first-principles real-space study of disordered two-dimensional materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda

We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen–Baerends corrected exchange potential. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene Si xC 1–x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussedmore » in the light of the available experimental and other theoretical data. As a result, our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.« less

Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

PubMed

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tight-Binding Inhibition of Human Monoamine Oxidase B by Chromone Analogs: A Kinetic, Crystallographic, and Biological Analysis.

PubMed

Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia

2018-05-10

Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).

Multiscale modeling of nanostructured ZnO based devices for optoelectronic applications: Dynamically-coupled structural fields, charge, and thermal transport processes

NASA Astrophysics Data System (ADS)

Abdullah, Abdulmuin; Alqahtani, Saad; Nishat, Md Rezaul Karim; Ahmed, Shaikh; SIU Nanoelectronics Research Group Team

Recently, hybrid ZnO nanostructures (such as ZnO deposited on ZnO-alloys, Si, GaN, polymer, conducting oxides, and organic compounds) have attracted much attention for their possible applications in optoelectronic devices (such as solar cells, light emitting and laser diodes), as well as in spintronics (such as spin-based memory, and logic). However, efficiency and performance of these hybrid ZnO devices strongly depend on an intricate interplay of complex, nonlinear, highly stochastic and dynamically-coupled structural fields, charge, and thermal transport processes at different length and time scales, which have not yet been fully assessed experimentally. In this work, we study the effects of these coupled processes on the electronic and optical emission properties in nanostructured ZnO devices. The multiscale computational framework employs the atomistic valence force-field molecular mechanics, models for linear and non-linear polarization, the 8-band sp3s* tight-binding models, and coupling to a TCAD toolkit to determine the terminal properties of the device. A series of numerical experiments are performed (by varying different nanoscale parameters such as size, geometry, crystal cut, composition, and electrostatics) that mainly aim to improve the efficiency of these devices. Supported by the U.S. National Science Foundation Grant No. 1102192.

Effect of random vacancies on the electronic properties of graphene and T graphene: a theoretical approach

NASA Astrophysics Data System (ADS)

Sadhukhan, B.; Nayak, A.; Mookerjee, A.

2017-12-01

In this communication we present together four distinct techniques for the study of electronic structure of solids: the tight-binding linear muffin-tin orbitals, the real space and augmented space recursions and the modified exchange-correlation. Using this we investigate the effect of random vacancies on the electronic properties of the carbon hexagonal allotrope, graphene, and the non-hexagonal allotrope, planar T graphene. We have inserted random vacancies at different concentrations, to simulate disorder in pristine graphene and planar T graphene sheets. The resulting disorder, both on-site (diagonal disorder) as well as in the hopping integrals (off-diagonal disorder), introduces sharp peaks in the vicinity of the Dirac point built up from localized states for both hexagonal and non-hexagonal structures. These peaks become resonances with increasing vacancy concentration. We find that in presence of vacancies, graphene-like linear dispersion appears in planar T graphene and the cross points form a loop in the first Brillouin zone similar to buckled T graphene that originates from π and π* bands without regular hexagonal symmetry. We also calculate the single-particle relaxation time, τ (ěc {q}) of ěc {q} labeled quantum electronic states which originates from scattering due to presence of vacancies, causing quantum level broadening.

Recursive Factorization of the Inverse Overlap Matrix in Linear-Scaling Quantum Molecular Dynamics Simulations.

PubMed

Negre, Christian F A; Mniszewski, Susan M; Cawkwell, Marc J; Bock, Nicolas; Wall, Michael E; Niklasson, Anders M N

2016-07-12

We present a reduced complexity algorithm to compute the inverse overlap factors required to solve the generalized eigenvalue problem in a quantum-based molecular dynamics (MD) simulation. Our method is based on the recursive, iterative refinement of an initial guess of Z (inverse square root of the overlap matrix S). The initial guess of Z is obtained beforehand by using either an approximate divide-and-conquer technique or dynamical methods, propagated within an extended Lagrangian dynamics from previous MD time steps. With this formulation, we achieve long-term stability and energy conservation even under the incomplete, approximate, iterative refinement of Z. Linear-scaling performance is obtained using numerically thresholded sparse matrix algebra based on the ELLPACK-R sparse matrix data format, which also enables efficient shared-memory parallelization. As we show in this article using self-consistent density-functional-based tight-binding MD, our approach is faster than conventional methods based on the diagonalization of overlap matrix S for systems as small as a few hundred atoms, substantially accelerating quantum-based simulations even for molecular structures of intermediate size. For a 4158-atom water-solvated polyalanine system, we find an average speedup factor of 122 for the computation of Z in each MD step.

Recursive Factorization of the Inverse Overlap Matrix in Linear Scaling Quantum Molecular Dynamics Simulations

DOE PAGES

Negre, Christian F. A; Mniszewski, Susan M.; Cawkwell, Marc Jon; ...

2016-06-06

We present a reduced complexity algorithm to compute the inverse overlap factors required to solve the generalized eigenvalue problem in a quantum-based molecular dynamics (MD) simulation. Our method is based on the recursive iterative re nement of an initial guess Z of the inverse overlap matrix S. The initial guess of Z is obtained beforehand either by using an approximate divide and conquer technique or dynamically, propagated within an extended Lagrangian dynamics from previous MD time steps. With this formulation, we achieve long-term stability and energy conservation even under incomplete approximate iterative re nement of Z. Linear scaling performance ismore » obtained using numerically thresholded sparse matrix algebra based on the ELLPACK-R sparse matrix data format, which also enables e cient shared memory parallelization. As we show in this article using selfconsistent density functional based tight-binding MD, our approach is faster than conventional methods based on the direct diagonalization of the overlap matrix S for systems as small as a few hundred atoms, substantially accelerating quantum-based simulations even for molecular structures of intermediate size. For a 4,158 atom water-solvated polyalanine system we nd an average speedup factor of 122 for the computation of Z in each MD step.« less

Cytoskeletal mechanics: Structure and Dynamics

NASA Astrophysics Data System (ADS)

Bausch, Andreas

2008-03-01

The actin cytoskeleton, a dynamic network of semiflexible filaments and associated regulatory proteins, is responsible for the extraordinary viscoelastic properties of cells. Especially for cellular motility the controlled self assembly to defined structures and the dynamic reorganization on different time scales are of outstanding importance. A prominent example for the controlled self assembly are actin bundles: in many cytoskeletal processes cells rely on the tight control of the structural and mechanical properties of the actin bundles. Using an in vitro model system we show that size control relies on a mismatch between the helical structure of individual actin filaments and the packing symmetry within bundles. While such self assembled structure may evoke the picture of a static network the contrary is the case: the cytoskeleton is highly dynamic and a constant remodeling takes place in vivo. Such dynamic reorganization of the cytoskeleton relies on the non-static nature of single actin/ABP bonds. Here, we study the thermal and forced unbinding events of individual ABP in such in vitro networks. The binding kinetics of the transient crosslinkers determines the mechanical response of such networks -- in the linear as well in the non-linear regime. These effects are important prerequisites for the high adaptability of cells and at the same time might be the molecular mechanism employed by them for mechanosensing.

The K-turn motif in riboswitches and other RNA species☆

PubMed Central

Lilley, David M.J.

2014-01-01

The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078

Linear Optical Response of Silicon Nanotubes Under Axial Magnetic Field

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2013-01-01

We investigated the optical properties of silicon nanotubes (SiNTs) in the low energy region, E < 0.5 eV, and middle energy region, 1.8 eV < E < 2 eV. The dependence of optical matrix elements and linear susceptibility on radius and magnetic field, in terms of one-dimensional (1-d) wavevector and subband index, is calculated using the tight-binding approximation. It is found that, on increasing the nanotube diameter, the low-energy peaks show red-shift and their intensities are decreased. Also, we found that in the middle energy region all tubes have two distinct peaks, where the energy position of the second peak is approximately constant and independent of the nanotube diameter. Comparing the band structure of these tubes in different magnetic fields, several differences are clearly seen, such as splitting of degenerate bands, creation of additional band-edge states, and bandgap modification. It is found that applying the magnetic field leads to a phase transition in zigzag silicon hexagonal nanotubes (Si h-NTs), unlike in zigzag silicon gear-like nanotubes (Si g-NTs), which remain semiconducting in any magnetic field. We found that the axial magnetic field has two effects on the linear susceptibility spectrum, namely broadening and splitting. The axial magnetic field leads to the creation of a peak with energy less than 0.2 eV in metallic Si h-NTs, whereas in the absence of a magnetic field such a transition is not allowed.

Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

PubMed Central

Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

2008-01-01

Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

Conductance of AFM Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)

2002-01-01

This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.

Membrane Association of the PTEN Tumor Suppressor: Electrostatic Interaction with Phos-phatidylserine-Containing Bilayers and Regulatory Role of the C-Terminal Tail

PubMed Central

Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias

2012-01-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177

Membrane association of the PTEN tumor suppressor: electrostatic interaction with phosphatidylserine-containing bilayers and regulatory role of the C-terminal tail.

PubMed

Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias

2012-12-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.

Supercontinuum Emission from Water using 40 fs Pulses in the External Tight Focusing Limit

NASA Astrophysics Data System (ADS)

Sreeja, S.; Rao, S. Venugopal; Bagchi, Suman; Sreedhar, S.; Prashant, T. Shuvan; Radhakrishnan, P.; Tewari, Surya P.; Kiran, P. Prem

2011-10-01

We present our results from the measurements of Supereonlinuum emission (SCE) resulting from the propagation ol" tightly foe used 40 femtosecond laser pulses through distilled water. The e fleet of linearly polarized (LP) and circularly polarized (CP) light pulses on the SCE: in different external focal geometries (f/6 & f/12) is studied in detail. A considerable shift in the minimum wavelength of SCF under tighter focusing limit is observed.

Electromagnetic fields of an ultra-short tightly-focused radially-polarized laser pulse

NASA Astrophysics Data System (ADS)

Salamin, Yousef I.; Li, Jian-Xing

2017-12-01

Fully analytic expressions, for the electric and magnetic fields of an ultrashort and tightly focused laser pulse of the radially polarized category, are presented to lowest order of approximation. The fields are derived from scalar and vector potentials, along the lines of our earlier work for a similar pulse of the linearly polarized variety. A systematic program is also described from which the fields may be obtained to any desired accuracy, analytically or numerically.

Glucose monitoring using a polymer brush modified polypropylene hollow fiber-based hydraulic flow sensor.

PubMed

Fortin, Nicolas; Klok, Harm-Anton

2015-03-04

Tight regulation of blood glucose levels of diabetic patients requires durable and robust continuous glucose sensing schemes. This manuscript reports the fabrication of ultrathin, phenylboronic acid (PBA) functionalized polymer brushes that swell upon glucose binding and which were integrated as the sensing interface in a new polypropylene hollow fiber (PPHF)-based hydraulic flow glucose sensor prototype. The polymer brushes were prepared via surface-initiated atom transfer radical polymerization of sodium methacrylate followed by postpolymerization modification with 3-aminophenyl boronic acid. In a first series of experiments, the glucose-response of PBA-functionalized poly(methacrylic acid) (PMAA) brushes grafted from planar silicon surfaces was investigated by quartz crystal microbalance with dissipation (QCM-D) and atomic force microscopy (AFM) experiments. The QCM-D experiments revealed a more or less linear change of the frequency shift for glucose concentrations up to ∼10 mM and demonstrated that glucose binding was completely reversible for up to seven switching cycles. The AFM experiments indicated that glucose binding was accompanied by an increase in the film thickness of the PBA functionalized PMAA brushes. The PBA functionalized PMAA brushes were subsequently grafted from the surface of PPHF membranes. The hydraulic permeability of these porous fibers depends on the thickness and swelling of the PMAA brush coating. PBA functionalized brush-coated PPHFs showed a decrease in flux upon exposure to glucose, which is consistent with swelling of the brush coating. Because they avoid the use of enzymes and do not rely on an electrochemical transduction scheme, these PPHF-based hydraulic flow sensors could represent an interesting alternative class of continuous glucose sensors.

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE PAGES

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

2016-09-09

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

NASA Astrophysics Data System (ADS)

Leleyter, M.; Olivi-Tran, N.

2008-12-01

We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.

Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

2010-01-01

Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

PubMed

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

2016-10-11

In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.

Influence of Gestational Age at Initiation of Antihypertensive Therapy: Secondary Analysis of CHIPS Trial Data (Control of Hypertension in Pregnancy Study).

PubMed

Pels, Anouk; Mol, Ben Willem J; Singer, Joel; Lee, Terry; von Dadelszen, Peter; Ganzevoort, Wessel; Asztalos, Elizabeth; Magee, Laura A

2018-06-01

For hypertensive women in CHIPS (Control of Hypertension in Pregnancy Study), we assessed whether the maternal benefits of tight control could be achieved, while minimizing any potentially negative effect on fetal growth, by delaying initiation of antihypertensive therapy until later in pregnancy. For the 981 women with nonsevere, chronic or gestational hypertension randomized to less-tight (target diastolic blood pressure, 100 mm Hg), or tight (target, 85 mm Hg) control, we used mixed-effects logistic regression to examine whether the effect of less-tight (versus tight) control on major outcomes was dependent on gestational age at randomization, adjusting for baseline factors as in the primary analysis and including an interaction term between gestational age at randomization and treatment allocation. Gestational age was considered categorically (quartiles) and continuously (linear or quadratic form), and the optimal functional form selected to provide the best fit to the data based on the Akaike information criterion. Randomization before (but not after) 24 weeks to less-tight (versus tight) control was associated with fewer babies with birth weight <10th centile ( P interaction =0.005), but more preterm birth ( P interaction =0.043), and no effect on perinatal death or high-level neonatal care >48 hours ( P interaction =0.354). For the mother, less-tight (versus tight) control was associated with more severe hypertension at all gestational ages but particularly so before 28 weeks ( P interaction =0.076). In women with nonsevere, chronic, or gestational hypertension, there seems to be no gestational age at which less-tight (versus tight) control is the preferred management strategy to optimize maternal or perinatal outcomes. URL: https://www.isrctn.com. Unique identifier: ISRCTN71416914. © 2018 The Authors.

Alignment of the Stanford Linear Collider Arcs: Concepts and results

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pitthan, R.; Bell, B.; Friedsam, H.

1987-02-01

The alignment of the Arcs for the Stanford Linear Collider at SLAC has posed problems in accelerator survey and alignment not encountered before. These problems come less from the tight tolerances of 0.1 mm, although reaching such a tight statistically defined accuracy in a controlled manner is difficult enough, but from the absence of a common reference plane for the Arcs. Traditional circular accelerators, including HERA and LEP, have been designed in one plane referenced to local gravity. For the SLC Arcs no such single plane exists. Methods and concepts developed to solve these and other problems, connected with themore » unique design of SLC, range from the first use of satellites for accelerator alignment, use of electronic laser theodolites for placement of components, computer control of the manual adjustment process, complete automation of the data flow incorporating the most advanced concepts of geodesy, strict separation of survey and alignment, to linear principal component analysis for the final statistical smoothing of the mechanical components.« less

Dynamic constitutional frameworks for DNA biomimetic recognition.

PubMed

Catana, Romina; Barboiu, Mihail; Moleavin, Ioana; Clima, Lilia; Rotaru, Alexandru; Ursu, Elena-Laura; Pinteala, Mariana

2015-02-07

Linear and cross-linked dynamic constitutional frameworks generated from reversibly interacting linear PEG/core constituents and cationic sites shed light on the dominant coiling versus linear DNA binding behaviours, closer to the histone DNA binding wrapping mechanism.

Automodification of PARP-1 mediates its tight binding to the nuclear matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zaalishvili, Giorgi, E-mail: giozaal@gmail.com; Margiani, Dina; Kutalia, Ketevan

2010-02-26

Poly(ADP-ribose) polymerase-1 (PARP-1), a nuclear enzyme that catalyzes the NAD{sup +}-dependent addition of ADP-ribose polymers on a variety of nuclear proteins, has been shown to be associated with the nuclear matrix. As yet, the properties and conditions of this association are unclear. Here, we show the existence of two PARP-1 pools associated with the nuclear matrix of rat liver and the ability of PARP-1 automodification to facilitate its binding to the nuclear matrix.

Data key to quest for quality.

PubMed

Chang, Florence S; Nielsen, Jon; Macias, Charles

2013-11-01

Late-binding data warehousing reduces the time it takes to obtain data needed to make crucial decisions. Late binding refers to when and how tightly data from the source applications are bound to the rules and vocabularies that make it useful. In some cases, data can be seen in real time. In historically paper-driven environments where data-driven decisions may be a new concept, buy-in from clinicians, physicians, and hospital leaders is key to success in using data to improve outcomes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez-Morales, A.; Martínez-Orozco, J. C.; Rodríguez-Vargas, I.

The main characteristics of the quantum confined Stark effect (QCSE) are studied theoretically in quantum wells of Gaussian profile. The semi-empirical tight-binding model and the Green function formalism are applied in the numerical calculations. A comparison of the QCSE in quantum wells with different kinds of confining potential is presented.

Dirac fermions and pseudomagnetic fields in two-dimensional electron gases with triangular antidot lattices

NASA Astrophysics Data System (ADS)

Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai

2017-07-01

We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.

Quantitative analysis on electric dipole energy in Rashba band splitting.

PubMed

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-09-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

Quantitative analysis on electric dipole energy in Rashba band splitting

PubMed Central

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-01-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493

Band gap engineering for poly(p-phenylene) and poly(p-phenylene vinylene) copolymers using the tight-binding approach

NASA Astrophysics Data System (ADS)

Giro, R.; Caldas, M. J.; Galvão, D. S.

The interest in poly(p-phenylene) (PPP) and poly(p-phenylene vinylene) (PPV) copolymers stems from the fact that these homopolymers present interesting optical and electronic properties that allow a great variety of technological applications. Combining different numbers of PPP and PPV units it is possible, in principle, to obtain new structures presenting intermediate gap values (2.8 eV and 2.4 eV for PPP and PPV, respectively). For this study we used a Hückel Hamiltonian tight-binding coupled to the negative factor counting (NFC) technique. We carried out a systematic search to determine optimum relative concentrations for disordered binary polymeric alloys with predefined gap values. Once these structures were obtained, we used the semiempirical methods AM1/PM3 and ZINDO/S-CI for geometrical and optical studies, respectively. Our theoretical results show that it is possible to obtain copolymers of PPP and PPV with intermediate gap values of their parent structures.

Modeling Magnetic Properties in EZTB

NASA Technical Reports Server (NTRS)

Lee, Seungwon; vonAllmen, Paul

2007-01-01

A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.

Structure and Stability of Molecular Crystals with Many-Body Dispersion-Inclusive Density Functional Tight Binding.

PubMed

Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre

2018-01-18

Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.

The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

PubMed

Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

2018-03-05

During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.

Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

DOE PAGES

Zhang, Hong; Zapol, Peter; Dixon, David A.; ...

2015-11-17

The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

Tight-binding model for materials at mesoscale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei

2016-12-21

TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less

Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference

NASA Astrophysics Data System (ADS)

Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.

2018-02-01

Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.

Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hong; Zapol, Peter; Dixon, David A.

The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

Adaptive frozen orbital treatment for the fragment molecular orbital method combined with density-functional tight-binding

NASA Astrophysics Data System (ADS)

Nishimoto, Yoshio; Fedorov, Dmitri G.

2018-02-01

The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.

Microscopic theory of the superconducting gap in the quasi-one-dimensional organic conductor (TMTSF) 2ClO4 : Model derivation and two-particle self-consistent analysis

NASA Astrophysics Data System (ADS)

Aizawa, Hirohito; Kuroki, Kazuhiko

2018-03-01

We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.

Analysis of Nuclear Factor-κB (NF-κB) Essential Modulator (NEMO) Binding to Linear and Lysine-linked Ubiquitin Chains and Its Role in the Activation of NF-κB*

PubMed Central

Kensche, Tobias; Tokunaga, Fuminori; Ikeda, Fumiyo; Goto, Eiji; Iwai, Kazuhiro; Dikic, Ivan

2012-01-01

Nuclear factor-κB (NF-κB) essential modulator (NEMO), a component of the inhibitor of κB kinase (IKK) complex, controls NF-κB signaling by binding to ubiquitin chains. Structural studies of NEMO provided a rationale for the specific binding between the UBAN (ubiquitin binding in ABIN and NEMO) domain of NEMO and linear (Met-1-linked) di-ubiquitin chains. Full-length NEMO can also interact with Lys-11-, Lys-48-, and Lys-63-linked ubiquitin chains of varying length in cells. Here, we show that purified full-length NEMO binds preferentially to linear ubiquitin chains in competition with lysine-linked ubiquitin chains of defined length, including long Lys-63-linked deca-ubiquitins. Linear di-ubiquitins were sufficient to activate both the IKK complex in vitro and to trigger maximal NF-κB activation in cells. In TNFα-stimulated cells, NEMO chimeras engineered to bind exclusively to Lys-63-linked ubiquitin chains mediated partial NF-κB activation compared with cells expressing NEMO that binds to linear ubiquitin chains. We propose that NEMO functions as a high affinity receptor for linear ubiquitin chains and a low affinity receptor for long lysine-linked ubiquitin chains. This phenomenon could explain quantitatively distinct NF-κB activation patterns in response to numerous cell stimuli. PMID:22605335

Donor states in inverse opals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahan, G. D.

We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less

Affinity modulation of small-molecule ligands by borrowing endogenous protein surfaces

PubMed Central

Briesewitz, Roger; Ray, Gregory T.; Wandless, Thomas J.; Crabtree, Gerald R.

1999-01-01

A general strategy is described for improving the binding properties of small-molecule ligands to protein targets. A bifunctional molecule is created by chemically linking a ligand of interest to another small molecule that binds tightly to a second protein. When the ligand of interest is presented to the target protein by the second protein, additional protein–protein interactions outside of the ligand-binding sites serve either to increase or decrease the affinity of the binding event. We have applied this approach to an intractable target, the SH2 domain, and demonstrate a 3-fold enhancement over the natural peptide. This approach provides a way to modulate the potency and specificity of biologically active compounds. PMID:10051576

Identification of a ZP3-binding protein on acrosome-intact mouse sperm by photoaffinity crosslinking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bleil, J.D.; Wassarman, P.M.

1990-07-01

During the process of fertilization in mammals, sperm bind in a relatively species-specific manner to the zona pellucida (ZP) of ovulated eggs. ZP3, a glycoprotein found in the mouse egg zona pellucida, serves as receptor for sperm during gamete adhesion. We report here that a Mr 56,000 protein found on mouse sperm has properties expected for a sperm component that recognizes and binds to ZP3. This sperm protein is radiolabeled preferentially by a photoactivatable heterobifunctional crosslinker (Denny-Jaffee reagent) covalently linked to purified ZP3, binds very tightly to ZP3-affinity columns, and is localized to heads of acrosome-intact but not acrosome-reacted sperm.more » These and other findings suggest that this protein may be a ZP3-binding protein that, together with the sperm receptor, supports species-specific binding of mouse sperm to unfertilized eggs.« less

The ZO-1–associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density

PubMed Central

Balda, Maria S.; Garrett, Michelle D.; Matter, Karl

2003-01-01

Epithelial tight junctions regulate paracellular permeability, restrict apical/basolateral intramembrane diffusion of lipids, and have been proposed to participate in the control of epithelial cell proliferation and differentiation. Previously, we have identified ZO-1–associated nucleic acid binding proteins (ZONAB), a Y-box transcription factor whose nuclear localization and transcriptional activity is regulated by the tight junction–associated candidate tumor suppressor ZO-1. Now, we found that reduction of ZONAB expression using an antisense approach or by RNA interference strongly reduced proliferation of MDCK cells. Transfection of wild-type or ZONAB-binding fragments of ZO-1 reduced proliferation as well as nuclear ZONAB pools, indicating that promotion of proliferation by ZONAB requires its nuclear accumulation. Overexpression of ZONAB resulted in increased cell density in mature monolayers, and depletion of ZONAB or overexpression of ZO-1 reduced cell density. ZONAB was found to associate with cell division kinase (CDK) 4, and reduction of nuclear ZONAB levels resulted in reduced nuclear CDK4. Thus, our data indicate that tight junctions can regulate epithelial cell proliferation and cell density via a ZONAB/ZO-1–based pathway. Although this regulatory process may also involve regulation of transcription by ZONAB, our data suggest that one mechanism by which ZONAB and ZO-1 influence proliferation is by regulating the nuclear accumulation of CDK4. PMID:12566432

Disulfide bonding arrangements in active forms of the somatomedin B domain of human vitronectin.

PubMed

Kamikubo, Yuichi; De Guzman, Roberto; Kroon, Gerard; Curriden, Scott; Neels, Jaap G; Churchill, Michael J; Dawson, Philip; Ołdziej, Stanisław; Jagielska, Anna; Scheraga, Harold A; Loskutoff, David J; Dyson, H Jane

2004-06-01

The N-terminal cysteine-rich somatomedin B (SMB) domain (residues 1-44) of the human glycoprotein vitronectin contains the high-affinity binding sites for plasminogen activator inhibitor-1 (PAI-1) and the urokinase receptor (uPAR). We previously showed that the eight cysteine residues of recombinant SMB (rSMB) are organized into four disulfide bonds in a linear uncrossed pattern (Cys(5)-Cys(9), Cys(19)-Cys(21), Cys(25)-Cys(31), and Cys(32)-Cys(39)). In the present study, we use an alternative method to show that this disulfide bond arrangement remains a major preferred one in solution, and we determine the solution structure of the domain using NMR analysis. The solution structure shows that the four disulfide bonds are tightly packed in the center of the domain, replacing the traditional hydrophobic core expected for a globular protein. The few noncysteine hydrophobic side chains form a cluster on the outside of the domain, providing a distinctive binding surface for the physiological partners PAI-1 and uPAR. The hydrophobic surface consists mainly of side chains from the loop formed by the Cys(25)-Cys(31) disulfide bond, and is surrounded by conserved acidic and basic side chains, which are likely to contribute to the specificity of the intermolecular interactions of this domain. Interestingly, the overall fold of the molecule is compatible with several arrangements of the disulfide bonds. A number of different disulfide bond arrangements were able to satisfy the NMR restraints, and an extensive series of conformational energy calculations performed in explicit solvent confirmed that several disulfide bond arrangements have comparable stabilization energies. An experimental demonstration of the presence of alternative disulfide conformations in active rSMB is provided by the behavior of a mutant in which Asn(14) is replaced by Met. This mutant has the same PAI-1 binding activity as rVN1-51, but its fragmentation pattern following cyanogen bromide treatment is incompatible with the linear uncrossed disulfide arrangement. These results suggest that active forms of the SMB domain may have a number of allowed disulfide bond arrangements as long as the Cys(25)-Cys(31) disulfide bond is preserved.

In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization.

PubMed

Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst

2013-01-15

Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.

Development of acetophenone ligands as potential neuroimaging agents for cholinesterases.

PubMed

Jollymore-Hughes, Courtney T; Pottie, Ian R; Martin, Earl; Rosenberry, Terrone L; Darvesh, Sultan

2016-11-01

Association of cholinesterase with β-amyloid plaques and tau neurofibrillary tangles in Alzheimer's disease offers an opportunity to detect disease pathology during life. Achieving this requires development of radiolabelled cholinesterase ligands with high enzyme affinity. Various fluorinated acetophenone derivatives bind to acetylcholinesterase with high affinity, including 2,2,2-trifluoro-1-(3-dimethylaminophenyl)ethanone (1) and 1-(3-tert-butylphenyl)-2,2,2-trifluoroethanone (2). Such compounds also offer potential for incorporation of radioactive fluorine ( 18 F) for Positron Emission Tomography (PET) imaging of cholinesterases in association with Alzheimer's disease pathology in the living brain. Here we describe the synthesis of two meta-substituted chlorodifluoroacetophenones using a Weinreb amide strategy and their rapid conversion to the corresponding trifluoro derivatives through nucleophilic substitution by fluoride ion, in a reaction amenable to incorporating 18 F for PET imaging. In vitro kinetic analysis indicates tight binding of the trifluoro derivatives to cholinesterases. Compound 1 has a K i value of 7nM for acetylcholinesterase and 1300nM for butyrylcholinesterase while for compound 2 these values are 0.4nM and 26nM, respectively. Tight binding of these compounds to cholinesterase encourages their development for PET imaging detection of cholinesterase associated with Alzheimer's disease pathology. Copyright © 2016 Elsevier Ltd. All rights reserved.

Structural basis for the inhibition of bacterial multidrug exporters.

PubMed

Nakashima, Ryosuke; Sakurai, Keisuke; Yamasaki, Seiji; Hayashi, Katsuhiko; Nagata, Chikahiro; Hoshino, Kazuki; Onodera, Yoshikuni; Nishino, Kunihiko; Yamaguchi, Akihito

2013-08-01

The multidrug efflux transporter AcrB and its homologues are important in the multidrug resistance of Gram-negative pathogens. However, despite efforts to develop efflux inhibitors, clinically useful inhibitors are not available at present. Pyridopyrimidine derivatives are AcrB- and MexB-specific inhibitors that do not inhibit MexY; MexB and MexY are principal multidrug exporters in Pseudomonas aeruginosa. We have previously determined the crystal structure of AcrB in the absence and presence of antibiotics. Drugs were shown to be exported by a functionally rotating mechanism through tandem proximal and distal multisite drug-binding pockets. Here we describe the first inhibitor-bound structures of AcrB and MexB, in which these proteins are bound by a pyridopyrimidine derivative. The pyridopyrimidine derivative binds tightly to a narrow pit composed of a phenylalanine cluster located in the distal pocket and sterically hinders the functional rotation. This pit is a hydrophobic trap that branches off from the substrate-translocation channel. Phe 178 is located at the edge of this trap in AcrB and MexB and contributes to the tight binding of the inhibitor molecule through a π-π interaction with the pyridopyrimidine ring. The voluminous side chain of Trp 177 located at the corresponding position in MexY prevents inhibitor binding. The structure of the hydrophobic trap described in this study will contribute to the development of universal inhibitors of MexB and MexY in P. aeruginosa.

Atomistic simulations of the optical absorption of type-II CdSe/ZnTe superlattices

PubMed Central

2012-01-01

We perform accurate tight binding simulations to design type-II short-period CdSe/ZnTe superlattices suited for photovoltaic applications. Absorption calculations demonstrate a very good agreement with optical results with threshold strongly depending on the chemical species near interfaces. PMID:23031315

The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Varnum, Susan M.

2012-03-01

Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was foundmore » to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.« less

Dual binding in cohesin-dockerin complexes: the energy landscape and the role of short, terminal segments of the dockerin module.

PubMed

Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek

2018-03-22

The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.

Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes

PubMed Central

Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.

2001-01-01

Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926

Rubisco Activity: Effects of Drought Stress

PubMed Central

PARRY, MARTIN A. J.; ANDRALOJC, P. JOHN; KHAN, SHAHNAZ; LEA, PETER J.; KEYS, ALFRED J.

2002-01-01

Ribulose‐1,5‐bisphosphate carboxylase/oxygenase (Rubisco) activity is modulated in vivo either by reaction with CO2 and Mg2+ to carbamylate a lysine residue in the catalytic site, or by the binding of inhibitors within the catalytic site. Binding of inhibitors blocks either activity or the carbamylation of the lysine residue that is essential for activity. At night, in many species, 2‐carboxyarabinitol‐1‐phosphate (CA1P) is formed which binds tightly to Rubisco, inhibiting catalytic activity. Recent work has shown that tight‐binding inhibitors can also decrease Rubisco activity in the light and contribute to the regulation of Rubisco activity. Here we determine the influence that such inhibitors of Rubisco exert on catalytic activity during drought stress. In tobacco plants, ‘total Rubisco activity’, i.e. the activity following pre‐incubation with CO2 and Mg2+, was positively correlated with leaf relative water content. However, ‘total Rubisco activity’ in extracts from leaves with low water potential increased markedly when tightly bound inhibitors were removed, thus increasing the number of catalytic sites available. This suggests that in tobacco the decrease of Rubisco activity under drought stress is not primarily the result of changes in activation by CO2 and Mg2+ but due rather to the presence of tight‐binding inhibitors. The amounts of inhibitor present in leaves of droughted tobacco based on the decrease in Rubisco activity per mg soluble protein were usually much greater than the amounts of the known inhibitors (CA1P and ‘daytime inhibitor’) that can be recovered in acid extracts. Alternative explanations for the difference between maximal and total activities are discussed. PMID:12102509

Control of the Ability of Profilin to Bind and Facilitate Nucleotide Exchange from G-actin*

PubMed Central

Wen, Kuo-Kuang; McKane, Melissa; Houtman, Jon C. D.; Rubenstein, Peter A.

2008-01-01

A major factor in profilin regulation of actin cytoskeletal dynamics is its facilitation of G-actin nucleotide exchange. However, the mechanism of this facilitation is unknown. We studied the interaction of yeast (YPF) and human profilin 1 (HPF1) with yeast and mammalian skeletal muscle actins. Homologous pairs (YPF and yeast actin, HPF1 and muscle actin) bound more tightly to one another than heterologous pairs. However, with saturating profilin, HPF1 caused a faster etheno-ATP exchange with both yeast and muscle actins than did YPF. Based on the -fold change in ATP exchange rate/Kd, however, the homologous pairs are more efficient than the heterologous pairs. Thus, strength of binding of profilin to actin and nucleotide exchange rate are not tightly coupled. Actin/HPF interactions were entropically driven, whereas YPF interactions were enthalpically driven. Hybrid yeast actins containing subdomain 1 (sub1) or subdomain 1 and 2 (sub12) muscle actin residues bound more weakly to YPF than did yeast actin (Kd = 2 μm versus 0.6 μm). These hybrids bound even more weakly to HPF than did yeast actin (Kd = 5 μm versus 3.2 μm). sub1/YPF interactions were entropically driven, whereas the sub12/YPF binding was enthalpically driven. Compared with WT yeast actin, YPF binding to sub1 occurred with a 5 times faster koff and a 2 times faster kon. sub12 bound with a 3 times faster koff and a 1.5 times slower kon. Profilin controls the energetics of its interaction with nonhybrid actin, but interactions between actin subdomains 1 and 2 affect the topography of the profilin binding site. PMID:18223293

Coxibs interfere with the action of aspirin by binding tightly to one monomer of cyclooxygenase-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rimon, Gilad; Sidhu, Ranjinder S.; Lauver, D. Adam

Pain associated with inflammation involves prostaglandins synthesized from arachidonic acid (AA) through cyclooxygenase-2 (COX-2) pathways while thromboxane A{sub 2} formed by platelets from AA via cyclooxygenase-1 (COX-1) mediates thrombosis. COX-1 and COX-2 are both targets of nonselective nonsteroidal antiinflammatory drugs (nsNSAIDs) including aspirin whereas COX-2 activity is preferentially blocked by COX-2 inhibitors called coxibs. COXs are homodimers composed of identical subunits, but we have shown that only one subunit is active at a time during catalysis; moreover, many nsNSAIDS bind to a single subunit of a COX dimer to inhibit the COX activity of the entire dimer. Here, we reportmore » the surprising observation that celecoxib and other coxibs bind tightly to a subunit of COX-1. Although celecoxib binding to one monomer of COX-1 does not affect the normal catalytic processing of AA by the second, partner subunit, celecoxib does interfere with the inhibition of COX-1 by aspirin in vitro. X-ray crystallographic results obtained with a celecoxib/COX-1 complex show how celecoxib can bind to one of the two available COX sites of the COX-1 dimer. Finally, we find that administration of celecoxib to dogs interferes with the ability of a low dose of aspirin to inhibit AA-induced ex vivo platelet aggregation. COX-2 inhibitors such as celecoxib are widely used for pain relief. Because coxibs exhibit cardiovascular side effects, they are often prescribed in combination with low-dose aspirin to prevent thrombosis. Our studies predict that the cardioprotective effect of low-dose aspirin on COX-1 may be blunted when taken with coxibs.« less

Studying the varied shapes of gold clusters by an elegant optimization algorithm that hybridizes the density functional tight-binding theory and the density functional theory

NASA Astrophysics Data System (ADS)

Yen, Tsung-Wen; Lim, Thong-Leng; Yoon, Tiem-Leong; Lai, S. K.

2017-11-01

We combined a new parametrized density functional tight-binding (DFTB) theory (Fihey et al. 2015) with an unbiased modified basin hopping (MBH) optimization algorithm (Yen and Lai 2015) and applied it to calculate the lowest energy structures of Au clusters. From the calculated topologies and their conformational changes, we find that this DFTB/MBH method is a necessary procedure for a systematic study of the structural development of Au clusters but is somewhat insufficient for a quantitative study. As a result, we propose an extended hybridized algorithm. This improved algorithm proceeds in two steps. In the first step, the DFTB theory is employed to calculate the total energy of the cluster and this step (through running DFTB/MBH optimization for given Monte-Carlo steps) is meant to efficiently bring the Au cluster near to the region of the lowest energy minimum since the cluster as a whole has explicitly considered the interactions of valence electrons with ions, albeit semi-quantitatively. Then, in the second succeeding step, the energy-minimum searching process will continue with a skilledly replacement of the energy function calculated by the DFTB theory in the first step by one calculated in the full density functional theory (DFT). In these subsequent calculations, we couple the DFT energy also with the MBH strategy and proceed with the DFT/MBH optimization until the lowest energy value is found. We checked that this extended hybridized algorithm successfully predicts the twisted pyramidal structure for the Au40 cluster and correctly confirms also the linear shape of C8 which our previous DFTB/MBH method failed to do so. Perhaps more remarkable is the topological growth of Aun: it changes from a planar (n =3-11) → an oblate-like cage (n =12-15) → a hollow-shape cage (n =16-18) and finally a pyramidal-like cage (n =19, 20). These varied forms of the cluster's shapes are consistent with those reported in the literature.

Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

PubMed Central

Chang, F. N.; Flaks, Joel G.

1972-01-01

The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and binding also occurred to ribosomes from streptomycin-resistant and -dependent strains, as well as to 50S subunits from all strains. Kdiss for all of these binding equilibria were [Formula: see text] 10−4m. This weaker non-specific binding coincided with the beginning of aggregation phenomena involving the particles, and occurred at sites distinct from the single site which binds the antibiotic tightly. This latter site was completely lost after the one-step mutation to high-level resistance or dependence. PMID:4133236

Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

PubMed

Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

2015-12-17

The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

Bayesian linearized amplitude-versus-frequency inversion for quality factor and its application

NASA Astrophysics Data System (ADS)

Yang, Xinchao; Teng, Long; Li, Jingnan; Cheng, Jiubing

2018-06-01

We propose a straightforward attenuation inversion method by utilizing the amplitude-versus-frequency (AVF) characteristics of seismic data. A new linearized approximation equation of the angle and frequency dependent reflectivity in viscoelastic media is derived. We then use the presented equation to implement the Bayesian linear AVF inversion. The inversion result includes not only P-wave and S-wave velocities, and densities, but also P-wave and S-wave quality factors. Synthetic tests show that the AVF inversion surpasses the AVA inversion for quality factor estimation. However, a higher signal noise ratio (SNR) of data is necessary for the AVF inversion. To show its feasibility, we apply both the new Bayesian AVF inversion and conventional AVA inversion to a tight gas reservoir data in Sichuan Basin in China. Considering the SNR of the field data, a combination of AVF inversion for attenuation parameters and AVA inversion for elastic parameters is recommended. The result reveals that attenuation estimations could serve as a useful complement in combination with the AVA inversion results for the detection of tight gas reservoirs.

Ti(IV) and the Siderophore Desferrioxamine B: A Tight Complex Has Biological and Environmental Implications.

PubMed

Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M

2017-02-06

The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.

Plasmonic graded-chains as deep-subwavelength light concentrators

NASA Astrophysics Data System (ADS)

Esteves-López, Natalia; Pastawski, Horacio M.; Bustos-Marún, Raúl A.

2015-04-01

We have studied the plasmonic properties of aperiodic arrays of identical nanoparticles (NPs) formed by two opposite and equal graded-chains (a chain where interactions change gradually). We found that these arrays concentrate the external electromagnetic fields even in the long wavelength limit. The phenomenon was understood by identifying the system with an effective cavity where plasmonics excitations are trapped between effective band edges, resulting from the change of passband with the NP's position. Dependence of excitation concentration on several system parameters was also assessed. This includes different gradings as well as NP couplings, damping, and resonant frequencies. In the spirit of the scaling laws in condensed matter physics, we developed a theory that allows us to rationalize all these system parameters into universal curves. The theory is quite general and can also be used in many other situations (different arrays for example). Additionally, we also provided an analytical solution, in the tight-binding limit, for the plasmonic response of homogeneous linear chains of NPs illuminated by a plane wave. Our results can find applications in sensing, near field imaging, plasmon-enhanced photodetectors, as well as to increase solar cell efficiency.

Optimal Ge/SiGe nanofin geometries for hole mobility enhancement: Technology limit from atomic simulations

NASA Astrophysics Data System (ADS)

Vedula, Ravi Pramod; Mehrotra, Saumitra; Kubis, Tillmann; Povolotskyi, Michael; Klimeck, Gerhard; Strachan, Alejandro

2015-05-01

We use first principles simulations to engineer Ge nanofins for maximum hole mobility by controlling strain tri-axially through nano-patterning. Large-scale molecular dynamics predict fully relaxed, atomic structures for experimentally achievable nanofins, and orthogonal tight binding is used to obtain the corresponding electronic structure. Hole transport properties are then obtained via a linearized Boltzmann formalism. This approach explicitly accounts for free surfaces and associated strain relaxation as well as strain gradients which are critical for quantitative predictions in nanoscale structures. We show that the transverse strain relaxation resulting from the reduction in the aspect ratio of the fins leads to a significant enhancement in phonon limited hole mobility (7× over unstrained, bulk Ge, and 3.5× over biaxially strained Ge). Maximum enhancement is achieved by reducing the width to be approximately 1.5 times the height and further reduction in width does not result in additional gains. These results indicate significant room for improvement over current-generation Ge nanofins, provide geometrical guidelines to design optimized geometries and insight into the physics behind the significant mobility enhancement.

Time reversibility of quantum diffusion in small-world networks

NASA Astrophysics Data System (ADS)

Han, Sung-Guk; Kim, Beom Jun

2012-02-01

We study the time-reversal dynamics of a tight-binding electron in the Watts-Strogatz (WS) small-world networks. The localized initial wave packet at time t = 0 diffuses as time proceeds until the time-reversal operation, together with the momentum perturbation of the strength η, is made at the reversal time T. The time irreversibility is measured by I = |Π( t = 2 T) - Π( t = 0)|, where Π is the participation ratio gauging the extendedness of the wavefunction and for convenience, t is measured forward even after the time reversal. When η = 0, the time evolution after T makes the wavefunction at t = 2 T identical to the one at t = 0, and we find I = 0, implying a null irreversibility or a complete reversibility. On the other hand, as η is increased from zero, the reversibility becomes weaker, and we observe enhancement of the irreversibility. We find that I linearly increases with increasing η in the weakly-perturbed region, and that the irreversibility is much stronger in the WS network than in the local regular network.

Spin-orbit torque in a three-dimensional topological insulator-ferromagnet heterostructure: Crossover between bulk and surface transport

NASA Astrophysics Data System (ADS)

Ghosh, S.; Manchon, A.

2018-04-01

Current-driven spin-orbit torques are investigated in a heterostructure composed of a ferromagnet deposited on top of a three-dimensional topological insulator using the linear response formalism. We develop a tight-binding model of the heterostructure adopting a minimal interfacial hybridization scheme that promotes induced magnetic exchange on the topological surface states, as well as induced Rashba-like spin-orbit coupling in the ferromagnet. Therefore our model accounts for the spin Hall effect from bulk states together with inverse spin galvanic and magnetoelectric effects at the interface on equal footing. By varying the transport energy across the band structure, we uncover a crossover from surface-dominated to bulk-dominated transport regimes. We show that the spin density profile and the nature of the spin-orbit torques differ substantially in both regimes. Our results, which compare favorably with experimental observations, demonstrate that the large dampinglike torque reported recently is more likely attributed to the Berry curvature of interfacial states, while spin Hall torque remains small even in the bulk-dominated regime.

Topologically invariant double Dirac states in bismuth-based perovskites: Consequence of ambivalent charge states and covalent bonding

NASA Astrophysics Data System (ADS)

Khamari, Bramhachari; Kashikar, Ravi; Nanda, B. R. K.

2018-01-01

Density functional calculations and model tight-binding Hamiltonian studies are carried out to examine the bulk and surface electronic structure of the largely unexplored perovskite family of A BiO3 , where A is a group I-II element. From the study, we reveal the existence of two TI states, one in valence band (V-TI) and the other in conduction band (C-TI), as the universal feature of A BiO3 . The V-TI and C-TI are, respectively, born out of bonding and antibonding states caused by Bi-{s ,p } -O-{p } coordinated covalent interactions. Further, we outline a classification scheme in this family where one class follows spin orbit coupling and the other follows the second neighbor Bi-Bi hybridization to induce s-p band inversion for the realization of C-TI states. Below a certain critical thickness of the film, which varies with A , TI states of top and bottom surfaces couple to destroy the Dirac type linear dispersion and consequently to open narrow surface energy gaps.

Coupling effect of topological states and Chern insulators in two-dimensional triangular lattices

NASA Astrophysics Data System (ADS)

Zhang, Jiayong; Zhao, Bao; Xue, Yang; Zhou, Tong; Yang, Zhongqin

2018-03-01

We investigate topological states of two-dimensional (2D) triangular lattices with multiorbitals. Tight-binding model calculations of a 2D triangular lattice based on px and py orbitals exhibit very interesting doubly degenerate energy points at different positions (Γ and K /K' ) in momentum space, with quadratic non-Dirac and linear Dirac band dispersions, respectively. Counterintuitively, the system shows a global topologically trivial rather than nontrivial state with consideration of spin-orbit coupling due to the "destructive interference effect" between the topological states at the Γ and K /K' points. The topologically nontrivial state can emerge by introducing another set of triangular lattices to the system (bitriangular lattices) due to the breakdown of the interference effect. With first-principles calculations, we predict an intrinsic Chern insulating behavior (quantum anomalous Hall effect) in a family of the 2D triangular lattice metal-organic framework of Co(C21N3H15) (TPyB-Co) from this scheme. Our results provide a different path and theoretical guidance for the search for and design of new 2D topological quantum materials.

Band-gap tuning and optical response of two-dimensional SixC1 -x : A first-principles real-space study of disordered two-dimensional materials

NASA Astrophysics Data System (ADS)

Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda; Datta, Sujoy; Johnson, Duane D.; Mookerjee, Abhijit

2017-08-01

We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique [Mookerjee, J. Phys. C 6, 1340 (1973), 10.1088/0022-3719/6/8/003] formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen-Baerends corrected exchange potential [Singh, Harbola, Hemanadhan, Mookerjee, and Johnson, Phys. Rev. B 93, 085204 (2016), 10.1103/PhysRevB.93.085204]. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene SixC1 -x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussed in the light of the available experimental and other theoretical data. Our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.

Electronic conductance of a poly(p-phenylene)-like nanowire in the presence of thermal atomic vibrations

NASA Astrophysics Data System (ADS)

Shariati, Ashrafalsadat; Rabani, Hassan; Mardaani, Mohammad

2017-10-01

We present a theoretical method based on Green’s function technique and tight-binding approach as well as harmonic approximation in order to calculate the coherent electronic conductance of an extended poly(p-phenylene) oligomer in the presence of thermal atomic vibrations. We study two proposed mass-spring models for atomic vibrations: one, including rigid benzene rings connected to each other by vibrating bonds; and in another, the bonds along the oligomer vibrate even in the benzene rings. The electron-phonon (e-ph) interaction influences the electron hopping energies linearly with respect to atomic displacements. The model shows that the conductance spectra exhibit some new energy gaps in the presence of e-ph interaction even at zero temperature. The conductance is more affected by e-ph interaction when the atomic vibrations are supposed to be present in the benzene rings. At the edges of the band energy and central gap, the phonon-assisted phenomena can be observed. Generally, the increasing e-ph interaction strength as well as temperature destroys the electronic conductance especially in the resonance region.

Geometrical and band-structure effects on phonon-limited hole mobility in rectangular cross-sectional germanium nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, H., E-mail: tanaka@semicon.kuee.kyoto-u.ac.jp; Mori, S.; Morioka, N.

2014-12-21

We calculated the phonon-limited hole mobility in rectangular cross-sectional [001], [110], [111], and [112]-oriented germanium nanowires, and the hole transport characteristics were investigated. A tight-binding approximation was used for holes, and phonons were described by a valence force field model. Then, scattering probability of holes by phonons was calculated taking account of hole-phonon interaction atomistically, and the linearized Boltzmann's transport equation was solved to calculate the hole mobility at low longitudinal field. The dependence of the hole mobility on nanowire geometry was analyzed in terms of the valence band structure of germanium nanowires, and it was found that the dependencemore » was qualitatively reproduced by considering an average effective mass and the density of states of holes. The calculation revealed that [110] germanium nanowires with large height along the [001] direction show high hole mobility. Germanium nanowires with this geometry are also expected to exhibit high electron mobility in our previous work, and thus they are promising for complementary metal-oxide-semiconductor (CMOS) applications.« less

Theoretical investigations on diamondoids (CnHm, n = 10-41): Nomenclature, structural stabilities, and gap distributions

NASA Astrophysics Data System (ADS)

Wang, Ya-Ting; Zhao, Yu-Jun; Liao, Ji-Hai; Yang, Xiao-Bao

2018-01-01

Combining the congruence check and the first-principles calculations, we have systematically investigated the structural stabilities and gap distributions of possible diamondoids (CnHm) with the carbon numbers (n) from 10 to 41. A simple method for the nomenclature is proposed, which can be used to distinguish and screen the candidates with high efficiency. Different from previous theoretical studies, the possible diamondoids can be enumerated according to our nomenclature, without any pre-determination from experiments. The structural stabilities and electronic properties have been studied by density functional based tight binding and first-principles methods, where a nearly linear correlation is found between the energy gaps obtained by these two methods. According to the formation energy of structures, we have determined the stable configurations as a function of chemical potential. The maximum and minimum energy gaps are found to be dominated by the shape of diamondoids for clusters with a given number of carbon atoms, while the gap decreases in general as the size increases due to the quantum confinement.

Tight-Binding Description of Impurity States in Semiconductors

ERIC Educational Resources Information Center

Dominguez-Adame, F.

2012-01-01

Introductory textbooks in solid state physics usually present the hydrogenic impurity model to calculate the energy of carriers bound to donors or acceptors in semiconductors. This model treats the pure semiconductor as a homogeneous medium and the impurity is represented as a fixed point charge. This approach is only valid for shallow impurities…

Intrinsic optical confinement for ultrathin InAsN quantum well superlattices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakri, A.; Robert, C.; Pedesseau, L.

We study energy-band engineering with InAsN monolayer in GaAs/GaP quantum well structure. A tight-binding calculation indicates that both type I alignment along with direct band-gap behavior can be obtained. We show that the optical transitions are less sensitive to the position of the probe.

Electric-field-induced plasmon in AA-stacked bilayer graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuang, Y.C., E-mail: yingchih.chuang@gmail.com; Wu, J.Y., E-mail: yarst5@gmail.com; Lin, M.F., E-mail: mflin@mail.ncku.edu.tw

2013-12-15

The collective excitations in AA-stacked bilayer graphene for a perpendicular electric field are investigated analytically within the tight-binding model and the random-phase approximation. Such a field destroys the uniform probability distribution of the four sublattices. This drives a symmetry breaking between the intralayer and interlayer polarization intensities from the intrapair band excitations. A field-induced acoustic plasmon thus emerges in addition to the strongly field-tunable intrinsic acoustic and optical plasmons. At long wavelengths, the three modes show different dispersions and field dependence. The definite physical mechanism of the electrically inducible and tunable mode can be expected to also be present inmore » other AA-stacked few-layer graphenes. -- Highlights: •The analytical derivations are performed by the tight-binding model. •An electric field drives the non-uniformity of the charge distribution. •A symmetry breaking between the intralayer and interlayer polarizations is illustrated. •An extra plasmon emerges besides two intrinsic modes in AA-stacked bilayer graphene. •The mechanism of a field-induced mode is present in AA-stacked few-layer graphenes.« less

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

NASA Astrophysics Data System (ADS)

Henke, Paul S.; Mak, Chi H.

2014-08-01

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Transferable tight binding model for strained group IV and III-V heterostructures

NASA Astrophysics Data System (ADS)

Tan, Yaohua; Povolotskyi, Micheal; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

Modern semiconductor devices have reached critical device dimensions in the range of several nanometers. For reliable prediction of device performance, it is critical to have a numerical efficient model that are transferable to material interfaces. In this work, we present an empirical tight binding (ETB) model with transferable parameters for strained IV and III-V group semiconductors. The ETB model is numerically highly efficient as it make use of an orthogonal sp3d5s* basis set with nearest neighbor inter-atomic interactions. The ETB parameters are generated from HSE06 hybrid functional calculations. Band structures of strained group IV and III-V materials by ETB model are in good agreement with corresponding HSE06 calculations. Furthermore, the ETB model is applied to strained superlattices which consist of group IV and III-V elements. The ETB model turns out to be transferable to nano-scale hetero-structure. The ETB band structures agree with the corresponding HSE06 results in the whole Brillouin zone. The ETB band gaps of superlattices with common cations or common anions have discrepancies within 0.05eV.

RIM-BPs Mediate Tight Coupling of Action Potentials to Ca(2+)-Triggered Neurotransmitter Release.

PubMed

Acuna, Claudio; Liu, Xinran; Gonzalez, Aneysis; Südhof, Thomas C

2015-09-23

Ultrafast neurotransmitter release requires tight colocalization of voltage-gated Ca(2+) channels with primed, release-ready synaptic vesicles at the presynaptic active zone. RIM-binding proteins (RIM-BPs) are multidomain active zone proteins that bind to RIMs and to Ca(2+) channels. In Drosophila, deletion of RIM-BPs dramatically reduces neurotransmitter release, but little is known about RIM-BP function in mammalian synapses. Here, we generated double conditional knockout mice for RIM-BP1 and RIM-BP2, and analyzed RIM-BP-deficient synapses in cultured hippocampal neurons and the calyx of Held. Surprisingly, we find that in murine synapses, RIM-BPs are not essential for neurotransmitter release as such, but are selectively required for high-fidelity coupling of action potential-induced Ca(2+) influx to Ca(2+)-stimulated synaptic vesicle exocytosis. Deletion of RIM-BPs decelerated action-potential-triggered neurotransmitter release and rendered it unreliable, thereby impairing the fidelity of synaptic transmission. Thus, RIM-BPs ensure optimal organization of the machinery for fast release in mammalian synapses without being a central component of the machinery itself. Copyright © 2015 Elsevier Inc. All rights reserved.

Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.

PubMed

Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto

2018-04-11

We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.

Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

NASA Astrophysics Data System (ADS)

Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

2018-02-01

Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.

Spin textures on general surfaces of the correlated topological insulator SmB6

NASA Astrophysics Data System (ADS)

Baruselli, Pier Paolo; Vojta, Matthias

2016-05-01

Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

PubMed

Henke, Paul S; Mak, Chi H

2014-08-14

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Tuning the electronic properties of gated multilayer phosphorene: A self-consistent tight-binding study

NASA Astrophysics Data System (ADS)

Li, L. L.; Partoens, B.; Peeters, F. M.

2018-04-01

By taking account of the electric-field-induced charge screening, a self-consistent calculation within the framework of the tight-binding approach is employed to obtain the electronic band structure of gated multilayer phosphorene and the charge densities on the different phosphorene layers. We find charge density and screening anomalies in single-gated multilayer phosphorene and electron-hole bilayers in dual-gated multilayer phosphorene. Due to the unique puckered lattice structure, both intralayer and interlayer charge screenings are important in gated multilayer phosphorene. We find that the electric-field tuning of the band structure of multilayer phosphorene is distinctively different in the presence and absence of charge screening. For instance, it is shown that the unscreened band gap of multilayer phosphorene decreases dramatically with increasing electric-field strength. However, in the presence of charge screening, the magnitude of this band-gap decrease is significantly reduced and the reduction depends strongly on the number of phosphorene layers. Our theoretical results of the band-gap tuning are compared with recent experiments and good agreement is found.

Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution

NASA Astrophysics Data System (ADS)

Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

2015-08-01

Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.

Landau level splitting due to graphene superlattices

NASA Astrophysics Data System (ADS)

Pal, G.; Apel, W.; Schweitzer, L.

2012-06-01

The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.

Implementation and benchmark of a long-range corrected functional in the density functional based tight-binding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lutsker, V.; Niehaus, T. A., E-mail: thomas.niehaus@physik.uni-regensburg.de; Aradi, B.

2015-11-14

Bridging the gap between first principles methods and empirical schemes, the density functional based tight-binding method (DFTB) has become a versatile tool in predictive atomistic simulations over the past years. One of the major restrictions of this method is the limitation to local or gradient corrected exchange-correlation functionals. This excludes the important class of hybrid or long-range corrected functionals, which are advantageous in thermochemistry, as well as in the computation of vibrational, photoelectron, and optical spectra. The present work provides a detailed account of the implementation of DFTB for a long-range corrected functional in generalized Kohn-Sham theory. We apply themore » method to a set of organic molecules and compare ionization potentials and electron affinities with the original DFTB method and higher level theory. The new scheme cures the significant overpolarization in electric fields found for local DFTB, which parallels the functional dependence in first principles density functional theory (DFT). At the same time, the computational savings with respect to full DFT calculations are not compromised as evidenced by numerical benchmark data.« less

Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene

NASA Astrophysics Data System (ADS)

Reijnders, K. J. A.; Katsnelson, M. I.

2017-07-01

We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.

GABAB receptor cell surface export is controlled by an endoplasmic reticulum gatekeeper

PubMed Central

Doly, Stéphane; Shirvani, Hamasseh; Gäta, Gabriel; Meye, Frank; Emerit, Michel-Boris; Enslen, Hervé; Achour, Lamia; Pardo-Lopez, Liliana; Kwon, Yang Seung; Armand, Vincent; Gardette, Robert; Giros, Bruno; Gassmann, Martin; Bettler, Bernhard; Mameli, Manuel; Darmon, Michèle; Marullo, Stefano

2016-01-01

Summary Endoplasmic reticulum (ER) release and cell surface export of many G protein-coupled receptors (GPCRs), are tightly regulated. For GABAB receptors of GABA, the major mammalian inhibitory neurotransmitter, the ligand-binding GB1 subunit is maintained in the ER by unknown mechanisms in the absence of hetero-dimerization with the GB2 subunit. We report that GB1 retention is regulated by a specific gatekeeper, PRAF2. This ER resident transmembrane protein binds to GB1, preventing its progression in the biosynthetic pathway. GB1 release occurs upon competitive displacement from PRAF2 by GB2. PRAF2 concentration, relative to that of GB1 and GB2, tightly controls cell surface receptor density and controls GABAB function in neurons. Experimental perturbation of PRAF2 levels in vivo caused marked hyperactivity disorders in mice. These data reveal an unanticipated major impact of specific ER gate-keepers on GPCR function and identify PRAF2 as a new molecular target with therapeutic potential for psychiatric and neurological diseases involving GABAB function. PMID:26033241

Proposed truncated Cu-Hf tight-binding potential to study the crystal-to-amorphous phase transition

NASA Astrophysics Data System (ADS)

Cui, Yuanyuan; Li, Jiahao; Dai, Ye; Liu, Baixin

2010-09-01

Proposed truncated Cu-Hf tight-binding potential was constructed by fitting the physical properties of Cu, Hf, and their stable compounds, i.e., Cu5Hf, Cu8Hf3, Cu10Hf7, and CuHf2. Based on the constructed potentials, molecular dynamics simulations were carried out to compare the relative stability of the crystalline solid solution and the disordered state. Simulation results not only reveal that the physical origin of crystal-to-amorphous transition is the crystalline lattice collapsing when the solute atoms exceeding the critical concentration, but also predict that the glass forming range (GFR) of the Cu-Hf system is 21-77 at. % Cu, which covers the GFRs determined by various metallic glass-producing techniques. Ion beam mixing experiments of the Cu-Hf system were conducted using 200 keV xenon ions and the results show that a uniform amorphous phase can be obtained in the Cu23Hf77 sample, matching well with the GFR determined by the interatomic potential, which, in turn, provides additional evidence to the relevance of the constructed Cu-Hf potential.

Topological states in a two-dimensional metal alloy in Si surface: BiAg/Si(111)-4 ×4 surface

NASA Astrophysics Data System (ADS)

Zhang, Xiaoming; Cui, Bin; Zhao, Mingwen; Liu, Feng

2018-02-01

A bridging topological state with a conventional semiconductor platform offers an attractive route towards future spintronics and quantum device applications. Here, based on first-principles and tight-binding calculations, we demonstrate the existence of topological states hosted by a two-dimensional (2D) metal alloy in a Si surface, the BiAg/Si(111)-4 ×4 surface, which has already been synthesized experimentally. It exhibits a topological insulating state with an energy gap of 71 meV (˜819 K ) above the Fermi level and a topological metallic state with quasiquantized conductance below the Fermi level. The underlying mechanism leading to the formation of such nontrivial states is revealed by analysis of the "charge-transfer" and "orbital-filtering" effect of the Si substrate. A minimal effective tight-binding model is employed to reveal the formation mechanism of the topological states. Our finding opens opportunities to detect topological states and measure its quantized conductance in a large family of 2D surface metal alloys, which have been or are to be grown on semiconductor substrates.

The Reach of Linear Protein-DNA Dimerizers

PubMed Central

Stafford, Ryan L.; Dervan, Peter B.

2008-01-01

A protein-DNA dimerizer constructed from a DNA-binding pyrrole-imidazole polyamide and the peptide FYPWMK facilitates binding of the natural transcription factor Exd to an adjacent DNA site. Previous dimerizers have been constructed with the peptide attached to an internal pyrrole monomer in an overall branched oligomer. Linear oligomers constructed by attaching the peptide to the polyamide C-terminus expand the range of protein-DNA dimerization to six additional DNA sites. Replacing the FYPWMK hexapeptide with a WM dipeptide, which was previously functional in branched compounds, does not lead to a functional linear dimerizer. Instead, inserting an additional lysine generates a minimal, linear WMK tripeptide conjugate that maintains the activity of the larger FYPWMK dimerizers in a single DNA-binding site orientation. These studies provide insight into the importance of linker length and composition, binding site spacing and orientation, and the protein-binding domain content that are important for the optimization of protein DNA-dimerizers suitable for biological experiments. PMID:17949089

Binding of various ovotransferrin fragments to chick-embryo red cells.

PubMed Central

Oratore, A; D'Andrea, G; Moreton, K; Williams, J

1989-01-01

1. The ability of N- and C-terminal half-molecule fragments of hen ovotransferrin to interact with chick red blood cells (CERBC) has been studied under conditions that allow binding of the transferrin to transferrin receptors to take place, but not the delivery of iron to the cell. Two kinds of half-molecule fragments were used: (a) those which can associate with one another to give a dimer resembling native transferrin and (b) those which cannot associate in this way because they lack a few amino acid residues from their C-terminal ends. 2. Neither N nor C half-molecules alone can bind to the CERBC, but, when both are present, tight binding occurs. 3. Whether or not the half-molecules can associate with one another makes little difference to receptor binding. 4. Given that one of the half-molecules is iron-saturated, the presence or absence of iron in the contralateral half-molecule again makes little difference to receptor binding. PMID:2920021

Controlled rotation of the F1-ATPase reveals differential and continuous binding changes for ATP synthesis

PubMed Central

Adachi, Kengo; Oiwa, Kazuhiro; Yoshida, Masasuke; Nishizaka, Takayuki; Kinosita, Kazuhiko

2012-01-01

F1-ATPase is an ATP-driven rotary molecular motor that synthesizes ATP when rotated in reverse. To elucidate the mechanism of ATP synthesis, we imaged binding and release of fluorescently labelled ADP and ATP while rotating the motor in either direction by magnets. Here we report the binding and release rates for each of the three catalytic sites for 360° of the rotary angle. We show that the rates do not significantly depend on the rotary direction, indicating ATP synthesis by direct reversal of the hydrolysis-driven rotation. ADP and ATP are discriminated in angle-dependent binding, but not in release. Phosphate blocks ATP binding at angles where ADP binding is essential for ATP synthesis. In synthesis rotation, the affinity for ADP increases by >104, followed by a shift to high ATP affinity, and finally the affinity for ATP decreases by >104. All these angular changes are gradual, implicating tight coupling between the rotor angle and site affinities. PMID:22929779

Mask patterning process using the negative tone chemically amplified resist TOK OEBR-CAN024

NASA Astrophysics Data System (ADS)

Irmscher, Mathias; Beyer, Dirk; Butschke, Joerg; Hudek, Peter; Koepernik, Corinna; Plumhoff, Jason; Rausa, Emmanuel; Sato, Mitsuru; Voehringer, Peter

2004-08-01

Optimized process parameters using the TOK OEBR-CAN024 resist for high chrome load patterning have been determined. A tight linearity tolerance for opaque and clear features, independent on the local pattern density, was the goal of our process integration work. For this purpose we evaluated a new correction method taking into account electron scattering and process influences. The method is based on matching of measured pattern geometry by iterative back-simulation using multiple Gauss and/or exponential functions. The obtained control function acts as input for the proximity correction software PROXECCO. Approaches with different pattern oversize and two Cr thicknesses were accomplished and the results have been reported. Isolated opaque and clear lines could be realized in a very tight linearity range. The increasing line width of small dense lines, induced by the etching process, could be corrected only partially.

Fields of an ultrashort tightly focused radially polarized laser pulse in a linear response plasma

NASA Astrophysics Data System (ADS)

Salamin, Yousef I.

2017-10-01

Analytical expressions for the fields of a radially polarized, ultrashort, and tightly focused laser pulse propagating in a linear-response plasma are derived and discussed. The fields are obtained from solving the inhomogeneous wave equations for the vector and scalar potentials, linked by the Lorenz gauge, in a plasma background. First, the scalar potential is eliminated using the gauge condition, then the vector potential is synthesized from Fourier components of an initial uniform distribution of wavenumbers, and the inverse Fourier transformation is carried out term-by-term in a truncated series (finite sum). The zeroth-order term in, for example, the axial electric field component is shown to model a pulse much better than its widely used paraxial approximation counterpart. Some of the propagation characteristics of the fields are discussed and all fields are shown to have manifested the expected limits for propagation in a vacuum.

Neuraminidase inhibitor R-125489 - A promising drug for treating influenza virus: Steered molecular dynamics approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mai, Binh Khanh; Li, Mai Suan, E-mail: masli@ifpan.edu.pl

2011-07-08

Highlights: {yields} We study binding affinity of R-125489 and its prodrug CS-8958 to neuraminidase of pathogenic influenza viruses by molecular dynamics simulations. {yields} It is shown that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. {yields} We predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus. {yields} The high correlation between theoretical and experimental data implies that SMD is a very promising tool for drug design. -- Abstract: Two neuraminidase inhibitors, oseltamivir and zanamivir, are important drug treatments for influenza. Oseltamivir-resistant mutants of the influenzamore » virus A/H1N1 and A/H5N1 have emerged, necessitating the development of new long-acting antiviral agents. One such agent is a new neuraminidase inhibitor R-125489 and its prodrug CS-8958. An atomic level understanding of the nature of this antiviral agents binding is still missing. We address this gap in our knowledge by applying steered molecular dynamics (SMD) simulations to different subtypes of seasonal and highly pathogenic influenza viruses. We show that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. Based on results obtained by SMD and the molecular mechanics-Poisson-Boltzmann surface area method, we predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus as its binding affinity does not vary much across these systems. The high correlation level between theoretically determined rupture forces and experimental data on binding energies for the large number of systems studied here implies that SMD is a promising tool for drug design.« less

Uncoupling protein 1 binds one nucleotide per monomer and is stabilized by tightly bound cardiolipin

PubMed Central

Lee, Yang; Willers, Chrissie; Kunji, Edmund R. S.; Crichton, Paul G.

2015-01-01

Uncoupling protein 1 (UCP1) catalyzes fatty acid-activated, purine nucleotide-sensitive proton leak across the mitochondrial inner membrane of brown adipose tissue to produce heat, and could help combat obesity and metabolic disease in humans. Studies over the last 30 years conclude that the protein is a dimer, binding one nucleotide molecule per two proteins, and unlike the related mitochondrial ADP/ATP carrier, does not bind cardiolipin. Here, we have developed novel methods to purify milligram amounts of UCP1 from native sources by using covalent chromatography that, unlike past methods, allows the protein to be prepared in defined conditions, free of excess detergent and lipid. Assessment of purified preparations by TLC reveal that UCP1 retains tightly bound cardiolipin, with a lipid phosphorus content equating to three molecules per protein, like the ADP/ATP carrier. Cardiolipin stabilizes UCP1, as demonstrated by reconstitution experiments and thermostability assays, indicating that the lipid has an integral role in the functioning of the protein, similar to other mitochondrial carriers. Furthermore, we find that UCP1 is not dimeric but monomeric, as indicated by size exclusion analysis, and has a ligand titration profile in isothermal calorimetric measurements that clearly shows that one nucleotide binds per monomer. These findings reveal the fundamental composition of UCP1, which is essential for understanding the mechanism of the protein. Our assessment of the properties of UCP1 indicate that it is not unique among mitochondrial carriers and so is likely to use a common exchange mechanism in its primary function in brown adipose tissue mitochondria. PMID:26038550

NMR Studies of the C-Terminus of alpha4 Reveal Possible Mechanism of Its Interaction with MID1 and Protein Phosphatase 2A

PubMed Central

Du, Haijuan; Massiah, Michael A.

2011-01-01

Alpha4 is a regulatory subunit of the protein phosphatase family of enzymes and plays an essential role in regulating the catalytic subunit of PP2A (PP2Ac) within the rapamycin-sensitive signaling pathway. Alpha4 also interacts with MID1, a microtubule-associated ubiquitin E3 ligase that appears to regulate the function of PP2A. The C-terminal region of alpha4 plays a key role in the binding interaction of PP2Ac and MID1. Here we report on the solution structure of a 45-amino acid region derived from the C-terminus of alpha4 (alpha45) that binds tightly to MID1. In aqueous solution, alpha45 has properties of an intrinsically unstructured peptide although chemical shift index and dihedral angle estimation based on chemical shifts of backbone atoms indicate the presence of a transient α-helix. Alpha45 adopts a helix-turn-helix HEAT-like structure in 1% SDS micelles, which may mimic a negatively charged surface for which alpha45 could bind. Alpha45 binds tightly to the Bbox1 domain of MID1 in aqueous solution and adopts a structure consistent with the helix-turn-helix structure observed in 1% SDS. The structure of alpha45 reveals two distinct surfaces, one that can interact with a negatively charged surface, which is present on PP2A, and one that interacts with the Bbox1 domain of MID1. PMID:22194938

Conformation-controlled binding kinetics of antibodies

NASA Astrophysics Data System (ADS)

Galanti, Marta; Fanelli, Duccio; Piazza, Francesco

2016-01-01

Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.

The VirD2 pilot protein of Agrobacterium-transferred DNA interacts with the TATA box-binding protein and a nuclear protein kinase in plants

PubMed Central

Bakó, László; Umeda, Masaaki; Tiburcio, Antonio F.; Schell, Jeff; Koncz, Csaba

2003-01-01

The bacterial virulence protein VirD2 plays an important role in nuclear import and chromosomal integration of Agrobacterium-transferred DNA in fungal, plant, animal, and human cells. Here we show that in nuclei of alfalfa cells, VirD2 interacts with and is phosphorylated by CAK2Ms, a conserved plant ortholog of cyclin-dependent kinase-activating kinases. CAK2Ms binds to and phosphorylates the C-terminal regulatory domain of RNA polymerase II largest subunit, which can recruit the TATA box-binding protein. VirD2 is found in tight association with the TATA box-binding protein in vivo. These results indicate that recognition of VirD2 is mediated by widely conserved nuclear factors in eukaryotes. PMID:12900506

Anion-induced reconstitution of a self-assembling system to express a chloride-binding Co10L15 pentagonal prism.

PubMed

Riddell, Imogen A; Smulders, Maarten M J; Clegg, Jack K; Hristova, Yana R; Breiner, Boris; Thoburn, John D; Nitschke, Jonathan R

2012-09-01

Biochemical systems are adaptable, capable of reconstitution at all levels to achieve the functions associated with life. Synthetic chemical systems are more limited in their ability to reorganize to achieve new functions; they can reconfigure to bind an added substrate (template effect) or one binding event may modulate a receptor's affinity for a second substrate (allosteric effect). Here we describe a synthetic chemical system that is capable of structural reconstitution on receipt of one anionic signal (perchlorate) to create a tight binding pocket for another anion (chloride). The complex, barrel-like structure of the chloride receptor is templated by five perchlorate anions. This second-order templation phenomenon allows chemical networks to be envisaged that express more complex responses to chemical signals than is currently feasible.

Permanent magnet focused X-band photoinjector

DOEpatents

Yu, David U. L.; Rosenzweig, James

2002-09-10

A compact high energy photoelectron injector integrates the photocathode directly into a multicell linear accelerator with no drift space between the injection and the linac. High electron beam brightness is achieved by accelerating a tightly focused electron beam in an integrated, multi-cell, X-band rf linear accelerator (linac). The photoelectron linac employs a Plane-Wave-Transformer (PWT) design which provides strong cell-to-cell coupling, easing manufacturing tolerances and costs.

Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. IV. Performance of many-body force fields and tight-binding schemes for the fluid phases of silicon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desgranges, Caroline; Delhommelle, Jerome

We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less

Interactions of Kid-Kis toxin-antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid-Kis oligomers.

PubMed

Monti, Maria C; Hernández-Arriaga, Ana M; Kamphuis, Monique B; López-Villarejo, Juan; Heck, Albert J R; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H H

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin-antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid-kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid-Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2-Kis2-Kid2-Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2-Kis2-Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2-Kis2)n complexes repress the kid-kis operon.

Adenosylcobinamide methyl phosphate as a pseudocoenzyme for diol dehydrase.

PubMed

Ishida, A; Toraya, T

1993-02-16

Adenosylcobinamide methyl phosphate, a novel analog of adenosylcobalamin lacking the nucleotide loop moiety, was synthesized. It did not show detectable coenzymic activity but behaved as a strong competitive inhibitor against AdoCbl with relatively high affinity (Ki = 2.5 microM). When apoenzyme was incubated at 37 degrees C with this analog in the presence of substrate, the Co-C bond of the analog was almost completely and irreversibly cleaved within 10 min, forming an enzyme-bound Co(II)-containing species. The cleavage was not observed in the absence of substrate. The Co-C bond cleavage in the presence of substrate was not catalytic but stoichiometric, implying that the Co-C bond of the analog undergoes activation when the analog binds to the active site of the enzyme. 5'-Deoxyadenosine was the only product derived from the adenosyl group of the analog upon the Co-C bond cleavage. Apoenzyme did not undergo modification during this process. Therefore, it seems likely that adenosylcobinamide methyl phosphate acts as a pseudocoenzyme or a potent suicide coenzyme. Since adenosylcobinamide neither functions as coenzyme nor binds tightly to apoenzyme, it can be concluded that the phosphodiester moiety of the nucleotide loop of adenosylcobalamin is essential for tight binding to apoenzyme and therefore for subsequent activation of the Co-C bond and catalysis. It is also evident that the nucleotide loop is obligatory for the normal progress of catalytic cycle.

FDTD simulation of trapping nanowires with linearly polarized and radially polarized optical tweezers.

PubMed

Li, Jing; Wu, Xiaoping

2011-10-10

In this paper a model of the trapping force on nanowires is built by three dimensional finite-difference time-domain (FDTD) and Maxwell stress tensor methods, and the tightly focused laser beam is expressed by spherical vector wave functions (VSWFs). The trapping capacities on nanoscale-diameter nanowires are discussed in terms of a strongly focused linearly polarized beam and radially polarized beam. Simulation results demonstrate that the radially polarized beam has higher trapping efficiency on nanowires with higher refractive indices than linearly polarized beam.

FDTD simulation of trapping nanowires with linearly polarized and radially polarized optical tweezers

PubMed Central

Li, Jing; Wu, Xiaoping

2011-01-01

In this paper a model of the trapping force on nanowires is built by three dimensional finite-difference time-domain (FDTD) and Maxwell stress tensor methods, and the tightly focused laser beam is expressed by spherical vector wave functions (VSWFs). The trapping capacities on nanoscale-diameter nanowires are discussed in terms of a strongly focused linearly polarized beam and radially polarized beam. Simulation results demonstrate that the radially polarized beam has higher trapping efficiency on nanowires with higher refractive indices than linearly polarized beam. PMID:21997083

Social Justice and Social Order: Binding Moralities across the Political Spectrum

PubMed Central

2016-01-01

Two studies explored the relationship between political ideology and endorsement of a range of moral principles. Political liberals and conservatives did not differ on intrapersonal or interpersonal moralities, which require self-regulation. However differences emerged on collective moralities, which involve social regulation. Contrary to Moral Foundations Theory, both liberals and conservatives endorsed a group-focused binding morality, specifically Social Justice and Social Order respectively. Libertarians were the group without a binding morality. Although Social Justice and Social Order appear conflictual, analyses based on earlier cross-cultural work on societal tightness-looseness suggest that countries actually benefit in terms of economic success and societal well-being when these group-based moralities co-exist and serve as counterweights in social regulation. PMID:27031103

Epithelial Microvilli Establish an Electrostatic Barrier to Microbial Adhesion

PubMed Central

Bennett, Kaila M.; Walker, Sharon L.

2014-01-01

Microvilli are membrane extensions on the apical surface of polarized epithelia, such as intestinal enterocytes and tubule and duct epithelia. One notable exception in mucosal epithelia is M cells, which are specialized for capturing luminal microbial particles; M cells display a unique apical membrane lacking microvilli. Based on studies of M cell uptake under different ionic conditions, we hypothesized that microvilli may augment the mucosal barrier by providing an increased surface charge density from the increased membrane surface and associated glycoproteins. Thus, electrostatic charges may repel microbes from epithelial cells bearing microvilli, while M cells are more susceptible to microbial adhesion. To test the role of microvilli in bacterial adhesion and uptake, we developed polarized intestinal epithelial cells with reduced microvilli (“microvillus-minus,” or MVM) but retaining normal tight junctions. When tested for interactions with microbial particles in suspension, MVM cells showed greatly enhanced adhesion and uptake of particles compared to microvillus-positive cells. This preference showed a linear relationship to bacterial surface charge, suggesting that microvilli resist binding of microbes by using electrostatic repulsion. Moreover, this predicts that pathogen modification of electrostatic forces may contribute directly to virulence. Accordingly, the effacement effector protein Tir from enterohemorrhagic Escherichia coli O157:H7 expressed in epithelial cells induced a loss of microvilli with consequent enhanced microbial binding. These results provide a new context for microvillus function in the host-pathogen relationship, based on electrostatic interactions. PMID:24778113

Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

PubMed

Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Cornière, Axelle; Takahashi, Masayuki; Nordén, Bengt

2012-06-01

Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

Crystal structure of coelenterazine-binding protein from Renilla muelleri at 1.7 A: why it is not a calcium-regulated photoprotein.

PubMed

Stepanyuk, Galina A; Liu, Zhi-Jie; Markova, Svetlana S; Frank, Ludmila A; Lee, John; Vysotski, Eugene S; Wang, Bi-Cheng

2008-04-01

Bioluminescence in the sea pansy Renilla involves two distinct proteins, a Ca2+-triggered coelenterazine-binding protein (CBP), and Renilla luciferase. CBP contains one tightly bound coelenterazine molecule, which becomes available for reaction with luciferase and O2 only subsequent to Ca2+ binding. CBP belongs to the EF-hand superfamily of Ca2+-binding proteins and contains three "EF-hand" Ca2+-binding sites. The overall spatial structure of recombinant selenomethionine-labeled CBP determined at 1.7 A, is found to approximate the protein scaffold characteristic of the class of Ca2+-regulated photoproteins. Photoproteins however, catalyze molecular oxygen addition to coelenterazine producing a 2-hydroperoxycoelenterazine intermediate, which is stabilized within the binding cavity in the absence of Ca2+. Addition of Ca2+ triggers the bioluminescence reaction. However in CBP this first step of oxygen addition is not allowed. The different amino acid environments and hydrogen bond interactions within the binding cavity, are proposed to account for the different properties of the two classes of proteins.

MCM ring hexamerization is a prerequisite for DNA-binding

DOE PAGES

Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

2015-09-13

The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

Nonlinear Thomson scattering of a relativistically strong tightly focused ultrashort laser pulse

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vais, O. E.; Bochkarev, S. G., E-mail: bochkar@sci.lebedev.ru; Bychenkov, V. Yu.

The problem of nonlinear Thomson scattering of a relativistically strong linearly polarized ultrashort laser pulse tightly focused into a spot with a diameter of D{sub F} ≳ λ (where λ is the laser wavelength) is solved. The energy, spectral, and angular distributions of radiation generated due to Thomson scattering from test electrons located in the focal region are found. The characteristics of scattered radiation are studied as functions of the tightness of laser focusing and the initial position of test particles relative to the center of the focal region for a given laser pulse energy. It is demonstrated that themore » ultratight focusing is not optimal for obtaining the brightest and hardest source of secondary electromagnetic radiation. The hardest and shortest radiation pulse is generated when the beam waist diameter is ≃10λ.« less

Hyperbolic-symmetry vector fields.

PubMed

Gao, Xu-Zhen; Pan, Yue; Cai, Meng-Qiang; Li, Yongnan; Tu, Chenghou; Wang, Hui-Tian

2015-12-14

We present and construct a new kind of orthogonal coordinate system, hyperbolic coordinate system. We present and design a new kind of local linearly polarized vector fields, which is defined as the hyperbolic-symmetry vector fields because the points with the same polarization form a series of hyperbolae. We experimentally demonstrate the generation of such a kind of hyperbolic-symmetry vector optical fields. In particular, we also study the modified hyperbolic-symmetry vector optical fields with the twofold and fourfold symmetric states of polarization when introducing the mirror symmetry. The tight focusing behaviors of these vector fields are also investigated. In addition, we also fabricate micro-structures on the K9 glass surfaces by several tightly focused (modified) hyperbolic-symmetry vector fields patterns, which demonstrate that the simulated tightly focused fields are in good agreement with the fabricated micro-structures.

The ribonucleoprotein Csr network.

PubMed

Seyll, Ethel; Van Melderen, Laurence

2013-11-08

Ribonucleoprotein complexes are essential regulatory components in bacteria. In this review, we focus on the carbon storage regulator (Csr) network, which is well conserved in the bacterial world. This regulatory network is composed of the CsrA master regulator, its targets and regulators. CsrA binds to mRNA targets and regulates translation either negatively or positively. Binding to small non-coding RNAs controls activity of this protein. Expression of these regulators is tightly regulated at the level of transcription and stability by various global regulators (RNAses, two-component systems, alarmone). We discuss the implications of these complex regulations in bacterial adaptation.

The Mismetallation of Enzymes during Oxidative Stress*

PubMed Central

Imlay, James A.

2014-01-01

Mononuclear iron enzymes can tightly bind non-activating metals. How do cells avoid mismetallation? The model bacterium Escherichia coli may control its metal pools so that thermodynamics favor the correct metallation of each enzyme. This system is disrupted, however, by superoxide and hydrogen peroxide. These species oxidize ferrous iron and thereby displace it from many iron-dependent mononuclear enzymes. Ultimately, zinc binds in its place, confers little activity, and imposes metabolic bottlenecks. Data suggest that E. coli compensates by using thiols to extract the zinc and by importing manganese to replace the catalytic iron atom. Manganese resists oxidants and provides substantial activity. PMID:25160623

The Relationship of Ethics to Quality: A Particular Case of Research in Autism

ERIC Educational Resources Information Center

Waltz, Mitzi

2007-01-01

To look for the answers of "What is the relationship between "ethics" and "quality" in education research?," this article explores factors that bind the two too tightly together for extrication, including representation of subject and researcher mindsets, the setting of research agendas, research design and funding. Using research in autism as a…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Xiang, J.B.

We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.

Transmission eigenchannels from nonequilibrium Green's functions

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Brandbyge, Mads

2007-09-01

The concept of transmission eigenchannels is described in a tight-binding nonequilibrium Green’s function (NEGF) framework. A simple procedure for calculating the eigenchannels is derived using only the properties of the device subspace and quantities normally available in a NEGF calculation. The method is exemplified by visualization in real space of the eigenchannels for three different molecular and atomic wires.

Atomic resolution x-ray structure of the substrate recognition domain of higher plant rubisco activase

USDA-ARS?s Scientific Manuscript database

The rapid release of tight-binding inhibitors from dead-end Rubisco complexes requires the activity of Rubisco activase, an AAA+ ATPase that utilizes chemo-mechanical energy to catalyze the reactivation of Rubisco. Activase is thought to play a central role in coordinating the rate of CO2 fixation w...

A linear programming approach to characterizing norm bounded uncertainty from experimental data

NASA Technical Reports Server (NTRS)

Scheid, R. E.; Bayard, D. S.; Yam, Y.

1991-01-01

The linear programming spectral overbounding and factorization (LPSOF) algorithm, an algorithm for finding a minimum phase transfer function of specified order whose magnitude tightly overbounds a specified nonparametric function of frequency, is introduced. This method has direct application to transforming nonparametric uncertainty bounds (available from system identification experiments) into parametric representations required for modern robust control design software (i.e., a minimum-phase transfer function multiplied by a norm-bounded perturbation).

Transient pressure analysis of a volume fracturing well in fractured tight oil reservoirs

NASA Astrophysics Data System (ADS)

Lu, Cheng; Wang, Jiahang; Zhang, Cong; Cheng, Minhua; Wang, Xiaodong; Dong, Wenxiu; Zhou, Yingfang

2017-12-01

This paper presents a semi-analytical model to simulate transient pressure curves for a vertical well with a reconstructed fracture network in fractured tight oil reservoirs. In the proposed model, the reservoir is a composite system and contains two regions. The inner region is described as a formation with a finite conductivity hydraulic fracture network and the flow in the fracture is assumed to be linear, while the outer region is modeled using the classical Warren-Root model where radial flow is applied. The transient pressure curves of a vertical well in the proposed reservoir model are calculated semi-analytically using the Laplace transform and Stehfest numerical inversion. As shown in the type curves, the flow is divided into several regimes: (a) linear flow in artificial main fractures; (b) coupled boundary flow; (c) early linear flow in a fractured formation; (d) mid radial flow in the semi-fractures of the formation; (e) mid radial flow or pseudo steady flow; (f) mid cross-flow; (g) closed boundary flow. Based on our newly proposed model, the effects of some sensitive parameters, such as elastic storativity ratio, cross-flow coefficient, fracture conductivity and skin factor, on the type curves were also analyzed extensively. The simulated type curves show that for a vertical fractured well in a tight reservoir, the elastic storativity ratios and crossflow coefficients affect the time and the degree of crossflow respectively. The pressure loss increases with an increase in the fracture conductivity. To a certain extent, the effect of the fracture conductivity is more obvious than that of the half length of the fracture on improving the production effect. With an increase in the wellbore storage coefficient, the fluid compressibility is so large that it might cover the early stage fracturing characteristics. Linear or bilinear flow may not be recognized, and the pressure and pressure derivative gradually shift to the right. With an increase in the skin effect, the pressure loss increases gradually.

A Comparison of Structural and Evolutionary Attributes of Escherichia coli and Thermus thermophilus Small Ribosomal Subunits: Signatures of Thermal Adaptation

PubMed Central

Mallik, Saurav; Kundu, Sudip

2013-01-01

Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU). Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA) is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs) in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins) have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli) are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder) at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend. PMID:23940533

The yeast transcription elongation factor Spt4/5 is a sequence‐specific RNA binding protein

PubMed Central

Blythe, Amanda J.; Yazar‐Klosinski, Berra; Webster, Michael W.; Chen, Eefei; Vandevenne, Marylène; Bendak, Katerina; Mackay, Joel P.; Hartzog, Grant A.

2016-01-01

Abstract The heterodimeric transcription elongation factor Spt4/Spt5 (Spt4/5) tightly associates with RNAPII to regulate both transcriptional elongation and co‐transcriptional pre‐mRNA processing; however, the mechanisms by which Spt4/5 acts are poorly understood. Recent studies of the human and Drosophila Spt4/5 complexes indicate that they can bind nucleic acids in vitro. We demonstrate here that yeast Spt4/5 can bind in a sequence‐specific manner to single stranded RNA containing AAN repeats. Furthermore, we show that the major protein determinants for RNA‐binding are Spt4 together with the NGN domain of Spt5 and that the KOW domains are not required for RNA recognition. These findings attribute a new function to a domain of Spt4/5 that associates directly with RNAPII, making significant steps towards elucidating the mechanism behind transcriptional control by Spt4/5. PMID:27376968

Binding of trivalent chromium to serum transferrin is sufficiently rapid to be physiologically relevant.

PubMed

Deng, Ge; Wu, Kristi; Cruce, Alex A; Bowman, Michael K; Vincent, John B

2015-02-01

Transferrin, the major iron transport protein in the blood, also transports trivalent chromium in vivo. Recent in vitro studies have, however, suggested that the binding of chromic ions to apotransferrin is too slow to be biologically relevant. Nevertheless, the in vitro studies have generally failed to adequately take physiological bicarbonate concentrations into account. In aqueous buffer (with ambient (bi)carbonate concentrations), the binding of chromium to transferrin is too slow to be physiologically relevant, taking days to reach equilibrium with the protein's associated conformational changes. However, in the presence of 25mM (bi)carbonate, the concentration in human blood, chromic ions bind rapidly and tightly to transferrin. Details of the kinetics of chromium binding to human serum transferrin and conalbumin (egg white transferrin) in the presence of bicarbonate and other major potential chromium ligands are described and are consistent with transferrin being the major chromic ion transporter from the blood to tissues. Copyright © 2014 Elsevier Inc. All rights reserved.

MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

PubMed Central

Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

2003-01-01

Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

The Possible Mechanism of Idiosyncratic Lapatinib-Induced Liver Injury in Patients Carrying Human Leukocyte Antigen-DRB1*07:01

PubMed Central

Hirasawa, Makoto; Hagihara, Katsunobu; Okudaira, Noriko; Izumi, Takashi

2015-01-01

Idiosyncratic lapatinib-induced liver injury has been reported to be associated with human leukocyte antigen (HLA)-DRB1*07:01. In order to investigate its mechanism, interaction of lapatinib with HLA-DRB1*07:01 and its ligand peptide derived from tetanus toxoid, has been evaluated in vitro. Here we show that lapatinib enhances binding of the ligand peptide to HLA-DRB1*07:01. Furthermore in silico molecular dynamics analysis revealed that lapatinib could change the β chain helix in the HLA-DRB1*07:01 specifically to form a tightly closed binding groove structure and modify a large part of the binding groove. These results indicate that lapatinib affects the ligand binding to HLA-DRB1*07:01 and idiosyncratic lapatinib-induced liver injury might be triggered by this mechanism. This is the first report showing that the clinically available drug can enhance the binding of ligand peptide to HLA class II molecules in vitro and in silico. PMID:26098642

Mass spectrometry reveals that the antibiotic simocyclinone D8 binds to DNA gyrase in a "bent-over" conformation: evidence of positive cooperativity in binding.

PubMed

Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R

2011-05-03

DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.

Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

PubMed

Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

2015-02-10

Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

Crystal structure of the Escherichia coli regulator of sigma70, Rsd, in complex with sigma70 domain 4.

PubMed

Patikoglou, Georgia A; Westblade, Lars F; Campbell, Elizabeth A; Lamour, Valérie; Lane, William J; Darst, Seth A

2007-09-21

The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) sigma(70) factor. Rsd plays a role in alternative sigma factor-dependent transcription by biasing the competition between sigma(70) and alternative sigma factors for the available core RNAP. Here, we determined the 2.6 A-resolution X-ray crystal structure of Rsd bound to sigma(70) domain 4 (sigma(70)(4)), the primary determinant for Rsd binding within sigma(70). The structure reveals that Rsd binding interferes with the two primary functions of sigma(70)(4), core RNAP binding and promoter -35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the sigma(70)(4)-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between sigma(70)(4) binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.

Crystal structure of the Escherichia coli regulator of σ70, Rsd, in complex with σ70 domain 4

PubMed Central

Patikoglou, Georgia A.; Westblade, Lars F.; Campbell, Elizabeth A.; Lamour, Valérie; Lane, William J.; Darst, Seth A.

2007-01-01

Summary The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) σ70 factor. Rsd plays a role in alternative σ factor-dependent transcription by biasing the competition between σ70 and alternative σ factors for the available core RNAP. Here, we determined the 2.6 Å-resolution X-ray crystal structure of Rsd bound to σ70 domain 4 (σ704), the primary determinant for Rsd binding within σ70. The structure reveals that Rsd binding interferes with the two primary functions of σ704, core RNAP binding and promoter –35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the σ704-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between σ704 binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation. PMID:17681541

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patikoglou,G.; Westblade, L.; Campbell, E.

The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) {sigma}{sup 70} factor. Rsd plays a role in alternative {sigma} factor-dependent transcription by biasing the competition between {sigma}{sup 70} and alternative {sigma} factors for the available core RNAP. Here, we determined the 2.6 {angstrom}-resolution X-ray crystal structure of Rsd bound to {sigma}{sup 70} domain 4 ({sigma}{sup 70}{sub 4}), the primary determinant for Rsd binding within {sigma}{sup 70}. The structure reveals that Rsd binding interferes with the two primary functions of {sigma}{sup 70}{sub 4}, core RNAP binding and promoter -35 element binding. Interestingly, the most highly conservedmore » Rsd residues form a network of interactions through the middle of the Rsd structure that connect the {sigma}{sup 70}{sub 4}-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between {sigma}{sup 70}{sub 4} binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.« less

Comparative study of Poincaré plot analysis using short electroencephalogram signals during anaesthesia with spectral edge frequency 95 and bispectral index.

PubMed

Hayashi, K; Yamada, T; Sawa, T

2015-03-01

The return or Poincaré plot is a non-linear analytical approach in a two-dimensional plane, where a timed signal is plotted against itself after a time delay. Its scatter pattern reflects the randomness and variability in the signals. Quantification of a Poincaré plot of the electroencephalogram has potential to determine anaesthesia depth. We quantified the degree of dispersion (i.e. standard deviation, SD) along the diagonal line of the electroencephalogram-Poincaré plot (named as SD1/SD2), and compared SD1/SD2 values with spectral edge frequency 95 (SEF95) and bispectral index values. The regression analysis showed a tight linear regression equation with a coefficient of determination (R(2) ) value of 0.904 (p < 0.0001) between the Poincaré index (SD1/SD2) and SEF95, and a moderate linear regression equation between SD1/SD2 and bispectral index (R(2)  = 0.346, p < 0.0001). Quantification of the Poincaré plot tightly correlates with SEF95, reflecting anaesthesia-dependent changes in electroencephalogram oscillation. © 2014 The Association of Anaesthetists of Great Britain and Ireland.

Quantitative relation between intermolecular and intramolecular binding of pro-rich peptides to SH3 domains.

PubMed

Zhou, Huan-Xiang

2006-11-01

Flexible linkers are often found to tether binding sequence motifs or connect protein domains. Here we analyze three usages of flexible linkers: 1), intramolecular binding of proline-rich peptides (PRPs) to SH3 domains for kinase regulation; 2), intramolecular binding of PRP for increasing the folding stability of SH3 domains; and 3), covalent linking of PRPs and other ligands for high-affinity bivalent binding. The basis of these analyses is a quantitative relation between intermolecular and intramolecular binding constants. This relation has the form K(i) = K(e0)p for intramolecular binding and K(e) = K(e01)K(e02)p for bivalent binding. The effective concentration p depends on the length of the linker and the distance between the linker attachment points in the bound state. Several applications illustrate the usefulness of the quantitative relation. These include intramolecular binding to the Itk SH3 domain by an internal PRP and to a circular permutant of the alpha-spectrin SH3 domain by a designed PRP, and bivalent binding to the two SH3 domains of Grb2 by two linked PRPs. These and other examples suggest that flexible linkers and sequence motifs tethered to them, like folded protein domains, are also subject to tight control during evolution.

Small Molecules Engage Hot Spots through Cooperative Binding To Inhibit a Tight Protein-Protein Interaction.

PubMed

Liu, Degang; Xu, David; Liu, Min; Knabe, William Eric; Yuan, Cai; Zhou, Donghui; Huang, Mingdong; Meroueh, Samy O

2017-03-28

Protein-protein interactions drive every aspect of cell signaling, yet only a few small-molecule inhibitors of these interactions exist. Despite our ability to identify critical residues known as hot spots, little is known about how to effectively engage them to disrupt protein-protein interactions. Here, we take advantage of the ease of preparation and stability of pyrrolinone 1, a small-molecule inhibitor of the tight interaction between the urokinase receptor (uPAR) and its binding partner, the urokinase-type plasminogen activator uPA, to synthesize more than 40 derivatives and explore their effect on the protein-protein interaction. We report the crystal structure of uPAR bound to previously discovered pyrazole 3 and to pyrrolinone 12. While both 3 and 12 bind to uPAR and compete with a fluorescently labeled peptide probe, only 12 and its derivatives inhibit the full uPAR·uPA interaction. Compounds 3 and 12 mimic and engage different hot-spot residues on uPA and uPAR, respectively. Interestingly, 12 is involved in a π-cation interaction with Arg-53, which is not considered a hot spot. Explicit-solvent molecular dynamics simulations reveal that 3 and 12 exhibit dramatically different correlations of motion with residues on uPAR. Free energy calculations for the wild-type and mutant uPAR bound to uPA or 12 show that Arg-53 interacts with uPA or with 12 in a highly cooperative manner, thereby altering the contributions of hot spots to uPAR binding. The direct engagement of peripheral residues not considered hot spots through π-cation or salt-bridge interactions could provide new opportunities for enhanced small-molecule engagement of hot spots to disrupt challenging protein-protein interactions.

Design, synthesis and biological evaluation of (S)-valine thiazole-derived cyclic and non-cyclic peptidomimetic oligomers as modulators of human P-glycoprotein (ABCB1)

PubMed Central

Singh, Satyakam; Prasad, Nagarajan Rajendra; Kapoor, Khyati; Chufan, Eduardo E.; Patel, Bhargav A.; Ambudkar, Suresh V.; Talele, Tanaji T.

2014-01-01

Multidrug resistance (MDR) caused by ATP-binding cassette (ABC) transporter P-glycoprotein (P-gp) through extrusion of anticancer drugs from the cells is a major cause of failure to cancer chemotherapy. Previously, selenazole containing cyclic peptides were reported as P-gp inhibitors and these were also used for co-crystallization with mouse P-gp, which has 87% homology to human P-gp. It has been reported that human P-gp, can simultaneously accommodate 2-3 moderate size molecules at the drug binding pocket. Our in-silico analysis based on the homology model of human P-gp spurred our efforts to investigate the optimal size of (S)-valine-derived thiazole units that can be accommodated at drug-binding pocket. Towards this goal, we synthesized varying lengths of linear and cyclic derivatives of (S)-valine-derived thiazole units to investigate the optimal size, lipophilicity and the structural form (linear and cyclic) of valine-derived thiazole peptides that can accommodate well in the P-gp binding pocket and affects its activity, previously an unexplored concept. Among these oligomers, lipophilic linear- (13) and cyclic-trimer (17) derivatives of QZ59S-SSS were found to be the most and equally potent inhibitors of human P-gp (IC50 = 1.5 μM). Cyclic trimer and linear trimer being equipotent, future studies can be focused on non-cyclic counterparts of cyclic peptides maintaining linear trimer length. Binding model of the linear trimer (13) within the drug-binding site on the homology model of human P-gp represents an opportunity for future optimization, specifically replacing valine and thiazole groups in the non-cyclic form. PMID:24288265

Design, synthesis, and biological evaluation of (S)-valine thiazole-derived cyclic and noncyclic peptidomimetic oligomers as modulators of human P-glycoprotein (ABCB1).

PubMed

Singh, Satyakam; Prasad, Nagarajan Rajendra; Kapoor, Khyati; Chufan, Eduardo E; Patel, Bhargav A; Ambudkar, Suresh V; Talele, Tanaji T

2014-01-03

Multidrug resistance caused by ATP binding cassette transporter P-glycoprotein (P-gp) through extrusion of anticancer drugs from the cells is a major cause of failure in cancer chemotherapy. Previously, selenazole-containing cyclic peptides were reported as P-gp inhibitors and were also used for co-crystallization with mouse P-gp, which has 87 % homology to human P-gp. It has been reported that human P-gp can simultaneously accommodate two to three moderately sized molecules at the drug binding pocket. Our in silico analysis, based on the homology model of human P-gp, spurred our efforts to investigate the optimal size of (S)-valine-derived thiazole units that can be accommodated at the drug binding pocket. Towards this goal, we synthesized varying lengths of linear and cyclic derivatives of (S)-valine-derived thiazole units to investigate the optimal size, lipophilicity, and structural form (linear or cyclic) of valine-derived thiazole peptides that can be accommodated in the P-gp binding pocket and affects its activity, previously an unexplored concept. Among these oligomers, lipophilic linear (13) and cyclic trimer (17) derivatives of QZ59S-SSS were found to be the most and equally potent inhibitors of human P-gp (IC50 =1.5 μM). As the cyclic trimer and linear trimer compounds are equipotent, future studies should focus on noncyclic counterparts of cyclic peptides maintaining linear trimer length. A binding model of the linear trimer 13 within the drug binding site on the homology model of human P-gp represents an opportunity for future optimization, specifically replacing valine and thiazole groups in the noncyclic form. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Time-dependent quantum transport: An efficient method based on Liouville-von-Neumann equation for single-electron density matrix

NASA Astrophysics Data System (ADS)

Xie, Hang; Jiang, Feng; Tian, Heng; Zheng, Xiao; Kwok, Yanho; Chen, Shuguang; Yam, ChiYung; Yan, YiJing; Chen, Guanhua

2012-07-01

Basing on our hierarchical equations of motion for time-dependent quantum transport [X. Zheng, G. H. Chen, Y. Mo, S. K. Koo, H. Tian, C. Y. Yam, and Y. J. Yan, J. Chem. Phys. 133, 114101 (2010), 10.1063/1.3475566], we develop an efficient and accurate numerical algorithm to solve the Liouville-von-Neumann equation. We solve the real-time evolution of the reduced single-electron density matrix at the tight-binding level. Calculations are carried out to simulate the transient current through a linear chain of atoms, with each represented by a single orbital. The self-energy matrix is expanded in terms of multiple Lorentzian functions, and the Fermi distribution function is evaluated via the Padè spectrum decomposition. This Lorentzian-Padè decomposition scheme is employed to simulate the transient current. With sufficient Lorentzian functions used to fit the self-energy matrices, we show that the lead spectral function and the dynamics response can be treated accurately. Compared to the conventional master equation approaches, our method is much more efficient as the computational time scales cubically with the system size and linearly with the simulation time. As a result, the simulations of the transient currents through systems containing up to one hundred of atoms have been carried out. As density functional theory is also an effective one-particle theory, the Lorentzian-Padè decomposition scheme developed here can be generalized for first-principles simulation of realistic systems.

Expression of Ulex europaeus agglutinin I lectin-binding sites in squamous cell carcinomas and their absence in basal cell carcinomas. Indicator of tumor type and differentiation.

PubMed

Heng, M C; Fallon-Friedlander, S; Bennett, R

1992-06-01

Lectins bind tightly to carbohydrate moieties on cell surfaces. Alterations in lectin binding have been reported to accompany epidermal cell differentiation, marking alterations in membrane sugars during this process. The presence of UEA I (Ulex europaeus agglutinin I) L-fucose-specific lectin-binding sites has been used as a marker for terminally differentiated (committed) keratinocytes. In this article, we report the presence of UEA-I-binding sites on squamous keratinocytes of well-differentiated squamous cell carcinomas, with patchy loss of UEA I positivity on poorly differentiated cells of squamous cell carcinomas, suggesting a possible use for this technique in the rapid assessment of less differentiated areas within the squamous cell tumor. The absence of UEA-I-binding sites on basal cell carcinomas may be related to an inability of cells comprising this tumor to convert the L-D-pyranosyl moiety on basal cells to the L-fucose moiety, resulting in an inability of basal cell carcinoma cell to undergo terminal differentiation into a committed keratinocyte.

Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

PubMed Central

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-01-01

Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539

Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

PubMed

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-08-09

The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.

Assessment of the Activation of Rho Family GTP-Binding Proteins in Breast Cancer Cells and Specimens

DTIC Science & Technology

2001-08-01

lymphopenia Vav2 GEF for Rho, Rac, and Cdc42 proto-oncogene product; NM009500 Vav3 GEF for Rho and Rac proto-oncogene product; NM020505 hPEM -2 GEF for...junctions, and desmosomes play a fundamental role in maintaining the polarized phenotype and vectorial transport functions of epithelial cells. The tight

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Ring, D.M.

The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.

2016-04-13

We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less

Analytical excited state forces for the time-dependent density-functional tight-binding method.

PubMed

Heringer, D; Niehaus, T A; Wanko, M; Frauenheim, Th

2007-12-01

An analytical formulation for the geometrical derivatives of excitation energies within the time-dependent density-functional tight-binding (TD-DFTB) method is presented. The derivation is based on the auxiliary functional approach proposed in [Furche and Ahlrichs, J Chem Phys 2002, 117, 7433]. To validate the quality of the potential energy surfaces provided by the method, adiabatic excitation energies, excited state geometries, and harmonic vibrational frequencies were calculated for a test set of molecules in excited states of different symmetry and multiplicity. According to the results, the TD-DFTB scheme surpasses the performance of configuration interaction singles and the random phase approximation but has a lower quality than ab initio time-dependent density-functional theory. As a consequence of the special form of the approximations made in TD-DFTB, the scaling exponent of the method can be reduced to three, similar to the ground state. The low scaling prefactor and the satisfactory accuracy of the method makes TD-DFTB especially suitable for molecular dynamics simulations of dozens of atoms as well as for the computation of luminescence spectra of systems containing hundreds of atoms. (c) 2007 Wiley Periodicals, Inc.

Model many-body Stoner Hamiltonian for binary FeCr alloys

NASA Astrophysics Data System (ADS)

Nguyen-Manh, D.; Dudarev, S. L.

2009-09-01

We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

2014-03-01

Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

Proton transfer along water bridges in biological systems with density-functional tight-binding

NASA Astrophysics Data System (ADS)

Reiss, Krystle; Wise, Abigail; Mazzuca, James

2015-03-01

When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.

Atomistic analysis of valley-orbit hybrid states and inter-dot tunnel rates in a Si double quantum dot

NASA Astrophysics Data System (ADS)

Ferdous, Rifat; Rahman, Rajib; Klimeck, Gerhard

2014-03-01

Silicon quantum dots are promising candidates for solid-state quantum computing due to the long spin coherence times in silicon, arising from small spin-orbit interaction and a nearly spin free host lattice. However, the conduction band valley degeneracy adds an additional degree of freedom to the electronic structure, complicating the encoding and operation of qubits. Although the valley and the orbital indices can be uniquely identified in an ideal silicon quantum dot, atomic-scale disorder mixes valley and orbital states in realistic dots. Such valley-orbit hybridization, strongly influences the inter-dot tunnel rates.Using a full-band atomistic tight-binding method, we analyze the effect of atomic-scale interface disorder in a silicon double quantum dot. Fourier transform of the tight-binding wavefunctions helps to analyze the effect of disorder on valley-orbit hybridization. We also calculate and compare inter-dot inter-valley and intra-valley tunneling, in the presence of realistic disorder, such as interface tilt, surface roughness, alloy disorder, and interface charges. The method provides a useful way to compute electronic states in realistically disordered systems without any posteriori fitting parameters.

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE PAGES

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

2017-10-17

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Electronic Structure and Properties of Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Yang, Liu; Arnold, Jim (Technical Monitor)

2001-01-01

A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.

A general intermolecular force field based on tight-binding quantum chemical calculations

NASA Astrophysics Data System (ADS)

Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

2017-10-01

A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

NASA Astrophysics Data System (ADS)

Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

2018-04-01

Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

Photonic Bandgaps in Photonic Molecules

NASA Technical Reports Server (NTRS)

Smith, David D.; Chang, Hongrok; Gates, Amanda L.; Fuller, Kirk A.; Gregory, Don A.; Witherow, William K.; Paley, Mark S.; Frazier, Donald O.; Curreri, Peter A. (Technical Monitor)

2002-01-01

This talk will focus on photonic bandgaps that arise due to nearly free photon and tight-binding effects in coupled microparticle and ring-resonator systems. The Mie formulation for homogeneous spheres is generalized to handle core/shell systems and multiple concentric layers in a manner that exploits an analogy with stratified planar systems, thereby allowing concentric multi-layered structures to be treated as photonic bandgap (PBG) materials. Representative results from a Mie code employing this analogy demonstrate that photonic bands arising from nearly free photon effects are easily observed in the backscattering, asymmetry parameter, and albedo for periodic quarter-wave concentric layers, though are not readily apparent in extinction spectra. Rather, the periodicity simply alters the scattering profile, enhancing the ratio of backscattering to forward scattering inside the bandgap, in direct analogy with planar quarter-wave multilayers. PBGs arising from tight-binding may also be observed when the layers (or rings) are designed such that the coupling between them is weak. We demonstrate that for a structure consisting of N coupled micro-resonators, the morphology dependent resonances split into N higher-Q modes, in direct analogy with other types of oscillators, and that this splitting ultimately results in PBGs which can lead to enhanced nonlinear optical effects.

Effect of Sb in thick InGaAsSbN layers grown by liquid phase epitaxy

NASA Astrophysics Data System (ADS)

Donchev, V.; Milanova, M.; Asenova, I.; Shtinkov, N.; Alonso-Álvarez, D.; Mellor, A.; Karmakov, Y.; Georgiev, S.; Ekins-Daukes, N.

2018-02-01

Dilute nitride InGaAsSbN layers grown by low-temperature liquid phase epitaxy are studied in comparison with quaternary InGaAsN layers grown at the same growth conditions to understand the effect of Sb in the alloy. The lattice mismatch to the GaAs substrate is found to be slightly larger for the InGaAsSbN layers, which is explained by the large atomic radius of Sb. A reduction of the band gap energy with respect to InGaAsN is demonstrated by means of photoluminescence (PL), surface photovoltage (SPV) spectroscopy and tight-binding calculations. The band-gap energies determined from PL and ellipsometry measurements are in good agreement, while the SPV spectroscopy and the tight-binding calculations provide lower values. Possible reasons for these discrepancies are discussed. The PL spectra reveal localized electronic states in the band gap near the conduction band edge, which is confirmed by SPV spectroscopy. The analysis of the power dependence of the integrated PL has allowed determining the dominant radiative recombination mechanisms in the layers. The values of the refraction index in a wide spectral region are found to be higher for the Sb containing layers.

Specific binding of Clostridium perfringens enterotoxin fragment to Claudin-b and modulation of zebrafish epidermal barrier.

PubMed

Zhang, Jingjing; Ni, Chen; Yang, Zhenguo; Piontek, Anna; Chen, Huapu; Wang, Sijie; Fan, Yiming; Qin, Zhihai; Piontek, Joerg

2015-08-01

Claudins (Cldn) are the major components of tight junctions (TJs) sealing the paracellular cleft in tissue barriers of various organs. Zebrafish Cldnb, the homolog of mammalian Cldn4, is expressed at epithelial cell-cell contacts and is important for regulating epidermal permeability. The bacterial toxin Clostridium perfringens enterotoxin (CPE) has been shown to bind to a subset of mammalian Cldns. In this study, we used the Cldn-binding C-terminal domain of CPE (194-319 amino acids, cCPE 194-319 ) to investigate its functional role in modulating zebrafish larval epidermal barriers. In vitro analyses show that cCPE 194-319 removed Cldn4 from epithelial cells and disrupted the monolayer tightness, which could be rescued by the removal of cCPE 194-319. Incubation of zebrafish larvae with cCPE 194-319 removed Cldnb specifically from the epidermal cell membrane. Dye diffusion analysis with 4-kDa fluorescent dextran indicated that the permeability of the epidermal barrier increased due to cCPE 194-319 incubation. Electron microscopic investigation revealed reversible loss of TJ integrity by Cldnb removal. Collectively, these results suggest that cCPE 194-319 could be used as a Cldnb modulator to transiently open the epidermal barrier in zebrafish. In addition, zebrafish might be used as an in vivo system to investigate the capability of cCPE to enhance drug delivery across tissue barriers. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genetic evidence for a tight cooperation of TatB and TatC during productive recognition of twin-arginine (Tat) signal peptides in Escherichia coli.

PubMed

Lausberg, Frank; Fleckenstein, Stefan; Kreutzenbeck, Peter; Fröbel, Julia; Rose, Patrick; Müller, Matthias; Freudl, Roland

2012-01-01

The twin arginine translocation (Tat) pathway transports folded proteins across the cytoplasmic membrane of bacteria. Tat signal peptides contain a consensus motif (S/T-R-R-X-F-L-K) that is thought to play a crucial role in substrate recognition by the Tat translocase. Replacement of the phenylalanine at the +2 consensus position in the signal peptide of a Tat-specific reporter protein (TorA-MalE) by aspartate blocked export of the corresponding TorA(D(+2))-MalE precursor, indicating that this mutation prevents a productive binding of the TorA(D(+2)) signal peptide to the Tat translocase. Mutations were identified in the extreme amino-terminal regions of TatB and TatC that synergistically suppressed the export defect of TorA(D(+2))-MalE when present in pairwise or triple combinations. The observed synergistic suppression activities were even more pronounced in the restoration of membrane translocation of another export-defective precursor, TorA(KQ)-MalE, in which the conserved twin arginine residues had been replaced by lysine-glutamine. Collectively, these findings indicate that the extreme amino-terminal regions of TatB and TatC cooperate tightly during recognition and productive binding of Tat-dependent precursor proteins and, furthermore, that TatB and TatC are both involved in the formation of a specific signal peptide binding site that reaches out as far as the end of the TatB transmembrane segment.

Interactions of Kid–Kis toxin–antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid–Kis oligomers

PubMed Central

Monti, Maria C.; Hernández-Arriaga, Ana M.; Kamphuis, Monique B.; López-Villarejo, Juan; Heck, Albert J. R.; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H. H.

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin–antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid–kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid–Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2–Kis2–Kid2–Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2–Kis2–Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2–Kis2)n complexes repress the kid–kis operon. PMID:17317682

A systems wide mass spectrometric based linear motif screen to identify dominant in-vivo interacting proteins for the ubiquitin ligase MDM2.

PubMed

Nicholson, Judith; Scherl, Alex; Way, Luke; Blackburn, Elizabeth A; Walkinshaw, Malcolm D; Ball, Kathryn L; Hupp, Ted R

2014-06-01

Linear motifs mediate protein-protein interactions (PPI) that allow expansion of a target protein interactome at a systems level. This study uses a proteomics approach and linear motif sub-stratifications to expand on PPIs of MDM2. MDM2 is a multi-functional protein with over one hundred known binding partners not stratified by hierarchy or function. A new linear motif based on a MDM2 interaction consensus is used to select novel MDM2 interactors based on Nutlin-3 responsiveness in a cell-based proteomics screen. MDM2 binds a subset of peptide motifs corresponding to real proteins with a range of allosteric responses to MDM2 ligands. We validate cyclophilin B as a novel protein with a consensus MDM2 binding motif that is stabilised by Nutlin-3 in vivo, thus identifying one of the few known interactors of MDM2 that is stabilised by Nutlin-3. These data invoke two modes of peptide binding at the MDM2 N-terminus that rely on a consensus core motif to control the equilibrium between MDM2 binding proteins. This approach stratifies MDM2 interacting proteins based on the linear motif feature and provides a new biomarker assay to define clinically relevant Nutlin-3 responsive MDM2 interactors. Copyright © 2014 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Structural mechanism of the ATP-induced dissociation of rigor myosin from actin

PubMed Central

Kühner, Sebastian; Fischer, Stefan

2011-01-01

Myosin is a true nanomachine, which produces mechanical force from ATP hydrolysis by cyclically interacting with actin filaments in a four-step cycle. The principle underlying each step is that structural changes in separate regions of the protein must be mechanically coupled. The step in which myosin dissociates from tightly bound actin (the rigor state) is triggered by the 30 Å distant binding of ATP. Large conformational differences between the crystal structures make it difficult to perceive the coupling mechanism. Energetically accessible transition pathways computed at atomic detail reveal a simple coupling mechanism for the reciprocal binding of ATP and actin. PMID:21518908

Equilibrium structure and atomic vibrations of Nin clusters

NASA Astrophysics Data System (ADS)

Borisova, Svetlana D.; Rusina, Galina G.

2017-12-01

The equilibrium bond lengths and binding energy, second differences in energy and vibrational frequencies of free clusters Nin (2 ≤ n ≤ 20) were calculated with the use of the interaction potential obtained in the tight-binding approximation (TBA). The results show that the minimum vibration frequency plays a significant role in the evaluation of the dynamic stability of the clusters. A nonmonotonic dependence of the minimum vibration frequency of clusters on their size and the extreme values for the number of atoms in a cluster n = 4, 6, 13, and 19 are demonstrated. This result agrees with the theoretical and experimental data on stable structures of small metallic clusters.

Vector optical fields with bipolar symmetry of linear polarization.

PubMed

Pan, Yue; Li, Yongnan; Li, Si-Min; Ren, Zhi-Cheng; Si, Yu; Tu, Chenghou; Wang, Hui-Tian

2013-09-15

We focus on a new kind of vector optical field with bipolar symmetry of linear polarization instead of cylindrical and elliptical symmetries, enriching members of family of vector optical fields. We design theoretically and generate experimentally the demanded vector optical fields and then explore some novel tightly focusing properties. The geometric configurations of states of polarization provide additional degrees of freedom assisting in engineering the field distribution at the focus to the specific applications such as lithography, optical trapping, and material processing.

Guiding, bending, and splitting of coupled defect surface modes in a surface-wave photonic crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Zhen; Gao, Fei; Zhang, Baile, E-mail: blzhang@ntu.edu.sg

2016-01-25

We experimentally demonstrate a type of waveguiding mechanism for coupled surface-wave defect modes in a surface-wave photonic crystal. Unlike conventional spoof surface plasmon waveguides, waveguiding of coupled surface-wave defect modes is achieved through weak coupling between tightly localized defect cavities in an otherwise gapped surface-wave photonic crystal, as a classical wave analogue of tight-binding electronic wavefunctions in solid state lattices. Wave patterns associated with the high transmission of coupled defect surface modes are directly mapped with a near-field microwave scanning probe for various structures including a straight waveguide, a sharp corner, and a T-shaped splitter. These results may find usemore » in the design of integrated surface-wave devices with suppressed crosstalk.« less

Optical absorption of zigzag single walled boron nitride nanotubes

NASA Astrophysics Data System (ADS)

Moradian, Rostam; Chegel, Raad; Behzad, Somayeh

2010-11-01

In a realistic three-dimensional model, optical matrix element and linear optical absorption of zigzag single walled boron nitride nanotubes (BNNTs) in the tight binding approximation are studied. In terms of absolute value of dipole matrix elements of the first three direct transitions at kz=0, we divided the zigzag BNNTs into three groups and investigated their optical absorption spectrum in energy ranges E<5, 77.5 eV. We found that in lower energies, E<5 eV, all groups show different behaviors while in the higher energies, 77.5 eV, their behaviors depend on their even or odd nanotube index. We also found that in the energy range 7

Tetragonal bismuth bilayer: A stable and robust quantum spin hall insulator

DOE PAGES

Kou, Liangzhi; Tan, Xin; Ma, Yandong; ...

2015-11-23

In this study, topological insulators (TIs) exhibit novel physics with great promise for new devices, but considerable challenges remain to identify TIs with high structural stability and large nontrivial band gap suitable for practical applications. Here we predict by first-principles calculations a two-dimensional (2D) TI, also known as a quantum spin Hall (QSH) insulator, in a tetragonal bismuth bilayer (TB-Bi) structure that is dynamically and thermally stable based on phonon calculations and finite-temperature molecular dynamics simulations. Density functional theory and tight-binding calculations reveal a band inversion among the Bi-p orbits driven by the strong intrinsic spin–orbit coupling, producing a largemore » nontrivial band gap, which can be effectively tuned by moderate strains. The helical gapless edge states exhibit a linear dispersion with a high Fermi velocity comparable to that of graphene, and the QSH phase remains robust on a NaCl substrate. These remarkable properties place TB-Bi among the most promising 2D TIs for high-speed spintronic devices, and the present results provide insights into the intriguing QSH phenomenon in this new Bi structure and offer guidance for its implementation in potential applications.« less

Surface shift of the occupied and unoccupied 4f levels of the rare-earth metals

NASA Astrophysics Data System (ADS)

Aldén, M.; Johansson, B.; Skriver, H. L.

1995-02-01

The surface energy shifts of the occupied and unoccupied 4f levels for the lanthanide metals have been calculated from first principles by means of a Green's-function technique within the tight-binding linear muffin-tin orbitals method. We use the concept of complete screening to identify the occupied and unoccupied 4f energy level shifts as the surface segregation energy of a 4fn-1 and 4fn+1 impurity atom, respectively, in a 4fn host metal. The calculations include both initial- and final-state effects and give values that are considerably lower than those measured on polycrystalline samples as well as those found in previous initial-state model calculations. The present theory agrees well with very recent high-resolution, single-crystal film measurements for Gd, Tb, Dy, Ho, Er, Tm, and Lu. We furthermore utilize the unique possibility offered by the lanthanide metals to clarify the roles played by the initial and the different final states of the core-excitation process, permitted by the fact that the so-called initial-state effect is identical upon 4f removal and 4f addition. Surface energy and work function calculations are also reported.

Emergent pseudospin-1 Maxwell fermions with a threefold degeneracy in optical lattices

NASA Astrophysics Data System (ADS)

Zhu, Yan-Qing; Zhang, Dan-Wei; Yan, Hui; Xing, Ding-Yu; Zhu, Shi-Liang

2017-09-01

The discovery of relativistic spin-1/2 fermions such as Dirac and Weyl fermions in condensed-matter or artificial systems opens a new era in modern physics. An interesting but rarely explored question is whether other relativistic spinal excitations could be realized with artificial systems. Here, we construct two- and three-dimensional tight-binding models realizable with cold fermionic atoms in optical lattices, where the low energy excitations are effectively described by the spin-1 Maxwell equations in the Hamiltonian form. These relativistic (linear dispersion) excitations with unconventional integer pseudospin, beyond the Dirac-Weyl-Majorana fermions, are an exotic kind of fermions named as Maxwell fermions. We demonstrate that the systems have rich topological features. For instance, the threefold degenerate points called Maxwell points may have quantized Berry phases and anomalous quantum Hall effects with spin-momentum locking may appear in topological Maxwell insulators in the two-dimensional lattices. In three dimensions, Maxwell points may have nontrivial monopole charges of ±2 with two Fermi arcs connecting them, and the merging of the Maxwell points leads to topological phase transitions. Finally, we propose realistic schemes for realizing the model Hamiltonians and detecting the topological properties of the emergent Maxwell quasiparticles in optical lattices.

Negative differential resistance and rectification effects in zigzag graphene nanoribbon heterojunctions: Induced by edge oxidation and symmetry concept

NASA Astrophysics Data System (ADS)

Nazirfakhr, Maryam; Shahhoseini, Ali

2018-03-01

By applying non-equilibrium Green's functions (NEGF) in combination with tight-binding (TB) model, we investigate and compare the electronic transport properties of H-terminated zigzag graphene nanoribbon (H/ZGNR) and O-terminated ZGNR/H-terminated ZGNR (O/ZGNR-H/ZGNR) heterostructure under finite bias. Moreover, the effect of width and symmetry on the electronic transport properties of both models is also considered. The results reveal that asymmetric H/ZGNRs have linear I-V characteristics in whole bias range, but symmetric H-ZGNRs show negative differential resistance (NDR) behavior which is inversely proportional to the width of the H/ZGNR. It is also shown that the I-V characteristic of O/ZGNR-H/ZGNR heterostructure shows a rectification effect, whether the geometrical structure is symmetric or asymmetric. The fewer the number of zigzag chains, the bigger the rectification ratio. It should be mentioned that, the rectification ratios of symmetric heterostructures are much bigger than asymmetric one. Transmission spectrum, density of states (DOS), molecular projected self-consistent Hamiltonian (MPSH) and molecular eigenstates are analyzed subsequently to understand the electronic transport properties of these ZGNR devices. Our findings could be used in developing nanoscale rectifiers and NDR devices.

Bose-Einstein condensation in diamond hierarchical lattices.

PubMed

Lyra, M L; de Moura, F A B F; de Oliveira, I N; Serva, M

2014-05-01

The Bose-Einstein condensation of noninteracting particles restricted to move on the sites of hierarchical diamond lattices is investigated. Using a tight-binding single-particle Hamiltonian with properly rescaled hopping amplitudes, we are able to employ an orthogonal basis transformation to exactly map it on a set of decoupled linear chains with sizes and degeneracies written in terms of the network branching parameter q and generation number n. The integrated density of states is shown to have a fractal structure of gaps and degeneracies with a power-law decay at the band bottom. The spectral dimension d(s) coincides with the network topological dimension d(f) = ln(2q)/ln(2). We perform a finite-size scaling analysis of the fraction of condensed particles and specific heat to characterize the critical behavior of the BEC transition that occurs for q > 2 (d(s) > 2). The critical exponents are shown to follow those for lattices with a pure power-law spectral density, with non-mean-field values for q < 8 (d(s) < 4). The transition temperature is shown to grow monotonically with the branching parameter, obeying the relation 1/T(c) = a + b/(q - 2).

First-Principles Calculations of Current-Induced Spin-Transfer Torques in Magnetic Domain Walls

NASA Astrophysics Data System (ADS)

Tang, Ling; Xu, Zhijun; Yang, Zejin

2013-05-01

Current-induced spin-transfer torques (STTs) have been studied in Fe, Co and Ni domain walls (DWs) by the method based on the first-principles noncollinear calculations of scattering wavefunctions expanded in the tight-binding linearized muffin-tin orbital (TB-LMTO) basis. The results show that the out-of-plane component of nonadiabatic STT in Fe DW has localized form, which is in contrast to the typical nonlocal oscillating nonadiabatic torques obtained in Co and Ni DWs. Meanwhile, the degree of nonadiabaticity in STT is also much greater for Fe DW. Further, our results demonstrate that compared to the well-known first-order nonadiabatic STT, the torque in the third-order spatial derivative of local spin can better describe the distribution of localized nonadiabatic STT in Fe DW. The dynamics of local spin driven by this third-order torques in Fe DW have been investigated by the Landau-Lifshitz-Gilbert (LLG) equation. The calculated results show that with the same amplitude of STTs the DW velocity induced by this third-order term is about half of the wall speed for the case of the first-order nonadiabatic STT.

Influence of the aggregate state on band structure and optical properties of C60 computed with different methods

NASA Astrophysics Data System (ADS)

Pal, Amrita; Arabnejad, Saeid; Yamashita, Koichi; Manzhos, Sergei

2018-05-01

C60 and C60 based molecules are efficient acceptors and electron transport layers for planar perovskite solar cells. While properties of these molecules are well studied by ab initio methods, those of solid C60, specifically its optical absorption properties, are not. We present a combined density functional theory-Density Functional Tight Binding (DFTB) study of the effect of solid state packing on the band structure and optical absorption of C60. The valence and conduction band edge energies of solid C60 differ on the order of 0.1 eV from single molecule frontier orbital energies. We show that calculations of optical properties using linear response time dependent-DFT(B) or the imaginary part of the dielectric constant (dipole approximation) can result in unrealistically large redshifts in the presence of intermolecular interactions compared to available experimental data. We show that optical spectra computed from the frequency-dependent real polarizability can better reproduce the effect of C60 aggregation on optical absorption, specifically with a generalized gradient approximation functional, and may be more suited to study effects of molecular aggregation.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

2D Quantum Simulation of MOSFET Using the Non Equilibrium Green's Function Method

NASA Technical Reports Server (NTRS)

Svizhenko, Alexel; Anantram, M. P.; Govindan, T. R.; Yan, Jerry (Technical Monitor)

2000-01-01

The objectives this viewgraph presentation summarizes include: (1) the development of a quantum mechanical simulator for ultra short channel MOSFET simulation, including theory, physical approximations, and computer code; (2) explore physics that is not accessible by semiclassical methods; (3) benchmarking of semiclassical and classical methods; and (4) study other two-dimensional devices and molecular structure, from discretized Hamiltonian to tight-binding Hamiltonian.

Strain Effects on Properties of Phosphorene and Phosphorene Nanoribbons: a DFT and Tight Binding Study

NASA Astrophysics Data System (ADS)

Zhang, Ruo-Yu; Zheng, Ji-Ming; Jiang, Zhen-Yi

2018-01-01

Not Available Supported by the National Natural Science Foundation of China under Grant Nos 51572219 and 11447030, the Natural Science Foundation of Shaanxi Province of China under Grant Nos 2014JM2-1008 and 2015JM1018, and the State Key Laboratory of Transient Optics and Photonics Technology 2015 Annual Open Fund under Grant No SKLST200915.

Assessment of the Activation State of Rho Family GTP-Binding Proteins in Breast Cancer Cells and Specimens

DTIC Science & Technology

2004-08-01

AF038388 Vav3 GEF for Rho and Rac Proto-oncogene product NM020505 hPEM -2 GEF for Cdc42 Predominantly expressed in brain AB007884 GEF-H1 GEF for Rac and Rho...fence tions, and desmosomes play a fundamental role in maintain- function). A functional tight junction is crucial to maintain ing the polarized phenotype

Theoretical verification of experimentally obtained conformation-dependent electronic conductance in a biphenyl molecule

NASA Astrophysics Data System (ADS)

Maiti, Santanu K.

2014-07-01

The experimentally obtained (Venkataraman et al. [1]) cosine squared relation of electronic conductance in a biphenyl molecule is verified theoretically within a tight-binding framework. Using Green's function formalism we numerically calculate two-terminal conductance as a function of relative twist angle among the molecular rings and find that the results are in good agreement with the experimental observation.

Vertical electronic transport in van de waals heterostructures

NASA Astrophysics Data System (ADS)

Qiao, Zhenhua; Zhenhua Qiao's Group Team

In this work, we will introduce the theoretical investigation of the vertical electronic transport in various heterostructrues by using both tight-binding method and first-principles calculations. Counterintuitively, we find that the maximum electronic transport is achieved at very limited scattering regions but not at large overlapped catering regions. Based on this finding, we design a special setup to measure the tunneling effect in rotated bilayer systems.

Modeling electron transfer in photosystem I.

PubMed

Makita, Hiroki; Hastings, Gary

2016-06-01

Nanosecond to millisecond time-resolved absorption spectroscopy has been used to study electron transfer processes in photosystem I particles from Synechocystis sp. PCC 6803 with eight different quinones incorporated into the A1 binding site, at both 298 and 77K. A detailed kinetic model was constructed and solved within the context of Marcus electron transfer theory, and it was found that all of the data could be well described only if the in situ midpoint potentials of the quinones fell in a tightly defined range. For photosystem I with phylloquinone incorporated into the A1 binding site all of the time-resolved optical data is best modeled when the in situ midpoint potential of phylloquinone on the A/B branch is -635/-690 mV, respectively. With the midpoint potential of the F(X) iron sulfur cluster set at -680 mV, this indicates that forward electron transfer from A(1)(-) to F(X) is slightly endergonic/exergonic on the A/B branch, respectively. Additionally, for forward electron transfer from A(1)(-) to F(X), on both the A and B branches the reorganization energy is close to 0.7 eV. Reorganization energies of 0.4 or 1.0 eV are not possible. For the eight different quinones incorporated, the same kinetic model was used, allowing us to establish in situ redox potentials for all of the incorporated quinones on both branches. A linear correlation was found between the in situ and in vitro midpoint potentials of the quinones on both branches. Copyright © 2016 Elsevier B.V. All rights reserved.

Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2

PubMed Central

Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

2007-01-01

Background Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. Results We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Conclusion Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation. PMID:18028534

Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2.

PubMed

Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

2007-11-20

Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation.

Binding specificity of Bacillus thuringiensis Cry1Aa for purified, native Bombyx mori aminopeptidase N and cadherin-like receptors

PubMed Central

Jenkins, Jeremy L; Dean, Donald H

2001-01-01

Background To better understand the molecular interactions of Bt toxins with non-target insects, we have examined the real-time binding specificity and affinity of Cry1 toxins to native silkworm (Bombyx mori) midgut receptors. Previous studies on B. mori receptors utilized brush border membrane vesicles or purifed receptors in blot-type assays. Results The Bombyx mori (silkworm) aminopeptidase N (APN) and cadherin-like receptors for Bacillus thuringiensis insecticidal Cry1Aa toxin were purified and their real-time binding affinities for Cry toxins were examined by surface plasmon resonance. Cry1Ab and Cry1Ac toxins did not bind to the immobilized native receptors, correlating with their low toxicities. Cry1Aa displayed moderate affinity for B. mori APN (75 nM), and unusually tight binding to the cadherin-like receptor (2.6 nM), which results from slow dissociation rates. The binding of a hybrid toxin (Aa/Aa/Ac) was identical to Cry1Aa. Conclusions These results indicate domain II of Cry1Aa is essential for binding to native B. mori receptors and for toxicity. Moreover, the high-affinity binding of Cry1Aa to native cadherin-like receptor emphasizes the importance of this receptor class for Bt toxin research. PMID:11722800

Probing the human estrogen receptor-α binding requirements for phenolic mono- and di-hydroxyl compounds: A combined synthesis, binding and docking study

PubMed Central

McCullough, Christopher; Neumann, Terrence S.; Gone, Jayapal Reddy; He, Zhengjie; Herrild, Christian; Wondergem, Julie; Pandey, Rajesh K.; Donaldson, William A.; Sem, Daniel S.

2014-01-01

Various estrogen analogs were synthesized and tested for binding to human ERα using a fluorescence polarization displacement assay. Binding affinity and orientation were also predicted using docking calculations. Docking was able to accurately predict relative binding affinity and orientation for estradiol, but only if a tightly bound water molecule bridging Arg394/Glu353 is present. Di-hydroxyl compounds sometimes bind in two orientations, which are flipped in terms of relative positioning of their hydroxyl groups. Di-hydroxyl compounds were predicted to bind with their aliphatic hydroxyl group interacting with His524 in ERα. One nonsteroid-based dihdroxyl compound was 1000-fold specific for ERβ over ERα, and was also 25-fold specific for agonist ERβ versus antagonist activity. Docking predictions suggest this specificity may be due to interaction of the aliphatic hydroxyl with His475 in the agonist form of ERβ, versus with Thr299 in the antagonist form. But, the presence of this aliphatic hydroxyl is not required in all compounds, since mono-hydroxyl (phenolic) compounds bind ERα with high affinity, via hydroxyl hydrogen bonding interactions with the ERα Arg394/Glu353/water triad, and van der Waals interactions with the rest of the molecule. PMID:24315190

Arsenic-induced cutaneous hyperplastic lesions are associated with the dysregulation of Yap, a Hippo signaling-related protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Changzhao; Srivastava, Ritesh K.; Elmets, Craig A.

2013-09-06

Highlights: •Arsenic activates canonical Hippo signaling pathway and up-regulates αCatenin in the skin. •Arsenic activates transcriptional activity of Yap by its nuclear translocation. •Yap is involved in the disruption of tight/adherens junctions in arsenic-exposed animals. -- Abstract: Arsenic exposure in humans causes a number of toxic manifestations in the skin including cutaneous neoplasm. However, the mechanism of these alterations remains elusive. Here, we provide novel observations that arsenic induced Hippo signaling pathway in the murine skin. This pathway plays crucial roles in determining organ size during the embryonic development and if aberrantly activated in adults, contributes to the pathogenesis ofmore » epithelial neoplasm. Arsenic treatment enhanced phosphorylation-dependent activation of LATS1 kinase and other Hippo signaling regulatory proteins Sav1 and MOB1. Phospho-LATS kinase is known to catalyze the inactivation of a transcriptional co-activator, Yap. However, in arsenic-treated epidermis, we did not observed its inactivation. Thus, as expected, unphosphorylated-Yap was translocated to the nucleus in arsenic-treated epidermis. Yap by binding to the transcription factors TEADs induces transcription of its target genes. Consistently, an up-regulation of Yap-dependent target genes Cyr61, Gli2, Ankrd1 and Ctgf was observed in the skin of arsenic-treated mice. Phosphorylated Yap is important in regulating tight and adherens junctions through its binding to αCatenin. We found disruption of these junctions in the arsenic-treated mouse skin despite an increase in αCatenin. These data provide evidence that arsenic-induced canonical Hippo signaling pathway and Yap-mediated disruption of tight and adherens junctions are independently regulated. These effects together may contribute to the carcinogenic effects of arsenic in the skin.« less

Curli mediate bacterial adhesion to fibronectin via tensile multiple bonds

NASA Astrophysics Data System (ADS)

Oh, Yoo Jin; Hubauer-Brenner, Michael; Gruber, Hermann J.; Cui, Yidan; Traxler, Lukas; Siligan, Christine; Park, Sungsu; Hinterdorfer, Peter

2016-09-01

Many enteric bacteria including pathogenic Escherichia coli and Salmonella strains produce curli fibers that bind to host surfaces, leading to bacterial internalization into host cells. By using a nanomechanical force-sensing approach, we obtained real-time information about the distribution of molecular bonds involved in the adhesion of curliated bacteria to fibronectin. We found that curliated E. coli and fibronectin formed dense quantized and multiple specific bonds with high tensile strength, resulting in tight bacterial binding. Nanomechanical recognition measurements revealed that approximately 10 bonds were disrupted either sequentially or simultaneously under force load. Thus the curli formation of bacterial surfaces leads to multi-bond structural components of fibrous nature, which may explain the strong mechanical binding of curliated bacteria to host cells and unveil the functions of these proteins in bacterial internalization and invasion.

Dynamic regulation of GDP binding to G proteins revealed by magnetic field-dependent NMR relaxation analyses

PubMed Central

Toyama, Yuki; Kano, Hanaho; Mase, Yoko; Yokogawa, Mariko; Osawa, Masanori; Shimada, Ichio

2017-01-01

Heterotrimeric guanine-nucleotide-binding proteins (G proteins) serve as molecular switches in signalling pathways, by coupling the activation of cell surface receptors to intracellular responses. Mutations in the G protein α-subunit (Gα) that accelerate guanosine diphosphate (GDP) dissociation cause hyperactivation of the downstream effector proteins, leading to oncogenesis. However, the structural mechanism of the accelerated GDP dissociation has remained unclear. Here, we use magnetic field-dependent nuclear magnetic resonance relaxation analyses to investigate the structural and dynamic properties of GDP bound Gα on a microsecond timescale. We show that Gα rapidly exchanges between a ground-state conformation, which tightly binds to GDP and an excited conformation with reduced GDP affinity. The oncogenic D150N mutation accelerates GDP dissociation by shifting the equilibrium towards the excited conformation. PMID:28223697

Dynamic regulation of GDP binding to G proteins revealed by magnetic field-dependent NMR relaxation analyses.

PubMed

Toyama, Yuki; Kano, Hanaho; Mase, Yoko; Yokogawa, Mariko; Osawa, Masanori; Shimada, Ichio

2017-02-22

Heterotrimeric guanine-nucleotide-binding proteins (G proteins) serve as molecular switches in signalling pathways, by coupling the activation of cell surface receptors to intracellular responses. Mutations in the G protein α-subunit (Gα) that accelerate guanosine diphosphate (GDP) dissociation cause hyperactivation of the downstream effector proteins, leading to oncogenesis. However, the structural mechanism of the accelerated GDP dissociation has remained unclear. Here, we use magnetic field-dependent nuclear magnetic resonance relaxation analyses to investigate the structural and dynamic properties of GDP bound Gα on a microsecond timescale. We show that Gα rapidly exchanges between a ground-state conformation, which tightly binds to GDP and an excited conformation with reduced GDP affinity. The oncogenic D150N mutation accelerates GDP dissociation by shifting the equilibrium towards the excited conformation.

Sequence of events in measles virus replication: role of phosphoprotein-nucleocapsid interactions.

PubMed

Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia; Gerlier, Denis

2014-09-01

The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, P(XD) and N(TAIL) is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the P(XD) F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in P(XD)-to-N(TAIL) binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the P(XD)-N(TAIL) interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼ 6,700-nucleotide messenger RNAs from six to ten consecutive genes is unknown. Using a quantitative protein complementation assay and a biGene-biSilencing system allowing conditional expression of two P genes copies, the role of the P-to-N interaction in polymerase function was further characterized. We report here a dynamic protein anchoring mechanism that differs from all other known polymerases that rely only onto a sustained and direct binding to their nucleic acid template. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A single charge in the actin binding domain of fascin can independently tune the linear and non-linear response of an actin bundle network.

PubMed

Maier, M; Müller, K W; Heussinger, C; Köhler, S; Wall, W A; Bausch, A R; Lieleg, O

2015-05-01

Actin binding proteins (ABPs) not only set the structure of actin filament assemblies but also mediate the frequency-dependent viscoelastic moduli of cross-linked and bundled actin networks. Point mutations in the actin binding domain of those ABPs can tune the association and dissociation dynamics of the actin/ABP bond and thus modulate the network mechanics both in the linear and non-linear response regime. We here demonstrate how the exchange of a single charged amino acid in the actin binding domain of the ABP fascin triggers such a modulation of the network rheology. Whereas the overall structure of the bundle networks is conserved, the transition point from strain-hardening to strain-weakening sensitively depends on the cross-linker off-rate and the applied shear rate. Our experimental results are consistent both with numerical simulations of a cross-linked bundle network and a theoretical description of the bundle network mechanics which is based on non-affine bending deformations and force-dependent cross-link dynamics.

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

The interaction of representative members from two classes of antimycotics--the azoles and the allylamines--with cytochromes P-450 in steroidogenic tissues and liver.

PubMed

Schuster, I

1985-06-01

Spectrophotometric studies with ketoconazole, clotrimazole and miconazole show strong type-II interactions with several cytochromes P-450, particularly (Ks greater than 10(7)M-1; pH7.4; 25 degrees C) with the 11 beta-hydroxylase of adrenal mitochondria, with the 17 alpha/20 lyase of testis microsomes and with some forms of cytochromes P-450 of liver. A tight binding of the azoles also occurs to the reduced cytochromes, giving rise to an impeded CO binding to the haem iron. The binding of the azoles to 11 beta-hydroxylase and 17 alpha/20 lyase is much tighter than the binding of endogenous substrates, and consequently inhibition of steroidogenesis will occur at these sites. The metabolism of xenobiotic substrates by the cytochromes P-450 of liver will also be severely impeded. In contrast, the allylamines naftifine and SF 86-327 are type-I substrates for a small portion of cytochromes P-450 of liver microsomes only and there is no spectral evidence for binding to the cytochromes P-450 involved in steroid biosynthesis.

Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

PubMed

Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

2005-06-01

A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

Epistatic mutations in PUMA BH3 drive an alternate binding mode to potently and selectively inhibit anti-apoptotic Bfl-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jenson, Justin M.; Ryan, Jeremy A.; Grant, Robert A.

Overexpression of anti-apoptotic Bcl-2 family proteins contributes to cancer progression and confers resistance to chemotherapy. Small molecules that target Bcl-2 are used in the clinic to treat leukemia, but tight and selective inhibitors are not available for Bcl-2 paralog Bfl-1. Guided by computational analysis, we designed variants of the native BH3 motif PUMA that are > 150-fold selective for Bfl-1 binding. The designed peptides potently trigger disruption of the mitochondrial outer membrane in cells dependent on Bfl-1, but not in cells dependent on other anti-apoptotic homologs. High-resolution crystal structures show that designed peptide FS2 binds Bfl-1 in a shifted geometry,more » relative to PUMA and other binding partners, due to a set of epistatic mutations. FS2 modified with an electrophile reacts with a cysteine near the peptide-binding groove to augment specificity. Designed Bfl-1 binders provide reagents for cellular profiling and leads for developing enhanced and cell-permeable peptide or small-molecule inhibitors.« less

BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

PubMed

da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

1993-07-01

The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

Weak partitioning chromatography for anion exchange purification of monoclonal antibodies.

PubMed

Kelley, Brian D; Tobler, Scott A; Brown, Paul; Coffman, Jonathan L; Godavarti, Ranga; Iskra, Timothy; Switzer, Mary; Vunnum, Suresh

2008-10-15

Weak partitioning chromatography (WPC) is an isocratic chromatographic protein separation method performed under mobile phase conditions where a significant amount of the product protein binds to the resin, well in excess of typical flowthrough operations. The more stringent load and wash conditions lead to improved removal of more tightly binding impurities, although at the cost of a reduction in step yield. The step yield can be restored by extending the column load and incorporating a short wash at the end of the load stage. The use of WPC with anion exchange resins enables a two-column cGMP purification platform to be used for many different mAbs. The operating window for WPC can be easily established using high throughput batch-binding screens. Under conditions that favor very strong product binding, competitive effects from product binding can give rise to a reduction in column loading capacity. Robust performance of WPC anion exchange chromatography has been demonstrated in multiple cGMP mAb purification processes. Excellent clearance of host cell proteins, leached Protein A, DNA, high molecular weight species, and model virus has been achieved. (c) 2008 Wiley Periodicals, Inc.

Epistatic mutations in PUMA BH3 drive an alternate binding mode to potently and selectively inhibit anti-apoptotic Bfl-1

PubMed Central

Jenson, Justin M; Ryan, Jeremy A; Grant, Robert A; Letai, Anthony; Keating, Amy E

2017-01-01

Overexpression of anti-apoptotic Bcl-2 family proteins contributes to cancer progression and confers resistance to chemotherapy. Small molecules that target Bcl-2 are used in the clinic to treat leukemia, but tight and selective inhibitors are not available for Bcl-2 paralog Bfl-1. Guided by computational analysis, we designed variants of the native BH3 motif PUMA that are > 150-fold selective for Bfl-1 binding. The designed peptides potently trigger disruption of the mitochondrial outer membrane in cells dependent on Bfl-1, but not in cells dependent on other anti-apoptotic homologs. High-resolution crystal structures show that designed peptide FS2 binds Bfl-1 in a shifted geometry, relative to PUMA and other binding partners, due to a set of epistatic mutations. FS2 modified with an electrophile reacts with a cysteine near the peptide-binding groove to augment specificity. Designed Bfl-1 binders provide reagents for cellular profiling and leads for developing enhanced and cell-permeable peptide or small-molecule inhibitors. DOI: http://dx.doi.org/10.7554/eLife.25541.001 PMID:28594323

Binding affinity toward human prion protein of some anti-prion compounds - Assessment based on QSAR modeling, molecular docking and non-parametric ranking.

PubMed

Kovačević, Strahinja; Karadžić, Milica; Podunavac-Kuzmanović, Sanja; Jevrić, Lidija

2018-01-01

The present study is based on the quantitative structure-activity relationship (QSAR) analysis of binding affinity toward human prion protein (huPrP C ) of quinacrine, pyridine dicarbonitrile, diphenylthiazole and diphenyloxazole analogs applying different linear and non-linear chemometric regression techniques, including univariate linear regression, multiple linear regression, partial least squares regression and artificial neural networks. The QSAR analysis distinguished molecular lipophilicity as an important factor that contributes to the binding affinity. Principal component analysis was used in order to reveal similarities or dissimilarities among the studied compounds. The analysis of in silico absorption, distribution, metabolism, excretion and toxicity (ADMET) parameters was conducted. The ranking of the studied analogs on the basis of their ADMET parameters was done applying the sum of ranking differences, as a relatively new chemometric method. The main aim of the study was to reveal the most important molecular features whose changes lead to the changes in the binding affinities of the studied compounds. Another point of view on the binding affinity of the most promising analogs was established by application of molecular docking analysis. The results of the molecular docking were proven to be in agreement with the experimental outcome. Copyright © 2017 Elsevier B.V. All rights reserved.

Regulation of Na(+)/K(+)-ATPase by nuclear respiratory factor 1: implication in the tight coupling of neuronal activity, energy generation, and energy consumption.

PubMed

Johar, Kaid; Priya, Anusha; Wong-Riley, Margaret T T

2012-11-23

NRF-1 regulates mediators of neuronal activity and energy generation. NRF-1 transcriptionally regulates Na(+)/K(+)-ATPase subunits α1 and β1. NRF-1 functionally regulates mediators of energy consumption in neurons. NRF-1 mediates the tight coupling of neuronal activity, energy generation, and energy consumption at the molecular level. Energy generation and energy consumption are tightly coupled to neuronal activity at the cellular level. Na(+)/K(+)-ATPase, a major energy-consuming enzyme, is well expressed in neurons rich in cytochrome c oxidase, an important enzyme of the energy-generating machinery, and glutamatergic receptors that are mediators of neuronal activity. The present study sought to test our hypothesis that the coupling extends to the molecular level, whereby Na(+)/K(+)-ATPase subunits are regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), found recently by our laboratory to regulate all cytochrome c oxidase subunit genes and some NMDA and AMPA receptor subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutational analysis, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Atp1a1 and Atp1b1 genes but not of the Atp1a3 gene in neurons. The transcripts of Atp1a1 and Atp1b1 subunit genes were up-regulated by KCl and down-regulated by tetrodotoxin. Atp1b1 is positively regulated by NRF-1, and silencing of NRF-1 with small interference RNA blocked the up-regulation of Atp1b1 induced by KCl, whereas overexpression of NRF-1 rescued these transcripts from being suppressed by tetrodotoxin. On the other hand, Atp1a1 is negatively regulated by NRF-1. The binding sites of NRF-1 on Atp1a1 and Atp1b1 are conserved among mice, rats, and humans. Thus, NRF-1 regulates key Na(+)/K(+)-ATPase subunits and plays an important role in mediating the tight coupling between energy consumption, energy generation, and neuronal activity at the molecular level.

Understanding the length dependence of molecular junction thermopower.

PubMed

Karlström, Olov; Strange, Mikkel; Solomon, Gemma C

2014-01-28

Thermopower of molecular junctions is sensitive to details in the junction and may increase, decrease, or saturate with increasing chain length, depending on the system. Using McConnell's theory for exponentially suppressed transport together with a simple and easily interpretable tight binding model, we show how these different behaviors depend on the molecular backbone and its binding to the contacts. We distinguish between resonances from binding groups or undercoordinated electrode atoms, and those from the periodic backbone. It is demonstrated that while the former gives a length-independent contribution to the thermopower, possibly changing its sign, the latter determines its length dependence. This means that the question of which orbitals from the periodic chain that dominate the transport should not be inferred from the sign of the thermopower but from its length dependence. We find that the same molecular backbone can, in principle, show four qualitatively different thermopower trends depending on the binding group: It can be positive or negative for short chains, and it can either increase or decrease with length.

Structural basis for LeishIF4E-1 modulation by an interacting protein in the human parasite Leishmania major.

PubMed

Meleppattu, Shimi; Arthanari, Haribabu; Zinoviev, Alexandra; Boeszoermenyi, Andras; Wagner, Gerhard; Shapira, Michal; Léger-Abraham, Mélissa

2018-03-19

Leishmania parasites are unicellular pathogens that are transmitted to humans through the bite of infected sandflies. Most of the regulation of their gene expression occurs post-transcriptionally, and the different patterns of gene expression required throughout the parasites' life cycle are regulated at the level of translation. Here, we report the X-ray crystal structure of the Leishmania cap-binding isoform 1, LeishIF4E-1, bound to a protein fragment of previously unknown function, Leish4E-IP1, that binds tightly to LeishIF4E-1. The molecular structure, coupled to NMR spectroscopy experiments and in vitro cap-binding assays, reveal that Leish4E-IP1 allosterically destabilizes the binding of LeishIF4E-1 to the 5' mRNA cap. We propose mechanisms through which Leish4E-IP1-mediated LeishIF4E-1 inhibition could regulate translation initiation in the human parasite.

Structural Analysis of the Phenol-Responsive Sensory Domain of the Transcription Activator PoxR.

PubMed

Patil, Vinod Vikas; Park, Kwang-Hyun; Lee, Seung-Goo; Woo, Euijeon

2016-04-05

Positive phenol-degradative gene regulator (PoxR) is a σ(54)-dependent AAA+ ATPase transcription activator that regulates the catabolism of phenols. The PoxR sensory domain detects phenols and relays signals for the activation of transcription. Here we report the first structure of the phenol sensory domain bound to phenol and five derivatives. It exists as a tightly intertwined homodimer with a phenol-binding pocket buried inside, placing two C termini on the same side of the dimer. His102 and Trp130 interact with the hydroxyl group of the phenol in a cavity surrounded by rigid hydrophobic residues on one side and a flexible region on the other. Each monomer has a V4R fold with a unique zinc-binding site. A shift at the C-terminal helix suggests that there is a possible conformational change upon ligand binding. The results provide a structural basis of chemical effector binding for transcriptional regulation with broad implications for protein engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sequence and characterization of cytoplasmic nuclear protein import factor p97

PubMed Central

1995-01-01

Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630

Recognition of the pro-mutagenic base uracil by family B DNA polymerases from archaea.

PubMed

Shuttleworth, Gillian; Fogg, Mark J; Kurpiewski, Michael R; Jen-Jacobson, Linda; Connolly, Bernard A

2004-03-26

Archaeal family B DNA polymerases contain a specialised pocket that binds tightly to template-strand uracil, causing the stalling of DNA replication. The mechanism of this unique "template-strand proof-reading" has been studied using equilibrium binding measurements, DNA footprinting, van't Hoff analysis and calorimetry. Binding assays have shown that the polymerase preferentially binds to uracil in single as opposed to double-stranded DNA. Tightest binding is observed using primer-templates that contain uracil four bases in front of the primer-template junction, corresponding to the observed stalling position. Ethylation interference analysis of primer-templates shows that the two phosphates, immediately flanking the uracil (NpUpN), are important for binding; contacts are also made to phosphates in the primer-strand. Microcalorimetry and van't Hoff analysis have given a fuller understanding of the thermodynamic parameters involved in uracil recognition. All the results are consistent with a "read-ahead" mechanism, in which the replicating polymerase scans the template, ahead of the replication fork, for the presence of uracil and halts polymerisation on detecting this base. Post-stalling events, serving to eliminate uracil, await full elucidation.

Structure of GlnK1 with bound effectors indicates regulatory mechanism for ammonia uptake.

PubMed

Yildiz, Ozkan; Kalthoff, Christoph; Raunser, Stefan; Kühlbrandt, Werner

2007-01-24

A binary complex of the ammonia channel Amt1 from Methanococcus jannaschii and its cognate P(II) signalling protein GlnK1 has been produced and characterized. Complex formation is prevented specifically by the effector molecules Mg-ATP and 2-ketoglutarate. Single-particle electron microscopy of the complex shows that GlnK1 binds on the cytoplasmic side of Amt1. Three high-resolution X-ray structures of GlnK1 indicate that the functionally important T-loop has an extended, flexible conformation in the absence of Mg-ATP, but assumes a compact, tightly folded conformation upon Mg-ATP binding, which in turn creates a 2-ketoglutarate-binding site. We propose a regulatory mechanism by which nitrogen uptake is controlled by the binding of both effector molecules to GlnK1. At normal effector levels, a 2-ketoglutarate molecule binding at the apex of the compact T-loop would prevent complex formation, ensuring uninhibited ammonia uptake. At low levels of Mg-ATP, the extended loops would seal the ammonia channels in the complex. Binding of both effector molecules to P(II) signalling proteins may thus represent an effective feedback mechanism for regulating ammonium uptake through the membrane.

CRYO-EM STRUCTURES OF THE ACTIN:TROPOMYOSIN FILAMENT REVEAL THE MECHANISM FOR THE TRANSITION FROM C- TO M-STATE

PubMed Central

Sousa, Duncan R.; Stagg, Scott M.; Stroupe, M. Elizabeth

2013-01-01

Tropomyosin is a key factor in the molecular mechanisms that regulate the binding of myosin motors to actin filaments in most eukaryotic cells. This regulation is achieved by the azimuthal repositioning of tropomyosin along the actin:tropomyosin:troponin thin filament to block or expose myosin binding sites on actin. In striated muscle, including involuntary cardiac muscle, tropomyosin regulates muscle contraction by coupling Ca2+ binding to troponin with myosin binding to the thin filament. In smooth muscle, the switch is the post-translational modification of the myosin. Depending on the activation state of troponin and the binding state of myosin, tropomyosin can occupy the blocked, closed, or open position on actin. Using native cryogenic 3DEM, we have directly resolved and visualized cardiac and gizzard muscle tropomyosin on filamentous actin in the position that corresponds to the closed state. From the 8-Å resolution structure of the reconstituted Ac:Tm filament formed with gizzard-derived Tm we discuss two possible mechanisms for the transition from closed to open state and describe the role Tm plays in blocking myosin tight binding in the closed state position. PMID:24021812

Displacement of disordered water molecules from hydrophobic pocket creates enthalpic signature: binding of phosphonamidate to the S₁'-pocket of thermolysin.

PubMed

Englert, L; Biela, A; Zayed, M; Heine, A; Hangauer, D; Klebe, G

2010-11-01

Prerequisite for the design of tight binding protein inhibitors and prediction of their properties is an in-depth understanding of the structural and thermodynamic details of the binding process. A series of closely related phosphonamidates was studied to elucidate the forces underlying their binding affinity to thermolysin. The investigated inhibitors are identical except for the parts penetrating into the hydrophobic S₁'-pocket. A correlation of structural, kinetic and thermodynamic data was carried out by X-ray crystallography, kinetic inhibition assay and isothermal titration calorimetry. Binding affinity increases with larger ligand hydrophobic P₁'-moieties accommodating the S₁'-pocket. Surprisingly, larger P₁'-side chain modifications are accompanied by an increase in the enthalpic contribution to binding. In agreement with other studies, it is suggested that the release of largely disordered waters from an imperfectly hydrated pocket results in an enthalpically favourable integration of these water molecules into bulk water upon inhibitor binding. This enthalpically favourable process contributes more strongly to the binding energetics than the entropy increase resulting from the release of water molecules from the S₁'-pocket or the formation of apolar interactions between protein and inhibitor. Displacement of highly disordered water molecules from a rather imperfectly hydrated and hydrophobic specificity pocket can reveal an enthalpic signature of inhibitor binding. Copyright © 2010 Elsevier B.V. All rights reserved.

Elucidation of Lipid Binding Sites on Lung Surfactant Protein A Using X-ray Crystallography, Mutagenesis, and Molecular Dynamics Simulations.

PubMed

Goh, Boon Chong; Wu, Huixing; Rynkiewicz, Michael J; Schulten, Klaus; Seaton, Barbara A; McCormack, Francis X

2016-07-05

Surfactant protein A (SP-A) is a collagenous C-type lectin (collectin) that is critical for pulmonary defense against inhaled microorganisms. Bifunctional avidity of SP-A for pathogen-associated molecular patterns (PAMPs) such as lipid A and for dipalmitoylphosphatidylcholine (DPPC), the major component of surfactant membranes lining the air-liquid interface of the lung, ensures that the protein is poised for first-line interactions with inhaled pathogens. To improve our understanding of the motifs that are required for interactions with microbes and surfactant structures, we explored the role of the tyrosine-rich binding surface on the carbohydrate recognition domain of SP-A in the interaction with DPPC and lipid A using crystallography, site-directed mutagenesis, and molecular dynamics simulations. Critical binding features for DPPC binding include a three-walled tyrosine cage that binds the choline headgroup through cation-π interactions and a positively charged cluster that binds the phosphoryl group. This basic cluster is also critical for binding of lipid A, a bacterial PAMP and target for SP-A. Molecular dynamics simulations further predict that SP-A binds lipid A more tightly than DPPC. These results suggest that the differential binding properties of SP-A favor transfer of the protein from surfactant DPPC to pathogen membranes containing appropriate lipid PAMPs to effect key host defense functions.

Genetic Evidence for a Tight Cooperation of TatB and TatC during Productive Recognition of Twin-Arginine (Tat) Signal Peptides in Escherichia coli

PubMed Central

Lausberg, Frank; Fleckenstein, Stefan; Kreutzenbeck, Peter; Fröbel, Julia; Rose, Patrick; Müller, Matthias; Freudl, Roland

2012-01-01

The twin arginine translocation (Tat) pathway transports folded proteins across the cytoplasmic membrane of bacteria. Tat signal peptides contain a consensus motif (S/T-R-R-X-F-L-K) that is thought to play a crucial role in substrate recognition by the Tat translocase. Replacement of the phenylalanine at the +2 consensus position in the signal peptide of a Tat-specific reporter protein (TorA-MalE) by aspartate blocked export of the corresponding TorA(D+2)-MalE precursor, indicating that this mutation prevents a productive binding of the TorA(D+2) signal peptide to the Tat translocase. Mutations were identified in the extreme amino-terminal regions of TatB and TatC that synergistically suppressed the export defect of TorA(D+2)-MalE when present in pairwise or triple combinations. The observed synergistic suppression activities were even more pronounced in the restoration of membrane translocation of another export-defective precursor, TorA(KQ)-MalE, in which the conserved twin arginine residues had been replaced by lysine-glutamine. Collectively, these findings indicate that the extreme amino-terminal regions of TatB and TatC cooperate tightly during recognition and productive binding of Tat-dependent precursor proteins and, furthermore, that TatB and TatC are both involved in the formation of a specific signal peptide binding site that reaches out as far as the end of the TatB transmembrane segment. PMID:22761916

Crystal Structures of the Histo-Aspartic Protease (HAP) from Plasmodium falciparum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhaumik, Prasenjit; Xiao, Huogen; Parr, Charity L.

The structures of recombinant histo-aspartic protease (HAP) from malaria-causing parasite Plasmodium falciparum as apoenzyme and in complex with two inhibitors, pepstatin A and KNI-10006, were solved at 2.5-, 3.3-, and 3.05-{angstrom} resolutions, respectively. In the apoenzyme crystals, HAP forms a tight dimer not seen previously in any aspartic protease. The interactions between the monomers affect the conformation of two flexible loops, the functionally important 'flap' (residues 70-83) and its structural equivalent in the C-terminal domain (residues 238-245), as well as the orientation of helix 225-235. The flap is found in an open conformation in the apoenzyme. Unexpectedly, the active sitemore » of the apoenzyme contains a zinc ion tightly bound to His32 and Asp215 from one monomer and to Glu278A from the other monomer, with the coordination of Zn resembling that seen in metalloproteases. The flap is closed in the structure of the pepstatin A complex, whereas it is open in the complex with KNI-10006. Although the binding mode of pepstatin A is significantly different from that in other pepsin-like aspartic proteases, its location in the active site makes unlikely the previously proposed hypothesis that HAP is a serine protease. The binding mode of KNI-10006 is unusual compared with the binding of other inhibitors from the KNI series to aspartic proteases. The novel features of the HAP active site could facilitate design of specific inhibitors used in the development of antimalarial drugs.« less

Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.

2011-01-01

We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.

Carbon Nanotube Field Emission Arrays

DTIC Science & Technology

2011-06-01

K , and M [14]. Using the tight binding energy model, the energy dispersion relations for graphene can be calculated for the triangle formed from...The corresponding reciprocal lattice vectors, b1 and b2, and Brillouin zone of graphene [14]. 19 graphene band structure is the six K ...points where the two bands are degenerate and the Fermi level passes. It has been shown through thorough calculations that at T = 0 K , the density

Formation Energies of Native Point Defects in Strained layer Superlattices (Postprint)

DTIC Science & Technology

2017-06-05

AFRL-RX-WP-JA-2017-0440 FORMATION ENERGIES OF NATIVE POINT DEFECTS IN STRAINED-LAYER SUPERLATTICES (POSTPRINT) Zhi Gang Yu...2017 Interim 11 September 2013 – 31 May 2017 4. TITLE AND SUBTITLE FORMATION ENERGIES OF NATIVE POINT DEFECTS IN STRAINED-LAYER SUPERLATTICES...Hamiltonian, tight-binding Hamiltonian, and Green’s function techniques to obtain energy levels arising from native point defects (NPDs) in InAs-GaSb and

Majorana-Hubbard model on the square lattice

NASA Astrophysics Data System (ADS)

Affleck, Ian; Rahmani, Armin; Pikulin, Dmitry

2017-09-01

We study a tight-binding model of interacting Majorana (Hermitian) modes on a square lattice. The model may have an experimental realization in a superconducting-film-topological-insulator heterostructure in a magnetic field. We find a rich phase diagram, as a function of interaction strength, including an emergent superfluid phase with spontaneous breaking of an emergent U (1 ) symmetry, separated by a supersymmetric transition from a gapless normal phase.

Various Stone-Wales defects in phagraphene

NASA Astrophysics Data System (ADS)

Openov, L. A.; Podlivaev, A. I.

2016-08-01

Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.

Dislocation Onset and Glide in Carbon Nanotubes under Torsion

NASA Astrophysics Data System (ADS)

Dumitrica, Traian; Zhang, Dong-Bo; James, Richard

2009-03-01

The torsional plastic response of carbon nanotubes is comprehensively described in the objective molecular dynamics framework [1-3]. It is shown that an (n,m) tube is prone to slip along a nearly-axial helical path, which introduces a distinct (+1,-1) change in the wrapping index. The low energy realization occurs without loss of mass, via nucleation of a 5-7-7-5 dislocation dipole, followed by a nearly-axial glide of the 5-7 dislocation. The onset of plasticity depends not only on chirality but also on handedness. For a given handedness of the applied twist, chiral tubes of opposed handedness are most susceptible to yield. A right-handed applied twist on an armchair (zig-zag) tube leads to a right- (left-) handed tube. [4pt] [1] T. Dumitrica and R.D. James, Objective Molecular Dynamics, Journal of the Mechanics and Physics of Solids 55, 2206 (2007). [0pt] [2] D.-B. Zhang, M. Hua, and T. Dumitrica, Stability of Polycrystalline and Wurtzite Si Nanowires via Symmetry-Adapted Tight-Binding Objective Molecular Dynamics, Journal of Chemical Physics 128, 084104 (2008). [0pt] [3] D.-B. Zhang and T. Dumitrica, Elasticity of Ideal Single-Walled Carbon Nanotubes via Symmetry-Adapted Tight-Binding Objective Modeling, Applied Physics Letters 93, 031919 (2008).

Physics and performances of III-V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations.

PubMed

Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M

2018-06-27

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

Maximally localized Wannier functions in LaMnO3 within PBE + U, hybrid functionals and partially self-consistent GW: an efficient route to construct ab initio tight-binding parameters for eg perovskites.

PubMed

Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G

2012-06-13

Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.

Effective mass in bilayer graphene at low carrier densities: The role of potential disorder and electron-electron interaction

NASA Astrophysics Data System (ADS)

Li, J.; Tan, L. Z.; Zou, K.; Stabile, A. A.; Seiwell, D. J.; Watanabe, K.; Taniguchi, T.; Louie, Steven G.; Zhu, J.

2016-10-01

In a two-dimensional electron gas, the electron-electron interaction generally becomes stronger at lower carrier densities and renormalizes the Fermi-liquid parameters, such as the effective mass of carriers. We combine experiment and theory to study the effective masses of electrons and holes me* and mh* in bilayer graphene in the low carrier density regime on the order of 1 ×1011c m-2 . Measurements use temperature-dependent low-field Shubnikov-de Haas oscillations observed in high-mobility hexagonal boron nitride supported samples. We find that while me* follows a tight-binding description in the whole density range, mh* starts to drop rapidly below the tight-binding description at a carrier density of n =6 ×1011c m-2 and exhibits a strong suppression of 30% when n reaches 2 ×1011c m-2 . Contributions from the electron-electron interaction alone, evaluated using several different approximations, cannot explain the experimental trend. Instead, the effect of the potential fluctuation and the resulting electron-hole puddles play a crucial role. Calculations including both the electron-electron interaction and disorder effects explain the experimental data qualitatively and quantitatively. This Rapid Communication reveals an unusual disorder effect unique to two-dimensional semimetallic systems.

Quantum Hall effect in ac driven graphene: From the half-integer to the integer case

NASA Astrophysics Data System (ADS)

Ding, Kai-He; Lim, Lih-King; Su, Gang; Weng, Zheng-Yu

2018-01-01

We theoretically study the quantum Hall effect (QHE) in graphene with an ac electric field. Based on the tight-binding model, the structure of the half-integer Hall plateaus at σxy=±(n +1 /2 ) 4 e2/h (n is an integer) gets qualitatively changed with the addition of new integer Hall plateaus at σxy=±n (4 e2/h ) starting from the edges of the band center regime towards the band center with an increasing ac field. Beyond a critical field strength, a Hall plateau with σxy=0 can be realized at the band center, hence fully restoring a conventional integer QHE with particle-hole symmetry. Within a low-energy Hamiltonian for Dirac cones merging, we show a very good agreement with the tight-binding calculations for the Hall plateau transitions. We also obtain the band structure for driven graphene ribbons to provide a further understanding on the appearance of the new Hall plateaus, showing a trivial insulator behavior for the σxy=0 state. In the presence of disorder, we numerically study the disorder-induced destruction of the quantum Hall states in a finite driven sample and find that qualitative features known in the undriven disordered case are maintained.

A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.

PubMed

Quan, Yundi; Pickett, Warren E

2018-02-21

Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point

NASA Astrophysics Data System (ADS)

Quan, Yundi; Pickett, Warren E.

2018-02-01

Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

Mobile spin impurity in an optical lattice

NASA Astrophysics Data System (ADS)

Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.

2017-07-01

We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.

Physics and performances of III–V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations

NASA Astrophysics Data System (ADS)

Afzalian, A.; Vasen, T.; Ramvall, P.; Shen, T.-M.; Wu, J.; Passlack, M.

2018-06-01

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III–V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III–V GAA nanowire HTFETs including the effect of electron–phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

Extension of the self-consistent-charge density-functional tight-binding method: third-order expansion of the density functional theory total energy and introduction of a modified effective coulomb interaction.

PubMed

Yang, Yang; Yu, Haibo; York, Darrin; Cui, Qiang; Elstner, Marcus

2007-10-25

The standard self-consistent-charge density-functional-tight-binding (SCC-DFTB) method (Phys. Rev. B 1998, 58, 7260) is derived by a second-order expansion of the density functional theory total energy expression, followed by an approximation of the charge density fluctuations by charge monopoles and an effective damped Coulomb interaction between the atomic net charges. The central assumptions behind this effective charge-charge interaction are the inverse relation of atomic size and chemical hardness and the use of a fixed chemical hardness parameter independent of the atomic charge state. While these approximations seem to be unproblematic for many covalently bound systems, they are quantitatively insufficient for hydrogen-bonding interactions and (anionic) molecules with localized net charges. Here, we present an extension of the SCC-DFTB method to incorporate third-order terms in the charge density fluctuations, leading to chemical hardness parameters that are dependent on the atomic charge state and a modification of the Coulomb scaling to improve the electrostatic treatment within the second-order terms. These modifications lead to a significant improvement in the description of hydrogen-bonding interactions and proton affinities of biologically relevant molecules.

Phononic crystals of spherical particles: A tight binding approach

NASA Astrophysics Data System (ADS)

Mattarelli, M.; Secchi, M.; Montagna, M.

2013-11-01

The vibrational dynamics of a fcc phononic crystal of spheres is studied and compared with that of a single free sphere, modelled either by a continuous homogeneous medium or by a finite cluster of atoms. For weak interaction among the spheres, the vibrational dynamics of the phononic crystal is described by shallow bands, with low degree of dispersion, corresponding to the acoustic spheroidal and torsional modes of the single sphere. The phonon displacements are therefore related to the vibrations of a sphere, as the electron wave functions in a crystal are related to the atomic wave functions in a tight binding model. Important dispersion is found for the two lowest phonon bands, which correspond to zero frequency free translation and rotation of a free sphere. Brillouin scattering spectra are calculated at some values of the exchanged wavevectors of the light, and compared with those of a single sphere. With weak interaction between particles, given the high acoustic impedance mismatch in dry systems, the density of phonon states consist of sharp bands separated by large gaps, which can be well accounted for by a single particle model. Based on the width of the frequency gaps, tunable with the particle size, and on the small number of dispersive acoustic phonons, such systems may provide excellent materials for application as sound or heat filters.

Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

NASA Astrophysics Data System (ADS)

Menezes, Marcos; Capaz, Rodrigo

Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.

Time-efficient simulations of tight-binding electronic structures with Intel Xeon PhiTM many-core processors

NASA Astrophysics Data System (ADS)

Ryu, Hoon; Jeong, Yosang; Kang, Ji-Hoon; Cho, Kyu Nam

2016-12-01

Modelling of multi-million atomic semiconductor structures is important as it not only predicts properties of physically realizable novel materials, but can accelerate advanced device designs. This work elaborates a new Technology-Computer-Aided-Design (TCAD) tool for nanoelectronics modelling, which uses a sp3d5s∗ tight-binding approach to describe multi-million atomic structures, and simulate electronic structures with high performance computing (HPC), including atomic effects such as alloy and dopant disorders. Being named as Quantum simulation tool for Advanced Nanoscale Devices (Q-AND), the tool shows nice scalability on traditional multi-core HPC clusters implying the strong capability of large-scale electronic structure simulations, particularly with remarkable performance enhancement on latest clusters of Intel Xeon PhiTM coprocessors. A review of the recent modelling study conducted to understand an experimental work of highly phosphorus-doped silicon nanowires, is presented to demonstrate the utility of Q-AND. Having been developed via Intel Parallel Computing Center project, Q-AND will be open to public to establish a sound framework of nanoelectronics modelling with advanced HPC clusters of a many-core base. With details of the development methodology and exemplary study of dopant electronics, this work will present a practical guideline for TCAD development to researchers in the field of computational nanoelectronics.

No significant regulation of bicoid mRNA by Pumilio or Nanos in the early Drosophila embryo.

PubMed

Wharton, Tammy H; Nomie, Krystle J; Wharton, Robin P

2018-01-01

Drosophila Pumilio (Pum) is a founding member of the conserved Puf domain class of RNA-binding translational regulators. Pum binds with high specificity, contacting eight nucleotides, one with each of the repeats in its RNA-binding domain. In general, Pum is thought to block translation in collaboration with Nanos (Nos), which exhibits no binding specificity in isolation but is recruited jointly to regulatory sequences containing a Pum binding site in the 3'-UTRs of target mRNAs. Unlike Pum, which is ubiquitous in the early embryo, Nos is tightly restricted to the posterior, ensuring that repression of its best-characterized target, maternal hunchback (hb) mRNA, takes place exclusively in the posterior. An exceptional case of Nos-independent regulation by Pum has been described-repression of maternal bicoid (bcd) mRNA at the anterior pole of the early embryo, dependent on both Pum and conserved Pum binding sites in the 3'-UTR of the mRNA. We have re-investigated regulation of bcd in the early embryo; our experiments reveal no evidence of a role for Pum or its conserved binding sites in regulation of the perdurance of bcd mRNA or protein. Instead, we find that Pum and Nos control the accumulation of bcd mRNA in testes.

Dominant Alcohol-Protein Interaction via Hydration-Enabled Enthalpy-Driven Binding Mechanism

PubMed Central

Chong, Yuan; Kleinhammes, Alfred; Tang, Pei; Xu, Yan; Wu, Yue

2015-01-01

Water plays an important role in weak associations of small drug molecules with proteins. Intense focus has been on binding-induced structural changes in the water network surrounding protein binding sites, especially their contributions to binding thermodynamics. However, water is also tightly coupled to protein conformations and dynamics, and so far little is known about the influence of water-protein interactions on ligand binding. Alcohols are a type of low-affinity drugs, and it remains unclear how water affects alcohol-protein interactions. Here, we present alcohol adsorption isotherms under controlled protein hydration using in-situ NMR detection. As functions of hydration level, Gibbs free energy, enthalpy, and entropy of binding were determined from the temperature dependence of isotherms. Two types of alcohol binding were found. The dominant type is low-affinity nonspecific binding, which is strongly dependent on temperature and the level of hydration. At low hydration levels, this nonspecific binding only occurs above a threshold of alcohol vapor pressure. An increased hydration level reduces this threshold, with it finally disappearing at a hydration level of h~0.2 (g water/g protein), gradually shifting alcohol binding from an entropy-driven to an enthalpy-driven process. Water at charged and polar groups on the protein surface was found to be particularly important in enabling this binding. Although further increase in hydration has smaller effects on the changes of binding enthalpy and entropy, it results in significant negative change in Gibbs free energy due to unmatched enthalpy-entropy compensation. These results show the crucial role of water-protein interplay in alcohol binding. PMID:25856773

Dual structural transition in small nanoparticles of Cu-Au alloy

NASA Astrophysics Data System (ADS)

Gafner, Yuri; Gafner, Svetlana; Redel, Larisa; Zamulin, Ivan

2018-02-01

Cu-Au alloy nanoparticles are known to be widely used in the catalysis of various chemical reactions as it was experimentally defined that in many cases the partial substitution of copper with gold increases catalytic activity. However, providing the reaction capacity of alloy nanoparticles the surface electronic structure strongly depends on their atomic ordering. Therefore, to theoretically determine catalytic properties, one needs to use a most real structural model complying with Cu-Au nanoparticles under various external influences. So, thermal stability limits were studied for the initial L12 phase in Cu3Au nanoalloy clusters up to 8.0 nm and Cu-Au clusters up to 3.0 nm at various degrees of Au atom concentration, with molecular dynamics method using a modified tight-binding TB-SMA potential. Dual structural transition L12 → FCC and further FCC → Ih is shown to be possible under the thermal factor in Cu3Au and Cu-Au clusters with the diameter up to 3.0 nm. The temperature of the structural transition FCC → Ih is established to decrease for small particles of Cu-Au alloy under the increase of Au atom concentration. For clusters with this structural transition, the melting point is found to be a linear increasing function of concentration, and for clusters without FCC → Ih structural transition, the melting point is a linear decreasing function of Au content. Thus, the article shows that doping Cu nanoclusters with Au atoms allows to control the forming structure as well as the melting point.

Targeted entry of enveloped viruses: measles and herpes simplex virus I.

PubMed

Navaratnarajah, Chanakha K; Miest, Tanner S; Carfi, Andrea; Cattaneo, Roberto

2012-02-01

We compare the receptor-based mechanisms that a small RNA virus and a larger DNA virus have evolved to drive the fusion of viral and cellular membranes. Both systems rely on tight control over triggering the concerted refolding of a trimeric fusion protein. While measles virus entry depends on a receptor-binding protein and a fusion protein only, the herpes simplex virus (HSV) is more complex and requires four viral proteins. Nevertheless, in both viruses a receptor-binding protein is required for triggering the membrane fusion process. Moreover, specificity domains can be appended to these receptor-binding proteins to target virus entry to cells expressing a designated receptor. We discuss how principles established with measles and HSV can be applied to targeting other enveloped viruses, and alternatively how retargeted envelopes can be fitted on foreign capsids. Copyright © 2011 Elsevier B.V. All rights reserved.

An investigation of low ergonomics risk awareness, among staffs at early product development phase in Malaysia automotive industries

NASA Astrophysics Data System (ADS)

Aziz, Fazilah Abdul; Razali, Noraini; Najmiyah Jaafar, Nur

2016-02-01

Currently there are many automotive companies still unable to effectively prevent consequences of poor ergonomics in their manufacturing processes. This study purpose is to determine the surrounding factors that influence low ergonomics risk awareness among staffs at early product development phase in Malaysia automotive industry. In this study there are four variables, low ergonomic risk awareness, inappropriate method and tools, tight development schedule and lack of management support. The survey data were gathered from 245 respondents of local automotive companies in Malaysia. The data was analysed through multiple regression and moderated regression using the IBM SPSS software. Study results revealed that low ergonomic risk awareness has influenced by inappropriate method and tool, and tight development schedule. There were positive linear relationships between low ergonomic risk awareness and inappropriate method and tools, and tight development schedule. The more inappropriate method and tools applied; the lower their ergonomic risk awareness. The more tight development schedule is the lower ergonomic risk awareness. The relationship between low ergonomic risk awareness and inappropriate method and tools depends on staff's age, and education level. Furthermore the relationship between low ergonomic risk awareness and tight development schedule depends on staff's working experience and number of project involvement. The main contribution of this paper was identified the number of factors of low ergonomics risk awareness and offers better understanding on ergonomics among researchers and automotive manufacturer's employees during product development process.

Thermodynamics of cooperative binding of FAD to human NQO1: Implications to understanding cofactor-dependent function and stability of the flavoproteome.

PubMed

Clavería-Gimeno, Rafael; Velazquez-Campoy, Adrian; Pey, Angel Luis

2017-12-15

The stability of human flavoproteins strongly depends on flavin levels, although the structural and energetic basis of this relationship is poorly understood. Here, we report an in-depth analysis on the thermodynamics of FAD binding to one of the most representative examples of such relationship, NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a dimeric enzyme that tightly binds FAD, which triggers large structural changes upon binding. A common cancer-associated polymorphism (P187S) severely compromises FAD binding. We show that FAD binding is described well by a thermodynamic model explicitly incorporating binding cooperativity when applied to different sets of calorimetric analyses and NQO1 variants, thus providing insight on the effects in vitro and in cells of cancer-associated P187S, its suppressor mutation H80R and the role of NQO1 C-terminal domain to modulate binding cooperativity and energetics. Furthermore, we show that FAD binding to NQO1 is very sensitive to physiologically relevant environmental conditions, such as the presence of phosphate buffer and salts. Overall, our results contribute to understanding at the molecular level the link between NQO1 stability and fluctuations of FAD levels intracellularly, and supports the notion that FAD binding energetics and cooperativity are fundamentally linked with the dynamic nature of apo-NQO1 conformational ensemble. Copyright © 2017 Elsevier Inc. All rights reserved.

The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

PubMed

Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

2017-01-01

Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

Interface Schottky barrier engineering via strain in metal-semiconductor composites

NASA Astrophysics Data System (ADS)

Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao

2016-01-01

The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k

A new graphic plot analysis for determination of neuroreceptor binding in positron emission tomography studies.

PubMed

Ito, Hiroshi; Yokoi, Takashi; Ikoma, Yoko; Shidahara, Miho; Seki, Chie; Naganawa, Mika; Takahashi, Hidehiko; Takano, Harumasa; Kimura, Yuichi; Ichise, Masanori; Suhara, Tetsuya

2010-01-01

In positron emission tomography (PET) studies with radioligands for neuroreceptors, tracer kinetics have been described by the standard two-tissue compartment model that includes the compartments of nondisplaceable binding and specific binding to receptors. In the present study, we have developed a new graphic plot analysis to determine the total distribution volume (V(T)) and nondisplaceable distribution volume (V(ND)) independently, and therefore the binding potential (BP(ND)). In this plot, Y(t) is the ratio of brain tissue activity to time-integrated arterial input function, and X(t) is the ratio of time-integrated brain tissue activity to time-integrated arterial input function. The x-intercept of linear regression of the plots for early phase represents V(ND), and the x-intercept of linear regression of the plots for delayed phase after the equilibrium time represents V(T). BP(ND) can be calculated by BP(ND)=V(T)/V(ND)-1. Dynamic PET scanning with measurement of arterial input function was performed on six healthy men after intravenous rapid bolus injection of [(11)C]FLB457. The plot yielded a curve in regions with specific binding while it yielded a straight line through all plot data in regions with no specific binding. V(ND), V(T), and BP(ND) values calculated by the present method were in good agreement with those by conventional non-linear least-squares fitting procedure. This method can be used to distinguish graphically whether the radioligand binding includes specific binding or not.

Endoreversible quantum heat engines in the linear response regime.

PubMed

Wang, Honghui; He, Jizhou; Wang, Jianhui

2017-07-01

We analyze general models of quantum heat engines operating a cycle of two adiabatic and two isothermal processes. We use the quantum master equation for a system to describe heat transfer current during a thermodynamic process in contact with a heat reservoir, with no use of phenomenological thermal conduction. We apply the endoreversibility description to such engine models working in the linear response regime and derive expressions of the efficiency and the power. By analyzing the entropy production rate along a single cycle, we identify the thermodynamic flux and force that a linear relation connects. From maximizing the power output, we find that such heat engines satisfy the tight-coupling condition and the efficiency at maximum power agrees with the Curzon-Ahlborn efficiency known as the upper bound in the linear response regime.

Parallel/distributed direct method for solving linear systems

NASA Technical Reports Server (NTRS)

Lin, Avi

1990-01-01

A new family of parallel schemes for directly solving linear systems is presented and analyzed. It is shown that these schemes exhibit a near optimal performance and enjoy several important features: (1) For large enough linear systems, the design of the appropriate paralleled algorithm is insensitive to the number of processors as its performance grows monotonically with them; (2) It is especially good for large matrices, with dimensions large relative to the number of processors in the system; (3) It can be used in both distributed parallel computing environments and tightly coupled parallel computing systems; and (4) This set of algorithms can be mapped onto any parallel architecture without any major programming difficulties or algorithmical changes.

Thermodynamic stability of carbonic anhydrase: measurements of binding affinity and stoichiometry using ThermoFluor.

PubMed

Matulis, Daumantas; Kranz, James K; Salemme, F Raymond; Todd, Matthew J

2005-04-05

ThermoFluor (a miniaturized high-throughput protein stability assay) was used to analyze the linkage between protein thermal stability and ligand binding. Equilibrium binding ligands increase protein thermal stability by an amount proportional to the concentration and affinity of the ligand. Binding constants (K(b)) were measured by examining the systematic effect of ligand concentration on protein stability. The precise ligand effects depend on the thermodynamics of protein stability: in particular, the unfolding enthalpy. An extension of current theoretical treatments was developed for tight binding inhibitors, where ligand effect on T(m) can also reveal binding stoichiometry. A thermodynamic analysis of carbonic anhydrase by differential scanning calorimetry (DSC) enabled a dissection of the Gibbs free energy of stability into enthalpic and entropic components. Under certain conditions, thermal stability increased by over 30 degrees C; the heat capacity of protein unfolding was estimated from the dependence of calorimetric enthalpy on T(m). The binding affinity of six sulfonamide inhibitors to two isozymes (human type 1 and bovine type 2) was analyzed by both ThermoFluor and isothermal titration calorimetry (ITC), resulting in a good correlation in the rank ordering of ligand affinity. This combined investigation by ThermoFluor, ITC, and DSC provides a detailed picture of the linkage between ligand binding and protein stability. The systematic effect of ligands on stability is shown to be a general tool to measure affinity.

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

PubMed

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

2014-08-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

PubMed Central

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix

2014-01-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

PubMed Central

Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

1999-01-01

Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307

Interaction of nitric oxide with human heme oxygenase-1.

PubMed

Wang, Jinling; Lu, Shen; Moënne-Loccoz, Pierre; Ortiz de Montellano, Paul R

2003-01-24

NO and CO may complement each other as signaling molecules in some physiological situations. We have examined the binding of NO to human heme oxygenase-1 (hHO-1), an enzyme that oxidizes heme to biliverdin, CO, and free iron, to determine whether inhibition of hHO-1 by NO can contribute to the signaling interplay of NO and CO. An Fe(3+)-NO hHO-1-heme complex is formed with NO or the NO donors NOC9 or 2-(N,N-diethylamino)-diazenolate-2-oxide.sodium salt. Resonance Raman spectroscopy shows that ferric hHO-1-heme forms a 6-coordinated, low spin complex with NO. The nu(N-O) vibration of this complex detected by Fourier transform IR is only 4 cm(-1) lower than that of the corresponding metmyoglobin (met-Mb) complex but is broader, suggesting a greater degree of ligand conformational freedom. The Fe(3+)-NO complex of hHO-1 is much more stable than that of met-Mb. Stopped-flow studies indicate that k(on) for formation of the hHO-1-heme Fe(3+)-NO complex is approximately 50-times faster, and k(off) 10 times slower, than for met-Mb, resulting in K(d) = 1.4 microm for NO. NO thus binds 500-fold more tightly to ferric hHO-1-heme than to met-Mb. The hHO-1 mutations E29A, G139A, D140A, S142A, G143A, G143F, and K179A/R183A do not significantly diminish the tight binding of NO, indicating that NO binding is not highly sensitive to mutations of residues that normally stabilize the distal water ligand. As expected from the K(d) value, the enzyme is reversibly inhibited upon exposure to pathologically, and possibly physiologically, relevant concentrations of NO. Inhibition of hHO-1 by NO may contribute to the pleiotropic responses to NO and CO.

Use of procainamide gels in the purification of human and horse serum cholinesterases.

PubMed Central

Ralston, J S; Main, A R; Kilpatrick, B F; Chasson, A L

1983-01-01

Two large-scale methods based primarily on the use of procainamide-Sepharose gels were developed for the purification of horse and human serum non-specific cholinesterases. With method I, the procainamide-Sepharose 4B gel was used in the first step to handle large volumes of serum. With method II, the procainamide-Sepharose 4B gel was used in the final step to obtain pure enzyme. Although both methods gave electrophoretically pure cholinesterase preparations in good yields, they were significantly more efficient at purifying the horse enzyme than the human enzyme. To study this problem, the relative binding of human and horse cholinesterases to procainamide-, methylacridinium (MAC)-, m-trimethylammoniophenyl (m-PTA)- and p-trimethylammoniophenyl (p-PTA)-Sepharose 4B gels were measured, by using two approaches. In one, binding was measured by a procedure involving equilibration of pure cholinesterase in a small volume of diluted gel slurry (4%, v/v). A partially purified preparation of Electrophorus acetylcholinesterase was included. Pure human cholinesterase bound consistently more tightly to each of the gels than did horse cholinesterase, and the acetylcholinesterase appeared to bind the gels 10-100 times more tightly than did the non-specific cholinesterases. The order of binding for the cholinesterases, beginning with the tightest, was: procainamide-Sepharose 4B, MAC-Sepharose 4B, p-PTA-Sepharose 4B and m-PTA-Sepharose 4B. For the acetylcholinesterase the order was: MAC-Sepharose 4B, procainamide-Sepharose 4B, p-PTA-Sepharose 4B and m-PTA-Sepharose 4B. The second approach involved passing native sera or partially purified sera fractions through 1 ml test columns of each of the four affinity gels to determine their retention capacity for the cholinesterases. With these impure samples, the MAC-Sepharose 4B gels proved superior to the procainamide-Sepharose 4B gels at retaining human cholinesterase, but the opposite was true for the horse cholinesterase. PMID:6870822

Mutation-linked, excessively tight interaction between the calmodulin binding domain and the C-terminal domain of the cardiac ryanodine receptor as a novel cause of catecholaminergic polymorphic ventricular tachycardia.

PubMed

Nishimura, Shigehiko; Yamamoto, Takeshi; Nakamura, Yoshihide; Kohno, Michiaki; Hamada, Yoriomi; Sufu, Yoko; Fukui, Go; Nanno, Takuma; Ishiguchi, Hironori; Kato, Takayoshi; Xu, Xiaojuan; Ono, Makoto; Oda, Tetsuro; Okuda, Shinichi; Kobayashi, Shigeki; Yano, Masafumi

2018-06-01

Ryanodine receptor (RyR2) is known to be a causal gene of catecholaminergic polymorphic ventricular tachycardia (CPVT), an important inherited disease. Some of the human CPVT-associated mutations have been found in a domain (4026-4172) that has EF hand motifs, the so-called calmodulin (CaM)-like domain (CaMLD). The purpose of this study was to investigate the underlying mechanism by which CPVT is induced by a mutation at CaMLD. A new N4103K/+ knock-in (KI) mice model was generated. Sustained ventricular tachycardia was frequently observed after infusion of caffeine plus epinephrine in KI mice. Endogenous CaM bound to RyR2 decreased even at baseline in isolated KI cardiomyocytes. Ca 2+ spark frequency (CaSpF) was much higher in KI cells than in wild-type cells. Addition of GSH-CaM (higher affinity CaM to RyR2) significantly decreased CaSpF. In response to isoproterenol, spontaneous Ca 2+ transient (SCaT) was frequently observed in intact KI cells. Incorporation of GSH-CaM into intact KI cells using a protein delivery kit decreased SCaT significantly. An assay using a quartz crystal microbalance technique revealed that mutated CaMLD peptide showed higher binding affinity to CaM binding domain (CaMBD) peptide. In the N4103K mutant, CaM binding affinity to RyR2 was significantly reduced regardless of beta-adrenergic stimulation. We found that this was caused by an abnormally tight interaction between CaMBD and mutated CaM-like domain (N4103K-CaMBD). Thus, CaMBD-CaMLD interaction may be a novel therapeutic target for treatment of lethal arrhythmia. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

The role of apical cell-cell junctions and associated cytoskeleton in mechanotransduction.

PubMed

Sluysmans, Sophie; Vasileva, Ekaterina; Spadaro, Domenica; Shah, Jimit; Rouaud, Florian; Citi, Sandra

2017-04-01

Tissues of multicellular organisms are characterised by several types of specialised cell-cell junctions. In vertebrate epithelia and endothelia, tight and adherens junctions (AJ) play critical roles in barrier and adhesion functions, and are connected to the actin and microtubule cytoskeletons. The interaction between junctions and the cytoskeleton is crucial for tissue development and physiology, and is involved in the molecular mechanisms governing cell shape, motility, growth and signalling. The machineries which functionally connect tight and AJ to the cytoskeleton comprise proteins which either bind directly to cytoskeletal filaments, or function as adaptors for regulators of the assembly and function of the cytoskeleton. In the last two decades, specific cytoskeleton-associated junctional molecules have been implicated in mechanotransduction, revealing the existence of multimolecular complexes that can sense mechanical cues and translate them into adaptation to tensile forces and biochemical signals. Here, we summarise the current knowledge about the machineries that link tight and AJ to actin filaments and microtubules, and the molecular basis for mechanotransduction at epithelial and endothelial AJ. © 2017 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.

Prediction and analysis of beta-turns in proteins by support vector machine.

PubMed

Pham, Tho Hoan; Satou, Kenji; Ho, Tu Bao

2003-01-01

Tight turn has long been recognized as one of the three important features of proteins after the alpha-helix and beta-sheet. Tight turns play an important role in globular proteins from both the structural and functional points of view. More than 90% tight turns are beta-turns. Analysis and prediction of beta-turns in particular and tight turns in general are very useful for the design of new molecules such as drugs, pesticides, and antigens. In this paper, we introduce a support vector machine (SVM) approach to prediction and analysis of beta-turns. We have investigated two aspects of applying SVM to the prediction and analysis of beta-turns. First, we developed a new SVM method, called BTSVM, which predicts beta-turns of a protein from its sequence. The prediction results on the dataset of 426 non-homologous protein chains by sevenfold cross-validation technique showed that our method is superior to the other previous methods. Second, we analyzed how amino acid positions support (or prevent) the formation of beta-turns based on the "multivariable" classification model of a linear SVM. This model is more general than the other ones of previous statistical methods. Our analysis results are more comprehensive and easier to use than previously published analysis results.

Linear Scaling of the Exciton Binding Energy versus the Band Gap of Two-Dimensional Materials

NASA Astrophysics Data System (ADS)

Choi, Jin-Ho; Cui, Ping; Lan, Haiping; Zhang, Zhenyu

2015-08-01

The exciton is one of the most crucial physical entities in the performance of optoelectronic and photonic devices, and widely varying exciton binding energies have been reported in different classes of materials. Using first-principles calculations within the G W -Bethe-Salpeter equation approach, here we investigate the excitonic properties of two recently discovered layered materials: phosphorene and graphene fluoride. We first confirm large exciton binding energies of, respectively, 0.85 and 2.03 eV in these systems. Next, by comparing these systems with several other representative two-dimensional materials, we discover a striking linear relationship between the exciton binding energy and the band gap and interpret the existence of the linear scaling law within a simple hydrogenic picture. The broad applicability of this novel scaling law is further demonstrated by using strained graphene fluoride. These findings are expected to stimulate related studies in higher and lower dimensions, potentially resulting in a deeper understanding of excitonic effects in materials of all dimensionalities.

Exploiting hydrogen bonding interactions to probe smaller linear and cyclic diamines binding to G-quadruplexes: a DFT and molecular dynamics study.

PubMed

Kanti Si, Mrinal; Sen, Anik; Ganguly, Bishwajit

2017-05-10

G-quadruplexes are formed by the association of four guanine bases through Hoogsteen hydrogen bonding in guanine-rich sequences of DNA and exist in the telomere as well as in promoter regions of certain oncogenes. The sequences of G-quadruplex-DNA are targets for the design of molecules that can bind and can be developed as anti-cancer drugs. The linear and cyclic protonated diamines have been explored to bind to G-quadruplex-DNA through hydrogen bonding interactions. The quadruplex-DNA binders exploit π-stacking and hydrogen bonding interactions with the phosphate backbone of loops and grooves. In this study, linear and cyclic protonated diamines showed remarkable binding affinity for G-tetrads using hydrogen bonding interactions. The DFT M06-2X/6-31G(d)//B3LYP/6-31+G(d) level of theory showed that the cyclic ee-1,2-CHDA (equatorial-equatorial form of 1,2-disubstituted cyclohexadiamine di-cation) binds to the G-tetrads very strongly (∼70.0 kcal mol -1 ), with a much higher binding energy than the linear protonated diamines. The binding affinity of ligands for G-tetrads with counterions has also been examined. The binding preference of these small ligands for G-tetrads is higher than for DNA-duplex. The binding affinity of an intercalated acridine-based ligand (BRACO-19) for G-quadruplexes has been examined and the binding energy is relatively lower than that for the 1,2 disubstituted cyclohexadiamine di-cation with G-tetrads. The atoms-in-molecules (AIM) analysis reveals that the hydrogen bonding interactions between the organic systems with G-tetrads are primarily electrostatic in nature. The molecular dynamics simulations performed using a classical force field (GROMACS) also supported the phosphate backbone sites of G-quadruplex-DNA to bind to these diamines. To mimic the structural pattern of BRACO-19, the designed inhibitor N,2-bis-2(3,4-aminocyclohexyl) acetamide (9) examined possesses two 1,2-CHDA moieties linked through an acetamide group. The molecular dynamics results showed that the designed molecule 9 can efficiently bind to the base-pairs and the phosphate backbone of G quadruplex-DNA using H-bonding interactions. The binding affinity calculated for the intercalated acridine-based drug (BRACO-19) with G-quadruplexes is weaker compared to ee-1,2-CHDA. These ligands deliver a different binding motif (hydrogen bonding) compared to the reported G-quadruplex binders of π-delocalized systems and will kindle interest in examining such scaffolds to stabilize DNA.

Dynamics simulations for engineering macromolecular interactions

NASA Astrophysics Data System (ADS)

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.

Dynamics simulations for engineering macromolecular interactions.

PubMed

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20,000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.

Improved Density Functional Tight Binding Potentials for Metalloid Aluminum Clusters

DTIC Science & Technology

2016-06-01

simulations of the oxidation of Al4Cp * 4 show reasonable comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers...comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers from Cp* to the metal centers during the...initio molecular dynamics of the oxidation of Al4Cp * 4 using a DFT-based Car -Parrinello method. This simulation, which 43 several months on the

Genome-wide overlap in the binding location and function of chromatin-remodeling proteins | Center for Cancer Research

Cancer.gov

A single strand of DNA can stretch several meters. Yet dozens of these strands, which can be one-tenth as thin as a human hair, need to fit into the cell’s nucleus. To pack those strands into such a small space, DNA tightly winds itself around histone proteins, forming nucleosomes that are strung together into complexes called chromatin. Beyond efficiently packaging DNA,

Electronic properties of Bilayer Fullerene onions

NASA Astrophysics Data System (ADS)

Pincak, R.; Shunaev, V. V.; Smotlacha, J.; Slepchenkov, M. M.; Glukhova, O. E.

2017-10-01

The HOMO-LUMO gaps of the bilayer fullerene onions were investigated. For this purpose, the HOMO and LUMO energies were calculated for the isolated fullerenes using the parametrization of the tight binding method with the Harrison-Goodwin modification. Next, the difference of the Fermi levels of the outer and inner shell was calculated by considering the hybridization of the orbitals on the base of the geometric parameters. The results were obtained by the combination of these calculations.

Trans-polyacetylene within the extended tight-binding picture and evidence for next-nearest neighbour hopping from the dispersion of interband transition edges

NASA Astrophysics Data System (ADS)

Drechsler, S. L.; Heiner, E.; Osipov, V. A.

1986-11-01

The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.

Biological Activities of Fusarochromanone: a Potent Anti-cancer Agent

DTIC Science & Technology

2014-09-03

experiments to more fully elucidate the detailed mechanism underlying this favorable feature of FC101. Like most other bioactive natural flavonoids , FC101...tribution, metabolism, and elimination of compounds in blood and tissues over time. FC101 is a flavonoid , and over 4,000 natural compounds have been... Flavonoids generally bind tightly to serum proteins (e.g., serum albumin) and thus substantial amounts are inaccessible to the desired bio- logical targets

Structures of Aln (n= 27, 28, 29, and 30) clusters with double-tetrahedron structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, W.; Lu, W. C.; Sun, J.

2008-01-31

Global search for lowest-energy structures of neutral aluminum clusters Al{sub n} (n = 27, 28, 29 and 30) was performed using a genetic algorithm (GA) coupled with a tight-binding (TB) method. Structural candidates obtained from our GA search were further optimized with first-principles calculations. It is found that the medium-sized aluminum clusters Al{sub 27} to Al{sub 30} favor double-tetrahedron structures.

Electronic transport in methylated fragments of DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.

2015-11-16

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

Electronic transport in methylated fragments of DNA

NASA Astrophysics Data System (ADS)

de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

2015-11-01

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

Glucocorticoids induce transactivation of tight junction genes occludin and claudin-5 in retinal endothelial cells via a novel cis-element.

PubMed

Felinski, Edward A; Cox, Amy E; Phillips, Brett E; Antonetti, David A

2008-06-01

Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205bp sequence responsible for the glucocorticoid response. However, this region does not possess a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40bp occludin enhancer element (OEE), containing two highly conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression.

GLUCOCORTICOIDS INDUCE TRANSACTIVATION OF TIGHT JUNCTION GENES OCCLUDIN AND CLAUDIN-5 IN RETINAL ENDOTHELIAL CELLS VIA A NOVEL CIS-ELEMENT

PubMed Central

Felinski, Edward A.; Cox, Amy E.; Phillips, Brett E.; Antonetti, David A.

2008-01-01

Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205 bp sequence responsible for the glucocorticoid response. However, this region does not posses a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40 bp occludin enhancer element (OEE), containing two highly-conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression. PMID:18501346

Uptake of /sup 75/Se-selenite by brush border membrane vesicles from chick duodenum stimulated by vitamin D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mykkanen, H.M.; Wasserman, R.H.

1989-02-01

Brush border membrane vesicles were isolated from mucosal homogenates of duodena from normal, rachitic and vitamin D-treated rachitic chicks using a discontinuous sucrose gradient, and further purified by glycerol gradient centrifugation. In vitro uptake of 75Se-selenite by purified brush border membrane vesicles was studied using a rapid filtration technique. The time course of 75Se uptake was non-linear; rapid initial binding was followed by a gradual decrease in the rate of uptake until an equilibrium value was reached at 60-120 min. The initial binding at 36 s was not affected by selenite concentration in the incubation buffer, while the fractional ratemore » of uptake between the 36 s and 2 min time periods was clearly lower with 1 mM Se than with 4-100 microM Se. 75Se uptake did not show any dependency on the external Na-gradient, nor could it be inhibited by other anions (arsenate, phosphate). Treatment of rachitic chicks either with cholecalciferol (500 Iu, 72 h) or with 1,25(OH)2-cholecalciferol (0.5 microgram given 16 h prior to isolation of the vesicles) significantly enhanced 75Se uptake. A threefold excess of mannitol in the outside buffer reduced 75Se uptake by vesicles from vitamin D-deficient and D-treated chicks 60% and 35% respectively, but had no effect on vesicles from vitamin D-treated chicks preloaded with 75Se. Neither saponin treatment nor excess cold selenite could release the label from the vesicles preloaded with 75Se. These data are compatible with the hypothesis that selenite easily crosses the brush border membrane into the intravesicular space and, once inside, is tightly bound by the membrane.« less

Signatures of Pleiotropy, Economy and Convergent Evolution in a Domain-Resolved Map of Human–Virus Protein–Protein Interaction Networks

PubMed Central

Garamszegi, Sara; Franzosa, Eric A.; Xia, Yu

2013-01-01

A central challenge in host-pathogen systems biology is the elucidation of general, systems-level principles that distinguish host-pathogen interactions from within-host interactions. Current analyses of host-pathogen and within-host protein-protein interaction networks are largely limited by their resolution, treating proteins as nodes and interactions as edges. Here, we construct a domain-resolved map of human-virus and within-human protein-protein interaction networks by annotating protein interactions with high-coverage, high-accuracy, domain-centric interaction mechanisms: (1) domain-domain interactions, in which a domain in one protein binds to a domain in a second protein, and (2) domain-motif interactions, in which a domain in one protein binds to a short, linear peptide motif in a second protein. Analysis of these domain-resolved networks reveals, for the first time, significant mechanistic differences between virus-human and within-human interactions at the resolution of single domains. While human proteins tend to compete with each other for domain binding sites by means of sequence similarity, viral proteins tend to compete with human proteins for domain binding sites in the absence of sequence similarity. Independent of their previously established preference for targeting human protein hubs, viral proteins also preferentially target human proteins containing linear motif-binding domains. Compared to human proteins, viral proteins participate in more domain-motif interactions, target more unique linear motif-binding domains per residue, and contain more unique linear motifs per residue. Together, these results suggest that viruses surmount genome size constraints by convergently evolving multiple short linear motifs in order to effectively mimic, hijack, and manipulate complex host processes for their survival. Our domain-resolved analyses reveal unique signatures of pleiotropy, economy, and convergent evolution in viral-host interactions that are otherwise hidden in the traditional binary network, highlighting the power and necessity of high-resolution approaches in host-pathogen systems biology. PMID:24339775

Signatures of pleiotropy, economy and convergent evolution in a domain-resolved map of human-virus protein-protein interaction networks.

PubMed

Garamszegi, Sara; Franzosa, Eric A; Xia, Yu

2013-01-01

A central challenge in host-pathogen systems biology is the elucidation of general, systems-level principles that distinguish host-pathogen interactions from within-host interactions. Current analyses of host-pathogen and within-host protein-protein interaction networks are largely limited by their resolution, treating proteins as nodes and interactions as edges. Here, we construct a domain-resolved map of human-virus and within-human protein-protein interaction networks by annotating protein interactions with high-coverage, high-accuracy, domain-centric interaction mechanisms: (1) domain-domain interactions, in which a domain in one protein binds to a domain in a second protein, and (2) domain-motif interactions, in which a domain in one protein binds to a short, linear peptide motif in a second protein. Analysis of these domain-resolved networks reveals, for the first time, significant mechanistic differences between virus-human and within-human interactions at the resolution of single domains. While human proteins tend to compete with each other for domain binding sites by means of sequence similarity, viral proteins tend to compete with human proteins for domain binding sites in the absence of sequence similarity. Independent of their previously established preference for targeting human protein hubs, viral proteins also preferentially target human proteins containing linear motif-binding domains. Compared to human proteins, viral proteins participate in more domain-motif interactions, target more unique linear motif-binding domains per residue, and contain more unique linear motifs per residue. Together, these results suggest that viruses surmount genome size constraints by convergently evolving multiple short linear motifs in order to effectively mimic, hijack, and manipulate complex host processes for their survival. Our domain-resolved analyses reveal unique signatures of pleiotropy, economy, and convergent evolution in viral-host interactions that are otherwise hidden in the traditional binary network, highlighting the power and necessity of high-resolution approaches in host-pathogen systems biology.

RNA-dependent RNA polymerase of hepatitis C virus binds to its coding region RNA stem-loop structure, 5BSL3.2, and its negative strand.

PubMed

Kanamori, Hiroshi; Yuhashi, Kazuhito; Ohnishi, Shin; Koike, Kazuhiko; Kodama, Tatsuhiko

2010-05-01

The hepatitis C virus NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme involved in viral replication. Interaction between NS5B RdRp and the viral RNA sequence is likely to be an important step in viral RNA replication. The C-terminal half of the NS5B-coding sequence, which contains the important cis-acting replication element, has been identified as an NS5B-binding sequence. In the present study, we confirm the specific binding of NS5B to one of the RNA stem-loop structures in the region, 5BSL3.2. In addition, we show that NS5B binds to the complementary strand of 5BSL3.2 (5BSL3.2N). The bulge structure of 5BSL3.2N was shown to be indispensable for tight binding to NS5B. In vitro RdRp activity was inhibited by 5BSL3.2N, indicating the importance of the RNA element in the polymerization by RdRp. These results suggest the involvement of the RNA stem-loop structure of the negative strand in the replication process.

Structure of a Glomulin-RBX1-CUL1 complex: inhibition of a RING E3 ligase through masking of its E2-binding surface

PubMed Central

Duda, David M.; Olszewski, Jennifer L.; Tron, Adriana E.; Hammel, Michal; Lambert, Lester J.; Waddell, M. Brett; Mittag, Tanja; DeCaprio, James A.; Schulman, Brenda A.

2012-01-01

Summary The ~300 human Cullin-RING ligases (CRLs) are multisubunit E3s in which a RING protein, either RBX1 or RBX2, recruits an E2 to catalyze ubiquitination. RBX1-containing CRLs also can bind Glomulin (GLMN), which binds RBX1’s RING domain, regulates the RBX1-CUL1-containing SCFFBW7 complex, and is disrupted in the disease Glomuvenous Malformation. Here we report the crystal structure of a complex between GLMN, RBX1, and a fragment of CUL1. Structural and biochemical analyses reveal that GLMN adopts a HEAT-like repeat fold that tightly binds the E2-interacting surface of RBX1, inhibiting CRL-mediated chain formation by the E2 CDC34. The structure explains the basis for GLMN’s selectivity toward RBX1 over RBX2, and how disease-associated mutations disrupt GLMN-RBX1 interactions. Our study reveals a mechanism for RING E3 ligase regulation whereby an inhibitor blocks E2 access, and raises the possibility that other E3s are likewise controlled by cellular proteins that mask E2-binding surfaces to mediate inhibition. PMID:22748924

Biocompatible medical implant materials with binding sites for a biodegradable drug-delivery system

PubMed Central

Al-Dubai, Haifa; Pittner, Gisela; Pittner, Fritz; Gabor, Franz

2011-01-01

Feasibility studies have been carried out for development of a biocompatible coating of medical implant materials allowing the binding of biodegradable drug-delivery systems in a way that their reloading might be possible. These novel coatings, able to bind biodegradable nanoparticles, may serve in the long run as drug carriers to mediate local pharmacological activity. After biodegradation of the nanoparticles, the binding sites could be reloaded with fresh drug-delivering particles. As a suitable receptor system for the nanoparticles, antibodies are anchored. The design of the receptor is of great importance as any bio- or chemorecognitive interaction with other components circulating in the blood has to be avoided. Furthermore, the binding between receptor and the particles has to be strong enough to keep them tightly bound during their lifetime, but on the other hand allow reloading after final degradation of the particles. The nanoparticles suggested as a drug-delivery system for medical implants can be loaded with different pharmaceuticals such as antibiotics, growth factors, or immunosuppressives. This concept may enable the changing of medication, even after implantation of the medical device, if afforded by patients’ needs. PMID:24198488

Simplified biased random walk model for RecA-protein-mediated homology recognition offers rapid and accurate self-assembly of long linear arrays of binding sites

NASA Astrophysics Data System (ADS)

Kates-Harbeck, Julian; Tilloy, Antoine; Prentiss, Mara

2013-07-01

Inspired by RecA-protein-based homology recognition, we consider the pairing of two long linear arrays of binding sites. We propose a fully reversible, physically realizable biased random walk model for rapid and accurate self-assembly due to the spontaneous pairing of matching binding sites, where the statistics of the searched sample are included. In the model, there are two bound conformations, and the free energy for each conformation is a weakly nonlinear function of the number of contiguous matched bound sites.

Structure-based optimization of Cephalothin-analogue boronic acids as β-lactamase inhibitors

PubMed Central

Morandi, Stefania; Morandi, Federica; Caselli, Emilia; Shoichet, Brian K.; Prati, Fabio

2008-01-01

Boronic acids have proved to be promising selective inhibitors of β-lactamases, acting as transition state analogues. Starting from a previously described nanomolar inhibitor of AmpC β-lactamase, three new inhibitors were designed to gain interactions with highly conserved residues, such as Asn343, and to bind more tightly to the enzyme. Among these, one was obtained by stereoselective synthesis and succeeded in placing its anionic group into the carboxylate binding site of the enzyme, as revealed by X-ray crystallography of the complex inhibitor/AmpC. Nevertheless, it failed at improving affinity, when compared to the lead from which it was derived. The origins of this structural and energetic discrepancy are discussed. PMID:17997318

Molecular Bases of cyclodextrin Adapter Interactions with Engineered Protein Nanopores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, A.; Mikhailova, E; Cheley, S

2010-01-01

Engineered protein pores have several potential applications in biotechnology: as sensor elements in stochastic detection and ultrarapid DNA sequencing, as nanoreactors to observe single-molecule chemistry, and in the construction of nano- and micro-devices. One important class of pores contains molecular adapters, which provide internal binding sites for small molecules. Mutants of the {alpha}-hemolysin ({alpha}HL) pore that bind the adapter {beta}-cyclodextrin ({beta}CD) {approx}10{sup 4} times more tightly than the wild type have been obtained. We now use single-channel electrical recording, protein engineering including unnatural amino acid mutagenesis, and high-resolution x-ray crystallography to provide definitive structural information on these engineered protein nanoporesmore » in unparalleled detail.« less

Tight Junction–Associated Signaling Pathways Modulate Cell Proliferation in Uveal Melanoma

PubMed Central

Jayagopal, Ashwath; Yang, Jin-Long; Haselton, Frederick R.; Chang, Min S.

2011-01-01

Purpose. To investigate the role of tight junction (TJ)–associated signaling pathways in the proliferation of uveal melanoma. Methods. Human uveal melanoma cell lines overexpressing the TJ molecule blood vessel epicardial substance (Bves) were generated. The effects of Bves overexpression on TJ protein expression, cell proliferation, and cell cycle distribution were quantified. In addition, localization and transcription activity of the TJ-associated protein ZO-1–associated nucleic acid binding protein (ZONAB) were evaluated using immunofluorescence and bioluminescence reporter assays to study the involvement of Bves signaling in cell proliferation-associated pathways. Results. Bves overexpression in uveal melanoma cell lines resulted in increased expression of the TJ proteins occludin and ZO-1, reduced cell proliferation, and increased sequestration of ZONAB at TJs and reduced ZONAB transcriptional activity. Conclusions. TJ proteins are present in uveal melanoma, and TJ-associated signaling pathways modulate cell signaling pathways relevant to proliferation in uveal melanoma. PMID:20861479

Measurement of Nanomolar Dissociation Constants by Titration Calorimetry and Thermal Shift Assay – Radicicol Binding to Hsp90 and Ethoxzolamide Binding to CAII

PubMed Central

Zubrienė, Asta; Matulienė, Jurgita; Baranauskienė, Lina; Jachno, Jelena; Torresan, Jolanta; Michailovienė, Vilma; Cimmperman, Piotras; Matulis, Daumantas

2009-01-01

The analysis of tight protein-ligand binding reactions by isothermal titration calorimetry (ITC) and thermal shift assay (TSA) is presented. The binding of radicicol to the N-terminal domain of human heat shock protein 90 (Hsp90αN) and the binding of ethoxzolamide to human carbonic anhydrase (hCAII) were too strong to be measured accurately by direct ITC titration and therefore were measured by displacement ITC and by observing the temperature-denaturation transitions of ligand-free and ligand-bound protein. Stabilization of both proteins by their ligands was profound, increasing the melting temperature by more than 10 ºC, depending on ligand concentration. Analysis of the melting temperature dependence on the protein and ligand concentrations yielded dissociation constants equal to 1 nM and 2 nM for Hsp90αN-radicicol and hCAII-ethoxzolamide, respectively. The ligand-free and ligand-bound protein fractions melt separately, and two melting transitions are observed. This phenomenon is especially pronounced when the ligand concentration is equal to about half the protein concentration. The analysis compares ITC and TSA data, accounts for two transitions and yields the ligand binding constant and the parameters of protein stability, including the Gibbs free energy and the enthalpy of unfolding. PMID:19582223

Conformational dynamics of a G-protein α subunit is tightly regulated by nucleotide binding.

PubMed

Goricanec, David; Stehle, Ralf; Egloff, Pascal; Grigoriu, Simina; Plückthun, Andreas; Wagner, Gerhard; Hagn, Franz

2016-06-28

Heterotrimeric G proteins play a pivotal role in the signal-transduction pathways initiated by G-protein-coupled receptor (GPCR) activation. Agonist-receptor binding causes GDP-to-GTP exchange and dissociation of the Gα subunit from the heterotrimeric G protein, leading to downstream signaling. Here, we studied the internal mobility of a G-protein α subunit in its apo and nucleotide-bound forms and characterized their dynamical features at multiple time scales using solution NMR, small-angle X-ray scattering, and molecular dynamics simulations. We find that binding of GTP analogs leads to a rigid and closed arrangement of the Gα subdomain, whereas the apo and GDP-bound forms are considerably more open and dynamic. Furthermore, we were able to detect two conformational states of the Gα Ras domain in slow exchange whose populations are regulated by binding to nucleotides and a GPCR. One of these conformational states, the open state, binds to the GPCR; the second conformation, the closed state, shows no interaction with the receptor. Binding to the GPCR stabilizes the open state. This study provides an in-depth analysis of the conformational landscape and the switching function of a G-protein α subunit and the influence of a GPCR in that landscape.

Conformational dynamics of a G-protein α subunit is tightly regulated by nucleotide binding

PubMed Central

Goricanec, David; Stehle, Ralf; Egloff, Pascal; Grigoriu, Simina; Wagner, Gerhard; Hagn, Franz

2016-01-01

Heterotrimeric G proteins play a pivotal role in the signal-transduction pathways initiated by G-protein–coupled receptor (GPCR) activation. Agonist–receptor binding causes GDP-to-GTP exchange and dissociation of the Gα subunit from the heterotrimeric G protein, leading to downstream signaling. Here, we studied the internal mobility of a G-protein α subunit in its apo and nucleotide-bound forms and characterized their dynamical features at multiple time scales using solution NMR, small-angle X-ray scattering, and molecular dynamics simulations. We find that binding of GTP analogs leads to a rigid and closed arrangement of the Gα subdomain, whereas the apo and GDP-bound forms are considerably more open and dynamic. Furthermore, we were able to detect two conformational states of the Gα Ras domain in slow exchange whose populations are regulated by binding to nucleotides and a GPCR. One of these conformational states, the open state, binds to the GPCR; the second conformation, the closed state, shows no interaction with the receptor. Binding to the GPCR stabilizes the open state. This study provides an in-depth analysis of the conformational landscape and the switching function of a G-protein α subunit and the influence of a GPCR in that landscape. PMID:27298341

Preparation and DNA-binding properties of substituted triostin antibiotics.

PubMed

Cornish, A; Fox, K R; Waring, M J

1983-02-01

Novel derivatives of the triostin group of antibiotics were prepared by supplementing cultures of the producing organism Streptomyces triostinicus with a variety of aromatic carboxylic acids. Five new antibiotics, each having both the natural quinoxaline chromophores replaced by a substituted ring system, were purified to homogeneity and characterized by high-pressure liquid chromatography and nuclear magnetic resonance. Their antibacterial activities and DNA-binding properties were investigated. Addition of a halogen atom at position 6 of the quinoxaline ring or an amino group at position 3 had little effect on either the biological activity or the DNA-binding characteristics. The bis-3-amino derivative is fluorescent, and its fluorescence is strongly quenched by calf thymus DNA and polydeoxyguanylate-polydeoxycytidylate but not by polydeoxyadenylate-polydeoxythymidylate, suggesting that it binds preferentially to guanosine-cytosine-rich sequences in natural DNA. Binding constants for the bis-6-chloro and bis-3-amino derivatives do not differ greatly from those of unsubstituted triostin A. The analogs having two quinoline chromophores or a chlorine atom in position 7 of the quinoxaline ring display little or no detectable antibacterial activity, in marked contrast to the other congeners. Bis-7-chloro-triostin A binds conspicuously more tightly to polydeoxyadenylate-polydeoxythymidylate than to any other polynucleotide tested.

Response of SCP-2L domain of human MFE-2 to ligand removal: binding site closure and burial of peroxisomal targeting signal.

PubMed

Lensink, M F; Haapalainen, A M; Hiltunen, J K; Glumoff, T; Juffer, A H

2002-10-11

In the study of the structure and function relationship of human MFE-2, we have investigated the dynamics of human MFE-2SCP-2L (hSCP-2L) and its response to ligand removal. A comparison was made with homologous rabbit SCP-2. Breathing and a closing motion are found, identifiable with an adjustment in size and a closing off of the binding pocket. Crucial residues for structural integrity have been identified. Particularly mobile areas of the protein are loop 1 that is connecting helices A and C in space, and helix D, next to the entrance of the pocket. In hSCP-2L, the binding pocket gets occupied by Phe93, which is making a tight hydrophobic contact with Trp36. In addition, it is found that the C-terminal peroxisomal targeting signal (PTS1) that is solvent exposed in the complexed structure becomes buried when no ligand is present. Moreover, an anti-correlation exists between burial of PTS1 and the size of the binding pocket. The results are in accordance with plant nsLTPs, where a similar accommodation of binding pocket size was found after ligand binding/removal. Furthermore, the calculations support the suggestion of a ligand-assisted targeting mechanism.

Binding of mitochondrial leader sequences to Tom20 assessed using a bacterial two-hybrid system shows that hydrophobic interactions are essential and that some mutated leaders that do not bind Tom20 can still be imported.

PubMed

Mukhopadhyay, Abhijit; Yang, Chun-Song; Weiner, Henry

2006-12-01

Previous studies pointed to the importance of leucine residues in the binding of mitochondrial leader sequences to Tom20, an outer membrane protein translocator that initially binds the leader during import. A bacteria two-hybrid assay was here employed to determine if this could be an alternative way to investigate the binding of leader to the receptor. Leucine to alanine and arginine to glutamine mutations were made in the leader sequence from rat liver aldehyde dehydrogenase (pALDH). The leucine residues in the C-terminal of pALDH leader were found to be essential for TOM20 binding. The hydrophobic residues of another mitochondrial leader F1beta-ATPase that were important for Tom20 binding were found at the C-terminus of the leader. In contrast, it was the leucines in the N-terminus of the leader of ornithine transcarbamylase that were essential for binding. Modeling the peptides to the structure of Tom20 showed that the hydrophobic residues from the three proteins could all fit into the hydrophobic binding pocket. The mutants of pALDH that did not bind to Tom20 were still imported in vivo in transformed HeLa cells or in vitro into isolated mitochondria. In contrast, the mutant from pOTC was imported less well ( approximately 50%) while the mutant from F1beta-ATPase was not imported to any measurable extent. Binding to Tom20 might not be a prerequisite for import; however, it also is possible that import can occur even if binding to a receptor component is poor, so long as the leader binds tightly to another component of the translocator.

PAR-CLIP data indicate that Nrd1-Nab3-dependent transcription termination regulates expression of hundreds of protein coding genes in yeast

PubMed Central

2014-01-01

Background Nrd1 and Nab3 are essential sequence-specific yeast RNA binding proteins that function as a heterodimer in the processing and degradation of diverse classes of RNAs. These proteins also regulate several mRNA coding genes; however, it remains unclear exactly what percentage of the mRNA component of the transcriptome these proteins control. To address this question, we used the pyCRAC software package developed in our laboratory to analyze CRAC and PAR-CLIP data for Nrd1-Nab3-RNA interactions. Results We generated high-resolution maps of Nrd1-Nab3-RNA interactions, from which we have uncovered hundreds of new Nrd1-Nab3 mRNA targets, representing between 20 and 30% of protein-coding transcripts. Although Nrd1 and Nab3 showed a preference for binding near 5′ ends of relatively short transcripts, they bound transcripts throughout coding sequences and 3′ UTRs. Moreover, our data for Nrd1-Nab3 binding to 3′ UTRs was consistent with a role for these proteins in the termination of transcription. Our data also support a tight integration of Nrd1-Nab3 with the nutrient response pathway. Finally, we provide experimental evidence for some of our predictions, using northern blot and RT-PCR assays. Conclusions Collectively, our data support the notion that Nrd1 and Nab3 function is tightly integrated with the nutrient response and indicate a role for these proteins in the regulation of many mRNA coding genes. Further, we provide evidence to support the hypothesis that Nrd1-Nab3 represents a failsafe termination mechanism in instances of readthrough transcription. PMID:24393166

Halorhodopsin pumps Cl– and bacteriorhodopsin pumps protons by a common mechanism that uses conserved electrostatic interactions

PubMed Central

Gunner, M. R.

2014-01-01

Key mutations differentiate the functions of homologous proteins. One example compares the inward ion pump halorhodopsin (HR) and the outward proton pump bacteriorhodopsin (BR). Of the nine essential buried ionizable residues in BR, six are conserved in HR. However, HR changes three BR acids, D85 in a central cluster of ionizable residues, D96, nearer the intracellular, and E204, nearer the extracellular side of the membrane to the small, neutral amino acids T111, V122, and T230, respectively. In BR, acidic amino acids are stationary anions whose proton affinity is modulated by conformational changes, establishing a sequence of directed binding and release of protons. Multiconformation continuum electrostatics calculations of chloride affinity and residue protonation show that, in reaction intermediates where an acid is ionized in BR, a Cl– is bound to HR in a position near the deleted acid. In the HR ground state, Cl– binds tightly to the central cluster T111 site and weakly to the extracellular T230 site, recovering the charges on ionized BR-D85 and neutral E204 in BR. Imposing key conformational changes from the BR M intermediate into the HR structure results in the loss of Cl– from the central T111 site and the tight binding of Cl– to the extracellular T230 site, mirroring the changes that protonate BR-D85 and ionize E204 in BR. The use of a mobile chloride in place of D85 and E204 makes HR more susceptible to the environmental pH and salt concentrations than BR. These studies shed light on how ion transfer mechanisms are controlled through the interplay of protein and ion electrostatics. PMID:25362051

A New Class of Orthosteric uPAR•uPA Small-Molecule Antagonists Are Allosteric Inhibitors of the uPAR•Vitronectin Interaction

PubMed Central

Liu, Degang; Zhou, Donghui; Wang, Bo; Knabe, William Eric; Meroueh, Samy O.

2015-01-01

The urokinase receptor (uPAR) is a GPI-anchored cell surface receptor that is at the center of an intricate network of protein-protein interactions. Its immediate binding partners are the serine proteinase urokinase (uPA), and vitronectin (VTN), a component of the extracellular matrix. uPA and VTN bind at distinct sites on uPAR to promote extracellular matrix degradation and integrin signaling, respectively. Here, we report the discovery of a new class of pyrrolone small-molecule inhibitors of the tight ∼1 nM uPAR•uPA protein-protein interaction. These compounds were designed to bind to the uPA pocket on uPAR. The highest affinity compound, namely 7, displaced a fluorescently-labeled α-helical peptide (AE147-FAM) with an inhibition constant Ki of 0.7 µM and inhibited the tight uPAR•uPAATF interaction with an IC50 of 18 µM. Biophysical studies with surface plasmon resonance showed that VTN binding is highly dependent on uPA. This cooperative binding was confirmed as 7, which binds at the uPAR•uPA interface, also inhibited the distal VTN•uPAR interaction. In cell culture, 7 blocked the uPAR•uPA interaction in uPAR-expressing human embryonic kidney (HEK-293) cells, and impaired cell adhesion to VTN, a process that is mediated by integrins. As a result, 7 inhibited integrin signaling in MDA-MB-231 cancer cells as evidenced by a decrease in focal adhesion kinase (FAK) phosphorylation and Rac1 GTPase activation. Consistent with these results, 7 blocked breast MDA-MB-231 cancer cell invasion with IC50 values similar to those observed in ELISA and surface plasmon resonance competition studies. Explicit-solvent molecular dynamics simulations show that the cooperativity between uPA and VTN is attributed to stabilization of uPAR motion by uPA. In addition, free energy calculations revealed that uPA stabilizes the VTN•uPARSMB interaction through more favorable electrostatics and entropy. Disruption of the uPAR•VTNSMB interaction by 7 is consistent with the cooperative binding to uPAR by uPA and VTN. Interestingly, the VTNSMB•uPAR interaction was less favorable in the VTNSMB•uPAR•7 complex suggesting potential cooperativity between 7 and VTN. Compound 7 provides an excellent starting point for the development of more potent derivatives to explore uPAR biology. PMID:25671694

A new class of orthosteric uPAR·uPA small-molecule antagonists are allosteric inhibitors of the uPAR·vitronectin interaction.

PubMed

Liu, Degang; Zhou, Donghui; Wang, Bo; Knabe, William Eric; Meroueh, Samy O

2015-06-19

The urokinase receptor (uPAR) is a GPI-anchored cell surface receptor that is at the center of an intricate network of protein-protein interactions. Its immediate binding partners are the serine proteinase urokinase (uPA), and vitronectin (VTN), a component of the extracellular matrix. uPA and VTN bind at distinct sites on uPAR to promote extracellular matrix degradation and integrin signaling, respectively. Here, we report the discovery of a new class of pyrrolone small-molecule inhibitors of the tight ∼1 nM uPAR·uPA protein-protein interaction. These compounds were designed to bind to the uPA pocket on uPAR. The highest affinity compound, namely 7, displaced a fluorescently labeled α-helical peptide (AE147-FAM) with an inhibition constant Ki of 0.7 μM and inhibited the tight uPAR·uPAATF interaction with an IC50 of 18 μM. Biophysical studies with surface plasmon resonance showed that VTN binding is highly dependent on uPA. This cooperative binding was confirmed as 7, which binds at the uPAR·uPA interface, also inhibited the distal VTN·uPAR interaction. In cell culture, 7 blocked the uPAR·uPA interaction in uPAR-expressing human embryonic kidney (HEK-293) cells and impaired cell adhesion to VTN, a process that is mediated by integrins. As a result, 7 inhibited integrin signaling in MDA-MB-231 cancer cells as evidenced by a decrease in focal adhesion kinase (FAK) phosphorylation and Rac1 GTPase activation. Consistent with these results, 7 blocked breast MDA-MB-231 cancer cell invasion with IC50 values similar to those observed in ELISA and surface plasmon resonance competition studies. Explicit-solvent molecular dynamics simulations show that the cooperativity between uPA and VTN is attributed to stabilization of uPAR motion by uPA. In addition, free energy calculations revealed that uPA stabilizes the VTNSMB·uPAR interaction through more favorable electrostatics and entropy. Disruption of the uPAR·VTNSMB interaction by 7 is consistent with the cooperative binding to uPAR by uPA and VTN. Interestingly, the VTNSMB·uPAR interaction was less favorable in the VTNSMB·uPAR·7 complex suggesting potential cooperativity between 7 and VTN. Compound 7 provides an excellent starting point for the development of more potent derivatives to explore uPAR biology.

Oxidation of Са2+-Binding Domain of NADPH Oxidase 5 (NOX5): Toward Understanding the Mechanism of Inactivation of NOX5 by ROS.

PubMed

Petrushanko, Irina Yu; Lobachev, Vladimir M; Kononikhin, Alexey S; Makarov, Alexander A; Devred, Francois; Kovacic, Hervé; Kubatiev, Aslan A; Tsvetkov, Philipp O

2016-01-01

NOX5 protein, one of the most active generators of reactive oxygen species (ROS), plays an important role in many processes, including regulation of cell growth, death and differentiation. Because of its central role in ROS generation, it needs to be tightly regulated to guarantee cellular homeostasis. Contrary to other members of NADPH-oxidases family, NOX5 has its own regulatory calcium-binding domain and thus could be activated directly by calcium ions. While several mechanisms of activation have been described, very little is known about the mechanisms that could prevent the overproduction of ROS by NOX5. In the present study using calorimetric methods and circular dichroism we found that oxidation of cysteine and methionine residues of NOX5 decreases binding of Ca2+ ions and perturbs both secondary and tertiary structure of protein. Our data strongly suggest that oxidation of calcium-binding domain of NOX5 could be implicated in its inactivation, serving as a possible defense mechanism against oxidative stress.

Snapin mediates insulin secretory granule docking, but not trans-SNARE complex formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Somanath, Sangeeta; Partridge, Christopher J.; Marshall, Catriona

Secretory granule exocytosis is a tightly regulated process requiring granule targeting, tethering, priming, and membrane fusion. At the heart of this process is the SNARE complex, which drives fusion through a coiled-coil zippering effect mediated by the granule v-SNARE protein, VAMP2, and the plasma membrane t-SNAREs, SNAP-25 and syntaxin-1A. Here we demonstrate that in pancreatic β-cells the SNAP-25 accessory protein, snapin, C-terminal H2 domain binds SNAP-25 through its N-terminal Sn-1 domain. Interestingly whilst snapin binds SNAP-25, there is only modest binding of this complex with syntaxin-1A under resting conditions. Instead synataxin-1A appears to be recruited in response to secretory stimulation.more » These results indicate that snapin plays a role in tethering insulin granules to the plasma membrane through coiled coil interaction of snapin with SNAP-25, with full granule fusion competency only resulting after subsequent syntaxin-1A recruitment triggered by secretory stimulation. - Highlights: • Snapin mediates granule docking. • Snapin binds SNAP-25. • SNARE complex forms downstream.« less

Calmodulin fishing with a structurally disordered bait triggers CyaA catalysis

PubMed Central

O’Brien, Darragh P.; Durand, Dominique; Voegele, Alexis; Hourdel, Véronique; Davi, Marilyne; Chamot-Rooke, Julia; Vachette, Patrice; Brier, Sébastien; Ladant, Daniel

2017-01-01

Once translocated into the cytosol of target cells, the catalytic domain (AC) of the adenylate cyclase toxin (CyaA), a major virulence factor of Bordetella pertussis, is potently activated by binding calmodulin (CaM) to produce supraphysiological levels of cAMP, inducing cell death. Using a combination of small-angle X-ray scattering (SAXS), hydrogen/deuterium exchange mass spectrometry (HDX-MS), and synchrotron radiation circular dichroism (SR-CD), we show that, in the absence of CaM, AC exhibits significant structural disorder, and a 75-residue-long stretch within AC undergoes a disorder-to-order transition upon CaM binding. Beyond this local folding, CaM binding induces long-range allosteric effects that stabilize the distant catalytic site, whilst preserving catalytic loop flexibility. We propose that the high enzymatic activity of AC is due to a tight balance between the CaM-induced decrease of structural flexibility around the catalytic site and the preservation of catalytic loop flexibility, allowing for fast substrate binding and product release. The CaM-induced dampening of AC conformational disorder is likely relevant to other CaM-activated enzymes. PMID:29287065

The interaction of Clostridium perfringens enterotoxin with receptor claudins

PubMed Central

Shrestha, Archana; Uzal, Francisco A.; McClane, Bruce A.

2016-01-01

Clostridium perfringens enterotoxin (CPE) has significant medical importance due to its involvement in several common human gastrointestinal diseases. This 35 kDa single polypeptide toxin consists of two domains: a C-terminal domain involved in receptor binding and an N-terminal domain involved in oligomerization, membrane insertion and pore formation. The action of CPE starts with its binding to receptors, which include certain members of the claudin tight junction protein family; bound CPE then forms a series of complexes, one of which is a pore that causes the calcium influx responsible for host cell death. Recent studies have revealed that CPE binding to claudin receptors involves interactions between the C-terminal CPE domain and both the 1st and 2nd extracellular loops (ECL-1 and ECL-2) of claudin receptors. Of particular importance for this binding is the docking of ECL-2 into a pocket present in the C-terminal domain of the toxin. This increased understanding of CPE interactions with claudin receptors is now fostering the development of receptor decoy therapeutics for CPE-mediated gastrointestinal disease, reagents for cancer therapy/diagnoses and enhancers of drug delivery. PMID:27090847

Enantiospecific adsorption of propranolol enantiomers on naturally chiral copper surface: A molecular dynamics simulation investigation

NASA Astrophysics Data System (ADS)

Sedghamiz, Tahereh; Bahrami, Maryam; Ghatee, Mohammad Hadi

2017-04-01

Adsorption of propranolol enantiomers on naturally chiral copper (Cu(3,1,17)S) and achiral copper (Cu(100)) surfaces were studied by molecular dynamics simulation to unravel the features of adsorbate-adsorbent enantioselectivity. Adsorption of S- and R-propranolol on Cu(3,1,17)S terraces (with 100 plane) leads mainly to endo- and exo-conformers, respectively. Simulated pair correlation function (g(r)) and mean square displacement (MSD) were analyzed to identify adsorption sites of enantiomers on Cu(3,1,17)S substrate surface, and their simulated binding energies were used to access the adsorption strength. According to (g(r)), R-propranolol adsorbs via naphtyl group while S-propranolol mainly adsorbs through chain group. R-enantiomer binds more tightly to the chiral substrate surface than S-enantiomer as indicated by a higher simulated binding energy by 2.74 kJ mol-1 per molecule. The difference in binding energies of propranolol enantiomers on naturally chiral Cu(3,1,17)S is almost six times larger than on the achiral Cu(100) surface, which substantiates the appreciably strong specific enantioselective adsorption on the former surface.

C-terminal threonines and serines play distinct roles in the desensitization of rhodopsin, a G protein-coupled receptor

PubMed Central

Azevedo, Anthony W; Doan, Thuy; Moaven, Hormoz; Sokal, Iza; Baameur, Faiza; Vishnivetskiy, Sergey A; Homan, Kristoff T; Tesmer, John JG; Gurevich, Vsevolod V; Chen, Jeannie; Rieke, Fred

2015-01-01

Rod photoreceptors generate measurable responses to single-photon activation of individual molecules of the G protein-coupled receptor (GPCR), rhodopsin. Timely rhodopsin desensitization depends on phosphorylation and arrestin binding, which quenches G protein activation. Rhodopsin phosphorylation has been measured biochemically at C-terminal serine residues, suggesting that these residues are critical for producing fast, low-noise responses. The role of native threonine residues is unclear. We compared single-photon responses from rhodopsin lacking native serine or threonine phosphorylation sites. Contrary to expectation, serine-only rhodopsin generated prolonged step-like single-photon responses that terminated abruptly and randomly, whereas threonine-only rhodopsin generated responses that were only modestly slower than normal. We show that the step-like responses of serine-only rhodopsin reflect slow and stochastic arrestin binding. Thus, threonine sites play a privileged role in promoting timely arrestin binding and rhodopsin desensitization. Similar coordination of phosphorylation and arrestin binding may more generally permit tight control of the duration of GPCR activity. DOI: http://dx.doi.org/10.7554/eLife.05981.001 PMID:25910054

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

PubMed Central

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-01-01

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase

PubMed Central

Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel

2012-01-01

The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308

The IκBα/NF-κB complex has two hot spots, one at either end of the interface

PubMed Central

Bergqvist, Simon; Ghosh, Gourisankar; Komives, Elizabeth A.

2008-01-01

IκBα binds to and inhibits the transcriptional activity of NF-κB family members via its ankyrin repeat (AR) domain. The binding affinity of IκBα with NF-κB(p50/p65) heterodimers and NF-κB(p65/65) homodimers is in the picomolar range, and in the cell, this results in long half-lives of the complexes. Direct binding experiments have been performed using surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) on a series of truncations and mutations in order to understand what regions of the interface are most important for the tight binding affinity of this complex. We previously showed that interactions between residues 305 and 321 of NF-κB(p65) with the first AR of IκBα are critical for the binding energy. Interactions in this region are responsible for more than 7 kcal/mol of the binding energy. Here we show equally drastic consequences for the binding energy occur upon truncation of even a few residues at the C terminus of IκBα. Thus, the interface actually has two hot spots, one at either end of the elongated and large surface of interaction. These results suggest a “squeeze” mechanism that leads to the extremely high affinity of the IκBα•NF-κB complex through stabilization of the ankyrin repeat domain. PMID:18824506

Binding properties of SUMO-interacting motifs (SIMs) in yeast.

PubMed

Jardin, Christophe; Horn, Anselm H C; Sticht, Heinrich

2015-03-01

Small ubiquitin-like modifier (SUMO) conjugation and interaction play an essential role in many cellular processes. A large number of yeast proteins is known to interact non-covalently with SUMO via short SUMO-interacting motifs (SIMs), but the structural details of this interaction are yet poorly characterized. In the present work, sequence analysis of a large dataset of 148 yeast SIMs revealed the existence of a hydrophobic core binding motif and a preference for acidic residues either within or adjacent to the core motif. Thus the sequence properties of yeast SIMs are highly similar to those described for human. Molecular dynamics simulations were performed to investigate the binding preferences for four representative SIM peptides differing in the number and distribution of acidic residues. Furthermore, the relative stability of two previously observed alternative binding orientations (parallel, antiparallel) was assessed. For all SIMs investigated, the antiparallel binding mode remained stable in the simulations and the SIMs were tightly bound via their hydrophobic core residues supplemented by polar interactions of the acidic residues. In contrary, the stability of the parallel binding mode is more dependent on the sequence features of the SIM motif like the number and position of acidic residues or the presence of additional adjacent interaction motifs. This information should be helpful to enhance the prediction of SIMs and their binding properties in different organisms to facilitate the reconstruction of the SUMO interactome.