Tight-binding model for borophene and borophane

NASA Astrophysics Data System (ADS)

Nakhaee, M.; Ketabi, S. A.; Peeters, F. M.

2018-03-01

Starting from the simplified linear combination of atomic orbitals method in combination with first-principles calculations, we construct a tight-binding (TB) model in the two-centre approximation for borophene and hydrogenated borophene (borophane). The Slater and Koster approach is applied to calculate the TB Hamiltonian of these systems. We obtain expressions for the Hamiltonian and overlap matrix elements between different orbitals for the different atoms and present the SK coefficients in a nonorthogonal basis set. An anisotropic Dirac cone is found in the band structure of borophane. We derive a Dirac low-energy Hamiltonian and compare the Fermi velocities with that of graphene.

Communication: Charge-population based dispersion interactions for molecules and materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

2016-04-21

We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less

Universal Sign Control of Coupling in Tight-Binding Lattices

NASA Astrophysics Data System (ADS)

Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander

2016-05-01

We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.

Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

NASA Astrophysics Data System (ADS)

Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

2018-04-01

Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

Development of tight-binding based GW algorithm and its computational implementation for graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source

Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less

Gaussian polarizable-ion tight binding.

PubMed

Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

2016-10-14

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

Gaussian polarizable-ion tight binding

NASA Astrophysics Data System (ADS)

Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

2016-10-01

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

Tight-binding tunneling amplitude of an optical lattice

NASA Astrophysics Data System (ADS)

Arzamasovs, Maksims; Liu, Bo

2017-11-01

The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.

Density functional tight-binding and infrequent metadynamics can capture entropic effects in intramolecular hydrogen transfer reactions

NASA Astrophysics Data System (ADS)

Oliveira, Luiz F. L.; Fu, Christopher D.; Pfaendtner, Jim

2018-04-01

Infrequent metadynamics uses biased simulations to estimate the unbiased kinetics of a system, facilitating the calculation of rates and barriers. Here the method is applied to study intramolecular hydrogen transfer reactions involving peroxy radicals, a class of reactions that is challenging to model due to the entropic contributions of the formation of ring structures in the transition state. Using the self-consistent charge density-functional based tight-binding (DFTB) method, we applied infrequent metadynamics to the study of four intramolecular H-transfer reactions, demonstrating that the method can qualitatively reproduce these high entropic contributions, as observed in experiments and those predicted by transition state theory modeled by higher levels of theory. We also show that infrequent metadynamics and DFTB are successful in describing the relationship between transition state ring size and kinetic coefficients (e.g., activation energies and the pre-exponential factors).

Structure and Stability of Molecular Crystals with Many-Body Dispersion-Inclusive Density Functional Tight Binding.

PubMed

Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre

2018-01-18

Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.

The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

PubMed Central

Balda, Maria S.; Matter, Karl

2000-01-01

Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE PAGES

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

2016-09-09

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

PubMed

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

2016-10-11

In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.

The tightly bound nuclei in the liquid drop model

NASA Astrophysics Data System (ADS)

Sree Harsha, N. R.

2018-05-01

In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.

Implementation and benchmark of a long-range corrected functional in the density functional based tight-binding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lutsker, V.; Niehaus, T. A., E-mail: thomas.niehaus@physik.uni-regensburg.de; Aradi, B.

2015-11-14

Bridging the gap between first principles methods and empirical schemes, the density functional based tight-binding method (DFTB) has become a versatile tool in predictive atomistic simulations over the past years. One of the major restrictions of this method is the limitation to local or gradient corrected exchange-correlation functionals. This excludes the important class of hybrid or long-range corrected functionals, which are advantageous in thermochemistry, as well as in the computation of vibrational, photoelectron, and optical spectra. The present work provides a detailed account of the implementation of DFTB for a long-range corrected functional in generalized Kohn-Sham theory. We apply themore » method to a set of organic molecules and compare ionization potentials and electron affinities with the original DFTB method and higher level theory. The new scheme cures the significant overpolarization in electric fields found for local DFTB, which parallels the functional dependence in first principles density functional theory (DFT). At the same time, the computational savings with respect to full DFT calculations are not compromised as evidenced by numerical benchmark data.« less

Assessment of the Density Functional Tight Binding Method for Protic Ionic Liquids

PubMed Central

2015-01-01

Density functional tight binding (DFTB), which is ∼100–1000 times faster than full density functional theory (DFT), has been used to simulate the structure and properties of protic ionic liquid (IL) ions, clusters of ions and the bulk liquid. Proton affinities for a wide range of IL cations and anions determined using DFTB generally reproduce G3B3 values to within 5–10 kcal/mol. The structures and thermodynamic stabilities of n-alkyl ammonium nitrate clusters (up to 450 quantum chemical atoms) predicted with DFTB are in excellent agreement with those determined using DFT. The IL bulk structure simulated using DFTB with periodic boundary conditions is in excellent agreement with published neutron diffraction data. PMID:25328497

Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

PubMed Central

Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

2001-01-01

The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

Tight binding simulation study on zigzag single-walled carbon nanotubes

NASA Astrophysics Data System (ADS)

Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

2018-01-01

Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.

Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

PubMed

Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

2015-06-09

The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

Self-Consistent Charge Density Functional Tight-Binding Study of Poly(3,4-ethylenedioxythiophene): Poly(styrenesulfonate) Ammonia Gas Sensor.

PubMed

Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal

2017-12-01

Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.

Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

NASA Astrophysics Data System (ADS)

You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

2012-04-01

We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

Non-collinear magnetism with analytic Bond-Order Potentials

NASA Astrophysics Data System (ADS)

Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

2015-03-01

The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

Conductance of AFM Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)

2002-01-01

This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.

PubMed

Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas

2015-07-14

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.

Actinide electronic structure and atomic forces

NASA Astrophysics Data System (ADS)

Albers, R. C.; Rudin, Sven P.; Trinkle, Dallas R.; Jones, M. D.

2000-07-01

We have developed a new method[1] of fitting tight-binding parameterizations based on functional forms developed at the Naval Research Laboratory.[2] We have applied these methods to actinide metals and report our success using them (see below). The fitting procedure uses first-principles local-density-approximation (LDA) linear augmented plane-wave (LAPW) band structure techniques[3] to first calculate an electronic-structure band structure and total energy for fcc, bcc, and simple cubic crystal structures for the actinide of interest. The tight-binding parameterization is then chosen to fit the detailed energy eigenvalues of the bands along symmetry directions, and the symmetry of the parameterization is constrained to agree with the correct symmetry of the LDA band structure at each eigenvalue and k-vector that is fit to. By fitting to a range of different volumes and the three different crystal structures, we find that the resulting parameterization is robust and appears to accurately calculate other crystal structures and properties of interest.

Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

DOE PAGES

Zhang, Hong; Zapol, Peter; Dixon, David A.; ...

2015-11-17

The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hong; Zapol, Peter; Dixon, David A.

The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

Adaptive frozen orbital treatment for the fragment molecular orbital method combined with density-functional tight-binding

NASA Astrophysics Data System (ADS)

Nishimoto, Yoshio; Fedorov, Dmitri G.

2018-02-01

The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.

Analytical excited state forces for the time-dependent density-functional tight-binding method.

PubMed

Heringer, D; Niehaus, T A; Wanko, M; Frauenheim, Th

2007-12-01

An analytical formulation for the geometrical derivatives of excitation energies within the time-dependent density-functional tight-binding (TD-DFTB) method is presented. The derivation is based on the auxiliary functional approach proposed in [Furche and Ahlrichs, J Chem Phys 2002, 117, 7433]. To validate the quality of the potential energy surfaces provided by the method, adiabatic excitation energies, excited state geometries, and harmonic vibrational frequencies were calculated for a test set of molecules in excited states of different symmetry and multiplicity. According to the results, the TD-DFTB scheme surpasses the performance of configuration interaction singles and the random phase approximation but has a lower quality than ab initio time-dependent density-functional theory. As a consequence of the special form of the approximations made in TD-DFTB, the scaling exponent of the method can be reduced to three, similar to the ground state. The low scaling prefactor and the satisfactory accuracy of the method makes TD-DFTB especially suitable for molecular dynamics simulations of dozens of atoms as well as for the computation of luminescence spectra of systems containing hundreds of atoms. (c) 2007 Wiley Periodicals, Inc.

Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution

NASA Astrophysics Data System (ADS)

Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

2015-08-01

Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.

2D Quantum Simulation of MOSFET Using the Non Equilibrium Green's Function Method

NASA Technical Reports Server (NTRS)

Svizhenko, Alexel; Anantram, M. P.; Govindan, T. R.; Yan, Jerry (Technical Monitor)

2000-01-01

The objectives this viewgraph presentation summarizes include: (1) the development of a quantum mechanical simulator for ultra short channel MOSFET simulation, including theory, physical approximations, and computer code; (2) explore physics that is not accessible by semiclassical methods; (3) benchmarking of semiclassical and classical methods; and (4) study other two-dimensional devices and molecular structure, from discretized Hamiltonian to tight-binding Hamiltonian.

Transport gap engineering by contact geometry in graphene nanoribbons: Experimental and theoretical studies on artificial materials

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.

Electronic Properties of SiNTs Under External Electric and Magnetic Fields Using the Tight-Binding Method

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.

Conductance of three-terminal molecular bridge based on tight-binding theory

NASA Astrophysics Data System (ADS)

Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

2005-05-01

The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

DOE PAGES

Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

2015-06-26

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

Efficient self-consistency for magnetic tight binding

NASA Astrophysics Data System (ADS)

Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.

2011-06-01

Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.

Dpb11 may function with RPA and DNA to initiate DNA replication.

PubMed

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

Tight-binding calculation of the magnetic moment of CrAs under pressure

NASA Astrophysics Data System (ADS)

Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio

2018-03-01

We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.

ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

NASA Astrophysics Data System (ADS)

Korol, Roman; Kilgour, Michael; Segal, Dvira

2018-03-01

We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

Mechanistic Basis Of Calmodulin Mediated Estrogen Receptor Alpha Activation and Antiestrogen Resistance

DTIC Science & Technology

2010-06-01

for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic

Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

PubMed

Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

2016-03-14

Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

Improved Density Functional Tight Binding Potentials for Metalloid Aluminum Clusters

DTIC Science & Technology

2016-06-01

simulations of the oxidation of Al4Cp * 4 show reasonable comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers...comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers from Cp* to the metal centers during the...initio molecular dynamics of the oxidation of Al4Cp * 4 using a DFT-based Car -Parrinello method. This simulation, which 43 several months on the

Accurate modeling of defects in graphene transport calculations

NASA Astrophysics Data System (ADS)

Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

2018-01-01

We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.

DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

NASA Astrophysics Data System (ADS)

Humeniuk, Alexander; Mitrić, Roland

2017-12-01

A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.

A general intermolecular force field based on tight-binding quantum chemical calculations

NASA Astrophysics Data System (ADS)

Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

2017-10-01

A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

Dpb11 may function with RPA and DNA to initiate DNA replication

PubMed Central

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

Most of the tight positional conservation of transcription factor binding sites near the transcription start site reflects their co-localization within regulatory modules.

PubMed

Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L

2016-11-21

Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.

Universal tight binding model for chemical reactions in solution and at surfaces. II. Water.

PubMed

Lozovoi, A Y; Sheppard, T J; Pashov, D L; Kohanoff, J J; Paxton, A T

2014-07-28

A revised water model intended for use in condensed phase simulations in the framework of the self consistent polarizable ion tight binding theory is constructed. The model is applied to water monomer, dimer, hexamers, ice, and liquid, where it demonstrates good agreement with theoretical results obtained by more accurate methods, such as DFT and CCSD(T), and with experiment. In particular, the temperature dependence of the self diffusion coefficient in liquid water predicted by the model, closely reproduces experimental curves in the temperature interval between 230 K and 350 K. In addition, and in contrast to standard DFT, the model properly orders the relative densities of liquid water and ice. A notable, but inevitable, shortcoming of the model is underestimation of the static dielectric constant by a factor of two. We demonstrate that the description of inter and intramolecular forces embodied in the tight binding approximation in quantum mechanics leads to a number of valuable insights which can be missing from ab initio quantum chemistry and classical force fields. These include a discussion of the origin of the enhanced molecular electric dipole moment in the condensed phases, and a detailed explanation for the increase of coordination number in liquid water as a function of temperature and compared with ice--leading to insights into the anomalous expansion on freezing. The theory holds out the prospect of an understanding of the currently unexplained density maximum of water near the freezing point.

Transmission eigenchannels from nonequilibrium Green's functions

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Brandbyge, Mads

2007-09-01

The concept of transmission eigenchannels is described in a tight-binding nonequilibrium Green’s function (NEGF) framework. A simple procedure for calculating the eigenchannels is derived using only the properties of the device subspace and quantities normally available in a NEGF calculation. The method is exemplified by visualization in real space of the eigenchannels for three different molecular and atomic wires.

Physical and metabolic requirements for early interaction of poliovirus and human rhinovirus with HeLa cells.

PubMed Central

Lonberg-Holm, K; Whiteley, N M

1976-01-01

Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301

Edge currents in frustrated Josephson junction ladders

NASA Astrophysics Data System (ADS)

Marques, A. M.; Santos, F. D. R.; Dias, R. G.

2016-09-01

We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.

Bak Conformational Changes Induced by Ligand Binding: Insight into BH3 Domain Binding and Bak Homo-Oligomerization

PubMed Central

Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.

2012-01-01

Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769

Three pillars for achieving quantum mechanical molecular dynamics simulations of huge systems: Divide-and-conquer, density-functional tight-binding, and massively parallel computation.

PubMed

Nishizawa, Hiroaki; Nishimura, Yoshifumi; Kobayashi, Masato; Irle, Stephan; Nakai, Hiromi

2016-08-05

The linear-scaling divide-and-conquer (DC) quantum chemical methodology is applied to the density-functional tight-binding (DFTB) theory to develop a massively parallel program that achieves on-the-fly molecular reaction dynamics simulations of huge systems from scratch. The functions to perform large scale geometry optimization and molecular dynamics with DC-DFTB potential energy surface are implemented to the program called DC-DFTB-K. A novel interpolation-based algorithm is developed for parallelizing the determination of the Fermi level in the DC method. The performance of the DC-DFTB-K program is assessed using a laboratory computer and the K computer. Numerical tests show the high efficiency of the DC-DFTB-K program, a single-point energy gradient calculation of a one-million-atom system is completed within 60 s using 7290 nodes of the K computer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Band gap engineering for poly(p-phenylene) and poly(p-phenylene vinylene) copolymers using the tight-binding approach

NASA Astrophysics Data System (ADS)

Giro, R.; Caldas, M. J.; Galvão, D. S.

The interest in poly(p-phenylene) (PPP) and poly(p-phenylene vinylene) (PPV) copolymers stems from the fact that these homopolymers present interesting optical and electronic properties that allow a great variety of technological applications. Combining different numbers of PPP and PPV units it is possible, in principle, to obtain new structures presenting intermediate gap values (2.8 eV and 2.4 eV for PPP and PPV, respectively). For this study we used a Hückel Hamiltonian tight-binding coupled to the negative factor counting (NFC) technique. We carried out a systematic search to determine optimum relative concentrations for disordered binary polymeric alloys with predefined gap values. Once these structures were obtained, we used the semiempirical methods AM1/PM3 and ZINDO/S-CI for geometrical and optical studies, respectively. Our theoretical results show that it is possible to obtain copolymers of PPP and PPV with intermediate gap values of their parent structures.

Uncoupling protein 1 binds one nucleotide per monomer and is stabilized by tightly bound cardiolipin

PubMed Central

Lee, Yang; Willers, Chrissie; Kunji, Edmund R. S.; Crichton, Paul G.

2015-01-01

Uncoupling protein 1 (UCP1) catalyzes fatty acid-activated, purine nucleotide-sensitive proton leak across the mitochondrial inner membrane of brown adipose tissue to produce heat, and could help combat obesity and metabolic disease in humans. Studies over the last 30 years conclude that the protein is a dimer, binding one nucleotide molecule per two proteins, and unlike the related mitochondrial ADP/ATP carrier, does not bind cardiolipin. Here, we have developed novel methods to purify milligram amounts of UCP1 from native sources by using covalent chromatography that, unlike past methods, allows the protein to be prepared in defined conditions, free of excess detergent and lipid. Assessment of purified preparations by TLC reveal that UCP1 retains tightly bound cardiolipin, with a lipid phosphorus content equating to three molecules per protein, like the ADP/ATP carrier. Cardiolipin stabilizes UCP1, as demonstrated by reconstitution experiments and thermostability assays, indicating that the lipid has an integral role in the functioning of the protein, similar to other mitochondrial carriers. Furthermore, we find that UCP1 is not dimeric but monomeric, as indicated by size exclusion analysis, and has a ligand titration profile in isothermal calorimetric measurements that clearly shows that one nucleotide binds per monomer. These findings reveal the fundamental composition of UCP1, which is essential for understanding the mechanism of the protein. Our assessment of the properties of UCP1 indicate that it is not unique among mitochondrial carriers and so is likely to use a common exchange mechanism in its primary function in brown adipose tissue mitochondria. PMID:26038550

Extension of the self-consistent-charge density-functional tight-binding method: third-order expansion of the density functional theory total energy and introduction of a modified effective coulomb interaction.

PubMed

Yang, Yang; Yu, Haibo; York, Darrin; Cui, Qiang; Elstner, Marcus

2007-10-25

The standard self-consistent-charge density-functional-tight-binding (SCC-DFTB) method (Phys. Rev. B 1998, 58, 7260) is derived by a second-order expansion of the density functional theory total energy expression, followed by an approximation of the charge density fluctuations by charge monopoles and an effective damped Coulomb interaction between the atomic net charges. The central assumptions behind this effective charge-charge interaction are the inverse relation of atomic size and chemical hardness and the use of a fixed chemical hardness parameter independent of the atomic charge state. While these approximations seem to be unproblematic for many covalently bound systems, they are quantitatively insufficient for hydrogen-bonding interactions and (anionic) molecules with localized net charges. Here, we present an extension of the SCC-DFTB method to incorporate third-order terms in the charge density fluctuations, leading to chemical hardness parameters that are dependent on the atomic charge state and a modification of the Coulomb scaling to improve the electrostatic treatment within the second-order terms. These modifications lead to a significant improvement in the description of hydrogen-bonding interactions and proton affinities of biologically relevant molecules.

Schematic baryon models, their tight binding description and their microwave realization

NASA Astrophysics Data System (ADS)

Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-12-01

A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.

Magnetic susceptibilities of actinide 3d-metal intermetallic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.

1988-04-15

We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.

Atomistic analysis of valley-orbit hybrid states and inter-dot tunnel rates in a Si double quantum dot

NASA Astrophysics Data System (ADS)

Ferdous, Rifat; Rahman, Rajib; Klimeck, Gerhard

2014-03-01

Silicon quantum dots are promising candidates for solid-state quantum computing due to the long spin coherence times in silicon, arising from small spin-orbit interaction and a nearly spin free host lattice. However, the conduction band valley degeneracy adds an additional degree of freedom to the electronic structure, complicating the encoding and operation of qubits. Although the valley and the orbital indices can be uniquely identified in an ideal silicon quantum dot, atomic-scale disorder mixes valley and orbital states in realistic dots. Such valley-orbit hybridization, strongly influences the inter-dot tunnel rates.Using a full-band atomistic tight-binding method, we analyze the effect of atomic-scale interface disorder in a silicon double quantum dot. Fourier transform of the tight-binding wavefunctions helps to analyze the effect of disorder on valley-orbit hybridization. We also calculate and compare inter-dot inter-valley and intra-valley tunneling, in the presence of realistic disorder, such as interface tilt, surface roughness, alloy disorder, and interface charges. The method provides a useful way to compute electronic states in realistically disordered systems without any posteriori fitting parameters.

Self-Consistent Optimization of Excited States within Density-Functional Tight-Binding.

PubMed

Kowalczyk, Tim; Le, Khoa; Irle, Stephan

2016-01-12

We present an implementation of energies and gradients for the ΔDFTB method, an analogue of Δ-self-consistent-field density functional theory (ΔSCF) within density-functional tight-binding, for the lowest singlet excited state of closed-shell molecules. Benchmarks of ΔDFTB excitation energies, optimized geometries, Stokes shifts, and vibrational frequencies reveal that ΔDFTB provides a qualitatively correct description of changes in molecular geometries and vibrational frequencies due to excited-state relaxation. The accuracy of ΔDFTB Stokes shifts is comparable to that of ΔSCF-DFT, and ΔDFTB performs similarly to ΔSCF with the PBE functional for vertical excitation energies of larger chromophores where the need for efficient excited-state methods is most urgent. We provide some justification for the use of an excited-state reference density in the DFTB expansion of the electronic energy and demonstrate that ΔDFTB preserves many of the properties of its parent ΔSCF approach. This implementation fills an important gap in the extended framework of DFTB, where access to excited states has been limited to the time-dependent linear-response approach, and affords access to rapid exploration of a valuable class of excited-state potential energy surfaces.

Crumbs3 Is Essential for Proper Epithelial Development and Viability

PubMed Central

Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.

2014-01-01

First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893

Measurement of free glucocorticoids: quantifying corticosteroid-binding globulin binding affinity and its variation within and among mammalian species.

PubMed

Delehanty, Brendan; Hossain, Sabrina; Jen, Chao Ching; Crawshaw, Graham J; Boonstra, Rudy

2015-01-01

Plasma glucocorticoids (GCs) are commonly used as measures of stress in wildlife. A great deal of evidence indicates that only free GC (GC not bound by the specific binding protein, corticosteroid-binding globulin, CBG) leaves the circulation and exerts biological effects on GC-sensitive tissues. Free hormone concentrations are difficult to measure directly, so researchers estimate free GC using two measures: the binding affinity and the binding capacity in plasma. We provide an inexpensive saturation binding method for calculating the binding affinity (equilibrium dissociation constant, K d) of CBG that can be run without specialized laboratory equipment. Given that other plasma proteins, such as albumin, also bind GCs, the method compensates for this non-specific binding. Separation of bound GC from free GC was achieved with dextran-coated charcoal. The method provides repeatable estimates (12% coefficient of variation in the red squirrel, Tamiasciurus hudsonicus), and there is little evidence of inter-individual variation in K d (range 2.0-7.3 nM for 16 Richardson's ground squirrels, Urocitellus richardsonii). The K d values of 28 mammalian species we assessed were mostly clustered around a median of 4 nM, but five species had values between 13 and 61 nM. This pattern may be distinct from birds, for which published values are more tightly distributed (1.5-5.1 nM). The charcoal separation method provides a reliable and robust method for measuring the K d in a wide range of species. It uses basic laboratory equipment to provide rapid results at very low cost. Given the importance of CBG in regulating the biological activity of GCs, this method is a useful tool for physiological ecologists.

Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

NASA Astrophysics Data System (ADS)

Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

2018-01-01

The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

Use of procainamide gels in the purification of human and horse serum cholinesterases.

PubMed Central

Ralston, J S; Main, A R; Kilpatrick, B F; Chasson, A L

1983-01-01

Two large-scale methods based primarily on the use of procainamide-Sepharose gels were developed for the purification of horse and human serum non-specific cholinesterases. With method I, the procainamide-Sepharose 4B gel was used in the first step to handle large volumes of serum. With method II, the procainamide-Sepharose 4B gel was used in the final step to obtain pure enzyme. Although both methods gave electrophoretically pure cholinesterase preparations in good yields, they were significantly more efficient at purifying the horse enzyme than the human enzyme. To study this problem, the relative binding of human and horse cholinesterases to procainamide-, methylacridinium (MAC)-, m-trimethylammoniophenyl (m-PTA)- and p-trimethylammoniophenyl (p-PTA)-Sepharose 4B gels were measured, by using two approaches. In one, binding was measured by a procedure involving equilibration of pure cholinesterase in a small volume of diluted gel slurry (4%, v/v). A partially purified preparation of Electrophorus acetylcholinesterase was included. Pure human cholinesterase bound consistently more tightly to each of the gels than did horse cholinesterase, and the acetylcholinesterase appeared to bind the gels 10-100 times more tightly than did the non-specific cholinesterases. The order of binding for the cholinesterases, beginning with the tightest, was: procainamide-Sepharose 4B, MAC-Sepharose 4B, p-PTA-Sepharose 4B and m-PTA-Sepharose 4B. For the acetylcholinesterase the order was: MAC-Sepharose 4B, procainamide-Sepharose 4B, p-PTA-Sepharose 4B and m-PTA-Sepharose 4B. The second approach involved passing native sera or partially purified sera fractions through 1 ml test columns of each of the four affinity gels to determine their retention capacity for the cholinesterases. With these impure samples, the MAC-Sepharose 4B gels proved superior to the procainamide-Sepharose 4B gels at retaining human cholinesterase, but the opposite was true for the horse cholinesterase. PMID:6870822

Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. IV. Performance of many-body force fields and tight-binding schemes for the fluid phases of silicon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desgranges, Caroline; Delhommelle, Jerome

We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less

Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

PubMed

Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

2018-05-08

Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Vertical electronic transport in van de waals heterostructures

NASA Astrophysics Data System (ADS)

Qiao, Zhenhua; Zhenhua Qiao's Group Team

In this work, we will introduce the theoretical investigation of the vertical electronic transport in various heterostructrues by using both tight-binding method and first-principles calculations. Counterintuitively, we find that the maximum electronic transport is achieved at very limited scattering regions but not at large overlapped catering regions. Based on this finding, we design a special setup to measure the tunneling effect in rotated bilayer systems.

Dual binding in cohesin-dockerin complexes: the energy landscape and the role of short, terminal segments of the dockerin module.

PubMed

Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek

2018-03-22

The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.

Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

NASA Astrophysics Data System (ADS)

Shen, Ka

2018-04-01

We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.

OLIFE: Tight Binding Code for Transmission Coefficient Calculation

NASA Astrophysics Data System (ADS)

Mijbil, Zainelabideen Yousif

2018-05-01

A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.

Electronic Structure of Alpha-Quartz and the Influence of Some Local Disorder: A Tight Binding Study,

DTIC Science & Technology

1977-01-01

An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater

Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

PubMed

Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

2014-10-28

Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

DFTB Parameters for the Periodic Table: Part 1, Electronic Structure.

PubMed

Wahiduzzaman, Mohammad; Oliveira, Augusto F; Philipsen, Pier; Zhechkov, Lyuben; van Lenthe, Erik; Witek, Henryk A; Heine, Thomas

2013-09-10

A parametrization scheme for the electronic part of the density-functional based tight-binding (DFTB) method that covers the periodic table is presented. A semiautomatic parametrization scheme has been developed that uses Kohn-Sham energies and band structure curvatures of real and fictitious homoatomic crystal structures as reference data. A confinement potential is used to tighten the Kohn-Sham orbitals, which includes two free parameters that are used to optimize the performance of the method. The method is tested on more than 100 systems and shows excellent overall performance.

Electrostatic Interactions in the Binding Pathway of a Transient Protein Complex Studied by NMR and Isothermal Titration Calorimetry*

PubMed Central

Meneses, Erick; Mittermaier, Anthony

2014-01-01

Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758

A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

PubMed Central

Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

2009-01-01

Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

NASA Astrophysics Data System (ADS)

Leleyter, M.; Olivi-Tran, N.

2008-12-01

We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.

Predicting permanent and transient protein-protein interfaces.

PubMed

La, David; Kong, Misun; Hoffman, William; Choi, Youn Im; Kihara, Daisuke

2013-05-01

Protein-protein interactions (PPIs) are involved in diverse functions in a cell. To optimize functional roles of interactions, proteins interact with a spectrum of binding affinities. Interactions are conventionally classified into permanent and transient, where the former denotes tight binding between proteins that result in strong complexes, whereas the latter compose of relatively weak interactions that can dissociate after binding to regulate functional activity at specific time point. Knowing the type of interactions has significant implications for understanding the nature and function of PPIs. In this study, we constructed amino acid substitution models that capture mutation patterns at permanent and transient type of protein interfaces, which were found to be different with statistical significance. Using the substitution models, we developed a novel computational method that predicts permanent and transient protein binding interfaces (PBIs) in protein surfaces. Without knowledge of the interacting partner, the method uses a single query protein structure and a multiple sequence alignment of the sequence family. Using a large dataset of permanent and transient proteins, we show that our method, BindML+, performs very well in protein interface classification. A very high area under the curve (AUC) value of 0.957 was observed when predicted protein binding sites were classified. Remarkably, near prefect accuracy was achieved with an AUC of 0.991 when actual binding sites were classified. The developed method will be also useful for protein design of permanent and transient PBIs. Copyright © 2013 Wiley Periodicals, Inc.

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

NASA Astrophysics Data System (ADS)

Henke, Paul S.; Mak, Chi H.

2014-08-01

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.

PubMed

Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto

2018-04-11

We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

PubMed

Henke, Paul S; Mak, Chi H

2014-08-14

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

NASA Astrophysics Data System (ADS)

Turek, I.; Kudrnovský, J.; Drchal, V.

2015-12-01

We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

A Sparse Self-Consistent Field Algorithm and Its Parallel Implementation: Application to Density-Functional-Based Tight Binding.

PubMed

Scemama, Anthony; Renon, Nicolas; Rapacioli, Mathias

2014-06-10

We present an algorithm and its parallel implementation for solving a self-consistent problem as encountered in Hartree-Fock or density functional theory. The algorithm takes advantage of the sparsity of matrices through the use of local molecular orbitals. The implementation allows one to exploit efficiently modern symmetric multiprocessing (SMP) computer architectures. As a first application, the algorithm is used within the density-functional-based tight binding method, for which most of the computational time is spent in the linear algebra routines (diagonalization of the Fock/Kohn-Sham matrix). We show that with this algorithm (i) single point calculations on very large systems (millions of atoms) can be performed on large SMP machines, (ii) calculations involving intermediate size systems (1000-100 000 atoms) are also strongly accelerated and can run efficiently on standard servers, and (iii) the error on the total energy due to the use of a cutoff in the molecular orbital coefficients can be controlled such that it remains smaller than the SCF convergence criterion.

Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

PubMed Central

Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

2017-01-01

Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

Various Stone-Wales defects in phagraphene

NASA Astrophysics Data System (ADS)

Openov, L. A.; Podlivaev, A. I.

2016-08-01

Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.

Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

PubMed Central

Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

2008-01-01

Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

Surface passivation for tight-binding calculations of covalent solids.

PubMed

Bernstein, N

2007-07-04

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

Surface passivation for tight-binding calculations of covalent solids

NASA Astrophysics Data System (ADS)

Bernstein, N.

2007-07-01

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus

USDA-ARS?s Scientific Manuscript database

The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...

Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

PubMed Central

2011-01-01

Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588

First Experimental Realization of the Dirac Oscillator

NASA Astrophysics Data System (ADS)

Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-10-01

We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.

A tight binding model study of tunneling conductance spectra of spin and orbitally ordered CMR manganites

NASA Astrophysics Data System (ADS)

Panda, Saswati; Sahoo, D. D.; Rout, G. C.

2018-04-01

We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.

DFTB+ and lanthanides

NASA Astrophysics Data System (ADS)

Hourahine, B.; Aradi, B.; Frauenheim, T.

2010-07-01

DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

NASA Astrophysics Data System (ADS)

Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

2017-05-01

We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.

Excitons in boron nitride single layer

NASA Astrophysics Data System (ADS)

Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François

2016-09-01

Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.

Electronic properties of Bilayer Fullerene onions

NASA Astrophysics Data System (ADS)

Pincak, R.; Shunaev, V. V.; Smotlacha, J.; Slepchenkov, M. M.; Glukhova, O. E.

2017-10-01

The HOMO-LUMO gaps of the bilayer fullerene onions were investigated. For this purpose, the HOMO and LUMO energies were calculated for the isolated fullerenes using the parametrization of the tight binding method with the Harrison-Goodwin modification. Next, the difference of the Fermi levels of the outer and inner shell was calculated by considering the hybridization of the orbitals on the base of the geometric parameters. The results were obtained by the combination of these calculations.

Structures of Aln (n= 27, 28, 29, and 30) clusters with double-tetrahedron structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, W.; Lu, W. C.; Sun, J.

2008-01-31

Global search for lowest-energy structures of neutral aluminum clusters Al{sub n} (n = 27, 28, 29 and 30) was performed using a genetic algorithm (GA) coupled with a tight-binding (TB) method. Structural candidates obtained from our GA search were further optimized with first-principles calculations. It is found that the medium-sized aluminum clusters Al{sub 27} to Al{sub 30} favor double-tetrahedron structures.

Green's function calculations for semi-infinite carbon nanotubes

NASA Astrophysics Data System (ADS)

John, D. L.; Pulfrey, D. L.

2006-02-01

In the modeling of nanoscale electronic devices, the non-equilibrium Green's function technique is gaining increasing popularity. One complication in this method is the need for computation of the self-energy functions that account for the interactions between the active portion of a device and its leads. In the one-dimensional case, these functions may be computed analytically. In higher dimensions, a numerical approach is required. In this work, we generalize earlier methods that were developed for tight-binding Hamiltonians, and present results for the case of a carbon nanotube.

Ti(IV) and the Siderophore Desferrioxamine B: A Tight Complex Has Biological and Environmental Implications.

PubMed

Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M

2017-02-06

The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.

Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

NASA Astrophysics Data System (ADS)

Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

2015-07-01

The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

Tight-binding modeling and low-energy behavior of the semi-Dirac point.

PubMed

Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E

2009-07-03

We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.

Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films

NASA Astrophysics Data System (ADS)

Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.

2018-04-01

We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.

The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

NASA Astrophysics Data System (ADS)

Kar, J. K.; Panda, Saswati; Rout, G. C.

2017-05-01

We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

PubMed

Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

2015-02-10

Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

HIV-1 gp120 Glycoprotein Interacting with Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Non-integrin (DC-SIGN) Down-Regulates Tight Junction Proteins to Disrupt the Blood Retinal Barrier and Increase Its Permeability.

PubMed

Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang

2016-10-28

Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Spin structure of electron subbands in (110)-grown quantum wells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nestoklon, M. O.; Tarasenko, S. A.; Jancu, J.-M.

We present the theory of fine structure of electron states in symmetric and asymmetric zinc-blende-type quantum wells with the (110) crystallographic orientation. By combining the symmetry analysis, sp{sup 3}d{sup 5}s* tight-binding method, and envelope-function approach we obtain quantitative description of in-plane wave vector, well width and applied electric field dependencies of the zero-magnetic-field spin splitting of electron subbands and extract spin-orbit-coupling parameters.

Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

PubMed

Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

2017-09-30

Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Proton transfer along water bridges in biological systems with density-functional tight-binding

NASA Astrophysics Data System (ADS)

Reiss, Krystle; Wise, Abigail; Mazzuca, James

2015-03-01

When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.

Neuraminidase inhibitor R-125489 - A promising drug for treating influenza virus: Steered molecular dynamics approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mai, Binh Khanh; Li, Mai Suan, E-mail: masli@ifpan.edu.pl

2011-07-08

Highlights: {yields} We study binding affinity of R-125489 and its prodrug CS-8958 to neuraminidase of pathogenic influenza viruses by molecular dynamics simulations. {yields} It is shown that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. {yields} We predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus. {yields} The high correlation between theoretical and experimental data implies that SMD is a very promising tool for drug design. -- Abstract: Two neuraminidase inhibitors, oseltamivir and zanamivir, are important drug treatments for influenza. Oseltamivir-resistant mutants of the influenzamore » virus A/H1N1 and A/H5N1 have emerged, necessitating the development of new long-acting antiviral agents. One such agent is a new neuraminidase inhibitor R-125489 and its prodrug CS-8958. An atomic level understanding of the nature of this antiviral agents binding is still missing. We address this gap in our knowledge by applying steered molecular dynamics (SMD) simulations to different subtypes of seasonal and highly pathogenic influenza viruses. We show that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. Based on results obtained by SMD and the molecular mechanics-Poisson-Boltzmann surface area method, we predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus as its binding affinity does not vary much across these systems. The high correlation level between theoretically determined rupture forces and experimental data on binding energies for the large number of systems studied here implies that SMD is a promising tool for drug design.« less

Comparison of Conjugate Gradient Density Matrix Search and Chebyshev Expansion Methods for Avoiding Diagonalization in Large-Scale Electronic Structure Calculations

NASA Technical Reports Server (NTRS)

Bates, Kevin R.; Daniels, Andrew D.; Scuseria, Gustavo E.

1998-01-01

We report a comparison of two linear-scaling methods which avoid the diagonalization bottleneck of traditional electronic structure algorithms. The Chebyshev expansion method (CEM) is implemented for carbon tight-binding calculations of large systems and its memory and timing requirements compared to those of our previously implemented conjugate gradient density matrix search (CG-DMS). Benchmark calculations are carried out on icosahedral fullerenes from C60 to C8640 and the linear scaling memory and CPU requirements of the CEM demonstrated. We show that the CPU requisites of the CEM and CG-DMS are similar for calculations with comparable accuracy.

The relationship between water binding and desiccation tolerance in tissues

NASA Technical Reports Server (NTRS)

Vertucci, C. W.; Leopold, A. C.

1987-01-01

In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.

Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

NASA Astrophysics Data System (ADS)

Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

2013-07-01

We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.

FAST TRACK COMMUNICATION: Finite-temperature magnetism in bcc Fe under compression

NASA Astrophysics Data System (ADS)

Sha, Xianwei; Cohen, R. E.

2010-09-01

We investigate the contributions of finite-temperature magnetic fluctuations to the thermodynamic properties of bcc Fe as functions of pressure. First, we apply a tight-binding total-energy model parameterized to first-principles linearized augmented plane-wave computations to examine various ferromagnetic, anti-ferromagnetic, and noncollinear spin spiral states at zero temperature. The tight-binding data are fit to a generalized Heisenberg Hamiltonian to describe the magnetic energy functional based on local moments. We then use Monte Carlo simulations to compute the magnetic susceptibility, the Curie temperature, heat capacity, and magnetic free energy. Including the finite-temperature magnetism improves the agreement with experiment for the calculated thermal expansion coefficients.

Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

PubMed

Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

PubMed

Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

2005-06-01

A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

Weak partitioning chromatography for anion exchange purification of monoclonal antibodies.

PubMed

Kelley, Brian D; Tobler, Scott A; Brown, Paul; Coffman, Jonathan L; Godavarti, Ranga; Iskra, Timothy; Switzer, Mary; Vunnum, Suresh

2008-10-15

Weak partitioning chromatography (WPC) is an isocratic chromatographic protein separation method performed under mobile phase conditions where a significant amount of the product protein binds to the resin, well in excess of typical flowthrough operations. The more stringent load and wash conditions lead to improved removal of more tightly binding impurities, although at the cost of a reduction in step yield. The step yield can be restored by extending the column load and incorporating a short wash at the end of the load stage. The use of WPC with anion exchange resins enables a two-column cGMP purification platform to be used for many different mAbs. The operating window for WPC can be easily established using high throughput batch-binding screens. Under conditions that favor very strong product binding, competitive effects from product binding can give rise to a reduction in column loading capacity. Robust performance of WPC anion exchange chromatography has been demonstrated in multiple cGMP mAb purification processes. Excellent clearance of host cell proteins, leached Protein A, DNA, high molecular weight species, and model virus has been achieved. (c) 2008 Wiley Periodicals, Inc.

Computational Nanotechnology Program

NASA Technical Reports Server (NTRS)

Scuseria, Gustavo E.

1997-01-01

The objectives are: (1) development of methodological and computational tool for the quantum chemistry study of carbon nanostructures and (2) development of the fundamental understanding of the bonding, reactivity, and electronic structure of carbon nanostructures. Our calculations have continued to play a central role in understanding the outcome of the carbon nanotube macroscopic production experiment. The calculations on buckyonions offer the resolution of a long controversy between experiment and theory. Our new tight binding method offers increased speed for realistic simulations of large carbon nanostructures.

III-Nitride, SiC and Diamond Materials for Electronic Devices. Symposium Held April 8-12 1996, San Francisco, California, U.S.A. Volume 423.

DTIC Science & Technology

1996-12-01

gallium, nitrogen and gallium nitride structures. Thus it can be shown to be transferable and efficient for predictive molecular -dynamic simulations on...potentials and forces for the molecular dynamics simulations are derived by means of a density-functional based nonorthogonal tight-binding (DF-TB) scheme...LDA). Molecular -dynamics simulations for determining the different reconstructions of the SiC surface use the slab method (two-dimensional periodic

Intermediate band formation in a δ-doped like QW superlattices of GaAs/AlxGa1-xAs for solar cell design

NASA Astrophysics Data System (ADS)

Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.

2018-03-01

It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

PubMed Central

1988-01-01

We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

PubMed Central

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-01-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

PubMed

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-06-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

Tight Junction–Associated Signaling Pathways Modulate Cell Proliferation in Uveal Melanoma

PubMed Central

Jayagopal, Ashwath; Yang, Jin-Long; Haselton, Frederick R.; Chang, Min S.

2011-01-01

Purpose. To investigate the role of tight junction (TJ)–associated signaling pathways in the proliferation of uveal melanoma. Methods. Human uveal melanoma cell lines overexpressing the TJ molecule blood vessel epicardial substance (Bves) were generated. The effects of Bves overexpression on TJ protein expression, cell proliferation, and cell cycle distribution were quantified. In addition, localization and transcription activity of the TJ-associated protein ZO-1–associated nucleic acid binding protein (ZONAB) were evaluated using immunofluorescence and bioluminescence reporter assays to study the involvement of Bves signaling in cell proliferation-associated pathways. Results. Bves overexpression in uveal melanoma cell lines resulted in increased expression of the TJ proteins occludin and ZO-1, reduced cell proliferation, and increased sequestration of ZONAB at TJs and reduced ZONAB transcriptional activity. Conclusions. TJ proteins are present in uveal melanoma, and TJ-associated signaling pathways modulate cell signaling pathways relevant to proliferation in uveal melanoma. PMID:20861479

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.; Ring, D.M.

We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

2016-10-15

Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.

Optimization of binding electrostatics: Charge complementarity in the barnase-barstar protein complex

PubMed Central

lee, Lee-Peng; Tidor, Bruce

2001-01-01

Theoretical and experimental studies have shown that the large desolvation penalty required for polar and charged groups frequently precludes their involvement in electrostatic interactions that contribute strongly to net stability in the folding or binding of proteins in aqueous solution near room temperature. We have previously developed a theoretical framework for computing optimized electrostatic interactions and illustrated use of the algorithm with simplified geometries. Given a receptor and model assumptions, the method computes the ligand-charge distribution that provides the most favorable balance of desolvation and interaction effects on binding. In this paper the method has been extended to treat complexes using actual molecular shapes. The barnase-barstar protein complex was investigated with barnase treated as a target receptor. The atomic point charges of barstar were varied to optimize the electrostatic binding free energy. Barnase and natural barstar form a tight complex (Kd ∼ 10−14 M) with many charged and polar groups near the interface that make this a particularly relevant system for investigating the role of electrostatic effects on binding. The results show that sets of barstar charges (resulting from optimization with different constraints) can be found that give rise to relatively large predicted improvements in electrostatic binding free energy. Principles for enhancing the effect of electrostatic interactions in molecular binding in aqueous environments are discussed in light of the optima. Our findings suggest that, in general, the enhancements in electrostatic binding free energy resulting from modification of polar and charged groups can be substantial. Moreover, a recently proposed definition of electrostatic complementarity is shown to be a useful tool for examining binding interfaces. Finally, calculational results suggest that wild-type barstar is closer to being affinity optimized than is barnase for their mutual binding, consistent with the known roles of these proteins. PMID:11266622

Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

PubMed Central

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-01-01

Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539

Physics and performances of III-V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations.

PubMed

Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M

2018-06-27

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

Maximally localized Wannier functions in LaMnO3 within PBE + U, hybrid functionals and partially self-consistent GW: an efficient route to construct ab initio tight-binding parameters for eg perovskites.

PubMed

Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G

2012-06-13

Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.

Physics and performances of III–V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations

NASA Astrophysics Data System (ADS)

Afzalian, A.; Vasen, T.; Ramvall, P.; Shen, T.-M.; Wu, J.; Passlack, M.

2018-06-01

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III–V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III–V GAA nanowire HTFETs including the effect of electron–phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

Stability and electronic properties of oxygen-doped ZnS polytypes: DFTB study

NASA Astrophysics Data System (ADS)

Popov, Ilya S.; Vorokh, Andrey S.; Enyashin, Andrey N.

2018-06-01

Synthesis from aqueous solutions is an affordable method for fabrication of II-VI semiconductors. However, application of this method often imposes a disorder of crystal lattice, manifesting as a rich variety of polytypes arising from wurtzite and zinc blende phases. The origin of this disordering still remains debatable. Here, the influence of the most likely impurity at water environment - substitutional oxygen - on the polytypic equilibrium of zinc sulphide is studied by means of density-functional tight-binding method. According to calculations, the inclusion of such oxygen does not affect the polytypic equilibrium. Apart of thermodynamic stability, the electronic and elastic properties of ZnS polytypes are studied as the function of oxygen distribution.

Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion

PubMed Central

Stefanski, Adrianne L.; McManaman, James L.

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572

Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

PubMed

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

2012-12-04

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

PubMed Central

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

2014-01-01

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis.

PubMed

He, J; Cooper, H M; Reyes, A; Di Re, M; Sembongi, H; Litwin, T R; Gao, J; Neuman, K C; Fearnley, I M; Spinazzola, A; Walker, J E; Holt, I J

2012-07-01

Mitochondrial ribosomes and translation factors co-purify with mitochondrial nucleoids of human cells, based on affinity protein purification of tagged mitochondrial DNA binding proteins. Among the most frequently identified proteins were ATAD3 and prohibitin, which have been identified previously as nucleoid components, using a variety of methods. Both proteins are demonstrated to be required for mitochondrial protein synthesis in human cultured cells, and the major binding partner of ATAD3 is the mitochondrial ribosome. Altered ATAD3 expression also perturbs mtDNA maintenance and replication. These findings suggest an intimate association between nucleoids and the machinery of protein synthesis in mitochondria. ATAD3 and prohibitin are tightly associated with the mitochondrial membranes and so we propose that they support nucleic acid complexes at the inner membrane of the mitochondrion.

A combined representation method for use in band structure calculations. 1: Method

NASA Technical Reports Server (NTRS)

Friedli, C.; Ashcroft, N. W.

1975-01-01

A representation was described whose basis levels combine the important physical aspects of a finite set of plane waves with those of a set of Bloch tight-binding levels. The chosen combination has a particularly simple dependence on the wave vector within the Brillouin Zone, and its use in reducing the standard one-electron band structure problem to the usual secular equation has the advantage that the lattice sums involved in the calculation of the matrix elements are actually independent of the wave vector. For systems with complicated crystal structures, for which the Korringa-Kohn-Rostoker (KKR), Augmented-Plane Wave (APW) and Orthogonalized-Plane Wave (OPW) methods are difficult to apply, the present method leads to results with satisfactory accuracy and convergence.

Interface Schottky barrier engineering via strain in metal-semiconductor composites

NASA Astrophysics Data System (ADS)

Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao

2016-01-01

The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k

Oxidation of Са2+-Binding Domain of NADPH Oxidase 5 (NOX5): Toward Understanding the Mechanism of Inactivation of NOX5 by ROS.

PubMed

Petrushanko, Irina Yu; Lobachev, Vladimir M; Kononikhin, Alexey S; Makarov, Alexander A; Devred, Francois; Kovacic, Hervé; Kubatiev, Aslan A; Tsvetkov, Philipp O

2016-01-01

NOX5 protein, one of the most active generators of reactive oxygen species (ROS), plays an important role in many processes, including regulation of cell growth, death and differentiation. Because of its central role in ROS generation, it needs to be tightly regulated to guarantee cellular homeostasis. Contrary to other members of NADPH-oxidases family, NOX5 has its own regulatory calcium-binding domain and thus could be activated directly by calcium ions. While several mechanisms of activation have been described, very little is known about the mechanisms that could prevent the overproduction of ROS by NOX5. In the present study using calorimetric methods and circular dichroism we found that oxidation of cysteine and methionine residues of NOX5 decreases binding of Ca2+ ions and perturbs both secondary and tertiary structure of protein. Our data strongly suggest that oxidation of calcium-binding domain of NOX5 could be implicated in its inactivation, serving as a possible defense mechanism against oxidative stress.

Vacancy Mediated Mechanism of Nitrogen Substitution in Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu; Sadanadan, Bindu; Rao, Apparao M.

2003-01-01

Nitrogen substitution reaction in a graphene sheet and carbon nanotubes of different diameter are investigated using the generalized tight-binding molecular dynamics method. The formation of a vacancy in curved graphene sheet or a carbon nanotube is found to cause a curvature dependent local reconstruction of the surface. Our simulations and analysis show that vacancy mediated N substitution (rather than N chemisorption) is favored on the surface of nanotubes with diameter larger than 8 nm. This predicted value of the critical minimum diameter for N incorporation is confirmed by experimental results presented.

Atomic Structure and Properties of Extended Defects in Silicon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buczko, R.; Chisholm, M.F.; Kaplan, T.

1998-10-15

The Z-contrast technique represents a new approach to high-resolution electron microscopy allowing for the first time incoherent imaging of materials on the atomic scale. The key advantages of the technique, an intrinsically higher resolution limit and directly interpretable, compositionally sensitive imaging, allow a new level of insight into the atomic configurations of extended defects in silicon. This experimental technique has been combined with theoretical calculations (a combination of first principles, tight binding, and classical methods) to extend this level of insight by obtaining the energetic and electronic structure of the defects.

Polarizable atomistic calculation of site energy disorder in amorphous Alq3.

PubMed

Nagata, Yuki

2010-02-01

A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.

Investigation of the effect of scattering centers on low dimensional nanowire channel

NASA Astrophysics Data System (ADS)

Cariappa, K. S.; Shukla, Raja; Sarkar, Niladri

2018-05-01

In this work, we studied the effect of scattering centers on the electron density profiles of a one dimensional Nanowire channel. Density Matrix Formalism is used for calculating the local electron densities at room temperature. Various scattering centers have been simulated in the channel. The nearest neighbor tight binding method is applied to construct the Hamiltonian of nanoscale devices. We invoke scattering centers by adding local scattering potentials to the Hamiltonian. This analysis could give an insight into the understanding and utilization of defects for device engineering.

Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle

2010-07-23

Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less

The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

PubMed

Tsapara, Anna; Matter, Karl; Balda, Maria S

2006-03-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

PubMed Central

Tsapara, Anna; Matter, Karl; Balda, Maria S.

2006-01-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

Pseudo-magnetic fields of strongly-curved graphene nanobubbles

NASA Astrophysics Data System (ADS)

Liu, Li-Chi

2018-04-01

We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.

Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

NASA Astrophysics Data System (ADS)

Venkataraman, Vijay Shankar

The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.

Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots.

PubMed

Douglas-Gallardo, Oscar A; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

2018-04-14

Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

Dynamic CRM occupancy reflects a temporal map of developmental progression.

PubMed

Wilczyński, Bartek; Furlong, Eileen E M

2010-06-22

Development is driven by tightly coordinated spatio-temporal patterns of gene expression, which are initiated through the action of transcription factors (TFs) binding to cis-regulatory modules (CRMs). Although many studies have investigated how spatial patterns arise, precise temporal control of gene expression is less well understood. Here, we show that dynamic changes in the timing of CRM occupancy is a prevalent feature common to all TFs examined in a developmental ChIP time course to date. CRMs exhibit complex binding patterns that cannot be explained by the sequence motifs or expression of the TFs themselves. The temporal changes in TF binding are highly correlated with dynamic patterns of target gene expression, which in turn reflect transitions in cellular function during different stages of development. Thus, it is not only the timing of a TF's expression, but also its temporal occupancy in refined time windows, which determines temporal gene expression. Systematic measurement of dynamic CRM occupancy may therefore serve as a powerful method to decode dynamic changes in gene expression driving developmental progression.

Structure of an E. coli integral membrane sulfurtransferase and its structural transition upon SCN- binding defined by EPR-based hybrid method

NASA Astrophysics Data System (ADS)

Ling, Shenglong; Wang, Wei; Yu, Lu; Peng, Junhui; Cai, Xiaoying; Xiong, Ying; Hayati, Zahra; Zhang, Longhua; Zhang, Zhiyong; Song, Likai; Tian, Changlin

2016-01-01

Electron paramagnetic resonance (EPR)-based hybrid experimental and computational approaches were applied to determine the structure of a full-length E. coli integral membrane sulfurtransferase, dimeric YgaP, and its structural and dynamic changes upon ligand binding. The solution NMR structures of the YgaP transmembrane domain (TMD) and cytosolic catalytic rhodanese domain were reported recently, but the tertiary fold of full-length YgaP was not yet available. Here, systematic site-specific EPR analysis defined a helix-loop-helix secondary structure of the YagP-TMD monomers using mobility, accessibility and membrane immersion measurements. The tertiary folds of dimeric YgaP-TMD and full-length YgaP in detergent micelles were determined through inter- and intra-monomer distance mapping and rigid-body computation. Further EPR analysis demonstrated the tight packing of the two YgaP second transmembrane helices upon binding of the catalytic product SCN-, which provides insight into the thiocyanate exportation mechanism of YgaP in the E. coli membrane.

Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots

NASA Astrophysics Data System (ADS)

Douglas-Gallardo, Oscar A.; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

2018-04-01

Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

NASA Astrophysics Data System (ADS)

Jahangiri, Soran; Mosey, Nicholas J.

2018-01-01

Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

NASA Astrophysics Data System (ADS)

Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

2018-02-01

We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.

Tight-Binding Study of Polarons in Two-Dimensional Systems: Implications for Organic Field-Effect Transistor Materials

NASA Astrophysics Data System (ADS)

Lei, Jie

2011-03-01

In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.

Improved nonorthogonal tight-binding Hamiltonian for molecular-dynamics simulations of silicon clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordejon, P.; Lebedenko, D.; Menon, M.

1994-08-15

We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v

A Model for Predicting Thermoelectric Properties of Bi2Te3

NASA Technical Reports Server (NTRS)

Lee, Seungwon; VonAllmen, Paul

2009-01-01

A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.

Density function theory study of the adsorption and dissociation of carbon monoxide on tungsten nanoparticles.

PubMed

Weng, Meng-Hsiung; Ju, Shin-Pon; Chen, Hsin-Tsung; Chen, Hui-Lung; Lu, Jian-Ming; Lin, Ken-Huang; Lin, Jenn-Sen; Hsieh, Jin-Yuan; Yang, Hsi-Wen

2013-02-01

The adsorption and dissociation properties of carbon monoxide (CO) molecule on tungsten W(n) (n = 10-15) nanoparticles have been investigated by density-functional theory (DFT) calculations. The lowest-energy structures for W(n) (n = 10-15) nanoparticles are found by the basin-hopping method and big-bang method with the modified tight-binding many-body potential. We calculated the corresponding adsorption energies, C-O bond lengths and dissociation barriers for adsorption of CO on nanoparticles. The electronic properties of CO on nanoparticles are studied by the analysis of density of state and charge density. The characteristic of CO on W(n) nanoparticles are also compared with that of W bulk.

Visualization of atomic-scale phenomena in superconductors: application to FeSe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas

Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less

Visualization of atomic-scale phenomena in superconductors: application to FeSe

DOE PAGES

Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas; ...

2014-10-31

Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less

Transformation and fate of 2,4,6-trinitrotoluene (TNT) in anaerobic bioslurry reactors under various aeration schemes: implications for the decontamination of soils.

PubMed

Newcombe, David A; Crawford, Ronald L

2007-12-01

Energetic compounds have been used in a variety of industrial and military applications worldwide leading to widespread environmental contamination. Many of these compounds are toxic and resist degradation by oxidative enzymes resulting in a need for alternative remediation methods. It has been shown that trinitrotoluene (TNT)-contaminated soil subjected to treatment in strictly anaerobic bioreactors results in tight binding of TNT transformation products to soil organic matter. The research presented here examined the fate of TNT and its metabolites in bioreactors under three different aeration regimes. In all treatment regimes, the typical metabolites of aminodinitrotoluenes and diaminonitrotoluenes were observed prior to irreversible binding into the soil fraction of the slurry. Significant transformation of TNT into organic acids or simple diols, as others report in prior work, was not observed in any of the treatments and is an unlikely fate of TNT in anaerobic soil slurries. These results indicate that aeration does not dramatically affect transformation or fate of TNT in reactor systems that receive a rich carbon source but does affect the rate at which metabolites become tightly bound to the soil. The most rapid transformations and lowest redox potentials were observed in reactors in which an aerobic headspace was maintained suggesting that aerobes play a role in establishing conditions that are most conducive to TNT reduction.

Long-range correction for tight-binding TD-DFT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

2015-10-07

We present two improvements to the tight-binding approximation of time-dependent density functional theory (TD-DFTB): First, we add an exact Hartree-Fock exchange term, which is switched on at large distances, to the ground state Hamiltonian and similarly to the coupling matrix that enters the linear response equations for the calculation of excited electronic states. We show that the excitation energies of charge transfer states are improved relative to the standard approach without the long-range correction by testing the method on a set of molecules from the database in Peach et al. [J. Chem. Phys. 128, 044118 (2008)] which are known tomore » exhibit problematic charge transfer states. The degree of spatial overlap between occupied and virtual orbitals indicates where TD-DFTB and long-range corrected TD-DFTB (lc-TD-DFTB) can be expected to produce large errors. Second, we improve the calculation of oscillator strengths. The transition dipoles are obtained from Slater Koster files for the dipole matrix elements between valence orbitals. In particular, excitations localized on a single atom, which appear dark when using Mulliken transition charges, acquire a more realistic oscillator strength in this way. These extensions pave the way for using lc-TD-DFTB to describe the electronic structure of large chromophoric polymers, where uncorrected TD-DFTB fails to describe the high degree of conjugation and produces spurious low-lying charge transfer states.« less

Improving Density Functional Tight Binding Predictions of Free Energy Surfaces for Slow Chemical Reactions in Solution

NASA Astrophysics Data System (ADS)

Kroonblawd, Matthew; Goldman, Nir

2017-06-01

First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for reactions that are fast relative to DFT simulation times (<10 ps), but the effects on slow reactions and the free energy surface are not well-known. We present a force matching approach to improve the chemical accuracy of DFTB. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

Improving density functional tight binding predictions of free energy surfaces for peptide condensation reactions in solution

NASA Astrophysics Data System (ADS)

Kroonblawd, Matthew; Goldman, Nir

First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for chemistry that is fast relative to DFT simulation times (<10 ps), but the effects on slow chemistry and the free energy surface are not well-known. We present a force matching approach to increase the accuracy of DFTB predictions for free energy surfaces. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials without a priori knowledge of transition states. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT results for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.

PubMed

Vetrano, Stefania; Danese, Silvio

2009-05-01

Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.

Application of a 1.48-microm diode laser for bisecting oocytes into two identical hemizonae for the hemizona assay.

PubMed

Edenfeld, J; Schöpper, B; Sturm, R; Diedrich, K; Al-Hasani, S

2002-04-01

Laser systems are very promising new technical tools in assisted reproduction. It was investigated if laser radiation can replace the mechanical cutting procedure via micromanipulator in the hemizona assay (HZA), a commonly used bioassay to determine the sperm-zona pellucida binding capacity. An oocyte was bisected precisely into two identical hemizonae with approximately 20 laser pulses (pulse length 30 msec) using a 1.48-microm diode laser. Compared with the conventional method using microscalpels for zona bisection, laser treated hemizonae showed equivalent sperm-binding and within the two groups there was no detectable difference between matching hemizonae in their capacity for tight sperm-binding. To evaluate whether laser radiation affects the outcome of the HZA when effects of certain substances are investigated, the spermatozoa were preincubated with human follicular fluid (hFF), which inhibits the binding of spermatozoa to zona pellucida in vitro. Supplementation with follicular fluid exerted an inhibitory effect in both groups. The hemizona index (HZI) showed no statistical differences between the two methods. Therefore, the 1.48-microm diode laser is a suitable new instrument for generating equally sized hemizonae. There is no use for holding pipettes and microscalpels, on the contrary, for performing the HZA the laser is a precise, very quick and easy to use new working tool.

Electronic instability and change of crystalline phase in compounds of the V3Si type at low temperature

NASA Technical Reports Server (NTRS)

Labbe, J.; Friedel, J.

1978-01-01

In V3Si, the V atoms form an array of dense linear chains; a tight-binding approximation in one dimension was used to describe the d electrons. The electronic energy calculated by this method was reduced when the lattice is deformed. This lead to a band type of the Jahn Teller effect, which may explain the cubic to tetragonal transition which was observed at low temperatures. The theory can be extended to other superconductors of the V3X type when X=Ga, Ge, Sn, etcetera, or NB3SN.

Generalized Kubo formulas for the transport properties of incommensurate 2D atomic heterostructures

NASA Astrophysics Data System (ADS)

Cancès, Eric; Cazeaux, Paul; Luskin, Mitchell

2017-06-01

We give an exact formulation for the transport coefficients of incommensurate two-dimensional atomic multilayer systems in the tight-binding approximation. This formulation is based upon the C* algebra framework introduced by Bellissard and collaborators [Coherent and Dissipative Transport in Aperiodic Solids, Lecture Notes in Physics (Springer, 2003), Vol. 597, pp. 413-486 and J. Math. Phys. 35(10), 5373-5451 (1994)] to study aperiodic solids (disordered crystals, quasicrystals, and amorphous materials), notably in the presence of magnetic fields (quantum Hall effect). We also present numerical approximations and test our methods on a one-dimensional incommensurate bilayer system.

Study on spin filtering and switching action in a double-triangular network chain

NASA Astrophysics Data System (ADS)

Zhang, Yongmei

2018-04-01

Spin transport properties of a double-triangular quantum network with local magnetic moment on backbones and magnetic flux penetrating the network plane are studied. Numerical simulation results show that such a quantum network will be a good candidate for spin filter and spin switch. Local dispersion and density of states are considered in the framework of tight-binding approximation. Transmission coefficients are calculated by the method of transfer matrix. Spin transmission is regulated by substrate magnetic moment and magnetic flux piercing those triangles. Experimental realization of such theoretical research will be conducive to designing of new spintronic devices.

Anisotropic Nanomechanics of Boron Nitride Nanotubes: Nanostructured "Skin" Effect

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu; Cho, KyeongJae

2000-01-01

The stiffness and plasticity of boron nitride nanotubes are investigated using generalized tight-binding molecular dynamics and ab-initio total energy methods. Due to boron-nitride BN bond buckling effects, compressed zigzag BN nanotubes are found to undergo novel anisotropic strain release followed by anisotropic plastic buckling. The strain is preferentially released towards N atoms in the rotated BN bonds. The tubes buckle anisotropically towards only one end when uniaxially compressed from both. A "skin-effect" model of smart nanocomposite materials is proposed which will localize the structural damage towards the 'skin' or surface side of the material.

Phosphorene quantum dot-fullerene nanocomposites for solar energy conversion: An unexplored inorganic-organic nanohybrid with novel photovoltaic properties

NASA Astrophysics Data System (ADS)

Rajbanshi, Biplab; Kar, Moumita; Sarkar, Pallavi; Sarkar, Pranab

2017-10-01

Using the self-consistent charge density-functional based tight-binding (SCC-DFTB) method, coupled with time-dependent density functional theory (TDDFT) calculations, for the first time we explore the possibility of use of phosphorene quantum dots in solar energy harvesting devices. The phosphorene quantum dots-fullerene (PQDs-PCBA) nanocomposites show type-II band alignment indicating spatial separation of charge carriers. The TDDFT calculations also show that the PQD-fullerene nanocomposites seem to be exciting material for future generation solar energy harvester, with extremely fast charge transfer and very poor recombination rate.

Nuclear magnetic resonance and restrained molecular dynamics studies of the interaction of an epidermal growth factor-derived peptide with protein tyrosine phosphatase 1B.

PubMed

Glover, N R; Tracey, A S

1999-04-20

The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.

Performance of the DFTB method in comparison to DFT and semiempirical methods for geometries and energies of C20-C86fullerene isomers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Guishan; Irle, Stephan; Morokuma, Keiji

2005-07-20

The research described in this product was performed in part in the Environmental Molecular Sciences Laboratory, a national scientific user facility sponsored by the Department of Energy's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory. The performance of both non-iterative (NCC) and self-consistent charge (SCC) versions of the density functional tight binding (DFTB) method, as well as AM1 and PM3 methods, has been compared with the B3LYP method, a hybrid density functional theory (DFT) method, for equilibrium geometries and relative energies of various isomers of C20–C86 fullerenes. Both NCC- and SCCDFTB methods compare very favorablymore » with B3LYP both in geometries and isomer relative energies, while AM1 and PM3 do noticeably worse.« less

Exact evaluation of the causal spectrum and localization properties of electronic states on a scale-free network

NASA Astrophysics Data System (ADS)

Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.

2018-07-01

A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.

Magnetic quantization in monolayer bismuthene

NASA Astrophysics Data System (ADS)

Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa

The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.

Chirality dependence of dipole matrix element of carbon nanotubes in axial magnetic field: A third neighbor tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.

Electro-optical properties of zigzag and armchair boron nitride nanotubes under a transverse electric field: Tight binding calculations

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2012-02-01

The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. II. Application—Effect of quantum confinement and homogeneous strain on Cu conductance

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard

2014-03-01

The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.

Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices

NASA Astrophysics Data System (ADS)

Graefe, E. M.; Korsch, H. J.; Rush, A.

2016-07-01

Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuevas, F.A.; Curilef, S., E-mail: scurilef@ucn.cl; Plastino, A.R., E-mail: arplastino@ugr.es

The spread of a wave-packet (or its deformation) is a very important topic in quantum mechanics. Understanding this phenomenon is relevant in connection with the study of diverse physical systems. In this paper we apply various 'spreading measures' to characterize the evolution of an initially localized wave-packet in a tight-binding lattice, with special emphasis on information-theoretical measures. We investigate the behavior of both the probability distribution associated with the wave packet and the concomitant probability current. Complexity measures based upon Renyi entropies appear to be particularly good descriptors of the details of the delocalization process. - Highlights: > Spread ofmore » highly localized wave-packet in the tight-binding lattice. > Entropic and information-theoretical characterization is used to understand the delocalization. > The behavior of both the probability distribution and the concomitant probability current is investigated. > Renyi entropies appear to be good descriptors of the details of the delocalization process.« less

Generalized virial theorem for massless electrons in graphene and other Dirac materials

NASA Astrophysics Data System (ADS)

Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

2016-05-01

The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.

Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

NASA Astrophysics Data System (ADS)

Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

2017-03-01

Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.

Simulation and experimental analysis of nanoindentation and mechanical properties of amorphous NiAl alloys.

PubMed

Wang, Chih-Hao; Fang, Te-Hua; Cheng, Po-Chien; Chiang, Chia-Chin; Chao, Kuan-Chi

2015-06-01

This paper used numerical and experimental methods to investigate the mechanical properties of amorphous NiAl alloys during the nanoindentation process. A simulation was performed using the many-body tight-binding potential method. Temperature, plastic deformation, elastic recovery, and hardness were evaluated. The experimental method was based on nanoindentation measurements, allowing a precise prediction of Young's modulus and hardness values for comparison with the simulation results. The indentation simulation results showed a significant increase of NiAl hardness and elastic recovery with increasing Ni content. Furthermore, the results showed that hardness and Young's modulus increase with increasing Ni content. The simulation results are in good agreement with the experimental results. Adhesion test of amorphous NiAl alloys at room temperature is also described in this study.

Non-equilibrium Green's functions method: Non-trivial and disordered leads

NASA Astrophysics Data System (ADS)

He, Yu; Wang, Yu; Klimeck, Gerhard; Kubis, Tillmann

2014-11-01

The non-equilibrium Green's function algorithm requires contact self-energies to model charge injection and extraction. All existing approaches assume infinitely periodic leads attached to a possibly quite complex device. This contradicts today's realistic devices in which contacts are spatially inhomogeneous, chemically disordered, and impacting the overall device characteristics. This work extends the complex absorbing potentials method for arbitrary, ideal, or non-ideal leads in atomistic tight binding representation. The algorithm is demonstrated on a Si nanowire with periodic leads, a graphene nanoribbon with trumpet shape leads, and devices with leads of randomly alloyed Si0.5Ge0.5. It is found that alloy randomness in the leads can reduce the predicted ON-state current of Si0.5Ge0.5 transistors by 45% compared to conventional lead methods.

Theoretical Studies about Adsorption on Silicon Surface

NASA Astrophysics Data System (ADS)

Huang, Yan; Chen, Xiaoshuang; Zhu, Xiao Yan; Duan, He; Zhou, Xiao Hao; Lu, Wei

In this review paper, we address the important research topic of adsorption on the silicon surface. The deposition of single Si ad-species (adatom and ad-dimer) on the p(2×2) reconstructed Si(100) surface has been simulated by the empirical tight-binding method. Using the clean and defective Si surfaces as the deposition substrates, the deposition energies are mapped out around the clean surface, dimer vacancies, steps and kink structures. The binding sites, saddle points and several possible diffusion paths are obtained from the calculated energy. With further analysis of the deposition and diffusion behaviors, the influences of the surface defects can be found. Then, by adopting the first-principle calculations, the adsorptions of the II-VI group elements on the clean and As-passivated Si(211) substrates have been calculated as the example of adsorption on the high-miller-index Si surface.

Trapping of the Enoyl-Acyl Carrier Protein Reductase–Acyl Carrier Protein Interaction

PubMed Central

Tallorin, Lorillee; Finzel, Kara; Nguyen, Quynh G.; Beld, Joris; La Clair, James J.; Burkart, Michael D.

2016-01-01

An ideal target for metabolic engineering, fatty acid biosynthesis remains poorly understood on a molecular level. These carrier protein-dependent pathways require fundamental protein–protein interactions to guide reactivity and processivity, and their control has become one of the major hurdles in successfully adapting these biological machines. Our laboratory has developed methods to prepare acyl carrier proteins (ACPs) loaded with substrate mimetics and cross-linkers to visualize and trap interactions with partner enzymes, and we continue to expand the tools for studying these pathways. We now describe application of the slow-onset, tight-binding inhibitor triclosan to explore the interactions between the type II fatty acid ACP from Escherichia coli, AcpP, and its corresponding enoyl-ACP reductase, FabI. We show that the AcpP–triclosan complex demonstrates nM binding, inhibits in vitro activity, and can be used to isolate FabI in complex proteomes. PMID:26938266

Modeling chain folding in protein-constrained circular DNA.

PubMed Central

Martino, J A; Olson, W K

1998-01-01

An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675

Transition States and transition state analogue interactions with enzymes.

PubMed

Schramm, Vern L

2015-04-21

Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.

Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2

PubMed Central

Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.

2009-01-01

Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464

Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

PubMed

Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

2017-11-16

The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

PubMed Central

Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

2009-01-01

8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165

Molecular dynamics simulations of the amino acid-ZnO (10-10) interface: a comparison between density functional theory and density functional tight binding results.

PubMed

grosse Holthaus, Svea; Köppen, Susan; Frauenheim, Thomas; Ciacchi, Lucio Colombi

2014-06-21

We investigate the adsorption behavior of four different amino acids (glutamine, glutamate, serine, cysteine) on the zinc oxide (101̄0) surface, comparing the geometry and energy associated with a number of different adsorption configurations. In doing this, we highlight the benefits and limits of using density-functional tight-binding (DFTB) with respect to standard density functional theory (DFT). The DFTB method is found to reliably reproduce the DFT adsorption geometries. Analysis of the adsorption configurations emphasizes the fundamental role of the first hydration layer in mediating the interactions between the amino acids and the surface. Direct surface-molecule bonds are found to form predominantly via the carboxylate groups of the studied amino acids. No surface-mediated chemical reactions are observed, with the notable exception of a proton transfer from the thiol group of cysteine to a hydroxyl group of the surface hydration layer. The adsorption energies are found to be dominated both by the formation of direct or indirect surface-molecule hydrogen bonds, but also by the rearrangement of the hydrogen-bond network in surface proximity in a non-intuitive way. Energetic comparisons between DFTB and DFT are made difficult on one side by the long time necessary to achieve convergence of potential energy values in MD simulations and on the other side by the necessity of including higher-order corrections to DFTB to obtain a good description of the hydrogen bond energetics. Overall, our results suggest that DFTB is a good reference method to set the correct chemical states and the initial geometries of hybrid biomolecule/ZnO systems to be simulated with non-reactive force fields.

Molecular dynamics simulations of the amino acid-ZnO (10-10) interface: A comparison between density functional theory and density functional tight binding results

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holthaus, Svea große; Köppen, Susan, E-mail: koeppen@hmi.uni-bremen.de; Frauenheim, Thomas

2014-06-21

We investigate the adsorption behavior of four different amino acids (glutamine, glutamate, serine, cysteine) on the zinc oxide (101{sup ¯}0) surface, comparing the geometry and energy associated with a number of different adsorption configurations. In doing this, we highlight the benefits and limits of using density-functional tight-binding (DFTB) with respect to standard density functional theory (DFT). The DFTB method is found to reliably reproduce the DFT adsorption geometries. Analysis of the adsorption configurations emphasizes the fundamental role of the first hydration layer in mediating the interactions between the amino acids and the surface. Direct surface-molecule bonds are found to formmore » predominantly via the carboxylate groups of the studied amino acids. No surface-mediated chemical reactions are observed, with the notable exception of a proton transfer from the thiol group of cysteine to a hydroxyl group of the surface hydration layer. The adsorption energies are found to be dominated both by the formation of direct or indirect surface-molecule hydrogen bonds, but also by the rearrangement of the hydrogen-bond network in surface proximity in a non-intuitive way. Energetic comparisons between DFTB and DFT are made difficult on one side by the long time necessary to achieve convergence of potential energy values in MD simulations and on the other side by the necessity of including higher-order corrections to DFTB to obtain a good description of the hydrogen bond energetics. Overall, our results suggest that DFTB is a good reference method to set the correct chemical states and the initial geometries of hybrid biomolecule/ZnO systems to be simulated with non-reactive force fields.« less

Antifreeze Protein Binds Irreversibly to Ice

NASA Astrophysics Data System (ADS)

Braslavsky, I.; Pertaya, N.; di Prinzio, C. L.; Wilen, L.; Thomson, E.; Wettlaufer, J. S.; Marshall, C. B.; Davies, P. L.

2006-03-01

Many organisms are protected from freezing by antifreeze proteins (AFPs), which bind to ice and prevent its growth by a mechanism not completely understood. Although it has been postulated that AFPs would have to bind irreversibly to arrest the growth of an ice crystal bathed in excess liquid water, the binding forces seem insufficient to support such a tight interaction. By putting a fluorescent tag on a fish AFP, we were able to visualize AFP binding to ice and demonstrate, by lack of recovery after photo-bleaching, that it is indeed irreversible. Because even the most avid protein/ligand interactions exhibit reversibility, this finding is key to understanding the mechanism of antifreeze proteins, which are becoming increasingly valuable in cryopreservation and improving the frost tolerance of crops.

AFRRI Reports, Second Quarter 1994

DTIC Science & Technology

1994-08-01

the antrum wete immediately placed in sterile 0.9% NaCl, kept on ice, coded, and then prepared for culture, smears, and urease assay by homogeniza...high urease specific activity (>1 |J.mol- min-1 ■ mg protein-1) plus high-affinity substrate binding (Mi- chaelis constant [K^\\ < 1 mmol/L),27 in at...031, respectively), and the characteristic bacterial growth with high-activity product.on of a urease with tight substrate binding " was found in

Triazole biotin: a tight-binding biotinidase-resistant conjugate.

PubMed

Germeroth, Anne I; Hanna, Jill R; Karim, Rehana; Kundel, Franziska; Lowther, Jonathan; Neate, Peter G N; Blackburn, Elizabeth A; Wear, Martin A; Campopiano, Dominic J; Hulme, Alison N

2013-11-28

The natural amide bond found in all biotinylated proteins has been replaced with a triazole through CuAAC reaction of an alkynyl biotin derivative. The resultant triazole-linked adducts are shown to be highly resistant to the ubiquitous hydrolytic enzyme biotinidase and to bind avidin with dissociation constants in the low pM range. Application of this strategy to the production of a series of biotinidase-resistant biotin-Gd-DOTA contrast agents is demonstrated.

Combined first-principles and model Hamiltonian study of the perovskite series R MnO 3 (R =La ,Pr ,Nd ,Sm ,Eu , and Gd )

NASA Astrophysics Data System (ADS)

Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare

2016-02-01

We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.

Neural-network-assisted genetic algorithm applied to silicon clusters

NASA Astrophysics Data System (ADS)

Marim, L. R.; Lemes, M. R.; dal Pino, A.

2003-03-01

Recently, a new optimization procedure that combines the power of artificial neural-networks with the versatility of the genetic algorithm (GA) was introduced. This method, called neural-network-assisted genetic algorithm (NAGA), uses a neural network to restrict the search space and it is expected to speed up the solution of global optimization problems if some previous information is available. In this paper, we have tested NAGA to determine the ground-state geometry of Sin (10⩽n⩽15) according to a tight-binding total-energy method. Our results indicate that NAGA was able to find the desired global minimum of the potential energy for all the test cases and it was at least ten times faster than pure genetic algorithm.

Structure of an E. coli integral membrane sulfurtransferase and its structural transition upon SCN− binding defined by EPR-based hybrid method

PubMed Central

Ling, Shenglong; Wang, Wei; Yu, Lu; Peng, Junhui; Cai, Xiaoying; Xiong, Ying; Hayati, Zahra; Zhang, Longhua; Zhang, Zhiyong; Song, Likai; Tian, Changlin

2016-01-01

Electron paramagnetic resonance (EPR)-based hybrid experimental and computational approaches were applied to determine the structure of a full-length E. coli integral membrane sulfurtransferase, dimeric YgaP, and its structural and dynamic changes upon ligand binding. The solution NMR structures of the YgaP transmembrane domain (TMD) and cytosolic catalytic rhodanese domain were reported recently, but the tertiary fold of full-length YgaP was not yet available. Here, systematic site-specific EPR analysis defined a helix-loop-helix secondary structure of the YagP-TMD monomers using mobility, accessibility and membrane immersion measurements. The tertiary folds of dimeric YgaP-TMD and full-length YgaP in detergent micelles were determined through inter- and intra-monomer distance mapping and rigid-body computation. Further EPR analysis demonstrated the tight packing of the two YgaP second transmembrane helices upon binding of the catalytic product SCN−, which provides insight into the thiocyanate exportation mechanism of YgaP in the E. coli membrane. PMID:26817826

Structure-guided design of an engineered streptavidin with reusability to purify streptavidin-binding peptide tagged proteins or biotinylated proteins.

PubMed

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.

Structure-Guided Design of an Engineered Streptavidin with Reusability to Purify Streptavidin-Binding Peptide Tagged Proteins or Biotinylated Proteins

PubMed Central

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971

Modified Hydra Bioassay to Evaluate the Toxicity of Multiple Mycotoxins and Predict the Detoxification Efficacy of a Clay-Based Sorbent

PubMed Central

Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD

2013-01-01

Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854

Modified hydra bioassay to evaluate the toxicity of multiple mycotoxins and predict the detoxification efficacy of a clay-based sorbent.

PubMed

Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D

2014-01-01

Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. Copyright © 2012 John Wiley & Sons, Ltd.

Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

NASA Astrophysics Data System (ADS)

Tretiak, Sergei

2014-03-01

The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

Slow-binding inhibition of sialidase from influenza virus.

PubMed

Pegg, M S; von Itzstein, M

1994-04-01

Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.

Spiral wound extraction cartridge

DOEpatents

Wisted, Eric E.; Lundquist, Susan H.

1999-01-01

A cartridge device for removing an analyte from a fluid comprises a hollow core, a sheet composite comprising a particulate-loaded porous membrane and optionally at least one reinforcing spacer sheet, the particulate being capable of binding the analyte, the sheet composite being formed into a spiral configuration about the core, wherein the sheet composite is wound around itself and wherein the windings of sheet composite are of sufficient tightness so that adjacent layers are essentially free of spaces therebetween, two end caps which are disposed over the core and the lateral ends of the spirally wound sheet composite, and means for securing the end caps to the core, the end caps also being secured to the lateral ends of the spirally wound sheet composite. A method for removing an analyte from a fluid comprises the steps of providing a spirally wound element of the invention and passing the fluid containing the analyte through the element essentially normal to a surface of the sheet composite so as to bind the analyte to the particulate of the particulate-loaded porous membrane, the method optionally including the step of eluting the bound analyte from the sheet composite.

Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

PubMed

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tight-Binding Inhibition of Human Monoamine Oxidase B by Chromone Analogs: A Kinetic, Crystallographic, and Biological Analysis.

PubMed

Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia

2018-05-10

Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).

Potential evaluation of CO2 storage and enhanced oil recovery of tight oil reservoir in the Ordos Basin, China.

PubMed

Tian, Xiaofeng; Cheng, Linsong; Cao, Renyi; Zhang, Miaoyi; Guo, Qiang; Wang, Yimin; Zhang, Jian; Cui, Yu

2015-07-01

Carbon -di-oxide (CO2) is regarded as the most important greenhouse gas to accelerate climate change and ocean acidification. The Chinese government is seeking methods to reduce anthropogenic CO2 gas emission. CO2 capture and geological storage is one of the main methods. In addition, injecting CO2 is also an effective method to replenish formation energy in developing tight oil reservoirs. However, exiting methods to estimate CO2 storage capacity are all based on the material balance theory. This was absolutely correct for normal reservoirs. However, as natural fractures widely exist in tight oil reservoirs and majority of them are vertical ones, tight oil reservoirs are not close. Therefore, material balance theory is not adaptive. In the present study, a new method to calculate CO2 storage capacity is presented. The CO2 effective storage capacity, in this new method, consisted of free CO2, CO2 dissolved in oil and CO2 dissolved in water. Case studies of tight oil reservoir from Ordos Basin was conducted and it was found that due to far lower viscosity of CO2 and larger solubility in oil, CO2 could flow in tight oil reservoirs more easily. As a result, injecting CO2 in tight oil reservoirs could obviously enhance sweep efficiency by 24.5% and oil recovery efficiency by 7.5%. CO2 effective storage capacity of Chang 7 tight oil reservoir in Longdong area was 1.88 x 10(7) t. The Chang 7 tight oil reservoir in Ordos Basin was estimated to be 6.38 x 10(11) t. As tight oil reservoirs were widely distributed in Songliao Basin, Sichuan Basin and so on, geological storage capacity of CO2 in China is potential.

Conductance of single microRNAs chains related to the autism spectrum disorder

NASA Astrophysics Data System (ADS)

Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.

2014-09-01

The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.

Resonant enhancement of band-to-band tunneling in in-plane MoS2/WS2 heterojunctions

NASA Astrophysics Data System (ADS)

Kuroda, Tatsuya; Mori, Nobuya

2018-04-01

The band-to-band (BTB) tunneling current J through in-plane MoS2/WS2 heterojunctions is calculated by the nonequilibrium Green function method combined with tight-binding approximation. Types A and B of band configurations are considered. For type-A (type-B) heterojunctions, a potential notch exists (or is absent) at the heterointerface. Both type-A and type-B MoS2/WS2 heterojunctions can support a higher BTB current than MoS2 and WS2 homojunctions. For type-A heterojunctions, the resonant enhancement of J occurs resulting in a significantly higher BTB tunneling current.

Electronic topological transitions in Zn under compression

NASA Astrophysics Data System (ADS)

Kechin, Vladimir V.

2001-01-01

The electronic structure of hcp Zn under pressure up to 10 GPa has been calculated self-consistently by means of the scalar relativistic tight-binding linear muffin-tin orbital method. The calculations show that three electronic topological transitions (ETT's) occur in Zn when the c/a axial ratio diminishes under compression. One transition occurs at c/a~=1.82 when the ``needles'' appear around the symmetry point K of the Brillouin zone. The other two transitions occur at c/a~=3, when the ``butterfly'' and ``cigar'' appear simultaneously both around the L point. It has been shown that these ETT's are responsible for a number of anomalies observed in Zn at compression.

Computational predictions of zinc oxide hollow structures

NASA Astrophysics Data System (ADS)

Tuoc, Vu Ngoc; Huan, Tran Doan; Thao, Nguyen Thi

2018-03-01

Nanoporous materials are emerging as potential candidates for a wide range of technological applications in environment, electronic, and optoelectronics, to name just a few. Within this active research area, experimental works are predominant while theoretical/computational prediction and study of these materials face some intrinsic challenges, one of them is how to predict porous structures. We propose a computationally and technically feasible approach for predicting zinc oxide structures with hollows at the nano scale. The designed zinc oxide hollow structures are studied with computations using the density functional tight binding and conventional density functional theory methods, revealing a variety of promising mechanical and electronic properties, which can potentially find future realistic applications.

Electronic properties of a molecular system with Platinum

NASA Astrophysics Data System (ADS)

Ojeda, J. H.; Medina, F. G.; Becerra-Alonso, David

2017-10-01

The electronic properties are studied using a finite homogeneous molecule called Trans-platinum-linked oligo(tetraethenylethenes). This system is composed of individual molecules such as benzene rings, platinum, Phosphore and Sulfur. The mechanism for the study of the electron transport through this system is based on placing the molecule between metal contacts to control the current through the molecular system. We study this molecule based on the tight-binding approach for the calculation of the transport properties using the Landauer-Büttiker formalism and the Fischer-Lee relationship, based on a semi-analytic Green's function method within a real-space renormalization approach. Our results show a significant agreement with experimental measurements.

The K-turn motif in riboswitches and other RNA species☆

PubMed Central

Lilley, David M.J.

2014-01-01

The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078

Non-equilibrium Green's functions method: Non-trivial and disordered leads

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Yu, E-mail: heyuyhe@gmail.com; Wang, Yu; Klimeck, Gerhard

2014-11-24

The non-equilibrium Green's function algorithm requires contact self-energies to model charge injection and extraction. All existing approaches assume infinitely periodic leads attached to a possibly quite complex device. This contradicts today's realistic devices in which contacts are spatially inhomogeneous, chemically disordered, and impacting the overall device characteristics. This work extends the complex absorbing potentials method for arbitrary, ideal, or non-ideal leads in atomistic tight binding representation. The algorithm is demonstrated on a Si nanowire with periodic leads, a graphene nanoribbon with trumpet shape leads, and devices with leads of randomly alloyed Si{sub 0.5}Ge{sub 0.5}. It is found that alloy randomnessmore » in the leads can reduce the predicted ON-state current of Si{sub 0.5}Ge{sub 0.5} transistors by 45% compared to conventional lead methods.« less

Ligand selectivity of estrogen receptors by a molecular dynamics study.

PubMed

Hu, Guodong; Wang, Jihua

2014-03-03

Estrogen receptors α (ERα) and β (ERβ) have different physiological functions and expression levels in different tissues. ERα and ERβ are highly homologous and have only two residue substitutions in the binding pocket. This high similarity at the active site stimulates the interests for discovering subtype selective ligands. In this study, molecular dynamics (MD) simulations combined with molecular mechanics generalized Born surface area (MM-GBSA) method have been carried out to analyze the basis of selectivity of three ligands (659, 818 and 041). The calculated binding free energies show that all the ligands bind more tightly to ERβ than to ERα. The dominant free energy components of selectivity for 659 are similar to that for 041, but different from that for 818. The decompositions of free energy contributions and structural analysis imply that there are eight residues primarily contributing to the selectivity for 659, five residues for 041, as well as two residues for 818. The structural analysis implies that two residue substitutions in binding packet cause the position of 659 in ERβ-659 complex to shift relative to that in ERα-659 complex and also cause the conformational changes of other residues in the binding pocket. The higher selectivity for 041 is mainly caused by three residues, Ile373 (Met421), His475 (His524) and Leu476 (Leu525). Copyright © 2013. Published by Elsevier Masson SAS.

Membrane Association of the PTEN Tumor Suppressor: Electrostatic Interaction with Phos-phatidylserine-Containing Bilayers and Regulatory Role of the C-Terminal Tail

PubMed Central

Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias

2012-01-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177

Membrane association of the PTEN tumor suppressor: electrostatic interaction with phosphatidylserine-containing bilayers and regulatory role of the C-terminal tail.

PubMed

Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias

2012-12-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.

Adaptive tight frame based medical image reconstruction: a proof-of-concept study for computed tomography

NASA Astrophysics Data System (ADS)

Zhou, Weifeng; Cai, Jian-Feng; Gao, Hao

2013-12-01

A popular approach for medical image reconstruction has been through the sparsity regularization, assuming the targeted image can be well approximated by sparse coefficients under some properly designed system. The wavelet tight frame is such a widely used system due to its capability for sparsely approximating piecewise-smooth functions, such as medical images. However, using a fixed system may not always be optimal for reconstructing a variety of diversified images. Recently, the method based on the adaptive over-complete dictionary that is specific to structures of the targeted images has demonstrated its superiority for image processing. This work is to develop the adaptive wavelet tight frame method image reconstruction. The proposed scheme first constructs the adaptive wavelet tight frame that is task specific, and then reconstructs the image of interest by solving an l1-regularized minimization problem using the constructed adaptive tight frame system. The proof-of-concept study is performed for computed tomography (CT), and the simulation results suggest that the adaptive tight frame method improves the reconstructed CT image quality from the traditional tight frame method.

Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

2010-01-01

Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less

Structural modification of P-glycoprotein induced by OH radicals: Insights from atomistic simulations

NASA Astrophysics Data System (ADS)

Khosravian, N.; Kamaraj, B.; Neyts, E. C.; Bogaerts, A.

2016-02-01

This study reports on the possible effects of OH radical impact on the transmembrane domain 6 of P-glycoprotein, TM6, which plays a crucial role in drug binding in human cells. For the first time, we employ molecular dynamics (MD) simulations based on the self-consistent charge density functional tight binding (SCC-DFTB) method to elucidate the potential sites of fragmentation and mutation in this domain upon impact of OH radicals, and to obtain fundamental information about the underlying reaction mechanisms. Furthermore, we apply non-reactive MD simulations to investigate the long-term effect of this mutation, with possible implications for drug binding. Our simulations indicate that the interaction of OH radicals with TM6 might lead to the breaking of C-C and C-N peptide bonds, which eventually cause fragmentation of TM6. Moreover, according to our simulations, the OH radicals can yield mutation in the aromatic ring of phenylalanine in TM6, which in turn affects its structure. As TM6 plays an important role in the binding of a range of cytotoxic drugs with P-glycoprotein, any changes in its structure are likely to affect the response of the tumor cell in chemotherapy. This is crucial for cancer therapies based on reactive oxygen species, such as plasma treatment.

Conformational Changes Represent the Rate-Limiting Step in the Transport Cycle of Maize SUCROSE TRANSPORTER1[C][W

PubMed Central

Derrer, Carmen; Wittek, Anke; Bamberg, Ernst; Carpaneto, Armando; Dreyer, Ingo; Geiger, Dietmar

2013-01-01

Proton-driven Suc transporters allow phloem cells of higher plants to accumulate Suc to more than 1 M, which is up to ∼1000-fold higher than in the surrounding extracellular space. The carrier protein can accomplish this task only because proton and Suc transport are tightly coupled. This study provides insights into this coupling by resolving the first step in the transport cycle of the Suc transporter SUT1 from maize (Zea mays). Voltage clamp fluorometry measurements combining electrophysiological techniques with fluorescence-based methods enable the visualization of conformational changes of SUT1 expressed in Xenopus laevis oocytes. Using the Suc derivate sucralose, binding of which hinders conformational changes of SUT1, the association of protons to the carrier could be dissected from transport-associated movements of the protein. These combined approaches enabled us to resolve the binding of protons to the carrier and its interrelationship with the alternating movement of the protein. The data indicate that the rate-limiting step of the reaction cycle is determined by the accessibility of the proton binding site. This, in turn, is determined by the conformational change of the SUT1 protein, alternately exposing the binding pockets to the inward and to the outward face of the membrane. PMID:23964025

Automodification of PARP-1 mediates its tight binding to the nuclear matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zaalishvili, Giorgi, E-mail: giozaal@gmail.com; Margiani, Dina; Kutalia, Ketevan

2010-02-26

Poly(ADP-ribose) polymerase-1 (PARP-1), a nuclear enzyme that catalyzes the NAD{sup +}-dependent addition of ADP-ribose polymers on a variety of nuclear proteins, has been shown to be associated with the nuclear matrix. As yet, the properties and conditions of this association are unclear. Here, we show the existence of two PARP-1 pools associated with the nuclear matrix of rat liver and the ability of PARP-1 automodification to facilitate its binding to the nuclear matrix.

Data key to quest for quality.

PubMed

Chang, Florence S; Nielsen, Jon; Macias, Charles

2013-11-01

Late-binding data warehousing reduces the time it takes to obtain data needed to make crucial decisions. Late binding refers to when and how tightly data from the source applications are bound to the rules and vocabularies that make it useful. In some cases, data can be seen in real time. In historically paper-driven environments where data-driven decisions may be a new concept, buy-in from clinicians, physicians, and hospital leaders is key to success in using data to improve outcomes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez-Morales, A.; Martínez-Orozco, J. C.; Rodríguez-Vargas, I.

The main characteristics of the quantum confined Stark effect (QCSE) are studied theoretically in quantum wells of Gaussian profile. The semi-empirical tight-binding model and the Green function formalism are applied in the numerical calculations. A comparison of the QCSE in quantum wells with different kinds of confining potential is presented.

Quantum-confinement effects on conduction band structure of rectangular cross-sectional GaAs nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, H., E-mail: tanaka@semicon.kuee.kyoto-u.ac.jp; Morioka, N.; Mori, S.

2014-02-07

The conduction band structure and electron effective mass of GaAs nanowires with various cross-sectional shapes and orientations were calculated by two methods, a tight-binding method and an effective mass equation taking the bulk full-band structure into account. The effective mass of nanowires increases as the cross-sectional size decreases, and this increase in effective mass depends on the orientations and substrate faces of nanowires. Among [001], [110], and [111]-oriented rectangular cross-sectional GaAs nanowires, [110]-oriented nanowires with wider width along the [001] direction showed the lightest effective mass. This dependence originates from the anisotropy of the Γ valley of bulk GaAs. Themore » relationship between effective mass and bulk band structure is discussed.« less

Bandstructure modulation for Si-h and Si-g nanotubes in a transverse electric field: Tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2013-11-01

We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.

Dirac fermions and pseudomagnetic fields in two-dimensional electron gases with triangular antidot lattices

NASA Astrophysics Data System (ADS)

Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai

2017-07-01

We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.

Quantitative analysis on electric dipole energy in Rashba band splitting.

PubMed

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-09-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

Quantitative analysis on electric dipole energy in Rashba band splitting

PubMed Central

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-01-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493

Modeling Magnetic Properties in EZTB

NASA Technical Reports Server (NTRS)

Lee, Seungwon; vonAllmen, Paul

2007-01-01

A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.

The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

PubMed

Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

2018-03-05

During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.

Tight-binding model for materials at mesoscale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei

2016-12-21

TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less

Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference

NASA Astrophysics Data System (ADS)

Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.

2018-02-01

Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.

Microscopic theory of the superconducting gap in the quasi-one-dimensional organic conductor (TMTSF) 2ClO4 : Model derivation and two-particle self-consistent analysis

NASA Astrophysics Data System (ADS)

Aizawa, Hirohito; Kuroki, Kazuhiko

2018-03-01

We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.

Donor states in inverse opals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahan, G. D.

We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less

Affinity modulation of small-molecule ligands by borrowing endogenous protein surfaces

PubMed Central

Briesewitz, Roger; Ray, Gregory T.; Wandless, Thomas J.; Crabtree, Gerald R.

1999-01-01

A general strategy is described for improving the binding properties of small-molecule ligands to protein targets. A bifunctional molecule is created by chemically linking a ligand of interest to another small molecule that binds tightly to a second protein. When the ligand of interest is presented to the target protein by the second protein, additional protein–protein interactions outside of the ligand-binding sites serve either to increase or decrease the affinity of the binding event. We have applied this approach to an intractable target, the SH2 domain, and demonstrate a 3-fold enhancement over the natural peptide. This approach provides a way to modulate the potency and specificity of biologically active compounds. PMID:10051576

Identification of a ZP3-binding protein on acrosome-intact mouse sperm by photoaffinity crosslinking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bleil, J.D.; Wassarman, P.M.

1990-07-01

During the process of fertilization in mammals, sperm bind in a relatively species-specific manner to the zona pellucida (ZP) of ovulated eggs. ZP3, a glycoprotein found in the mouse egg zona pellucida, serves as receptor for sperm during gamete adhesion. We report here that a Mr 56,000 protein found on mouse sperm has properties expected for a sperm component that recognizes and binds to ZP3. This sperm protein is radiolabeled preferentially by a photoactivatable heterobifunctional crosslinker (Denny-Jaffee reagent) covalently linked to purified ZP3, binds very tightly to ZP3-affinity columns, and is localized to heads of acrosome-intact but not acrosome-reacted sperm.more » These and other findings suggest that this protein may be a ZP3-binding protein that, together with the sperm receptor, supports species-specific binding of mouse sperm to unfertilized eggs.« less

The ZO-1–associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density

PubMed Central

Balda, Maria S.; Garrett, Michelle D.; Matter, Karl

2003-01-01

Epithelial tight junctions regulate paracellular permeability, restrict apical/basolateral intramembrane diffusion of lipids, and have been proposed to participate in the control of epithelial cell proliferation and differentiation. Previously, we have identified ZO-1–associated nucleic acid binding proteins (ZONAB), a Y-box transcription factor whose nuclear localization and transcriptional activity is regulated by the tight junction–associated candidate tumor suppressor ZO-1. Now, we found that reduction of ZONAB expression using an antisense approach or by RNA interference strongly reduced proliferation of MDCK cells. Transfection of wild-type or ZONAB-binding fragments of ZO-1 reduced proliferation as well as nuclear ZONAB pools, indicating that promotion of proliferation by ZONAB requires its nuclear accumulation. Overexpression of ZONAB resulted in increased cell density in mature monolayers, and depletion of ZONAB or overexpression of ZO-1 reduced cell density. ZONAB was found to associate with cell division kinase (CDK) 4, and reduction of nuclear ZONAB levels resulted in reduced nuclear CDK4. Thus, our data indicate that tight junctions can regulate epithelial cell proliferation and cell density via a ZONAB/ZO-1–based pathway. Although this regulatory process may also involve regulation of transcription by ZONAB, our data suggest that one mechanism by which ZONAB and ZO-1 influence proliferation is by regulating the nuclear accumulation of CDK4. PMID:12566432

Synthesis, crystal structure, DFT calculation and DNA binding studies of new water-soluble derivatives of dppz

NASA Astrophysics Data System (ADS)

Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh

2017-10-01

Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.

Mechanical coupling in myosin V: a simulation study

PubMed Central

Ovchinnikov, Victor; Trout, Bernhardt L.

2009-01-01

Myosin motor function depends on the interaction between different domains that transmit information from one part of the molecule to another. The inter-domain coupling in myosin V is studied with Restrained Targeted Molecular Dynamics (RTMD) using an all-atom representation in explicit solvent. To elucidate the origin of the conformational change due to the binding of ATP, targeting forces are applied to small sets of atoms (the forcing sets, FS) in the direction of their displacement from the rigor conformation, which has a closed actin-binding cleft, to the post-rigor conformation, in which the cleft is open. The ‘minimal’ FS that results in extensive structural changes in the overall myosin conformation is comprised of the ATP, Switch 1, and the nearby HF, HG and HH helices. Addition of switch 2 to the forcing set is required to achieve a complete opening of the actin-binding cleft. The RTMD simulations reveal the mechanical coupling pathways between (i) the nucleotide-binding pocket (NBP) and the actin-binding cleft, (ii) the NBP and the converter, and (iii) the actin-binding cleft and the converter. Closing of the NBP due to ATP binding is tightly coupled to the opening of the cleft, and leads to the rupture of a key hydrogen bond (F441N/A684O) between switch 2 and the SH1 helix. The actin-binding cleft may mediate the rupture of this bond via a connection between the HW helix, the Relay helix, and Switch 2. The findings are consistent with experimental studies and a recent normal mode analysis. The present method is expected to be useful more generally in studies of inter-domain coupling in proteins. PMID:19853615

Mechanical coupling in myosin V: a simulation study.

PubMed

Ovchinnikov, Victor; Trout, Bernhardt L; Karplus, Martin

2010-01-29

Myosin motor function depends on the interaction between different domains that transmit information from one part of the molecule to another. The interdomain coupling in myosin V is studied with restrained targeted molecular dynamics using an all-atom representation in explicit solvent. To elucidate the origin of the conformational change due to the binding of ATP, targeting forces are applied to small sets of atoms (the forcing sets, FSs) in the direction of their displacement from the rigor conformation, which has a closed actin-binding cleft, to the post-rigor conformation, in which the cleft is open. The "minimal" FS that results in extensive structural changes in the overall myosin conformation is composed of ATP, switch 1, and the nearby HF, HG, and HH helices. Addition of switch 2 to the FS is required to achieve a complete opening of the actin-binding cleft. The restrained targeted molecular dynamics simulations reveal the mechanical coupling pathways between (i) the nucleotide-binding pocket (NBP) and the actin-binding cleft, (ii) the NBP and the converter, and (iii) the actin-binding cleft and the converter. Closing of the NBP due to ATP binding is tightly coupled to the opening of the cleft and leads to the rupture of a key hydrogen bond (F441N/A684O) between switch 2 and the SH1 helix. The actin-binding cleft may mediate the rupture of this bond via a connection between the HW helix, the relay helix, and switch 2. The findings are consistent with experimental studies and a recent normal mode analysis. The present method is expected to be useful more generally in studies of interdomain coupling in proteins.

In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization.

PubMed

Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst

2013-01-15

Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.

Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions

DOE PAGES

Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...

2016-07-01

Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Qin; Zaikowski, Lori; Kaur, Parmeet

Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

Development of acetophenone ligands as potential neuroimaging agents for cholinesterases.

PubMed

Jollymore-Hughes, Courtney T; Pottie, Ian R; Martin, Earl; Rosenberry, Terrone L; Darvesh, Sultan

2016-11-01

Association of cholinesterase with β-amyloid plaques and tau neurofibrillary tangles in Alzheimer's disease offers an opportunity to detect disease pathology during life. Achieving this requires development of radiolabelled cholinesterase ligands with high enzyme affinity. Various fluorinated acetophenone derivatives bind to acetylcholinesterase with high affinity, including 2,2,2-trifluoro-1-(3-dimethylaminophenyl)ethanone (1) and 1-(3-tert-butylphenyl)-2,2,2-trifluoroethanone (2). Such compounds also offer potential for incorporation of radioactive fluorine ( 18 F) for Positron Emission Tomography (PET) imaging of cholinesterases in association with Alzheimer's disease pathology in the living brain. Here we describe the synthesis of two meta-substituted chlorodifluoroacetophenones using a Weinreb amide strategy and their rapid conversion to the corresponding trifluoro derivatives through nucleophilic substitution by fluoride ion, in a reaction amenable to incorporating 18 F for PET imaging. In vitro kinetic analysis indicates tight binding of the trifluoro derivatives to cholinesterases. Compound 1 has a K i value of 7nM for acetylcholinesterase and 1300nM for butyrylcholinesterase while for compound 2 these values are 0.4nM and 26nM, respectively. Tight binding of these compounds to cholinesterase encourages their development for PET imaging detection of cholinesterase associated with Alzheimer's disease pathology. Copyright © 2016 Elsevier Ltd. All rights reserved.

Structural basis for the inhibition of bacterial multidrug exporters.

PubMed

Nakashima, Ryosuke; Sakurai, Keisuke; Yamasaki, Seiji; Hayashi, Katsuhiko; Nagata, Chikahiro; Hoshino, Kazuki; Onodera, Yoshikuni; Nishino, Kunihiko; Yamaguchi, Akihito

2013-08-01

The multidrug efflux transporter AcrB and its homologues are important in the multidrug resistance of Gram-negative pathogens. However, despite efforts to develop efflux inhibitors, clinically useful inhibitors are not available at present. Pyridopyrimidine derivatives are AcrB- and MexB-specific inhibitors that do not inhibit MexY; MexB and MexY are principal multidrug exporters in Pseudomonas aeruginosa. We have previously determined the crystal structure of AcrB in the absence and presence of antibiotics. Drugs were shown to be exported by a functionally rotating mechanism through tandem proximal and distal multisite drug-binding pockets. Here we describe the first inhibitor-bound structures of AcrB and MexB, in which these proteins are bound by a pyridopyrimidine derivative. The pyridopyrimidine derivative binds tightly to a narrow pit composed of a phenylalanine cluster located in the distal pocket and sterically hinders the functional rotation. This pit is a hydrophobic trap that branches off from the substrate-translocation channel. Phe 178 is located at the edge of this trap in AcrB and MexB and contributes to the tight binding of the inhibitor molecule through a π-π interaction with the pyridopyrimidine ring. The voluminous side chain of Trp 177 located at the corresponding position in MexY prevents inhibitor binding. The structure of the hydrophobic trap described in this study will contribute to the development of universal inhibitors of MexB and MexY in P. aeruginosa.

An efficient method for quantum transport simulations in the time domain

NASA Astrophysics Data System (ADS)

Wang, Y.; Yam, C.-Y.; Frauenheim, Th.; Chen, G. H.; Niehaus, T. A.

2011-11-01

An approximate method based on adiabatic time dependent density functional theory (TDDFT) is presented, that allows for the description of the electron dynamics in nanoscale junctions under arbitrary time dependent external potentials. The density matrix of the device region is propagated according to the Liouville-von Neumann equation. The semi-infinite leads give rise to dissipative terms in the equation of motion which are calculated from first principles in the wide band limit. In contrast to earlier ab initio implementations of this formalism, the Hamiltonian is here approximated in the spirit of the density functional based tight-binding (DFTB) method. Results are presented for two prototypical molecular devices and compared to full TDDFT calculations. The temporal profile of the current traces is qualitatively well captured by the DFTB scheme. Steady state currents show considerable variations, both in comparison of approximate and full TDDFT, but also among TDDFT calculations with different basis sets.

Use of HPLC for the detection of iron chelators in cultures of bacteria, fungi, and algae. [E. coli; Bacillus megaterium; Ustilago sphaerogena; Anabaena flos-aqua

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyer, G.L.; Speirs, R.J.; Morse, P.D.

1990-06-01

Iron is essential for the growth of living cells. To meet biochemical needs, microorganisms, including algae, produce high affinity chelators termed siderophores. These compounds solubilize Fe and increase its bioavailability. We have developed a new method to study siderophore formation in cultured and natural environments. Based on the fact siderophores tightly bind 55-Fe, the radioactive complexes can be separated by HPLC using an inert PRP-1 column and detected by scintillation counting. This method cleanly resolves several known siderophores, including ferrichrome A, ferrichrome, desferal, and rhodotorulic acid. The optimization of the method and its use for analysis of siderophore formation inmore » bacteria (E. coli, and Bacillus megaterium), fungi (Ustilago sphaerogena), and cyanobacteria (Anabaena flos-aqua UTEX 1444 and Anabaena sp. ATCC 27898) will be presented.« less

Analysis of cholesterol trafficking with fluorescent probes

PubMed Central

Maxfield, Frederick R.; Wüstner, Daniel

2013-01-01

Cholesterol plays an important role in determining the biophysical properties of biological membranes, and its concentration is tightly controlled by homeostatic processes. The intracellular transport of cholesterol among organelles is a key part of the homeostatic mechanism, but sterol transport processes are not well understood. Fluorescence microscopy is a valuable tool for studying intracellular transport processes, but this method can be challenging for lipid molecules because addition of a fluorophore may alter the properties of the molecule greatly. We discuss the use of fluorescent molecules that can bind to cholesterol to reveal its distribution in cells. We also discuss the use of intrinsically fluorescent sterols that closely mimic cholesterol, as well as some minimally modified fluorophore-labeled sterols. Methods for imaging these sterols by conventional fluorescence microscopy and by multiphoton microscopy are described. Some label-free methods for imaging cholesterol itself are also discussed briefly. PMID:22325611

Does the low hole transport mass in <110> and <111> Si nanowires lead to mobility enhancements at high field and stress: A self-consistent tight-binding study

NASA Astrophysics Data System (ADS)

Kotlyar, R.; Linton, T. D.; Rios, R.; Giles, M. D.; Cea, S. M.; Kuhn, K. J.; Povolotskyi, Michael; Kubis, Tillmann; Klimeck, Gerhard

2012-06-01

The hole surface roughness and phonon limited mobility in the silicon <100>, <110>, and <111> square nanowires under the technologically important conditions of applied gate bias and stress are studied with the self-consistent Poisson-sp3d5s*-SO tight-binding bandstructure method. Under an applied gate field, the hole carriers in a wire undergo a volume to surface inversion transition diminishing the positive effects of the high <110> and <111> valence band nonparabolicities, which are known to lead to the large gains of the phonon limited mobility at a zero field in narrow wires. Nonetheless, the hole mobility in the unstressed wires down to the 5 nm size remains competitive or shows an enhancement at high gate field over the large wire limit. Down to the studied 3 nm sizes, the hole mobility is degraded by strong surface roughness scattering in <100> and <110> wires. The <111> channels are shown to experience less surface scattering degradation. The physics of the surface roughness scattering dependence on wafer and channel orientations in a wire is discussed. The calculated uniaxial compressive channel stress gains of the hole mobility are found to reduce in the narrow wires and at the high field. This exacerbates the stressed mobility degradation with size. Nonetheless, stress gains of a factor of 2 are obtained for <110> wires down to 3 nm size at a 5×1012 cm-2 hole inversion density per gate area.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Strain-induced fundamental optical transition in (In,Ga)As/GaP quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robert, C., E-mail: cedric.robert@insa-rennes.fr, E-mail: cedric.robert@tyndall.ie; Pedesseau, L.; Cornet, C.

The nature of the ground optical transition in an (In,Ga)As/GaP quantum dot is thoroughly investigated through a million atoms supercell tight-binding simulation. Precise quantum dot morphology is deduced from previously reported scanning-tunneling-microscopy images. The strain field is calculated with the valence force field method and has a strong influence on the confinement potentials, principally, for the conduction band states. Indeed, the wavefunction of the ground electron state is spatially confined in the GaP matrix, close to the dot apex, in a large tensile strain region, having mainly Xz character. Photoluminescence experiments under hydrostatic pressure strongly support the theoretical conclusions.

Structure of Boron Nitride Nanotubes: Tube Closing Vs. Chirality

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu

1998-01-01

The structure of boron nitride nanotubes is investigated using a generalized tight-binding molecular dynamics method. It is shown that dynamic relaxation results in a wavelike or "rippled" surface in which the B atoms rotate inward and the N atoms move outward, reminiscent of the surface relaxation of the III-V semiconductors. More importantly, the three different morphologies of the tube closing with flat, conical and amorphous ends, as observed in experiments, are shown to be directly related to the tube chiralities. The abundance of flat end tubes observed in experiments is, thus, shown to be an indication of the greater stability of "zig-zag" BN tubes over the "arm-chair" tubes under experimental conditions.

Physical and Electronic Isolation of Carbon Nanotube Conductors

NASA Technical Reports Server (NTRS)

OKeeffe, James; Biegel, Bryan (Technical Monitor)

2001-01-01

Multi-walled nanotubes are proposed as a method to electrically and physically isolate nanoscale conductors from their surroundings. We use tight binding (TB) and density functional theory (DFT) to simulate the effects of an external electric field on multi-wall nanotubes. Two categories of multi-wall nanotube are investigated, those with metallic and semiconducting outer shells. In the metallic case, simulations show that the outer wall effectively screens the inner core from an applied electric field. This offers the ability to reduce crosstalk between nanotube conductors. A semiconducting outer shell is found not to perturb an electric field incident on the inner core, thereby providing physical isolation while allowing the tube to remain electrically coupled to its surroundings.

Atomistic simulations of the optical absorption of type-II CdSe/ZnTe superlattices

PubMed Central

2012-01-01

We perform accurate tight binding simulations to design type-II short-period CdSe/ZnTe superlattices suited for photovoltaic applications. Absorption calculations demonstrate a very good agreement with optical results with threshold strongly depending on the chemical species near interfaces. PMID:23031315

The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Varnum, Susan M.

2012-03-01

Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was foundmore » to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.« less

Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes

PubMed Central

Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.

2001-01-01

Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926

Rubisco Activity: Effects of Drought Stress

PubMed Central

PARRY, MARTIN A. J.; ANDRALOJC, P. JOHN; KHAN, SHAHNAZ; LEA, PETER J.; KEYS, ALFRED J.

2002-01-01

Ribulose‐1,5‐bisphosphate carboxylase/oxygenase (Rubisco) activity is modulated in vivo either by reaction with CO2 and Mg2+ to carbamylate a lysine residue in the catalytic site, or by the binding of inhibitors within the catalytic site. Binding of inhibitors blocks either activity or the carbamylation of the lysine residue that is essential for activity. At night, in many species, 2‐carboxyarabinitol‐1‐phosphate (CA1P) is formed which binds tightly to Rubisco, inhibiting catalytic activity. Recent work has shown that tight‐binding inhibitors can also decrease Rubisco activity in the light and contribute to the regulation of Rubisco activity. Here we determine the influence that such inhibitors of Rubisco exert on catalytic activity during drought stress. In tobacco plants, ‘total Rubisco activity’, i.e. the activity following pre‐incubation with CO2 and Mg2+, was positively correlated with leaf relative water content. However, ‘total Rubisco activity’ in extracts from leaves with low water potential increased markedly when tightly bound inhibitors were removed, thus increasing the number of catalytic sites available. This suggests that in tobacco the decrease of Rubisco activity under drought stress is not primarily the result of changes in activation by CO2 and Mg2+ but due rather to the presence of tight‐binding inhibitors. The amounts of inhibitor present in leaves of droughted tobacco based on the decrease in Rubisco activity per mg soluble protein were usually much greater than the amounts of the known inhibitors (CA1P and ‘daytime inhibitor’) that can be recovered in acid extracts. Alternative explanations for the difference between maximal and total activities are discussed. PMID:12102509

Control of the Ability of Profilin to Bind and Facilitate Nucleotide Exchange from G-actin*

PubMed Central

Wen, Kuo-Kuang; McKane, Melissa; Houtman, Jon C. D.; Rubenstein, Peter A.

2008-01-01

A major factor in profilin regulation of actin cytoskeletal dynamics is its facilitation of G-actin nucleotide exchange. However, the mechanism of this facilitation is unknown. We studied the interaction of yeast (YPF) and human profilin 1 (HPF1) with yeast and mammalian skeletal muscle actins. Homologous pairs (YPF and yeast actin, HPF1 and muscle actin) bound more tightly to one another than heterologous pairs. However, with saturating profilin, HPF1 caused a faster etheno-ATP exchange with both yeast and muscle actins than did YPF. Based on the -fold change in ATP exchange rate/Kd, however, the homologous pairs are more efficient than the heterologous pairs. Thus, strength of binding of profilin to actin and nucleotide exchange rate are not tightly coupled. Actin/HPF interactions were entropically driven, whereas YPF interactions were enthalpically driven. Hybrid yeast actins containing subdomain 1 (sub1) or subdomain 1 and 2 (sub12) muscle actin residues bound more weakly to YPF than did yeast actin (Kd = 2 μm versus 0.6 μm). These hybrids bound even more weakly to HPF than did yeast actin (Kd = 5 μm versus 3.2 μm). sub1/YPF interactions were entropically driven, whereas the sub12/YPF binding was enthalpically driven. Compared with WT yeast actin, YPF binding to sub1 occurred with a 5 times faster koff and a 2 times faster kon. sub12 bound with a 3 times faster koff and a 1.5 times slower kon. Profilin controls the energetics of its interaction with nonhybrid actin, but interactions between actin subdomains 1 and 2 affect the topography of the profilin binding site. PMID:18223293

Coxibs interfere with the action of aspirin by binding tightly to one monomer of cyclooxygenase-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rimon, Gilad; Sidhu, Ranjinder S.; Lauver, D. Adam

Pain associated with inflammation involves prostaglandins synthesized from arachidonic acid (AA) through cyclooxygenase-2 (COX-2) pathways while thromboxane A{sub 2} formed by platelets from AA via cyclooxygenase-1 (COX-1) mediates thrombosis. COX-1 and COX-2 are both targets of nonselective nonsteroidal antiinflammatory drugs (nsNSAIDs) including aspirin whereas COX-2 activity is preferentially blocked by COX-2 inhibitors called coxibs. COXs are homodimers composed of identical subunits, but we have shown that only one subunit is active at a time during catalysis; moreover, many nsNSAIDS bind to a single subunit of a COX dimer to inhibit the COX activity of the entire dimer. Here, we reportmore » the surprising observation that celecoxib and other coxibs bind tightly to a subunit of COX-1. Although celecoxib binding to one monomer of COX-1 does not affect the normal catalytic processing of AA by the second, partner subunit, celecoxib does interfere with the inhibition of COX-1 by aspirin in vitro. X-ray crystallographic results obtained with a celecoxib/COX-1 complex show how celecoxib can bind to one of the two available COX sites of the COX-1 dimer. Finally, we find that administration of celecoxib to dogs interferes with the ability of a low dose of aspirin to inhibit AA-induced ex vivo platelet aggregation. COX-2 inhibitors such as celecoxib are widely used for pain relief. Because coxibs exhibit cardiovascular side effects, they are often prescribed in combination with low-dose aspirin to prevent thrombosis. Our studies predict that the cardioprotective effect of low-dose aspirin on COX-1 may be blunted when taken with coxibs.« less

Density-functional expansion methods: Grand challenges.

PubMed

Giese, Timothy J; York, Darrin M

2012-03-01

We discuss the source of errors in semiempirical density functional expansion (VE) methods. In particular, we show that VE methods are capable of well-reproducing their standard Kohn-Sham density functional method counterparts, but suffer from large errors upon using one or more of these approximations: the limited size of the atomic orbital basis, the Slater monopole auxiliary basis description of the response density, and the one- and two-body treatment of the core-Hamiltonian matrix elements. In the process of discussing these approximations and highlighting their symptoms, we introduce a new model that supplements the second-order density-functional tight-binding model with a self-consistent charge-dependent chemical potential equalization correction; we review our recently reported method for generalizing the auxiliary basis description of the atomic orbital response density; and we decompose the first-order potential into a summation of additive atomic components and many-body corrections, and from this examination, we provide new insights and preliminary results that motivate and inspire new approximate treatments of the core-Hamiltonian.

A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

PubMed

Williams, K P; Shoelson, S E

1993-03-15

Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

Spiral wound extraction cartridge

DOEpatents

Wisted, E.E.; Lundquist, S.H.

1999-04-27

A cartridge device for removing an analyte from a fluid comprises a hollow core, a sheet composite comprising a particulate-loaded porous membrane and optionally at least one reinforcing spacer sheet, the particulate being capable of binding the analyte, the sheet composite being formed into a spiral configuration about the core, wherein the sheet composite is wound around itself and wherein the windings of sheet composite are of sufficient tightness so that adjacent layers are essentially free of spaces therebetween, two end caps which are disposed over the core and the lateral ends of the spirally wound sheet composite, and means for securing the end caps to the core, the end caps also being secured to the lateral ends of the spirally wound sheet composite. A method for removing an analyte from a fluid comprises the steps of providing a spirally wound element of the invention and passing the fluid containing the analyte through the element essentially normal to a surface of the sheet composite so as to bind the analyte to the particulate of the particulate-loaded porous membrane, the method optionally including the step of eluting the bound analyte from the sheet composite. 4 figs.

Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

PubMed Central

Chang, F. N.; Flaks, Joel G.

1972-01-01

The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and binding also occurred to ribosomes from streptomycin-resistant and -dependent strains, as well as to 50S subunits from all strains. Kdiss for all of these binding equilibria were [Formula: see text] 10−4m. This weaker non-specific binding coincided with the beginning of aggregation phenomena involving the particles, and occurred at sites distinct from the single site which binds the antibiotic tightly. This latter site was completely lost after the one-step mutation to high-level resistance or dependence. PMID:4133236

Chemisorption and Diffusion of H on a Graphene Sheet and Single-Wall Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Dzegilenko, Fedor; Menon, Madhu

2000-01-01

Recent experiments on hydrogen storage in single wall nanotubes and nanotube bundles have reported large fractional weight of stored molecular hydrogen which are not in agreement with theoretical estimates based of simulation of hydrogen storage by physisorption mechanisms. Hydrogen storage in catalytically doped nanotube bundles indicate that atomic H might undergo chemisorption changing the basic nature of the storage mechanism under investigation by many groups. Using a generalized tight-binding molecular dynamics (GTBMD) method for reactive C-H dynamics, we investigate chemisorption and diffusion of atomic H on graphene sheet and C nanotubes. Effective potential energy surfaces (EPS) for chemisorption and diffusion are calculated for graphene sheet and nanotubes of different curvatures. Analysis of the activation barriers and quantum rate constants, computed via wave-packet dynamics method, will be discussed in this presentation.

Spectral densities for Frenkel exciton dynamics in molecular crystals: A TD-DFTB approach

NASA Astrophysics Data System (ADS)

Plötz, Per-Arno; Megow, Jörg; Niehaus, Thomas; Kühn, Oliver

2017-02-01

Effects of thermal fluctuations on the electronic excitation energies and intermonomeric Coulomb couplings are investigated for a perylene-tetracarboxylic-diimide crystal. To this end, time dependent density functional theory based tight binding (TD-DFTB) in the linear response formulation is used in combination with electronic ground state classical molecular dynamics. As a result, a parametrized Frenkel exciton Hamiltonian is obtained, with the effect of exciton-vibrational coupling being described by spectral densities. Employing dynamically defined normal modes, these spectral densities are analyzed in great detail, thus providing insight into the effect of specific intramolecular motions on excitation energies and Coulomb couplings. This distinguishes the present method from approaches using fixed transition densities. The efficiency by which intramolecular contributions to the spectral density can be calculated is a clear advantage of this method as compared with standard TD-DFT.

Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

DOE Office of Scientific and Technical Information (OSTI.GOV)

C Simmons; C Magee; D Smith

The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADPmore » cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.« less

Coupled motions in the SH2 and kinase domains of Csk control Src phosphorylation.

PubMed

Wong, Lilly; Lieser, Scot A; Miyashita, Osamu; Miller, Meghan; Tasken, Kjetil; Onuchic, Josè N; Adams, Joseph A; Woods, Virgil L; Jennings, Patricia A

2005-08-05

The C-terminal Src kinase (Csk) phosphorylates and down-regulates Src family tyrosine kinases. The Csk-binding protein (Cbp) localizes Csk close to its substrates at the plasma membrane, and increases the specific activity of the kinase. To investigate this long-range catalytic effect, the phosphorylation of Src and the conformation of Csk were investigated in the presence of a high-affinity phosphopeptide derived from Cbp. This peptide binds tightly to the SH2 domain and enhances Src recognition (lowers K(m)) by increasing the apparent phosphoryl transfer rate in the Csk active site, a phenomenon detected in rapid quench flow experiments. Previous studies demonstrated that the regulation of Csk activity is linked to conformational changes in the enzyme that can be probed with hydrogen-deuterium exchange methods. We show that the Cbp peptide impacts deuterium incorporation into its binding partner (the SH2 domain), and into the SH2-kinase linker and several sequences in the kinase domain, including the glycine-rich loop in the active site. These findings, along with computational data from normal mode analyses, suggest that the SH2 domain moves in a cantilever fashion with respect to the small lobe of the kinase domain, ordering the active site for catalysis. The binding of a small Cbp-derived peptide to the SH2 domain of Csk modifies these motions, enhancing Src recognition.

Interaction energies for the purine inhibitor roscovitine with cyclin-dependent kinase 2: correlated ab initio quantum-chemical, DFT and empirical calculations.

PubMed

Dobes, Petr; Otyepka, Michal; Strnad, Miroslav; Hobza, Pavel

2006-05-24

The interaction between roscovitine and cyclin-dependent kinase 2 (cdk2) was investigated by performing correlated ab initio quantum-chemical calculations. The whole protein was fragmented into smaller systems consisting of one or a few amino acids, and the interaction energies of these fragments with roscovitine were determined by using the MP2 method with the extended aug-cc-pVDZ basis set. For selected complexes, the complete basis set limit MP2 interaction energies, as well as the coupled-cluster corrections with inclusion of single, double and noninteractive triples contributions [CCSD(T)], were also evaluated. The energies of interaction between roscovitine and small fragments and between roscovitine and substantial sections of protein (722 atoms) were also computed by using density-functional tight-binding methods covering dispersion energy (DFTB-D) and the Cornell empirical potential. Total stabilisation energy originates predominantly from dispersion energy and methods that do not account for the dispersion energy cannot, therefore, be recommended for the study of protein-inhibitor interactions. The Cornell empirical potential describes reasonably well the interaction between roscovitine and protein; therefore, this method can be applied in future thermodynamic calculations. A limited number of amino acid residues contribute significantly to the binding of roscovitine and cdk2, whereas a rather large number of amino acids make a negligible contribution.

Tunnel Field-Effect Transistors in 2-D Transition Metal Dichalcogenide Materials

NASA Astrophysics Data System (ADS)

Ilatikhameneh, Hesameddin; Tan, Yaohua; Novakovic, Bozidar; Klimeck, Gerhard; Rahman, Rajib; Appenzeller, Joerg

2015-12-01

In this work, the performance of Tunnel Field-Effect Transistors (TFETs) based on two-dimensional Transition Metal Dichalcogenide (TMD) materials is investigated by atomistic quantum transport simulations. One of the major challenges of TFETs is their low ON-currents. 2D material based TFETs can have tight gate control and high electric fields at the tunnel junction, and can in principle generate high ON-currents along with a sub-threshold swing smaller than 60 mV/dec. Our simulations reveal that high performance TMD TFETs, not only require good gate control, but also rely on the choice of the right channel material with optimum band gap, effective mass and source/drain doping level. Unlike previous works, a full band atomistic tight binding method is used self-consistently with 3D Poisson equation to simulate ballistic quantum transport in these devices. The effect of the choice of TMD material on the performance of the device and its transfer characteristics are discussed. Moreover, the criteria for high ON-currents are explained with a simple analytic model, showing the related fundamental factors. Finally, the subthreshold swing and energy-delay of these TFETs are compared with conventional CMOS devices.

Tight-Binding Description of Impurity States in Semiconductors

ERIC Educational Resources Information Center

Dominguez-Adame, F.

2012-01-01

Introductory textbooks in solid state physics usually present the hydrogenic impurity model to calculate the energy of carriers bound to donors or acceptors in semiconductors. This model treats the pure semiconductor as a homogeneous medium and the impurity is represented as a fixed point charge. This approach is only valid for shallow impurities…

Intrinsic optical confinement for ultrathin InAsN quantum well superlattices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakri, A.; Robert, C.; Pedesseau, L.

We study energy-band engineering with InAsN monolayer in GaAs/GaP quantum well structure. A tight-binding calculation indicates that both type I alignment along with direct band-gap behavior can be obtained. We show that the optical transitions are less sensitive to the position of the probe.

Electric-field-induced plasmon in AA-stacked bilayer graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuang, Y.C., E-mail: yingchih.chuang@gmail.com; Wu, J.Y., E-mail: yarst5@gmail.com; Lin, M.F., E-mail: mflin@mail.ncku.edu.tw

2013-12-15

The collective excitations in AA-stacked bilayer graphene for a perpendicular electric field are investigated analytically within the tight-binding model and the random-phase approximation. Such a field destroys the uniform probability distribution of the four sublattices. This drives a symmetry breaking between the intralayer and interlayer polarization intensities from the intrapair band excitations. A field-induced acoustic plasmon thus emerges in addition to the strongly field-tunable intrinsic acoustic and optical plasmons. At long wavelengths, the three modes show different dispersions and field dependence. The definite physical mechanism of the electrically inducible and tunable mode can be expected to also be present inmore » other AA-stacked few-layer graphenes. -- Highlights: •The analytical derivations are performed by the tight-binding model. •An electric field drives the non-uniformity of the charge distribution. •A symmetry breaking between the intralayer and interlayer polarizations is illustrated. •An extra plasmon emerges besides two intrinsic modes in AA-stacked bilayer graphene. •The mechanism of a field-induced mode is present in AA-stacked few-layer graphenes.« less

Transferable tight binding model for strained group IV and III-V heterostructures

NASA Astrophysics Data System (ADS)

Tan, Yaohua; Povolotskyi, Micheal; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

Modern semiconductor devices have reached critical device dimensions in the range of several nanometers. For reliable prediction of device performance, it is critical to have a numerical efficient model that are transferable to material interfaces. In this work, we present an empirical tight binding (ETB) model with transferable parameters for strained IV and III-V group semiconductors. The ETB model is numerically highly efficient as it make use of an orthogonal sp3d5s* basis set with nearest neighbor inter-atomic interactions. The ETB parameters are generated from HSE06 hybrid functional calculations. Band structures of strained group IV and III-V materials by ETB model are in good agreement with corresponding HSE06 calculations. Furthermore, the ETB model is applied to strained superlattices which consist of group IV and III-V elements. The ETB model turns out to be transferable to nano-scale hetero-structure. The ETB band structures agree with the corresponding HSE06 results in the whole Brillouin zone. The ETB band gaps of superlattices with common cations or common anions have discrepancies within 0.05eV.

RIM-BPs Mediate Tight Coupling of Action Potentials to Ca(2+)-Triggered Neurotransmitter Release.

PubMed

Acuna, Claudio; Liu, Xinran; Gonzalez, Aneysis; Südhof, Thomas C

2015-09-23

Ultrafast neurotransmitter release requires tight colocalization of voltage-gated Ca(2+) channels with primed, release-ready synaptic vesicles at the presynaptic active zone. RIM-binding proteins (RIM-BPs) are multidomain active zone proteins that bind to RIMs and to Ca(2+) channels. In Drosophila, deletion of RIM-BPs dramatically reduces neurotransmitter release, but little is known about RIM-BP function in mammalian synapses. Here, we generated double conditional knockout mice for RIM-BP1 and RIM-BP2, and analyzed RIM-BP-deficient synapses in cultured hippocampal neurons and the calyx of Held. Surprisingly, we find that in murine synapses, RIM-BPs are not essential for neurotransmitter release as such, but are selectively required for high-fidelity coupling of action potential-induced Ca(2+) influx to Ca(2+)-stimulated synaptic vesicle exocytosis. Deletion of RIM-BPs decelerated action-potential-triggered neurotransmitter release and rendered it unreliable, thereby impairing the fidelity of synaptic transmission. Thus, RIM-BPs ensure optimal organization of the machinery for fast release in mammalian synapses without being a central component of the machinery itself. Copyright © 2015 Elsevier Inc. All rights reserved.

Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

NASA Astrophysics Data System (ADS)

Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

2018-02-01

Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.

Spin textures on general surfaces of the correlated topological insulator SmB6

NASA Astrophysics Data System (ADS)

Baruselli, Pier Paolo; Vojta, Matthias

2016-05-01

Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.

Tuning the electronic properties of gated multilayer phosphorene: A self-consistent tight-binding study

NASA Astrophysics Data System (ADS)

Li, L. L.; Partoens, B.; Peeters, F. M.

2018-04-01

By taking account of the electric-field-induced charge screening, a self-consistent calculation within the framework of the tight-binding approach is employed to obtain the electronic band structure of gated multilayer phosphorene and the charge densities on the different phosphorene layers. We find charge density and screening anomalies in single-gated multilayer phosphorene and electron-hole bilayers in dual-gated multilayer phosphorene. Due to the unique puckered lattice structure, both intralayer and interlayer charge screenings are important in gated multilayer phosphorene. We find that the electric-field tuning of the band structure of multilayer phosphorene is distinctively different in the presence and absence of charge screening. For instance, it is shown that the unscreened band gap of multilayer phosphorene decreases dramatically with increasing electric-field strength. However, in the presence of charge screening, the magnitude of this band-gap decrease is significantly reduced and the reduction depends strongly on the number of phosphorene layers. Our theoretical results of the band-gap tuning are compared with recent experiments and good agreement is found.

Landau level splitting due to graphene superlattices

NASA Astrophysics Data System (ADS)

Pal, G.; Apel, W.; Schweitzer, L.

2012-06-01

The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.

Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene

NASA Astrophysics Data System (ADS)

Reijnders, K. J. A.; Katsnelson, M. I.

2017-07-01

We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.

GABAB receptor cell surface export is controlled by an endoplasmic reticulum gatekeeper

PubMed Central

Doly, Stéphane; Shirvani, Hamasseh; Gäta, Gabriel; Meye, Frank; Emerit, Michel-Boris; Enslen, Hervé; Achour, Lamia; Pardo-Lopez, Liliana; Kwon, Yang Seung; Armand, Vincent; Gardette, Robert; Giros, Bruno; Gassmann, Martin; Bettler, Bernhard; Mameli, Manuel; Darmon, Michèle; Marullo, Stefano

2016-01-01

Summary Endoplasmic reticulum (ER) release and cell surface export of many G protein-coupled receptors (GPCRs), are tightly regulated. For GABAB receptors of GABA, the major mammalian inhibitory neurotransmitter, the ligand-binding GB1 subunit is maintained in the ER by unknown mechanisms in the absence of hetero-dimerization with the GB2 subunit. We report that GB1 retention is regulated by a specific gatekeeper, PRAF2. This ER resident transmembrane protein binds to GB1, preventing its progression in the biosynthetic pathway. GB1 release occurs upon competitive displacement from PRAF2 by GB2. PRAF2 concentration, relative to that of GB1 and GB2, tightly controls cell surface receptor density and controls GABAB function in neurons. Experimental perturbation of PRAF2 levels in vivo caused marked hyperactivity disorders in mice. These data reveal an unanticipated major impact of specific ER gate-keepers on GPCR function and identify PRAF2 as a new molecular target with therapeutic potential for psychiatric and neurological diseases involving GABAB function. PMID:26033241

Proposed truncated Cu-Hf tight-binding potential to study the crystal-to-amorphous phase transition

NASA Astrophysics Data System (ADS)

Cui, Yuanyuan; Li, Jiahao; Dai, Ye; Liu, Baixin

2010-09-01

Proposed truncated Cu-Hf tight-binding potential was constructed by fitting the physical properties of Cu, Hf, and their stable compounds, i.e., Cu5Hf, Cu8Hf3, Cu10Hf7, and CuHf2. Based on the constructed potentials, molecular dynamics simulations were carried out to compare the relative stability of the crystalline solid solution and the disordered state. Simulation results not only reveal that the physical origin of crystal-to-amorphous transition is the crystalline lattice collapsing when the solute atoms exceeding the critical concentration, but also predict that the glass forming range (GFR) of the Cu-Hf system is 21-77 at. % Cu, which covers the GFRs determined by various metallic glass-producing techniques. Ion beam mixing experiments of the Cu-Hf system were conducted using 200 keV xenon ions and the results show that a uniform amorphous phase can be obtained in the Cu23Hf77 sample, matching well with the GFR determined by the interatomic potential, which, in turn, provides additional evidence to the relevance of the constructed Cu-Hf potential.

Topological states in a two-dimensional metal alloy in Si surface: BiAg/Si(111)-4 ×4 surface

NASA Astrophysics Data System (ADS)

Zhang, Xiaoming; Cui, Bin; Zhao, Mingwen; Liu, Feng

2018-02-01

A bridging topological state with a conventional semiconductor platform offers an attractive route towards future spintronics and quantum device applications. Here, based on first-principles and tight-binding calculations, we demonstrate the existence of topological states hosted by a two-dimensional (2D) metal alloy in a Si surface, the BiAg/Si(111)-4 ×4 surface, which has already been synthesized experimentally. It exhibits a topological insulating state with an energy gap of 71 meV (˜819 K ) above the Fermi level and a topological metallic state with quasiquantized conductance below the Fermi level. The underlying mechanism leading to the formation of such nontrivial states is revealed by analysis of the "charge-transfer" and "orbital-filtering" effect of the Si substrate. A minimal effective tight-binding model is employed to reveal the formation mechanism of the topological states. Our finding opens opportunities to detect topological states and measure its quantized conductance in a large family of 2D surface metal alloys, which have been or are to be grown on semiconductor substrates.

Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.

PubMed

Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E

2018-05-08

We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.

Binding of various ovotransferrin fragments to chick-embryo red cells.

PubMed Central

Oratore, A; D'Andrea, G; Moreton, K; Williams, J

1989-01-01

1. The ability of N- and C-terminal half-molecule fragments of hen ovotransferrin to interact with chick red blood cells (CERBC) has been studied under conditions that allow binding of the transferrin to transferrin receptors to take place, but not the delivery of iron to the cell. Two kinds of half-molecule fragments were used: (a) those which can associate with one another to give a dimer resembling native transferrin and (b) those which cannot associate in this way because they lack a few amino acid residues from their C-terminal ends. 2. Neither N nor C half-molecules alone can bind to the CERBC, but, when both are present, tight binding occurs. 3. Whether or not the half-molecules can associate with one another makes little difference to receptor binding. 4. Given that one of the half-molecules is iron-saturated, the presence or absence of iron in the contralateral half-molecule again makes little difference to receptor binding. PMID:2920021

Controlled rotation of the F1-ATPase reveals differential and continuous binding changes for ATP synthesis

PubMed Central

Adachi, Kengo; Oiwa, Kazuhiro; Yoshida, Masasuke; Nishizaka, Takayuki; Kinosita, Kazuhiko

2012-01-01

F1-ATPase is an ATP-driven rotary molecular motor that synthesizes ATP when rotated in reverse. To elucidate the mechanism of ATP synthesis, we imaged binding and release of fluorescently labelled ADP and ATP while rotating the motor in either direction by magnets. Here we report the binding and release rates for each of the three catalytic sites for 360° of the rotary angle. We show that the rates do not significantly depend on the rotary direction, indicating ATP synthesis by direct reversal of the hydrolysis-driven rotation. ADP and ATP are discriminated in angle-dependent binding, but not in release. Phosphate blocks ATP binding at angles where ADP binding is essential for ATP synthesis. In synthesis rotation, the affinity for ADP increases by >104, followed by a shift to high ATP affinity, and finally the affinity for ATP decreases by >104. All these angular changes are gradual, implicating tight coupling between the rotor angle and site affinities. PMID:22929779

An ultra-wide bandwidth-based range/GPS tight integration approach for relative positioning in vehicular ad hoc networks

NASA Astrophysics Data System (ADS)

Shen, Feng; Wayn Cheong, Joon; Dempster, Andrew G.

2015-04-01

Relative position awareness is a vital premise for the implementation of emerging intelligent transportation systems, such as collision warning. However, commercial global navigation satellite systems (GNSS) receivers do not satisfy the requirements of these applications. Fortunately, cooperative positioning (CP) techniques, through sharing the GNSS measurements between vehicles, can improve the performance of relative positioning in a vehicular ad hoc network (VANET). In this paper, while assuming there are no obstacles between vehicles, a new enhanced tightly coupled CP technique is presented by adding ultra-wide bandwidth (UWB)-based inter-vehicular range measurements. In the proposed CP method, each vehicle fuses the GPS measurements and the inter-vehicular range measurements. Based on analytical and experimental results, in the full GPS coverage environment, the new tight integration CP method outperforms the INS-aided tight CP method, tight CP method, and DGPS by 11%, 15%, and 24%, respectively; in the GPS outage scenario, the performance improvement achieves 60%, 65%, and 73%, respectively.

NMR Studies of the C-Terminus of alpha4 Reveal Possible Mechanism of Its Interaction with MID1 and Protein Phosphatase 2A

PubMed Central

Du, Haijuan; Massiah, Michael A.

2011-01-01

Alpha4 is a regulatory subunit of the protein phosphatase family of enzymes and plays an essential role in regulating the catalytic subunit of PP2A (PP2Ac) within the rapamycin-sensitive signaling pathway. Alpha4 also interacts with MID1, a microtubule-associated ubiquitin E3 ligase that appears to regulate the function of PP2A. The C-terminal region of alpha4 plays a key role in the binding interaction of PP2Ac and MID1. Here we report on the solution structure of a 45-amino acid region derived from the C-terminus of alpha4 (alpha45) that binds tightly to MID1. In aqueous solution, alpha45 has properties of an intrinsically unstructured peptide although chemical shift index and dihedral angle estimation based on chemical shifts of backbone atoms indicate the presence of a transient α-helix. Alpha45 adopts a helix-turn-helix HEAT-like structure in 1% SDS micelles, which may mimic a negatively charged surface for which alpha45 could bind. Alpha45 binds tightly to the Bbox1 domain of MID1 in aqueous solution and adopts a structure consistent with the helix-turn-helix structure observed in 1% SDS. The structure of alpha45 reveals two distinct surfaces, one that can interact with a negatively charged surface, which is present on PP2A, and one that interacts with the Bbox1 domain of MID1. PMID:22194938

Conformation-controlled binding kinetics of antibodies

NASA Astrophysics Data System (ADS)

Galanti, Marta; Fanelli, Duccio; Piazza, Francesco

2016-01-01

Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.

The VirD2 pilot protein of Agrobacterium-transferred DNA interacts with the TATA box-binding protein and a nuclear protein kinase in plants

PubMed Central

Bakó, László; Umeda, Masaaki; Tiburcio, Antonio F.; Schell, Jeff; Koncz, Csaba

2003-01-01

The bacterial virulence protein VirD2 plays an important role in nuclear import and chromosomal integration of Agrobacterium-transferred DNA in fungal, plant, animal, and human cells. Here we show that in nuclei of alfalfa cells, VirD2 interacts with and is phosphorylated by CAK2Ms, a conserved plant ortholog of cyclin-dependent kinase-activating kinases. CAK2Ms binds to and phosphorylates the C-terminal regulatory domain of RNA polymerase II largest subunit, which can recruit the TATA box-binding protein. VirD2 is found in tight association with the TATA box-binding protein in vivo. These results indicate that recognition of VirD2 is mediated by widely conserved nuclear factors in eukaryotes. PMID:12900506

Anion-induced reconstitution of a self-assembling system to express a chloride-binding Co10L15 pentagonal prism.

PubMed

Riddell, Imogen A; Smulders, Maarten M J; Clegg, Jack K; Hristova, Yana R; Breiner, Boris; Thoburn, John D; Nitschke, Jonathan R

2012-09-01

Biochemical systems are adaptable, capable of reconstitution at all levels to achieve the functions associated with life. Synthetic chemical systems are more limited in their ability to reorganize to achieve new functions; they can reconfigure to bind an added substrate (template effect) or one binding event may modulate a receptor's affinity for a second substrate (allosteric effect). Here we describe a synthetic chemical system that is capable of structural reconstitution on receipt of one anionic signal (perchlorate) to create a tight binding pocket for another anion (chloride). The complex, barrel-like structure of the chloride receptor is templated by five perchlorate anions. This second-order templation phenomenon allows chemical networks to be envisaged that express more complex responses to chemical signals than is currently feasible.

Interactions of Kid-Kis toxin-antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid-Kis oligomers.

PubMed

Monti, Maria C; Hernández-Arriaga, Ana M; Kamphuis, Monique B; López-Villarejo, Juan; Heck, Albert J R; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H H

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin-antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid-kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid-Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2-Kis2-Kid2-Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2-Kis2-Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2-Kis2)n complexes repress the kid-kis operon.

Adenosylcobinamide methyl phosphate as a pseudocoenzyme for diol dehydrase.

PubMed

Ishida, A; Toraya, T

1993-02-16

Adenosylcobinamide methyl phosphate, a novel analog of adenosylcobalamin lacking the nucleotide loop moiety, was synthesized. It did not show detectable coenzymic activity but behaved as a strong competitive inhibitor against AdoCbl with relatively high affinity (Ki = 2.5 microM). When apoenzyme was incubated at 37 degrees C with this analog in the presence of substrate, the Co-C bond of the analog was almost completely and irreversibly cleaved within 10 min, forming an enzyme-bound Co(II)-containing species. The cleavage was not observed in the absence of substrate. The Co-C bond cleavage in the presence of substrate was not catalytic but stoichiometric, implying that the Co-C bond of the analog undergoes activation when the analog binds to the active site of the enzyme. 5'-Deoxyadenosine was the only product derived from the adenosyl group of the analog upon the Co-C bond cleavage. Apoenzyme did not undergo modification during this process. Therefore, it seems likely that adenosylcobinamide methyl phosphate acts as a pseudocoenzyme or a potent suicide coenzyme. Since adenosylcobinamide neither functions as coenzyme nor binds tightly to apoenzyme, it can be concluded that the phosphodiester moiety of the nucleotide loop of adenosylcobalamin is essential for tight binding to apoenzyme and therefore for subsequent activation of the Co-C bond and catalysis. It is also evident that the nucleotide loop is obligatory for the normal progress of catalytic cycle.

Engineering Designed Proteins for Light Capture, Energy Transfer, and Emissive Sensing In Vivo

NASA Astrophysics Data System (ADS)

Mancini, Joshua A.

Proteins that are used for photosynthetic light harvesting and biological signaling are critical to life. These types of proteins act as scaffolds that hold small, sometimes metal-containing organic molecules in precise locations for light absorption and successive use. For signaling proteins, this energy can be used to induce a photoisomerization of the small molecule that can turn on or off a signaling cascade that controls the physiology of an organism. Alternatively, photosynthetic light-harvesting proteins funnel this energy in a directional manner towards a charge separating catalytic component that can change this light energy into chemical energy. The protein environment also serves to tune the photophysical properties of the small molecules. This is seen extensively with the linear tetrapyrroles that are used in both photosynthetic and signaling proteins. Many efforts have been made to harness these natural proteins for societal use, including improving photophysical properties and interfacing capabilities with manmade catalytic components. Several methods of achieving improvement have entailed structurally guided mutation and directed evolution. However, these methods all have their limitations due to the inherent complexity and fragility of the natural proteins. This work presents an alternative more robust method to natural proteins. My thesis states: that man-made proteins, known as maquettes, employing basic rules of protein folding, can be designed to become light harvesting and signaling proteins that can be assembled fully in vivo providing an alternative, robust, and versatile platform for meeting the diverse array of societal "green chemistry" and biomedical needs. This in vivo assembly is carried out by interacting with cyanobacterial protein and pigment machinery, both as stand-alone units and as protein fusions with natural antenna complexes. Additionally, this work offers insight for fast and tight binding of circular and linear tetrapyrroles to the maquettes both in vitro and in vivo. Design principles are also established for increasing the amount of linear tetrapyrrole attachment to the maquette as well as modulating their photophysical properties. Fast and tight binding of cofactors, high cofactor attachment yields, and control of cofactor photophysical properties are all prerequisites for the maquettes to be successful in vivo photosynthetic light harvesting and signaling proteins.

Ultra-fast computation of electronic spectra for large systems by tight-binding based simplified Tamm-Dancoff approximation (sTDA-xTB)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grimme, Stefan, E-mail: grimme@thch.uni-bonn.de; Bannwarth, Christoph

2016-08-07

The computational bottleneck of the extremely fast simplified Tamm-Dancoff approximated (sTDA) time-dependent density functional theory procedure [S. Grimme, J. Chem. Phys. 138, 244104 (2013)] for the computation of electronic spectra for large systems is the determination of the ground state Kohn-Sham orbitals and eigenvalues. This limits such treatments to single structures with a few hundred atoms and hence, e.g., sampling along molecular dynamics trajectories for flexible systems or the calculation of chromophore aggregates is often not possible. The aim of this work is to solve this problem by a specifically designed semi-empirical tight binding (TB) procedure similar to the wellmore » established self-consistent-charge density functional TB scheme. The new special purpose method provides orbitals and orbital energies of hybrid density functional character for a subsequent and basically unmodified sTDA procedure. Compared to many previous semi-empirical excited state methods, an advantage of the ansatz is that a general eigenvalue problem in a non-orthogonal, extended atomic orbital basis is solved and therefore correct occupied/virtual orbital energy splittings as well as Rydberg levels are obtained. A key idea for the success of the new model is that the determination of atomic charges (describing an effective electron-electron interaction) and the one-particle spectrum is decoupled and treated by two differently parametrized Hamiltonians/basis sets. The three-diagonalization-step composite procedure can routinely compute broad range electronic spectra (0-8 eV) within minutes of computation time for systems composed of 500-1000 atoms with an accuracy typical of standard time-dependent density functional theory (0.3-0.5 eV average error). An easily extendable parametrization based on coupled-cluster and density functional computed reference data for the elements H–Zn including transition metals is described. The accuracy of the method termed sTDA-xTB is first benchmarked for vertical excitation energies of open- and closed-shell systems in comparison to other semi-empirical methods and applied to exemplary problems in electronic spectroscopy. As side products of the development, a robust and efficient valence electron TB method for the accurate determination of atomic charges as well as a more accurate calculation scheme of dipole rotatory strengths within the Tamm-Dancoff approximation is proposed.« less

Native red electrophoresis--a new method suitable for separation of native proteins.

PubMed

Dráb, Tomáš; Kračmerová, Jana; Tichá, Ivana; Hanzlíková, Eva; Tichá, Marie; Ryšlavá, Helena; Doubnerová, Veronika; Maňásková-Postlerová, Pavla; Liberda, Jiří

2011-12-01

A new type of native electrophoresis was developed to separate and characterize proteins. In this modification of the native blue electrophoresis, the dye Ponceau Red S is used instead of Coomassie Brilliant Blue to impose uniform negative charge on proteins to enable their electrophoretic separation according to their relative molecular masses. As Ponceau Red S binds less tightly to proteins, in comparison with Coomassie Blue, it can be easily removed after the electrophoretic separation and a further investigation of protein properties is made possible (e.g. an enzyme detection or electroblotting). The tested proteins also kept their native properties (enzyme activity or aggregation state). Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Photoelectron emission from LiF surfaces by ultrashort electromagnetic pulses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acuna, M. A.; Gravielle, M. S.; Departamento de Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires

2011-03-15

Energy- and angle-resolved electron emission spectra produced by incidence of ultrashort electromagnetic pulses on a LiF(001) surface are studied by employing a distorted-wave method named the crystal surface-Volkov (CSV) approximation. The theory makes use of the Volkov phase to describe the action of the external electric field on the emitted electron, while the electron-surface interaction is represented within the tight-binding model. The CSV approach is applied to investigate the effects introduced by the crystal lattice when the electric field is oriented parallel to the surface plane. These effects are essentially governed by the vector potential of the external field, whilemore » the influence of the crystal orientation was found to be negligible.« less

A quantum rings based on multiple quantum wells for 1.2-2.8 THz detection

NASA Astrophysics Data System (ADS)

Mobini, Alireza; Solaimani, M.

2018-07-01

In this paper optical properties of a new QR based on MQWs have been investigated for detection in the THz range. The QR composed of a periodic effective quantum sites that each one considered as QW in theta direction. Using Tight binding method, eigen value problem for a QR with circumstance of 100 nm number with different number of wells i.e. 2, 4, 6 and 8 are solved and the absorption spectrum have been calculated. The results show that absorption has maximum value in range of (1.2-2.88 THz) that can be used for THz detection. Finally, it is realized that by increasing the number of wells, the numbers of absorption line also increase.

Wavepacket dynamics in one-dimensional system with long-range correlated disorder

NASA Astrophysics Data System (ADS)

Yamada, Hiroaki S.

2018-03-01

We numerically investigate dynamical property in the one-dimensional tight-binding model with long-range correlated disorder having power spectrum 1 /fα (α: spectrum exponent) generated by Fourier filtering method. For relatively small α <αc (=2) time-dependence of mean square displacement (MSD) of the initially localized wavepacket shows ballistic spread and localizes as time elapses. It is shown that α-dependence of the dynamical localization length determined by the MSD exhibits a simple scaling law in the localization regime for the relatively weak disorder strength W. Furthermore, scaled MSD by the dynamical localization length almost obeys an universal function from the ballistic to the localization regime in the various combinations of the parameters α and W.

Why are Buckyonions Round?

NASA Technical Reports Server (NTRS)

Bates, Kevin R.; Scuseria, Gustavo E.

1998-01-01

Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite. However. theoretical models or large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations or round buckyonions and theoretical predictions of faceted icosahedral fullerenes.

Exchange and spin-orbit induced phenomena in diluted (Ga,Mn)As from first principles

NASA Astrophysics Data System (ADS)

Kudrnovský, J.; Drchal, V.; Turek, I.

2016-08-01

Physical properties induced by exchange interactions (Curie temperature and spin stiffness) and spin-orbit coupling (anomalous Hall effect, anisotropic magnetoresistance, and Gilbert damping) in the diluted (Ga,Mn)As ferromagnetic semiconductor are studied from first principles. Recently developed Kubo-Bastin transport theory and nonlocal torque operator formulation of the Gilbert damping as formulated in the tight-binding linear muffin-tin orbital method are used. The first-principles Liechtenstein mapping is employed to construct an effective Heisenberg Hamiltonian and to estimate Curie temperature and spin stiffness in the real-space random-phase approximation. Good agreement of calculated physical quantities with experiments on well-annealed samples containing only a small amount of compensating defects is obtained.

Energy transfer between two vacuum-gapped metal plates: Coulomb fluctuations and electron tunneling

NASA Astrophysics Data System (ADS)

Zhang, Zu-Quan; Lü, Jing-Tao; Wang, Jian-Sheng

2018-05-01

Recent experimental measurements for near-field radiative heat transfer between two bodies have been able to approach the gap distance within 2 nm , where the contributions of Coulomb fluctuation and electron tunneling are comparable. Using the nonequilibrium Green's function method in the G0W0 approximation, based on a tight-binding model, we obtain for the energy current a Caroli formula from the Meir-Wingreen formula in the local equilibrium approximation. Also, the Caroli formula is consistent with the evanescent part of the heat transfer from the theory of fluctuational electrodynamics. We go beyond the local equilibrium approximation to study the energy transfer in the crossover region from electron tunneling to Coulomb fluctuation based on a numerical calculation.

The role of cytosine methylation on charge transport through a DNA strand

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu; Govind, Niranjan, E-mail: niri.govind@pnnl.gov

Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance throughmore » the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.« less

Electrical design of InAs-Sb/GaSb superlattices for optical detectors using full bandstructure sp3s* tight-binding method and Bloch boundary conditions

NASA Astrophysics Data System (ADS)

Mir, Raja N.; Frensley, William R.

2013-10-01

InAs-Sb/GaSb type-II strain compensated superlattices (SLS) are currently being used in mid-wave and long-wave infrared photodetectors. The electronic bandstructure of InSb and GaSb shows very strong anisotropy and non-parabolicity close to the Γ-point for the conduction band (CB) minimum and the valence band (VB) maximum. Particularly around the energy range of 45-80 meV from band-edge we observe strong non-parabolicity in the CB and light hole VB. The band-edge dispersion determines the electrical properties of a material. When the bulk materials are combined to form a superlattice we need a model of bandstructure which takes into account the full bandstructure details of the constituents and also the strong interaction between the conduction band of InAs and valence bands of GaSb. There can also be contact potentials near the interface between two dissimilar superlattices which will not be captured unless a full bandstructure calculation is done. In this study, we have done a calculation using second nearest neighbor tight binding model in order to accurately reproduce the effective masses. The calculation of mini-band structure is done by finding the wavefunctions within one SL period subject to Bloch boundary conditions ψ(L)=ψ(0)eikL. We demonstrate in this paper how a calculation of carrier concentration as a function of the position of the Fermi level (EF) within bandgap(Eg) should be done in order to take into account the full bandstructure of broken-bandgap material systems. This calculation is key for determining electron transport particularly when we have an interface between two dissimilar superlattices.

Atomistic tight-binding computations of the structural and optical properties of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals

NASA Astrophysics Data System (ADS)

Sukkabot, Worasak

2018-05-01

A study of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals is carried out using atomistic tight-binding theory and the configuration interaction method to provide information for applications in bioimaging, biolabeling, display devices and near-infrared electronic instruments. The calculations yield the dependences of the internal and external passivated shells on the natural behaviours of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals. The reduction of the optical band gaps is observed with increasing numbers of monolayers in the external ZnS shell due to quantum confinement. Interestingly, the optical band gaps of CdTe/CdS/ZnS core/shell/shell nanocrystals are greater than those of CdTe/CdSe/ZnS core/shell/shell nanocrystals. In the presence of an external ZnS-coated shell, electron-hole wave function overlaps, oscillation strengths, ground-state exchange energies and Stokes shift are improved, whereas ground-state coulomb energies and fine-structure splitting are reduced. The oscillation strengths, Stokes shift and fine-structure splitting are reduced with the increase in external ZnS shell thickness. The oscillation strengths, Stokes shift and fine-structure splitting of CdTe/CdS/ZnS core/shell/shell nanocrystals are larger than those of CdTe/CdSe/ZnS core/shell/shell nanocrystals. Reduction of the atomistic electron-hole interactions is observed with increasing external ZnS shell size. The strong electron-hole interactions are more probed in CdTe/CdS/ZnS core/shell/shell nanocrystals than in CdTe/CdSe/ZnS core/shell/shell nanocrystals.

The role of cytosine methylation on charge transport through a DNA strand

NASA Astrophysics Data System (ADS)

Qi, Jianqing; Govind, Niranjan; Anantram, M. P.

2015-09-01

Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

Social Justice and Social Order: Binding Moralities across the Political Spectrum

PubMed Central

2016-01-01

Two studies explored the relationship between political ideology and endorsement of a range of moral principles. Political liberals and conservatives did not differ on intrapersonal or interpersonal moralities, which require self-regulation. However differences emerged on collective moralities, which involve social regulation. Contrary to Moral Foundations Theory, both liberals and conservatives endorsed a group-focused binding morality, specifically Social Justice and Social Order respectively. Libertarians were the group without a binding morality. Although Social Justice and Social Order appear conflictual, analyses based on earlier cross-cultural work on societal tightness-looseness suggest that countries actually benefit in terms of economic success and societal well-being when these group-based moralities co-exist and serve as counterweights in social regulation. PMID:27031103

Designing the Sniper: Improving Targeted Human Cytolytic Fusion Proteins for Anti-Cancer Therapy via Molecular Simulation.

PubMed

Bochicchio, Anna; Jordaan, Sandra; Losasso, Valeria; Chetty, Shivan; Perera, Rodrigo Casasnovas; Ippoliti, Emiliano; Barth, Stefan; Carloni, Paolo

2017-02-17

Targeted human cytolytic fusion proteins (hCFPs) are humanized immunotoxins for selective treatment of different diseases including cancer. They are composed of a ligand specifically binding to target cells genetically linked to a human apoptosis-inducing enzyme. hCFPs target cancer cells via an antibody or derivative (scFv) specifically binding to e.g., tumor associated antigens (TAAs). After internalization and translocation of the enzyme from endocytosed endosomes, the human enzymes introduced into the cytosol are efficiently inducing apoptosis. Under in vivo conditions such enzymes are subject to tight regulation by native inhibitors in order to prevent inappropriate induction of cell death in healthy cells. Tumor cells are known to upregulate these inhibitors as a survival mechanism resulting in escape of malignant cells from elimination by immune effector cells. Cytosolic inhibitors of Granzyme B and Angiogenin (Serpin P9 and RNH1, respectively), reduce the efficacy of hCFPs with these enzymes as effector domains, requiring detrimentally high doses in order to saturate inhibitor binding and rescue cytolytic activity. Variants of Granzyme B and Angiogenin might feature reduced affinity for their respective inhibitors, while retaining or even enhancing their catalytic activity. A powerful tool to design hCFPs mutants with improved potency is given by in silico methods. These include molecular dynamics (MD) simulations and enhanced sampling methods (ESM). MD and ESM allow predicting the enzyme-protein inhibitor binding stability and the associated conformational changes, provided that structural information is available. Such "high-resolution" detailed description enables the elucidation of interaction domains and the identification of sites where particular point mutations may modify those interactions. This review discusses recent advances in the use of MD and ESM for hCFP development from the viewpoints of scientists involved in both fields.

Designing the Sniper: Improving Targeted Human Cytolytic Fusion Proteins for Anti-Cancer Therapy via Molecular Simulation

PubMed Central

Bochicchio, Anna; Jordaan, Sandra; Losasso, Valeria; Chetty, Shivan; Casasnovas Perera, Rodrigo; Ippoliti, Emiliano; Barth, Stefan; Carloni, Paolo

2017-01-01

Targeted human cytolytic fusion proteins (hCFPs) are humanized immunotoxins for selective treatment of different diseases including cancer. They are composed of a ligand specifically binding to target cells genetically linked to a human apoptosis-inducing enzyme. hCFPs target cancer cells via an antibody or derivative (scFv) specifically binding to e.g., tumor associated antigens (TAAs). After internalization and translocation of the enzyme from endocytosed endosomes, the human enzymes introduced into the cytosol are efficiently inducing apoptosis. Under in vivo conditions such enzymes are subject to tight regulation by native inhibitors in order to prevent inappropriate induction of cell death in healthy cells. Tumor cells are known to up-regulate these inhibitors as a survival mechanism resulting in escape of malignant cells from elimination by immune effector cells. Cytosolic inhibitors of Granzyme B and Angiogenin (Serpin P9 and RNH1, respectively), reduce the efficacy of hCFPs with these enzymes as effector domains, requiring detrimentally high doses in order to saturate inhibitor binding and rescue cytolytic activity. Variants of Granzyme B and Angiogenin might feature reduced affinity for their respective inhibitors, while retaining or even enhancing their catalytic activity. A powerful tool to design hCFPs mutants with improved potency is given by in silico methods. These include molecular dynamics (MD) simulations and enhanced sampling methods (ESM). MD and ESM allow predicting the enzyme-protein inhibitor binding stability and the associated conformational changes, provided that structural information is available. Such “high-resolution” detailed description enables the elucidation of interaction domains and the identification of sites where particular point mutations may modify those interactions. This review discusses recent advances in the use of MD and ESM for hCFP development from the viewpoints of scientists involved in both fields. PMID:28536352

Crystal structure of coelenterazine-binding protein from Renilla muelleri at 1.7 A: why it is not a calcium-regulated photoprotein.

PubMed

Stepanyuk, Galina A; Liu, Zhi-Jie; Markova, Svetlana S; Frank, Ludmila A; Lee, John; Vysotski, Eugene S; Wang, Bi-Cheng

2008-04-01

Bioluminescence in the sea pansy Renilla involves two distinct proteins, a Ca2+-triggered coelenterazine-binding protein (CBP), and Renilla luciferase. CBP contains one tightly bound coelenterazine molecule, which becomes available for reaction with luciferase and O2 only subsequent to Ca2+ binding. CBP belongs to the EF-hand superfamily of Ca2+-binding proteins and contains three "EF-hand" Ca2+-binding sites. The overall spatial structure of recombinant selenomethionine-labeled CBP determined at 1.7 A, is found to approximate the protein scaffold characteristic of the class of Ca2+-regulated photoproteins. Photoproteins however, catalyze molecular oxygen addition to coelenterazine producing a 2-hydroperoxycoelenterazine intermediate, which is stabilized within the binding cavity in the absence of Ca2+. Addition of Ca2+ triggers the bioluminescence reaction. However in CBP this first step of oxygen addition is not allowed. The different amino acid environments and hydrogen bond interactions within the binding cavity, are proposed to account for the different properties of the two classes of proteins.

MCM ring hexamerization is a prerequisite for DNA-binding

DOE PAGES

Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

2015-09-13

The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

Kinetic mechanism of the dimeric ATP sulfurylase from plants

PubMed Central

Ravilious, Geoffrey E.; Herrmann, Jonathan; Goo Lee, Soon; Westfall, Corey S.; Jez, Joseph M.

2013-01-01

In plants, sulfur must be obtained from the environment and assimilated into usable forms for metabolism. ATP sulfurylase catalyses the thermodynamically unfavourable formation of a mixed phosphosulfate anhydride in APS (adenosine 5′-phosphosulfate) from ATP and sulfate as the first committed step of sulfur assimilation in plants. In contrast to the multi-functional, allosterically regulated ATP sulfurylases from bacteria, fungi and mammals, the plant enzyme functions as a mono-functional, non-allosteric homodimer. Owing to these differences, here we examine the kinetic mechanism of soybean ATP sulfurylase [GmATPS1 (Glycine max (soybean) ATP sulfurylase isoform 1)]. For the forward reaction (APS synthesis), initial velocity methods indicate a single-displacement mechanism. Dead-end inhibition studies with chlorate showed competitive inhibition versus sulfate and non-competitive inhibition versus APS. Initial velocity studies of the reverse reaction (ATP synthesis) demonstrate a sequential mechanism with global fitting analysis suggesting an ordered binding of substrates. ITC (isothermal titration calorimetry) showed tight binding of APS to GmATPS1. In contrast, binding of PPi (pyrophosphate) to GmATPS1 was not detected, although titration of the E•APS complex with PPi in the absence of magnesium displayed ternary complex formation. These results suggest a kinetic mechanism in which ATP and APS are the first substrates bound in the forward and reverse reactions, respectively. PMID:23789618

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuo, Nai-Wei; Gao, Yong; Schill, Megan S.

Chemokines play important roles in the immune system, not only recruiting leukocytes to the site of infection and inflammation but also guiding cell homing and cell development. The soluble poxvirusencoded protein vCCI, a CC chemokine inhibitor, can bind to human CC chemokines tightly to impair the host immune defense. This protein has no known homologs in eukaryotes, and may represent a potent method to stop inflammation. Previously, our structure of the vCCI:MIP-1β complex indicated that vCCI uses negatively charged residues in β-sheet II to interact with positively charged residues in the MIP-1βN-terminus, 20’s region and 40’s loop. However, the interactionsmore » between vCCI and other CC chemokines have not yet been fully explored. Here, we used NMR and fluorescence anisotropy to study the interaction between vCCI and eotaxin-1 (CCL11), another CC chemokine that is an important factor in the asthma response. NMR results reveal that the binding pattern is very similar to the vCCI:MIP-1βcomplex, and suggest that electrostatic interactions provide a major contribution to binding. Fluorescence anisotropy results on variants of eotaxin-1 further confirm the critical roles of the charged residues in eotaxin. Compared to wild-type eotaxin, single, double, or triple mutations at these critical charged residues weaken the binding. One exception is the K47A mutation that exhibits increased affinity for vCCI, which can be explained structurally. In addition, the binding affinity between vCCI and other wild type CC chemokines, MCP-1, MIP-1β and RANTES, were determined as 1.09 nM, 1.16 nM, and 0.22 nM, respectively. To our knowledge, this is the first work quantitatively measuring the binding affinity between vCCI and different CC chemokines.« less

The ribonucleoprotein Csr network.

PubMed

Seyll, Ethel; Van Melderen, Laurence

2013-11-08

Ribonucleoprotein complexes are essential regulatory components in bacteria. In this review, we focus on the carbon storage regulator (Csr) network, which is well conserved in the bacterial world. This regulatory network is composed of the CsrA master regulator, its targets and regulators. CsrA binds to mRNA targets and regulates translation either negatively or positively. Binding to small non-coding RNAs controls activity of this protein. Expression of these regulators is tightly regulated at the level of transcription and stability by various global regulators (RNAses, two-component systems, alarmone). We discuss the implications of these complex regulations in bacterial adaptation.

The Mismetallation of Enzymes during Oxidative Stress*

PubMed Central

Imlay, James A.

2014-01-01

Mononuclear iron enzymes can tightly bind non-activating metals. How do cells avoid mismetallation? The model bacterium Escherichia coli may control its metal pools so that thermodynamics favor the correct metallation of each enzyme. This system is disrupted, however, by superoxide and hydrogen peroxide. These species oxidize ferrous iron and thereby displace it from many iron-dependent mononuclear enzymes. Ultimately, zinc binds in its place, confers little activity, and imposes metabolic bottlenecks. Data suggest that E. coli compensates by using thiols to extract the zinc and by importing manganese to replace the catalytic iron atom. Manganese resists oxidants and provides substantial activity. PMID:25160623

Protein and Antibody Engineering by Phage Display

PubMed Central

Frei, J.C.; Lai, J.R.

2017-01-01

Phage display is an in vitro selection technique that allows for the rapid isolation of proteins with desired properties including increased affinity, specificity, stability, and new enzymatic activity. The power of phage display relies on the phenotype-to-genotype linkage of the protein of interest displayed on the phage surface with the encoding DNA packaged within the phage particle, which allows for selective enrichment of library pools and high-throughput screening of resulting clones. As an in vitro method, the conditions of the binding selection can be tightly controlled. Due to the high-throughput nature, rapidity, and ease of use, phage display is an excellent technological platform for engineering antibody or proteins with enhanced properties. Here, we describe methods for synthesis, selection, and screening of phage libraries with particular emphasis on designing humanizing antibody libraries and combinatorial scanning mutagenesis libraries. We conclude with a brief section on troubleshooting for all stages of the phage display process. PMID:27586328

Improvements on non-equilibrium and transport Green function techniques: The next-generation TRANSIESTA

NASA Astrophysics Data System (ADS)

Papior, Nick; Lorente, Nicolás; Frederiksen, Thomas; García, Alberto; Brandbyge, Mads

2017-03-01

We present novel methods implemented within the non-equilibrium Green function code (NEGF) TRANSIESTA based on density functional theory (DFT). Our flexible, next-generation DFT-NEGF code handles devices with one or multiple electrodes (Ne ≥ 1) with individual chemical potentials and electronic temperatures. We describe its novel methods for electrostatic gating, contour optimizations, and assertion of charge conservation, as well as the newly implemented algorithms for optimized and scalable matrix inversion, performance-critical pivoting, and hybrid parallelization. Additionally, a generic NEGF "post-processing" code (TBTRANS/PHTRANS) for electron and phonon transport is presented with several novelties such as Hamiltonian interpolations, Ne ≥ 1 electrode capability, bond-currents, generalized interface for user-defined tight-binding transport, transmission projection using eigenstates of a projected Hamiltonian, and fast inversion algorithms for large-scale simulations easily exceeding 106 atoms on workstation computers. The new features of both codes are demonstrated and bench-marked for relevant test systems.

Origami rules for the construction of localized eigenstates of the Hubbard model in decorated lattices

NASA Astrophysics Data System (ADS)

Dias, R. G.; Gouveia, J. D.

2015-11-01

We present a method of construction of exact localized many-body eigenstates of the Hubbard model in decorated lattices, both for U = 0 and U → ∞. These states are localized in what concerns both hole and particle movement. The starting point of the method is the construction of a plaquette or a set of plaquettes with a higher symmetry than that of the whole lattice. Using a simple set of rules, the tight-binding localized state in such a plaquette can be divided, folded and unfolded to new plaquette geometries. This set of rules is also valid for the construction of a localized state for one hole in the U → ∞ limit of the same plaquette, assuming a spin configuration which is a uniform linear combination of all possible permutations of the set of spins in the plaquette.

Multiple period s-p hybridization in nano-strip embedded photonic crystal.

PubMed

Han, Seunghoon; Lee, Il-Min; Kim, Hwi; Lee, Byoungho

2005-04-04

We report and analyze hybridization of s-state and p-state modes in photonic crystal one-dimensional defect cavity array. When embedding a nano-strip into a dielectric rod photonic crystal, an effective cavity array is made, where each cavity possesses two cavity modes: s-state and p-state. The two modes are laterally even versus the nano-strip direction, and interact with each other, producing defect bands, of which the group velocity becomes zero within the first Brillouin zone. We could model and describe the phenomena by using the tight-binding method, well agreeing with the plane-wave expansion method analysis. We note that the reported s- and p-state mode interaction corresponds to the hybridization of atomic orbital in solid-state physics. The concept of multiple period s-p hybridization and the proposed model can be useful for analyzing and developing novel photonic crystal waveguides and devices.

The Relationship of Ethics to Quality: A Particular Case of Research in Autism

ERIC Educational Resources Information Center

Waltz, Mitzi

2007-01-01

To look for the answers of "What is the relationship between "ethics" and "quality" in education research?," this article explores factors that bind the two too tightly together for extrication, including representation of subject and researcher mindsets, the setting of research agendas, research design and funding. Using research in autism as a…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Xiang, J.B.

We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.

Atomic resolution x-ray structure of the substrate recognition domain of higher plant rubisco activase

USDA-ARS?s Scientific Manuscript database

The rapid release of tight-binding inhibitors from dead-end Rubisco complexes requires the activity of Rubisco activase, an AAA+ ATPase that utilizes chemo-mechanical energy to catalyze the reactivation of Rubisco. Activase is thought to play a central role in coordinating the rate of CO2 fixation w...

Structural basis of oligosaccharide processing by glycosaminoglycan sulfotransferases.

PubMed

Gesteira, Tarsis F; Coulson-Thomas, Vivien J

2018-06-06

Heparan sulfate (HS) is a sulfated polysaccharide that plays a key role in morphogenesis, physiology and pathogenesis. The biosynthesis of HS takes place in the Golgi apparatus by a group of enzymes that polymerize, epimerize and sulfate the sugar chain. This biosynthetic process introduces varying degrees of sulfate substitution, which are tightly regulated and directly dictate binding specificity to different cytokines, morphogens and growth factors. Here we report the use of molecular dynamics simulations to investigate the dynamics of substrate recognition of two glycosaminoglycan (GAG) sulfotransferases, N-deacetylase-N-sulfotransferase and 2-O-sulfotransferase to the HS chain during the biosynthetic process. We performed multiple simulations of the binding of the sulfotransferase domains to both the HS oligosaccharide substrate and sulfate donor, 3'-phosphoadenosine-5'-phosphosulfate (PAPs). Analysis of extended simulations provide detailed and useful insights into the atomic interactions that are at work during oligosaccharide processing. The Fast Information Matching method was used to detect the enzyme global dynamics and to predict the pairwise contact of residues responsible for GAG-enzyme binding and unbinding. The correlation between HS displacement and the location of the modified GAG chain were calculated, indicating a possible route for HS and heparin during sulfotransferase processing. Our data also show sulfotransferases contain a conserved interspaced positively charged amino acid residues that form a patch which controls the protein-GAG binding equilibrium. Together, our findings provide further understanding on the fine-tuned complex mechanism of GAG biosynthesis. Our findings can also be extrapolated to other systems for calculating rates of protein-GAG binding.

Fractional charge and inter-Landau-level states at points of singular curvature.

PubMed

Biswas, Rudro R; Son, Dam Thanh

2016-08-02

The quest for universal properties of topological phases is fundamentally important because these signatures are robust to variations in system-specific details. Aspects of the response of quantum Hall states to smooth spatial curvature are well-studied, but challenging to observe experimentally. Here we go beyond this prevailing paradigm and obtain general results for the response of quantum Hall states to points of singular curvature in real space; such points may be readily experimentally actualized. We find, using continuum analytical methods, that the point of curvature binds an excess fractional charge and sequences of quantum states split away, energetically, from the degenerate bulk Landau levels. Importantly, these inter-Landau-level states are bound to the topological singularity and have energies that are universal functions of bulk parameters and the curvature. Our exact diagonalization of lattice tight-binding models on closed manifolds demonstrates that these results continue to hold even when lattice effects are significant. An important technological implication of these results is that these inter-Landau-level states, being both energetically and spatially isolated quantum states, are promising candidates for constructing qubits for quantum computation.

The yeast transcription elongation factor Spt4/5 is a sequence‐specific RNA binding protein

PubMed Central

Blythe, Amanda J.; Yazar‐Klosinski, Berra; Webster, Michael W.; Chen, Eefei; Vandevenne, Marylène; Bendak, Katerina; Mackay, Joel P.; Hartzog, Grant A.

2016-01-01

Abstract The heterodimeric transcription elongation factor Spt4/Spt5 (Spt4/5) tightly associates with RNAPII to regulate both transcriptional elongation and co‐transcriptional pre‐mRNA processing; however, the mechanisms by which Spt4/5 acts are poorly understood. Recent studies of the human and Drosophila Spt4/5 complexes indicate that they can bind nucleic acids in vitro. We demonstrate here that yeast Spt4/5 can bind in a sequence‐specific manner to single stranded RNA containing AAN repeats. Furthermore, we show that the major protein determinants for RNA‐binding are Spt4 together with the NGN domain of Spt5 and that the KOW domains are not required for RNA recognition. These findings attribute a new function to a domain of Spt4/5 that associates directly with RNAPII, making significant steps towards elucidating the mechanism behind transcriptional control by Spt4/5. PMID:27376968

Binding of trivalent chromium to serum transferrin is sufficiently rapid to be physiologically relevant.

PubMed

Deng, Ge; Wu, Kristi; Cruce, Alex A; Bowman, Michael K; Vincent, John B

2015-02-01

Transferrin, the major iron transport protein in the blood, also transports trivalent chromium in vivo. Recent in vitro studies have, however, suggested that the binding of chromic ions to apotransferrin is too slow to be biologically relevant. Nevertheless, the in vitro studies have generally failed to adequately take physiological bicarbonate concentrations into account. In aqueous buffer (with ambient (bi)carbonate concentrations), the binding of chromium to transferrin is too slow to be physiologically relevant, taking days to reach equilibrium with the protein's associated conformational changes. However, in the presence of 25mM (bi)carbonate, the concentration in human blood, chromic ions bind rapidly and tightly to transferrin. Details of the kinetics of chromium binding to human serum transferrin and conalbumin (egg white transferrin) in the presence of bicarbonate and other major potential chromium ligands are described and are consistent with transferrin being the major chromic ion transporter from the blood to tissues. Copyright © 2014 Elsevier Inc. All rights reserved.

MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

PubMed Central

Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

2003-01-01

Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

The Possible Mechanism of Idiosyncratic Lapatinib-Induced Liver Injury in Patients Carrying Human Leukocyte Antigen-DRB1*07:01

PubMed Central

Hirasawa, Makoto; Hagihara, Katsunobu; Okudaira, Noriko; Izumi, Takashi

2015-01-01

Idiosyncratic lapatinib-induced liver injury has been reported to be associated with human leukocyte antigen (HLA)-DRB1*07:01. In order to investigate its mechanism, interaction of lapatinib with HLA-DRB1*07:01 and its ligand peptide derived from tetanus toxoid, has been evaluated in vitro. Here we show that lapatinib enhances binding of the ligand peptide to HLA-DRB1*07:01. Furthermore in silico molecular dynamics analysis revealed that lapatinib could change the β chain helix in the HLA-DRB1*07:01 specifically to form a tightly closed binding groove structure and modify a large part of the binding groove. These results indicate that lapatinib affects the ligand binding to HLA-DRB1*07:01 and idiosyncratic lapatinib-induced liver injury might be triggered by this mechanism. This is the first report showing that the clinically available drug can enhance the binding of ligand peptide to HLA class II molecules in vitro and in silico. PMID:26098642

Mass spectrometry reveals that the antibiotic simocyclinone D8 binds to DNA gyrase in a "bent-over" conformation: evidence of positive cooperativity in binding.

PubMed

Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R

2011-05-03

DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.

Crystal structure of the Escherichia coli regulator of sigma70, Rsd, in complex with sigma70 domain 4.

PubMed

Patikoglou, Georgia A; Westblade, Lars F; Campbell, Elizabeth A; Lamour, Valérie; Lane, William J; Darst, Seth A

2007-09-21

The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) sigma(70) factor. Rsd plays a role in alternative sigma factor-dependent transcription by biasing the competition between sigma(70) and alternative sigma factors for the available core RNAP. Here, we determined the 2.6 A-resolution X-ray crystal structure of Rsd bound to sigma(70) domain 4 (sigma(70)(4)), the primary determinant for Rsd binding within sigma(70). The structure reveals that Rsd binding interferes with the two primary functions of sigma(70)(4), core RNAP binding and promoter -35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the sigma(70)(4)-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between sigma(70)(4) binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.

Crystal structure of the Escherichia coli regulator of σ70, Rsd, in complex with σ70 domain 4

PubMed Central

Patikoglou, Georgia A.; Westblade, Lars F.; Campbell, Elizabeth A.; Lamour, Valérie; Lane, William J.; Darst, Seth A.

2007-01-01

Summary The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) σ70 factor. Rsd plays a role in alternative σ factor-dependent transcription by biasing the competition between σ70 and alternative σ factors for the available core RNAP. Here, we determined the 2.6 Å-resolution X-ray crystal structure of Rsd bound to σ70 domain 4 (σ704), the primary determinant for Rsd binding within σ70. The structure reveals that Rsd binding interferes with the two primary functions of σ704, core RNAP binding and promoter –35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the σ704-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between σ704 binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation. PMID:17681541

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patikoglou,G.; Westblade, L.; Campbell, E.

The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) {sigma}{sup 70} factor. Rsd plays a role in alternative {sigma} factor-dependent transcription by biasing the competition between {sigma}{sup 70} and alternative {sigma} factors for the available core RNAP. Here, we determined the 2.6 {angstrom}-resolution X-ray crystal structure of Rsd bound to {sigma}{sup 70} domain 4 ({sigma}{sup 70}{sub 4}), the primary determinant for Rsd binding within {sigma}{sup 70}. The structure reveals that Rsd binding interferes with the two primary functions of {sigma}{sup 70}{sub 4}, core RNAP binding and promoter -35 element binding. Interestingly, the most highly conservedmore » Rsd residues form a network of interactions through the middle of the Rsd structure that connect the {sigma}{sup 70}{sub 4}-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between {sigma}{sup 70}{sub 4} binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.« less

AUV Positioning Method Based on Tightly Coupled SINS/LBL for Underwater Acoustic Multipath Propagation.

PubMed

Zhang, Tao; Shi, Hongfei; Chen, Liping; Li, Yao; Tong, Jinwu

2016-03-11

This paper researches an AUV (Autonomous Underwater Vehicle) positioning method based on SINS (Strapdown Inertial Navigation System)/LBL (Long Base Line) tightly coupled algorithm. This algorithm mainly includes SINS-assisted searching method of optimum slant-range of underwater acoustic propagation multipath, SINS/LBL tightly coupled model and multi-sensor information fusion algorithm. Fuzzy correlation peak problem of underwater LBL acoustic propagation multipath could be solved based on SINS positional information, thus improving LBL positional accuracy. Moreover, introduction of SINS-centered LBL locating information could compensate accumulative AUV position error effectively and regularly. Compared to loosely coupled algorithm, this tightly coupled algorithm can still provide accurate location information when there are fewer than four available hydrophones (or within the signal receiving range). Therefore, effective positional calibration area of tightly coupled system based on LBL array is wider and has higher reliability and fault tolerance than loosely coupled. It is more applicable to AUV positioning based on SINS/LBL.

AUV Positioning Method Based on Tightly Coupled SINS/LBL for Underwater Acoustic Multipath Propagation

PubMed Central

Zhang, Tao; Shi, Hongfei; Chen, Liping; Li, Yao; Tong, Jinwu

2016-01-01

This paper researches an AUV (Autonomous Underwater Vehicle) positioning method based on SINS (Strapdown Inertial Navigation System)/LBL (Long Base Line) tightly coupled algorithm. This algorithm mainly includes SINS-assisted searching method of optimum slant-range of underwater acoustic propagation multipath, SINS/LBL tightly coupled model and multi-sensor information fusion algorithm. Fuzzy correlation peak problem of underwater LBL acoustic propagation multipath could be solved based on SINS positional information, thus improving LBL positional accuracy. Moreover, introduction of SINS-centered LBL locating information could compensate accumulative AUV position error effectively and regularly. Compared to loosely coupled algorithm, this tightly coupled algorithm can still provide accurate location information when there are fewer than four available hydrophones (or within the signal receiving range). Therefore, effective positional calibration area of tightly coupled system based on LBL array is wider and has higher reliability and fault tolerance than loosely coupled. It is more applicable to AUV positioning based on SINS/LBL. PMID:26978361

Dissipative time-dependent quantum transport theory.

PubMed

Zhang, Yu; Yam, Chi Yung; Chen, GuanHua

2013-04-28

A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.

Quantitative relation between intermolecular and intramolecular binding of pro-rich peptides to SH3 domains.

PubMed

Zhou, Huan-Xiang

2006-11-01

Flexible linkers are often found to tether binding sequence motifs or connect protein domains. Here we analyze three usages of flexible linkers: 1), intramolecular binding of proline-rich peptides (PRPs) to SH3 domains for kinase regulation; 2), intramolecular binding of PRP for increasing the folding stability of SH3 domains; and 3), covalent linking of PRPs and other ligands for high-affinity bivalent binding. The basis of these analyses is a quantitative relation between intermolecular and intramolecular binding constants. This relation has the form K(i) = K(e0)p for intramolecular binding and K(e) = K(e01)K(e02)p for bivalent binding. The effective concentration p depends on the length of the linker and the distance between the linker attachment points in the bound state. Several applications illustrate the usefulness of the quantitative relation. These include intramolecular binding to the Itk SH3 domain by an internal PRP and to a circular permutant of the alpha-spectrin SH3 domain by a designed PRP, and bivalent binding to the two SH3 domains of Grb2 by two linked PRPs. These and other examples suggest that flexible linkers and sequence motifs tethered to them, like folded protein domains, are also subject to tight control during evolution.

Non-specific binding of Na+ and Mg2+ to RNA determined by force spectroscopy methods

PubMed Central

Bizarro, C. V.; Alemany, A.; Ritort, F.

2012-01-01

RNA duplex stability depends strongly on ionic conditions, and inside cells RNAs are exposed to both monovalent and multivalent ions. Despite recent advances, we do not have general methods to quantitatively account for the effects of monovalent and multivalent ions on RNA stability, and the thermodynamic parameters for secondary structure prediction have only been derived at 1M [Na+]. Here, by mechanically unfolding and folding a 20 bp RNA hairpin using optical tweezers, we study the RNA thermodynamics and kinetics at different monovalent and mixed monovalent/Mg2+ salt conditions. We measure the unfolding and folding rupture forces and apply Kramers theory to extract accurate information about the hairpin free energy landscape under tension at a wide range of ionic conditions. We obtain non-specific corrections for the free energy of formation of the RNA hairpin and measure how the distance of the transition state to the folded state changes with force and ionic strength. We experimentally validate the Tightly Bound Ion model and obtain values for the persistence length of ssRNA. Finally, we test the approximate rule by which the non-specific binding affinity of divalent cations at a given concentration is equivalent to that of monovalent cations taken at 100-fold concentration for small molecular constructs. PMID:22492710

Small Molecules Engage Hot Spots through Cooperative Binding To Inhibit a Tight Protein-Protein Interaction.

PubMed

Liu, Degang; Xu, David; Liu, Min; Knabe, William Eric; Yuan, Cai; Zhou, Donghui; Huang, Mingdong; Meroueh, Samy O

2017-03-28

Protein-protein interactions drive every aspect of cell signaling, yet only a few small-molecule inhibitors of these interactions exist. Despite our ability to identify critical residues known as hot spots, little is known about how to effectively engage them to disrupt protein-protein interactions. Here, we take advantage of the ease of preparation and stability of pyrrolinone 1, a small-molecule inhibitor of the tight interaction between the urokinase receptor (uPAR) and its binding partner, the urokinase-type plasminogen activator uPA, to synthesize more than 40 derivatives and explore their effect on the protein-protein interaction. We report the crystal structure of uPAR bound to previously discovered pyrazole 3 and to pyrrolinone 12. While both 3 and 12 bind to uPAR and compete with a fluorescently labeled peptide probe, only 12 and its derivatives inhibit the full uPAR·uPA interaction. Compounds 3 and 12 mimic and engage different hot-spot residues on uPA and uPAR, respectively. Interestingly, 12 is involved in a π-cation interaction with Arg-53, which is not considered a hot spot. Explicit-solvent molecular dynamics simulations reveal that 3 and 12 exhibit dramatically different correlations of motion with residues on uPAR. Free energy calculations for the wild-type and mutant uPAR bound to uPA or 12 show that Arg-53 interacts with uPA or with 12 in a highly cooperative manner, thereby altering the contributions of hot spots to uPAR binding. The direct engagement of peripheral residues not considered hot spots through π-cation or salt-bridge interactions could provide new opportunities for enhanced small-molecule engagement of hot spots to disrupt challenging protein-protein interactions.

Expression of Ulex europaeus agglutinin I lectin-binding sites in squamous cell carcinomas and their absence in basal cell carcinomas. Indicator of tumor type and differentiation.

PubMed

Heng, M C; Fallon-Friedlander, S; Bennett, R

1992-06-01

Lectins bind tightly to carbohydrate moieties on cell surfaces. Alterations in lectin binding have been reported to accompany epidermal cell differentiation, marking alterations in membrane sugars during this process. The presence of UEA I (Ulex europaeus agglutinin I) L-fucose-specific lectin-binding sites has been used as a marker for terminally differentiated (committed) keratinocytes. In this article, we report the presence of UEA-I-binding sites on squamous keratinocytes of well-differentiated squamous cell carcinomas, with patchy loss of UEA I positivity on poorly differentiated cells of squamous cell carcinomas, suggesting a possible use for this technique in the rapid assessment of less differentiated areas within the squamous cell tumor. The absence of UEA-I-binding sites on basal cell carcinomas may be related to an inability of cells comprising this tumor to convert the L-D-pyranosyl moiety on basal cells to the L-fucose moiety, resulting in an inability of basal cell carcinoma cell to undergo terminal differentiation into a committed keratinocyte.

Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

PubMed

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-08-09

The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.

Assessment of the Activation of Rho Family GTP-Binding Proteins in Breast Cancer Cells and Specimens

DTIC Science & Technology

2001-08-01

lymphopenia Vav2 GEF for Rho, Rac, and Cdc42 proto-oncogene product; NM009500 Vav3 GEF for Rho and Rac proto-oncogene product; NM020505 hPEM -2 GEF for...junctions, and desmosomes play a fundamental role in maintaining the polarized phenotype and vectorial transport functions of epithelial cells. The tight

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Ring, D.M.

The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.

2016-04-13

We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less

Model many-body Stoner Hamiltonian for binary FeCr alloys

NASA Astrophysics Data System (ADS)

Nguyen-Manh, D.; Dudarev, S. L.

2009-09-01

We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

2014-03-01

Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE PAGES

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

2017-10-17

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Electronic Structure and Properties of Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Yang, Liu; Arnold, Jim (Technical Monitor)

2001-01-01

A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.

Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

NASA Astrophysics Data System (ADS)

Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

2018-04-01

Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

Photonic Bandgaps in Photonic Molecules

NASA Technical Reports Server (NTRS)

Smith, David D.; Chang, Hongrok; Gates, Amanda L.; Fuller, Kirk A.; Gregory, Don A.; Witherow, William K.; Paley, Mark S.; Frazier, Donald O.; Curreri, Peter A. (Technical Monitor)

2002-01-01

This talk will focus on photonic bandgaps that arise due to nearly free photon and tight-binding effects in coupled microparticle and ring-resonator systems. The Mie formulation for homogeneous spheres is generalized to handle core/shell systems and multiple concentric layers in a manner that exploits an analogy with stratified planar systems, thereby allowing concentric multi-layered structures to be treated as photonic bandgap (PBG) materials. Representative results from a Mie code employing this analogy demonstrate that photonic bands arising from nearly free photon effects are easily observed in the backscattering, asymmetry parameter, and albedo for periodic quarter-wave concentric layers, though are not readily apparent in extinction spectra. Rather, the periodicity simply alters the scattering profile, enhancing the ratio of backscattering to forward scattering inside the bandgap, in direct analogy with planar quarter-wave multilayers. PBGs arising from tight-binding may also be observed when the layers (or rings) are designed such that the coupling between them is weak. We demonstrate that for a structure consisting of N coupled micro-resonators, the morphology dependent resonances split into N higher-Q modes, in direct analogy with other types of oscillators, and that this splitting ultimately results in PBGs which can lead to enhanced nonlinear optical effects.

Effect of Sb in thick InGaAsSbN layers grown by liquid phase epitaxy

NASA Astrophysics Data System (ADS)

Donchev, V.; Milanova, M.; Asenova, I.; Shtinkov, N.; Alonso-Álvarez, D.; Mellor, A.; Karmakov, Y.; Georgiev, S.; Ekins-Daukes, N.

2018-02-01

Dilute nitride InGaAsSbN layers grown by low-temperature liquid phase epitaxy are studied in comparison with quaternary InGaAsN layers grown at the same growth conditions to understand the effect of Sb in the alloy. The lattice mismatch to the GaAs substrate is found to be slightly larger for the InGaAsSbN layers, which is explained by the large atomic radius of Sb. A reduction of the band gap energy with respect to InGaAsN is demonstrated by means of photoluminescence (PL), surface photovoltage (SPV) spectroscopy and tight-binding calculations. The band-gap energies determined from PL and ellipsometry measurements are in good agreement, while the SPV spectroscopy and the tight-binding calculations provide lower values. Possible reasons for these discrepancies are discussed. The PL spectra reveal localized electronic states in the band gap near the conduction band edge, which is confirmed by SPV spectroscopy. The analysis of the power dependence of the integrated PL has allowed determining the dominant radiative recombination mechanisms in the layers. The values of the refraction index in a wide spectral region are found to be higher for the Sb containing layers.

Specific binding of Clostridium perfringens enterotoxin fragment to Claudin-b and modulation of zebrafish epidermal barrier.

PubMed

Zhang, Jingjing; Ni, Chen; Yang, Zhenguo; Piontek, Anna; Chen, Huapu; Wang, Sijie; Fan, Yiming; Qin, Zhihai; Piontek, Joerg

2015-08-01

Claudins (Cldn) are the major components of tight junctions (TJs) sealing the paracellular cleft in tissue barriers of various organs. Zebrafish Cldnb, the homolog of mammalian Cldn4, is expressed at epithelial cell-cell contacts and is important for regulating epidermal permeability. The bacterial toxin Clostridium perfringens enterotoxin (CPE) has been shown to bind to a subset of mammalian Cldns. In this study, we used the Cldn-binding C-terminal domain of CPE (194-319 amino acids, cCPE 194-319 ) to investigate its functional role in modulating zebrafish larval epidermal barriers. In vitro analyses show that cCPE 194-319 removed Cldn4 from epithelial cells and disrupted the monolayer tightness, which could be rescued by the removal of cCPE 194-319. Incubation of zebrafish larvae with cCPE 194-319 removed Cldnb specifically from the epidermal cell membrane. Dye diffusion analysis with 4-kDa fluorescent dextran indicated that the permeability of the epidermal barrier increased due to cCPE 194-319 incubation. Electron microscopic investigation revealed reversible loss of TJ integrity by Cldnb removal. Collectively, these results suggest that cCPE 194-319 could be used as a Cldnb modulator to transiently open the epidermal barrier in zebrafish. In addition, zebrafish might be used as an in vivo system to investigate the capability of cCPE to enhance drug delivery across tissue barriers. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genetic evidence for a tight cooperation of TatB and TatC during productive recognition of twin-arginine (Tat) signal peptides in Escherichia coli.

PubMed

Lausberg, Frank; Fleckenstein, Stefan; Kreutzenbeck, Peter; Fröbel, Julia; Rose, Patrick; Müller, Matthias; Freudl, Roland

2012-01-01

The twin arginine translocation (Tat) pathway transports folded proteins across the cytoplasmic membrane of bacteria. Tat signal peptides contain a consensus motif (S/T-R-R-X-F-L-K) that is thought to play a crucial role in substrate recognition by the Tat translocase. Replacement of the phenylalanine at the +2 consensus position in the signal peptide of a Tat-specific reporter protein (TorA-MalE) by aspartate blocked export of the corresponding TorA(D(+2))-MalE precursor, indicating that this mutation prevents a productive binding of the TorA(D(+2)) signal peptide to the Tat translocase. Mutations were identified in the extreme amino-terminal regions of TatB and TatC that synergistically suppressed the export defect of TorA(D(+2))-MalE when present in pairwise or triple combinations. The observed synergistic suppression activities were even more pronounced in the restoration of membrane translocation of another export-defective precursor, TorA(KQ)-MalE, in which the conserved twin arginine residues had been replaced by lysine-glutamine. Collectively, these findings indicate that the extreme amino-terminal regions of TatB and TatC cooperate tightly during recognition and productive binding of Tat-dependent precursor proteins and, furthermore, that TatB and TatC are both involved in the formation of a specific signal peptide binding site that reaches out as far as the end of the TatB transmembrane segment.

Interactions of Kid–Kis toxin–antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid–Kis oligomers

PubMed Central

Monti, Maria C.; Hernández-Arriaga, Ana M.; Kamphuis, Monique B.; López-Villarejo, Juan; Heck, Albert J. R.; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H. H.

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin–antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid–kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid–Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2–Kis2–Kid2–Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2–Kis2–Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2–Kis2)n complexes repress the kid–kis operon. PMID:17317682

Analysis of E2F factors during epidermal differentiation.

PubMed

Chang, Wing Y; Dagnino, Lina

2005-01-01

The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

Impact of the Topological Surface State on the Thermoelectric Transport in Sb2Te3 Thin Films.

PubMed

Hinsche, Nicki F; Zastrow, Sebastian; Gooth, Johannes; Pudewill, Laurens; Zierold, Robert; Rittweger, Florian; Rauch, Tomáš; Henk, Jürgen; Nielsch, Kornelius; Mertig, Ingrid

2015-04-28

Ab initio electronic structure calculations based on density functional theory and tight-binding methods for the thermoelectric properties of p-type Sb2Te3 films are presented. The thickness-dependent electrical conductivity and the thermopower are computed in the diffusive limit of transport based on the Boltzmann equation. Contributions of the bulk and the surface to the transport coefficients are separated, which enables to identify a clear impact of the topological surface state on the thermoelectric properties. When the charge carrier concentration is tuned, a crossover between a surface-state-dominant and a Fuchs-Sondheimer transport regime is achieved. The calculations are corroborated by thermoelectric transport measurements on Sb2Te3 films grown by atomic layer deposition.

Analytical solutions of the two-dimensional Dirac equation for a topological channel intersection

NASA Astrophysics Data System (ADS)

Anglin, J. R.; Schulz, A.

2017-01-01

Numerical simulations in a tight-binding model have shown that an intersection of topologically protected one-dimensional chiral channels can function as a beam splitter for noninteracting fermions on a two-dimensional lattice [Qiao, Jung, and MacDonald, Nano Lett. 11, 3453 (2011), 10.1021/nl201941f; Qiao et al., Phys. Rev. Lett. 112, 206601 (2014), 10.1103/PhysRevLett.112.206601]. Here we confirm this result analytically in the corresponding continuum k .p model, by solving the associated two-dimensional Dirac equation, in the presence of a "checkerboard" potential that provides a right-angled intersection between two zero-line modes. The method by which we obtain our analytical solutions is systematic and potentially generalizable to similar problems involving intersections of one-dimensional systems.

Why Are Buckyonions Round?

NASA Technical Reports Server (NTRS)

Bates, Kevin R.; Scuseria, Gustavo E.

1997-01-01

Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite carbon. However, theoretical models of large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations of round buckyonions and theoretical predictions of faceted icosahedral fullerenes.

First-Principles Study on the Gilbert Damping Constants of Transition Metal Alloys, Fe--Ni and Fe--Pt Systems

NASA Astrophysics Data System (ADS)

Sakuma, Akimasa

2012-08-01

We adapt the tight-binding linear muffin-tin orbital (TB-LMTO) method to the torque-correlation model for the Gilbert damping constant α and perform the first-principles calculation for disordered transition metal alloys, Fe--Ni and Fe--Pt systems, within the framework of the CPA. Quantitatively, the calculated α values are about one-half of the experimental values, whereas the variations in the Fermi level dependence of α are much larger than these discrepancies. As expected, we confirm in the (Fe--Ni)1-XPtX and FePt systems that Pt atoms certainly enhance α owing to their large spin--orbit coupling. For the disordered alloys, we find that α decreases with increasing chemical degree of order in a wide range.

Enhancement of thermoelectric figure of merit in zigzag graphene nanoribbons with periodic edge vacancies

NASA Astrophysics Data System (ADS)

Kolesnikov, D. V.; Sadykova, O. G.; Osipov, V. A.

2017-06-01

The influence of periodic edge vacancies and antidot arrays on the thermoelectric properties of zigzag graphene nanoribbons (ZGNRs) are investigated. Using Green’s function method, the tight-binding approximation for the electron Hamiltonian and the 4th nearest neighbor approximation for the phonon dynamical matrix, we calculate the Seebeck coefficient and the thermoelectric figure of merit. It is found that, at a certain periodic arrangement of vacancies on both edges of zigzag nanoribbon, a finite band gap opens and almost twofold degenerate energy levels appear. As a result, a marked increase in the Seebeck coefficient takes place. It is shown that an additional enhancement of the thermoelectric figure of merit can be achieved by a combination of periodic edge defects with an antidot array.

Dynamic docking and electron transfer between Zn-myoglobin and cytochrome b(5).

PubMed

Liang, Zhao-Xun; Nocek, Judith M; Huang, Kai; Hayes, Ryan T; Kurnikov, Igor V; Beratan, David N; Hoffman, Brian M

2002-06-19

We present a broad study of the effect of neutralizing the two negative charges of the Mb propionates on the interaction and electron transfer (ET) between horse Mb and bovine cyt b(5), through use of Zn-substituted Mb (ZnMb, 1) to study the photoinitiated reaction, ((3)ZnP)Mb + Fe(3+)cyt b(5) --> (ZnP)(+)Mb + Fe(2+)cyt b(5). The charge neutralization has been carried out both by replacing the Mb heme with zinc-deuteroporphyrin dimethylester (ZnMb(dme), 2), which replaces the charges by small neutral hydrophobic patches, and also by replacement with the newly prepared zinc-deuteroporphyrin diamide (ZnMb(diamide), 3), which converts the charged groups to neutral, hydrophilic ones. The effect of propionate neutralization on the conformation of the zinc-porphyrin in the Mb heme pocket has been studied by multinuclear NMR with an (15)N labeled zinc porphyrin derivative (ZnMb((15)N-diamide), 4). The rates of photoinitiated ET between the Mb's (1-3) and cyt b(5) have been measured over a range of pH values and ionic strengths. Isothermal titration calorimetry (ITC) and NMR methods have been used to independently investigate the effect of charge neutralization on Mb/b(5) binding. The neutralization of the two heme propionates of ZnMb by formation of the heme diester or, for the first time, the diamide increases the second-order rate constant of the ET reaction between ZnMb and cyt b(5) by as much as several 100-fold, depending on pH and ionic strength, while causing negligible changes in binding affinity. Brownian dynamic (BD) simulations and ET pathway calculations provide insight into the protein docking and ET process. The results support a new "dynamic docking" paradigm for protein-protein reactions in which numerous weakly bound conformations of the docked complex contribute to the binding of cyt b(5) to Mb and Hb, but only a very small subset of these are ET active, and this subset does not include the conformations most favorable for binding; the Mb surface is a large "target" with a small "bullseye" for the cyt b(5) "arrow". This paradigm differs sharply from the more familiar, "simple" docking within a single, or narrow range of conformations, where binding strength and ET reactivity increase in parallel. Likewise, it is distinct from, although complementary to, the well-known picture of conformational control of ET through "gating", or a related picture of "conformational coupling". The new model describes situations in which tight binding does not correlate with efficient ET reactivity, and explains how it is possible to modulate reactivity without changing affinity. Such "decoupling" of reactivity from binding clearly is of physiological relevance for the reduction of met-Mb in muscle and of met-Hb in a red cell, where tight binding of cyt b(5) to the high concentration of ferrous-Mb/Hb would prevent the cytochrome from finding and reducing the oxidized proteins; it likely is of physiological relevance in other situations, as well.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Structural mechanism of the ATP-induced dissociation of rigor myosin from actin

PubMed Central

Kühner, Sebastian; Fischer, Stefan

2011-01-01

Myosin is a true nanomachine, which produces mechanical force from ATP hydrolysis by cyclically interacting with actin filaments in a four-step cycle. The principle underlying each step is that structural changes in separate regions of the protein must be mechanically coupled. The step in which myosin dissociates from tightly bound actin (the rigor state) is triggered by the 30 Å distant binding of ATP. Large conformational differences between the crystal structures make it difficult to perceive the coupling mechanism. Energetically accessible transition pathways computed at atomic detail reveal a simple coupling mechanism for the reciprocal binding of ATP and actin. PMID:21518908

Equilibrium structure and atomic vibrations of Nin clusters

NASA Astrophysics Data System (ADS)

Borisova, Svetlana D.; Rusina, Galina G.

2017-12-01

The equilibrium bond lengths and binding energy, second differences in energy and vibrational frequencies of free clusters Nin (2 ≤ n ≤ 20) were calculated with the use of the interaction potential obtained in the tight-binding approximation (TBA). The results show that the minimum vibration frequency plays a significant role in the evaluation of the dynamic stability of the clusters. A nonmonotonic dependence of the minimum vibration frequency of clusters on their size and the extreme values for the number of atoms in a cluster n = 4, 6, 13, and 19 are demonstrated. This result agrees with the theoretical and experimental data on stable structures of small metallic clusters.

A new method of evaluating tight gas sands pore structure from nuclear magnetic resonance (NMR) logs

NASA Astrophysics Data System (ADS)

Xiao, Liang; Mao, Zhi-qiang; Xie, Xiu-hong

2016-04-01

Tight gas sands always display such characteristics of ultra-low porosity, permeability, high irreducible water, low resistivity contrast, complicated pore structure and strong heterogeneity, these make that the conventional methods are invalid. Many effective gas bearing formations are considered as dry zones or water saturated layers, and cannot be identified and exploited. To improve tight gas sands evaluation, the best method is quantitative characterizing rock pore structure. The mercury injection capillary pressure (MICP) curves are advantageous in predicting formation pore structure. However, the MICP experimental measurements are limited due to the environment and economy factors, this leads formation pore structure cannot be consecutively evaluated. Nuclear magnetic resonance (NMR) logs are considered to be promising in evaluating rock pore structure. Generally, to consecutively quantitatively evaluate tight gas sands pore structure, the best method is constructing pseudo Pc curves from NMR logs. In this paper, based on the analysis of lab experimental results for 20 core samples, which were drilled from tight gas sandstone reservoirs of Sichuan basin, and simultaneously applied for lab MICP and NMR measurements, the relationships of piecewise power function between nuclear magnetic resonance (NMR) transverse relaxation T2 time and pore-throat radius Rc are established. A novel method, which is used to transform NMR reverse cumulative curve as pseudo capillary pressure (Pc) curve is proposed, and the corresponding model is established based on formation classification. By using this model, formation pseudo Pc curves can be consecutively synthesized. The pore throat radius distribution, and pore structure evaluation parameters, such as the average pore throat radius (Rm), the threshold pressure (Pd), the maximum pore throat radius (Rmax) and so on, can also be precisely extracted. After this method is extended into field applications, several tight gas sandstone reservoirs are processed, and the predicted results are compared with core derived results. Good consistency between evaluated results with core derived results illustrates the dependability of the proposed method. Comparing with the previous methods, this presented model is much more theoretical, and the applicability is much improved. Combining with the evaluated results, our target tight gas sands are well evaluated, and many potential gas-bearing layers are effectively identified.

Comparison of cation adsorption by isostructural rutile and cassiterite.

PubMed

Machesky, Michael; Wesolowski, David; Rosenqvist, Jörgen; Předota, Milan; Vlcek, Lukas; Ridley, Moira; Kohli, Vaibhav; Zhang, Zhan; Fenter, Paul; Cummings, Peter; Lvov, Serguei; Fedkin, Mark; Rodriguez-Santiago, Victor; Kubicki, James; Bandura, Andrei

2011-04-19

Macroscopic net proton charging curves for powdered rutile and cassiterite specimens with the (110) crystal face predominant, as a function of pH in RbCl and NaCl solutions, trace SrCl(2) in NaCl, and trace ZnCl(2) in NaCl and Na Triflate solutions, are compared to corresponding molecular-level information obtained from static DFT optimizations and classical MD simulations, as well as synchrotron X-ray methods. The similarities and differences in the macroscopic charging behavior of rutile and cassiterite largely reflect the cation binding modes observed at the molecular level. Cation adsorption is primarily inner-sphere on both isostructural (110) surfaces, despite predictions that outer-sphere binding should predominate on low bulk dielectric constant oxides such as cassiterite (ε(bulk) ≈ 11). Inner-sphere adsorption is also significant for Rb(+) and Na(+) on neutral surfaces, whereas Cl(-) binding is predominately outer-sphere. As negative surface charge increases, relatively more Rb(+), Na(+), and especially Sr(2+) are bound in highly desolvated tetradentate fashion on the rutile (110) surface, largely accounting for enhanced negative charge development relative to cassiterite. Charging curves in the presence of Zn(2+) are very steep but similar for both oxides, reflective of Zn(2+) hydrolysis (and accompanying proton release) during the adsorption process, and the similar binding modes for ZnOH(+) on both surfaces. These results suggest that differences in cation adsorption between high and low bulk dielectric constant oxides are more subtly related to the relative degree of cation desolvation accompanying inner-sphere binding (i.e., more tetradentate binding on rutile), rather than distinct inner- and outer-sphere adsorption modes. Cation desolvation may be favored at the rutile (110) surface in part because inner-sphere water molecules are bound further from and less tightly than on the cassiterite (110) surface. Hence, their removal upon inner-sphere cation binding is relatively more favorable. © 2011 American Chemical Society

Quantitative analyses of bifunctional molecules.

PubMed

Braun, Patrick D; Wandless, Thomas J

2004-05-11

Small molecules can be discovered or engineered to bind tightly to biologically relevant proteins, and these molecules have proven to be powerful tools for both basic research and therapeutic applications. In many cases, detailed biophysical analyses of the intermolecular binding events are essential for improving the activity of the small molecules. These interactions can often be characterized as straightforward bimolecular binding events, and a variety of experimental and analytical techniques have been developed and refined to facilitate these analyses. Several investigators have recently synthesized heterodimeric molecules that are designed to bind simultaneously with two different proteins to form ternary complexes. These heterodimeric molecules often display compelling biological activity; however, they are difficult to characterize. The bimolecular interaction between one protein and the heterodimeric ligand (primary dissociation constant) can be determined by a number of methods. However, the interaction between that protein-ligand complex and the second protein (secondary dissociation constant) is more difficult to measure due to the noncovalent nature of the original protein-ligand complex. Consequently, these heterodimeric compounds are often characterized in terms of their activity, which is an experimentally dependent metric. We have developed a general quantitative mathematical model that can be used to measure both the primary (protein + ligand) and secondary (protein-ligand + protein) dissociation constants for heterodimeric small molecules. These values are largely independent of the experimental technique used and furthermore provide a direct measure of the thermodynamic stability of the ternary complexes that are formed. Fluorescence polarization and this model were used to characterize the heterodimeric molecule, SLFpYEEI, which binds to both FKBP12 and the Fyn SH2 domain, demonstrating that the model is useful for both predictive as well as ex post facto analytical applications.

Computational prediction and biochemical characterization of novel RNA aptamers to Rift Valley fever virus nucleocapsid protein.

PubMed

Ellenbecker, Mary; St Goddard, Jeremy; Sundet, Alec; Lanchy, Jean-Marc; Raiford, Douglas; Lodmell, J Stephen

2015-10-01

Rift Valley fever virus (RVFV) is a potent human and livestock pathogen endemic to sub-Saharan Africa and the Arabian Peninsula that has potential to spread to other parts of the world. Although there is no proven effective and safe treatment for RVFV infections, a potential therapeutic target is the virally encoded nucleocapsid protein (N). During the course of infection, N binds to viral RNA, and perturbation of this interaction can inhibit viral replication. To gain insight into how N recognizes viral RNA specifically, we designed an algorithm that uses a distance matrix and multidimensional scaling to compare the predicted secondary structures of known N-binding RNAs, or aptamers, that were isolated and characterized in previous in vitro evolution experiment. These aptamers did not exhibit overt sequence or predicted structure similarity, so we employed bioinformatic methods to propose novel aptamers based on analysis and clustering of secondary structures. We screened and scored the predicted secondary structures of novel randomly generated RNA sequences in silico and selected several of these putative N-binding RNAs whose secondary structures were similar to those of known N-binding RNAs. We found that overall the in silico generated RNA sequences bound well to N in vitro. Furthermore, introduction of these RNAs into cells prior to infection with RVFV inhibited viral replication in cell culture. This proof of concept study demonstrates how the predictive power of bioinformatics and the empirical power of biochemistry can be jointly harnessed to discover, synthesize, and test new RNA sequences that bind tightly to RVFV N protein. The approach would be easily generalizable to other applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

Glucocorticoid Induction of Occludin Expression and Endothelial Barrier Requires Transcription Factor p54 NONO

PubMed Central

Keil, Jason M.; Liu, Xuwen; Antonetti, David A.

2013-01-01

Purpose. Glucocorticoids (GCs) effectively reduce retinal edema and induce vascular barrier properties but possess unwanted side effects. Understanding GC induction of barrier properties may lead to more effective and specific therapies. Previous work identified the occludin enhancer element (OEE) as a GC-responsive cis-element in the promoters of multiple junctional genes, including occludin, claudin-5, and cadherin-9. Here, we identify two OEE-binding factors and determine their contribution to GC induction of tight junction (TJ) gene expression and endothelial barrier properties. Methods. OEE-binding factors were isolated from human retinal endothelial cells (HREC) using DNA affinity purification followed by MALDI-TOF MS/MS. Chromatin immunoprecipitation (ChIP) assays determined in situ binding. siRNA was used to evaluate the role of trans-acting factors in transcription of TJ genes in response to GC stimulation. Paracellular permeability was determined by quantifying flux through a cell monolayer, whereas transendothelial electrical resistance (TER) was measured using the ECIS system. Results. MS/MS analysis of HREC nuclear extracts identified the heterodimer of transcription factors p54/NONO (p54) and polypyrimidine tract-binding protein-associated splicing factor (PSF) as OEE-binding factors, which was confirmed by ChIP assay from GC-treated endothelial cells and rat retina. siRNA knockdown of p54 demonstrated that this factor is necessary for GC induction of occludin and claudin-5 expression. Further, p54 knockdown ablated the pro-barrier effects of GC treatment. Conclusions. p54 is essential for GC-mediated expression of occludin, claudin-5, and barrier induction, and the p54/PSF heterodimer may contribute to normal blood-retinal barrier (BRB) induction in vivo. Understanding the mechanism of GC induction of BRB properties may provide novel therapies for macular edema. PMID:23640037

Structural insights into the interaction between a potent anti-inflammatory protein, viral CC chemokine inhibitor (vCCI), and the human CC chemokine, Eotaxin-1.

PubMed

Kuo, Nai-Wei; Gao, Yong-Guang; Schill, Megan S; Isern, Nancy; Dupureur, Cynthia M; Liwang, Patricia J

2014-03-07

Chemokines play important roles in the immune system, not only recruiting leukocytes to the site of infection and inflammation but also guiding cell homing and cell development. The soluble poxvirus-encoded protein viral CC chemokine inhibitor (vCCI), a CC chemokine inhibitor, can bind to human CC chemokines tightly to impair the host immune defense. This protein has no known homologs in eukaryotes and may represent a potent method to stop inflammation. Previously, our structure of the vCCI·MIP-1β (macrophage inflammatory protein-1β) complex indicated that vCCI uses negatively charged residues in β-sheet II to interact with positively charged residues in the MIP-1β N terminus, 20s region and 40s loop. However, the interactions between vCCI and other CC chemokines have not yet been fully explored. Here, we used NMR and fluorescence anisotropy to study the interaction between vCCI and eotaxin-1 (CCL11), a CC chemokine that is an important factor in the asthma response. NMR results reveal that the binding pattern is very similar to the vCCI·MIP-1β complex and suggest that electrostatic interactions provide a major contribution to binding. Fluorescence anisotropy results on variants of eotaxin-1 further confirm the critical roles of the charged residues in eotaxin-1. In addition, the binding affinity between vCCI and other wild type CC chemokines, MCP-1 (monocyte chemoattractant protein-1), MIP-1β, and RANTES (regulated on activation normal T cell expressed and secreted), were determined as 1.1, 1.2, and 0.22 nm, respectively. To our knowledge, this is the first work quantitatively measuring the binding affinity between vCCI and multiple CC chemokines.

Structural Insights into the Interaction between a Potent Anti-inflammatory Protein, Viral CC Chemokine Inhibitor (vCCI), and the Human CC Chemokine, Eotaxin-1*

PubMed Central

Kuo, Nai-Wei; Gao, Yong-Guang; Schill, Megan S.; Isern, Nancy; Dupureur, Cynthia M.; LiWang, Patricia J.

2014-01-01

Chemokines play important roles in the immune system, not only recruiting leukocytes to the site of infection and inflammation but also guiding cell homing and cell development. The soluble poxvirus-encoded protein viral CC chemokine inhibitor (vCCI), a CC chemokine inhibitor, can bind to human CC chemokines tightly to impair the host immune defense. This protein has no known homologs in eukaryotes and may represent a potent method to stop inflammation. Previously, our structure of the vCCI·MIP-1β (macrophage inflammatory protein-1β) complex indicated that vCCI uses negatively charged residues in β-sheet II to interact with positively charged residues in the MIP-1β N terminus, 20s region and 40s loop. However, the interactions between vCCI and other CC chemokines have not yet been fully explored. Here, we used NMR and fluorescence anisotropy to study the interaction between vCCI and eotaxin-1 (CCL11), a CC chemokine that is an important factor in the asthma response. NMR results reveal that the binding pattern is very similar to the vCCI·MIP-1β complex and suggest that electrostatic interactions provide a major contribution to binding. Fluorescence anisotropy results on variants of eotaxin-1 further confirm the critical roles of the charged residues in eotaxin-1. In addition, the binding affinity between vCCI and other wild type CC chemokines, MCP-1 (monocyte chemoattractant protein-1), MIP-1β, and RANTES (regulated on activation normal T cell expressed and secreted), were determined as 1.1, 1.2, and 0.22 nm, respectively. To our knowledge, this is the first work quantitatively measuring the binding affinity between vCCI and multiple CC chemokines. PMID:24482230

Multiple Mechanisms of Zinc-Mediated Inhibition for the Apoptotic Caspases-3, -6, -7, and -8.

PubMed

Eron, Scott J; MacPherson, Derek J; Dagbay, Kevin B; Hardy, Jeanne A

2018-05-18

Zinc is emerging as a widely used and important biological regulatory signal. Cellular zinc levels are tightly regulated by a complex array of zinc importers and exporters to control processes such as apoptotic cell death. While caspase inhibition by zinc has been reported previously, the reported inhibition constants were too weak to suggest a critical biological role for zinc-mediated inhibition. In this work, we have adopted a method of assessing available zinc. This allowed assessment of accurate inhibition constants for apoptotic caspases, caspase-3, -6, -7, and -8. Each of these caspases are inhibited by zinc at intracellular levels but with widely differing inhibition constants and different zinc binding stoichiometries. Caspase-3, -6, and -8 appear to be constitutively inhibited by typical zinc levels, and this inhibition must be lifted to allow activation. The inhibition constant for caspase-7 (76 nM) is much weaker than for the other apoptotic caspases (2.6-6.9 nM) suggesting that caspase-7 is not inactivated by normal zinc concentrations but can be inhibited under conditions of zinc stress. Caspase-3, -7, and -8 were found to bind three, one, and two zincs, respectively. In each of these caspases, zinc was present in the active site, in contrast to caspase-6, which binds one zinc allosterically. The most notable new mechanism to emerge from this work is for zinc-mediated inhibition of caspase-8. Zinc binds caspase-8 directly at the active site and at a second site. Zinc binding inhibits formation of the caspase-8 dimer, the activated form of the enzyme. Together these findings suggest that zinc plays a critical role in regulation of apoptosis by direct inactivation of caspases, in a manner that is unique for each caspase.

Amino acid analogues bind to carbon nanotube via π-π interactions: Comparison of molecular mechanical and quantum mechanical calculations

NASA Astrophysics Data System (ADS)

Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

2012-01-01

Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

Amino acid analogues bind to carbon nanotube via π-π interactions: comparison of molecular mechanical and quantum mechanical calculations.

PubMed

Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

2012-01-14

Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

Accelerating atomic structure search with cluster regularization

NASA Astrophysics Data System (ADS)

Sørensen, K. H.; Jørgensen, M. S.; Bruix, A.; Hammer, B.

2018-06-01

We present a method for accelerating the global structure optimization of atomic compounds. The method is demonstrated to speed up the finding of the anatase TiO2(001)-(1 × 4) surface reconstruction within a density functional tight-binding theory framework using an evolutionary algorithm. As a key element of the method, we use unsupervised machine learning techniques to categorize atoms present in a diverse set of partially disordered surface structures into clusters of atoms having similar local atomic environments. Analysis of more than 1000 different structures shows that the total energy of the structures correlates with the summed distances of the atomic environments to their respective cluster centers in feature space, where the sum runs over all atoms in each structure. Our method is formulated as a gradient based minimization of this summed cluster distance for a given structure and alternates with a standard gradient based energy minimization. While the latter minimization ensures local relaxation within a given energy basin, the former enables escapes from meta-stable basins and hence increases the overall performance of the global optimization.

Drying of Pigment-Cellulose Nanofibril Substrates

PubMed Central

Timofeev, Oleg; Torvinen, Katariina; Sievänen, Jenni; Kaljunen, Timo; Kouko, Jarmo; Ketoja, Jukka A.

2014-01-01

A new substrate containing cellulose nanofibrils and inorganic pigment particles has been developed for printed electronics applications. The studied composite structure contains 80% fillers and is mechanically stable and flexible. Before drying, the solids content can be as low as 20% due to the high water binding capacity of the cellulose nanofibrils. We have studied several drying methods and their effects on the substrate properties. The aim is to achieve a tight, smooth surface keeping the drying efficiency simultaneously at a high level. The methods studied include: (1) drying on a hot metal surface; (2) air impingement drying; and (3) hot pressing. Somewhat surprisingly, drying rates measured for the pigment-cellulose nanofibril substrates were quite similar to those for the reference board sheets. Very high dewatering rates were observed for the hot pressing at high moisture contents. The drying method had significant effects on the final substrate properties, especially on short-range surface smoothness. The best smoothness was obtained with a combination of impingement and contact drying. The mechanical properties of the sheets were also affected by the drying method and associated temperature. PMID:28788220

Guiding, bending, and splitting of coupled defect surface modes in a surface-wave photonic crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Zhen; Gao, Fei; Zhang, Baile, E-mail: blzhang@ntu.edu.sg

2016-01-25

We experimentally demonstrate a type of waveguiding mechanism for coupled surface-wave defect modes in a surface-wave photonic crystal. Unlike conventional spoof surface plasmon waveguides, waveguiding of coupled surface-wave defect modes is achieved through weak coupling between tightly localized defect cavities in an otherwise gapped surface-wave photonic crystal, as a classical wave analogue of tight-binding electronic wavefunctions in solid state lattices. Wave patterns associated with the high transmission of coupled defect surface modes are directly mapped with a near-field microwave scanning probe for various structures including a straight waveguide, a sharp corner, and a T-shaped splitter. These results may find usemore » in the design of integrated surface-wave devices with suppressed crosstalk.« less

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Strain Effects on Properties of Phosphorene and Phosphorene Nanoribbons: a DFT and Tight Binding Study

NASA Astrophysics Data System (ADS)

Zhang, Ruo-Yu; Zheng, Ji-Ming; Jiang, Zhen-Yi

2018-01-01

Not Available Supported by the National Natural Science Foundation of China under Grant Nos 51572219 and 11447030, the Natural Science Foundation of Shaanxi Province of China under Grant Nos 2014JM2-1008 and 2015JM1018, and the State Key Laboratory of Transient Optics and Photonics Technology 2015 Annual Open Fund under Grant No SKLST200915.

Assessment of the Activation State of Rho Family GTP-Binding Proteins in Breast Cancer Cells and Specimens

DTIC Science & Technology

2004-08-01

AF038388 Vav3 GEF for Rho and Rac Proto-oncogene product NM020505 hPEM -2 GEF for Cdc42 Predominantly expressed in brain AB007884 GEF-H1 GEF for Rac and Rho...fence tions, and desmosomes play a fundamental role in maintain- function). A functional tight junction is crucial to maintain ing the polarized phenotype

Theoretical verification of experimentally obtained conformation-dependent electronic conductance in a biphenyl molecule

NASA Astrophysics Data System (ADS)

Maiti, Santanu K.

2014-07-01

The experimentally obtained (Venkataraman et al. [1]) cosine squared relation of electronic conductance in a biphenyl molecule is verified theoretically within a tight-binding framework. Using Green's function formalism we numerically calculate two-terminal conductance as a function of relative twist angle among the molecular rings and find that the results are in good agreement with the experimental observation.

The role of enzyme and substrate concentration in the evaluation of serum angiotensin converting enzyme (ACE) inhibition by enalaprilat in vitro.

PubMed

Weisser, K; Schloos, J

1991-10-09

The relationship between serum angiotensin converting enzyme (ACE) activity and concentration of the ACE inhibitor enalaprilat was determined in vitro in the presence of different concentrations (S = 4-200 mM) of the substrate Hip-Gly-Gly. From Henderson plots, a competitive tight-binding relationship between enalaprilat and serum ACE was found yielding a value of approximately 5 nM for serum ACE concentration (Et) and an inhibition constant (Ki) for enalaprilat of approximately 0.1 nM. A plot of reaction velocity (Vi) versus total inhibitor concentration (It) exhibited a non-parallel shift of the inhibition curve to the right with increasing S. This was reflected by apparent Hill coefficients greater than 1 when the commonly used inhibitory sigmoid concentration-effect model (Emax model) was applied to the data. Slopes greater than 1 were obviously due to discrepancies between the free inhibitor concentration (If) present in the assay and It plotted on the abscissa and could, therefore, be indicators of tight-binding conditions. Thus, the sigmoid Emax model leads to an overestimation of Ki. Therefore, a modification of the inhibitory sigmoid Emax model (called "Emax tight model") was applied, which accounts for the depletion of If by binding, refers to It and allows estimation of the parameters Et and IC50f (free concentration of inhibitor when 50% inhibition occurs) using non-linear regression analysis. This model could describe the non-symmetrical shape of the inhibition curves and the results for Ki and Et correlated very well with those derived from the Henderson plots. The latter findings confirm that the degree of ACE inhibition measured in vitro is, in fact, dependent on the concentration of substrate and enzyme present in the assay. This is of importance not only for the correct evaluation of Ki but also for the interpretation of the time course of serum ACE inhibition measured ex vivo. The non-linear model has some advantages over the linear Henderson equation: it is directly applicable without conversion of the data and avoids the stochastic dependency of the variables, allowing non-linear regression of all data points contributing with the same weight.

Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2

PubMed Central

Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

2007-01-01

Background Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. Results We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Conclusion Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation. PMID:18028534

Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2.

PubMed

Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

2007-11-20

Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation.

Binding specificity of Bacillus thuringiensis Cry1Aa for purified, native Bombyx mori aminopeptidase N and cadherin-like receptors

PubMed Central

Jenkins, Jeremy L; Dean, Donald H

2001-01-01

Background To better understand the molecular interactions of Bt toxins with non-target insects, we have examined the real-time binding specificity and affinity of Cry1 toxins to native silkworm (Bombyx mori) midgut receptors. Previous studies on B. mori receptors utilized brush border membrane vesicles or purifed receptors in blot-type assays. Results The Bombyx mori (silkworm) aminopeptidase N (APN) and cadherin-like receptors for Bacillus thuringiensis insecticidal Cry1Aa toxin were purified and their real-time binding affinities for Cry toxins were examined by surface plasmon resonance. Cry1Ab and Cry1Ac toxins did not bind to the immobilized native receptors, correlating with their low toxicities. Cry1Aa displayed moderate affinity for B. mori APN (75 nM), and unusually tight binding to the cadherin-like receptor (2.6 nM), which results from slow dissociation rates. The binding of a hybrid toxin (Aa/Aa/Ac) was identical to Cry1Aa. Conclusions These results indicate domain II of Cry1Aa is essential for binding to native B. mori receptors and for toxicity. Moreover, the high-affinity binding of Cry1Aa to native cadherin-like receptor emphasizes the importance of this receptor class for Bt toxin research. PMID:11722800

Probing the human estrogen receptor-α binding requirements for phenolic mono- and di-hydroxyl compounds: A combined synthesis, binding and docking study

PubMed Central

McCullough, Christopher; Neumann, Terrence S.; Gone, Jayapal Reddy; He, Zhengjie; Herrild, Christian; Wondergem, Julie; Pandey, Rajesh K.; Donaldson, William A.; Sem, Daniel S.

2014-01-01

Various estrogen analogs were synthesized and tested for binding to human ERα using a fluorescence polarization displacement assay. Binding affinity and orientation were also predicted using docking calculations. Docking was able to accurately predict relative binding affinity and orientation for estradiol, but only if a tightly bound water molecule bridging Arg394/Glu353 is present. Di-hydroxyl compounds sometimes bind in two orientations, which are flipped in terms of relative positioning of their hydroxyl groups. Di-hydroxyl compounds were predicted to bind with their aliphatic hydroxyl group interacting with His524 in ERα. One nonsteroid-based dihdroxyl compound was 1000-fold specific for ERβ over ERα, and was also 25-fold specific for agonist ERβ versus antagonist activity. Docking predictions suggest this specificity may be due to interaction of the aliphatic hydroxyl with His475 in the agonist form of ERβ, versus with Thr299 in the antagonist form. But, the presence of this aliphatic hydroxyl is not required in all compounds, since mono-hydroxyl (phenolic) compounds bind ERα with high affinity, via hydroxyl hydrogen bonding interactions with the ERα Arg394/Glu353/water triad, and van der Waals interactions with the rest of the molecule. PMID:24315190

Role of metal ions in catalysis by HIV integrase analyzed using a quantitative PCR disintegration assay.

PubMed

Diamond, Tracy L; Bushman, Frederic D

2006-01-01

Paired metal ions have been proposed to be central to the catalytic mechanisms of RNase H nucleases, bacterial transposases, Holliday junction resolvases, retroviral integrases and many other enzymes. Here we present a sensitive assay for DNA transesterification in which catalysis by human immunodeficiency virus-type 1 (HIV-1) integrase (IN) connects two DNA strands (disintegration reaction), allowing detection using quantitative PCR (qPCR). We present evidence suggesting that the three acidic residues of the IN active site function through metal binding using metal rescue. In this method, the catalytic acidic residues were each substituted with cysteines. Mn2+ binds tightly to the sulfur atoms of the cysteine residues, but Mg2+ does not. We found that Mn2+, but not Mg2+, could rescue catalysis of each cysteine-substituted enzyme, providing evidence for functionally important metal binding by all three residues. We also used the PCR-boosted assay to show that HIV-1 IN could carry out transesterification reactions involving DNA 5' hydroxyl groups as well as 3' hydroxyls as nucleophiles. Lastly, we show that Mn2+ by itself (i.e. without enzyme) can catalyze formation of a low level of PCR-amplifiable product under extreme conditions, allowing us to estimate the rate enhancement due to the IN-protein scaffold as at least 60 million-fold.

Role of metal ions in catalysis by HIV integrase analyzed using a quantitative PCR disintegration assay

PubMed Central

Diamond, Tracy L.; Bushman, Frederic D.

2006-01-01

Paired metal ions have been proposed to be central to the catalytic mechanisms of RNase H nucleases, bacterial transposases, Holliday junction resolvases, retroviral integrases and many other enzymes. Here we present a sensitive assay for DNA transesterification in which catalysis by human immunodeficiency virus-type 1 (HIV-1) integrase (IN) connects two DNA strands (disintegration reaction), allowing detection using quantitative PCR (qPCR). We present evidence suggesting that the three acidic residues of the IN active site function through metal binding using metal rescue. In this method, the catalytic acidic residues were each substituted with cysteines. Mn2+ binds tightly to the sulfur atoms of the cysteine residues, but Mg2+ does not. We found that Mn2+, but not Mg2+, could rescue catalysis of each cysteine-substituted enzyme, providing evidence for functionally important metal binding by all three residues. We also used the PCR-boosted assay to show that HIV-1 IN could carry out transesterification reactions involving DNA 5′ hydroxyl groups as well as 3′ hydroxyls as nucleophiles. Lastly, we show that Mn2+ by itself (i.e. without enzyme) can catalyze formation of a low level of PCR-amplifiable product under extreme conditions, allowing us to estimate the rate enhancement due to the IN-protein scaffold as at least 60 million-fold. PMID:17085478

Arsenic-induced cutaneous hyperplastic lesions are associated with the dysregulation of Yap, a Hippo signaling-related protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Changzhao; Srivastava, Ritesh K.; Elmets, Craig A.

2013-09-06

Highlights: •Arsenic activates canonical Hippo signaling pathway and up-regulates αCatenin in the skin. •Arsenic activates transcriptional activity of Yap by its nuclear translocation. •Yap is involved in the disruption of tight/adherens junctions in arsenic-exposed animals. -- Abstract: Arsenic exposure in humans causes a number of toxic manifestations in the skin including cutaneous neoplasm. However, the mechanism of these alterations remains elusive. Here, we provide novel observations that arsenic induced Hippo signaling pathway in the murine skin. This pathway plays crucial roles in determining organ size during the embryonic development and if aberrantly activated in adults, contributes to the pathogenesis ofmore » epithelial neoplasm. Arsenic treatment enhanced phosphorylation-dependent activation of LATS1 kinase and other Hippo signaling regulatory proteins Sav1 and MOB1. Phospho-LATS kinase is known to catalyze the inactivation of a transcriptional co-activator, Yap. However, in arsenic-treated epidermis, we did not observed its inactivation. Thus, as expected, unphosphorylated-Yap was translocated to the nucleus in arsenic-treated epidermis. Yap by binding to the transcription factors TEADs induces transcription of its target genes. Consistently, an up-regulation of Yap-dependent target genes Cyr61, Gli2, Ankrd1 and Ctgf was observed in the skin of arsenic-treated mice. Phosphorylated Yap is important in regulating tight and adherens junctions through its binding to αCatenin. We found disruption of these junctions in the arsenic-treated mouse skin despite an increase in αCatenin. These data provide evidence that arsenic-induced canonical Hippo signaling pathway and Yap-mediated disruption of tight and adherens junctions are independently regulated. These effects together may contribute to the carcinogenic effects of arsenic in the skin.« less

Studying the varied shapes of gold clusters by an elegant optimization algorithm that hybridizes the density functional tight-binding theory and the density functional theory

NASA Astrophysics Data System (ADS)

Yen, Tsung-Wen; Lim, Thong-Leng; Yoon, Tiem-Leong; Lai, S. K.

2017-11-01

We combined a new parametrized density functional tight-binding (DFTB) theory (Fihey et al. 2015) with an unbiased modified basin hopping (MBH) optimization algorithm (Yen and Lai 2015) and applied it to calculate the lowest energy structures of Au clusters. From the calculated topologies and their conformational changes, we find that this DFTB/MBH method is a necessary procedure for a systematic study of the structural development of Au clusters but is somewhat insufficient for a quantitative study. As a result, we propose an extended hybridized algorithm. This improved algorithm proceeds in two steps. In the first step, the DFTB theory is employed to calculate the total energy of the cluster and this step (through running DFTB/MBH optimization for given Monte-Carlo steps) is meant to efficiently bring the Au cluster near to the region of the lowest energy minimum since the cluster as a whole has explicitly considered the interactions of valence electrons with ions, albeit semi-quantitatively. Then, in the second succeeding step, the energy-minimum searching process will continue with a skilledly replacement of the energy function calculated by the DFTB theory in the first step by one calculated in the full density functional theory (DFT). In these subsequent calculations, we couple the DFT energy also with the MBH strategy and proceed with the DFT/MBH optimization until the lowest energy value is found. We checked that this extended hybridized algorithm successfully predicts the twisted pyramidal structure for the Au40 cluster and correctly confirms also the linear shape of C8 which our previous DFTB/MBH method failed to do so. Perhaps more remarkable is the topological growth of Aun: it changes from a planar (n =3-11) → an oblate-like cage (n =12-15) → a hollow-shape cage (n =16-18) and finally a pyramidal-like cage (n =19, 20). These varied forms of the cluster's shapes are consistent with those reported in the literature.

cis-trans Germanium chains in the intermetallic compounds ALi{sub 1-x}In{sub x}Ge{sub 2} and A{sub 2}(Li{sub 1-x}In{sub x}){sub 2}Ge{sub 3} (A=Sr, Ba, Eu)-experimental and theoretical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

You, Tae-Soo; Bobev, Svilen, E-mail: bobev@udel.ed

Two types of strontium-, barium- and europium-containing germanides have been synthesized using high temperature reactions and characterized by single-crystal X-ray diffraction. All reported compounds also contain mixed-occupied Li and In atoms, resulting in quaternary phases with narrow homogeneity ranges. The first type comprises EuLi{sub 0.91(1)}In{sub 0.09}Ge{sub 2}, SrLi{sub 0.95(1)}In{sub 0.05}Ge{sub 2} and BaLi{sub 0.99(1)}In{sub 0.01}Ge{sub 2}, which crystallize in the orthorhombic space group Pnma (BaLi{sub 0.9}Mg{sub 0.1}Si{sub 2} structure type, Pearson code oP16). The lattice parameters are a=7.129(4)-7.405(4) A; b=4.426(3)-4.638(2) A; and c=11.462(7)-11.872(6) A. The second type includes Eu{sub 2}Li{sub 1.36(1)}In{sub 0.64}Ge{sub 3} and Sr{sub 2}Li{sub 1.45(1)}In{sub 0.55}Ge{sub 3}, whichmore » adopt the orthorhombic space group Cmcm (Ce{sub 2}Li{sub 2}Ge{sub 3} structure type, Pearson code oC28) with lattice parameters a=4.534(2)-4.618(2) A; b=19.347(8)-19.685(9) A; and c=7.164(3)-7.260(3) A. The polyanionic sub-structures in both cases feature one-dimensional Ge chains with alternating Ge-Ge bonds in cis- and trans-conformation. Theoretical studies using the tight-binding linear muffin-tin orbital (LMTO) method provide the rationale for optimizing the overall bonding by diminishing the {pi}-p delocalization along the Ge chains, accounting for the experimentally confirmed substitution of Li forIn. -- Graphical abstract: Presented are the single-crystal structures of two types of closely related intermetallics, as well as their band structures, calculated using tight-binding linear muffin-tin orbital (TB-LMTO-ASA) method. Display Omitted« less

Curli mediate bacterial adhesion to fibronectin via tensile multiple bonds

NASA Astrophysics Data System (ADS)

Oh, Yoo Jin; Hubauer-Brenner, Michael; Gruber, Hermann J.; Cui, Yidan; Traxler, Lukas; Siligan, Christine; Park, Sungsu; Hinterdorfer, Peter

2016-09-01

Many enteric bacteria including pathogenic Escherichia coli and Salmonella strains produce curli fibers that bind to host surfaces, leading to bacterial internalization into host cells. By using a nanomechanical force-sensing approach, we obtained real-time information about the distribution of molecular bonds involved in the adhesion of curliated bacteria to fibronectin. We found that curliated E. coli and fibronectin formed dense quantized and multiple specific bonds with high tensile strength, resulting in tight bacterial binding. Nanomechanical recognition measurements revealed that approximately 10 bonds were disrupted either sequentially or simultaneously under force load. Thus the curli formation of bacterial surfaces leads to multi-bond structural components of fibrous nature, which may explain the strong mechanical binding of curliated bacteria to host cells and unveil the functions of these proteins in bacterial internalization and invasion.

Dynamic regulation of GDP binding to G proteins revealed by magnetic field-dependent NMR relaxation analyses

PubMed Central

Toyama, Yuki; Kano, Hanaho; Mase, Yoko; Yokogawa, Mariko; Osawa, Masanori; Shimada, Ichio

2017-01-01

Heterotrimeric guanine-nucleotide-binding proteins (G proteins) serve as molecular switches in signalling pathways, by coupling the activation of cell surface receptors to intracellular responses. Mutations in the G protein α-subunit (Gα) that accelerate guanosine diphosphate (GDP) dissociation cause hyperactivation of the downstream effector proteins, leading to oncogenesis. However, the structural mechanism of the accelerated GDP dissociation has remained unclear. Here, we use magnetic field-dependent nuclear magnetic resonance relaxation analyses to investigate the structural and dynamic properties of GDP bound Gα on a microsecond timescale. We show that Gα rapidly exchanges between a ground-state conformation, which tightly binds to GDP and an excited conformation with reduced GDP affinity. The oncogenic D150N mutation accelerates GDP dissociation by shifting the equilibrium towards the excited conformation. PMID:28223697

Dynamic regulation of GDP binding to G proteins revealed by magnetic field-dependent NMR relaxation analyses.

PubMed

Toyama, Yuki; Kano, Hanaho; Mase, Yoko; Yokogawa, Mariko; Osawa, Masanori; Shimada, Ichio

2017-02-22

Heterotrimeric guanine-nucleotide-binding proteins (G proteins) serve as molecular switches in signalling pathways, by coupling the activation of cell surface receptors to intracellular responses. Mutations in the G protein α-subunit (Gα) that accelerate guanosine diphosphate (GDP) dissociation cause hyperactivation of the downstream effector proteins, leading to oncogenesis. However, the structural mechanism of the accelerated GDP dissociation has remained unclear. Here, we use magnetic field-dependent nuclear magnetic resonance relaxation analyses to investigate the structural and dynamic properties of GDP bound Gα on a microsecond timescale. We show that Gα rapidly exchanges between a ground-state conformation, which tightly binds to GDP and an excited conformation with reduced GDP affinity. The oncogenic D150N mutation accelerates GDP dissociation by shifting the equilibrium towards the excited conformation.

Sequence of events in measles virus replication: role of phosphoprotein-nucleocapsid interactions.

PubMed

Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia; Gerlier, Denis

2014-09-01

The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, P(XD) and N(TAIL) is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the P(XD) F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in P(XD)-to-N(TAIL) binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the P(XD)-N(TAIL) interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼ 6,700-nucleotide messenger RNAs from six to ten consecutive genes is unknown. Using a quantitative protein complementation assay and a biGene-biSilencing system allowing conditional expression of two P genes copies, the role of the P-to-N interaction in polymerase function was further characterized. We report here a dynamic protein anchoring mechanism that differs from all other known polymerases that rely only onto a sustained and direct binding to their nucleic acid template. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Susceptibility of blackberry flowers to freezing temperatures

USDA-ARS?s Scientific Manuscript database

Injury of tight buds, open flowers and green fruit often occur in fruit crops during spring frost events. In this study, freezing tolerance of ‘Triple Crown’ blackberry flowers at different reproductive stages of development (tight bud to green drupe) was determined using two methods. One method i...

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

The interaction of representative members from two classes of antimycotics--the azoles and the allylamines--with cytochromes P-450 in steroidogenic tissues and liver.

PubMed

Schuster, I

1985-06-01

Spectrophotometric studies with ketoconazole, clotrimazole and miconazole show strong type-II interactions with several cytochromes P-450, particularly (Ks greater than 10(7)M-1; pH7.4; 25 degrees C) with the 11 beta-hydroxylase of adrenal mitochondria, with the 17 alpha/20 lyase of testis microsomes and with some forms of cytochromes P-450 of liver. A tight binding of the azoles also occurs to the reduced cytochromes, giving rise to an impeded CO binding to the haem iron. The binding of the azoles to 11 beta-hydroxylase and 17 alpha/20 lyase is much tighter than the binding of endogenous substrates, and consequently inhibition of steroidogenesis will occur at these sites. The metabolism of xenobiotic substrates by the cytochromes P-450 of liver will also be severely impeded. In contrast, the allylamines naftifine and SF 86-327 are type-I substrates for a small portion of cytochromes P-450 of liver microsomes only and there is no spectral evidence for binding to the cytochromes P-450 involved in steroid biosynthesis.

Epistatic mutations in PUMA BH3 drive an alternate binding mode to potently and selectively inhibit anti-apoptotic Bfl-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jenson, Justin M.; Ryan, Jeremy A.; Grant, Robert A.

Overexpression of anti-apoptotic Bcl-2 family proteins contributes to cancer progression and confers resistance to chemotherapy. Small molecules that target Bcl-2 are used in the clinic to treat leukemia, but tight and selective inhibitors are not available for Bcl-2 paralog Bfl-1. Guided by computational analysis, we designed variants of the native BH3 motif PUMA that are > 150-fold selective for Bfl-1 binding. The designed peptides potently trigger disruption of the mitochondrial outer membrane in cells dependent on Bfl-1, but not in cells dependent on other anti-apoptotic homologs. High-resolution crystal structures show that designed peptide FS2 binds Bfl-1 in a shifted geometry,more » relative to PUMA and other binding partners, due to a set of epistatic mutations. FS2 modified with an electrophile reacts with a cysteine near the peptide-binding groove to augment specificity. Designed Bfl-1 binders provide reagents for cellular profiling and leads for developing enhanced and cell-permeable peptide or small-molecule inhibitors.« less

BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

PubMed

da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

1993-07-01

The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

Epistatic mutations in PUMA BH3 drive an alternate binding mode to potently and selectively inhibit anti-apoptotic Bfl-1

PubMed Central

Jenson, Justin M; Ryan, Jeremy A; Grant, Robert A; Letai, Anthony; Keating, Amy E

2017-01-01

Overexpression of anti-apoptotic Bcl-2 family proteins contributes to cancer progression and confers resistance to chemotherapy. Small molecules that target Bcl-2 are used in the clinic to treat leukemia, but tight and selective inhibitors are not available for Bcl-2 paralog Bfl-1. Guided by computational analysis, we designed variants of the native BH3 motif PUMA that are > 150-fold selective for Bfl-1 binding. The designed peptides potently trigger disruption of the mitochondrial outer membrane in cells dependent on Bfl-1, but not in cells dependent on other anti-apoptotic homologs. High-resolution crystal structures show that designed peptide FS2 binds Bfl-1 in a shifted geometry, relative to PUMA and other binding partners, due to a set of epistatic mutations. FS2 modified with an electrophile reacts with a cysteine near the peptide-binding groove to augment specificity. Designed Bfl-1 binders provide reagents for cellular profiling and leads for developing enhanced and cell-permeable peptide or small-molecule inhibitors. DOI: http://dx.doi.org/10.7554/eLife.25541.001 PMID:28594323

Regulation of Na(+)/K(+)-ATPase by nuclear respiratory factor 1: implication in the tight coupling of neuronal activity, energy generation, and energy consumption.

PubMed

Johar, Kaid; Priya, Anusha; Wong-Riley, Margaret T T

2012-11-23

NRF-1 regulates mediators of neuronal activity and energy generation. NRF-1 transcriptionally regulates Na(+)/K(+)-ATPase subunits α1 and β1. NRF-1 functionally regulates mediators of energy consumption in neurons. NRF-1 mediates the tight coupling of neuronal activity, energy generation, and energy consumption at the molecular level. Energy generation and energy consumption are tightly coupled to neuronal activity at the cellular level. Na(+)/K(+)-ATPase, a major energy-consuming enzyme, is well expressed in neurons rich in cytochrome c oxidase, an important enzyme of the energy-generating machinery, and glutamatergic receptors that are mediators of neuronal activity. The present study sought to test our hypothesis that the coupling extends to the molecular level, whereby Na(+)/K(+)-ATPase subunits are regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), found recently by our laboratory to regulate all cytochrome c oxidase subunit genes and some NMDA and AMPA receptor subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutational analysis, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Atp1a1 and Atp1b1 genes but not of the Atp1a3 gene in neurons. The transcripts of Atp1a1 and Atp1b1 subunit genes were up-regulated by KCl and down-regulated by tetrodotoxin. Atp1b1 is positively regulated by NRF-1, and silencing of NRF-1 with small interference RNA blocked the up-regulation of Atp1b1 induced by KCl, whereas overexpression of NRF-1 rescued these transcripts from being suppressed by tetrodotoxin. On the other hand, Atp1a1 is negatively regulated by NRF-1. The binding sites of NRF-1 on Atp1a1 and Atp1b1 are conserved among mice, rats, and humans. Thus, NRF-1 regulates key Na(+)/K(+)-ATPase subunits and plays an important role in mediating the tight coupling between energy consumption, energy generation, and neuronal activity at the molecular level.

Understanding the length dependence of molecular junction thermopower.

PubMed

Karlström, Olov; Strange, Mikkel; Solomon, Gemma C

2014-01-28

Thermopower of molecular junctions is sensitive to details in the junction and may increase, decrease, or saturate with increasing chain length, depending on the system. Using McConnell's theory for exponentially suppressed transport together with a simple and easily interpretable tight binding model, we show how these different behaviors depend on the molecular backbone and its binding to the contacts. We distinguish between resonances from binding groups or undercoordinated electrode atoms, and those from the periodic backbone. It is demonstrated that while the former gives a length-independent contribution to the thermopower, possibly changing its sign, the latter determines its length dependence. This means that the question of which orbitals from the periodic chain that dominate the transport should not be inferred from the sign of the thermopower but from its length dependence. We find that the same molecular backbone can, in principle, show four qualitatively different thermopower trends depending on the binding group: It can be positive or negative for short chains, and it can either increase or decrease with length.

Structural basis for LeishIF4E-1 modulation by an interacting protein in the human parasite Leishmania major.

PubMed

Meleppattu, Shimi; Arthanari, Haribabu; Zinoviev, Alexandra; Boeszoermenyi, Andras; Wagner, Gerhard; Shapira, Michal; Léger-Abraham, Mélissa

2018-03-19

Leishmania parasites are unicellular pathogens that are transmitted to humans through the bite of infected sandflies. Most of the regulation of their gene expression occurs post-transcriptionally, and the different patterns of gene expression required throughout the parasites' life cycle are regulated at the level of translation. Here, we report the X-ray crystal structure of the Leishmania cap-binding isoform 1, LeishIF4E-1, bound to a protein fragment of previously unknown function, Leish4E-IP1, that binds tightly to LeishIF4E-1. The molecular structure, coupled to NMR spectroscopy experiments and in vitro cap-binding assays, reveal that Leish4E-IP1 allosterically destabilizes the binding of LeishIF4E-1 to the 5' mRNA cap. We propose mechanisms through which Leish4E-IP1-mediated LeishIF4E-1 inhibition could regulate translation initiation in the human parasite.

Recognition of Local DNA Structures by p53 Protein

PubMed Central

Brázda, Václav; Coufal, Jan

2017-01-01

p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

Structural Analysis of the Phenol-Responsive Sensory Domain of the Transcription Activator PoxR.

PubMed

Patil, Vinod Vikas; Park, Kwang-Hyun; Lee, Seung-Goo; Woo, Euijeon

2016-04-05

Positive phenol-degradative gene regulator (PoxR) is a σ(54)-dependent AAA+ ATPase transcription activator that regulates the catabolism of phenols. The PoxR sensory domain detects phenols and relays signals for the activation of transcription. Here we report the first structure of the phenol sensory domain bound to phenol and five derivatives. It exists as a tightly intertwined homodimer with a phenol-binding pocket buried inside, placing two C termini on the same side of the dimer. His102 and Trp130 interact with the hydroxyl group of the phenol in a cavity surrounded by rigid hydrophobic residues on one side and a flexible region on the other. Each monomer has a V4R fold with a unique zinc-binding site. A shift at the C-terminal helix suggests that there is a possible conformational change upon ligand binding. The results provide a structural basis of chemical effector binding for transcriptional regulation with broad implications for protein engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sequence and characterization of cytoplasmic nuclear protein import factor p97

PubMed Central

1995-01-01

Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630

Recognition of the pro-mutagenic base uracil by family B DNA polymerases from archaea.

PubMed

Shuttleworth, Gillian; Fogg, Mark J; Kurpiewski, Michael R; Jen-Jacobson, Linda; Connolly, Bernard A

2004-03-26

Archaeal family B DNA polymerases contain a specialised pocket that binds tightly to template-strand uracil, causing the stalling of DNA replication. The mechanism of this unique "template-strand proof-reading" has been studied using equilibrium binding measurements, DNA footprinting, van't Hoff analysis and calorimetry. Binding assays have shown that the polymerase preferentially binds to uracil in single as opposed to double-stranded DNA. Tightest binding is observed using primer-templates that contain uracil four bases in front of the primer-template junction, corresponding to the observed stalling position. Ethylation interference analysis of primer-templates shows that the two phosphates, immediately flanking the uracil (NpUpN), are important for binding; contacts are also made to phosphates in the primer-strand. Microcalorimetry and van't Hoff analysis have given a fuller understanding of the thermodynamic parameters involved in uracil recognition. All the results are consistent with a "read-ahead" mechanism, in which the replicating polymerase scans the template, ahead of the replication fork, for the presence of uracil and halts polymerisation on detecting this base. Post-stalling events, serving to eliminate uracil, await full elucidation.

Structure of GlnK1 with bound effectors indicates regulatory mechanism for ammonia uptake.

PubMed

Yildiz, Ozkan; Kalthoff, Christoph; Raunser, Stefan; Kühlbrandt, Werner

2007-01-24

A binary complex of the ammonia channel Amt1 from Methanococcus jannaschii and its cognate P(II) signalling protein GlnK1 has been produced and characterized. Complex formation is prevented specifically by the effector molecules Mg-ATP and 2-ketoglutarate. Single-particle electron microscopy of the complex shows that GlnK1 binds on the cytoplasmic side of Amt1. Three high-resolution X-ray structures of GlnK1 indicate that the functionally important T-loop has an extended, flexible conformation in the absence of Mg-ATP, but assumes a compact, tightly folded conformation upon Mg-ATP binding, which in turn creates a 2-ketoglutarate-binding site. We propose a regulatory mechanism by which nitrogen uptake is controlled by the binding of both effector molecules to GlnK1. At normal effector levels, a 2-ketoglutarate molecule binding at the apex of the compact T-loop would prevent complex formation, ensuring uninhibited ammonia uptake. At low levels of Mg-ATP, the extended loops would seal the ammonia channels in the complex. Binding of both effector molecules to P(II) signalling proteins may thus represent an effective feedback mechanism for regulating ammonium uptake through the membrane.

CRYO-EM STRUCTURES OF THE ACTIN:TROPOMYOSIN FILAMENT REVEAL THE MECHANISM FOR THE TRANSITION FROM C- TO M-STATE

PubMed Central

Sousa, Duncan R.; Stagg, Scott M.; Stroupe, M. Elizabeth

2013-01-01

Tropomyosin is a key factor in the molecular mechanisms that regulate the binding of myosin motors to actin filaments in most eukaryotic cells. This regulation is achieved by the azimuthal repositioning of tropomyosin along the actin:tropomyosin:troponin thin filament to block or expose myosin binding sites on actin. In striated muscle, including involuntary cardiac muscle, tropomyosin regulates muscle contraction by coupling Ca2+ binding to troponin with myosin binding to the thin filament. In smooth muscle, the switch is the post-translational modification of the myosin. Depending on the activation state of troponin and the binding state of myosin, tropomyosin can occupy the blocked, closed, or open position on actin. Using native cryogenic 3DEM, we have directly resolved and visualized cardiac and gizzard muscle tropomyosin on filamentous actin in the position that corresponds to the closed state. From the 8-Å resolution structure of the reconstituted Ac:Tm filament formed with gizzard-derived Tm we discuss two possible mechanisms for the transition from closed to open state and describe the role Tm plays in blocking myosin tight binding in the closed state position. PMID:24021812

Displacement of disordered water molecules from hydrophobic pocket creates enthalpic signature: binding of phosphonamidate to the S₁'-pocket of thermolysin.

PubMed

Englert, L; Biela, A; Zayed, M; Heine, A; Hangauer, D; Klebe, G

2010-11-01

Prerequisite for the design of tight binding protein inhibitors and prediction of their properties is an in-depth understanding of the structural and thermodynamic details of the binding process. A series of closely related phosphonamidates was studied to elucidate the forces underlying their binding affinity to thermolysin. The investigated inhibitors are identical except for the parts penetrating into the hydrophobic S₁'-pocket. A correlation of structural, kinetic and thermodynamic data was carried out by X-ray crystallography, kinetic inhibition assay and isothermal titration calorimetry. Binding affinity increases with larger ligand hydrophobic P₁'-moieties accommodating the S₁'-pocket. Surprisingly, larger P₁'-side chain modifications are accompanied by an increase in the enthalpic contribution to binding. In agreement with other studies, it is suggested that the release of largely disordered waters from an imperfectly hydrated pocket results in an enthalpically favourable integration of these water molecules into bulk water upon inhibitor binding. This enthalpically favourable process contributes more strongly to the binding energetics than the entropy increase resulting from the release of water molecules from the S₁'-pocket or the formation of apolar interactions between protein and inhibitor. Displacement of highly disordered water molecules from a rather imperfectly hydrated and hydrophobic specificity pocket can reveal an enthalpic signature of inhibitor binding. Copyright © 2010 Elsevier B.V. All rights reserved.

Elucidation of Lipid Binding Sites on Lung Surfactant Protein A Using X-ray Crystallography, Mutagenesis, and Molecular Dynamics Simulations.

PubMed

Goh, Boon Chong; Wu, Huixing; Rynkiewicz, Michael J; Schulten, Klaus; Seaton, Barbara A; McCormack, Francis X

2016-07-05

Surfactant protein A (SP-A) is a collagenous C-type lectin (collectin) that is critical for pulmonary defense against inhaled microorganisms. Bifunctional avidity of SP-A for pathogen-associated molecular patterns (PAMPs) such as lipid A and for dipalmitoylphosphatidylcholine (DPPC), the major component of surfactant membranes lining the air-liquid interface of the lung, ensures that the protein is poised for first-line interactions with inhaled pathogens. To improve our understanding of the motifs that are required for interactions with microbes and surfactant structures, we explored the role of the tyrosine-rich binding surface on the carbohydrate recognition domain of SP-A in the interaction with DPPC and lipid A using crystallography, site-directed mutagenesis, and molecular dynamics simulations. Critical binding features for DPPC binding include a three-walled tyrosine cage that binds the choline headgroup through cation-π interactions and a positively charged cluster that binds the phosphoryl group. This basic cluster is also critical for binding of lipid A, a bacterial PAMP and target for SP-A. Molecular dynamics simulations further predict that SP-A binds lipid A more tightly than DPPC. These results suggest that the differential binding properties of SP-A favor transfer of the protein from surfactant DPPC to pathogen membranes containing appropriate lipid PAMPs to effect key host defense functions.

Genetic Evidence for a Tight Cooperation of TatB and TatC during Productive Recognition of Twin-Arginine (Tat) Signal Peptides in Escherichia coli

PubMed Central

Lausberg, Frank; Fleckenstein, Stefan; Kreutzenbeck, Peter; Fröbel, Julia; Rose, Patrick; Müller, Matthias; Freudl, Roland

2012-01-01

The twin arginine translocation (Tat) pathway transports folded proteins across the cytoplasmic membrane of bacteria. Tat signal peptides contain a consensus motif (S/T-R-R-X-F-L-K) that is thought to play a crucial role in substrate recognition by the Tat translocase. Replacement of the phenylalanine at the +2 consensus position in the signal peptide of a Tat-specific reporter protein (TorA-MalE) by aspartate blocked export of the corresponding TorA(D+2)-MalE precursor, indicating that this mutation prevents a productive binding of the TorA(D+2) signal peptide to the Tat translocase. Mutations were identified in the extreme amino-terminal regions of TatB and TatC that synergistically suppressed the export defect of TorA(D+2)-MalE when present in pairwise or triple combinations. The observed synergistic suppression activities were even more pronounced in the restoration of membrane translocation of another export-defective precursor, TorA(KQ)-MalE, in which the conserved twin arginine residues had been replaced by lysine-glutamine. Collectively, these findings indicate that the extreme amino-terminal regions of TatB and TatC cooperate tightly during recognition and productive binding of Tat-dependent precursor proteins and, furthermore, that TatB and TatC are both involved in the formation of a specific signal peptide binding site that reaches out as far as the end of the TatB transmembrane segment. PMID:22761916

Crystal Structures of the Histo-Aspartic Protease (HAP) from Plasmodium falciparum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhaumik, Prasenjit; Xiao, Huogen; Parr, Charity L.

The structures of recombinant histo-aspartic protease (HAP) from malaria-causing parasite Plasmodium falciparum as apoenzyme and in complex with two inhibitors, pepstatin A and KNI-10006, were solved at 2.5-, 3.3-, and 3.05-{angstrom} resolutions, respectively. In the apoenzyme crystals, HAP forms a tight dimer not seen previously in any aspartic protease. The interactions between the monomers affect the conformation of two flexible loops, the functionally important 'flap' (residues 70-83) and its structural equivalent in the C-terminal domain (residues 238-245), as well as the orientation of helix 225-235. The flap is found in an open conformation in the apoenzyme. Unexpectedly, the active sitemore » of the apoenzyme contains a zinc ion tightly bound to His32 and Asp215 from one monomer and to Glu278A from the other monomer, with the coordination of Zn resembling that seen in metalloproteases. The flap is closed in the structure of the pepstatin A complex, whereas it is open in the complex with KNI-10006. Although the binding mode of pepstatin A is significantly different from that in other pepsin-like aspartic proteases, its location in the active site makes unlikely the previously proposed hypothesis that HAP is a serine protease. The binding mode of KNI-10006 is unusual compared with the binding of other inhibitors from the KNI series to aspartic proteases. The novel features of the HAP active site could facilitate design of specific inhibitors used in the development of antimalarial drugs.« less

Competitive adsorption behaviors of carbon dioxide and n-dodecane mixtures in 13X molecular sieve

NASA Astrophysics Data System (ADS)

Zhu, Chaofan; Dong, Mingzhe; Gong, Houjian

2018-01-01

The CO2 cyclic injection has been proven to be effective to enhance tight oil recovery under constant reservoir temperature and down hole pressure conditions. However, the enhance tight oil recovery mechanism was unclear, especially the adsorption of the CO2 and alkane in the surface. Therefore, it is great important to study the adsorption mechanism of CO2 and alkane mixtures in tight oil. In this study, a new experimental method and apparatus have been designed to test the change of the mole fraction of CO2 and n-C12 before and after the adsorption equilibrium. Then, the adsorption amount of CO2 and n-C12 was obtained by a mathematical method. Moreover, the adsorption character of CO2 and n-C12 mixtures in 13X molecular sieve and the effect of pressure on the adsorption and amount were studied. The results show that the adsorption of CO2 and the desorption of n-C12 follow the Langmuir adsorption. This study provides a straightforward method to experimentally determine the adsorption properties of the tight oil, which can be used to evaluate enhanced tight oil recovery by CO2 injection.

Analysis of Phosphatidic Acid Binding and Regulation of PIPKI In Vitro and in Intact Cells.

PubMed

Tay, L W R; Wang, Z; Du, G

2017-01-01

Phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] is a lipid second messenger that regulates a wide array of essential cellular events, such as signal transduction, vesicle trafficking, actin cytoskeleton dynamics, adhesion, and motility. To control the spatiotemporal production of PI(4,5)P2, the activity of type 1 phosphotidylinositol-4-phosphate-5-kinases (PIPKIs) is tightly regulated by small GTPases and another signaling lipid, phosphatidic acid (PA). It is of interest that PI(4,5)P2 is also a critical cofactor for the activation of the PA-generating enzyme, phospholipase D (PLD). It has been proposed that the reciprocal stimulation of PLD and PIPKI enzymes enables a rapid feedforward stimulation loop for the localized and acute generation of signaling lipids that are critical for the regulation of actin cytoskeletal reorganization and membrane trafficking. Here, we outline the methods for the expression and purification of PIPKIγ from bacteria, determination of direct PA binding, and activation of PIPKIγ using in vitro liposomes assays, and examination of actin cytoskeletal reorganization promoted by the PA-PIPKIγ signaling in intact cells using fluorescent microscopy. © 2017 Elsevier Inc. All rights reserved.

Cross-circularly polarized two-exciton states in one to three dimensions

NASA Astrophysics Data System (ADS)

Ajiki, Hiroshi

2015-03-01

Biexciton and two-exciton dissociated states of Frenkel-type excitons are studied theoretically using an exciton tight-binding (TB) model including a polarization degree of freedom. Because the biexciton consists of two cross-circularly polarized excitons, an on-site interaction (V) between the two excitons should be considered in addition to a nearest-neighbor two-exciton attractive interaction (δ). Although there are an infinitely large number of combinations of V and δ providing the observed binding energy of a biexciton, the wave function of the biexciton and two-exciton dissociated states is nearly independent of these parameter sets. This means that all the two-exciton states are uniquely determined from the exciton TB model. There are a spatially symmetric and an antisymmetric biexciton state for a one-dimensional (1D) lattice and two symmetric and one antisymmetric biexciton states at most for two- (2D) and three-dimensional (3D) lattices. In contrast, when the polarization degree of freedom is ignored, there is one biexciton state for 1D, 2D, and 3D lattices. For this study, a rapid and memory-saving calculation method for two-exciton states is extended to include the polarization degree of freedom.

Cross-circularly polarized two-exciton states in one to three dimensions.

PubMed

Ajiki, Hiroshi

2015-03-14

Biexciton and two-exciton dissociated states of Frenkel-type excitons are studied theoretically using an exciton tight-binding (TB) model including a polarization degree of freedom. Because the biexciton consists of two cross-circularly polarized excitons, an on-site interaction (V) between the two excitons should be considered in addition to a nearest-neighbor two-exciton attractive interaction (δ). Although there are an infinitely large number of combinations of V and δ providing the observed binding energy of a biexciton, the wave function of the biexciton and two-exciton dissociated states is nearly independent of these parameter sets. This means that all the two-exciton states are uniquely determined from the exciton TB model. There are a spatially symmetric and an antisymmetric biexciton state for a one-dimensional (1D) lattice and two symmetric and one antisymmetric biexciton states at most for two- (2D) and three-dimensional (3D) lattices. In contrast, when the polarization degree of freedom is ignored, there is one biexciton state for 1D, 2D, and 3D lattices. For this study, a rapid and memory-saving calculation method for two-exciton states is extended to include the polarization degree of freedom.

High-Throughput Screens to Discover Small-Molecule Modulators of Ryanodine Receptor Calcium Release Channels

PubMed Central

Rebbeck, Robyn T.; Essawy, Maram M.; Nitu, Florentin R.; Grant, Benjamin D.; Gillispie, Gregory D.; Thomas, David D.; Bers, Donald M.; Cornea, Razvan L.

2017-01-01

Using time-resolved fluorescence resonance energy transfer (FRET), we have developed and validated the first high-throughput screening (HTS) method to discover compounds that modulate an intracellular Ca2+ channel, the ryanodine receptor (RyR), for therapeutic applications. Intracellular Ca2+ regulation is critical for striated muscle function, and RyR is a central player. At resting [Ca2+], increased propensity of channel opening due to RyR dysregulation is associated with severe cardiac and skeletal myopathies, diabetes and neurological disorders. This leaky state of the RyR is an attractive target for pharmacological agents to treat such pathologies. Our FRET-based HTS detects RyR binding of accessory proteins calmodulin or FKBP12.6. Under conditions that mimic a pathological state, we carried out a screen of the 727-compound NIH Clinical Collection, which yielded six compounds that reproducibly changed FRET by >3SD. Dose-response of FRET and [3H]ryanodine binding readouts reveal that five hits reproducibly alter RyR1 structure and activity. One compound increased FRET and inhibited RyR1, which was only significant at nM [Ca2+], and accentuated without CaM present. These properties characterize a compound that could mitigate RyR1 leak. An excellent z′-factor and the tight correlation between structural and functional readouts validate this first HTS method to identify RyR modulators. PMID:27760856

Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.

2011-01-01

We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.

Protein and Antibody Engineering by Phage Display.

PubMed

Frei, J C; Lai, J R

2016-01-01

Phage display is an in vitro selection technique that allows for the rapid isolation of proteins with desired properties including increased affinity, specificity, stability, and new enzymatic activity. The power of phage display relies on the phenotype-to-genotype linkage of the protein of interest displayed on the phage surface with the encoding DNA packaged within the phage particle, which allows for selective enrichment of library pools and high-throughput screening of resulting clones. As an in vitro method, the conditions of the binding selection can be tightly controlled. Due to the high-throughput nature, rapidity, and ease of use, phage display is an excellent technological platform for engineering antibody or proteins with enhanced properties. Here, we describe methods for synthesis, selection, and screening of phage libraries with particular emphasis on designing humanizing antibody libraries and combinatorial scanning mutagenesis libraries. We conclude with a brief section on troubleshooting for all stages of the phage display process. © 2016 Elsevier Inc. All rights reserved.

A global reaction route mapping-based kinetic Monte Carlo algorithm

NASA Astrophysics Data System (ADS)

Mitchell, Izaac; Irle, Stephan; Page, Alister J.

2016-07-01

We propose a new on-the-fly kinetic Monte Carlo (KMC) method that is based on exhaustive potential energy surface searching carried out with the global reaction route mapping (GRRM) algorithm. Starting from any given equilibrium state, this GRRM-KMC algorithm performs a one-step GRRM search to identify all surrounding transition states. Intrinsic reaction coordinate pathways are then calculated to identify potential subsequent equilibrium states. Harmonic transition state theory is used to calculate rate constants for all potential pathways, before a standard KMC accept/reject selection is performed. The selected pathway is then used to propagate the system forward in time, which is calculated on the basis of 1st order kinetics. The GRRM-KMC algorithm is validated here in two challenging contexts: intramolecular proton transfer in malonaldehyde and surface carbon diffusion on an iron nanoparticle. We demonstrate that in both cases the GRRM-KMC method is capable of reproducing the 1st order kinetics observed during independent quantum chemical molecular dynamics simulations using the density-functional tight-binding potential.

Density-functional expansion methods: evaluation of LDA, GGA, and meta-GGA functionals and different integral approximations.

PubMed

Giese, Timothy J; York, Darrin M

2010-12-28

We extend the Kohn-Sham potential energy expansion (VE) to include variations of the kinetic energy density and use the VE formulation with a 6-31G* basis to perform a "Jacob's ladder" comparison of small molecule properties using density functionals classified as being either LDA, GGA, or meta-GGA. We show that the VE reproduces standard Kohn-Sham DFT results well if all integrals are performed without further approximation, and there is no substantial improvement in using meta-GGA functionals relative to GGA functionals. The advantages of using GGA versus LDA functionals becomes apparent when modeling hydrogen bonds. We furthermore examine the effect of using integral approximations to compute the zeroth-order energy and first-order matrix elements, and the results suggest that the origin of the short-range repulsive potential within self-consistent charge density-functional tight-binding methods mainly arises from the approximations made to the first-order matrix elements.

A global reaction route mapping-based kinetic Monte Carlo algorithm.

PubMed

Mitchell, Izaac; Irle, Stephan; Page, Alister J

2016-07-14

We propose a new on-the-fly kinetic Monte Carlo (KMC) method that is based on exhaustive potential energy surface searching carried out with the global reaction route mapping (GRRM) algorithm. Starting from any given equilibrium state, this GRRM-KMC algorithm performs a one-step GRRM search to identify all surrounding transition states. Intrinsic reaction coordinate pathways are then calculated to identify potential subsequent equilibrium states. Harmonic transition state theory is used to calculate rate constants for all potential pathways, before a standard KMC accept/reject selection is performed. The selected pathway is then used to propagate the system forward in time, which is calculated on the basis of 1st order kinetics. The GRRM-KMC algorithm is validated here in two challenging contexts: intramolecular proton transfer in malonaldehyde and surface carbon diffusion on an iron nanoparticle. We demonstrate that in both cases the GRRM-KMC method is capable of reproducing the 1st order kinetics observed during independent quantum chemical molecular dynamics simulations using the density-functional tight-binding potential.

QM/QM approach to model energy disorder in amorphous organic semiconductors.

PubMed

Friederich, Pascal; Meded, Velimir; Symalla, Franz; Elstner, Marcus; Wenzel, Wolfgang

2015-02-10

It is an outstanding challenge to model the electronic properties of organic amorphous materials utilized in organic electronics. Computation of the charge carrier mobility is a challenging problem as it requires integration of morphological and electronic degrees of freedom in a coherent methodology and depends strongly on the distribution of polaron energies in the system. Here we represent a QM/QM model to compute the polaron energies combining density functional methods for molecules in the vicinity of the polaron with computationally efficient density functional based tight binding methods in the rest of the environment. For seven widely used amorphous organic semiconductor materials, we show that the calculations are accelerated up to 1 order of magnitude without any loss in accuracy. Considering that the quantum chemical step is the efficiency bottleneck of a workflow to model the carrier mobility, these results are an important step toward accurate and efficient disordered organic semiconductors simulations, a prerequisite for accelerated materials screening and consequent component optimization in the organic electronics industry.

Tunable valley polarization by a gate voltage when an electron tunnels through multiple line defects in graphene.

PubMed

Liu, Zhe; Jiang, Liwei; Zheng, Yisong

2015-02-04

By means of an appropriate wave function connection condition, we study the electronic structure of a line defect superlattice of graphene with the Dirac equation method. We obtain the analytical dispersion relation, which can simulate well the tight-binding numerical result about the band structure of the superlattice. Then, we generalize this theoretical method to study the electronic transmission through a potential barrier where multiple line defects are periodically patterned. We find that there exists a critical incident angle which restricts the electronic transmission through multiple line defects within a specific incident angle range. The critical angle depends sensitively on the potential barrier height, which can be modulated by a gate voltage. As a result, non-trivial transmissions of K and K' valley electrons are restricted, respectively, in two distinct ranges of the incident angle. Our theoretical result demonstrates that a gate voltage can act as a feasible measure to tune the valley polarization when electrons tunnel through multiple line defects.

Investigation of Structure and Reactivity Relationship in M-N-C Type Catalysts using Density Functional Tight Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Negre, Christian Francisco Andres; Gonzales, Ivana

Catalysts inhibition studies were performed to indisputably confirm the role of various metal, carbon, and nitrogen moieties in the individual steps of oxygen reduction reaction (ORR) on M-N-C catalysts. ORR activity was studied at University of New Mexico by rotating ring disk electrode method in the acidic electrolyte with the addition of Tris (tris(hydroxymethyl)-aminomethane) as inhibiting agent. To understand the interaction of Tris with different defects that exist in Fe-N-C materials and provide the support for the experimental data, we used density functional theory (DFT) and modeled the interaction of protonated Tris (TrisH) with Fe containingcenters (Fe-N 4 and Fe-Nmore » 2C 2), pyridinic nitrogen, graphitic nitrogen, and pyrrolic nitrogen both as in plane and edge defects.« less

Influence of strain on dislocation core in silicon

NASA Astrophysics Data System (ADS)

Pizzagalli, L.; Godet, J.; Brochard, S.

2018-05-01

First principles, density functional-based tight binding and semi-empirical interatomic potentials calculations are performed to analyse the influence of large strains on the structure and stability of a 60? dislocation in silicon. Such strains typically arise during the mechanical testing of nanostructures like nanopillars or nanoparticles. We focus on bi-axial strains in the plane normal to the dislocation line. Our calculations surprisingly reveal that the dislocation core structure largely depends on the applied strain, for strain levels of about 5%. In the particular case of bi-axial compression, the transformation of the dislocation to a locally disordered configuration occurs for similar strain magnitudes. The formation of an opening, however, requires larger strains, of about 7.5%. Furthermore, our results suggest that electronic structure methods should be favoured to model dislocation cores in case of large strains whenever possible.

Carrier lifetime in exfoliated few-layer graphene determined from intersubband optical transitions.

PubMed

Limmer, Thomas; Feldmann, Jochen; Da Como, Enrico

2013-05-24

We report a femtosecond transient spectroscopy study in the near to middle infrared range, 0.8-0.35 eV photon energy, on graphene and few layer graphene single flakes. The spectra show an evolving structure of photoinduced absorption bands superimposed on the bleaching caused by Pauli blocking of the interband optically coupled states. Supported by tight-binding model calculations, we assign the photoinduced absorption features to intersubband transitions as the number of layers is increased. Interestingly, the intersubband photoinduced resonances show a longer dynamics than the interband bleaching, because of their independence from the absolute energy of the carriers with respect to the Dirac point. The dynamic of these intersubband transitions reflects the lifetime of the hot carriers and provides an elegant method to access it in this important class of semimetals.

Carrier Lifetime in Exfoliated Few-Layer Graphene Determined from Intersubband Optical Transitions

NASA Astrophysics Data System (ADS)

Limmer, Thomas; Feldmann, Jochen; Da Como, Enrico

2013-05-01

We report a femtosecond transient spectroscopy study in the near to middle infrared range, 0.8-0.35 eV photon energy, on graphene and few layer graphene single flakes. The spectra show an evolving structure of photoinduced absorption bands superimposed on the bleaching caused by Pauli blocking of the interband optically coupled states. Supported by tight-binding model calculations, we assign the photoinduced absorption features to intersubband transitions as the number of layers is increased. Interestingly, the intersubband photoinduced resonances show a longer dynamics than the interband bleaching, because of their independence from the absolute energy of the carriers with respect to the Dirac point. The dynamic of these intersubband transitions reflects the lifetime of the hot carriers and provides an elegant method to access it in this important class of semimetals.

Bandgap engineering of GaN nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ming, Bang-Ming; Yan, Hui; Wang, Ru-Zhi, E-mail: wrz@bjut.edu.cn, E-mail: yamcy@csrc.ac.cn

2016-05-15

Bandgap engineering has been a powerful technique for manipulating the electronic and optical properties of semiconductors. In this work, a systematic investigation of the electronic properties of [0001] GaN nanowires was carried out using the density functional based tight-binding method (DFTB). We studied the effects of geometric structure and uniaxial strain on the electronic properties of GaN nanowires with diameters ranging from 0.8 to 10 nm. Our results show that the band gap of GaN nanowires depends linearly on both the surface to volume ratio (S/V) and tensile strain. The band gap of GaN nanowires increases linearly with S/V, whilemore » it decreases linearly with increasing tensile strain. These linear relationships provide an effect way in designing GaN nanowires for their applications in novel nano-devices.« less

New Computational Approach to Electron Transport in Irregular Graphene Nanostructures

NASA Astrophysics Data System (ADS)

Mason, Douglas; Heller, Eric; Prendergast, David; Neaton, Jeffrey

2009-03-01

For novel graphene devices of nanoscale-to-macroscopic scale, many aspects of their transport properties are not easily understood due to difficulties in fabricating devices with regular edges. Here we develop a framework to efficiently calculate and potentially screen electronic transport properties of arbitrary nanoscale graphene device structures. A generalization of the established recursive Green's function method is presented, providing access to arbitrary device and lead geometries with substantial computer-time savings. Using single-orbital nearest-neighbor tight-binding models and the Green's function-Landauer scattering formalism, we will explore the transmission function of irregular two-dimensional graphene-based nanostructures with arbitrary lead orientation. Prepared by LBNL under contract DE-AC02-05CH11231 and supported by the U.S. Dept. of Energy Computer Science Graduate Fellowship under grant DE-FG02-97ER25308.

Spin diffusion and torques in disordered antiferromagnets

NASA Astrophysics Data System (ADS)

Manchon, Aurelien

2017-03-01

We have developed a drift-diffusion equation of spin transport in collinear bipartite metallic antiferromagnets. Starting from a model tight-binding Hamiltonian, we obtain the quantum kinetic equation within Keldysh formalism and expand it to the lowest order in spatial gradient using Wigner expansion method. In the diffusive limit, these equations track the spatio-temporal evolution of the spin accumulations and spin currents on each sublattice of the antiferromagnet. We use these equations to address the nature of the spin transfer torque in (i) a spin-valve composed of a ferromagnet and an antiferromagnet, (ii) a metallic bilayer consisting of an antiferromagnet adjacent to a heavy metal possessing spin Hall effect, and in (iii) a single antiferromagnet possessing spin Hall effect. We show that the latter can experience a self-torque thanks to the non-vanishing spin Hall effect in the antiferromagnet.

Spin Hall Effect and Weak Antilocalization in Graphene/Transition Metal Dichalcogenide Heterostructures.

PubMed

Garcia, Jose H; Cummings, Aron W; Roche, Stephan

2017-08-09

We report on a theoretical study of the spin Hall Effect (SHE) and weak antilocalization (WAL) in graphene/transition metal dichalcogenide (TMDC) heterostructures, computed through efficient real-space quantum transport methods, and using realistic tight-binding models parametrized from ab initio calculations. The graphene/WS 2 system is found to maximize spin proximity effects compared to graphene on MoS 2 , WSe 2 , or MoSe 2 with a crucial role played by disorder, given the disappearance of SHE signals in the presence of strong intervalley scattering. Notably, we found that stronger WAL effects are concomitant with weaker charge-to-spin conversion efficiency. For further experimental studies of graphene/TMDC heterostructures, our findings provide guidelines for reaching the upper limit of spin current formation and for fully harvesting the potential of two-dimensional materials for spintronic applications.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Carbon Nanotube Field Emission Arrays

DTIC Science & Technology

2011-06-01

K , and M [14]. Using the tight binding energy model, the energy dispersion relations for graphene can be calculated for the triangle formed from...The corresponding reciprocal lattice vectors, b1 and b2, and Brillouin zone of graphene [14]. 19 graphene band structure is the six K ...points where the two bands are degenerate and the Fermi level passes. It has been shown through thorough calculations that at T = 0 K , the density

Formation Energies of Native Point Defects in Strained layer Superlattices (Postprint)

DTIC Science & Technology

2017-06-05

AFRL-RX-WP-JA-2017-0440 FORMATION ENERGIES OF NATIVE POINT DEFECTS IN STRAINED-LAYER SUPERLATTICES (POSTPRINT) Zhi Gang Yu...2017 Interim 11 September 2013 – 31 May 2017 4. TITLE AND SUBTITLE FORMATION ENERGIES OF NATIVE POINT DEFECTS IN STRAINED-LAYER SUPERLATTICES...Hamiltonian, tight-binding Hamiltonian, and Green’s function techniques to obtain energy levels arising from native point defects (NPDs) in InAs-GaSb and

Majorana-Hubbard model on the square lattice

NASA Astrophysics Data System (ADS)

Affleck, Ian; Rahmani, Armin; Pikulin, Dmitry

2017-09-01

We study a tight-binding model of interacting Majorana (Hermitian) modes on a square lattice. The model may have an experimental realization in a superconducting-film-topological-insulator heterostructure in a magnetic field. We find a rich phase diagram, as a function of interaction strength, including an emergent superfluid phase with spontaneous breaking of an emergent U (1 ) symmetry, separated by a supersymmetric transition from a gapless normal phase.

Disorder and superfluid density in overdoped cuprate superconductors

NASA Astrophysics Data System (ADS)

Lee-Hone, N. R.; Dodge, J. S.; Broun, D. M.

2017-07-01

We calculate superfluid density for a dirty d -wave superconductor. The effects of impurity scattering are treated within the self-consistent t -matrix approximation, in weak-coupling BCS theory. Working from a realistic tight-binding parametrization of the Fermi surface, we find a superfluid density that is both correlated with Tc and linear in temperature, in good correspondence with recent experiments on overdoped La2 -xSrxCuO4 .

Dislocation Onset and Glide in Carbon Nanotubes under Torsion

NASA Astrophysics Data System (ADS)

Dumitrica, Traian; Zhang, Dong-Bo; James, Richard

2009-03-01

The torsional plastic response of carbon nanotubes is comprehensively described in the objective molecular dynamics framework [1-3]. It is shown that an (n,m) tube is prone to slip along a nearly-axial helical path, which introduces a distinct (+1,-1) change in the wrapping index. The low energy realization occurs without loss of mass, via nucleation of a 5-7-7-5 dislocation dipole, followed by a nearly-axial glide of the 5-7 dislocation. The onset of plasticity depends not only on chirality but also on handedness. For a given handedness of the applied twist, chiral tubes of opposed handedness are most susceptible to yield. A right-handed applied twist on an armchair (zig-zag) tube leads to a right- (left-) handed tube. [4pt] [1] T. Dumitrica and R.D. James, Objective Molecular Dynamics, Journal of the Mechanics and Physics of Solids 55, 2206 (2007). [0pt] [2] D.-B. Zhang, M. Hua, and T. Dumitrica, Stability of Polycrystalline and Wurtzite Si Nanowires via Symmetry-Adapted Tight-Binding Objective Molecular Dynamics, Journal of Chemical Physics 128, 084104 (2008). [0pt] [3] D.-B. Zhang and T. Dumitrica, Elasticity of Ideal Single-Walled Carbon Nanotubes via Symmetry-Adapted Tight-Binding Objective Modeling, Applied Physics Letters 93, 031919 (2008).

Dirac topological insulator in the dz2 manifold of a honeycomb oxide

NASA Astrophysics Data System (ADS)

Lado, J. L.; Pardo, V.

2016-09-01

We show by means of ab initio calculations and tight-binding modeling that an oxide system based on a honeycomb lattice can sustain topologically nontrivial states if a single orbital dominates the spectrum close to the Fermi level. In such a situation, the low-energy spectrum is described by two Dirac equations that become nontrivially gapped when spin-orbit coupling (SOC) is switched on. We provide one specific example but the recipe is general. We discuss a realization of this starting from a conventional spin-1/2 honeycomb antiferromagnet whose states close to the Fermi energy are dz2 orbitals. Switching off magnetism by atomic substitution and ensuring that the electronic structure becomes two-dimensional is sufficient for topologicality to arise in such a system. By deriving a tight-binding Wannier Hamiltonian, we find that the gap in such a model scales linearly with SOC, opposed to other oxide-based topological insulators, where smaller gaps tend to appear by construction of the lattice. We show that the quantum spin Hall state in this system survives in the presence of off-plane magnetism and the orbital magnetic field and we discuss its Landau level spectra, showing that our recipe provides a dz2 realization of the Kane-Mele model.

Effective mass in bilayer graphene at low carrier densities: The role of potential disorder and electron-electron interaction

NASA Astrophysics Data System (ADS)

Li, J.; Tan, L. Z.; Zou, K.; Stabile, A. A.; Seiwell, D. J.; Watanabe, K.; Taniguchi, T.; Louie, Steven G.; Zhu, J.

2016-10-01

In a two-dimensional electron gas, the electron-electron interaction generally becomes stronger at lower carrier densities and renormalizes the Fermi-liquid parameters, such as the effective mass of carriers. We combine experiment and theory to study the effective masses of electrons and holes me* and mh* in bilayer graphene in the low carrier density regime on the order of 1 ×1011c m-2 . Measurements use temperature-dependent low-field Shubnikov-de Haas oscillations observed in high-mobility hexagonal boron nitride supported samples. We find that while me* follows a tight-binding description in the whole density range, mh* starts to drop rapidly below the tight-binding description at a carrier density of n =6 ×1011c m-2 and exhibits a strong suppression of 30% when n reaches 2 ×1011c m-2 . Contributions from the electron-electron interaction alone, evaluated using several different approximations, cannot explain the experimental trend. Instead, the effect of the potential fluctuation and the resulting electron-hole puddles play a crucial role. Calculations including both the electron-electron interaction and disorder effects explain the experimental data qualitatively and quantitatively. This Rapid Communication reveals an unusual disorder effect unique to two-dimensional semimetallic systems.

Quantum Hall effect in ac driven graphene: From the half-integer to the integer case

NASA Astrophysics Data System (ADS)

Ding, Kai-He; Lim, Lih-King; Su, Gang; Weng, Zheng-Yu

2018-01-01

We theoretically study the quantum Hall effect (QHE) in graphene with an ac electric field. Based on the tight-binding model, the structure of the half-integer Hall plateaus at σxy=±(n +1 /2 ) 4 e2/h (n is an integer) gets qualitatively changed with the addition of new integer Hall plateaus at σxy=±n (4 e2/h ) starting from the edges of the band center regime towards the band center with an increasing ac field. Beyond a critical field strength, a Hall plateau with σxy=0 can be realized at the band center, hence fully restoring a conventional integer QHE with particle-hole symmetry. Within a low-energy Hamiltonian for Dirac cones merging, we show a very good agreement with the tight-binding calculations for the Hall plateau transitions. We also obtain the band structure for driven graphene ribbons to provide a further understanding on the appearance of the new Hall plateaus, showing a trivial insulator behavior for the σxy=0 state. In the presence of disorder, we numerically study the disorder-induced destruction of the quantum Hall states in a finite driven sample and find that qualitative features known in the undriven disordered case are maintained.

A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.

PubMed

Quan, Yundi; Pickett, Warren E

2018-02-21

Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point

NASA Astrophysics Data System (ADS)

Quan, Yundi; Pickett, Warren E.

2018-02-01

Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

Mobile spin impurity in an optical lattice

NASA Astrophysics Data System (ADS)

Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.

2017-07-01

We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.

Phononic crystals of spherical particles: A tight binding approach

NASA Astrophysics Data System (ADS)

Mattarelli, M.; Secchi, M.; Montagna, M.

2013-11-01

The vibrational dynamics of a fcc phononic crystal of spheres is studied and compared with that of a single free sphere, modelled either by a continuous homogeneous medium or by a finite cluster of atoms. For weak interaction among the spheres, the vibrational dynamics of the phononic crystal is described by shallow bands, with low degree of dispersion, corresponding to the acoustic spheroidal and torsional modes of the single sphere. The phonon displacements are therefore related to the vibrations of a sphere, as the electron wave functions in a crystal are related to the atomic wave functions in a tight binding model. Important dispersion is found for the two lowest phonon bands, which correspond to zero frequency free translation and rotation of a free sphere. Brillouin scattering spectra are calculated at some values of the exchanged wavevectors of the light, and compared with those of a single sphere. With weak interaction between particles, given the high acoustic impedance mismatch in dry systems, the density of phonon states consist of sharp bands separated by large gaps, which can be well accounted for by a single particle model. Based on the width of the frequency gaps, tunable with the particle size, and on the small number of dispersive acoustic phonons, such systems may provide excellent materials for application as sound or heat filters.

Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

NASA Astrophysics Data System (ADS)

Menezes, Marcos; Capaz, Rodrigo

Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.

Time-efficient simulations of tight-binding electronic structures with Intel Xeon PhiTM many-core processors

NASA Astrophysics Data System (ADS)

Ryu, Hoon; Jeong, Yosang; Kang, Ji-Hoon; Cho, Kyu Nam

2016-12-01

Modelling of multi-million atomic semiconductor structures is important as it not only predicts properties of physically realizable novel materials, but can accelerate advanced device designs. This work elaborates a new Technology-Computer-Aided-Design (TCAD) tool for nanoelectronics modelling, which uses a sp3d5s∗ tight-binding approach to describe multi-million atomic structures, and simulate electronic structures with high performance computing (HPC), including atomic effects such as alloy and dopant disorders. Being named as Quantum simulation tool for Advanced Nanoscale Devices (Q-AND), the tool shows nice scalability on traditional multi-core HPC clusters implying the strong capability of large-scale electronic structure simulations, particularly with remarkable performance enhancement on latest clusters of Intel Xeon PhiTM coprocessors. A review of the recent modelling study conducted to understand an experimental work of highly phosphorus-doped silicon nanowires, is presented to demonstrate the utility of Q-AND. Having been developed via Intel Parallel Computing Center project, Q-AND will be open to public to establish a sound framework of nanoelectronics modelling with advanced HPC clusters of a many-core base. With details of the development methodology and exemplary study of dopant electronics, this work will present a practical guideline for TCAD development to researchers in the field of computational nanoelectronics.

Utilizing time-lapse micro-CT-correlated bisphosphonate binding kinetics and soft tissue-derived input functions to differentiate site-specific changes in bone metabolism in vivo.

PubMed

Tower, R J; Campbell, G M; Müller, M; Glüer, C C; Tiwari, S

2015-05-01

The turnover of bone is a tightly regulated process between bone formation and resorption to ensure skeletal homeostasis. This process differs between bone types, with trabecular bone often associated with higher turnover than cortical bone. Analyses of bone by micro-computed tomography (micro-CT) reveal changes in structure and mineral content, but are limited in the study of metabolic activity at a single time point, while analyses of serum markers can reveal changes in bone metabolism, but cannot delineate the origin of any aberrant findings. To obtain a site-specific assessment of bone metabolic status, bisphosphonate binding kinetics were utilized. Using a fluorescently-labeled bisphosphonate, we show that early binding kinetics monitored in vivo using fluorescent molecular tomography (FMT) can monitor changes in bone metabolism in response to bone loss, stimulated by ovariectomy (OVX), or bone gain, resulting from treatment with the anabolic bone agent parathyroid hormone (PTH), and is capable of distinguishing different, metabolically distinct skeletal sites. Using time-lapse micro-CT, longitudinal bone turnover was quantified. The spine showed a significantly greater percent resorbing volume and surface in response to OVX, while mice treated with PTH showed significantly greater resorbing volume per bone surface in the spine and significantly greater forming surfaces in the knee. Correlation studies between binding kinetics and micro-CT suggest that forming surfaces, as assessed by time-lapse micro-CT, are preferentially reflected in the rate constant values while forming and resorbing bone volumes primarily affect plateau values. Additionally, we developed a blood pool correction method which now allows for quantitative multi-compartment analyses to be conducted using FMT. These results further expand our understanding of bisphosphonate binding and the use of bisphosphonate binding kinetics as a tool to monitor site-specific changes in bone metabolism in vivo. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

No significant regulation of bicoid mRNA by Pumilio or Nanos in the early Drosophila embryo.

PubMed

Wharton, Tammy H; Nomie, Krystle J; Wharton, Robin P

2018-01-01

Drosophila Pumilio (Pum) is a founding member of the conserved Puf domain class of RNA-binding translational regulators. Pum binds with high specificity, contacting eight nucleotides, one with each of the repeats in its RNA-binding domain. In general, Pum is thought to block translation in collaboration with Nanos (Nos), which exhibits no binding specificity in isolation but is recruited jointly to regulatory sequences containing a Pum binding site in the 3'-UTRs of target mRNAs. Unlike Pum, which is ubiquitous in the early embryo, Nos is tightly restricted to the posterior, ensuring that repression of its best-characterized target, maternal hunchback (hb) mRNA, takes place exclusively in the posterior. An exceptional case of Nos-independent regulation by Pum has been described-repression of maternal bicoid (bcd) mRNA at the anterior pole of the early embryo, dependent on both Pum and conserved Pum binding sites in the 3'-UTR of the mRNA. We have re-investigated regulation of bcd in the early embryo; our experiments reveal no evidence of a role for Pum or its conserved binding sites in regulation of the perdurance of bcd mRNA or protein. Instead, we find that Pum and Nos control the accumulation of bcd mRNA in testes.

Dominant Alcohol-Protein Interaction via Hydration-Enabled Enthalpy-Driven Binding Mechanism

PubMed Central

Chong, Yuan; Kleinhammes, Alfred; Tang, Pei; Xu, Yan; Wu, Yue

2015-01-01

Water plays an important role in weak associations of small drug molecules with proteins. Intense focus has been on binding-induced structural changes in the water network surrounding protein binding sites, especially their contributions to binding thermodynamics. However, water is also tightly coupled to protein conformations and dynamics, and so far little is known about the influence of water-protein interactions on ligand binding. Alcohols are a type of low-affinity drugs, and it remains unclear how water affects alcohol-protein interactions. Here, we present alcohol adsorption isotherms under controlled protein hydration using in-situ NMR detection. As functions of hydration level, Gibbs free energy, enthalpy, and entropy of binding were determined from the temperature dependence of isotherms. Two types of alcohol binding were found. The dominant type is low-affinity nonspecific binding, which is strongly dependent on temperature and the level of hydration. At low hydration levels, this nonspecific binding only occurs above a threshold of alcohol vapor pressure. An increased hydration level reduces this threshold, with it finally disappearing at a hydration level of h~0.2 (g water/g protein), gradually shifting alcohol binding from an entropy-driven to an enthalpy-driven process. Water at charged and polar groups on the protein surface was found to be particularly important in enabling this binding. Although further increase in hydration has smaller effects on the changes of binding enthalpy and entropy, it results in significant negative change in Gibbs free energy due to unmatched enthalpy-entropy compensation. These results show the crucial role of water-protein interplay in alcohol binding. PMID:25856773

Nanomechanics of Carbon and CxByNz Nanotubes: Via a Quantum Molecular Dynamics Method

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, M.; Cho, Kyeong Jae; Saini, Subhash (Technical Monitor)

1999-01-01

Nanomechanics of single-wall C, BN and BC$_3$ and B doped C nanotubes under axial compression and tension are investigated through a generalized tight-binding molecular dynamics (GTBMD) and {\\it ab-initio} electronic structure methods. The dynamic strength of BN, BC$_3$ and B doped C nanotubes for small axial strain are comparable to each other. The main difference is in the critical strain at which structural collapse occurs. For example, even a shallow doping with B lowers the value of critical strain for C nanotubes. The critical strain for BN nanotube is found to be more than that for the similar C nanotube. Once the structural collapse starts to occur we find that carbon nanotubes irreversibly go into plastic deformation regime via the formation of tetrahedral (four-fold coordinated) bonds at the location of sharp pinches or kinks. This finding is considerably different from the classical MD (molecular dynamics) simulation results known so far. The energetics and electronic densities of states of the collapsed structures, investigated with {\\it ab-initio) methods, will also be discussed.

Accurate donor electron wave functions from a multivalley effective mass theory.

NASA Astrophysics Data System (ADS)

Pendo, Luke; Hu, Xuedong

Multivalley effective mass (MEM) theories combine physical intuition with a marginal need for computational resources, but they tend to be insensitive to variations in the wavefunction. However, recent papers suggest full Bloch functions and suitable central cell donor potential corrections are essential to replicating qualitative and quantitative features of the wavefunction. In this talk, we consider a variational MEM method that can accurately predict both spectrum and wavefunction of isolated phosphorus donors. As per Gamble et. al, we employ a truncated series representation of the Bloch function with a tetrahedrally symmetric central cell correction. We use a dynamic dielectric constant, a feature commonly seen in tight-binding methods. Uniquely, we use a freely extensible basis of either all Slater- or all Gaussian-type functions. With a large basis able to capture the influence of higher energy eigenstates, this method is well positioned to consider the influence of external perturbations, such as electric field or applied strain, on the charge density. This work is supported by the US Army Research Office (W911NF1210609).

Theoretical investigations on diamondoids (CnHm, n = 10-41): Nomenclature, structural stabilities, and gap distributions

NASA Astrophysics Data System (ADS)

Wang, Ya-Ting; Zhao, Yu-Jun; Liao, Ji-Hai; Yang, Xiao-Bao

2018-01-01

Combining the congruence check and the first-principles calculations, we have systematically investigated the structural stabilities and gap distributions of possible diamondoids (CnHm) with the carbon numbers (n) from 10 to 41. A simple method for the nomenclature is proposed, which can be used to distinguish and screen the candidates with high efficiency. Different from previous theoretical studies, the possible diamondoids can be enumerated according to our nomenclature, without any pre-determination from experiments. The structural stabilities and electronic properties have been studied by density functional based tight binding and first-principles methods, where a nearly linear correlation is found between the energy gaps obtained by these two methods. According to the formation energy of structures, we have determined the stable configurations as a function of chemical potential. The maximum and minimum energy gaps are found to be dominated by the shape of diamondoids for clusters with a given number of carbon atoms, while the gap decreases in general as the size increases due to the quantum confinement.

The Role of Cytosine Methylation on Charge Transport through a DNA Strand

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, Jianqing; Govind, Niranjan; Anantram, M. P.

Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modifi-cation remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Buttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. Specifically, we compare the results generated with the widely used B3LYP exchange-correlation (XC) functional and CAM-B3LYP based tuned range-separated hybrid density functional. We first analyze the effectmore » of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that with both functionals, the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and interstrand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital (HOMO) level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with both functionals. We also study the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit. Our results suggest that the effect of the two different functionals is to alter the on-site energies of the DNA bases at the HOMO level, while the transport properties don't depend much on the two functionals.« less

Simulation studies of carbon nanotube field-effect transistors

NASA Astrophysics Data System (ADS)

John, David Llewellyn

Simulation studies of carbon nanotube field-effect transistors (CNFETs) are presented using models of increasing rigour and versatility that have been systematically developed. Firstly, it is demonstrated how one may compute the standard tight-binding band structure. From this foundation, a self-consistent solution for computing the equilibrium energy band diagram of devices with Schottky-barrier source and drain contacts is developed. While this does provide insight into the likely behaviour of CNFETs, a non-equilibrium model is required in order to predict the current-voltage relation. To this end, the effective-mass approximation is utilized, where a parabolic fit to the band structure is used in order to develop a Schrodinger-Poisson solver. This model is employed to predict both DC behaviour and switching times for CNFETs, and was one of the first models that captured quantum effects, such as tunneling and resonance, in these devices. In addition, this model has been used in order to validate compact models that incorporated tunneling via the WKB approximation. A modified WKB derivation is provided in order to account for the non-zero reflection of carriers above a potential energy step. In order to allow for greater flexibility in the CNFET geometries, and to lift the effective-mass approximation, a non-equilibrium Green's function method is finally developed, which uses an atomistic tight-binding Hamiltonian to model doped-contact, as opposed to Schottky-barrier-contact, devices. This approach benefits by being able to account for both inter- and intra-band tunneling, and by utilizing a quadratic matrix equation in order to improve the computation time for the required self-energy matrices. Within this technique, an expression for the local inter-atomic current is derived in order to provide more detailed information than the usual compact expression for the terminal current. With this final model, an investigation is presented into the effects of geometrical variations, contact thicknesses, and azimuthal variation in the surface potential of the nanotube.

Effects of Varying Degrees of Intermittent Hypoxia on Proinflammatory Cytokines and Adipokines in Rats and 3T3-L1 Adipocytes

PubMed Central

Zhou, Qin; Zhu, Hui; Niu, Wen-yan; Feng, Jing; Wang, Yan; Cao, Jie; Chen, Bao-yuan

2014-01-01

Objectives Intermittent hypoxia (IH), resulted from recurring episodes of upper airway obstruction, is the hallmark feature and the most important pathophysiologic pathway of obstructive sleep apnea (OSA). IH is believed to be the most important factor causing systemic inflammation. Studies suggest that insulin resistance (IR) is positively associated with OSA. In this study, we hypothesized that the recurrence of IH might result in cellular and systemic inflammation, which was manifested through the levels of proinflammatory cytokines and adipokines after IH exposure, and because IR is linked with inflammation tightly, this inflammatory situation may implicate an IR status. Methods We developed an IH 3T3-L1 adipocyte and rat model respectively, recapitulating the nocturnal oxygen profile in OSA. In IH cells, nuclear factor kappa B (NF-κB) DNA binding reactions, hypoxia-inducible factor-1α (HIF-1α), glucose transporter-1 (Glut-1), necrosis factor alpha (TNF-α), interleukin (IL) -6, leptin, adiponectin mRNA transcriptional activities and protein expressions were measured. In IH rats, blood glucose, insulin, TNF-α, IL-6, leptin and adiponectin levels were analyzed. Results The insulin and blood glucose levels in rats and NF-κB DNA binding activities in cells had significantly statistical results described as severe IH>moderate IH>mild IH>sustained hypoxia>control. The mRNA and protein levels of HIF-1α and Glut-1 in severe IH group were the highest. In cellular and animal models, both the mRNA and protein levels of TNF-α, IL-6 and leptin were the highest in severe IH group, when the lowest in severe IH group for adiponectin. Conclusions Oxidative stress and the release of pro-inflammatory cytokines/adipokines, which are the systemic inflammatory markers, are associated with IH closely and are proportional to the severity of IH. Because IR and glucose intolerance are linked with inflammation tightly, our results may implicate the clinical relationships between OSA and IR. PMID:24466027

Targeted entry of enveloped viruses: measles and herpes simplex virus I.

PubMed

Navaratnarajah, Chanakha K; Miest, Tanner S; Carfi, Andrea; Cattaneo, Roberto

2012-02-01

We compare the receptor-based mechanisms that a small RNA virus and a larger DNA virus have evolved to drive the fusion of viral and cellular membranes. Both systems rely on tight control over triggering the concerted refolding of a trimeric fusion protein. While measles virus entry depends on a receptor-binding protein and a fusion protein only, the herpes simplex virus (HSV) is more complex and requires four viral proteins. Nevertheless, in both viruses a receptor-binding protein is required for triggering the membrane fusion process. Moreover, specificity domains can be appended to these receptor-binding proteins to target virus entry to cells expressing a designated receptor. We discuss how principles established with measles and HSV can be applied to targeting other enveloped viruses, and alternatively how retargeted envelopes can be fitted on foreign capsids. Copyright © 2011 Elsevier B.V. All rights reserved.

NMR Model of PrgI-SipD Interaction and its Implications in the Needle-Tip Assembly of the Salmonella Type III Secretion System

PubMed Central

Rathinavelan, Thenmalarchelvi; Lara-Tejero, Maria; Lefebre, Matthew; Chatterjee, Srirupa; McShan, Andrew C.; Guo, Da-Chuan; Tang, Chun; Galan, Jorge E.; De Guzman, Roberto N.

2014-01-01

Salmonella and other pathogenic bacteria use the type III secretion system (T3SS) to inject virulence proteins into human cells to initiate infections. The structural component of the T3SS contains a needle and a needle tip. The needle is assembled from PrgI needle protomers and the needle tip is capped with several copies of the SipD tip protein. How a tip protein docks on the needle is unclear. A crystal structure of a PrgI-SipD fusion protein docked on the PrgI needle results in steric clash of SipD at the needle tip when modeled on the recent atomic structure of the needle. Thus, there is currently no good model of how SipD is docked on the PrgI needle tip. Previously, we showed by NMR paramagnetic relaxation enhancement (PRE) methods that a specific region in the SipD coiled-coil is the binding site for PrgI. Others have hypothesized that a domain of the tip protein – the N-terminal α-helical hairpin, has to swing away during the assembly of the needle apparatus. Here, we show by PRE methods that a truncated form of SipD lacking the α-helical hairpin domain binds more tightly to PrgI. Further, PRE-based structure calculations revealed multiple PrgI binding sites on the SipD coiled-coil. Our PRE results together with the recent NMR-derived atomic structure of the Salmonella needle suggest a possible model of how SipD might dock at the PrgI needle tip. SipD and PrgI are conserved in other bacterial T3SSs, thus our results have wider implication in understanding other needle-tip complexes. PMID:24951833

Structural and biophysical characterization of Rv3716c, a hypothetical protein from Mycobacterium tuberculosis.

PubMed

Gopalan, A; Deka, G; Prabhavathi, M; Savithri, H S; Murthy, M R N; Raja, A

2018-01-01

Latent tuberculosis (TB) is the main hurdle in reaching the goal of "Stop TB 2050". Tuberculin skin and Interferon-gamma release assay tests used currently for the diagnosis of TB infection cannot distinguish between active disease and latent tuberculosis infection (LTBI) and hence new and sensitive protein markers need to be identified for the diagnosis. A protein Rv3716c from Mycobacterium tuberculosis (MtbRv3716c) has been identified as a potential surrogate marker for the diagnosis of LTBI. Here, we present characterization of MtbRv3716c (∼13 kDa) using both biophysical and X-Ray crystallographic methods. EMSA study showed that MtbRv3716c binds to double stranded DNA. X-ray diffraction data collected on a crystal of MtbRv3716c at 1.9 Å resolution was used for structure determination using the molecular replacement method. Significant electron density was not observed for the N-terminal 21 and C-terminal 41 residues in the final electron density map. The C- terminal disordered region is proline rich and displays characteristics of intrinsically disordered proteins. Although the crystal asymmetric unit contained a protomer, a tight dimer could be generated by the application of the crystal two-fold symmetry parallel to the b axis. Packing of dimers in the crystal is mediated by a cadmium ion (Cd 2+ ) occurring at the interface of two dimers. Molecular packing analysis reveals large cavities that are probably occupied by the disordered segments of the N- and C-termini. Structural comparison with other homologous hypothetical DNA binding proteins (PDB codes: 1PUG, 1YBX) highlights structural features that might be significant for DNA binding. Copyright © 2017 Elsevier Inc. All rights reserved.

An investigation of low ergonomics risk awareness, among staffs at early product development phase in Malaysia automotive industries

NASA Astrophysics Data System (ADS)

Aziz, Fazilah Abdul; Razali, Noraini; Najmiyah Jaafar, Nur

2016-02-01

Currently there are many automotive companies still unable to effectively prevent consequences of poor ergonomics in their manufacturing processes. This study purpose is to determine the surrounding factors that influence low ergonomics risk awareness among staffs at early product development phase in Malaysia automotive industry. In this study there are four variables, low ergonomic risk awareness, inappropriate method and tools, tight development schedule and lack of management support. The survey data were gathered from 245 respondents of local automotive companies in Malaysia. The data was analysed through multiple regression and moderated regression using the IBM SPSS software. Study results revealed that low ergonomic risk awareness has influenced by inappropriate method and tool, and tight development schedule. There were positive linear relationships between low ergonomic risk awareness and inappropriate method and tools, and tight development schedule. The more inappropriate method and tools applied; the lower their ergonomic risk awareness. The more tight development schedule is the lower ergonomic risk awareness. The relationship between low ergonomic risk awareness and inappropriate method and tools depends on staff's age, and education level. Furthermore the relationship between low ergonomic risk awareness and tight development schedule depends on staff's working experience and number of project involvement. The main contribution of this paper was identified the number of factors of low ergonomics risk awareness and offers better understanding on ergonomics among researchers and automotive manufacturer's employees during product development process.

Thermodynamics of cooperative binding of FAD to human NQO1: Implications to understanding cofactor-dependent function and stability of the flavoproteome.

PubMed

Clavería-Gimeno, Rafael; Velazquez-Campoy, Adrian; Pey, Angel Luis

2017-12-15

The stability of human flavoproteins strongly depends on flavin levels, although the structural and energetic basis of this relationship is poorly understood. Here, we report an in-depth analysis on the thermodynamics of FAD binding to one of the most representative examples of such relationship, NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a dimeric enzyme that tightly binds FAD, which triggers large structural changes upon binding. A common cancer-associated polymorphism (P187S) severely compromises FAD binding. We show that FAD binding is described well by a thermodynamic model explicitly incorporating binding cooperativity when applied to different sets of calorimetric analyses and NQO1 variants, thus providing insight on the effects in vitro and in cells of cancer-associated P187S, its suppressor mutation H80R and the role of NQO1 C-terminal domain to modulate binding cooperativity and energetics. Furthermore, we show that FAD binding to NQO1 is very sensitive to physiologically relevant environmental conditions, such as the presence of phosphate buffer and salts. Overall, our results contribute to understanding at the molecular level the link between NQO1 stability and fluctuations of FAD levels intracellularly, and supports the notion that FAD binding energetics and cooperativity are fundamentally linked with the dynamic nature of apo-NQO1 conformational ensemble. Copyright © 2017 Elsevier Inc. All rights reserved.

The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

PubMed

Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

2017-01-01

Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

Thermodynamic stability of carbonic anhydrase: measurements of binding affinity and stoichiometry using ThermoFluor.

PubMed

Matulis, Daumantas; Kranz, James K; Salemme, F Raymond; Todd, Matthew J

2005-04-05

ThermoFluor (a miniaturized high-throughput protein stability assay) was used to analyze the linkage between protein thermal stability and ligand binding. Equilibrium binding ligands increase protein thermal stability by an amount proportional to the concentration and affinity of the ligand. Binding constants (K(b)) were measured by examining the systematic effect of ligand concentration on protein stability. The precise ligand effects depend on the thermodynamics of protein stability: in particular, the unfolding enthalpy. An extension of current theoretical treatments was developed for tight binding inhibitors, where ligand effect on T(m) can also reveal binding stoichiometry. A thermodynamic analysis of carbonic anhydrase by differential scanning calorimetry (DSC) enabled a dissection of the Gibbs free energy of stability into enthalpic and entropic components. Under certain conditions, thermal stability increased by over 30 degrees C; the heat capacity of protein unfolding was estimated from the dependence of calorimetric enthalpy on T(m). The binding affinity of six sulfonamide inhibitors to two isozymes (human type 1 and bovine type 2) was analyzed by both ThermoFluor and isothermal titration calorimetry (ITC), resulting in a good correlation in the rank ordering of ligand affinity. This combined investigation by ThermoFluor, ITC, and DSC provides a detailed picture of the linkage between ligand binding and protein stability. The systematic effect of ligands on stability is shown to be a general tool to measure affinity.

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

PubMed

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

2014-08-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

PubMed Central

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix

2014-01-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

iAID: an improved auxin-inducible degron system for the construction of a 'tight' conditional mutant in the budding yeast Saccharomyces cerevisiae.

PubMed

Tanaka, Seiji; Miyazawa-Onami, Mayumi; Iida, Tetsushi; Araki, Hiroyuki

2015-08-01

Isolation of a 'tight' conditional mutant of a gene of interest is an effective way of studying the functions of essential genes. Strategies that use ubiquitin-mediated protein degradation to eliminate the product of a gene of interest, such as heat-inducible degron (td) and auxin-inducible degron (AID), are powerful methods for constructing conditional mutants. However, these methods do not work with some genes. Here, we describe an improved AID system (iAID) for isolating tight conditional mutants in the budding yeast Saccharomyces cerevisiae. In this method, transcriptional repression by the 'Tet-OFF' promoter is combined with proteolytic elimination of the target protein by the AID system. To provide examples, we describe the construction of tight mutants of the replication factors Dpb11 and Mcm10, dpb11-iAID, and mcm10-iAID. Because Dpb11 and Mcm10 are required for the initiation of DNA replication, their tight mutants are unable to enter S phase. This is the case for dpb11-iAID and mcm10-iAID cells after the addition of tetracycline and auxin. Both the 'Tet-OFF' promoter and the AID system have been shown to work in model eukaryotes other than budding yeast. Therefore, the iAID system is not only useful in budding yeast, but also can be applied to other model systems to isolate tight conditional mutants. Copyright © 2015 John Wiley & Sons, Ltd.

Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

PubMed Central

Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

1999-01-01

Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307

Interaction of nitric oxide with human heme oxygenase-1.

PubMed

Wang, Jinling; Lu, Shen; Moënne-Loccoz, Pierre; Ortiz de Montellano, Paul R

2003-01-24

NO and CO may complement each other as signaling molecules in some physiological situations. We have examined the binding of NO to human heme oxygenase-1 (hHO-1), an enzyme that oxidizes heme to biliverdin, CO, and free iron, to determine whether inhibition of hHO-1 by NO can contribute to the signaling interplay of NO and CO. An Fe(3+)-NO hHO-1-heme complex is formed with NO or the NO donors NOC9 or 2-(N,N-diethylamino)-diazenolate-2-oxide.sodium salt. Resonance Raman spectroscopy shows that ferric hHO-1-heme forms a 6-coordinated, low spin complex with NO. The nu(N-O) vibration of this complex detected by Fourier transform IR is only 4 cm(-1) lower than that of the corresponding metmyoglobin (met-Mb) complex but is broader, suggesting a greater degree of ligand conformational freedom. The Fe(3+)-NO complex of hHO-1 is much more stable than that of met-Mb. Stopped-flow studies indicate that k(on) for formation of the hHO-1-heme Fe(3+)-NO complex is approximately 50-times faster, and k(off) 10 times slower, than for met-Mb, resulting in K(d) = 1.4 microm for NO. NO thus binds 500-fold more tightly to ferric hHO-1-heme than to met-Mb. The hHO-1 mutations E29A, G139A, D140A, S142A, G143A, G143F, and K179A/R183A do not significantly diminish the tight binding of NO, indicating that NO binding is not highly sensitive to mutations of residues that normally stabilize the distal water ligand. As expected from the K(d) value, the enzyme is reversibly inhibited upon exposure to pathologically, and possibly physiologically, relevant concentrations of NO. Inhibition of hHO-1 by NO may contribute to the pleiotropic responses to NO and CO.

Mutation-linked, excessively tight interaction between the calmodulin binding domain and the C-terminal domain of the cardiac ryanodine receptor as a novel cause of catecholaminergic polymorphic ventricular tachycardia.

PubMed

Nishimura, Shigehiko; Yamamoto, Takeshi; Nakamura, Yoshihide; Kohno, Michiaki; Hamada, Yoriomi; Sufu, Yoko; Fukui, Go; Nanno, Takuma; Ishiguchi, Hironori; Kato, Takayoshi; Xu, Xiaojuan; Ono, Makoto; Oda, Tetsuro; Okuda, Shinichi; Kobayashi, Shigeki; Yano, Masafumi

2018-06-01

Ryanodine receptor (RyR2) is known to be a causal gene of catecholaminergic polymorphic ventricular tachycardia (CPVT), an important inherited disease. Some of the human CPVT-associated mutations have been found in a domain (4026-4172) that has EF hand motifs, the so-called calmodulin (CaM)-like domain (CaMLD). The purpose of this study was to investigate the underlying mechanism by which CPVT is induced by a mutation at CaMLD. A new N4103K/+ knock-in (KI) mice model was generated. Sustained ventricular tachycardia was frequently observed after infusion of caffeine plus epinephrine in KI mice. Endogenous CaM bound to RyR2 decreased even at baseline in isolated KI cardiomyocytes. Ca 2+ spark frequency (CaSpF) was much higher in KI cells than in wild-type cells. Addition of GSH-CaM (higher affinity CaM to RyR2) significantly decreased CaSpF. In response to isoproterenol, spontaneous Ca 2+ transient (SCaT) was frequently observed in intact KI cells. Incorporation of GSH-CaM into intact KI cells using a protein delivery kit decreased SCaT significantly. An assay using a quartz crystal microbalance technique revealed that mutated CaMLD peptide showed higher binding affinity to CaM binding domain (CaMBD) peptide. In the N4103K mutant, CaM binding affinity to RyR2 was significantly reduced regardless of beta-adrenergic stimulation. We found that this was caused by an abnormally tight interaction between CaMBD and mutated CaM-like domain (N4103K-CaMBD). Thus, CaMBD-CaMLD interaction may be a novel therapeutic target for treatment of lethal arrhythmia. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

The role of apical cell-cell junctions and associated cytoskeleton in mechanotransduction.

PubMed

Sluysmans, Sophie; Vasileva, Ekaterina; Spadaro, Domenica; Shah, Jimit; Rouaud, Florian; Citi, Sandra

2017-04-01

Tissues of multicellular organisms are characterised by several types of specialised cell-cell junctions. In vertebrate epithelia and endothelia, tight and adherens junctions (AJ) play critical roles in barrier and adhesion functions, and are connected to the actin and microtubule cytoskeletons. The interaction between junctions and the cytoskeleton is crucial for tissue development and physiology, and is involved in the molecular mechanisms governing cell shape, motility, growth and signalling. The machineries which functionally connect tight and AJ to the cytoskeleton comprise proteins which either bind directly to cytoskeletal filaments, or function as adaptors for regulators of the assembly and function of the cytoskeleton. In the last two decades, specific cytoskeleton-associated junctional molecules have been implicated in mechanotransduction, revealing the existence of multimolecular complexes that can sense mechanical cues and translate them into adaptation to tensile forces and biochemical signals. Here, we summarise the current knowledge about the machineries that link tight and AJ to actin filaments and microtubules, and the molecular basis for mechanotransduction at epithelial and endothelial AJ. © 2017 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.

Dynamics simulations for engineering macromolecular interactions

NASA Astrophysics Data System (ADS)

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.

Dynamics simulations for engineering macromolecular interactions.

PubMed

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20,000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.