Sample records for tight binding models

  1. Transferable tight-binding model for strained group IV and III-V materials and heterostructures

    NASA Astrophysics Data System (ADS)

    Tan, Yaohua; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

    2016-07-01

    It is critical to capture the effect due to strain and material interface for device level transistor modeling. We introduce a transferable s p3d5s* tight-binding model with nearest-neighbor interactions for arbitrarily strained group IV and III-V materials. The tight-binding model is parametrized with respect to hybrid functional (HSE06) calculations for varieties of strained systems. The tight-binding calculations of ultrasmall superlattices formed by group IV and group III-V materials show good agreement with the corresponding HSE06 calculations. The application of the tight-binding model to superlattices demonstrates that the transferable tight-binding model with nearest-neighbor interactions can be obtained for group IV and III-V materials.

  2. Dielectric response of molecules in empirical tight-binding theory

    NASA Astrophysics Data System (ADS)

    Boykin, Timothy B.; Vogl, P.

    2002-01-01

    In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.

  3. Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

    PubMed

    Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

    2015-06-09

    The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

  4. Schematic baryon models, their tight binding description and their microwave realization

    NASA Astrophysics Data System (ADS)

    Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

    2013-12-01

    A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.

  5. Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions

    NASA Astrophysics Data System (ADS)

    Zhang, Shu-Hui; Yang, Wen

    2018-01-01

    We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.

  6. Tight-Binding study of Boron structures

    NASA Astrophysics Data System (ADS)

    McGrady, Joseph W.; Papaconstantopoulos, Dimitrios A.; Mehl, Michael J.

    2014-10-01

    We have performed Linearized Augmented Plane Wave (LAPW) calculations for five crystal structures (alpha, dhcp, sc, fcc, bcc) of Boron which we then fitted to a non-orthogonal tight-binding model following the Naval Research Laboratory Tight-Binding (NRL-TB) method. The predictions of the NRL-TB approach for complicated Boron structures such as R105 (or β-rhombohedral) and T190 are in agreement with recent first-principles calculations. Fully utilizing the computational speed of the NRL-TB method we calculated the energy differences of various structures, including those containing vacancies using supercells with up to 5000 atoms.

  7. Tight-binding calculation of single-band and generalized Wannier functions of graphene

    NASA Astrophysics Data System (ADS)

    Ribeiro, Allan Victor; Bruno-Alfonso, Alexys

    Recent work has shown that a tight-binding approach associated with Wannier functions (WFs) provides an intuitive physical image of the electronic structure of graphene. Regarding the case of graphene, Marzari et al. displayed the calculated WFs and presented a comparison between the Wannier-interpolated bands and the bands generated by using the density-functional code. Jung and MacDonald provided a tight-binding model for the π-bands of graphene that involves maximally localized Wannier functions (MLWFs). The mixing of the bands yields better localized WFs. In the present work, the MLWFs of graphene are calculated by combining the Quantum-ESPRESSO code and tight-binding approach. The MLWFs of graphene are calculated from the Bloch functions obtained through a tight binding approach that includes interactions and overlapping obtained by partially fitting the DFT bands. The phase of the Bloch functions of each band is appropriately chosen to produce MLWFs. The same thing applies to the coefficients of their linear combination in the generalized case. The method allows for an intuitive understanding of the maximally localized WFs of graphene and shows excellent agreement with the literature. Moreover, it provides accurate results at reduced computational cost.

  8. Edge currents in frustrated Josephson junction ladders

    NASA Astrophysics Data System (ADS)

    Marques, A. M.; Santos, F. D. R.; Dias, R. G.

    2016-09-01

    We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.

  9. Accurate modeling of defects in graphene transport calculations

    NASA Astrophysics Data System (ADS)

    Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

    2018-01-01

    We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.

  10. A tight binding model study of tunneling conductance spectra of spin and orbitally ordered CMR manganites

    NASA Astrophysics Data System (ADS)

    Panda, Saswati; Sahoo, D. D.; Rout, G. C.

    2018-04-01

    We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.

  11. Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

    NASA Astrophysics Data System (ADS)

    Shen, Ka

    2018-04-01

    We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.

  12. The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

    NASA Astrophysics Data System (ADS)

    Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

    2017-05-01

    We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.

  13. Tight-binding model for borophene and borophane

    NASA Astrophysics Data System (ADS)

    Nakhaee, M.; Ketabi, S. A.; Peeters, F. M.

    2018-03-01

    Starting from the simplified linear combination of atomic orbitals method in combination with first-principles calculations, we construct a tight-binding (TB) model in the two-centre approximation for borophene and hydrogenated borophene (borophane). The Slater and Koster approach is applied to calculate the TB Hamiltonian of these systems. We obtain expressions for the Hamiltonian and overlap matrix elements between different orbitals for the different atoms and present the SK coefficients in a nonorthogonal basis set. An anisotropic Dirac cone is found in the band structure of borophane. We derive a Dirac low-energy Hamiltonian and compare the Fermi velocities with that of graphene.

  14. Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

    NASA Astrophysics Data System (ADS)

    Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

    2013-07-01

    We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.

  15. A Model for Predicting Thermoelectric Properties of Bi2Te3

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; VonAllmen, Paul

    2009-01-01

    A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.

  16. Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

    NASA Astrophysics Data System (ADS)

    Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

    2018-04-01

    Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

  17. Tight-binding modeling and low-energy behavior of the semi-Dirac point.

    PubMed

    Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E

    2009-07-03

    We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.

  18. Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films

    NASA Astrophysics Data System (ADS)

    Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.

    2018-04-01

    We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.

  19. The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

    NASA Astrophysics Data System (ADS)

    Kar, J. K.; Panda, Saswati; Rout, G. C.

    2017-05-01

    We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

  20. The tightly bound nuclei in the liquid drop model

    NASA Astrophysics Data System (ADS)

    Sree Harsha, N. R.

    2018-05-01

    In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.

  1. Pseudo-magnetic fields of strongly-curved graphene nanobubbles

    NASA Astrophysics Data System (ADS)

    Liu, Li-Chi

    2018-04-01

    We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.

  2. Dpb11 may function with RPA and DNA to initiate DNA replication.

    PubMed

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

  3. Bak Conformational Changes Induced by Ligand Binding: Insight into BH3 Domain Binding and Bak Homo-Oligomerization

    PubMed Central

    Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.

    2012-01-01

    Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769

  4. Dpb11 may function with RPA and DNA to initiate DNA replication

    PubMed Central

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

  5. Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

    NASA Astrophysics Data System (ADS)

    Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

    2018-01-01

    The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

  6. Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

    NASA Astrophysics Data System (ADS)

    You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

    2012-04-01

    We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

  7. Universal tight binding model for chemical reactions in solution and at surfaces. II. Water.

    PubMed

    Lozovoi, A Y; Sheppard, T J; Pashov, D L; Kohanoff, J J; Paxton, A T

    2014-07-28

    A revised water model intended for use in condensed phase simulations in the framework of the self consistent polarizable ion tight binding theory is constructed. The model is applied to water monomer, dimer, hexamers, ice, and liquid, where it demonstrates good agreement with theoretical results obtained by more accurate methods, such as DFT and CCSD(T), and with experiment. In particular, the temperature dependence of the self diffusion coefficient in liquid water predicted by the model, closely reproduces experimental curves in the temperature interval between 230 K and 350 K. In addition, and in contrast to standard DFT, the model properly orders the relative densities of liquid water and ice. A notable, but inevitable, shortcoming of the model is underestimation of the static dielectric constant by a factor of two. We demonstrate that the description of inter and intramolecular forces embodied in the tight binding approximation in quantum mechanics leads to a number of valuable insights which can be missing from ab initio quantum chemistry and classical force fields. These include a discussion of the origin of the enhanced molecular electric dipole moment in the condensed phases, and a detailed explanation for the increase of coordination number in liquid water as a function of temperature and compared with ice--leading to insights into the anomalous expansion on freezing. The theory holds out the prospect of an understanding of the currently unexplained density maximum of water near the freezing point.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, J.R.; Lu, Z.; Ring, D.M.

    We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

  9. Tight binding simulation study on zigzag single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

    2018-01-01

    Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.

  10. Tight-Binding Study of Polarons in Two-Dimensional Systems: Implications for Organic Field-Effect Transistor Materials

    NASA Astrophysics Data System (ADS)

    Lei, Jie

    2011-03-01

    In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.

  11. Rapid calculation method for Frenkel-type two-exciton states in one to three dimensions

    NASA Astrophysics Data System (ADS)

    Ajiki, Hiroshi

    2014-07-01

    Biexciton and two-exciton dissociated states of Frenkel-type excitons are well described by a tight-binding model with a nearest-neighbor approximation. Such two-exciton states in a finite-size lattice are usually calculated by numerical diagonalization of the Hamiltonian, which requires an increasing amount of computational time and memory as the lattice size increases. I develop here a rapid, memory-saving method to calculate the energies and wave functions of two-exciton states by employing a bisection method. In addition, an attractive interaction between two excitons in the tight-binding model can be obtained directly so that the biexciton energy agrees with the observed energy, without the need for the trial-and-error procedure implemented in the numerical diagonalization method.

  12. Gaussian polarizable-ion tight binding.

    PubMed

    Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

    2016-10-14

    To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

  13. Gaussian polarizable-ion tight binding

    NASA Astrophysics Data System (ADS)

    Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

    2016-10-01

    To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

  14. Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

    PubMed

    Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

    2018-05-08

    Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  15. Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

    PubMed Central

    Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

    2017-01-01

    Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

  16. Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

    NASA Astrophysics Data System (ADS)

    Venkataraman, Vijay Shankar

    The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.

  17. Excitons in boron nitride single layer

    NASA Astrophysics Data System (ADS)

    Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François

    2016-09-01

    Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.

  18. Generalized virial theorem for massless electrons in graphene and other Dirac materials

    NASA Astrophysics Data System (ADS)

    Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

    2016-05-01

    The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.

  19. Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

    NASA Astrophysics Data System (ADS)

    Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

    2017-03-01

    Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.

  20. Modeling Magnetic Properties in EZTB

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; vonAllmen, Paul

    2007-01-01

    A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.

  1. Microscopic theory of the superconducting gap in the quasi-one-dimensional organic conductor (TMTSF) 2ClO4 : Model derivation and two-particle self-consistent analysis

    NASA Astrophysics Data System (ADS)

    Aizawa, Hirohito; Kuroki, Kazuhiko

    2018-03-01

    We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.

  2. FAST TRACK COMMUNICATION: Finite-temperature magnetism in bcc Fe under compression

    NASA Astrophysics Data System (ADS)

    Sha, Xianwei; Cohen, R. E.

    2010-09-01

    We investigate the contributions of finite-temperature magnetic fluctuations to the thermodynamic properties of bcc Fe as functions of pressure. First, we apply a tight-binding total-energy model parameterized to first-principles linearized augmented plane-wave computations to examine various ferromagnetic, anti-ferromagnetic, and noncollinear spin spiral states at zero temperature. The tight-binding data are fit to a generalized Heisenberg Hamiltonian to describe the magnetic energy functional based on local moments. We then use Monte Carlo simulations to compute the magnetic susceptibility, the Curie temperature, heat capacity, and magnetic free energy. Including the finite-temperature magnetism improves the agreement with experiment for the calculated thermal expansion coefficients.

  3. Microwave emulations and tight-binding calculations of transport in polyacetylene

    NASA Astrophysics Data System (ADS)

    Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

    2017-01-01

    A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.

  4. The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

    PubMed Central

    Balda, Maria S.; Matter, Karl

    2000-01-01

    Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

  5. Transferable tight binding model for strained group IV and III-V heterostructures

    NASA Astrophysics Data System (ADS)

    Tan, Yaohua; Povolotskyi, Micheal; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

    Modern semiconductor devices have reached critical device dimensions in the range of several nanometers. For reliable prediction of device performance, it is critical to have a numerical efficient model that are transferable to material interfaces. In this work, we present an empirical tight binding (ETB) model with transferable parameters for strained IV and III-V group semiconductors. The ETB model is numerically highly efficient as it make use of an orthogonal sp3d5s* basis set with nearest neighbor inter-atomic interactions. The ETB parameters are generated from HSE06 hybrid functional calculations. Band structures of strained group IV and III-V materials by ETB model are in good agreement with corresponding HSE06 calculations. Furthermore, the ETB model is applied to strained superlattices which consist of group IV and III-V elements. The ETB model turns out to be transferable to nano-scale hetero-structure. The ETB band structures agree with the corresponding HSE06 results in the whole Brillouin zone. The ETB band gaps of superlattices with common cations or common anions have discrepancies within 0.05eV.

  6. Development of tight-binding based GW algorithm and its computational implementation for graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source

    Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less

  7. Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

    2010-01-01

    Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less

  8. Exact evaluation of the causal spectrum and localization properties of electronic states on a scale-free network

    NASA Astrophysics Data System (ADS)

    Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.

    2018-07-01

    A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.

  9. Density functional tight-binding and infrequent metadynamics can capture entropic effects in intramolecular hydrogen transfer reactions

    NASA Astrophysics Data System (ADS)

    Oliveira, Luiz F. L.; Fu, Christopher D.; Pfaendtner, Jim

    2018-04-01

    Infrequent metadynamics uses biased simulations to estimate the unbiased kinetics of a system, facilitating the calculation of rates and barriers. Here the method is applied to study intramolecular hydrogen transfer reactions involving peroxy radicals, a class of reactions that is challenging to model due to the entropic contributions of the formation of ring structures in the transition state. Using the self-consistent charge density-functional based tight-binding (DFTB) method, we applied infrequent metadynamics to the study of four intramolecular H-transfer reactions, demonstrating that the method can qualitatively reproduce these high entropic contributions, as observed in experiments and those predicted by transition state theory modeled by higher levels of theory. We also show that infrequent metadynamics and DFTB are successful in describing the relationship between transition state ring size and kinetic coefficients (e.g., activation energies and the pre-exponential factors).

  10. An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. II. Application—Effect of quantum confinement and homogeneous strain on Cu conductance

    NASA Astrophysics Data System (ADS)

    Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard

    2014-03-01

    The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.

  11. Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

    2016-10-15

    Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.

  12. Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

    PubMed Central

    Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

    2001-01-01

    The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

  13. Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. IV. Performance of many-body force fields and tight-binding schemes for the fluid phases of silicon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Desgranges, Caroline; Delhommelle, Jerome

    We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less

  14. HIV-1 gp120 Glycoprotein Interacting with Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Non-integrin (DC-SIGN) Down-Regulates Tight Junction Proteins to Disrupt the Blood Retinal Barrier and Increase Its Permeability.

    PubMed

    Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang

    2016-10-28

    Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

    NASA Astrophysics Data System (ADS)

    Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

    2018-02-01

    We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.

  16. Tight-Binding Description of Impurity States in Semiconductors

    ERIC Educational Resources Information Center

    Dominguez-Adame, F.

    2012-01-01

    Introductory textbooks in solid state physics usually present the hydrogenic impurity model to calculate the energy of carriers bound to donors or acceptors in semiconductors. This model treats the pure semiconductor as a homogeneous medium and the impurity is represented as a fixed point charge. This approach is only valid for shallow impurities…

  17. Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.

    PubMed

    Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E

    2018-05-08

    We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.

  18. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.

    PubMed

    Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas

    2015-07-14

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.

  19. Intermediate band formation in a δ-doped like QW superlattices of GaAs/AlxGa1-xAs for solar cell design

    NASA Astrophysics Data System (ADS)

    Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.

    2018-03-01

    It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.

  20. An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

    NASA Astrophysics Data System (ADS)

    Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

    2014-03-01

    Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

  1. Conformation-controlled binding kinetics of antibodies

    NASA Astrophysics Data System (ADS)

    Galanti, Marta; Fanelli, Duccio; Piazza, Francesco

    2016-01-01

    Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.

  2. Tight-binding calculation studies of vacancy and adatom defects in graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing

    2016-02-19

    Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less

  3. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

  4. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

    DOE PAGES

    Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

    2015-06-26

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramírez-Morales, A.; Martínez-Orozco, J. C.; Rodríguez-Vargas, I.

    The main characteristics of the quantum confined Stark effect (QCSE) are studied theoretically in quantum wells of Gaussian profile. The semi-empirical tight-binding model and the Green function formalism are applied in the numerical calculations. A comparison of the QCSE in quantum wells with different kinds of confining potential is presented.

  6. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  7. Tight-binding model for materials at mesoscale

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei

    2016-12-21

    TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less

  8. Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference

    NASA Astrophysics Data System (ADS)

    Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.

    2018-02-01

    Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.

  9. Model many-body Stoner Hamiltonian for binary FeCr alloys

    NASA Astrophysics Data System (ADS)

    Nguyen-Manh, D.; Dudarev, S. L.

    2009-09-01

    We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.

  10. Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

    NASA Astrophysics Data System (ADS)

    Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

    2018-02-01

    Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.

  11. How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

    PubMed Central

    1988-01-01

    We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

  12. Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

    New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

  13. Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

    DOE PAGES

    Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

    2017-10-17

    New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

  14. The role of enzyme and substrate concentration in the evaluation of serum angiotensin converting enzyme (ACE) inhibition by enalaprilat in vitro.

    PubMed

    Weisser, K; Schloos, J

    1991-10-09

    The relationship between serum angiotensin converting enzyme (ACE) activity and concentration of the ACE inhibitor enalaprilat was determined in vitro in the presence of different concentrations (S = 4-200 mM) of the substrate Hip-Gly-Gly. From Henderson plots, a competitive tight-binding relationship between enalaprilat and serum ACE was found yielding a value of approximately 5 nM for serum ACE concentration (Et) and an inhibition constant (Ki) for enalaprilat of approximately 0.1 nM. A plot of reaction velocity (Vi) versus total inhibitor concentration (It) exhibited a non-parallel shift of the inhibition curve to the right with increasing S. This was reflected by apparent Hill coefficients greater than 1 when the commonly used inhibitory sigmoid concentration-effect model (Emax model) was applied to the data. Slopes greater than 1 were obviously due to discrepancies between the free inhibitor concentration (If) present in the assay and It plotted on the abscissa and could, therefore, be indicators of tight-binding conditions. Thus, the sigmoid Emax model leads to an overestimation of Ki. Therefore, a modification of the inhibitory sigmoid Emax model (called "Emax tight model") was applied, which accounts for the depletion of If by binding, refers to It and allows estimation of the parameters Et and IC50f (free concentration of inhibitor when 50% inhibition occurs) using non-linear regression analysis. This model could describe the non-symmetrical shape of the inhibition curves and the results for Ki and Et correlated very well with those derived from the Henderson plots. The latter findings confirm that the degree of ACE inhibition measured in vitro is, in fact, dependent on the concentration of substrate and enzyme present in the assay. This is of importance not only for the correct evaluation of Ki but also for the interpretation of the time course of serum ACE inhibition measured ex vivo. The non-linear model has some advantages over the linear Henderson equation: it is directly applicable without conversion of the data and avoids the stochastic dependency of the variables, allowing non-linear regression of all data points contributing with the same weight.

  15. Mechanistic Basis Of Calmodulin Mediated Estrogen Receptor Alpha Activation and Antiestrogen Resistance

    DTIC Science & Technology

    2010-06-01

    for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic

  16. The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

    PubMed

    Tsapara, Anna; Matter, Karl; Balda, Maria S

    2006-03-01

    The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

  17. The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

    PubMed Central

    Tsapara, Anna; Matter, Karl; Balda, Maria S.

    2006-01-01

    The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

  18. Majorana-Hubbard model on the square lattice

    NASA Astrophysics Data System (ADS)

    Affleck, Ian; Rahmani, Armin; Pikulin, Dmitry

    2017-09-01

    We study a tight-binding model of interacting Majorana (Hermitian) modes on a square lattice. The model may have an experimental realization in a superconducting-film-topological-insulator heterostructure in a magnetic field. We find a rich phase diagram, as a function of interaction strength, including an emergent superfluid phase with spontaneous breaking of an emergent U (1 ) symmetry, separated by a supersymmetric transition from a gapless normal phase.

  19. Magnetic quantization in monolayer bismuthene

    NASA Astrophysics Data System (ADS)

    Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa

    The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.

  20. Chirality dependence of dipole matrix element of carbon nanotubes in axial magnetic field: A third neighbor tight binding approach

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2014-02-01

    We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.

  1. Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

    PubMed

    Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

    2016-03-14

    Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

  2. Total-energy Assisted Tight-binding Method Based on Local Density Approximation of Density Functional Theory

    NASA Astrophysics Data System (ADS)

    Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki

    2018-06-01

    A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.

  3. DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

    NASA Astrophysics Data System (ADS)

    Humeniuk, Alexander; Mitrić, Roland

    2017-12-01

    A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.

  4. Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

    NASA Astrophysics Data System (ADS)

    Leleyter, M.; Olivi-Tran, N.

    2008-12-01

    We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.

  5. A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.

    PubMed

    Quan, Yundi; Pickett, Warren E

    2018-02-21

    Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

  6. A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point

    NASA Astrophysics Data System (ADS)

    Quan, Yundi; Pickett, Warren E.

    2018-02-01

    Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

  7. Combined first-principles and model Hamiltonian study of the perovskite series R MnO 3 (R =La ,Pr ,Nd ,Sm ,Eu , and Gd )

    NASA Astrophysics Data System (ADS)

    Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare

    2016-02-01

    We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.

  8. Electric-field-induced plasmon in AA-stacked bilayer graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chuang, Y.C., E-mail: yingchih.chuang@gmail.com; Wu, J.Y., E-mail: yarst5@gmail.com; Lin, M.F., E-mail: mflin@mail.ncku.edu.tw

    2013-12-15

    The collective excitations in AA-stacked bilayer graphene for a perpendicular electric field are investigated analytically within the tight-binding model and the random-phase approximation. Such a field destroys the uniform probability distribution of the four sublattices. This drives a symmetry breaking between the intralayer and interlayer polarization intensities from the intrapair band excitations. A field-induced acoustic plasmon thus emerges in addition to the strongly field-tunable intrinsic acoustic and optical plasmons. At long wavelengths, the three modes show different dispersions and field dependence. The definite physical mechanism of the electrically inducible and tunable mode can be expected to also be present inmore » other AA-stacked few-layer graphenes. -- Highlights: •The analytical derivations are performed by the tight-binding model. •An electric field drives the non-uniformity of the charge distribution. •A symmetry breaking between the intralayer and interlayer polarizations is illustrated. •An extra plasmon emerges besides two intrinsic modes in AA-stacked bilayer graphene. •The mechanism of a field-induced mode is present in AA-stacked few-layer graphenes.« less

  9. Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

    NASA Astrophysics Data System (ADS)

    Henke, Paul S.; Mak, Chi H.

    2014-08-01

    The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

  10. Spin textures on general surfaces of the correlated topological insulator SmB6

    NASA Astrophysics Data System (ADS)

    Baruselli, Pier Paolo; Vojta, Matthias

    2016-05-01

    Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.

  11. Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

    PubMed

    Henke, Paul S; Mak, Chi H

    2014-08-14

    The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

  12. Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution

    NASA Astrophysics Data System (ADS)

    Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

    2015-08-01

    Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.

  13. Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

    NASA Astrophysics Data System (ADS)

    Turek, I.; Kudrnovský, J.; Drchal, V.

    2015-12-01

    We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

  14. Electronic Structure and Properties of Deformed Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Yang, Liu; Arnold, Jim (Technical Monitor)

    2001-01-01

    A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.

  15. Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

    NASA Astrophysics Data System (ADS)

    Jahangiri, Soran; Mosey, Nicholas J.

    2018-01-01

    Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

  16. Nuclear magnetic resonance and restrained molecular dynamics studies of the interaction of an epidermal growth factor-derived peptide with protein tyrosine phosphatase 1B.

    PubMed

    Glover, N R; Tracey, A S

    1999-04-20

    The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.

  17. Time-efficient simulations of tight-binding electronic structures with Intel Xeon PhiTM many-core processors

    NASA Astrophysics Data System (ADS)

    Ryu, Hoon; Jeong, Yosang; Kang, Ji-Hoon; Cho, Kyu Nam

    2016-12-01

    Modelling of multi-million atomic semiconductor structures is important as it not only predicts properties of physically realizable novel materials, but can accelerate advanced device designs. This work elaborates a new Technology-Computer-Aided-Design (TCAD) tool for nanoelectronics modelling, which uses a sp3d5s∗ tight-binding approach to describe multi-million atomic structures, and simulate electronic structures with high performance computing (HPC), including atomic effects such as alloy and dopant disorders. Being named as Quantum simulation tool for Advanced Nanoscale Devices (Q-AND), the tool shows nice scalability on traditional multi-core HPC clusters implying the strong capability of large-scale electronic structure simulations, particularly with remarkable performance enhancement on latest clusters of Intel Xeon PhiTM coprocessors. A review of the recent modelling study conducted to understand an experimental work of highly phosphorus-doped silicon nanowires, is presented to demonstrate the utility of Q-AND. Having been developed via Intel Parallel Computing Center project, Q-AND will be open to public to establish a sound framework of nanoelectronics modelling with advanced HPC clusters of a many-core base. With details of the development methodology and exemplary study of dopant electronics, this work will present a practical guideline for TCAD development to researchers in the field of computational nanoelectronics.

  18. Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

    PubMed

    Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

    2017-09-30

    Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  19. Physical and metabolic requirements for early interaction of poliovirus and human rhinovirus with HeLa cells.

    PubMed Central

    Lonberg-Holm, K; Whiteley, N M

    1976-01-01

    Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, J.R.; Lu, Z.Y.; Xiang, J.B.

    We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.

  1. Ti(IV) and the Siderophore Desferrioxamine B: A Tight Complex Has Biological and Environmental Implications.

    PubMed

    Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M

    2017-02-06

    The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.

  2. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    PubMed

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Dirac fermions and pseudomagnetic fields in two-dimensional electron gases with triangular antidot lattices

    NASA Astrophysics Data System (ADS)

    Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai

    2017-07-01

    We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.

  4. Quantitative analysis on electric dipole energy in Rashba band splitting.

    PubMed

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-09-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

  5. Quantitative analysis on electric dipole energy in Rashba band splitting

    PubMed Central

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-01-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493

  6. Structure and Stability of Molecular Crystals with Many-Body Dispersion-Inclusive Density Functional Tight Binding.

    PubMed

    Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre

    2018-01-18

    Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.

  7. The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

    PubMed

    Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

    2018-03-05

    During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.

  8. Magnetic susceptibilities of actinide 3d-metal intermetallic compounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.

    1988-04-15

    We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.

  9. Crumbs3 Is Essential for Proper Epithelial Development and Viability

    PubMed Central

    Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.

    2014-01-01

    First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893

  10. Efficient self-consistency for magnetic tight binding

    NASA Astrophysics Data System (ADS)

    Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.

    2011-06-01

    Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.

  11. Dirac topological insulator in the dz2 manifold of a honeycomb oxide

    NASA Astrophysics Data System (ADS)

    Lado, J. L.; Pardo, V.

    2016-09-01

    We show by means of ab initio calculations and tight-binding modeling that an oxide system based on a honeycomb lattice can sustain topologically nontrivial states if a single orbital dominates the spectrum close to the Fermi level. In such a situation, the low-energy spectrum is described by two Dirac equations that become nontrivially gapped when spin-orbit coupling (SOC) is switched on. We provide one specific example but the recipe is general. We discuss a realization of this starting from a conventional spin-1/2 honeycomb antiferromagnet whose states close to the Fermi energy are dz2 orbitals. Switching off magnetism by atomic substitution and ensuring that the electronic structure becomes two-dimensional is sufficient for topologicality to arise in such a system. By deriving a tight-binding Wannier Hamiltonian, we find that the gap in such a model scales linearly with SOC, opposed to other oxide-based topological insulators, where smaller gaps tend to appear by construction of the lattice. We show that the quantum spin Hall state in this system survives in the presence of off-plane magnetism and the orbital magnetic field and we discuss its Landau level spectra, showing that our recipe provides a dz2 realization of the Kane-Mele model.

  12. Mobile spin impurity in an optical lattice

    NASA Astrophysics Data System (ADS)

    Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.

    2017-07-01

    We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.

  13. Phononic crystals of spherical particles: A tight binding approach

    NASA Astrophysics Data System (ADS)

    Mattarelli, M.; Secchi, M.; Montagna, M.

    2013-11-01

    The vibrational dynamics of a fcc phononic crystal of spheres is studied and compared with that of a single free sphere, modelled either by a continuous homogeneous medium or by a finite cluster of atoms. For weak interaction among the spheres, the vibrational dynamics of the phononic crystal is described by shallow bands, with low degree of dispersion, corresponding to the acoustic spheroidal and torsional modes of the single sphere. The phonon displacements are therefore related to the vibrations of a sphere, as the electron wave functions in a crystal are related to the atomic wave functions in a tight binding model. Important dispersion is found for the two lowest phonon bands, which correspond to zero frequency free translation and rotation of a free sphere. Brillouin scattering spectra are calculated at some values of the exchanged wavevectors of the light, and compared with those of a single sphere. With weak interaction between particles, given the high acoustic impedance mismatch in dry systems, the density of phonon states consist of sharp bands separated by large gaps, which can be well accounted for by a single particle model. Based on the width of the frequency gaps, tunable with the particle size, and on the small number of dispersive acoustic phonons, such systems may provide excellent materials for application as sound or heat filters.

  14. Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

    NASA Astrophysics Data System (ADS)

    Menezes, Marcos; Capaz, Rodrigo

    Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, J.R.; Lu, Z.Y.; Ring, D.M.

    The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.

  16. A general intermolecular force field based on tight-binding quantum chemical calculations

    NASA Astrophysics Data System (ADS)

    Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

    2017-10-01

    A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

  17. Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

    PubMed Central

    Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

    2009-01-01

    8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165

  18. Analytic second derivative of the energy for density-functional tight-binding combined with the fragment molecular orbital method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.

    2016-07-28

    The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.

  19. The Mismetallation of Enzymes during Oxidative Stress*

    PubMed Central

    Imlay, James A.

    2014-01-01

    Mononuclear iron enzymes can tightly bind non-activating metals. How do cells avoid mismetallation? The model bacterium Escherichia coli may control its metal pools so that thermodynamics favor the correct metallation of each enzyme. This system is disrupted, however, by superoxide and hydrogen peroxide. These species oxidize ferrous iron and thereby displace it from many iron-dependent mononuclear enzymes. Ultimately, zinc binds in its place, confers little activity, and imposes metabolic bottlenecks. Data suggest that E. coli compensates by using thiols to extract the zinc and by importing manganese to replace the catalytic iron atom. Manganese resists oxidants and provides substantial activity. PMID:25160623

  20. Tight-binding calculation of radiation loss in photonic crystal CROW.

    PubMed

    Ma, Jing; Martínez, Luis Javier; Fan, Shanhui; Povinelli, Michelle L

    2013-01-28

    The tight binding approximation (TBA) is used to relate the intrinsic, radiation loss of a coupled resonator optical waveguide (CROW) to that of a single constituent resonator within a light cone picture. We verify the validity of the TBA via direct, full-field simulation of CROWs based on the L2 photonic crystal cavity. The TBA predicts that the quality factor of the CROW increases with that of the isolated cavity. Moreover, our results provide a method to design CROWs with low intrinsic loss across the entire waveguide band.

  1. OLIFE: Tight Binding Code for Transmission Coefficient Calculation

    NASA Astrophysics Data System (ADS)

    Mijbil, Zainelabideen Yousif

    2018-05-01

    A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.

  2. Electronic Structure of Alpha-Quartz and the Influence of Some Local Disorder: A Tight Binding Study,

    DTIC Science & Technology

    1977-01-01

    An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater

  3. Electrostatic Interactions in the Binding Pathway of a Transient Protein Complex Studied by NMR and Isothermal Titration Calorimetry*

    PubMed Central

    Meneses, Erick; Mittermaier, Anthony

    2014-01-01

    Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758

  4. Dual binding in cohesin-dockerin complexes: the energy landscape and the role of short, terminal segments of the dockerin module.

    PubMed

    Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek

    2018-03-22

    The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.

  5. Membrane Association of the PTEN Tumor Suppressor: Electrostatic Interaction with Phos-phatidylserine-Containing Bilayers and Regulatory Role of the C-Terminal Tail

    PubMed Central

    Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias

    2012-01-01

    The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177

  6. Membrane association of the PTEN tumor suppressor: electrostatic interaction with phosphatidylserine-containing bilayers and regulatory role of the C-terminal tail.

    PubMed

    Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias

    2012-12-01

    The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Quantum simulation of disordered systems with cold atoms

    NASA Astrophysics Data System (ADS)

    Garreau, Jean-Claude

    2017-01-01

    This paper reviews the physics of quantum disorder in relation with a series of experiments using laser-cooled atoms exposed to "kicks" of a standing wave, realizing a paradigmatic model of quantum chaos, the kicked rotor. This dynamical system can be mapped onto a tight-binding Hamiltonian with pseudo-disorder, formally equivalent to the Anderson model of quantum disorder, with quantum chaos playing the role of disorder. This provides a very good quantum simulator for the Anderson physics. xml:lang="fr"

  8. Model of gas adsorption on magnetic surfaces

    NASA Astrophysics Data System (ADS)

    Pick, S.˛te˛´n.; D´, Hugues

    1997-12-01

    The semi-empirical self-consistent tight-binding model of gas (C, N, O) chemisorption is suggested to study its influence on surface magnetism. For the strongly ferromagnetic Fe(001), we find that the adsorbates are not effective in magnetism reduction. For the hypothetical magnetic V(001) surface, the magnetization is very sensitive to the vanadium d-band occupation used in the calculation. Supposing that the magnetization is weak, it can be essentially suppressed by the gas contamination. The effect is explained by the Stoner criterion.

  9. Correspondence between a shaken honeycomb lattice and the Haldane model

    NASA Astrophysics Data System (ADS)

    Modugno, Michele; Pettini, Giulio

    2017-11-01

    We investigate the correspondence between the tight-binding Floquet Hamiltonian of a periodically modulated honeycomb lattice and the Haldane model. We show that—though the two systems share the same topological phase diagram, as reported in a breakthrough experiment with ultracold atoms in a stretched honeycomb lattice [G. Jotzu et al., Nature (London) 515, 237 (2014), 10.1038/nature13915]—the corresponding Hamiltonians are not equivalent, the one of the shaken lattice presenting a much richer structure.

  10. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  11. Tight-binding tunneling amplitude of an optical lattice

    NASA Astrophysics Data System (ADS)

    Arzamasovs, Maksims; Liu, Bo

    2017-11-01

    The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.

  12. Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.

    PubMed

    Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto

    2018-04-11

    We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.

  13. Landau level splitting due to graphene superlattices

    NASA Astrophysics Data System (ADS)

    Pal, G.; Apel, W.; Schweitzer, L.

    2012-06-01

    The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.

  14. Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene

    NASA Astrophysics Data System (ADS)

    Reijnders, K. J. A.; Katsnelson, M. I.

    2017-07-01

    We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.

  15. Topological states in a two-dimensional metal alloy in Si surface: BiAg/Si(111)-4 ×4 surface

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoming; Cui, Bin; Zhao, Mingwen; Liu, Feng

    2018-02-01

    A bridging topological state with a conventional semiconductor platform offers an attractive route towards future spintronics and quantum device applications. Here, based on first-principles and tight-binding calculations, we demonstrate the existence of topological states hosted by a two-dimensional (2D) metal alloy in a Si surface, the BiAg/Si(111)-4 ×4 surface, which has already been synthesized experimentally. It exhibits a topological insulating state with an energy gap of 71 meV (˜819 K ) above the Fermi level and a topological metallic state with quasiquantized conductance below the Fermi level. The underlying mechanism leading to the formation of such nontrivial states is revealed by analysis of the "charge-transfer" and "orbital-filtering" effect of the Si substrate. A minimal effective tight-binding model is employed to reveal the formation mechanism of the topological states. Our finding opens opportunities to detect topological states and measure its quantized conductance in a large family of 2D surface metal alloys, which have been or are to be grown on semiconductor substrates.

  16. Band gap engineering in finite elongated graphene nanoribbon heterojunctions: Tight-binding model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tayo, Benjamin O.

    2015-08-15

    A simple model based on the divide and conquer rule and tight-binding (TB) approximation is employed for studying the role of finite size effect on the electronic properties of elongated graphene nanoribbon (GNR) heterojunctions. In our model, the GNR heterojunction is divided into three parts: a left (L) part, middle (M) part, and right (R) part. The left part is a GNR of width W{sub L}, the middle part is a GNR of width W{sub M}, and the right part is a GNR of width W{sub R}. We assume that the left and right parts of the GNR heterojunction interactmore » with the middle part only. Under this approximation, the Hamiltonian of the system can be expressed as a block tridiagonal matrix. The matrix elements of the tridiagonal matrix are computed using real space nearest neighbor orthogonal TB approximation. The electronic structure of the GNR heterojunction is analyzed by computing the density of states. We demonstrate that for heterojunctions for which W{sub L} = W{sub R}, the band gap of the system can be tuned continuously by varying the length of the middle part, thus providing a new approach to band gap engineering in GNRs. Our TB results were compared with calculations employing divide and conquer rule in combination with density functional theory (DFT) and were found to agree nicely.« less

  17. First-principles simulation and low-energy effective modeling of three-dimensional skyrmion in MnGe

    NASA Astrophysics Data System (ADS)

    Choi, Hongchul; Tai, Yuan-Yen; Zhu, Jian-Xin; T-4 Team

    The skyrmion spin textures are mostly observed in two-dimensional (2D) space, which can be topologically mapped onto the surface of the sphere with an integer multiple of topological winding number. Recently, MnGe has been reported as a candidate of 3D skyrmion crystal, showing the variation of the skyrmion size along the z-direction. We have performed the first-principles simulation and constructed a tight-binding model with calculated electronic-structure information to investigate the 3D skyrmion phase in MnGe. Our first-principles study within density functional theory shows that the calculated magnetic moment is larger than that for MnSi (with different lattice constant), implying the possibility of a multiple magnetic transition under pressure. We have also found that the small-sized skyrmion could be stabilized in a 2D structure. Such a high density of the skyrmion is in good agreement with the experimental finding of large topological Hall effect. Finally, we will extend our study to consider the 3D skyrmion structure based on the constructed tight-binding model. This work was carried out under the auspices of the National Nuclear Security Administration of the U.S. Department of Energy at Los Alamos National Laboratory (LANL) under Contract No. DE-AC52-06NA25396, and was supported by the LANL LDRD Program.

  18. A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus

    USDA-ARS?s Scientific Manuscript database

    The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...

  19. Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

    PubMed Central

    2011-01-01

    Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588

  20. First Experimental Realization of the Dirac Oscillator

    NASA Astrophysics Data System (ADS)

    Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

    2013-10-01

    We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.

  1. DFTB+ and lanthanides

    NASA Astrophysics Data System (ADS)

    Hourahine, B.; Aradi, B.; Frauenheim, T.

    2010-07-01

    DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

  2. Objective Molecular Dynamics with Self-consistent Charge Density Functional Tight-Binding (SCC-DFTB) Method

    NASA Astrophysics Data System (ADS)

    Dumitrica, Traian; Hourahine, Ben; Aradi, Balint; Frauenheim, Thomas

    We discus the coupling of the objective boundary conditions into the SCC density functional-based tight binding code DFTB+. The implementation is enabled by a generalization to the helical case of the classical Ewald method, specifically by Ewald-like formulas that do not rely on a unit cell with translational symmetry. The robustness of the method in addressing complex hetero-nuclear nano- and bio-fibrous systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal double-strand DNA. Work supported by NSF CMMI 1332228.

  3. Scattering matrix of arbitrary tight-binding Hamiltonians

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.

    2017-03-15

    A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.

  4. Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

    PubMed Central

    Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

    2008-01-01

    Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

  5. Carbon Nanotube Field Emission Arrays

    DTIC Science & Technology

    2011-06-01

    K , and M [14]. Using the tight binding energy model, the energy dispersion relations for graphene can be calculated for the triangle formed from...The corresponding reciprocal lattice vectors, b1 and b2, and Brillouin zone of graphene [14]. 19 graphene band structure is the six K ...points where the two bands are degenerate and the Fermi level passes. It has been shown through thorough calculations that at T = 0 K , the density

  6. Various Stone-Wales defects in phagraphene

    NASA Astrophysics Data System (ADS)

    Openov, L. A.; Podlivaev, A. I.

    2016-08-01

    Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.

  7. Maximally localized Wannier functions in LaMnO3 within PBE + U, hybrid functionals and partially self-consistent GW: an efficient route to construct ab initio tight-binding parameters for eg perovskites.

    PubMed

    Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G

    2012-06-13

    Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.

  8. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  9. Model construction and superconductivity analysis of organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta) based on first-principles band calculation

    NASA Astrophysics Data System (ADS)

    Aizawa, H.; Kuroki, K.; Yasuzuka, S.; Yamada, J.

    2012-11-01

    We perform a first-principles band calculation for a group of quasi-two-dimensional organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta). The ab-initio calculation shows that the density of states is correlated with the bandwidth of the singly occupied (highest) molecular orbital, while it is not necessarily correlated with the unit-cell volume. The direction of the major axis of the cross section of the Fermi surface lies in the Γ-B-direction, which differs from that obtained by the extended Hückel calculation. Then, we construct a tight-binding model which accurately reproduces the ab-initio band structure. The obtained transfer energies give a smaller dimerization than in the extended Hückel band. As to the difference in the anisotropy of the Fermi surface, the transfer energies along the inter-stacking direction are smaller than those obtained in the extended Hückel calculation. Assuming spin-fluctuation-mediated superconductivity, we apply random phase approximation to a two-band Hubbard model. This two-band Hubbard model is composed of the tight-binding model derived from the first-principles band structure and an on-site (intra-molecule) repulsive interaction taken as a variable parameter. The obtained superconducting gap changes sign four times along the Fermi surface like in a d-wave gap, and the nodal direction is different from that obtained in the extended Hückel model. Anion dependence of Tc is qualitatively consistent with the experimental observation.

  10. Interface Schottky barrier engineering via strain in metal-semiconductor composites

    NASA Astrophysics Data System (ADS)

    Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao

    2016-01-01

    The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k

  11. Design of graphene nanoparticle undergoing axial compression: quantum study

    NASA Astrophysics Data System (ADS)

    Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

    2011-03-01

    We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.

  12. Functionalized Fullerene Targeting Human Voltage-Gated Sodium Channel, hNav1.7.

    PubMed

    Hilder, Tamsyn A; Robinson, Anna; Chung, Shin-Ho

    2017-08-16

    Mutations of hNa v 1.7 that cause its activities to be enhanced contribute to severe neuropathic pain. Only a small number of hNa v 1.7 specific inhibitors have been identified, most of which interact with the voltage-sensing domain of the voltage-activated sodium ion channel. In our previous computational study, we demonstrated that a [Lys 6 ]-C 84 fullerene binds tightly (affinity of 46 nM) to Na v Ab, the voltage-gated sodium channel from the bacterium Arcobacter butzleri. Here, we extend this work and, using molecular dynamics simulations, demonstrate that the same [Lys 6 ]-C 84 fullerene binds strongly (2.7 nM) to the pore of a modeled human sodium ion channel hNa v 1.7. In contrast, the fullerene binds only weakly to a mutated model of hNa v 1.7 (I1399D) (14.5 mM) and a model of the skeletal muscle hNa v 1.4 (3.7 mM). Comparison of one representative sequence from each of the nine human sodium channel isoforms shows that only hNa v 1.7 possesses residues that are critical for binding the fullerene derivative and blocking the channel pore.

  13. Loose coupling in the bacterial flagellar motor

    PubMed Central

    Boschert, Ryan; Adler, Frederick R.; Blair, David F.

    2015-01-01

    Physiological properties of the flagellar rotary motor have been taken to indicate a tightly coupled mechanism in which each revolution is driven by a fixed number of energizing ions. Measurements that would directly test the tight-coupling hypothesis have not been made. Energizing ions flow through membrane-bound complexes formed from the proteins MotA and MotB, which are anchored to the cell wall and constitute the stator. Genetic and biochemical evidence points to a “power stroke” mechanism in which the ions interact with an aspartate residue of MotB to drive conformational changes in MotA that are transmitted to the rotor protein FliG. Each stator complex contains two separate ion-binding sites, raising the question of whether the power stroke is driven by one, two, or either number of ions. Here, we describe simulations of a model in which the conformational change can be driven by either one or two ions. This loosely coupled model can account for the observed physiological properties of the motor, including those that have been taken to indicate tight coupling; it also accords with recent measurements of motor torque at high load that are harder to explain in tight-coupling models. Under loads relevant to a swimming cell, the loosely coupled motor would perform about as well as a two-proton motor and significantly better than a one-proton motor. The loosely coupled motor is predicted to be especially advantageous under conditions of diminished energy supply, or of reduced temperature, turning faster than an obligatorily two-proton motor while using fewer ions. PMID:25825730

  14. Trans-polyacetylene within the extended tight-binding picture and evidence for next-nearest neighbour hopping from the dispersion of interband transition edges

    NASA Astrophysics Data System (ADS)

    Drechsler, S. L.; Heiner, E.; Osipov, V. A.

    1986-11-01

    The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.

  15. Electronic transport in methylated fragments of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  16. Electronic transport in methylated fragments of DNA

    NASA Astrophysics Data System (ADS)

    de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

    2015-11-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  17. Dynamical Reduction of the Dimensionality of Exchange Interactions and the "Spin-Liquid" Phase of κ-(BEDT-TTF)_{2}X.

    PubMed

    Powell, B J; Kenny, E P; Merino, J

    2017-08-25

    We show that the anisotropy of the effective spin model for the dimer Mott insulator phase of κ-(BEDT-TTF)_{2}X salts is dramatically different from that of the underlying tight-binding model. Intradimer quantum interference results in a model of coupled spin chains, where frustrated interchain interactions suppress long-range magnetic order. Thus, we argue, the "spin liquid" phase observed in some of these materials is a remnant of the Tomonaga-Luttinger physics of a single chain. This is consistent with previous experiments and resolves some outstanding puzzles.

  18. Interactions of Kid-Kis toxin-antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid-Kis oligomers.

    PubMed

    Monti, Maria C; Hernández-Arriaga, Ana M; Kamphuis, Monique B; López-Villarejo, Juan; Heck, Albert J R; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H H

    2007-01-01

    The parD operon of Escherichia coli plasmid R1 encodes a toxin-antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid-kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid-Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2-Kis2-Kid2-Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2-Kis2-Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2-Kis2)n complexes repress the kid-kis operon.

  19. DFTB3: Extension of the self-consistent-charge density-functional tight-binding method (SCC-DFTB).

    PubMed

    Gaus, Michael; Cui, Qiang; Elstner, Marcus

    2012-04-10

    The self-consistent-charge density-functional tight-binding method (SCC-DFTB) is an approximate quantum chemical method derived from density functional theory (DFT) based on a second-order expansion of the DFT total energy around a reference density. In the present study we combine earlier extensions and improve them consistently with, first, an improved Coulomb interaction between atomic partial charges, and second, the complete third-order expansion of the DFT total energy. These modifications lead us to the next generation of the DFTB methodology called DFTB3, which substantially improves the description of charged systems containing elements C, H, N, O, and P, especially regarding hydrogen binding energies and proton affinities. As a result, DFTB3 is particularly applicable to biomolecular systems. Remaining challenges and possible solutions are also briefly discussed.

  20. Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

    NASA Astrophysics Data System (ADS)

    Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

    2018-02-01

    In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.

  1. Mass spectrometry reveals that the antibiotic simocyclinone D8 binds to DNA gyrase in a "bent-over" conformation: evidence of positive cooperativity in binding.

    PubMed

    Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R

    2011-05-03

    DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.

  2. Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

    PubMed

    Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

    2015-02-10

    Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

  3. Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.

    2011-01-01

    We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.

  4. Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

    NASA Astrophysics Data System (ADS)

    Tretiak, Sergei

    2014-03-01

    The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

  5. Tight-binding chains with off-diagonal disorder: Bands of extended electronic states induced by minimal quasi-one-dimensionality

    NASA Astrophysics Data System (ADS)

    Nandy, Atanu; Pal, Biplab; Chakrabarti, Arunava

    2016-08-01

    It is shown that an entire class of off-diagonally disordered linear lattices composed of two basic building blocks and described within a tight-binding model can be tailored to generate absolutely continuous energy bands. It can be achieved if linear atomic clusters of an appropriate size are side-coupled to a suitable subset of sites in the backbone, and if the nearest-neighbor hopping integrals, in the backbone and in the side-coupled cluster, bear a certain ratio. We work out the precise relationship between the number of atoms in one of the building blocks in the backbone and that in the side attachment. In addition, we also evaluate the definite correlation between the numerical values of the hopping integrals at different subsections of the chain, that can convert an otherwise point spectrum (or a singular continuous one for deterministically disordered lattices) with exponentially (or power law) localized eigenfunctions to an absolutely continuous spectrum comprising one or more bands (subbands) populated by extended, totally transparent eigenstates. The results, which are analytically exact, put forward a non-trivial variation of the Anderson localization (Anderson P. W., Phys. Rev., 109 (1958) 1492), pointing towards its unusual sensitivity to the numerical values of the system parameters and, go well beyond the other related models such as the Random Dimer Model (RDM) (Dunlap D. H. et al., Phys. Rev. Lett., 65 (1990) 88).

  6. Band nesting, massive Dirac fermions, and valley Landé and Zeeman effects in transition metal dichalcogenides: A tight-binding model

    NASA Astrophysics Data System (ADS)

    Bieniek, Maciej; Korkusiński, Marek; Szulakowska, Ludmiła; Potasz, Paweł; Ozfidan, Isil; Hawrylak, Paweł

    2018-02-01

    We present here the minimal tight-binding model for a single layer of transition metal dichalcogenides (TMDCs) MX 2(M , metal; X , chalcogen) which illuminates the physics and captures band nesting, massive Dirac fermions, and valley Landé and Zeeman magnetic field effects. TMDCs share the hexagonal lattice with graphene but their electronic bands require much more complex atomic orbitals. Using symmetry arguments, a minimal basis consisting of three metal d orbitals and three chalcogen dimer p orbitals is constructed. The tunneling matrix elements between nearest-neighbor metal and chalcogen orbitals are explicitly derived at K ,-K , and Γ points of the Brillouin zone. The nearest-neighbor tunneling matrix elements connect specific metal and sulfur orbitals yielding an effective 6 ×6 Hamiltonian giving correct composition of metal and chalcogen orbitals but not the direct gap at K points. The direct gap at K , correct masses, and conduction band minima at Q points responsible for band nesting are obtained by inclusion of next-neighbor Mo-Mo tunneling. The parameters of the next-nearest-neighbor model are successfully fitted to MX 2(M =Mo ; X =S ) density functional ab initio calculations of the highest valence and lowest conduction band dispersion along K -Γ line in the Brillouin zone. The effective two-band massive Dirac Hamiltonian for MoS2, Landé g factors, and valley Zeeman splitting are obtained.

  7. Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.

    2016-04-13

    We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less

  8. Proton transfer along water bridges in biological systems with density-functional tight-binding

    NASA Astrophysics Data System (ADS)

    Reiss, Krystle; Wise, Abigail; Mazzuca, James

    2015-03-01

    When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.

  9. Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

    NASA Astrophysics Data System (ADS)

    Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

    2018-04-01

    Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

  10. Effect of disorder on the optical properties of short period superlattices

    NASA Technical Reports Server (NTRS)

    Strozier, J. A.; Zhang, Y. A.; Horton, C.; Ignatiev, A.; Shih, H. D.

    1993-01-01

    The optical properties of disordered short period superlattices are studied using a one-dimensional tight-binding model. A difference vector and disorder structure factor are proposed to characterize the disordered superlattice. The density of states, participation number, and optical absorption coefficients for both ordered and disordered superlattices are calculated as a function of energy. The results show that introduction of disorder into an indirect band gap material enhances the optical transition near the indirect band edge.

  11. Quasi-bound states in strained graphene

    NASA Astrophysics Data System (ADS)

    Bahamon, Dario; Qi, Zenan; Park, Harold; Pareira, Vitor; Campbell, David

    In this work, we explore the possibility of manipulating electronic states in graphene nanostructures by mechanical means. Specifically, we use molecular dynamics and tight-binding models to access the electronic and transport properties of strained graphene nanobubbles and graphene kirigami. We establish that low energy electrons can be confined in the arms of the kirigami and within the nanobubbles; under different load conditions the coupling between confined states and continuous states is modified creating different conductance line-shapes.

  12. Electron doping effects on the electrical conductivity of zigzag carbon nanotubes and corresponding unzipped armchair graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Mousavi, Hamze; Jalilvand, Samira; Kurdestany, Jamshid Moradi; Grabowski, Marek

    2017-10-01

    The Kubo formula is used to extract the electrical conductivity (EC) of different diameters of doped zigzag carbon nanotubes and their corresponding unzipped armchair graphene nanoribbons, as a function of temperature and chemical potential, within the tight-binding Hamiltonian model and Green's functions approach. The results reveal more sensitivity to temperature for semiconducting systems in addition to a decrease in EC of all systems with increasing cross-sections.

  13. Atomic scale simulations of pyrochlore oxides with a tight-binding variable-charge model: implications for radiation tolerance.

    PubMed

    Sattonnay, G; Tétot, R

    2014-02-05

    Atomistic simulations with new interatomic potentials derived from a tight-binding variable-charge model were performed in order to investigate the lattice properties and the defect formation energies in Gd2Ti2O7 and Gd2Zr2O7 pyrochlores. The main objective was to determine the role played by the defect stability on the radiation tolerance of these compounds. Calculations show that the titanate has a more covalent character than the zirconate. Moreover, the properties of oxygen Frenkel pairs, cation antisite defects and cation Frenkel pairs were studied. In Gd2Ti2O7 the cation antisite defect and the Ti-Frenkel pair are not stable: they evolve towards more stable defect configurations during the atomic relaxation process. This phenomenon is driven by a decrease of the Ti coordination number down to five which leads to a local atomic reorganization and strong structural distortions around the defects. These kinds of atomic rearrangements are not observed around defects in Gd2Zr2O7. Therefore, the defect stability in A2B2O7 depends on the ability of B atoms to accommodate high coordination number (higher than six seems impossible for Ti). The accumulation of structural distortions around Ti-defects due to this phenomenon could drive the Gd2Ti2O7 amorphization induced by irradiation.

  14. The relationship between water binding and desiccation tolerance in tissues

    NASA Technical Reports Server (NTRS)

    Vertucci, C. W.; Leopold, A. C.

    1987-01-01

    In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akabayov, B.; Akabayov, S; Lee , S

    Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

  16. Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

    PubMed

    Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

    2013-01-01

    Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

  17. Understanding the length dependence of molecular junction thermopower.

    PubMed

    Karlström, Olov; Strange, Mikkel; Solomon, Gemma C

    2014-01-28

    Thermopower of molecular junctions is sensitive to details in the junction and may increase, decrease, or saturate with increasing chain length, depending on the system. Using McConnell's theory for exponentially suppressed transport together with a simple and easily interpretable tight binding model, we show how these different behaviors depend on the molecular backbone and its binding to the contacts. We distinguish between resonances from binding groups or undercoordinated electrode atoms, and those from the periodic backbone. It is demonstrated that while the former gives a length-independent contribution to the thermopower, possibly changing its sign, the latter determines its length dependence. This means that the question of which orbitals from the periodic chain that dominate the transport should not be inferred from the sign of the thermopower but from its length dependence. We find that the same molecular backbone can, in principle, show four qualitatively different thermopower trends depending on the binding group: It can be positive or negative for short chains, and it can either increase or decrease with length.

  18. Time-dependent density-functional tight-binding method with the third-order expansion of electron density

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp

    2015-09-07

    We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less

  19. Time-dependent density-functional tight-binding method with the third-order expansion of electron density.

    PubMed

    Nishimoto, Yoshio

    2015-09-07

    We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.

  20. Weak partitioning chromatography for anion exchange purification of monoclonal antibodies.

    PubMed

    Kelley, Brian D; Tobler, Scott A; Brown, Paul; Coffman, Jonathan L; Godavarti, Ranga; Iskra, Timothy; Switzer, Mary; Vunnum, Suresh

    2008-10-15

    Weak partitioning chromatography (WPC) is an isocratic chromatographic protein separation method performed under mobile phase conditions where a significant amount of the product protein binds to the resin, well in excess of typical flowthrough operations. The more stringent load and wash conditions lead to improved removal of more tightly binding impurities, although at the cost of a reduction in step yield. The step yield can be restored by extending the column load and incorporating a short wash at the end of the load stage. The use of WPC with anion exchange resins enables a two-column cGMP purification platform to be used for many different mAbs. The operating window for WPC can be easily established using high throughput batch-binding screens. Under conditions that favor very strong product binding, competitive effects from product binding can give rise to a reduction in column loading capacity. Robust performance of WPC anion exchange chromatography has been demonstrated in multiple cGMP mAb purification processes. Excellent clearance of host cell proteins, leached Protein A, DNA, high molecular weight species, and model virus has been achieved. (c) 2008 Wiley Periodicals, Inc.

  1. Modeling direct interband tunneling. II. Lower-dimensional structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Andrew, E-mail: pandrew@ucla.edu; Chui, Chi On; California NanoSystems Institute, University of California, Los Angeles, Los Angeles, California 90095

    We investigate the applicability of the two-band Hamiltonian and the widely used Kane analytical formula to interband tunneling along unconfined directions in nanostructures. Through comparisons with k·p and tight-binding calculations and quantum transport simulations, we find that the primary correction is the change in effective band gap. For both constant fields and realistic tunnel field-effect transistors, dimensionally consistent band gap scaling of the Kane formula allows analytical and numerical device simulations to approximate non-equilibrium Green's function current characteristics without arbitrary fitting. This allows efficient first-order calibration of semiclassical models for interband tunneling in nanodevices.

  2. Superresolution imaging of transcription units on newt lampbrush chromosomes

    PubMed Central

    Kaufmann, Rainer; Cremer, Christoph; Gall, Joseph G.

    2013-01-01

    We have examined transcription loops on lampbrush chromosomes of the newt Notophthalmus by superresolution microscopy. Because of the favorable, essentially two-dimensional morphology of these loops, an average optical resolution in the x-y plane of about 50 nm was achieved. We analyzed the distribution of the multifunctional RNA-binding protein CELF1 on specific loops. CELF1 distribution is consistent with a model in which individual transcripts are tightly folded and hence closely packed against the loop axis. PMID:22892678

  3. Chemically Doped Double-Walled Carbon Nanotubes: Cylindrical Molecular Capacitors

    NASA Astrophysics Data System (ADS)

    Chen, Gugang; Bandow, S.; Margine, E. R.; Nisoli, C.; Kolmogorov, A. N.; Crespi, Vincent H.; Gupta, R.; Sumanasekera, G. U.; Iijima, S.; Eklund, P. C.

    2003-06-01

    A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.

  4. Chemically doped double-walled carbon nanotubes: cylindrical molecular capacitors.

    PubMed

    Chen, Gugang; Bandow, S; Margine, E R; Nisoli, C; Kolmogorov, A N; Crespi, Vincent H; Gupta, R; Sumanasekera, G U; Iijima, S; Eklund, P C

    2003-06-27

    A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.

  5. Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

    PubMed

    Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

    2014-10-28

    Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

  6. Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

    NASA Astrophysics Data System (ADS)

    de Moura, F. A. B. F.; Lyra, M. L.; de Almeida, M. L.; Ourique, G. S.; Fulco, U. L.; Albuquerque, E. L.

    2016-10-01

    We determine, by using a tight-binding model Hamiltonian, the characteristic current-voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation.

  7. Interactions of Kid–Kis toxin–antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid–Kis oligomers

    PubMed Central

    Monti, Maria C.; Hernández-Arriaga, Ana M.; Kamphuis, Monique B.; López-Villarejo, Juan; Heck, Albert J. R.; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H. H.

    2007-01-01

    The parD operon of Escherichia coli plasmid R1 encodes a toxin–antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid–kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid–Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2–Kis2–Kid2–Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2–Kis2–Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2–Kis2)n complexes repress the kid–kis operon. PMID:17317682

  8. Self-Consistent Charge Density Functional Tight-Binding Study of Poly(3,4-ethylenedioxythiophene): Poly(styrenesulfonate) Ammonia Gas Sensor.

    PubMed

    Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal

    2017-12-01

    Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.

  9. Modeling chain folding in protein-constrained circular DNA.

    PubMed Central

    Martino, J A; Olson, W K

    1998-01-01

    An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675

  10. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

    PubMed Central

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-01-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

  11. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

    PubMed

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-06-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

  12. Predicting permanent and transient protein-protein interfaces.

    PubMed

    La, David; Kong, Misun; Hoffman, William; Choi, Youn Im; Kihara, Daisuke

    2013-05-01

    Protein-protein interactions (PPIs) are involved in diverse functions in a cell. To optimize functional roles of interactions, proteins interact with a spectrum of binding affinities. Interactions are conventionally classified into permanent and transient, where the former denotes tight binding between proteins that result in strong complexes, whereas the latter compose of relatively weak interactions that can dissociate after binding to regulate functional activity at specific time point. Knowing the type of interactions has significant implications for understanding the nature and function of PPIs. In this study, we constructed amino acid substitution models that capture mutation patterns at permanent and transient type of protein interfaces, which were found to be different with statistical significance. Using the substitution models, we developed a novel computational method that predicts permanent and transient protein binding interfaces (PBIs) in protein surfaces. Without knowledge of the interacting partner, the method uses a single query protein structure and a multiple sequence alignment of the sequence family. Using a large dataset of permanent and transient proteins, we show that our method, BindML+, performs very well in protein interface classification. A very high area under the curve (AUC) value of 0.957 was observed when predicted protein binding sites were classified. Remarkably, near prefect accuracy was achieved with an AUC of 0.991 when actual binding sites were classified. The developed method will be also useful for protein design of permanent and transient PBIs. Copyright © 2013 Wiley Periodicals, Inc.

  13. Comparative Analysis of the Flax Immune Receptors L6 and L7 Suggests an Equilibrium-Based Switch Activation Model

    PubMed Central

    Chen, Chunhong; Newell, Kim; Lawrence, Gregory J.; Ellis, Jeffrey G.; Anderson, Peter A.; Dodds, Peter N.

    2016-01-01

    NOD-like receptors (NLRs) are central components of the plant immune system. L6 is a Toll/interleukin-1 receptor (TIR) domain-containing NLR from flax (Linum usitatissimum) conferring immunity to the flax rust fungus. Comparison of L6 to the weaker allele L7 identified two polymorphic regions in the TIR and the nucleotide binding (NB) domains that regulate both effector ligand-dependent and -independent cell death signaling as well as nucleotide binding to the receptor. This suggests that a negative functional interaction between the TIR and NB domains holds L7 in an inactive/ADP-bound state more tightly than L6, hence decreasing its capacity to adopt the active/ATP-bound state and explaining its weaker activity in planta. L6 and L7 variants with a more stable ADP-bound state failed to bind to AvrL567 in yeast two-hybrid assays, while binding was detected to the signaling active variants. This contrasts with current models predicting that effectors bind to inactive receptors to trigger activation. Based on the correlation between nucleotide binding, effector interaction, and immune signaling properties of L6/L7 variants, we propose that NLRs exist in an equilibrium between ON and OFF states and that effector binding to the ON state stabilizes this conformation, thereby shifting the equilibrium toward the active form of the receptor to trigger defense signaling. PMID:26744216

  14. Universal Sign Control of Coupling in Tight-Binding Lattices

    NASA Astrophysics Data System (ADS)

    Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander

    2016-05-01

    We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.

  15. Assessment of the Density Functional Tight Binding Method for Protic Ionic Liquids

    PubMed Central

    2015-01-01

    Density functional tight binding (DFTB), which is ∼100–1000 times faster than full density functional theory (DFT), has been used to simulate the structure and properties of protic ionic liquid (IL) ions, clusters of ions and the bulk liquid. Proton affinities for a wide range of IL cations and anions determined using DFTB generally reproduce G3B3 values to within 5–10 kcal/mol. The structures and thermodynamic stabilities of n-alkyl ammonium nitrate clusters (up to 450 quantum chemical atoms) predicted with DFTB are in excellent agreement with those determined using DFT. The IL bulk structure simulated using DFTB with periodic boundary conditions is in excellent agreement with published neutron diffraction data. PMID:25328497

  16. Modeling of full-Heusler alloys within tight-binding approximation: Case study of Fe2MnAl

    NASA Astrophysics Data System (ADS)

    Azhar, A.; Majidi, M. A.; Nanto, D.

    2017-07-01

    Heusler alloys have been known for about a century, and predictions of magnetic moment values using Slater-Pauling rule have been successful for many such materials. However, such a simple counting rule has been found not to always work for all Heusler alloys. For instance, Fe2CuAl has been found to have magnetic moment of 3.30 µB per formula unit although the Slater-Pauling rule suggests the value of 2 µB. On the other hand, a recent experiment shows that a non-stoichiometric Heusler compound Fe2Mn0.5Cu0.5Al possesses magnetic moment of 4 µB, closer to the Slater-Pauling prediction for the stoichiometric compound. Such discrepancies signify that the theory to predict the magnetic moment of Heusler alloys in general is still far from being complete. Motivated by this issue, we propose to do a theoretical study on a full-Heusler alloy Fe2MnAl to understand the formation of magnetic moment microscopically. We model the system by constructing a density-functional-theory-based tight-binding Hamiltonian and incorporating Hubbard repulsive as well as spin-spin interactions for the electrons occupying the d-orbitals. Then, we solve the model using Green's function approach, and treat the interaction terms within the mean-field approximation. At this stage, we aim to formulate the computational algorithm for the overall calculation process. Our final goal is to compute the total magnetic moment per unit cell of this system and compare it with the experimental data.

  17. Modeling Tight Junction Dynamics and Oscillations

    PubMed Central

    Kassab, Fuad; Marques, Ricardo Paulino; Lacaz-Vieira, Francisco

    2002-01-01

    Tight junction (TJ) permeability responds to changes of extracellular Ca2+ concentration. This can be gauged through changes of the transepithelial electrical conductance (G) determined in the absence of apical Na+. The early events of TJ dynamics were evaluated by the fast Ca2+ switch assay (FCSA) (Lacaz-Vieira, 2000), which consists of opening the TJs by removing basal calcium (Ca2+ bl) and closing by returning Ca2+ bl to normal values. Oscillations of TJ permeability were observed when Ca2+ bl is removed in the presence of apical calcium (Ca2+ ap) and were interpreted as resulting from oscillations of a feedback control loop which involves: (a) a sensor (the Ca2+ binding sites of zonula adhaerens), (b) a control unit (the cell signaling machinery), and (c) an effector (the TJs). A mathematical model to explain the dynamical behavior of the TJs and oscillations was developed. The extracellular route (ER), which comprises the paracellular space in series with the submucosal interstitial fluid, was modeled as a continuous aqueous medium having the TJ as a controlled barrier located at its apical end. The ER was approximated as a linear array of cells. The most apical cell is separated from the apical solution by the TJ and this cell bears the Ca2+ binding sites of zonula adhaerens that control the TJs. According to the model, the control unit receives information from the Ca2+ binding sites and delivers a signal that regulates the TJ barrier. Ca2+ moves along the ER according to one-dimensional diffusion following Fick's second law. Across the TJ, Ca2+ diffusion follows Fick's first law. Our first approach was to simulate the experimental results in a semiquantitative way. The model tested against experiment results performed in the frog urinary bladder adequately predicts the responses obtained in different experimental conditions, such as: (a) TJ opening and closing in a FCSA, (b) opening by the presence of apical Ca2+ and attainment of a new steady-state, (c) the escape phase which follows the halt of TJ opening induced by apical Ca2+, (d) the oscillations of TJ permeability, and (e) the effect of Ca2+ ap concentration on the frequency of oscillations. PMID:12149284

  18. Most of the tight positional conservation of transcription factor binding sites near the transcription start site reflects their co-localization within regulatory modules.

    PubMed

    Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L

    2016-11-21

    Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.

  19. Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion

    PubMed Central

    Stefanski, Adrianne L.; McManaman, James L.

    2013-01-01

    Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572

  20. Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

    PubMed Central

    Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

    2011-01-01

    Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539

  1. Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

    PubMed

    Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

    2011-08-09

    The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.

  2. Surface passivation for tight-binding calculations of covalent solids.

    PubMed

    Bernstein, N

    2007-07-04

    Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

  3. Surface passivation for tight-binding calculations of covalent solids

    NASA Astrophysics Data System (ADS)

    Bernstein, N.

    2007-07-01

    Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

  4. An Innovative Sensing Approach Using Carbon Nanotube-Based Composites for Structural Health Monitoring of Concrete Structures

    NASA Astrophysics Data System (ADS)

    Dwivedi, Vatsal

    This thesis presents some work on two quite disparate kinds of dynamical systems described by Hamiltonian dynamics. The first part describes a computation of gauge anomalies and their macroscopic effects in a semiclassical picture. The geometric (symplectic) formulation of classical mechanics is used to describe the dynamics of Weyl fermions in even spacetime dimensions, the only quantum input to the symplectic form being the Berry curvature that encodes the spin-momentum locking. The (semi-)classical equations of motion are used in a kinetic theory setup to compute the gauge and singlet currents, whose conservation laws reproduce the nonabelian gauge and singlet anomalies. Anomalous contributions to the hydrodynamic currents for a gas of Weyl fermions at a finite temperature and chemical potential are also calculated, and are in agreement with similar results in literature which were obtained using thermodynamic and/or quantum field theoretical arguments. The second part describes a generalized transfer matrix formalism for noninteracting tight-binding models. The formalism is used to study the bulk and edge spectra, both of which are encoded in the spectrum of the transfer matrices, for some of the common tight-binding models for noninteracting electronic topological phases of matter. The topological invariants associated with the boundary states are interpreted as winding numbers for windings around noncontractible loops on a Riemann sheet constructed using the algebraic structure of the transfer matrices, as well as with a Maslov index on a symplectic group manifold, which is the space of transfer matrices.

  5. Simulation studies of carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    John, David Llewellyn

    Simulation studies of carbon nanotube field-effect transistors (CNFETs) are presented using models of increasing rigour and versatility that have been systematically developed. Firstly, it is demonstrated how one may compute the standard tight-binding band structure. From this foundation, a self-consistent solution for computing the equilibrium energy band diagram of devices with Schottky-barrier source and drain contacts is developed. While this does provide insight into the likely behaviour of CNFETs, a non-equilibrium model is required in order to predict the current-voltage relation. To this end, the effective-mass approximation is utilized, where a parabolic fit to the band structure is used in order to develop a Schrodinger-Poisson solver. This model is employed to predict both DC behaviour and switching times for CNFETs, and was one of the first models that captured quantum effects, such as tunneling and resonance, in these devices. In addition, this model has been used in order to validate compact models that incorporated tunneling via the WKB approximation. A modified WKB derivation is provided in order to account for the non-zero reflection of carriers above a potential energy step. In order to allow for greater flexibility in the CNFET geometries, and to lift the effective-mass approximation, a non-equilibrium Green's function method is finally developed, which uses an atomistic tight-binding Hamiltonian to model doped-contact, as opposed to Schottky-barrier-contact, devices. This approach benefits by being able to account for both inter- and intra-band tunneling, and by utilizing a quadratic matrix equation in order to improve the computation time for the required self-energy matrices. Within this technique, an expression for the local inter-atomic current is derived in order to provide more detailed information than the usual compact expression for the terminal current. With this final model, an investigation is presented into the effects of geometrical variations, contact thicknesses, and azimuthal variation in the surface potential of the nanotube.

  6. Dislocation Onset and Glide in Carbon Nanotubes under Torsion

    NASA Astrophysics Data System (ADS)

    Dumitrica, Traian; Zhang, Dong-Bo; James, Richard

    2009-03-01

    The torsional plastic response of carbon nanotubes is comprehensively described in the objective molecular dynamics framework [1-3]. It is shown that an (n,m) tube is prone to slip along a nearly-axial helical path, which introduces a distinct (+1,-1) change in the wrapping index. The low energy realization occurs without loss of mass, via nucleation of a 5-7-7-5 dislocation dipole, followed by a nearly-axial glide of the 5-7 dislocation. The onset of plasticity depends not only on chirality but also on handedness. For a given handedness of the applied twist, chiral tubes of opposed handedness are most susceptible to yield. A right-handed applied twist on an armchair (zig-zag) tube leads to a right- (left-) handed tube. [4pt] [1] T. Dumitrica and R.D. James, Objective Molecular Dynamics, Journal of the Mechanics and Physics of Solids 55, 2206 (2007). [0pt] [2] D.-B. Zhang, M. Hua, and T. Dumitrica, Stability of Polycrystalline and Wurtzite Si Nanowires via Symmetry-Adapted Tight-Binding Objective Molecular Dynamics, Journal of Chemical Physics 128, 084104 (2008). [0pt] [3] D.-B. Zhang and T. Dumitrica, Elasticity of Ideal Single-Walled Carbon Nanotubes via Symmetry-Adapted Tight-Binding Objective Modeling, Applied Physics Letters 93, 031919 (2008).

  7. Physics and performances of III-V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations.

    PubMed

    Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M

    2018-06-27

    We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

  8. Quantum Hall effect in ac driven graphene: From the half-integer to the integer case

    NASA Astrophysics Data System (ADS)

    Ding, Kai-He; Lim, Lih-King; Su, Gang; Weng, Zheng-Yu

    2018-01-01

    We theoretically study the quantum Hall effect (QHE) in graphene with an ac electric field. Based on the tight-binding model, the structure of the half-integer Hall plateaus at σxy=±(n +1 /2 ) 4 e2/h (n is an integer) gets qualitatively changed with the addition of new integer Hall plateaus at σxy=±n (4 e2/h ) starting from the edges of the band center regime towards the band center with an increasing ac field. Beyond a critical field strength, a Hall plateau with σxy=0 can be realized at the band center, hence fully restoring a conventional integer QHE with particle-hole symmetry. Within a low-energy Hamiltonian for Dirac cones merging, we show a very good agreement with the tight-binding calculations for the Hall plateau transitions. We also obtain the band structure for driven graphene ribbons to provide a further understanding on the appearance of the new Hall plateaus, showing a trivial insulator behavior for the σxy=0 state. In the presence of disorder, we numerically study the disorder-induced destruction of the quantum Hall states in a finite driven sample and find that qualitative features known in the undriven disordered case are maintained.

  9. Physics and performances of III–V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations

    NASA Astrophysics Data System (ADS)

    Afzalian, A.; Vasen, T.; Ramvall, P.; Shen, T.-M.; Wu, J.; Passlack, M.

    2018-06-01

    We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III–V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III–V GAA nanowire HTFETs including the effect of electron–phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

  10. Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2

    PubMed Central

    Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

    2007-01-01

    Background Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. Results We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Conclusion Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation. PMID:18028534

  11. Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2.

    PubMed

    Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

    2007-11-20

    Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation.

  12. Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle

    2010-07-23

    Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less

  13. Surface Passivation in Empirical Tight Binding

    NASA Astrophysics Data System (ADS)

    He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann

    2016-03-01

    Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameters. This method is applied to a Si quantum well and a Si ultra-thin body transistor oxidized with SiO2 in several oxidation configurations. Comparison with ab-initio results and experiments verifies the presented method. Oxidation configurations that severely hamper the transistor performance are identified. It is also shown that the commonly used implicit H atom passivation overestimates the transistor performance.

  14. Tight-binding approximations to time-dependent density functional theory — A fast approach for the calculation of electronically excited states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rüger, Robert, E-mail: rueger@scm.com; Department of Theoretical Chemistry, Vrije Universiteit Amsterdam, De Boelelaan 1083, 1081 HV Amsterdam; Wilhelm-Ostwald-Institut für Physikalische und Theoretische Chemie, Linnéstr. 2, 04103 Leipzig

    2016-05-14

    We propose a new method of calculating electronically excited states that combines a density functional theory based ground state calculation with a linear response treatment that employs approximations used in the time-dependent density functional based tight binding (TD-DFTB) approach. The new method termed time-dependent density functional theory TD-DFT+TB does not rely on the DFTB parametrization and is therefore applicable to systems involving all combinations of elements. We show that the new method yields UV/Vis absorption spectra that are in excellent agreement with computationally much more expensive TD-DFT calculations. Errors in vertical excitation energies are reduced by a factor of twomore » compared to TD-DFTB.« less

  15. Non-collinear magnetism with analytic Bond-Order Potentials

    NASA Astrophysics Data System (ADS)

    Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

    2015-03-01

    The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

  16. Tight-binding study of stacking fault energies and the Rice criterion of ductility in the fcc metals

    NASA Astrophysics Data System (ADS)

    Mehl, Michael J.; Papaconstantopoulos, Dimitrios A.; Kioussis, Nicholas; Herbranson, M.

    2000-02-01

    We have used the Naval Research Laboratory (NRL) tight-binding (TB) method to calculate the generalized stacking fault energy and the Rice ductility criterion in the fcc metals Al, Cu, Rh, Pd, Ag, Ir, Pt, Au, and Pb. The method works well for all classes of metals, i.e., simple metals, noble metals, and transition metals. We compared our results with full potential linear-muffin-tin orbital and embedded atom method (EAM) calculations, as well as experiment, and found good agreement. This is impressive, since the NRL-TB approach only fits to first-principles full-potential linearized augmented plane-wave equations of state and band structures for cubic systems. Comparable accuracy with EAM potentials can be achieved only by fitting to the stacking fault energy.

  17. Theoretical study on the perpendicular anisotropic magnetoresistance using Rashba-type ferromagnetic model

    NASA Astrophysics Data System (ADS)

    Yahagi, Y.; Miura, D.; Sakuma, A.

    2018-05-01

    We investigated the anisotropic magnetoresistance (AMR) effects in ferromagnetic-metal multi-layers stacked on non-magnetic insulators in the context of microscopic theory. We represented this situation with tight-binding models that included the exchange and Rashba fields, where the Rashba field was assumed to originate from spin-orbit interactions as junction effects with the insulator. To describe the AMR ratios, the DC conductivity was calculated based on the Kubo formula. As a result, we showed that the Rashba field induced both perpendicular and in-plane AMR effects and that the perpendicular AMR effect rapidly decayed with increasing film thickness.

  18. Hidden order and unconventional superconductivity in URu2Si2

    NASA Astrophysics Data System (ADS)

    Rau, Jeffrey; Kee, Hae-Young

    2012-02-01

    The nature of the so-called hidden order in URu2Si2 and the subsequent superconducting phase have remained a puzzle for over two decades. Motivated by evidence for rotational symmetry breaking seen in recent magnetic torque measurements [Okazaki et al. Science 331, 439 (2011)], we derive a simple tight-binding model consistent with experimental Fermi surface probes and ab-initio calculations. From this model we use mean-field theory to examine the variety of hidden orders allowed by existing experimental results, including the torque measurements. We then construct a phase diagram in temperature and pressure and discuss relevant experimental consequences.

  19. Stochastic Model of Supercoiling-Dependent Transcription

    NASA Astrophysics Data System (ADS)

    Brackley, C. A.; Johnson, J.; Bentivoglio, A.; Corless, S.; Gilbert, N.; Gonnella, G.; Marenduzzo, D.

    2016-07-01

    We propose a stochastic model for gene transcription coupled to DNA supercoiling, where we incorporate the experimental observation that polymerases create supercoiling as they unwind the DNA helix and that these enzymes bind more favorably to regions where the genome is unwound. Within this model, we show that when the transcriptionally induced flux of supercoiling increases, there is a sharp crossover from a regime where torsional stresses relax quickly and gene transcription is random, to one where gene expression is highly correlated and tightly regulated by supercoiling. In the latter regime, the model displays transcriptional bursts, waves of supercoiling, and up regulation of divergent or bidirectional genes. It also predicts that topological enzymes which relax twist and writhe should provide a pathway to down regulate transcription.

  20. Symposium DD: Low-Dimensional Materials-Synthesis, Assembly, Property Scaling and Modeling. Held in San Francisco, CA on April 9-13, 2007

    DTIC Science & Technology

    2008-06-01

    Ciencia e Ingenieria de los Materiales , Universidad de Costa Rica, San Jose, Costa Rica. We have developed a new unifying tight-binding theory that...Fisico Matem6ticas, Universidad Aut6noma de Nuevo Le6n, San Nicolas de los Garza, Nuevo LeAfA3n, Mexico; 2Chemical Engineering Department and Texas...ORNL), Oak Ridge, Tennessee; 2Departamento de Ciencia de los Materiales e IM y QI, Universidad de Cadiz, Puerto Real, Cadiz, Spain; 3Departamento de

  1. Green's function calculations for semi-infinite carbon nanotubes

    NASA Astrophysics Data System (ADS)

    John, D. L.; Pulfrey, D. L.

    2006-02-01

    In the modeling of nanoscale electronic devices, the non-equilibrium Green's function technique is gaining increasing popularity. One complication in this method is the need for computation of the self-energy functions that account for the interactions between the active portion of a device and its leads. In the one-dimensional case, these functions may be computed analytically. In higher dimensions, a numerical approach is required. In this work, we generalize earlier methods that were developed for tight-binding Hamiltonians, and present results for the case of a carbon nanotube.

  2. Polarizable atomistic calculation of site energy disorder in amorphous Alq3.

    PubMed

    Nagata, Yuki

    2010-02-01

    A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.

  3. Lattice distortion and electron charge redistribution induced by defects in graphene

    DOE PAGES

    Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...

    2016-09-14

    Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.

  4. Nonlinear susceptibilities of finite conjugated organic polymers

    NASA Technical Reports Server (NTRS)

    Beratan, David N.; Onuchic, Jose Nelson; Perry, Joseph W.

    1987-01-01

    Tight-binding calculations of the length dependence of the third-order molecular hyperpolarizability for polyenes and polyynes are reported. The pi-electron wave functions were determined by exploiting the limited translational symmetry of the molecules. Perturbation theory was used to calculate the longitudinal component of the electronic nonresonant hyperpolarizability. This is the first two-'band' calculation of third-order hyperpolarizabilities on finite pi-electron systems of varying length. In contrast to the results of the one-'band' models, the hyperpolarizability densities increase rapidly and then, after about 10-15 repeating units, approach an asymptotic value.

  5. Multiple Weyl points and the sign change of their topological charges in woodpile photonic crystals

    NASA Astrophysics Data System (ADS)

    Chang, Ming-Li; Xiao, Meng; Chen, Wen-Jie; Chan, C. T.

    2017-03-01

    We show that Weyl points with topological charges 1 and 2 can be found in very simple chiral woodpile photonic crystals and the distribution of the charges can be changed by changing the material parameters without altering space-group symmetry. The underlying physics can be understood through a tight-binding model. Gapless surface states and their backscattering immune properties also are demonstrated in these systems. Obtaining Weyl points in these easily fabricated woodpile photonic crystals will facilitate the realization of Weyl point physics in optical and IR frequencies.

  6. Many-body instabilities and mass generation in slow Dirac materials

    NASA Astrophysics Data System (ADS)

    Triola, Christopher; Zhu, Jian-Xin; Migliori, Albert; Balatsky, Alexander V.

    2015-07-01

    Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum: the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model, we study the many-body instabilities of these systems and identify regions of parameter space in which the system exhibits spin density wave and charge density wave order.

  7. Molecular dynamics simulations of dense plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Collins, L.A.; Kress, J.D.; Kwon, I.

    1993-12-31

    We have performed quantum molecular dynamics simulations of hot, dense plasmas of hydrogen over a range of temperatures(0.1-5eV) and densities(0.0625-5g/cc). We determine the forces quantum mechanically from density functional, extended Huckel, and tight binding techniques and move the nuclei according to the classical equations of motion. We determine pair-correlation functions, diffusion coefficients, and electrical conductivities. We find that many-body effects predominate in this regime. We begin to obtain agreement with the OCP and Thomas-Fermi models only at the higher temperatures and densities.

  8. Spin-polarized transport in multiterminal silicene nanodevices

    NASA Astrophysics Data System (ADS)

    Xu, Ning

    2018-01-01

    The spin-polarized transport properties of multiterminal silicene nanodevices are studied using the tight binding model and Landauer-Buttier approach. We propose a four-terminal †-shaped junction device and two types of three-terminal T-shaped junction devices, which are made of the crossing of a zigzag and an armchair silicene nanoribbon. If the electrons are injected into the metallic lead, the near-perfect spin polarization with 100% around the Fermi energy can be achieved easily at the other semiconducting leads. Thus the multiterminal silicene nanodevices can act as controllable spin filters.

  9. Thermodynamics of cooperative binding of FAD to human NQO1: Implications to understanding cofactor-dependent function and stability of the flavoproteome.

    PubMed

    Clavería-Gimeno, Rafael; Velazquez-Campoy, Adrian; Pey, Angel Luis

    2017-12-15

    The stability of human flavoproteins strongly depends on flavin levels, although the structural and energetic basis of this relationship is poorly understood. Here, we report an in-depth analysis on the thermodynamics of FAD binding to one of the most representative examples of such relationship, NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a dimeric enzyme that tightly binds FAD, which triggers large structural changes upon binding. A common cancer-associated polymorphism (P187S) severely compromises FAD binding. We show that FAD binding is described well by a thermodynamic model explicitly incorporating binding cooperativity when applied to different sets of calorimetric analyses and NQO1 variants, thus providing insight on the effects in vitro and in cells of cancer-associated P187S, its suppressor mutation H80R and the role of NQO1 C-terminal domain to modulate binding cooperativity and energetics. Furthermore, we show that FAD binding to NQO1 is very sensitive to physiologically relevant environmental conditions, such as the presence of phosphate buffer and salts. Overall, our results contribute to understanding at the molecular level the link between NQO1 stability and fluctuations of FAD levels intracellularly, and supports the notion that FAD binding energetics and cooperativity are fundamentally linked with the dynamic nature of apo-NQO1 conformational ensemble. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Kinetics of bacterial phospholipase C activity at micellar interfaces: effect of substrate aggregate microstructure and a model for the kinetic parameters.

    PubMed

    Singh, Jasmeet; Ranganathan, Radha; Hajdu, Joseph

    2008-12-25

    Activity at micellar interfaces of bacterial phospholipase C from Bacillus cereus on phospholipids solubilized in micelles was investigated with the goal of elucidating the role of the interface microstructure and developing further an existing kinetic model. Enzyme kinetics and physicochemical characterization of model substrate aggregates were combined, thus enabling the interpretation of kinetics in the context of the interface. Substrates were diacylphosphatidylcholine of different acyl chain lengths in the form of mixed micelles with dodecyldimethylammoniopropanesulfonate. An early kinetic model, reformulated to reflect the interfacial nature of the kinetics, was applied to the kinetic data. A better method of data treatment is proposed, use of which makes the presence of microstructure effects quite transparent. Models for enzyme-micelle binding and enzyme-lipid binding are developed, and expressions incorporating the microstructural properties are derived for the enzyme-micelle dissociation constant K(s) and the interface Michaelis-Menten constant, K(M). Use of these expressions in the interface kinetic model brings excellent agreement between the kinetic data and the model. Numerical values for the thermodynamic and kinetic parameters are determined. Enzyme-lipid binding is found to be an activated process with an acyl chain length dependent free energy of activation that decreases with micelle lipid molar fraction with a coefficient of about -15RT and correlates with the tightness of molecular packing in the substrate aggregate. Thus, the physical insight obtained includes a model for the kinetic parameters that shows that these parameters depend on the substrate concentration and acyl chain length of the lipid. Enzyme-micelle binding is indicated to be hydrophobic and solvent mediated with a dissociation constant of 1.2 mM.

  11. Tight-binding molecular-dynamics study of point defects in GaAs

    NASA Astrophysics Data System (ADS)

    Seong, Hyangsuk; Lewis, Laurent J.

    1995-08-01

    Tight-binding molecular-dynamics simulations at 0 K have been performed in order to study the effect of defects (vacancies and antisites) in different states of charge on the electronic and structural properties of GaAs. Relaxations are fully included in the model, and for each defect we calculate the local atomic structure, the volume change upon relaxing, the formation energy (including chemical potential contributions), and the ionization levels. We find Ga vacancies to relax by an amount which is independent of the state of charge, consistent with positron lifetime measurements. Our calculations also predict Ga vacancies to exhibit a negative-U effect, and to assume a triply negative charge state for most values of the electron chemical potential. The relaxation of As vacancies, on the contrary, depends sensitively on the state of charge. The model confirms the two experimentally observed ionization levels for this defect, just below the conduction-band minimum. Likewise, Ga antisites exhibit large relaxations. In fact, in the neutral state, relaxation is so large that it leads to a ``broken-bond'' configuration, in excellent accord with the first-principles calculations of Zhang and Chadi [Phys. Rev. Lett. 64, 1789 (1990)]. This system also exhibits a negative-U effect, for values of the electron chemical potential near midgap. For As antisites, we find only a weak relaxation, independent of the charge. The model predicts the neutral state of the defect to be the ground state for values of the electron chemical potential near and above midgap, which supports the view that the EL2 defect is a neutral As antisite. Upon comparing the formation energies of the various defects we finally find that, for all values of the atomic chemical potentials, antisites are most likely to occur than vacancies.

  12. Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots.

    PubMed

    Douglas-Gallardo, Oscar A; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

    2018-04-14

    Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

  13. Kinetics and Mechanism of Mammalian Mitochondrial Ribosome Assembly.

    PubMed

    Bogenhagen, Daniel F; Ostermeyer-Fay, Anne G; Haley, John D; Garcia-Diaz, Miguel

    2018-02-13

    Mammalian mtDNA encodes only 13 proteins, all essential components of respiratory complexes, synthesized by mitochondrial ribosomes. Mitoribosomes contain greatly truncated RNAs transcribed from mtDNA, including a structural tRNA in place of 5S RNA as a scaffold for binding 82 nucleus-encoded proteins, mitoribosomal proteins (MRPs). Cryoelectron microscopy (cryo-EM) studies have determined the structure of the mitoribosome, but its mechanism of assembly is unknown. Our SILAC pulse-labeling experiments determine the rates of mitochondrial import of MRPs and their assembly into intact mitoribosomes, providing a basis for distinguishing MRPs that bind at early and late stages in mitoribosome assembly to generate a working model for mitoribosome assembly. Mitoribosome assembly is a slow process initiated at the mtDNA nucleoid driven by excess synthesis of individual MRPs. MRPs that are tightly associated in the structure frequently join the complex in a coordinated manner. Clinically significant MRP mutations reported to date affect proteins that bind early on during assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  14. Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots

    NASA Astrophysics Data System (ADS)

    Douglas-Gallardo, Oscar A.; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

    2018-04-01

    Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

  15. Identification of a regulation network in response to cadmium toxicity using blood clam Tegillarca granosa as model

    PubMed Central

    Bao, Yongbo; Liu, Xiao; Zhang, Weiwei; Cao, Jianping; Li, Wei; Li, Chenghua; Lin, Zhihua

    2016-01-01

    Clam, a filter-feeding lamellibranch mollusk, is capable to accumulate high levels of trace metals and has therefore become a model for investigation the mechanism of heavy metal toxification. In this study, the effects of cadmium were characterized in the gills of Tegillarca granosa during a 96-hour exposure course using integrated metabolomic and proteomic approaches. Neurotoxicity and disturbances in energy metabolism were implicated according to the metabolic responses after Cd exposure, and eventually affected the osmotic function of gill tissue. Proteomic analysis showed that oxidative stress, calcium-binding and sulfur-compound metabolism proteins were key factors responding to Cd challenge. A knowledge-based network regulation model was constructed with both metabolic and proteomic data. The model suggests that Cd stimulation mainly inhibits a core regulation network that is associated with histone function, ribosome processing and tight junctions, with the hub proteins actin, gamma 1 and Calmodulin 1. Moreover, myosin complex inhibition causes abnormal tight junctions and is linked to the irregular synthesis of amino acids. For the first time, this study provides insight into the proteomic and metabolomic changes caused by Cd in the blood clam T. granosa and suggests a potential toxicological pathway for Cd. PMID:27760991

  16. Transport gap engineering by contact geometry in graphene nanoribbons: Experimental and theoretical studies on artificial materials

    NASA Astrophysics Data System (ADS)

    Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

    2017-01-01

    Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.

  17. Electronic Properties of SiNTs Under External Electric and Magnetic Fields Using the Tight-Binding Method

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2014-02-01

    We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.

  18. Conductance of three-terminal molecular bridge based on tight-binding theory

    NASA Astrophysics Data System (ADS)

    Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

    2005-05-01

    The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

  19. Improved nonorthogonal tight-binding Hamiltonian for molecular-dynamics simulations of silicon clusters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordejon, P.; Lebedenko, D.; Menon, M.

    1994-08-15

    We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v

  20. Nucleotide-induced conformational dynamics in ABC transporters from structure-based coarse grained modelling.

    NASA Astrophysics Data System (ADS)

    Flechsig, Holger

    2016-02-01

    ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter. Possible explanations are discussed in the light of currently debated transport scenarios of ABC transporters.

  1. Crystal structures of penicillin-binding protein 3 (PBP3) from methicillin-resistant Staphylococcus aureus in the apo and cefotaxime-bound forms.

    PubMed

    Yoshida, Hisashi; Kawai, Fumihiro; Obayashi, Eiji; Akashi, Satoko; Roper, David I; Tame, Jeremy R H; Park, Sam-Yong

    2012-10-26

    Staphylococcus aureus is a widespread Gram-positive opportunistic pathogen, and a methicillin-resistant form (MRSA) is particularly difficult to treat clinically. We have solved two crystal structures of penicillin-binding protein (PBP) 3 (PBP3) from MRSA, the apo form and a complex with the β-lactam antibiotic cefotaxime, and used electrospray mass spectrometry to measure its sensitivity to a variety of penicillin derivatives. PBP3 is a class B PBP, possessing an N-terminal non-penicillin-binding domain, sometimes called a dimerization domain, and a C-terminal transpeptidase domain. The model shows a different orientation of its two domains compared to earlier models of other class B PBPs and a novel, larger N-domain. Consistent with the nomenclature of "dimerization domain", the N-terminal region forms an apparently tight interaction with a neighboring molecule related by a 2-fold symmetry axis in the crystal structure. This dimer form is predicted to be highly stable in solution by the PISA server, but mass spectrometry and analytical ultracentrifugation provide unequivocal evidence that the protein is a monomer in solution. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Hysteresis in DNA compaction by Dps is described by an Ising model

    PubMed Central

    Vtyurina, Natalia N.; Dulin, David; Docter, Margreet W.; Meyer, Anne S.; Dekker, Nynke H.; Abbondanzieri, Elio A.

    2016-01-01

    In all organisms, DNA molecules are tightly compacted into a dynamic 3D nucleoprotein complex. In bacteria, this compaction is governed by the family of nucleoid-associated proteins (NAPs). Under conditions of stress and starvation, an NAP called Dps (DNA-binding protein from starved cells) becomes highly up-regulated and can massively reorganize the bacterial chromosome. Although static structures of Dps–DNA complexes have been documented, little is known about the dynamics of their assembly. Here, we use fluorescence microscopy and magnetic-tweezers measurements to resolve the process of DNA compaction by Dps. Real-time in vitro studies demonstrated a highly cooperative process of Dps binding characterized by an abrupt collapse of the DNA extension, even under applied tension. Surprisingly, we also discovered a reproducible hysteresis in the process of compaction and decompaction of the Dps–DNA complex. This hysteresis is extremely stable over hour-long timescales despite the rapid binding and dissociation rates of Dps. A modified Ising model is successfully applied to fit these kinetic features. We find that long-lived hysteresis arises naturally as a consequence of protein cooperativity in large complexes and provides a useful mechanism for cells to adopt unique epigenetic states. PMID:27091987

  3. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  4. X-ray Raman scattering from molecules and solids in the framework of the Mahan-Nozières-De Dominicis model

    NASA Astrophysics Data System (ADS)

    Privalov, Timofei; Gel'mukhanov, Faris; Ågren, Hans

    2001-10-01

    We have developed a formulation of resonant x-ray Raman scattering of molecules and solids based on the Mahan-Nozières-De Dominicis model. A key step in the formulation is given by a reduction of the Keldysh-Dyson equations for the Green's function to a set of linear algebraic equations. This gave way for a tractable scheme that can be used to analyze the resonant x-ray scattering in the whole time domain. The formalism is used to investigate the role of core-hole relaxation, interference, band filling, detuning, and size of the scattering target. Numerical applications are performed with a one-dimensional tight-binding model.

  5. Ni2C surface carbide to catalyze low-temperature graphene growth

    NASA Astrophysics Data System (ADS)

    Martinez-Gordillo, Rafael; Varvenne, Céline; Amara, Hakim; Bichara, Christophe

    2018-05-01

    The possibility to grow a graphene layer using the chemical-vapor-deposition technique over a Ni2C /Ni (111 ) substrate has been identified experimentally, with the advantage of having a lower processing temperature (T <500 ∘C ), compared to standard growth over a Ni (111 ) surface. To understand the role of the metal carbide/metal catalyst, we first perform a static study of the Ni2C /Ni (111 ) structure and of the binding and removal of a carbon atom at the surface, using both a tight-binding (TB) energetic model and ab initio calculations. Grand-canonical Monte Carlo TB simulations then allow us (i) to determine the thermodynamic conditions to grow graphene and (ii) to separate key reaction steps in the growth mechanism explaining how the Ni2C /Ni (111 ) substrate catalyzes graphene formation at low temperature.

  6. Improving Density Functional Tight Binding Predictions of Free Energy Surfaces for Slow Chemical Reactions in Solution

    NASA Astrophysics Data System (ADS)

    Kroonblawd, Matthew; Goldman, Nir

    2017-06-01

    First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for reactions that are fast relative to DFT simulation times (<10 ps), but the effects on slow reactions and the free energy surface are not well-known. We present a force matching approach to improve the chemical accuracy of DFTB. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  7. Improving density functional tight binding predictions of free energy surfaces for peptide condensation reactions in solution

    NASA Astrophysics Data System (ADS)

    Kroonblawd, Matthew; Goldman, Nir

    First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for chemistry that is fast relative to DFT simulation times (<10 ps), but the effects on slow chemistry and the free energy surface are not well-known. We present a force matching approach to increase the accuracy of DFTB predictions for free energy surfaces. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials without a priori knowledge of transition states. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT results for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  8. Intense conductivity suppression by edge defects in zigzag MoS2 and WSe2 nanoribbons: a density functional based tight-binding study.

    PubMed

    Silva, F W N; Costa, A L M T; Liu, Lei; Barros, E B

    2016-11-04

    The effects of edge vacancies on the electron transport properties of zigzag MoS2/WSe2 nanoribbons are studied using a density functional theory (DFT)-based tight-binding model with a sp(3)d(5) basis set for the electronic structure calculation and applying the Landauer-Büttiker approach for the electronic transport. Our results show that the presence of a single edge vacancy, with a missing MoS2/WSe2 triplet, is enough to suppress the conductance of the system by almost one half for most energies around the Fermi level. Furthermore, the presence of other single defects along the same edge has little effect on the overall conductance, indicating that the conductance of that particular edge has been strongly suppressed by the first defect. The presence of another defect on the opposite edge further suppresses the quantum conductance, independently of the relative position between the two defects in opposite edges. The introduction of other defects cause the suppression to be energy dependent, leading to conductance peaks which depend on the geometry of the edges. The strong conductance dependence on the presence of edge defects is corroborated by DFT calculations using SIESTA, which show that the electronic bands near the Fermi energy are strongly localized at the edge.

  9. The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.

    PubMed

    Vetrano, Stefania; Danese, Silvio

    2009-05-01

    Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.

  10. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    PubMed

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  11. Continuum theory of edge states of topological insulators: variational principle and boundary conditions.

    PubMed

    Medhi, Amal; Shenoy, Vijay B

    2012-09-05

    We develop a continuum theory to model low energy excitations of a generic four-band time reversal invariant electronic system with boundaries. We propose a variational energy functional for the wavefunctions which allows us to derive natural boundary conditions valid for such systems. Our formulation is particularly suited for developing a continuum theory of the protected edge/surface excitations of topological insulators both in two and three dimensions. By a detailed comparison of our analytical formulation with tight binding calculations of ribbons of topological insulators modelled by the Bernevig-Hughes-Zhang (BHZ) Hamiltonian, we show that the continuum theory with a natural boundary condition provides an appropriate description of the low energy physics.

  12. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  13. Spin-selective electronic reconstruction in quantum ferromagnets: A view from the spin-asymmetric Hubbard model

    NASA Astrophysics Data System (ADS)

    Faúndez, J.; Jorge, T. N.; Craco, L.

    2018-03-01

    Using the tight-binding treatment for the spin-asymmetric Hubbard model we explore the effect of electronic interactions in the ferromagnetic, partially filled Lieb lattice. As a key result we demonstrate the formation of correlation satellites in the minority spin channel. In addition, we consider the role played by transverse-field spin fluctuations in metallic ferromagnets. We quantify the degree of electronic demagnetization, showing that the half-metallic state is rather robust to local spin flips. Not being restricted to the case of a partially filled Lieb lattice, our findings are expected to advance the general understanding of spin-selective electronic reconstruction in strongly correlated quantum ferromagnets.

  14. Theory of nanotube faraday cage

    NASA Astrophysics Data System (ADS)

    Roxana Margine, Elena; Nisoli, Cristiano; Kolmogorov, Aleksey; Crespi, Vincent H.

    2003-03-01

    Charge transfer between dopants and double-wall carbon nanotubes is examined theoretically. We model the system as a triple cylindrical capacitor with the dopants forming a shell around the outer wall of the nanotube. The total energy of the system contains three terms: the band structure energies of the inner and outer tube, calculated in a tight-binding model with rigid bands, and the electrostatic energy of the tri-layer distribution. Even for metallic inner and outer tube walls, wherein the diameter dependence of the bandgap does not favor the outer wall, nearly all of the dopant charge resides on the outer layer, a nanometer-scale Faraday cage. The calculated charge distribution is in agreement with recent experimental measurements.

  15. Opening-assisted coherent transport in the semiclassical regime

    NASA Astrophysics Data System (ADS)

    Zhang, Yang; Celardo, G. Luca; Borgonovi, Fausto; Kaplan, Lev

    2017-02-01

    We study quantum enhancement of transport in open systems in the presence of disorder and dephasing. Quantum coherence effects may significantly enhance transport in open systems even in the semiclassical regime (where the decoherence rate is greater than the intersite hopping amplitude), as long as the disorder is sufficiently strong. When the strengths of disorder and dephasing are fixed, there is an optimal opening strength at which the coherent transport enhancement is optimized. Analytic results are obtained in two simple paradigmatic tight-binding models of large systems: the linear chain and the fully connected network. The physical behavior is also reflected in the Fenna-Matthews-Olson (FMO) photosynthetic complex, which may be viewed as intermediate between these paradigmatic models.

  16. Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

    PubMed Central

    Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

    1999-01-01

    Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307

  17. Mutation-linked, excessively tight interaction between the calmodulin binding domain and the C-terminal domain of the cardiac ryanodine receptor as a novel cause of catecholaminergic polymorphic ventricular tachycardia.

    PubMed

    Nishimura, Shigehiko; Yamamoto, Takeshi; Nakamura, Yoshihide; Kohno, Michiaki; Hamada, Yoriomi; Sufu, Yoko; Fukui, Go; Nanno, Takuma; Ishiguchi, Hironori; Kato, Takayoshi; Xu, Xiaojuan; Ono, Makoto; Oda, Tetsuro; Okuda, Shinichi; Kobayashi, Shigeki; Yano, Masafumi

    2018-06-01

    Ryanodine receptor (RyR2) is known to be a causal gene of catecholaminergic polymorphic ventricular tachycardia (CPVT), an important inherited disease. Some of the human CPVT-associated mutations have been found in a domain (4026-4172) that has EF hand motifs, the so-called calmodulin (CaM)-like domain (CaMLD). The purpose of this study was to investigate the underlying mechanism by which CPVT is induced by a mutation at CaMLD. A new N4103K/+ knock-in (KI) mice model was generated. Sustained ventricular tachycardia was frequently observed after infusion of caffeine plus epinephrine in KI mice. Endogenous CaM bound to RyR2 decreased even at baseline in isolated KI cardiomyocytes. Ca 2+ spark frequency (CaSpF) was much higher in KI cells than in wild-type cells. Addition of GSH-CaM (higher affinity CaM to RyR2) significantly decreased CaSpF. In response to isoproterenol, spontaneous Ca 2+ transient (SCaT) was frequently observed in intact KI cells. Incorporation of GSH-CaM into intact KI cells using a protein delivery kit decreased SCaT significantly. An assay using a quartz crystal microbalance technique revealed that mutated CaMLD peptide showed higher binding affinity to CaM binding domain (CaMBD) peptide. In the N4103K mutant, CaM binding affinity to RyR2 was significantly reduced regardless of beta-adrenergic stimulation. We found that this was caused by an abnormally tight interaction between CaMBD and mutated CaM-like domain (N4103K-CaMBD). Thus, CaMBD-CaMLD interaction may be a novel therapeutic target for treatment of lethal arrhythmia. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  18. Binding of mitochondrial leader sequences to Tom20 assessed using a bacterial two-hybrid system shows that hydrophobic interactions are essential and that some mutated leaders that do not bind Tom20 can still be imported.

    PubMed

    Mukhopadhyay, Abhijit; Yang, Chun-Song; Weiner, Henry

    2006-12-01

    Previous studies pointed to the importance of leucine residues in the binding of mitochondrial leader sequences to Tom20, an outer membrane protein translocator that initially binds the leader during import. A bacteria two-hybrid assay was here employed to determine if this could be an alternative way to investigate the binding of leader to the receptor. Leucine to alanine and arginine to glutamine mutations were made in the leader sequence from rat liver aldehyde dehydrogenase (pALDH). The leucine residues in the C-terminal of pALDH leader were found to be essential for TOM20 binding. The hydrophobic residues of another mitochondrial leader F1beta-ATPase that were important for Tom20 binding were found at the C-terminus of the leader. In contrast, it was the leucines in the N-terminus of the leader of ornithine transcarbamylase that were essential for binding. Modeling the peptides to the structure of Tom20 showed that the hydrophobic residues from the three proteins could all fit into the hydrophobic binding pocket. The mutants of pALDH that did not bind to Tom20 were still imported in vivo in transformed HeLa cells or in vitro into isolated mitochondria. In contrast, the mutant from pOTC was imported less well ( approximately 50%) while the mutant from F1beta-ATPase was not imported to any measurable extent. Binding to Tom20 might not be a prerequisite for import; however, it also is possible that import can occur even if binding to a receptor component is poor, so long as the leader binds tightly to another component of the translocator.

  19. The effects of the glycation of transferrin on chromium binding and the transport and distribution of chromium in vivo.

    PubMed

    Deng, Ge; Dyroff, Samantha L; Lockart, Molly; Bowman, Michael K; Vincent, John B

    2016-11-01

    Chromium (III) has been shown to act as a pharmacological agent improving insulin sensitivity in rodent models of obesity, insulin resistance, and diabetes. To act in beneficial fashion, chromium must reach insulin-sensitive tissues. Chromium is transported from the bloodstream to the tissues by the iron-transport protein transferrin. When blood concentrations of glucose are high (as in a diabetic subject), transferrin can be glycated, modifying its ability to bind and transport iron. However, the effects of glycation of transferrin on its ability to bind and transport Cr have not been examined previously. Storage of transferrin at 37°C in the presence and absence of glucose has significant effects on the binding of Cr. Transferrin stored in the absence of glucose only binds one equivalent of Cr tightly, compared to the normal binding of two equivalents of Cr by transferrin. Glycated transferrin (stored in the presence of glucose) binds two equivalents of Cr but the changes in its extinction coefficient at 245nm that accompany binding suggest that the Cr-bound transferrin possesses a conformation that deviates appreciably from untreated transferrin. These changes have dramatic effects, greatly reducing the ability of transferrin to transport Cr in vivo in rats. The results suggest that glycation of transferrin in subjects with high blood glucose concentrations should reduce the ability of Cr from pharmacological agents to enter tissues. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Optical properties of drug metabolites in latent fingermarks

    PubMed Central

    Shen, Yao; Ai, Qing

    2016-01-01

    Drug metabolites usually have structures of split-ring resonators (SRRs), which might lead to negative permittivity and permeability in electromagnetic field. As a result, in the UV-vis region, the latent fingermarks images of drug addicts and non drug users are inverse. The optical properties of latent fingermarks are quite different between drug addicts and non-drug users. This is a technic superiority for crime scene investigation to distinguish them. In this paper, we calculate the permittivity and permeability of drug metabolites using tight-binding model. The latent fingermarks of smokers and non-smokers are given as an example. PMID:26838730

  1. Bipolaron assisted Bloch-like oscillations in organic lattices

    NASA Astrophysics Data System (ADS)

    Ribeiro, Luiz Antonio; Ferreira da Cunha, Wiliam; Magela e Silva, Geraldo

    2017-06-01

    The transport of a dissociated bipolaron in organic one-dimensional lattices is theoretically investigated in the scope of a tight-binding model that includes electron-lattice interactions and an external electric field. Remarkably, the results point to a physical picture in which the dissociated bipolaron propagates as a combined state of two free-like electrons that coherently perform spatial Bloch oscillations (BO) above a critical field strength. It was also obtained that the BO's trajectory presents a net forward motion in the direction of the applied electric field. The impact of dynamical disorder in the formation of electronic BOs is determined.

  2. Electronic properties of long DNA nanowires in dry and wet conditions

    NASA Astrophysics Data System (ADS)

    Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek

    2015-11-01

    The electronic behavior of the long disordered DNA nanowires in both dry and wet conditions is investigated through the band structure and density of states of a tight-binding Hamiltonian model for π-electrons of the backbone, using Green's functions approach. For a chosen set of parameters in the dry case, semiconducting behavior is reproduced. It is also shown that for sufficiently long strands, the order of the base pairs has no noticeable effect on the energy band-gap. Moreover, this semiconducting duplex shows metallic tendencies when interacting with the environment of polar molecules.

  3. Effect of Hydrogen Adsorption on the Stone-Wales Transformation in Small-Diameter Carbon Nanotubes

    NASA Astrophysics Data System (ADS)

    Openov, L. A.; Podlivaev, A. I.

    2018-04-01

    The effect of hydrogenation of (4, 0) and (3, 0) carbon nanotubes on the Stone-Wales transformation is studied in the framework of the nonorthogonal tight-binding model. It is shown that the atomic hydrogen adsorption can lead to both a decrease and an increase in the barriers for the direct and inverse transformations depending on the orientation of a rotating C-C bond with respect to the nanotube axis. The characteristic times of formation and annealing the Stone-Wales defects have been estimated. The Young's moduli have been calculated.

  4. d +i d chiral superconductivity in a triangular lattice from trigonal bipyramidal complexes

    NASA Astrophysics Data System (ADS)

    Lu, Chen; Zhang, Li-Da; Wu, Xianxin; Yang, Fan; Hu, Jiangping

    2018-04-01

    We model the newly predicted high-Tc superconducting candidates constructed by corner-shared trigonal bipyramidal complexes with an effective three-orbital tight-binding Hamiltonian and investigate the pairing symmetry of their superconducting states driven by electron-electron interactions. Our combined weak- and strong-coupling-based calculations consistently identify the chiral d +i d superconductivity as the leading pairing symmetry in a wide doping range with realistic interaction parameters. This pairing state has a nontrivial topological Chern number and can host gapless chiral edge modes, and the vortex cores under magnetic field can carry Majorana zero modes.

  5. Anisotropic Nanomechanics of Boron Nitride Nanotubes: Nanostructured "Skin" Effect

    NASA Technical Reports Server (NTRS)

    Srivastava, Deepak; Menon, Madhu; Cho, KyeongJae

    2000-01-01

    The stiffness and plasticity of boron nitride nanotubes are investigated using generalized tight-binding molecular dynamics and ab-initio total energy methods. Due to boron-nitride BN bond buckling effects, compressed zigzag BN nanotubes are found to undergo novel anisotropic strain release followed by anisotropic plastic buckling. The strain is preferentially released towards N atoms in the rotated BN bonds. The tubes buckle anisotropically towards only one end when uniaxially compressed from both. A "skin-effect" model of smart nanocomposite materials is proposed which will localize the structural damage towards the 'skin' or surface side of the material.

  6. Observation of interface carrier states in no-common-atom heterostructures ZnSe/BeTe.

    PubMed

    Gurevich, A S; Kochereshko, V P; Bleuse, J; Mariette, H; Waag, A; Akimoto, R

    2011-09-07

    The existence of intrinsic carrier interface states in heterostructures with no common atom at the interface (such as ZnSe/BeTe) is shown experimentally by ellipsometry and photoluminescence spectroscopy. These states are located on interfaces and lie inside the effective bandgap of the structure; they are characterized by a high density and a long lifetime. A tight binding model confirms theoretically the existence of these states in ZnSe/BeTe heterostructures for a ZnTe-type interface, in contrast to the case of the BeSe-type interface for which they do not exist.

  7. Observation of interface carrier states in no-common-atom heterostructures ZnSe/BeTe

    NASA Astrophysics Data System (ADS)

    Gurevich, A. S.; Kochereshko, V. P.; Bleuse, J.; Mariette, H.; Waag, A.; Akimoto, R.

    2011-09-01

    The existence of intrinsic carrier interface states in heterostructures with no common atom at the interface (such as ZnSe/BeTe) is shown experimentally by ellipsometry and photoluminescence spectroscopy. These states are located on interfaces and lie inside the effective bandgap of the structure; they are characterized by a high density and a long lifetime. A tight binding model confirms theoretically the existence of these states in ZnSe/BeTe heterostructures for a ZnTe-type interface, in contrast to the case of the BeSe-type interface for which they do not exist.

  8. Many-body instabilities and mass generation in slow Dirac materials

    NASA Astrophysics Data System (ADS)

    Triola, Christopher; Zhu, Jianxin; Migliori, Albert; Balatsky, Alexander

    2015-03-01

    Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum, the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model we study the many-body instabilities of these systems and identify regions of parameter space for which antiferromagnetic, ferromagnetic and charge density wave instabilities occur. Work Supported by USDOE BES E304.

  9. Thermally induced charge current through long molecules

    NASA Astrophysics Data System (ADS)

    Zimbovskaya, Natalya A.; Nitzan, Abraham

    2018-01-01

    In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

  10. Structural basis of kynurenine 3-monooxygenase inhibition.

    PubMed

    Amaral, Marta; Levy, Colin; Heyes, Derren J; Lafite, Pierre; Outeiro, Tiago F; Giorgini, Flaviano; Leys, David; Scrutton, Nigel S

    2013-04-18

    Inhibition of kynurenine 3-monooxygenase (KMO), an enzyme in the eukaryotic tryptophan catabolic pathway (that is, kynurenine pathway), leads to amelioration of Huntington's-disease-relevant phenotypes in yeast, fruitfly and mouse models, as well as in a mouse model of Alzheimer's disease. KMO is a flavin adenine dinucleotide (FAD)-dependent monooxygenase and is located in the outer mitochondrial membrane where it converts l-kynurenine to 3-hydroxykynurenine. Perturbations in the levels of kynurenine pathway metabolites have been linked to the pathogenesis of a spectrum of brain disorders, as well as cancer and several peripheral inflammatory conditions. Despite the importance of KMO as a target for neurodegenerative disease, the molecular basis of KMO inhibition by available lead compounds has remained unknown. Here we report the first crystal structure of Saccharomyces cerevisiae KMO, in the free form and in complex with the tight-binding inhibitor UPF 648. UPF 648 binds close to the FAD cofactor and perturbs the local active-site structure, preventing productive binding of the substrate l-kynurenine. Functional assays and targeted mutagenesis reveal that the active-site architecture and UPF 648 binding are essentially identical in human KMO, validating the yeast KMO-UPF 648 structure as a template for structure-based drug design. This will inform the search for new KMO inhibitors that are able to cross the blood-brain barrier in targeted therapies against neurodegenerative diseases such as Huntington's, Alzheimer's and Parkinson's diseases.

  11. Tight-binding calculation of the magnetic moment of CrAs under pressure

    NASA Astrophysics Data System (ADS)

    Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio

    2018-03-01

    We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.

  12. Electro-optical properties of zigzag and armchair boron nitride nanotubes under a transverse electric field: Tight binding calculations

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2012-02-01

    The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.

  13. Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices

    NASA Astrophysics Data System (ADS)

    Graefe, E. M.; Korsch, H. J.; Rush, A.

    2016-07-01

    Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.

  14. ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

    NASA Astrophysics Data System (ADS)

    Korol, Roman; Kilgour, Michael; Segal, Dvira

    2018-03-01

    We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuevas, F.A.; Curilef, S., E-mail: scurilef@ucn.cl; Plastino, A.R., E-mail: arplastino@ugr.es

    The spread of a wave-packet (or its deformation) is a very important topic in quantum mechanics. Understanding this phenomenon is relevant in connection with the study of diverse physical systems. In this paper we apply various 'spreading measures' to characterize the evolution of an initially localized wave-packet in a tight-binding lattice, with special emphasis on information-theoretical measures. We investigate the behavior of both the probability distribution associated with the wave packet and the concomitant probability current. Complexity measures based upon Renyi entropies appear to be particularly good descriptors of the details of the delocalization process. - Highlights: > Spread ofmore » highly localized wave-packet in the tight-binding lattice. > Entropic and information-theoretical characterization is used to understand the delocalization. > The behavior of both the probability distribution and the concomitant probability current is investigated. > Renyi entropies appear to be good descriptors of the details of the delocalization process.« less

  16. Communication: Charge-population based dispersion interactions for molecules and materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

    2016-04-21

    We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less

  17. Reusable Component Model Development Approach for Parallel and Distributed Simulation

    PubMed Central

    Zhu, Feng; Yao, Yiping; Chen, Huilong; Yao, Feng

    2014-01-01

    Model reuse is a key issue to be resolved in parallel and distributed simulation at present. However, component models built by different domain experts usually have diversiform interfaces, couple tightly, and bind with simulation platforms closely. As a result, they are difficult to be reused across different simulation platforms and applications. To address the problem, this paper first proposed a reusable component model framework. Based on this framework, then our reusable model development approach is elaborated, which contains two phases: (1) domain experts create simulation computational modules observing three principles to achieve their independence; (2) model developer encapsulates these simulation computational modules with six standard service interfaces to improve their reusability. The case study of a radar model indicates that the model developed using our approach has good reusability and it is easy to be used in different simulation platforms and applications. PMID:24729751

  18. Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

    PubMed Central

    Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

    2018-01-01

    Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348

  19. Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

    PubMed

    Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

    2017-07-01

    Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

  20. Assembly of streptolysin O pores assessed by quartz crystal microbalance and atomic force microscopy provides evidence for the formation of anchored but incomplete oligomers.

    PubMed

    Stewart, Sarah E; D'Angelo, Michael E; Paintavigna, Stefania; Tabor, Rico F; Martin, Lisandra L; Bird, Phillip I

    2015-01-01

    Streptolysin O (SLO) is a bacterial pore forming protein that is part of the cholesterol dependent cytolysin (CDC) family. We have used quartz crystal microbalance with dissipation monitoring (QCM-D) to examine SLO membrane binding and pore formation. In this system, SLO binds tightly to cholesterol-containing membranes, and assembles into partial and complete pores confirmed by atomic force microscopy. SLO binds to the lipid bilayer at a single rate consistent with the Langmuir isotherm model of adsorption. Changes in dissipation illustrate that SLO alters the viscoelastic properties of the bilayer during pore formation, but there is no loss of material from the bilayer as reported for small membrane-penetrating peptides. SLO mutants were used to further dissect the assembly and insertion processes by QCM-D. This shows the signature of SLO in QCM-D changes when pore formation is inhibited, and that bound and inserted SLO forms can be distinguished. Furthermore a pre-pore locked SLO mutant binds reversibly to lipid, suggesting that the partially complete wtSLO forms observed by AFM are anchored to the membrane. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Transition States and transition state analogue interactions with enzymes.

    PubMed

    Schramm, Vern L

    2015-04-21

    Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.

  2. Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2

    PubMed Central

    Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.

    2009-01-01

    Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464

  3. Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

    PubMed

    Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

    2017-11-16

    The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold

    2010-10-01

    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  5. Antifreeze Protein Binds Irreversibly to Ice

    NASA Astrophysics Data System (ADS)

    Braslavsky, I.; Pertaya, N.; di Prinzio, C. L.; Wilen, L.; Thomson, E.; Wettlaufer, J. S.; Marshall, C. B.; Davies, P. L.

    2006-03-01

    Many organisms are protected from freezing by antifreeze proteins (AFPs), which bind to ice and prevent its growth by a mechanism not completely understood. Although it has been postulated that AFPs would have to bind irreversibly to arrest the growth of an ice crystal bathed in excess liquid water, the binding forces seem insufficient to support such a tight interaction. By putting a fluorescent tag on a fish AFP, we were able to visualize AFP binding to ice and demonstrate, by lack of recovery after photo-bleaching, that it is indeed irreversible. Because even the most avid protein/ligand interactions exhibit reversibility, this finding is key to understanding the mechanism of antifreeze proteins, which are becoming increasingly valuable in cryopreservation and improving the frost tolerance of crops.

  6. Quantitative analyses of bifunctional molecules.

    PubMed

    Braun, Patrick D; Wandless, Thomas J

    2004-05-11

    Small molecules can be discovered or engineered to bind tightly to biologically relevant proteins, and these molecules have proven to be powerful tools for both basic research and therapeutic applications. In many cases, detailed biophysical analyses of the intermolecular binding events are essential for improving the activity of the small molecules. These interactions can often be characterized as straightforward bimolecular binding events, and a variety of experimental and analytical techniques have been developed and refined to facilitate these analyses. Several investigators have recently synthesized heterodimeric molecules that are designed to bind simultaneously with two different proteins to form ternary complexes. These heterodimeric molecules often display compelling biological activity; however, they are difficult to characterize. The bimolecular interaction between one protein and the heterodimeric ligand (primary dissociation constant) can be determined by a number of methods. However, the interaction between that protein-ligand complex and the second protein (secondary dissociation constant) is more difficult to measure due to the noncovalent nature of the original protein-ligand complex. Consequently, these heterodimeric compounds are often characterized in terms of their activity, which is an experimentally dependent metric. We have developed a general quantitative mathematical model that can be used to measure both the primary (protein + ligand) and secondary (protein-ligand + protein) dissociation constants for heterodimeric small molecules. These values are largely independent of the experimental technique used and furthermore provide a direct measure of the thermodynamic stability of the ternary complexes that are formed. Fluorescence polarization and this model were used to characterize the heterodimeric molecule, SLFpYEEI, which binds to both FKBP12 and the Fyn SH2 domain, demonstrating that the model is useful for both predictive as well as ex post facto analytical applications.

  7. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

    PubMed Central

    Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

    2011-01-01

    RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178

  8. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

    PubMed

    Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

    2011-04-29

    RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Engineering Encodable Lanthanide-Binding Tags (LBTs) into Loop Regions of Proteins

    PubMed Central

    Barthelmes, Katja; Reynolds, Anne M.; Peisach, Ezra; Jonker, Hendrik R. A.; DeNunzio, Nicholas J.; Allen, Karen N.; Imperiali, Barbara; Schwalbe, Harald

    2011-01-01

    Lanthanide-binding-tags (LBTs) are valuable tools for investigation of protein structure, function, and dynamics by NMR spectroscopy, X-ray crystallography and luminescence studies. We have inserted LBTs into three different loop positions (denoted L, R, and S) of the model protein interleukin-1β and varied the length of the spacer between the LBT and the protein (denoted 1-3). Luminescence studies demonstrate that all nine constructs bind Tb3+ tightly in the low nanomolar range. No significant change in the fusion protein occurs from insertion of the LBT, as shown by two X-ray crystallographic structures of the IL1β-S1 and IL1β-L3 constructs and for the remaining constructs by comparing 1H-15N-HSQC NMR spectra with wild-type IL1β. Additionally, binding of LBT-loop IL1β proteins to their native binding partner in vitro remains unaltered. X-ray crystallographic phasing was successful using only the signal from the bound lanthanide. Large residual dipolar couplings (RDCs) could be determined by NMR spectroscopy for all LBT-loop-constructs and revealed that the LBT-2 series were rigidly incorporated into the interleukin-1β structure. The paramagnetic NMR spectra of loop-LBT mutant IL1β-R2 were assigned and the Δχ tensor components were calculated based on RDCs and pseudocontact shifts (PCSs). A structural model of the IL1β-R2 construct was calculated using the paramagnetic restraints. The current data provide support that encodable LBTs serve as versatile biophysical tags when inserted into loop regions of proteins of known structure or predicted via homology modelling. PMID:21182275

  10. AFRRI Reports, Second Quarter 1994

    DTIC Science & Technology

    1994-08-01

    the antrum wete immediately placed in sterile 0.9% NaCl, kept on ice, coded, and then prepared for culture, smears, and urease assay by homogeniza...high urease specific activity (>1 |J.mol- min-1 ■ mg protein-1) plus high-affinity substrate binding (Mi- chaelis constant [K^\\ < 1 mmol/L),27 in at...031, respectively), and the characteristic bacterial growth with high-activity product.on of a urease with tight substrate binding " was found in

  11. Triazole biotin: a tight-binding biotinidase-resistant conjugate.

    PubMed

    Germeroth, Anne I; Hanna, Jill R; Karim, Rehana; Kundel, Franziska; Lowther, Jonathan; Neate, Peter G N; Blackburn, Elizabeth A; Wear, Martin A; Campopiano, Dominic J; Hulme, Alison N

    2013-11-28

    The natural amide bond found in all biotinylated proteins has been replaced with a triazole through CuAAC reaction of an alkynyl biotin derivative. The resultant triazole-linked adducts are shown to be highly resistant to the ubiquitous hydrolytic enzyme biotinidase and to bind avidin with dissociation constants in the low pM range. Application of this strategy to the production of a series of biotinidase-resistant biotin-Gd-DOTA contrast agents is demonstrated.

  12. Regulation of transcriptional activators by DNA-binding domain ubiquitination

    PubMed Central

    Landré, Vivien; Revi, Bhindu; Mir, Maria Gil; Verma, Chandra; Hupp, Ted R; Gilbert, Nick; Ball, Kathryn L

    2017-01-01

    Ubiquitin is a key component of the regulatory network that maintains gene expression in eukaryotes, yet the molecular mechanism(s) by which non-degradative ubiquitination modulates transcriptional activator (TA) function is unknown. Here endogenous p53, a stress-activated transcription factor required to maintain health, is stably monoubiquitinated, following pathway activation by IR or Nutlin-3 and localized to the nucleus where it becomes tightly associated with chromatin. Comparative structure–function analysis and in silico modelling demonstrate a direct role for DNA-binding domain (DBD) monoubiquitination in TA activation. When attached to the DBD of either p53, or a second TA IRF-1, ubiquitin is orientated towards, and makes contact with, the DNA. The contact is made between a predominantly cationic surface on ubiquitin and the anionic DNA. Our data demonstrate an unexpected role for ubiquitin in the mechanism of TA-activity enhancement and provides insight into a new level of transcriptional regulation. PMID:28362432

  13. Structure-guided design of an engineered streptavidin with reusability to purify streptavidin-binding peptide tagged proteins or biotinylated proteins.

    PubMed

    Wu, Sau-Ching; Wong, Sui-Lam

    2013-01-01

    Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.

  14. Structure-Guided Design of an Engineered Streptavidin with Reusability to Purify Streptavidin-Binding Peptide Tagged Proteins or Biotinylated Proteins

    PubMed Central

    Wu, Sau-Ching; Wong, Sui-Lam

    2013-01-01

    Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971

  15. Electrical design of InAs-Sb/GaSb superlattices for optical detectors using full bandstructure sp3s* tight-binding method and Bloch boundary conditions

    NASA Astrophysics Data System (ADS)

    Mir, Raja N.; Frensley, William R.

    2013-10-01

    InAs-Sb/GaSb type-II strain compensated superlattices (SLS) are currently being used in mid-wave and long-wave infrared photodetectors. The electronic bandstructure of InSb and GaSb shows very strong anisotropy and non-parabolicity close to the Γ-point for the conduction band (CB) minimum and the valence band (VB) maximum. Particularly around the energy range of 45-80 meV from band-edge we observe strong non-parabolicity in the CB and light hole VB. The band-edge dispersion determines the electrical properties of a material. When the bulk materials are combined to form a superlattice we need a model of bandstructure which takes into account the full bandstructure details of the constituents and also the strong interaction between the conduction band of InAs and valence bands of GaSb. There can also be contact potentials near the interface between two dissimilar superlattices which will not be captured unless a full bandstructure calculation is done. In this study, we have done a calculation using second nearest neighbor tight binding model in order to accurately reproduce the effective masses. The calculation of mini-band structure is done by finding the wavefunctions within one SL period subject to Bloch boundary conditions ψ(L)=ψ(0)eikL. We demonstrate in this paper how a calculation of carrier concentration as a function of the position of the Fermi level (EF) within bandgap(Eg) should be done in order to take into account the full bandstructure of broken-bandgap material systems. This calculation is key for determining electron transport particularly when we have an interface between two dissimilar superlattices.

  16. Playing relativistic billiards beyond graphene

    NASA Astrophysics Data System (ADS)

    Sadurní, E.; Seligman, T. H.; Mortessagne, F.

    2010-05-01

    The possibility of using hexagonal structures in general, and graphene in particular, to emulate the Dirac equation is the topic under consideration here. We show that Dirac oscillators with or without rest mass can be emulated by distorting a tight-binding model on a hexagonal structure. In the quest to make a toy model for such relativistic equations, we first show that a hexagonal lattice of attractive potential wells would be a good candidate. Firstly, we consider the corresponding one-dimensional (1D) model giving rise to a 1D Dirac oscillator and then construct explicitly the deformations needed in the 2D case. Finally, we discuss how such a model can be implemented as an electromagnetic billiard using arrays of dielectric resonators between two conducting plates that ensure evanescent modes outside the resonators for transversal electric modes, and we describe a feasible experimental setup.

  17. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  18. Modified Hydra Bioassay to Evaluate the Toxicity of Multiple Mycotoxins and Predict the Detoxification Efficacy of a Clay-Based Sorbent

    PubMed Central

    Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD

    2013-01-01

    Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854

  19. Modified hydra bioassay to evaluate the toxicity of multiple mycotoxins and predict the detoxification efficacy of a clay-based sorbent.

    PubMed

    Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D

    2014-01-01

    Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. Copyright © 2012 John Wiley & Sons, Ltd.

  20. Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria

    2016-08-15

    Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP 2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL -) with a distinct second site is required for high PIP 2sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP 2sensitivity, even in the absence of PL -. Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP 2(2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domainmore » (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL -binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP 2site and explaining the positive allostery between PL -binding and PIP 2sensitivity.« less

  1. Increasing the potency of an alhydrogel-formulated anthrax vaccine by minimizing antigen-adjuvant interactions.

    PubMed

    Watkinson, Allan; Soliakov, Andrei; Ganesan, Ashok; Hirst, Karie; Lebutt, Chris; Fleetwood, Kelly; Fusco, Peter C; Fuerst, Thomas R; Lakey, Jeremy H

    2013-11-01

    Aluminum salts are the most widely used vaccine adjuvants, and phosphate is known to modulate antigen-adjuvant interactions. Here we report an unexpected role for phosphate buffer in an anthrax vaccine (SparVax) containing recombinant protective antigen (rPA) and aluminum oxyhydroxide (AlOH) adjuvant (Alhydrogel). Phosphate ions bind to AlOH to produce an aluminum phosphate surface with a reduced rPA adsorption coefficient and binding capacity. However, these effects continued to increase as the free phosphate concentration increased, and the binding of rPA changed from endothermic to exothermic. Crucially, phosphate restored the thermostability of bound rPA so that it resembled the soluble form, even though it remained tightly bound to the surface. Batches of vaccine with either 0.25 mM (subsaturated) or 4 mM (saturated) phosphate were tested in a disease model at batch release, which showed that the latter was significantly more potent. Both formulations retained their potency for 3 years. The strongest aluminum adjuvant effects are thus likely to be via weakly attached or easily released native-state antigen proteins.

  2. Ubiquitin-like domains can target to the proteasome but proteolysis requires a disordered region.

    PubMed

    Yu, Houqing; Kago, Grace; Yellman, Christopher M; Matouschek, Andreas

    2016-07-15

    Ubiquitin and some of its homologues target proteins to the proteasome for degradation. Other ubiquitin-like domains are involved in cellular processes unrelated to the proteasome, and proteins containing these domains remain stable in the cell. We find that the 10 yeast ubiquitin-like domains tested bind to the proteasome, and that all 11 identified domains can target proteins for degradation. Their apparent proteasome affinities are not directly related to their stabilities or functions. That is, ubiquitin-like domains in proteins not part of the ubiquitin proteasome system may bind the proteasome more tightly than domains in proteins that are bona fide components. We propose that proteins with ubiquitin-like domains have properties other than proteasome binding that confer stability. We show that one of these properties is the absence of accessible disordered regions that allow the proteasome to initiate degradation. In support of this model, we find that Mdy2 is degraded in yeast when a disordered region in the protein becomes exposed and that the attachment of a disordered region to Ubp6 leads to its degradation. © 2016 The Authors.

  3. Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids.

    PubMed

    Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria; Heyman, Sarah; Stary-Weinzinger, Anna; Yuan, Peng; Nichols, Colin G

    2016-09-01

    Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL(-)) with a distinct second site is required for high PIP2 sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP2 sensitivity, even in the absence of PL(-) Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP2 (2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domain (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL(-) binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP2 site and explaining the positive allostery between PL(-) binding and PIP2 sensitivity. © 2016 Lee et al.

  4. Slow-binding inhibition of sialidase from influenza virus.

    PubMed

    Pegg, M S; von Itzstein, M

    1994-04-01

    Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.

  5. Implementing the SU(2) Symmetry for the DMRG

    NASA Astrophysics Data System (ADS)

    Alvarez, Gonzalo

    2010-03-01

    In the Density Matrix Renormalization Group (DMRG) algorithm (White, 1992), Hamiltonian symmetries play an important role. Using symmetries, the matrix representation of the Hamiltonian can be blocked. Diagonalizing each matrix block is more efficient than diagonalizing the original matrix. This talk will explain how the DMRG++ codefootnotetextarXiv:0902.3185 or Computer Physics Communications 180 (2009) 1572-1578. has been extended to handle the non-local SU(2) symmetry in a model independent way. Improvements in CPU times compared to runs with only local symmetries will be discussed for typical tight-binding models of strongly correlated electronic systems. The computational bottleneck of the algorithm, and the use of shared memory parallelization will also be addressed. Finally, a roadmap for future work on DMRG++ will be presented.

  6. The Biotin/Avidin complex adhesion force

    NASA Astrophysics Data System (ADS)

    Balsera, Manel A.; Izrailev, Sergei; Stepaniants, Sergey; Oono, Yoshitsugu; Schulten, Klaus

    1997-03-01

    The vitamin Biotin and the protein avidin form one of the strongest non-covalent bonds between biological molecules. We have performed molecular and stochastic dynamic modeling of the unbinding of this complex(Izrailev et al., Biophysical Journal, In press). These simulations provide insight into the effect of particular residues and water on the tight binding of the system. With the aid of simple phenomenological models we have related qualitatively our results to Atomic Force Microscopy adhesion force measurements (E.-L. Florin, V. T. Moy and H. E. Gaub Science) 264:415-417 and kinetic dissociation experiments( A. Chilcotti and P. S. Stayton, J. Am. Chem. Soc.) 117:10622-10628. We will discuss the difficulties preventing a more quantitative understanding of the unbinding force and kinetics.

  7. Intermediate activity of midge antifreeze protein is due to a tyrosine-rich ice-binding site and atypical ice plane affinity.

    PubMed

    Basu, Koli; Wasserman, Samantha S; Jeronimo, Paul S; Graham, Laurie A; Davies, Peter L

    2016-04-01

    An antifreeze protein (AFP) from a midge (Chironomidae) was recently discovered and modelled as a tightly wound disulfide-braced solenoid with a surface-exposed rank of stacked tyrosines. New isoforms of the midge AFP have been identified from RT-PCR and are fully consistent with the model. Although they differ in the number of 10-residue coils, the row of tyrosines that form the putative ice-binding site is conserved. Recombinant midge AFP has been produced, and the properly folded form purified by ice affinity. This monomeric AFP has a distinct circular dichroism spectrum, a melting temperature between 35 and 50 °C and is fully renaturable on cooling. Mutagenesis of the middle tyrosine in the rank of seven eliminates antifreeze activity, whereas mutation of a tyrosine off this predicted ice-binding face had no such effect. This AFP has unusual properties compared to other known AFPs. First, its freezing-point depression activity is intermediate between that of the hyperactive and moderately active AFPs. As with hyperactive AFPs, when midge AFP-bound ice crystals exceed their freezing-point depression, ice grows explosively perpendicular to the c-axis. However, midge AFP does not bind to the basal plane of ice as do hyperactive AFPs, but rather to a pyramidal plane that is at a shallower angle relative to the basal plane than binding planes of moderate AFPs. These properties distinguish midge AFP from all other ice-binding proteins and the intermediate activity level fits well to the modest challenge of protecting newly emerged adult insects from late spring frosts. Nucleotide sequences of new midge AFP isoforms are available in the GenBank database under accession numbers KU094814-8. Sequences will be released after publication. © 2016 Federation of European Biochemical Societies.

  8. Tight-Binding Inhibition of Human Monoamine Oxidase B by Chromone Analogs: A Kinetic, Crystallographic, and Biological Analysis.

    PubMed

    Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia

    2018-05-10

    Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).

  9. The K-turn motif in riboswitches and other RNA species☆

    PubMed Central

    Lilley, David M.J.

    2014-01-01

    The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078

  10. Optimization of binding electrostatics: Charge complementarity in the barnase-barstar protein complex

    PubMed Central

    lee, Lee-Peng; Tidor, Bruce

    2001-01-01

    Theoretical and experimental studies have shown that the large desolvation penalty required for polar and charged groups frequently precludes their involvement in electrostatic interactions that contribute strongly to net stability in the folding or binding of proteins in aqueous solution near room temperature. We have previously developed a theoretical framework for computing optimized electrostatic interactions and illustrated use of the algorithm with simplified geometries. Given a receptor and model assumptions, the method computes the ligand-charge distribution that provides the most favorable balance of desolvation and interaction effects on binding. In this paper the method has been extended to treat complexes using actual molecular shapes. The barnase-barstar protein complex was investigated with barnase treated as a target receptor. The atomic point charges of barstar were varied to optimize the electrostatic binding free energy. Barnase and natural barstar form a tight complex (Kd ∼ 10−14 M) with many charged and polar groups near the interface that make this a particularly relevant system for investigating the role of electrostatic effects on binding. The results show that sets of barstar charges (resulting from optimization with different constraints) can be found that give rise to relatively large predicted improvements in electrostatic binding free energy. Principles for enhancing the effect of electrostatic interactions in molecular binding in aqueous environments are discussed in light of the optima. Our findings suggest that, in general, the enhancements in electrostatic binding free energy resulting from modification of polar and charged groups can be substantial. Moreover, a recently proposed definition of electrostatic complementarity is shown to be a useful tool for examining binding interfaces. Finally, calculational results suggest that wild-type barstar is closer to being affinity optimized than is barnase for their mutual binding, consistent with the known roles of these proteins. PMID:11266622

  11. Increasing the affinity of selective bZIP-binding peptides through surface residue redesign.

    PubMed

    Kaplan, Jenifer B; Reinke, Aaron W; Keating, Amy E

    2014-07-01

    The coiled-coil dimer is a prevalent protein interaction motif that is important for many cellular processes. The basic leucine-zipper (bZIP) transcription factors are one family of proteins for which coiled-coil mediated dimerization is essential for function, and misregulation of bZIPs can lead to disease states including cancer. This makes coiled coils attractive protein-protein interaction targets to disrupt using engineered molecules. Previous work designing peptides to compete with native coiled-coil interactions focused primarily on designing the core residues of the interface to achieve affinity and specificity. However, folding studies on the model bZIP GCN4 show that coiled-coil surface residues also contribute to binding affinity. Here we extend a prior study in which peptides were designed to bind tightly and specifically to representative members of each of 20 human bZIP families. These "anti-bZIP" peptides were designed with an emphasis on target-binding specificity, with contributions to design-target specificity and affinity engineered considering only the coiled-coil core residues. High-throughput testing using peptide arrays indicated many successes. We have now measured the binding affinities and specificities of anti-bZIPs that bind to FOS, XBP1, ATF6, and CREBZF in solution and tested whether redesigning the surface residues can increase design-target affinity. Incorporating residues that favor helix formation into the designs increased binding affinities in all cases, providing low-nanomolar binders of each target. However, changes in surface electrostatic interactions sometimes changed the binding specificity of the designed peptides. © 2014 The Protein Society.

  12. Conductance of AFM Deformed Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)

    2002-01-01

    This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.

  13. Processing Impact on Monoclonal Antibody Drug Products: Protein Subvisible Particulate Formation Induced by Grinding Stress.

    PubMed

    Gikanga, Benson; Eisner, Devon Roshan; Ovadia, Robert; Day, Eric S; Stauch, Oliver B; Maa, Yuh-Fun

    2017-01-01

    Subvisible particle formation in monoclonal antibody drug product resulting from mixing and filling operations represents a significant processing risk that can lead to filter fouling and thereby lead to process delays or failures. Several previous studies from our lab and others demonstrated the formation of subvisible particulates in mAb formulations resulting from mixing operations using some bottom-mounted mixers or stirrer bars. It was hypothesized that the stress (e.g., shear/cavitation) derived from tight clearance and/or close contact between the impeller and shaft was responsible for protein subvisible particulate generation. These studies, however, could not distinguish between the two surfaces without contact (tight clearance) or between two contacting surfaces (close contact). In the present study we expand on those findings and utilize small-scale mixing models that are able to, for the first time, distinguish between tight clearances and tight contact. In this study we evaluated different mixer types including a top-mounted mixer, several impeller-based bottom-mounted mixers, and a rotary piston pump. The impact of tight clearance/close contact on subvisible particle formation in at-scale mixing platforms was demonstrated in the gap between the impeller and drive unit as well as between the piston and the housing of the pump. Furthermore, small-scale mixing models based on different designs of magnetic stir bars that mimic the tight clearance/close contact of the manufacturing-scale mixers also induced subvisible particles in mAb formulations. Additional small-scale models that feature tight clearance but no close contact (grinding) suggested that it is the repeated grinding/contacting of the moving parts and not the presence of tight clearance in the processing equipment that is the root cause of protein subvisible particulate formation. When multiple mAbs, Fabs (fragment antigen binding), or non-antibody related proteins were mixed in the small-scale mixing model, for molecules investigated, it was observed that mAbs and Fabs appear to be more susceptible to particle formation than non-antibody-related proteins. In the grinding zone, mAb/Fab molecules aggregated into insoluble particles with neither detectable soluble aggregates nor fragmented species. This investigation represents a step closer to the understanding of the underlying stress mechanism leading to mAb subvisible particulate formation as the result of drug product processing. LAY ABSTRACT: Mixing and fill finish are important unit operations in drug product manufacturing for compounding (dilution, pooling, homogenization, etc.) and filling into primary packaging containers (vials, pre-filled syringes, etc.), respectively. The current trend in adopting bottom-mounted mixers as well as low fill-volume filling systems has raised concerns about their impact on drug product quality and process performance. However, investigations into the effects of their use for biopharmaceutical products, particularly monoclonal antibody formulations, are rarely published. The purpose of this study is three-fold: (1) to revisit the impact of bottom-mounted mixer design on monoclonal antibody subvisible particle formation; (2) to identify the root cause for subvisible particle formation; and (3) to fully utilize available particle analysis tools to demonstrate the correlation between particle count in the solution and filter fouling during sterile filtration. The outcomes of this study will benefit scientists and engineers who develop biologic product manufacturing processes by providing a better understanding of drug product process challenges. © PDA, Inc. 2017.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sahu, Sivabrata, E-mail: siva1987@iopb.res.in; Parashar, S. K. S., E-mail: sksparashar@yahoo.com; Rout, G. C., E-mail: gcr@iopb.res.in

    We address here a tight-binding theoretical model calculation for AA-stacked bi-layer graphene taking into account of a biased potential between two layers to study the density of states and the band dispersion within the total Brillouin zone. We have calculated the electronic Green’s function for electron operator corresponding to A and B sub lattices by Zubarev’s Green’s function technique from which the electronic density of states and the electron band energy dispersion are calculated. The numerically computed density of states and band energy dispersions are investigated by tuning the biased potential to exhibit the band gap by varying the differentmore » physical parameters.« less

  15. Highly tunable charge and spin transport in silicene junctions: phase transitions and half-metallic states.

    PubMed

    Mahdavifar, Maryam; Khoeini, Farhad

    2018-08-10

    We report peculiar charge and spin transport properties in S-shaped silicene junctions with the Kane-Mele tight-binding model. In this work, we investigate the effects of electric and exchange fields on the charge and spin transport properties. Our results show that by applying a perpendicular electric field, metal-semiconductor and also semimetal-semiconductor phase transitions occur in our systems. Furthermore, full spin current can be obtained in the structures, so the half-metallic states are observable. Our results enable us to control charge and spin currents and provide new opportunities and applications in silicene-based electronics, optoelectronics, and spintronics.

  16. Gate-Controllable Magneto-optic Kerr Effect in Layered Collinear Antiferromagnets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sivadas, Nikhil; Okamoto, Satoshi; Xiao, Di

    2016-12-23

    In this paper, using symmetry arguments and a tight-binding model, we show that for layered collinear antiferromagnets, magneto-optic effects can be generated and manipulated by controlling crystal symmetries through a gate voltage. This provides a promising route for electric field manipulation of the magneto-optic effects without modifying the underlying magnetic structure. We further demonstrate the gate control of the magneto-optic Kerr effect (MOKE) in bilayer MnPSe 3 using first-principles calculations. Finally, the field-induced inversion symmetry breaking effect leads to gate-controllable MOKE, whose direction of rotation can be switched by the reversal of the gate voltage.

  17. Conductance of single microRNAs chains related to the autism spectrum disorder

    NASA Astrophysics Data System (ADS)

    Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.

    2014-09-01

    The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.

  18. Twisting dirac fermions: circular dichroism in bilayer graphene

    NASA Astrophysics Data System (ADS)

    Suárez Morell, E.; Chico, Leonor; Brey, Luis

    2017-09-01

    Twisted bilayer graphene is a chiral system which has been recently shown to present circular dichroism. In this work we show that the origin of this optical activity is the rotation of the Dirac fermions’ helicities in the top and bottom layer. Starting from the Kubo formula, we obtain a compact expression for the Hall conductivity that takes into account the dephasing of the electromagnetic field between the top and bottom layers and gathers all the symmetries of the system. Our results are based in both a continuum and a tight-binding model, and they can be generalized to any two-dimensional Dirac material with a chiral stacking between layers.

  19. Influence of gap states on the nonresonant second hyperpolarizabilities of conjugated organic polymers

    NASA Technical Reports Server (NTRS)

    Beratan, David N.

    1989-01-01

    The presence of conjugation and substitution defects introduces gap states in finite polyenes that are shown to influence the size and sign of the second molecular hyperpolarizability (SMH). Using a one-electron tight-binding model, the dependence of SMH on the defect-state occupancy and energy in finite polyenes is calculated. Defects can cause a significant decrease or enhancement of SMH by impeding charge delocalization or by creating partly filled bands (mimicking the one-band limit), respectively. Concomitant sign changes in SMH are predicted. Calculation results suggest strategies for designing molecules that can be either photochemically or electrochemically switched between states with considerably different SMHs.

  20. Electron Spin Dephasing and Decoherence by Interaction with Nuclear Spins in Self-Assembled Quantum Dots

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; vonAllmen, Paul; Oyafuso, Fabiano; Klimeck, Gerhard; Whale, K. Birgitta

    2004-01-01

    Electron spin dephasing and decoherence by its interaction with nuclear spins in self-assembled quantum dots are investigated in the framework of the empirical tight-binding model. Electron spin dephasing in an ensemble of dots is induced by the inhomogeneous precession frequencies of the electron among dots, while electron spin decoherence in a single dot arises from the inhomogeneous precession frequencies of nuclear spins in the dot. For In(x)Ga(1-x) As self-assembled dots containing 30000 nuclei, the dephasing and decoherence times are predicted to be on the order of 100 ps and 1 (micro)s.

  1. Exciton intrachain transport induced by interchain packing configurations in conjugated polymers.

    PubMed

    Meng, Ruixuan; Gao, Kun; Zhang, Gaiyan; Han, Shixuan; Yang, Fujiang; Li, Yuan; Xie, Shijie

    2015-07-28

    Based on a tight binding model combined with a nonadiabatic dynamics approach, we theoretically investigate the exciton intrachain transport in conjugated polymers with different interchain packing configurations. We construct two different interchain packing configurations, i.e. linear and exponential forms, and simulate the dynamical processes of the exciton transport in these systems. We find that, in both cases, there exists a distribution of driving force for exciton transport, which stems from the gradient of the exciton creation energy along the chains. This finding enriches the picture of exciton transport in polymers and provides a new idea to improve the exciton transport length in polymeric photovoltaic devices.

  2. Transparent lattices and their solitary waves.

    PubMed

    Sadurní, E

    2014-09-01

    We provide a family of transparent tight-binding models with nontrivial potentials and site-dependent hopping parameters. Their feasibility is discussed in electromagnetic resonators, dielectric slabs, and quantum-mechanical traps. In the second part of the paper, the arrays are obtained through a generalization of supersymmetric quantum mechanics in discrete variables. The formalism includes a finite-difference Darboux transformation applied to the scattering matrix of a periodic array. A procedure for constructing a hierarchy of discrete Hamiltonians is indicated and a particular biparametric family is given. The corresponding potentials and hopping functions are identified as solitary waves, pointing to a discrete spinorial generalization of the Korteweg-deVries family.

  3. Pressure Effects on the Magnetic Phase Transition of Mn3SnC1-xNx (x = 0, 0.5)

    NASA Astrophysics Data System (ADS)

    Hu, Jing-Yu; Wen, Yong-Chun; Yao, Yuan; Wang, Cong; Zhao, Qing; Jin, Chang-Qing; Yu, Ri-Cheng

    2012-08-01

    The electronic transport properties of Mn3SnC and Mn3SnC0.5N0.5 were measured under pressures up to 1.8 GPa. At ambient pressure, an abrupt increase of resistance occurs around the temperature of magnetic phase transition in both samples. The transition temperature Tc from paramagnetic to ferrimagnetic state decreases linearly at rates of 12.6 and 6.3K/GPa with pressure for Mn3SnC and Mn3SnC0.5N0.5, respectively. This phenomenon could be understood by the Labbe-Jardin tight binding approximation model.

  4. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

    DOE PAGES

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

    2016-09-09

    In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

  5. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

    In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

  6. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

    PubMed

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

    2016-10-11

    In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.

  7. Structural basis of kynurenine 3-monooxygenase inhibition

    PubMed Central

    Amaral, Marta; Levy, Colin; Heyes, Derren J.; Lafite, Pierre; Outeiro, Tiago F.; Giorgini, Flaviano; Leys, David; Scrutton, Nigel S.

    2013-01-01

    Inhibition of kynurenine 3-monooxygenase (KMO), an enzyme in the eukaryotic tryptophan catabolic pathway (i.e. kynurenine pathway), leads to amelioration of Huntington’s disease-relevant phenotypes in yeast, fruit fly, and mouse models1–5, as well as a mouse model of Alzheimer’s disease3. KMO is a FAD-dependent monooxygenase, and is located in the outer mitochondrial membrane where it converts L-kynurenine to 3-hydroxykynurenine. Perturbations in the levels of kynurenine pathway metabolites have been linked to the pathogenesis of a spectrum of brain disorders6, as well as cancer7,8, and several peripheral inflammatory conditions9. Despite the importance of KMO as a target for neurodegenerative disease, the molecular basis of KMO inhibition by available lead compounds has remained hitherto unknown. Here we report the first crystal structure of KMO, in the free form and in complex with the tight-binding inhibitor UPF 648. UPF 648 binds close to the FAD cofactor and perturbs the local active site structure, preventing productive binding of the substrate kynurenine. Functional assays and targeted mutagenesis revealed that the active site architecture and UPF 648 binding are essentially identical in human KMO, validating the yeast KMO:UPF 648 structure as a template for structure-based drug design. This will inform the search for new KMO inhibitors that are able to cross the blood-brain barrier in targeted therapies against neurodegenerative diseases such as Huntington’s, Alzheimer’s, and Parkinson’s diseases. PMID:23575632

  8. Rapid surface-biostructure interaction analysis using strong metal-based nanomagnets.

    PubMed

    Rotzetter, Aline C C; Schumacher, Christoph M; Zako, Tamotsu; Stark, Wendelin J; Maeda, Mizuo

    2013-11-19

    Nanomaterials are increasingly suggested for the selective adsorption and extraction of complex compounds in biomedicine. Binding of the latter requires specific surface modifications of the nanostructures. However, even complicated macromolecules such as proteins can afford affinities toward basic surface characteristics such as hydrophobicity, topology, and electrostatic charge. In this study, we address these more basic physical interactions. In a model system, the interaction of bovine serum albumin and amyloid β 42 fibrillar aggregates with carbon-coated cobalt nanoparticles, functionalized with various polymers differing in character, was studied. The possibility of rapid magnetic separation upon binding to the surface represents a valuable tool for studying surface interactions and selectivities. We find that the surface interaction of Aβ 42 fibrillar aggregates is mostly hydrophobic in nature. Because bovine serum albumin (BSA) is conformationally adaptive, it is known to bind surfaces with widely differing properties (charge, topology, and hydrophobicity). However, the rate of tight binding (no desorption upon washing) can vary largely depending on the extent of necessary conformational changes for a specific surface. We found that BSA can only bind slowly to polyethylenimine-coated nanomagnets. Under competitive conditions (high excess BSA compared to that for β 42 fibrillar aggregates), this effect is beneficial for targeting the fibrillar species. These findings highlight the possibility of selective extractions from complex media when advantageous basic physical surface properties are chosen.

  9. The iron uptake repressor Fep1 in the fission yeast binds Fe-S cluster through conserved cysteines.

    PubMed

    Kim, Hyo-Jin; Lee, Kang-Lok; Kim, Kyoung-Dong; Roe, Jung-Hye

    2016-09-09

    Iron homeostasis is tightly regulated since iron is an essential but toxic element in the cell. The GATA-type transcription factor Fep1 and its orthologs contribute to iron homeostasis in many fungi by repressing genes for iron uptake when intracellular iron is high. Even though the function and interaction partners of Fep1 have been elucidated extensively In Schizosaccharomyces pombe, the mechanism behind iron-sensing by Fep1 remains elusive. It has been reported that Fep1 interacts with Fe-S-containing monothiol glutaredoxin Grx4 and Grx4-Fra2 complex. In this study, we demonstrate that Fep1 also binds iron, in the form of Fe-S cluster. Spectroscopic and biochemical analyses of as isolated and reconstituted Fep1 suggest that the dimeric Fep1 binds Fe-S clusters. The mutation study revealed that the cluster-binding depended on the conserved cysteines located between the two zinc fingers in the DNA binding domain. EPR analyses revealed [Fe-S]-specific peaks indicative of mixed presence of [2Fe-2S], [3Fe-4S], or [4Fe-4S]. The finding that Fep1 is an Fe-S protein fits nicely with the model that the Fe-S-trafficking Grx4 senses intracellular iron environment and modulates the activity of Fep1. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Specific cardiolipin binding interferes with labeling of sulfhydryl residues in the adenosine diphosphate/adenosine triphosphate carrier protein from beef heart mitochondria.

    PubMed

    Beyer, K; Nuscher, B

    1996-12-10

    The interaction of cardiolipin with the isolated ADP/ATP carrier protein from beef heart mitochondria has been studied by means of the unmasking of a single cysteinyl residue, Cys56, which accompanies the conformational transition of the protein [Leblanc, P., & Clauser, H, (1972) FEBS Lett. 23, 107-113]. The unmasking was monitored by using the static fluorescence of the sulfhydryl reagent N-(1-pyrenyl)maleimide (PYM). The rate of PYM binding that was observed after initiation of the conformational transition by ADP was drastically reduced in the presence of cardiolipin (CL). Phospholipids other than CL were much less effective. It can be shown that the conformational transition and the binding reaction are both affected by CL, although to varying extents. An enhancement of the rate of the ADP-dependent PYM binding was observed upon digestion of the protein bound phospholipid by phospholipase A2. The phospholipase treatment also led to an increased ADP-independent PYM binding, thus indicating that the ADP control of the carrier transition was gradually lost. The ADP control could be fully restored through the addition of CL, provided that the phospholipase incubation had been terminated after approximately 1 h. These results will be discussed in relation to an earlier report of tight cardiolipin binding [Beyer, K., & Klingenberg, M. (1985) Biochemistry 24, 3821-3826] and to current structural models of the ADP/ATP carrier protein.

  11. Automodification of PARP-1 mediates its tight binding to the nuclear matrix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zaalishvili, Giorgi, E-mail: giozaal@gmail.com; Margiani, Dina; Kutalia, Ketevan

    2010-02-26

    Poly(ADP-ribose) polymerase-1 (PARP-1), a nuclear enzyme that catalyzes the NAD{sup +}-dependent addition of ADP-ribose polymers on a variety of nuclear proteins, has been shown to be associated with the nuclear matrix. As yet, the properties and conditions of this association are unclear. Here, we show the existence of two PARP-1 pools associated with the nuclear matrix of rat liver and the ability of PARP-1 automodification to facilitate its binding to the nuclear matrix.

  12. Data key to quest for quality.

    PubMed

    Chang, Florence S; Nielsen, Jon; Macias, Charles

    2013-11-01

    Late-binding data warehousing reduces the time it takes to obtain data needed to make crucial decisions. Late binding refers to when and how tightly data from the source applications are bound to the rules and vocabularies that make it useful. In some cases, data can be seen in real time. In historically paper-driven environments where data-driven decisions may be a new concept, buy-in from clinicians, physicians, and hospital leaders is key to success in using data to improve outcomes.

  13. Three pillars for achieving quantum mechanical molecular dynamics simulations of huge systems: Divide-and-conquer, density-functional tight-binding, and massively parallel computation.

    PubMed

    Nishizawa, Hiroaki; Nishimura, Yoshifumi; Kobayashi, Masato; Irle, Stephan; Nakai, Hiromi

    2016-08-05

    The linear-scaling divide-and-conquer (DC) quantum chemical methodology is applied to the density-functional tight-binding (DFTB) theory to develop a massively parallel program that achieves on-the-fly molecular reaction dynamics simulations of huge systems from scratch. The functions to perform large scale geometry optimization and molecular dynamics with DC-DFTB potential energy surface are implemented to the program called DC-DFTB-K. A novel interpolation-based algorithm is developed for parallelizing the determination of the Fermi level in the DC method. The performance of the DC-DFTB-K program is assessed using a laboratory computer and the K computer. Numerical tests show the high efficiency of the DC-DFTB-K program, a single-point energy gradient calculation of a one-million-atom system is completed within 60 s using 7290 nodes of the K computer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Bandstructure modulation for Si-h and Si-g nanotubes in a transverse electric field: Tight binding approach

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2013-11-01

    We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.

  15. Band gap engineering for poly(p-phenylene) and poly(p-phenylene vinylene) copolymers using the tight-binding approach

    NASA Astrophysics Data System (ADS)

    Giro, R.; Caldas, M. J.; Galvão, D. S.

    The interest in poly(p-phenylene) (PPP) and poly(p-phenylene vinylene) (PPV) copolymers stems from the fact that these homopolymers present interesting optical and electronic properties that allow a great variety of technological applications. Combining different numbers of PPP and PPV units it is possible, in principle, to obtain new structures presenting intermediate gap values (2.8 eV and 2.4 eV for PPP and PPV, respectively). For this study we used a Hückel Hamiltonian tight-binding coupled to the negative factor counting (NFC) technique. We carried out a systematic search to determine optimum relative concentrations for disordered binary polymeric alloys with predefined gap values. Once these structures were obtained, we used the semiempirical methods AM1/PM3 and ZINDO/S-CI for geometrical and optical studies, respectively. Our theoretical results show that it is possible to obtain copolymers of PPP and PPV with intermediate gap values of their parent structures.

  16. Actinide electronic structure and atomic forces

    NASA Astrophysics Data System (ADS)

    Albers, R. C.; Rudin, Sven P.; Trinkle, Dallas R.; Jones, M. D.

    2000-07-01

    We have developed a new method[1] of fitting tight-binding parameterizations based on functional forms developed at the Naval Research Laboratory.[2] We have applied these methods to actinide metals and report our success using them (see below). The fitting procedure uses first-principles local-density-approximation (LDA) linear augmented plane-wave (LAPW) band structure techniques[3] to first calculate an electronic-structure band structure and total energy for fcc, bcc, and simple cubic crystal structures for the actinide of interest. The tight-binding parameterization is then chosen to fit the detailed energy eigenvalues of the bands along symmetry directions, and the symmetry of the parameterization is constrained to agree with the correct symmetry of the LDA band structure at each eigenvalue and k-vector that is fit to. By fitting to a range of different volumes and the three different crystal structures, we find that the resulting parameterization is robust and appears to accurately calculate other crystal structures and properties of interest.

  17. Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

    DOE PAGES

    Zhang, Hong; Zapol, Peter; Dixon, David A.; ...

    2015-11-17

    The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

  18. Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hong; Zapol, Peter; Dixon, David A.

    The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

  19. Adaptive frozen orbital treatment for the fragment molecular orbital method combined with density-functional tight-binding

    NASA Astrophysics Data System (ADS)

    Nishimoto, Yoshio; Fedorov, Dmitri G.

    2018-02-01

    The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.

  20. Donor states in inverse opals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mahan, G. D.

    We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less

  1. Affinity modulation of small-molecule ligands by borrowing endogenous protein surfaces

    PubMed Central

    Briesewitz, Roger; Ray, Gregory T.; Wandless, Thomas J.; Crabtree, Gerald R.

    1999-01-01

    A general strategy is described for improving the binding properties of small-molecule ligands to protein targets. A bifunctional molecule is created by chemically linking a ligand of interest to another small molecule that binds tightly to a second protein. When the ligand of interest is presented to the target protein by the second protein, additional protein–protein interactions outside of the ligand-binding sites serve either to increase or decrease the affinity of the binding event. We have applied this approach to an intractable target, the SH2 domain, and demonstrate a 3-fold enhancement over the natural peptide. This approach provides a way to modulate the potency and specificity of biologically active compounds. PMID:10051576

  2. Competitive folding of RNA structures at a termination–antitermination site

    PubMed Central

    Ait-Bara, Soraya; Clerté, Caroline; Declerck, Nathalie; Margeat, Emmanuel

    2017-01-01

    Antitermination is a regulatory process based on the competitive folding of terminator–antiterminator structures that can form in the leader region of nascent transcripts. In the case of the Bacillus subtilis licS gene involved in β-glucosides utilization, the binding of the antitermination protein LicT to a short RNA hairpin (RAT) prevents the formation of an overlapping terminator and thereby allows transcription to proceed. Here, we monitored in vitro the competition between termination and antitermination by combining bulk and single-molecule fluorescence-based assays using labeled RNA oligonucleotide constructs of increasing length that mimic the progressive transcription of the terminator invading the antiterminator hairpin. Although high affinity binding is abolished as soon as the antiterminator basal stem is disrupted by the invading terminator, LicT can still bind and promote closing of the partially unfolded RAT hairpin. However, binding no longer occurs once the antiterminator structure has been disrupted by the full-length terminator. Based on these findings, we propose a kinetic competition model for the sequential events taking place at the termination–antitermination site, where LicT needs to capture its RAT target before completion of the terminator to remain tightly bound during RNAP pausing, before finally dissociating irreversibly from the elongated licS transcript. PMID:28235843

  3. Soluble Aβ aggregates can inhibit prion propagation.

    PubMed

    Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John

    2017-11-01

    Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.

  4. A phosphoinositide-binding cluster in cavin1 acts as a molecular sensor for cavin1 degradation

    PubMed Central

    Tillu, Vikas A.; Kovtun, Oleksiy; McMahon, Kerrie-Ann; Collins, Brett M.; Parton, Robert G.

    2015-01-01

    Caveolae are abundant surface organelles implicated in a range of cellular processes. Two classes of proteins work together to generate caveolae: integral membrane proteins termed caveolins and cytoplasmic coat proteins called cavins. Caveolae respond to membrane stress by releasing cavins into the cytosol. A crucial aspect of this model is tight regulation of cytosolic pools of cavin under resting conditions. We now show that a recently identified region of cavin1 that can bind phosphoinositide (PI) lipids is also a major site of ubiquitylation. Ubiquitylation of lysines within this site leads to rapid proteasomal degradation. In cells that lack caveolins and caveolae, cavin1 is cytosolic and rapidly degraded as compared with cells in which cavin1 is associated with caveolae. Membrane stretching causes caveolar disassembly, release of cavin complexes into the cytosol, and increased proteasomal degradation of wild-type cavin1 but not mutant cavin1 lacking the major ubiquitylation site. Release of cavin1 from caveolae thus leads to exposure of key lysine residues in the PI-binding region, acting as a trigger for cavin1 ubiquitylation and down-regulation. This mutually exclusive PI-binding/ubiquitylation mechanism may help maintain low levels of cytosolic cavin1 in resting cells, a prerequisite for cavins acting as signaling modules following release from caveolae. PMID:26269585

  5. [Effect of self-microemulsifying system on cell tight junctions].

    PubMed

    Sha, Xian-Yi; Fang, Xiao-Ling

    2006-01-01

    To study the effect of negatively charged and positively charged self-microemulsifying systems (SMES) on the cellular tight junction complex was to be investigated at molecular cell level. Human intestinal epithelial Caco-2 cell model was established. Effect of formulations on the transepithelial electrical resistance (TEER) and permeability of the paracellular transport marker mannitol were measured to evaluate the cell integrity. Changes in subcellular localization of the tight junction protein zona occludens 1 (ZO-1) and cytoskeleton protein actin by immunofluorescence were also assessed after treatment of two SMESs in different dilutions. The TEER of cell monolayers was not markedly affected by negatively charged SMES in different dilutions. The positively charged SMES could significantly decrease the TEER (P < 0.05) in three dilutions. The full recovery of TEER was found after the treatment of lower dilution for 2 h, then cultured for 48 h, while the recovery of TEER was 81.3% of control in 1 : 50 dilution. Two SMESs could enhance the apparent permeability coefficient of mannitol (2.9 - 64.6 folds), which depended on the dilution times. The immunofluorescent results indicated that the distribution of ZO-1 and actin were discrete in cell membrane after the treatment of formulation. Since the positively charged microemulsion could bind to the epithelial cell membrane by electrostatic interaction, the actin of the cells undergone some kind of stress stimulated by the higher concentration of microemulsion was more markedly affected than the negatively charged SMES. Effect of formulations on ZO-1 and actin relied on the dilution. SMES is able to enhance the paracellular transport marker mannitol. The mechanism of opening of tight junctions by SMES might be the change of distribution of ZO-1 and actin.

  6. Valley density-wave (VDW) and Superconductivity in Iron-Pnictides

    NASA Astrophysics Data System (ADS)

    Cvetkovic, Vladimir; Tesanovic, Zlatko

    2009-03-01

    One of the experimentally observed features of iron-pnictide superconductors is the structural transition and SDW ordering occurring at almost the same temperature. Starting from a tight-binding model [1], we construct an effective theory for iron-pnictides with the distinctive two hole and two electron Fermi surfaces. This theory is then mapped onto a negative-U Hubbard model with additional orbital and spin flavors [2]. We demonstrate that the superconducting instability of the attractive Hubbard model --- valley density-wave (VDW) --- corresponds to the observed structural and SDW orders. The deviations from perfect nesting between the hole and electron Fermi surfaces are mapped onto the Zeeman field which causes portions of Fermi surface to remain ungapped. The origin of pnictide superconductivity in this model, and its ties to the VDW are discussed. [1] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0804.4678. [2] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0808.3742.

  7. Identification of a ZP3-binding protein on acrosome-intact mouse sperm by photoaffinity crosslinking

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bleil, J.D.; Wassarman, P.M.

    1990-07-01

    During the process of fertilization in mammals, sperm bind in a relatively species-specific manner to the zona pellucida (ZP) of ovulated eggs. ZP3, a glycoprotein found in the mouse egg zona pellucida, serves as receptor for sperm during gamete adhesion. We report here that a Mr 56,000 protein found on mouse sperm has properties expected for a sperm component that recognizes and binds to ZP3. This sperm protein is radiolabeled preferentially by a photoactivatable heterobifunctional crosslinker (Denny-Jaffee reagent) covalently linked to purified ZP3, binds very tightly to ZP3-affinity columns, and is localized to heads of acrosome-intact but not acrosome-reacted sperm.more » These and other findings suggest that this protein may be a ZP3-binding protein that, together with the sperm receptor, supports species-specific binding of mouse sperm to unfertilized eggs.« less

  8. The ZO-1–associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density

    PubMed Central

    Balda, Maria S.; Garrett, Michelle D.; Matter, Karl

    2003-01-01

    Epithelial tight junctions regulate paracellular permeability, restrict apical/basolateral intramembrane diffusion of lipids, and have been proposed to participate in the control of epithelial cell proliferation and differentiation. Previously, we have identified ZO-1–associated nucleic acid binding proteins (ZONAB), a Y-box transcription factor whose nuclear localization and transcriptional activity is regulated by the tight junction–associated candidate tumor suppressor ZO-1. Now, we found that reduction of ZONAB expression using an antisense approach or by RNA interference strongly reduced proliferation of MDCK cells. Transfection of wild-type or ZONAB-binding fragments of ZO-1 reduced proliferation as well as nuclear ZONAB pools, indicating that promotion of proliferation by ZONAB requires its nuclear accumulation. Overexpression of ZONAB resulted in increased cell density in mature monolayers, and depletion of ZONAB or overexpression of ZO-1 reduced cell density. ZONAB was found to associate with cell division kinase (CDK) 4, and reduction of nuclear ZONAB levels resulted in reduced nuclear CDK4. Thus, our data indicate that tight junctions can regulate epithelial cell proliferation and cell density via a ZONAB/ZO-1–based pathway. Although this regulatory process may also involve regulation of transcription by ZONAB, our data suggest that one mechanism by which ZONAB and ZO-1 influence proliferation is by regulating the nuclear accumulation of CDK4. PMID:12566432

  9. Analytical solutions of the two-dimensional Dirac equation for a topological channel intersection

    NASA Astrophysics Data System (ADS)

    Anglin, J. R.; Schulz, A.

    2017-01-01

    Numerical simulations in a tight-binding model have shown that an intersection of topologically protected one-dimensional chiral channels can function as a beam splitter for noninteracting fermions on a two-dimensional lattice [Qiao, Jung, and MacDonald, Nano Lett. 11, 3453 (2011), 10.1021/nl201941f; Qiao et al., Phys. Rev. Lett. 112, 206601 (2014), 10.1103/PhysRevLett.112.206601]. Here we confirm this result analytically in the corresponding continuum k .p model, by solving the associated two-dimensional Dirac equation, in the presence of a "checkerboard" potential that provides a right-angled intersection between two zero-line modes. The method by which we obtain our analytical solutions is systematic and potentially generalizable to similar problems involving intersections of one-dimensional systems.

  10. Descriptions of carbon isotopes within the energy density functional theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ismail, Atef; Cheong, Lee Yen; Yahya, Noorhana

    2014-10-24

    Within the energy density functional (EDF) theory, the structure properties of Carbon isotopes are systematically studied. The shell model calculations are done for both even-A and odd-A nuclei, to study the structure of rich-neutron Carbon isotopes. The EDF theory indicates the single-neutron halo structures in {sup 15}C, {sup 17}C and {sup 19}C, and the two-neutron halo structures in {sup 16}C and {sup 22}C nuclei. It is also found that close to the neutron drip-line, there exist amazing increase in the neutron radii and decrease on the binding energies BE, which are tightly related with the blocking effect and correspondingly themore » blocking effect plays a significant role in the shell model configurations.« less

  11. Dissociation of the Tubulin-sequestering and Microtubule Catastrophe-promoting Activities of Oncoprotein 18/Stathmin

    PubMed Central

    Howell, Bonnie; Larsson, Niklas; Gullberg, Martin; Cassimeris, Lynne

    1999-01-01

    Oncoprotein 18/stathmin (Op18) has been identified recently as a protein that destabilizes microtubules, but the mechanism of destabilization is currently controversial. Based on in vitro microtubule assembly assays, evidence has been presented supporting conflicting destabilization models of either tubulin sequestration or promotion of microtubule catastrophes. We found that Op18 can destabilize microtubules by both of these mechanisms and that these activities can be dissociated by changing pH. At pH 6.8, Op18 slowed microtubule elongation and increased catastrophes at both plus and minus ends, consistent with a tubulin-sequestering activity. In contrast, at pH 7.5, Op18 promoted microtubule catastrophes, particularly at plus ends, with little effect on elongation rates at either microtubule end. Dissociation of tubulin-sequestering and catastrophe-promoting activities of Op18 was further demonstrated by analysis of truncated Op18 derivatives. Lack of a C-terminal region of Op18 (aa 100–147) resulted in a truncated protein that lost sequestering activity at pH 6.8 but retained catastrophe-promoting activity. In contrast, lack of an N-terminal region of Op18 (aa 5–25) resulted in a truncated protein that still sequestered tubulin at pH 6.8 but was unable to promote catastrophes at pH 7.5. At pH 6.8, both the full length and the N-terminal–truncated Op18 bound tubulin, whereas truncation at the C-terminus resulted in a pronounced decrease in tubulin binding. Based on these results, and a previous study documenting a pH-dependent change in binding affinity between Op18 and tubulin, it is likely that tubulin sequestering observed at lower pH resulted from the relatively tight interaction between Op18 and tubulin and that this tight binding requires the C-terminus of Op18; however, under conditions in which Op18 binds weakly to tubulin (pH 7.5), Op18 stimulated catastrophes without altering tubulin subunit association or dissociation rates, and Op18 did not depolymerize microtubules capped with guanylyl (α, β)-methylene diphosphonate–tubulin subunits. We hypothesize that weak binding between Op18 and tubulin results in free Op18, which is available to interact with microtubule ends and thereby promote catastrophes by a mechanism that likely involves GTP hydrolysis. PMID:9880330

  12. In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization.

    PubMed

    Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst

    2013-01-15

    Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.

  13. Development of acetophenone ligands as potential neuroimaging agents for cholinesterases.

    PubMed

    Jollymore-Hughes, Courtney T; Pottie, Ian R; Martin, Earl; Rosenberry, Terrone L; Darvesh, Sultan

    2016-11-01

    Association of cholinesterase with β-amyloid plaques and tau neurofibrillary tangles in Alzheimer's disease offers an opportunity to detect disease pathology during life. Achieving this requires development of radiolabelled cholinesterase ligands with high enzyme affinity. Various fluorinated acetophenone derivatives bind to acetylcholinesterase with high affinity, including 2,2,2-trifluoro-1-(3-dimethylaminophenyl)ethanone (1) and 1-(3-tert-butylphenyl)-2,2,2-trifluoroethanone (2). Such compounds also offer potential for incorporation of radioactive fluorine ( 18 F) for Positron Emission Tomography (PET) imaging of cholinesterases in association with Alzheimer's disease pathology in the living brain. Here we describe the synthesis of two meta-substituted chlorodifluoroacetophenones using a Weinreb amide strategy and their rapid conversion to the corresponding trifluoro derivatives through nucleophilic substitution by fluoride ion, in a reaction amenable to incorporating 18 F for PET imaging. In vitro kinetic analysis indicates tight binding of the trifluoro derivatives to cholinesterases. Compound 1 has a K i value of 7nM for acetylcholinesterase and 1300nM for butyrylcholinesterase while for compound 2 these values are 0.4nM and 26nM, respectively. Tight binding of these compounds to cholinesterase encourages their development for PET imaging detection of cholinesterase associated with Alzheimer's disease pathology. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Structural basis for the inhibition of bacterial multidrug exporters.

    PubMed

    Nakashima, Ryosuke; Sakurai, Keisuke; Yamasaki, Seiji; Hayashi, Katsuhiko; Nagata, Chikahiro; Hoshino, Kazuki; Onodera, Yoshikuni; Nishino, Kunihiko; Yamaguchi, Akihito

    2013-08-01

    The multidrug efflux transporter AcrB and its homologues are important in the multidrug resistance of Gram-negative pathogens. However, despite efforts to develop efflux inhibitors, clinically useful inhibitors are not available at present. Pyridopyrimidine derivatives are AcrB- and MexB-specific inhibitors that do not inhibit MexY; MexB and MexY are principal multidrug exporters in Pseudomonas aeruginosa. We have previously determined the crystal structure of AcrB in the absence and presence of antibiotics. Drugs were shown to be exported by a functionally rotating mechanism through tandem proximal and distal multisite drug-binding pockets. Here we describe the first inhibitor-bound structures of AcrB and MexB, in which these proteins are bound by a pyridopyrimidine derivative. The pyridopyrimidine derivative binds tightly to a narrow pit composed of a phenylalanine cluster located in the distal pocket and sterically hinders the functional rotation. This pit is a hydrophobic trap that branches off from the substrate-translocation channel. Phe 178 is located at the edge of this trap in AcrB and MexB and contributes to the tight binding of the inhibitor molecule through a π-π interaction with the pyridopyrimidine ring. The voluminous side chain of Trp 177 located at the corresponding position in MexY prevents inhibitor binding. The structure of the hydrophobic trap described in this study will contribute to the development of universal inhibitors of MexB and MexY in P. aeruginosa.

  15. Amino acid analogues bind to carbon nanotube via π-π interactions: Comparison of molecular mechanical and quantum mechanical calculations

    NASA Astrophysics Data System (ADS)

    Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

    2012-01-01

    Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

  16. Amino acid analogues bind to carbon nanotube via π-π interactions: comparison of molecular mechanical and quantum mechanical calculations.

    PubMed

    Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

    2012-01-14

    Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

  17. Atomistic simulations of the optical absorption of type-II CdSe/ZnTe superlattices

    PubMed Central

    2012-01-01

    We perform accurate tight binding simulations to design type-II short-period CdSe/ZnTe superlattices suited for photovoltaic applications. Absorption calculations demonstrate a very good agreement with optical results with threshold strongly depending on the chemical species near interfaces. PMID:23031315

  18. The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanfeng; Varnum, Susan M.

    2012-03-01

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was foundmore » to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.« less

  19. Surface-Bound Casein Modulates the Adsorption and Activity of Kinesin on SiO2 Surfaces

    PubMed Central

    Ozeki, Tomomitsu; Verma, Vivek; Uppalapati, Maruti; Suzuki, Yukiko; Nakamura, Mikihiko; Catchmark, Jeffrey M.; Hancock, William O.

    2009-01-01

    Abstract Conventional kinesin is routinely adsorbed to hydrophilic surfaces such as SiO2. Pretreatment of surfaces with casein has become the standard protocol for achieving optimal kinesin activity, but the mechanism by which casein enhances kinesin surface adsorption and function is poorly understood. We used quartz crystal microbalance measurements and microtubule gliding assays to uncover the role that casein plays in enhancing the activity of surface-adsorbed kinesin. On SiO2 surfaces, casein adsorbs as both a tightly bound monolayer and a reversibly bound second layer that has a dissociation constant of 500 nM and can be desorbed by washing with casein-free buffer. Experiments using truncated kinesins demonstrate that in the presence of soluble casein, kinesin tails bind well to the surface, whereas kinesin head binding is blocked. Removing soluble casein reverses these binding profiles. Surprisingly, reversibly bound casein plays only a moderate role during kinesin adsorption, but it significantly enhances kinesin activity when surface-adsorbed motors are interacting with microtubules. These results point to a model in which a dynamic casein bilayer prevents reversible association of the heads with the surface and enhances association of the kinesin tail with the surface. Understanding protein-surface interactions in this model system should provide a framework for engineering surfaces for functional adsorption of other motor proteins and surface-active enzymes. PMID:19383474

  20. Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions

    DOE PAGES

    Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...

    2016-07-01

    Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Qin; Zaikowski, Lori; Kaur, Parmeet

    Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

  2. Biophysical characterization of interactions between the C-termini of peripheral nerve claudins and the PDZ₁ domain of zonula occludens.

    PubMed

    Wu, Jiawen; Peng, Dungeng; Zhang, Yang; Lu, Zhenwei; Voehler, Markus; Sanders, Charles R; Li, Jun

    2015-03-27

    Our recent study has shown that cellular junctions in myelin and in the epi-/perineruium that encase nerve fibers regulate the permeability of the peripheral nerves. This permeability may affect propagation of the action potential. Direct interactions between the PDZ₁ domain of zonula occludens (ZO₁ or ZO₂) and the C-termini of claudins are known to be crucial for the formation of tight junctions. Using the purified PDZ₁ domain of ZO₂ and a variety of C-terminal mutants of peripheral nerve claudins (claudin-1, claudin-2, claudin-3, claudin-5 in epi-/perineurium; claudin-19 in myelin), we have utilized NMR spectroscopy to determine specific roles of the 3 C-terminal claudin residues (position -2, -1, 0) for their interactions with PDZ₁ of ZO₂. In contrast to the canonical model that emphasizes the importance of residues at the -2 and 0 positions, our results demonstrate that, for peripheral nerve claudins, the residue at position -1 plays a critical role in association with PDZ₁, while the side-chain of residue 0 plays a significant but lesser role. Surprisingly, claudin-19, the most abundant claudin in myelin, exhibited no binding to ZO₂. These findings reveal that the binding mechanism of claudin/ZO in epi-/perineurium is distinct from the canonical interactions between non-ZO PDZ-containing proteins with their ligands. This observation provides the molecular basis for a strategy to develop drugs that target tight junctions in the epi-/perineurium of peripheral nerves. Published by Elsevier Inc.

  3. Electronic transport across a junction between armchair graphene nanotube and zigzag nanoribbon. Transmission in an armchair nanotube without a zigzag half-line of dimers

    NASA Astrophysics Data System (ADS)

    Sharma, Basant Lal

    2018-05-01

    Based on the well known nearest-neighbor tight-binding approximation for graphene, an exact expression for the electronic conductance across a zigzag nanoribbon/armchair nanotube junction is presented for non-interacting electrons. The junction results from the removal of a half-row of zigzag dimers in armchair nanotube, or equivalently by partial rolling of zigzag nanoribbon and insertion of a half-row of zigzag dimers in between. From the former point of view, a discrete form of Dirichlet condition is imposed on a zigzag half-line of dimers assuming the vanishing of wave function outside the physical structure. A closed form expression is provided for the reflection and transmission moduli for the outgoing wave modes for each given electronic wave mode incident from either side of the junction. It is demonstrated that such a contact junction between the nanotube and nanoribbon exhibits negligible backscattering, and the transmission has been found to be nearly ballistic. In contrast to the previously reported studies for partially unzipped carbon nanotubes (CNTs), using the same tight binding model, it is found that due to the "defect" there is certain amount of mixing between the electronic wave modes with even and odd reflection symmetries. But the junction remains a perfect valley filter for CNTs at certain energy ranges. Applications aside from the electronic case, include wave propagation in quasi-one-dimensional honeycomb structures of graphene-like constitution. The paper includes several numerical calculations, analytical derivations, and graphical results, which complement the provision of succinct closed form expressions.

  4. Three-dimensional structure and dynamics of wine tannin-saliva protein complexes. A multitechnique approach.

    PubMed

    Simon, Cécile; Barathieu, Karine; Laguerre, Michel; Schmitter, Jean-Marie; Fouquet, Eric; Pianet, Isabelle; Dufourc, Erick J

    2003-09-09

    The interactions between the B3 (catechin-4alpha,8-catechin) red wine tannin and the human salivary protein fragment IB7(14) (SPPGKPQGPPPQGG) were monitored by (1)H magic angle spinning NMR, circular dichroism, electrospray ionization mass spectrometry, and molecular modeling. It is found that the secondary structure of IB7(14) is made of a type II helix (collagen helix) and random coil. The central glycine 8 appears to act as a flexible rotula separating two helix II regions. Three tannin molecules tightly complex the peptide, without modifying its secondary structure, but seem to reduce its conformational dynamics. The binding dissociation constant is in the millimolar range. B3 tannins with a "tweezers" conformation bind to the hydrophilic side of the saliva peptide, suggesting that the principal driving forces toward association are governed by hydrogen bonding between the carbonyl functions of proline residues and both the phenol and catechol OH groups. These findings are further discussed in the frame of an astringency phenomenon.

  5. Petri Net-Based Model of Helicobacter pylori Mediated Disruption of Tight Junction Proteins in Stomach Lining during Gastric Carcinoma

    PubMed Central

    Naz, Anam; Obaid, Ayesha; Awan, Faryal M.; Ikram, Aqsa; Ahmad, Jamil; Ali, Amjad

    2017-01-01

    Tight junctions help prevent the passage of digestive enzymes and microorganisms through the space between adjacent epithelial cells lining. However, Helicobacter pylori encoded virulence factors negatively regulate these tight junctions and contribute to dysfunction of gastric mucosa. Here, we have predicted the regulation of important tight junction proteins, such as Zonula occludens-1, Claudin-2 and Connexin32 in the presence of pathogenic proteins. Molecular events such as post translational modifications and crosstalk between phosphorylation, O-glycosylation, palmitoylation and methylation are explored which may compromise the integrity of these tight junction proteins. Furthermore, the signaling pathways disrupted by dysregulated kinases, proteins and post-translational modifications are reviewed to design an abstracted computational model showing the situation-dependent dynamic behaviors of these biological processes and entities. A qualitative hybrid Petri Net model is therefore constructed showing the altered host pathways in the presence of virulence factor cytotoxin-associated gene A, leading to the disruption of tight junction proteins. The model is qualitative logic-based, which does not depend on any kinetic parameter and quantitative data and depends on knowledge derived from experiments. The designed model provides insights into the tight junction disruption and disease progression. Model is then verified by the available experimental data, nevertheless formal in vitro experimentation is a promising way to ensure its validation. The major findings propose that H. pylori activated kinases are responsible to trigger specific post translational modifications within tight junction proteins, at specific sites. These modifications may favor alterations in gastric barrier and provide a route to bacterial invasion into host cells. PMID:28932213

  6. Petri Net-Based Model of Helicobacter pylori Mediated Disruption of Tight Junction Proteins in Stomach Lining during Gastric Carcinoma.

    PubMed

    Naz, Anam; Obaid, Ayesha; Awan, Faryal M; Ikram, Aqsa; Ahmad, Jamil; Ali, Amjad

    2017-01-01

    Tight junctions help prevent the passage of digestive enzymes and microorganisms through the space between adjacent epithelial cells lining. However, Helicobacter pylori encoded virulence factors negatively regulate these tight junctions and contribute to dysfunction of gastric mucosa. Here, we have predicted the regulation of important tight junction proteins, such as Zonula occludens-1, Claudin-2 and Connexin32 in the presence of pathogenic proteins. Molecular events such as post translational modifications and crosstalk between phosphorylation, O-glycosylation, palmitoylation and methylation are explored which may compromise the integrity of these tight junction proteins. Furthermore, the signaling pathways disrupted by dysregulated kinases, proteins and post-translational modifications are reviewed to design an abstracted computational model showing the situation-dependent dynamic behaviors of these biological processes and entities. A qualitative hybrid Petri Net model is therefore constructed showing the altered host pathways in the presence of virulence factor cytotoxin-associated gene A, leading to the disruption of tight junction proteins. The model is qualitative logic-based, which does not depend on any kinetic parameter and quantitative data and depends on knowledge derived from experiments. The designed model provides insights into the tight junction disruption and disease progression. Model is then verified by the available experimental data, nevertheless formal in vitro experimentation is a promising way to ensure its validation. The major findings propose that H. pylori activated kinases are responsible to trigger specific post translational modifications within tight junction proteins, at specific sites. These modifications may favor alterations in gastric barrier and provide a route to bacterial invasion into host cells.

  7. Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes

    PubMed Central

    Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.

    2001-01-01

    Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926

  8. Rubisco Activity: Effects of Drought Stress

    PubMed Central

    PARRY, MARTIN A. J.; ANDRALOJC, P. JOHN; KHAN, SHAHNAZ; LEA, PETER J.; KEYS, ALFRED J.

    2002-01-01

    Ribulose‐1,5‐bisphosphate carboxylase/oxygenase (Rubisco) activity is modulated in vivo either by reaction with CO2 and Mg2+ to carbamylate a lysine residue in the catalytic site, or by the binding of inhibitors within the catalytic site. Binding of inhibitors blocks either activity or the carbamylation of the lysine residue that is essential for activity. At night, in many species, 2‐carboxyarabinitol‐1‐phosphate (CA1P) is formed which binds tightly to Rubisco, inhibiting catalytic activity. Recent work has shown that tight‐binding inhibitors can also decrease Rubisco activity in the light and contribute to the regulation of Rubisco activity. Here we determine the influence that such inhibitors of Rubisco exert on catalytic activity during drought stress. In tobacco plants, ‘total Rubisco activity’, i.e. the activity following pre‐incubation with CO2 and Mg2+, was positively correlated with leaf relative water content. However, ‘total Rubisco activity’ in extracts from leaves with low water potential increased markedly when tightly bound inhibitors were removed, thus increasing the number of catalytic sites available. This suggests that in tobacco the decrease of Rubisco activity under drought stress is not primarily the result of changes in activation by CO2 and Mg2+ but due rather to the presence of tight‐binding inhibitors. The amounts of inhibitor present in leaves of droughted tobacco based on the decrease in Rubisco activity per mg soluble protein were usually much greater than the amounts of the known inhibitors (CA1P and ‘daytime inhibitor’) that can be recovered in acid extracts. Alternative explanations for the difference between maximal and total activities are discussed. PMID:12102509

  9. Control of the Ability of Profilin to Bind and Facilitate Nucleotide Exchange from G-actin*

    PubMed Central

    Wen, Kuo-Kuang; McKane, Melissa; Houtman, Jon C. D.; Rubenstein, Peter A.

    2008-01-01

    A major factor in profilin regulation of actin cytoskeletal dynamics is its facilitation of G-actin nucleotide exchange. However, the mechanism of this facilitation is unknown. We studied the interaction of yeast (YPF) and human profilin 1 (HPF1) with yeast and mammalian skeletal muscle actins. Homologous pairs (YPF and yeast actin, HPF1 and muscle actin) bound more tightly to one another than heterologous pairs. However, with saturating profilin, HPF1 caused a faster etheno-ATP exchange with both yeast and muscle actins than did YPF. Based on the -fold change in ATP exchange rate/Kd, however, the homologous pairs are more efficient than the heterologous pairs. Thus, strength of binding of profilin to actin and nucleotide exchange rate are not tightly coupled. Actin/HPF interactions were entropically driven, whereas YPF interactions were enthalpically driven. Hybrid yeast actins containing subdomain 1 (sub1) or subdomain 1 and 2 (sub12) muscle actin residues bound more weakly to YPF than did yeast actin (Kd = 2 μm versus 0.6 μm). These hybrids bound even more weakly to HPF than did yeast actin (Kd = 5 μm versus 3.2 μm). sub1/YPF interactions were entropically driven, whereas the sub12/YPF binding was enthalpically driven. Compared with WT yeast actin, YPF binding to sub1 occurred with a 5 times faster koff and a 2 times faster kon. sub12 bound with a 3 times faster koff and a 1.5 times slower kon. Profilin controls the energetics of its interaction with nonhybrid actin, but interactions between actin subdomains 1 and 2 affect the topography of the profilin binding site. PMID:18223293

  10. Coxibs interfere with the action of aspirin by binding tightly to one monomer of cyclooxygenase-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rimon, Gilad; Sidhu, Ranjinder S.; Lauver, D. Adam

    Pain associated with inflammation involves prostaglandins synthesized from arachidonic acid (AA) through cyclooxygenase-2 (COX-2) pathways while thromboxane A{sub 2} formed by platelets from AA via cyclooxygenase-1 (COX-1) mediates thrombosis. COX-1 and COX-2 are both targets of nonselective nonsteroidal antiinflammatory drugs (nsNSAIDs) including aspirin whereas COX-2 activity is preferentially blocked by COX-2 inhibitors called coxibs. COXs are homodimers composed of identical subunits, but we have shown that only one subunit is active at a time during catalysis; moreover, many nsNSAIDS bind to a single subunit of a COX dimer to inhibit the COX activity of the entire dimer. Here, we reportmore » the surprising observation that celecoxib and other coxibs bind tightly to a subunit of COX-1. Although celecoxib binding to one monomer of COX-1 does not affect the normal catalytic processing of AA by the second, partner subunit, celecoxib does interfere with the inhibition of COX-1 by aspirin in vitro. X-ray crystallographic results obtained with a celecoxib/COX-1 complex show how celecoxib can bind to one of the two available COX sites of the COX-1 dimer. Finally, we find that administration of celecoxib to dogs interferes with the ability of a low dose of aspirin to inhibit AA-induced ex vivo platelet aggregation. COX-2 inhibitors such as celecoxib are widely used for pain relief. Because coxibs exhibit cardiovascular side effects, they are often prescribed in combination with low-dose aspirin to prevent thrombosis. Our studies predict that the cardioprotective effect of low-dose aspirin on COX-1 may be blunted when taken with coxibs.« less

  11. Dynamical Localization for Discrete and Continuous Random Schrödinger Operators

    NASA Astrophysics Data System (ADS)

    Germinet, F.; De Bièvre, S.

    We show for a large class of random Schrödinger operators Ho on and on that dynamical localization holds, i.e. that, with probability one, for a suitable energy interval I and for q a positive real, Here ψ is a function of sufficiently rapid decrease, and PI(Ho) is the spectral projector of Ho corresponding to the interval I. The result is obtained through the control of the decay of the eigenfunctions of Ho and covers, in the discrete case, the Anderson tight-binding model with Bernoulli potential (dimension ν = 1) or singular potential (ν > 1), and in the continuous case Anderson as well as random Landau Hamiltonians.

  12. Excitonic fine-structure splitting in telecom-wavelength InAs/GaAs quantum dots: Statistical distribution and height-dependence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldmann, Elias, E-mail: goldmann@itp.uni-bremen.de; Barthel, Stefan; Florian, Matthias

    The variation of the excitonic fine-structure splitting is studied for semiconductor quantum dots under the influence of a strain-reducing layer, utilized to shift the emission wavelength of the excitonic transition into the telecom-wavelength regime of 1.3–1.5 μm. By means of a sp{sup 3}s{sup *}-tight-binding model and configuration interaction, we calculate wavelength shifts and fine-structure splittings for various quantum dot geometries. We find the splittings remaining small and even decreasing with strain-reducing layer composition for quantum dots with large height. Combined with an observed increased emission efficiency, the applicability for generation of entanglement photons is persistent.

  13. Analytic expression for the giant fieldlike spin torque in spin-filter magnetic tunnel junctions

    NASA Astrophysics Data System (ADS)

    Tang, Y.-H.; Huang, Z.-W.; Huang, B.-H.

    2017-08-01

    We propose analytic expressions for fieldlike, T⊥, and spin-transfer, T∥, spin torque components in the spin-filter-based magnetic tunnel junction (SFMTJ), by using the single-band tight-binding model with the nonequilibrium Keldysh formalism. In consideration of multireflection processes between noncollinear magnetization of the spin-filter (SF) barrier and the ferromagnetic (FM) electrode, the central spin-selective SF barrier plays an active role in the striking discovery T⊥≫T∥ , which can be further identified by the unusual barrier thickness dependence of giant T⊥. Our general expressions reveal the sinusoidal angular dependence of both spin torque components, even in the presence of the SF barrier.

  14. Spin-Swapping Transport and Torques in Ultrathin Magnetic Bilayers

    NASA Astrophysics Data System (ADS)

    Saidaoui, Hamed Ben Mohamed; Manchon, A.

    2016-07-01

    Planar spin transport in disordered ultrathin magnetic bilayers comprising a ferromagnet and a normal metal (typically used for spin pumping, spin Seebeck and spin-orbit torque experiments) is investigated theoretically. Using a tight-binding model that puts the extrinsic spin Hall effect and spin swapping on equal footing, we show that the nature of spin-orbit coupled transport dramatically depends on the ratio between the layer thickness d and the mean free path λ . While the spin Hall effect dominates in the diffusive limit (d ≫λ ), spin swapping dominates in the Knudsen regime (d ≲λ ). A remarkable consequence is that spin swapping induces a substantial fieldlike torque in the Knudsen regime.

  15. Spin and charge transport across cobalt/graphene interfaces

    NASA Astrophysics Data System (ADS)

    Chshiev, Mairbek; Kalitsov, Alan; Mryasov, Oleg

    We report ballistic calculations of in-plane and out-of-plane spin and charge transport through graphene attached to the hcp-Co electrodes. Our calculations are based on the Keldysh non-equilibrium Green Function formalism and the tight binding Hamiltonian model tailored to treat both lateral and vertical device configurations. We present results for (i) vertical device that consists of a one-side fluorinated C4F graphene sandwiched between two hcp Co electrodes and (ii) lateral device consisting of pristine graphene/C4F graphene bilayer with two top hcp-Co electrodes Our calculations predict large magnetoresistance with small resistance-area product and significant deviation from sinusoidal behavior of spin transfer torque for the vertical device configuration.

  16. Quantum mechanism of nonlocal Gilbert damping in magnetic trilayers

    NASA Astrophysics Data System (ADS)

    Barati, Ehsan; Cinal, Marek

    2015-06-01

    A fully quantum-mechanical calculation of the Gilbert damping constant α in magnetic trilayers is done by employing the torque-correlation formula within a realistic tight-binding model. A remarkable enhancement of α in Co/NM1/NM2 trilayers is obtained due to adding the caps NM2=Pd, Pt, and it decays with the thickness of the spacers NM1=Cu, Ag, Au in agreement with experiment. Nonlocal origin of the Gilbert damping is visualized with its atomic layer contributions. It is shown that magnetization in Co is damped remotely by strong spin-orbit coupling in NM2 via quantum states with large amplitude in both Co and NM2.

  17. Organization and dynamics of the actin cytoskeleton during dendritic spine morphological remodeling.

    PubMed

    Chazeau, Anaël; Giannone, Grégory

    2016-08-01

    In the central nervous system, most excitatory post-synapses are small subcellular structures called dendritic spines. Their structure and morphological remodeling are tightly coupled to changes in synaptic transmission. The F-actin cytoskeleton is the main driving force of dendritic spine remodeling and sustains synaptic plasticity. It is therefore essential to understand how changes in synaptic transmission can regulate the organization and dynamics of actin binding proteins (ABPs). In this review, we will provide a detailed description of the organization and dynamics of F-actin and ABPs in dendritic spines and will discuss the current models explaining how the actin cytoskeleton sustains both structural and functional synaptic plasticity.

  18. Strain-induced chiral magnetic effect in Weyl semimetals

    DOE PAGES

    Cortijo, Alberto; Kharzeev, Dmitri; Landsteiner, Karl; ...

    2016-12-19

    Here, we argue that strain applied to a time-reversal and inversion breaking Weyl semimetal in a magnetic field can induce an electric current via the chiral magnetic effect. A tight-binding model is used to show that strain generically changes the locations in the Brillouin zone but also the energies of the band touching points (tips of the Weyl cones). Since axial charge in a Weyl semimetal can relax via intervalley scattering processes, the induced current will decay with a time scale given by the lifetime of a chiral quasiparticle. Lastly, we estimate the strength and lifetime of the current formore » typical material parameters and find that it should be experimentally observable.« less

  19. Multiple mobility edges in a 1D Aubry chain with Hubbard interaction in presence of electric field: Controlled electron transport

    NASA Astrophysics Data System (ADS)

    Saha, Srilekha; Maiti, Santanu K.; Karmakar, S. N.

    2016-09-01

    Electronic behavior of a 1D Aubry chain with Hubbard interaction is critically analyzed in presence of electric field. Multiple energy bands are generated as a result of Hubbard correlation and Aubry potential, and, within these bands localized states are developed under the application of electric field. Within a tight-binding framework we compute electronic transmission probability and average density of states using Green's function approach where the interaction parameter is treated under Hartree-Fock mean field scheme. From our analysis we find that selective transmission can be obtained by tuning injecting electron energy, and thus, the present model can be utilized as a controlled switching device.

  20. Visualization of atomic-scale phenomena in superconductors: application to FeSe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas

    Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less

  1. Visualization of atomic-scale phenomena in superconductors: application to FeSe

    DOE PAGES

    Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas; ...

    2014-10-31

    Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less

  2. Correlation between morphology, electron band structure, and resistivity of Pb atomic chains on the Si(5 5 3)-Au surface

    NASA Astrophysics Data System (ADS)

    Jałochowski, M.; Kwapiński, T.; Łukasik, P.; Nita, P.; Kopciuszyński, M.

    2016-07-01

    Structural and electron transport properties of multiple Pb atomic chains fabricated on the Si(5 5 3)-Au surface are investigated using scanning tunneling spectroscopy, reflection high electron energy diffraction, angular resolved photoemission electron spectroscopy and in situ electrical resistance. The study shows that Pb atomic chains growth modulates the electron band structure of pristine Si(5 5 3)-Au surface and hence changes its sheet resistivity. Strong correlation between chains morphology, electron band structure and electron transport properties is found. To explain experimental findings a theoretical tight-binding model of multiple atomic chains interacting on effective substrate is proposed.

  3. Design principles for shift current photovoltaics

    DOE PAGES

    Cook, Ashley M.; M. Fregoso, Benjamin; de Juan, Fernando; ...

    2017-01-25

    While the basic principles of conventional solar cells are well understood, little attention has gone towards maximizing the efficiency of photovoltaic devices based on shift currents. Furthermore, by analysing effective models, here we outline simple design principles for the optimization of shift currents for frequencies near the band gap. This method allows us to express the band edge shift current in terms of a few model parameters and to show it depends explicitly on wavefunctions in addition to standard band structure. We use our approach to identify two classes of shift current photovoltaics, ferroelectric polymer films and single-layer orthorhombic monochalcogenidesmore » such as GeS, which display the largest band edge responsivities reported so far. Moreover, exploring the parameter space of the tight-binding models that describe them we find photoresponsivities that can exceed 100 mA W -1 . Our results illustrate the great potential of shift current photovoltaics to compete with conventional solar cells.« less

  4. Design principles for shift current photovoltaics

    PubMed Central

    Cook, Ashley M.; M. Fregoso, Benjamin; de Juan, Fernando; Coh, Sinisa; Moore, Joel E.

    2017-01-01

    While the basic principles of conventional solar cells are well understood, little attention has gone towards maximizing the efficiency of photovoltaic devices based on shift currents. By analysing effective models, here we outline simple design principles for the optimization of shift currents for frequencies near the band gap. Our method allows us to express the band edge shift current in terms of a few model parameters and to show it depends explicitly on wavefunctions in addition to standard band structure. We use our approach to identify two classes of shift current photovoltaics, ferroelectric polymer films and single-layer orthorhombic monochalcogenides such as GeS, which display the largest band edge responsivities reported so far. Moreover, exploring the parameter space of the tight-binding models that describe them we find photoresponsivities that can exceed 100 mA W−1. Our results illustrate the great potential of shift current photovoltaics to compete with conventional solar cells. PMID:28120823

  5. disorder effect on quantum transport properties of ultra thin Fe film

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaotian; Nakamura, Kohji; Shindou, Ryuichi

    2015-03-01

    Ferromagnetic ultrathin films are experimentally known to often exhibit perpendicular magnetic anisotropy, when being placed on certain substrates. Based on reported ab-initio band calculations of free-standing Fe-monolayer and that on MgO substrate, we will introduce an effective tight-binding model, which capture a part of an electronic structure near Fermi level for both cases. We will show that the model supports electronic bands with non-zero Chern number and chiral edge modes which cross a direct band gap on the order of 50meV. Unluckily, however, the direct band gap is also masked by another dispersive bands which have non-zero Berry's curvature in the k-space. To demonstrate how disorder kills conducting characters of the latter bulk bands while leave intact those of the chiral edge modes, we will clarify behaviors of localization length and conductance in the effective model with on-site disorders.

  6. Design principles for shift current photovoltaics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, Ashley M.; M. Fregoso, Benjamin; de Juan, Fernando

    While the basic principles of conventional solar cells are well understood, little attention has gone towards maximizing the efficiency of photovoltaic devices based on shift currents. Furthermore, by analysing effective models, here we outline simple design principles for the optimization of shift currents for frequencies near the band gap. This method allows us to express the band edge shift current in terms of a few model parameters and to show it depends explicitly on wavefunctions in addition to standard band structure. We use our approach to identify two classes of shift current photovoltaics, ferroelectric polymer films and single-layer orthorhombic monochalcogenidesmore » such as GeS, which display the largest band edge responsivities reported so far. Moreover, exploring the parameter space of the tight-binding models that describe them we find photoresponsivities that can exceed 100 mA W -1 . Our results illustrate the great potential of shift current photovoltaics to compete with conventional solar cells.« less

  7. Modeling Bi-induced changes in the electronic structure of GaAs1-xBix alloys

    NASA Astrophysics Data System (ADS)

    Virkkala, Ville; Havu, Ville; Tuomisto, Filip; Puska, Martti J.

    2013-12-01

    We suggested recently [V. Virkkala , Phys. Rev. BPRBMDO1098-012110.1103/PhysRevB.88.035204 88, 035204 (2013)] that the band-gap narrowing in dilute GaAs1-xNx alloys can be explained to result from the broadening of the localized N states due to the N-N interaction along the zigzag chains in the <110> directions. In that study our tight-binding modeling based on first-principles density-functional calculations took into account the random distribution of N atoms in a natural way. In this work we extend our modeling to GaAs1-xBix alloys. Our results indicate that Bi states mix with host material states. However, the states near the valence-band edge agglomerate along the zigzag chains originating from individual Bi atoms. This leads to Bi-Bi interactions in a random alloy broadening these states in energy and causing the band-gap narrowing.

  8. Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

    PubMed Central

    Chang, F. N.; Flaks, Joel G.

    1972-01-01

    The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and binding also occurred to ribosomes from streptomycin-resistant and -dependent strains, as well as to 50S subunits from all strains. Kdiss for all of these binding equilibria were [Formula: see text] 10−4m. This weaker non-specific binding coincided with the beginning of aggregation phenomena involving the particles, and occurred at sites distinct from the single site which binds the antibiotic tightly. This latter site was completely lost after the one-step mutation to high-level resistance or dependence. PMID:4133236

  9. Surface plasmon resonance spectroscopy studies of membrane proteins: transducin binding and activation by rhodopsin monitored in thin membrane films.

    PubMed Central

    Salamon, Z; Wang, Y; Soulages, J L; Brown, M F; Tollin, G

    1996-01-01

    Surface plasmon resonance (SPR) spectroscopy can provide useful information regarding average structural properties of membrane films supported on planar solid substrates. Here we have used SPR spectroscopy for the first time to monitor the binding and activation of G-protein (transducin or Gt) by bovine rhodopsin incorporated into an egg phosphatidylcholine bilayer deposited on a silver film. Rhodopsin incorporation into the membrane, performed by dilution of a detergent solution of the protein, proceeds in a saturable manner. Before photolysis, the SPR data show that Gt binds tightly (Keq approximately equal to 60 nM) and with positive cooperativity to rhodopsin in the lipid layer to form a closely packed film. A simple multilayer model yields a calculated average thickness of about 57 A, in good agreement with the structure of Gt. The data also demonstrate that Gt binding saturates at a Gt/rhodopsin ratio of approximately 0.6. Moreover, upon visible light irradiation, characteristic changes occur in the SPR spectrum, which can be modeled by a 6 A increase in the average thickness of the lipid/protein film caused by formation of metarhodopsin II (MII). Upon subsequent addition of GTP, further SPR spectral changes are induced. These are interpreted as resulting from dissociation of the alpha-subunit of Gt, formation of new MII-Gt complexes, and possible conformational changes of Gt as a consequence of complex formation. The above results clearly demonstrate the ability of SPR spectroscopy to monitor interactions among the proteins associated with signal transduction in membrane-bound systems. Images FIGURE 1 PMID:8804611

  10. Using a model comparison approach to describe the assembly pathway for histone H1

    PubMed Central

    Contreras, Carlos; Villasana, Minaya; Hendzel, Michael J.

    2018-01-01

    Histones H1 or linker histones are highly dynamic proteins that diffuse throughout the cell nucleus and associate with chromatin (DNA and associated proteins). This binding interaction of histone H1 with the chromatin is thought to regulate chromatin organization and DNA accessibility to transcription factors and has been proven to involve a kinetic process characterized by a population that associates weakly with chromatin and rapidly dissociates and another population that resides at a binding site for up to several minutes before dissociating. When considering differences between these two classes of interactions in a mathematical model for the purpose of describing and quantifying the dynamics of histone H1, it becomes apparent that there could be several assembly pathways that explain the kinetic data obtained in living cells. In this work, we model these different pathways using systems of reaction-diffusion equations and carry out a model comparison analysis using FRAP (fluorescence recovery after photobleaching) experimental data from different histone H1 variants to determine the most feasible mechanism to explain histone H1 binding to chromatin. The analysis favors four different chromatin assembly pathways for histone H1 which share common features and provide meaningful biological information on histone H1 dynamics. We show, using perturbation analysis, that the explicit consideration of high- and low-affinity associations of histone H1 with chromatin in the favored assembly pathways improves the interpretation of histone H1 experimental FRAP data. To illustrate the results, we use one of the favored models to assess the kinetic changes of histone H1 after core histone hyperacetylation, and conclude that this post-transcriptional modification does not affect significantly the transition of histone H1 from a weakly bound state to a tightly bound state. PMID:29352283

  11. Synergistic effects of ATP and RNA binding to human DEAD-box protein DDX1.

    PubMed

    Kellner, Julian N; Reinstein, Jochen; Meinhart, Anton

    2015-03-11

    RNA helicases of the DEAD-box protein family form the largest group of helicases. The human DEAD-box protein 1 (DDX1) plays an important role in tRNA and mRNA processing, is involved in tumor progression and is also hijacked by several virus families such as HIV-1 for replication and nuclear export. Although important in many cellular processes, the mechanism of DDX1's enzymatic function is unknown. We have performed equilibrium titrations and transient kinetics to determine affinities for nucleotides and RNA. We find an exceptional tight binding of DDX1 to adenosine diphosphate (ADP), one of the strongest affinities observed for DEAD-box helicases. ADP binds tighter by three orders of magnitude when compared to adenosine triphosphate (ATP), arresting the enzyme in a potential dead-end ADP conformation under physiological conditions. We thus suggest that a nucleotide exchange factor leads to DDX1 recycling. Furthermore, we find a strong cooperativity in binding of RNA and ATP to DDX1 that is also reflected in ATP hydrolysis. We present a model in which either ATP or RNA binding alone can partially shift the equilibrium from an 'open' to a 'closed'-state; this shift appears to be not further pronounced substantially even in the presence of both RNA and ATP as the low rate of ATP hydrolysis does not change. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. The Receptacle Model of Salting-In by Tetramethylammonium Ions

    PubMed Central

    Hribar–Lee, Barbara; Dill, Ken A.; Vlachy, Vojko

    2010-01-01

    Water is a poor solvent for nonpolar solutes. Water containing ions is an even poorer solvent. According to standard terminology, the tendency of salts to precipitate oils from water is called salting-out. However, interestingly, some salt ions, such as tetramethylammonium (TMA), cause instead the salting-in of hydrophobic solutes. Even more puzzling, there is a systematic dependence on solute size. TMA causes the salting-out of small hydrophobes and the salting-in of larger nonpolar solutes. We study these effects using NPT Monte Carlo simulations of the MB + dipole model of water, which was previously shown to account for hydrophobic effects and ion solubilities in water. The present model gives a structural interpretation for the thermodynamics of salting-in. The TMA structure allows deep penetration by a first shell of waters, the dipoles of which interact electrostatically with the ion. This first water shell sets up a second water shell that is shaped to act as a receptacle that binds the nonpolar solute. In this way, a nonpolar solute can actually bind more tightly to the TMA ion than to another hydrophobe, leading to the increased solubility and salting-in. Such structuring may also explain why molecular ions do not follow the same charge density series’ as atomic ions do. PMID:21028768

  13. Receptacle model of salting-in by tetramethylammonium ions.

    PubMed

    Hribar-Lee, Barbara; Dill, Ken A; Vlachy, Vojko

    2010-11-25

    Water is a poor solvent for nonpolar solutes. Water containing ions is an even poorer solvent. According to standard terminology, the tendency of salts to precipitate oils from water is called salting-out. However, interestingly, some salt ions, such as tetramethylammonium (TMA), cause instead the salting-in of hydrophobic solutes. Even more puzzling, there is a systematic dependence on solute size. TMA causes the salting-out of small hydrophobes and the salting-in of larger nonpolar solutes. We study these effects using NPT Monte Carlo simulations of the Mercedes-Benz (MB) + dipole model of water, which was previously shown to account for hydrophobic effects and ion solubilities in water. The present model gives a structural interpretation for the thermodynamics of salting-in. The TMA structure allows deep penetration by a first shell of waters, the dipoles of which interact electrostatically with the ion. This first water shell sets up a second water shell that is shaped to act as a receptacle that binds the nonpolar solute. In this way, a nonpolar solute can actually bind more tightly to the TMA ion than to another hydrophobe, leading to the increased solubility and salting-in. Such structuring may also explain why molecular ions do not follow the same charge density series as atomic ions do.

  14. Cross-circularly polarized two-exciton states in one to three dimensions

    NASA Astrophysics Data System (ADS)

    Ajiki, Hiroshi

    2015-03-01

    Biexciton and two-exciton dissociated states of Frenkel-type excitons are studied theoretically using an exciton tight-binding (TB) model including a polarization degree of freedom. Because the biexciton consists of two cross-circularly polarized excitons, an on-site interaction (V) between the two excitons should be considered in addition to a nearest-neighbor two-exciton attractive interaction (δ). Although there are an infinitely large number of combinations of V and δ providing the observed binding energy of a biexciton, the wave function of the biexciton and two-exciton dissociated states is nearly independent of these parameter sets. This means that all the two-exciton states are uniquely determined from the exciton TB model. There are a spatially symmetric and an antisymmetric biexciton state for a one-dimensional (1D) lattice and two symmetric and one antisymmetric biexciton states at most for two- (2D) and three-dimensional (3D) lattices. In contrast, when the polarization degree of freedom is ignored, there is one biexciton state for 1D, 2D, and 3D lattices. For this study, a rapid and memory-saving calculation method for two-exciton states is extended to include the polarization degree of freedom.

  15. Cross-circularly polarized two-exciton states in one to three dimensions.

    PubMed

    Ajiki, Hiroshi

    2015-03-14

    Biexciton and two-exciton dissociated states of Frenkel-type excitons are studied theoretically using an exciton tight-binding (TB) model including a polarization degree of freedom. Because the biexciton consists of two cross-circularly polarized excitons, an on-site interaction (V) between the two excitons should be considered in addition to a nearest-neighbor two-exciton attractive interaction (δ). Although there are an infinitely large number of combinations of V and δ providing the observed binding energy of a biexciton, the wave function of the biexciton and two-exciton dissociated states is nearly independent of these parameter sets. This means that all the two-exciton states are uniquely determined from the exciton TB model. There are a spatially symmetric and an antisymmetric biexciton state for a one-dimensional (1D) lattice and two symmetric and one antisymmetric biexciton states at most for two- (2D) and three-dimensional (3D) lattices. In contrast, when the polarization degree of freedom is ignored, there is one biexciton state for 1D, 2D, and 3D lattices. For this study, a rapid and memory-saving calculation method for two-exciton states is extended to include the polarization degree of freedom.

  16. Very empirical treatment of solvation and entropy: a force field derived from Log Po/w

    NASA Astrophysics Data System (ADS)

    Kellogg, Glen Eugene; Burnett, James C.; Abraham, Donald J.

    2001-04-01

    A non-covalent interaction force field model derived from the partition coefficient of 1-octanol/water solubility is described. This model, HINT for Hydropathic INTeractions, is shown to include, in very empirical and approximate terms, all components of biomolecular associations, including hydrogen bonding, Coulombic interactions, hydrophobic interactions, entropy and solvation/desolvation. Particular emphasis is placed on: (1) demonstrating the relationship between the total empirical HINT score and free energy of association, ΔG interaction; (2) showing that the HINT hydrophobic-polar interaction sub-score represents the energy cost of desolvation upon binding for interacting biomolecules; and (3) a new methodology for treating constrained water molecules as discrete independent small ligands. An example calculation is reported for dihydrofolate reductase (DHFR) bound with methotrexate (MTX). In that case the observed very tight binding, ΔG interaction≤-13.6 kcal mol-1, is largely due to ten hydrogen bonds between the ligand and enzyme with estimated strength ranging between -0.4 and -2.3 kcal mol-1. Four water molecules bridging between DHFR and MTX contribute an additional -1.7 kcal mol-1 stability to the complex. The HINT estimate of the cost of desolvation is +13.9 kcal mol-1.

  17. Identification of a β-lactamase inhibitory protein variant that is a potent inhibitor of Staphylococcus PC1 β-lactamase

    PubMed Central

    Yuan, Ji; Chow, Dar-Chone; Huang, Wanzhi; Palzkill, Timothy

    2011-01-01

    The β-lactamase inhibitory protein (BLIP) binds and inhibits a diverse collection of class A β-lactamases. Widespread resistance to β-lactam antibiotics currently limits treatment strategies for Staphylococcus infections. The goal of this study was to determine the binding affinity of BLIP for S. aureus PC1 β-lactamase and to identify mutants that alter binding affinity. The BLIP inhibition constant (Ki) for the PC1 β-lactamase was measured at 350 nM and isothermal titration calorimetry (ITC) experiments indicated a binding constant (Kd) of 380 nM. A total of 23 residue positions in BLIP that contact β-lactamase were randomized and phage display was used to sort the libraries for tight binders to immobilized PC1 β-lactamase. The BLIP K74G mutant was the dominant clone selected and it was found to inhibit the PC1 β-lactamase with a Ki of 42 nM while calorimetry indicated a Kd of 26 nM. Molecular modeling studies suggested BLIP binds weakly to the PC1 β-lactamase due to the presence of alanine at position 104 of PC1. This position is occupied by glutamate in the TEM-1 enzyme where it forms a salt bridge with BLIP residue Lys74 that is important for the stability of the complex. This hypothesis was confirmed by showing that the A104E PC1 enzyme binds BLIP with 15-fold greater affinity than wild type PC1 β-lactamase. Kinetic measurements indicated similar association rates for all complexes with the variation in affinity due to altered dissociation rate constants suggesting changes in short-range interactions are responsible for the altered binding properties of the mutants. PMID:21238457

  18. Modeling the coma of 2060 Chiron

    NASA Technical Reports Server (NTRS)

    Boice, D. C.; Konno, I.; Stern, S. Alan; Huebner, W. F.

    1991-01-01

    Observations of comet-like activity and a resolved coma have established that 2060 Chiron is a comet. Determinations of its radius range from 65 to 200 km. This unusually large size for a comet suggests that the atmosphere of Chiron is intermediate to the tightly bound, thin atmospheres typical of planets and satellite and the greatly extended atmospheres in free expansion typical of cometary comae. Under certain conditions it may gravitationally bind an atmosphere that is thick compared to its size, while a significant amount of gas escapes to an extensive exosphere. These attributes coupled with reports of sporadic outbursts at large heliocentric distances and the identification of CN in the coma make Chiron a challenging object to model. Simple models of gas production and the dusty coma were recently presented but a general concensus on many basic features has not emerged. Development was begun on a more complete coma model of Chiron. The objectives are to report progress on this model and give the preliminary results for understanding Chiron.

  19. Structure and Mechanism of Styrene Monooxygenase Reductase: New Insight into the FAD–Transfer Reaction†

    PubMed Central

    Morrison, Eliot; Kantz, Auric; Gassner, George T.; Sazinsky, Matthew H.

    2013-01-01

    The two–component flavoprotein styrene monooxygenase (SMO) from Pseudomonas putida S12 catalyzes the NADH– and FAD–dependent epoxidation of styrene to styrene oxide. In this study we investigate the mechanism of flavin reduction and transfer from the reductase (SMOB) to epoxidase (NSMOA) component and report our findings in light of the 2.2–Å crystal structure of SMOB. Upon rapidly mixing with NADH, SMOB forms an NADH→FADox charge–transfer intermediate and catalyzes a hydride–transfer reaction from NADH to FAD, with a rate constant of 49.1 ± 1.4 s−1, in a step that is coupled to the rapid dissociation of NAD+. Electrochemical and equilibrium–binding studies indicate that NSMOA binds FADhq ~13–times more tightly than SMOB, which supports a vectoral transfer of FADhq from the reductase to the epoxidase. After binding to NSMOA, FADhq rapidly reacts with molecular oxygen to form a stable C(4a)–hydroperoxide intermediate. The half–life of apoSMOB generated in the FAD–transfer reaction is increased ~21–fold, supporting the model of a protein–protein interaction between apoSMOB and NSMOA with the peroxide intermediate. The mechanisms of FAD–dissociation and transport from SMOB to NSMOA were probed by monitoring the competitive reduction of cytochrome c in the presence and absence of pyridine nucleotides. Based on these studies, we propose a model in which reduced FAD binds to SMOB in equilibrium between an unreactive, sequestered state (S–state) and more reactive, transfer state (T–state). Dissociation of NAD+ after the hydride transfer–reaction transiently populates the T–state, promoting the transfer of FADhq to NSMOA. The binding of pyridine nucleotides to SMOB–FADhq shifts the FADhq–binding equilibrium from the T–state to the S–state. Additionally, the 2.2–Å crystal structure of SMOB–FADox reported in this work is discussed in light of the pyridine nucleotide–gated flavin–transfer and electron–transfer reactions. PMID:23909369

  20. Intrinsic optical confinement for ultrathin InAsN quantum well superlattices

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sakri, A.; Robert, C.; Pedesseau, L.

    We study energy-band engineering with InAsN monolayer in GaAs/GaP quantum well structure. A tight-binding calculation indicates that both type I alignment along with direct band-gap behavior can be obtained. We show that the optical transitions are less sensitive to the position of the probe.

  1. RIM-BPs Mediate Tight Coupling of Action Potentials to Ca(2+)-Triggered Neurotransmitter Release.

    PubMed

    Acuna, Claudio; Liu, Xinran; Gonzalez, Aneysis; Südhof, Thomas C

    2015-09-23

    Ultrafast neurotransmitter release requires tight colocalization of voltage-gated Ca(2+) channels with primed, release-ready synaptic vesicles at the presynaptic active zone. RIM-binding proteins (RIM-BPs) are multidomain active zone proteins that bind to RIMs and to Ca(2+) channels. In Drosophila, deletion of RIM-BPs dramatically reduces neurotransmitter release, but little is known about RIM-BP function in mammalian synapses. Here, we generated double conditional knockout mice for RIM-BP1 and RIM-BP2, and analyzed RIM-BP-deficient synapses in cultured hippocampal neurons and the calyx of Held. Surprisingly, we find that in murine synapses, RIM-BPs are not essential for neurotransmitter release as such, but are selectively required for high-fidelity coupling of action potential-induced Ca(2+) influx to Ca(2+)-stimulated synaptic vesicle exocytosis. Deletion of RIM-BPs decelerated action-potential-triggered neurotransmitter release and rendered it unreliable, thereby impairing the fidelity of synaptic transmission. Thus, RIM-BPs ensure optimal organization of the machinery for fast release in mammalian synapses without being a central component of the machinery itself. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Tuning the electronic properties of gated multilayer phosphorene: A self-consistent tight-binding study

    NASA Astrophysics Data System (ADS)

    Li, L. L.; Partoens, B.; Peeters, F. M.

    2018-04-01

    By taking account of the electric-field-induced charge screening, a self-consistent calculation within the framework of the tight-binding approach is employed to obtain the electronic band structure of gated multilayer phosphorene and the charge densities on the different phosphorene layers. We find charge density and screening anomalies in single-gated multilayer phosphorene and electron-hole bilayers in dual-gated multilayer phosphorene. Due to the unique puckered lattice structure, both intralayer and interlayer charge screenings are important in gated multilayer phosphorene. We find that the electric-field tuning of the band structure of multilayer phosphorene is distinctively different in the presence and absence of charge screening. For instance, it is shown that the unscreened band gap of multilayer phosphorene decreases dramatically with increasing electric-field strength. However, in the presence of charge screening, the magnitude of this band-gap decrease is significantly reduced and the reduction depends strongly on the number of phosphorene layers. Our theoretical results of the band-gap tuning are compared with recent experiments and good agreement is found.

  3. Implementation and benchmark of a long-range corrected functional in the density functional based tight-binding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lutsker, V.; Niehaus, T. A., E-mail: thomas.niehaus@physik.uni-regensburg.de; Aradi, B.

    2015-11-14

    Bridging the gap between first principles methods and empirical schemes, the density functional based tight-binding method (DFTB) has become a versatile tool in predictive atomistic simulations over the past years. One of the major restrictions of this method is the limitation to local or gradient corrected exchange-correlation functionals. This excludes the important class of hybrid or long-range corrected functionals, which are advantageous in thermochemistry, as well as in the computation of vibrational, photoelectron, and optical spectra. The present work provides a detailed account of the implementation of DFTB for a long-range corrected functional in generalized Kohn-Sham theory. We apply themore » method to a set of organic molecules and compare ionization potentials and electron affinities with the original DFTB method and higher level theory. The new scheme cures the significant overpolarization in electric fields found for local DFTB, which parallels the functional dependence in first principles density functional theory (DFT). At the same time, the computational savings with respect to full DFT calculations are not compromised as evidenced by numerical benchmark data.« less

  4. GABAB receptor cell surface export is controlled by an endoplasmic reticulum gatekeeper

    PubMed Central

    Doly, Stéphane; Shirvani, Hamasseh; Gäta, Gabriel; Meye, Frank; Emerit, Michel-Boris; Enslen, Hervé; Achour, Lamia; Pardo-Lopez, Liliana; Kwon, Yang Seung; Armand, Vincent; Gardette, Robert; Giros, Bruno; Gassmann, Martin; Bettler, Bernhard; Mameli, Manuel; Darmon, Michèle; Marullo, Stefano

    2016-01-01

    Summary Endoplasmic reticulum (ER) release and cell surface export of many G protein-coupled receptors (GPCRs), are tightly regulated. For GABAB receptors of GABA, the major mammalian inhibitory neurotransmitter, the ligand-binding GB1 subunit is maintained in the ER by unknown mechanisms in the absence of hetero-dimerization with the GB2 subunit. We report that GB1 retention is regulated by a specific gatekeeper, PRAF2. This ER resident transmembrane protein binds to GB1, preventing its progression in the biosynthetic pathway. GB1 release occurs upon competitive displacement from PRAF2 by GB2. PRAF2 concentration, relative to that of GB1 and GB2, tightly controls cell surface receptor density and controls GABAB function in neurons. Experimental perturbation of PRAF2 levels in vivo caused marked hyperactivity disorders in mice. These data reveal an unanticipated major impact of specific ER gate-keepers on GPCR function and identify PRAF2 as a new molecular target with therapeutic potential for psychiatric and neurological diseases involving GABAB function. PMID:26033241

  5. Proposed truncated Cu-Hf tight-binding potential to study the crystal-to-amorphous phase transition

    NASA Astrophysics Data System (ADS)

    Cui, Yuanyuan; Li, Jiahao; Dai, Ye; Liu, Baixin

    2010-09-01

    Proposed truncated Cu-Hf tight-binding potential was constructed by fitting the physical properties of Cu, Hf, and their stable compounds, i.e., Cu5Hf, Cu8Hf3, Cu10Hf7, and CuHf2. Based on the constructed potentials, molecular dynamics simulations were carried out to compare the relative stability of the crystalline solid solution and the disordered state. Simulation results not only reveal that the physical origin of crystal-to-amorphous transition is the crystalline lattice collapsing when the solute atoms exceeding the critical concentration, but also predict that the glass forming range (GFR) of the Cu-Hf system is 21-77 at. % Cu, which covers the GFRs determined by various metallic glass-producing techniques. Ion beam mixing experiments of the Cu-Hf system were conducted using 200 keV xenon ions and the results show that a uniform amorphous phase can be obtained in the Cu23Hf77 sample, matching well with the GFR determined by the interatomic potential, which, in turn, provides additional evidence to the relevance of the constructed Cu-Hf potential.

  6. A Sparse Self-Consistent Field Algorithm and Its Parallel Implementation: Application to Density-Functional-Based Tight Binding.

    PubMed

    Scemama, Anthony; Renon, Nicolas; Rapacioli, Mathias

    2014-06-10

    We present an algorithm and its parallel implementation for solving a self-consistent problem as encountered in Hartree-Fock or density functional theory. The algorithm takes advantage of the sparsity of matrices through the use of local molecular orbitals. The implementation allows one to exploit efficiently modern symmetric multiprocessing (SMP) computer architectures. As a first application, the algorithm is used within the density-functional-based tight binding method, for which most of the computational time is spent in the linear algebra routines (diagonalization of the Fock/Kohn-Sham matrix). We show that with this algorithm (i) single point calculations on very large systems (millions of atoms) can be performed on large SMP machines, (ii) calculations involving intermediate size systems (1000-100 000 atoms) are also strongly accelerated and can run efficiently on standard servers, and (iii) the error on the total energy due to the use of a cutoff in the molecular orbital coefficients can be controlled such that it remains smaller than the SCF convergence criterion.

  7. Green functions of graphene: An analytic approach

    NASA Astrophysics Data System (ADS)

    Lawlor, James A.; Ferreira, Mauro S.

    2015-04-01

    In this article we derive the lattice Green Functions (GFs) of graphene using a Tight Binding Hamiltonian incorporating both first and second nearest neighbour hoppings and allowing for a non-orthogonal electron wavefunction overlap. It is shown how the resulting GFs can be simplified from a double to a single integral form to aid computation, and that when considering off-diagonal GFs in the high symmetry directions of the lattice this single integral can be approximated very accurately by an algebraic expression. By comparing our results to the conventional first nearest neighbour model commonly found in the literature, it is apparent that the extended model leads to a sizeable change in the electronic structure away from the linear regime. As such, this article serves as a blueprint for researchers who wish to examine quantities where these considerations are important.

  8. Thermoelectric efficiency of single-molecule junctions with long molecular linkers.

    PubMed

    Zimbovskaya, Natalya A

    2018-06-18

    We report results of theoretical studies of thermoelectric efficiency of single-molecule junctions with long molecular linkers. The linker is simulated by a chain of identical sites described using a tight-binding model. It is shown that thermoelectric figure of merit ZT strongly depends on the bridge length, being controlled by the lineshape of electron transmission function within the tunnel energy range corresponding to HOMO/LUMO transport channel. Using the adopted model we demonstrate that ZT may significantly increase as the linker lengthens, and that gateway states on the bridge (if any) may noticeably affect the length-dependent ZT. Temperature dependences of ZT for various bridge lengths are analyzed. It is shown that broad minima emerge in ZT versus temperature curves whose positions are controlled by the bridge lengths. © 2018 IOP Publishing Ltd.

  9. Binding of various ovotransferrin fragments to chick-embryo red cells.

    PubMed Central

    Oratore, A; D'Andrea, G; Moreton, K; Williams, J

    1989-01-01

    1. The ability of N- and C-terminal half-molecule fragments of hen ovotransferrin to interact with chick red blood cells (CERBC) has been studied under conditions that allow binding of the transferrin to transferrin receptors to take place, but not the delivery of iron to the cell. Two kinds of half-molecule fragments were used: (a) those which can associate with one another to give a dimer resembling native transferrin and (b) those which cannot associate in this way because they lack a few amino acid residues from their C-terminal ends. 2. Neither N nor C half-molecules alone can bind to the CERBC, but, when both are present, tight binding occurs. 3. Whether or not the half-molecules can associate with one another makes little difference to receptor binding. 4. Given that one of the half-molecules is iron-saturated, the presence or absence of iron in the contralateral half-molecule again makes little difference to receptor binding. PMID:2920021

  10. Controlled rotation of the F1-ATPase reveals differential and continuous binding changes for ATP synthesis

    PubMed Central

    Adachi, Kengo; Oiwa, Kazuhiro; Yoshida, Masasuke; Nishizaka, Takayuki; Kinosita, Kazuhiko

    2012-01-01

    F1-ATPase is an ATP-driven rotary molecular motor that synthesizes ATP when rotated in reverse. To elucidate the mechanism of ATP synthesis, we imaged binding and release of fluorescently labelled ADP and ATP while rotating the motor in either direction by magnets. Here we report the binding and release rates for each of the three catalytic sites for 360° of the rotary angle. We show that the rates do not significantly depend on the rotary direction, indicating ATP synthesis by direct reversal of the hydrolysis-driven rotation. ADP and ATP are discriminated in angle-dependent binding, but not in release. Phosphate blocks ATP binding at angles where ADP binding is essential for ATP synthesis. In synthesis rotation, the affinity for ADP increases by >104, followed by a shift to high ATP affinity, and finally the affinity for ATP decreases by >104. All these angular changes are gradual, implicating tight coupling between the rotor angle and site affinities. PMID:22929779

  11. Neuraminidase inhibitor R-125489 - A promising drug for treating influenza virus: Steered molecular dynamics approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mai, Binh Khanh; Li, Mai Suan, E-mail: masli@ifpan.edu.pl

    2011-07-08

    Highlights: {yields} We study binding affinity of R-125489 and its prodrug CS-8958 to neuraminidase of pathogenic influenza viruses by molecular dynamics simulations. {yields} It is shown that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. {yields} We predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus. {yields} The high correlation between theoretical and experimental data implies that SMD is a very promising tool for drug design. -- Abstract: Two neuraminidase inhibitors, oseltamivir and zanamivir, are important drug treatments for influenza. Oseltamivir-resistant mutants of the influenzamore » virus A/H1N1 and A/H5N1 have emerged, necessitating the development of new long-acting antiviral agents. One such agent is a new neuraminidase inhibitor R-125489 and its prodrug CS-8958. An atomic level understanding of the nature of this antiviral agents binding is still missing. We address this gap in our knowledge by applying steered molecular dynamics (SMD) simulations to different subtypes of seasonal and highly pathogenic influenza viruses. We show that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. Based on results obtained by SMD and the molecular mechanics-Poisson-Boltzmann surface area method, we predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus as its binding affinity does not vary much across these systems. The high correlation level between theoretically determined rupture forces and experimental data on binding energies for the large number of systems studied here implies that SMD is a promising tool for drug design.« less

  12. Ankyrin-G Inhibits Endocytosis of Cadherin Dimers.

    PubMed

    Cadwell, Chantel M; Jenkins, Paul M; Bennett, Vann; Kowalczyk, Andrew P

    2016-01-08

    Dynamic regulation of endothelial cell adhesion is central to vascular development and maintenance. Furthermore, altered endothelial adhesion is implicated in numerous diseases. Therefore, normal vascular patterning and maintenance require tight regulation of endothelial cell adhesion dynamics. However, the mechanisms that control junctional plasticity are not fully understood. Vascular endothelial cadherin (VE-cadherin) is an adhesive protein found in adherens junctions of endothelial cells. VE-cadherin mediates adhesion through trans interactions formed by its extracellular domain. Trans binding is followed by cis interactions that laterally cluster the cadherin in junctions. VE-cadherin is linked to the actin cytoskeleton through cytoplasmic interactions with β- and α-catenin, which serve to increase adhesive strength. Furthermore, p120-catenin binds to the cytoplasmic tail of cadherin and stabilizes it at the plasma membrane. Here we report that induced cis dimerization of VE-cadherin inhibits endocytosis independent of both p120 binding and trans interactions. However, we find that ankyrin-G, a protein that links membrane proteins to the spectrin-actin cytoskeleton, associates with VE-cadherin and inhibits its endocytosis. Ankyrin-G inhibits VE-cadherin endocytosis independent of p120 binding. We propose a model in which ankyrin-G associates with and inhibits the endocytosis of VE-cadherin cis dimers. Our findings support a novel mechanism for regulation of VE-cadherin endocytosis through ankyrin association with cadherin engaged in lateral interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    C Simmons; C Magee; D Smith

    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADPmore » cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.« less

  14. A mathematical model of the mevalonate cholesterol biosynthesis pathway.

    PubMed

    Pool, Frances; Currie, Richard; Sweby, Peter K; Salazar, José Domingo; Tindall, Marcus J

    2018-04-14

    We formulate, parameterise and analyse a mathematical model of the mevalonate pathway, a key pathway in the synthesis of cholesterol. Of high clinical importance, the pathway incorporates rate limiting enzymatic reactions with multiple negative feedbacks. In this work we investigate the pathway dynamics and demonstrate that rate limiting steps and negative feedbacks within it act in concert to tightly regulate intracellular cholesterol levels. Formulated using the theory of nonlinear ordinary differential equations and parameterised in the context of a hepatocyte, the governing equations are analysed numerically and analytically. Sensitivity and mathematical analysis demonstrate the importance of the two rate limiting enzymes 3-hydroxy-3-methylglutaryl-CoA reductase and squalene synthase in controlling the concentration of substrates within the pathway as well as that of cholesterol. The role of individual feedbacks, both global (between that of cholesterol and sterol regulatory element-binding protein 2; SREBP-2) and local internal (between substrates in the pathway) are investigated. We find that whilst the cholesterol SREBP-2 feedback regulates the overall system dynamics, local feedbacks activate within the pathway to tightly regulate the overall cellular cholesterol concentration. The network stability is analysed by constructing a reduced model of the full pathway and is shown to exhibit one real, stable steady-state. We close by addressing the biological question as to how farnesyl-PP levels are affected by CYP51 inhibition, and demonstrate that the regulatory mechanisms within the network work in unison to ensure they remain bounded. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Effects of Varying Degrees of Intermittent Hypoxia on Proinflammatory Cytokines and Adipokines in Rats and 3T3-L1 Adipocytes

    PubMed Central

    Zhou, Qin; Zhu, Hui; Niu, Wen-yan; Feng, Jing; Wang, Yan; Cao, Jie; Chen, Bao-yuan

    2014-01-01

    Objectives Intermittent hypoxia (IH), resulted from recurring episodes of upper airway obstruction, is the hallmark feature and the most important pathophysiologic pathway of obstructive sleep apnea (OSA). IH is believed to be the most important factor causing systemic inflammation. Studies suggest that insulin resistance (IR) is positively associated with OSA. In this study, we hypothesized that the recurrence of IH might result in cellular and systemic inflammation, which was manifested through the levels of proinflammatory cytokines and adipokines after IH exposure, and because IR is linked with inflammation tightly, this inflammatory situation may implicate an IR status. Methods We developed an IH 3T3-L1 adipocyte and rat model respectively, recapitulating the nocturnal oxygen profile in OSA. In IH cells, nuclear factor kappa B (NF-κB) DNA binding reactions, hypoxia-inducible factor-1α (HIF-1α), glucose transporter-1 (Glut-1), necrosis factor alpha (TNF-α), interleukin (IL) -6, leptin, adiponectin mRNA transcriptional activities and protein expressions were measured. In IH rats, blood glucose, insulin, TNF-α, IL-6, leptin and adiponectin levels were analyzed. Results The insulin and blood glucose levels in rats and NF-κB DNA binding activities in cells had significantly statistical results described as severe IH>moderate IH>mild IH>sustained hypoxia>control. The mRNA and protein levels of HIF-1α and Glut-1 in severe IH group were the highest. In cellular and animal models, both the mRNA and protein levels of TNF-α, IL-6 and leptin were the highest in severe IH group, when the lowest in severe IH group for adiponectin. Conclusions Oxidative stress and the release of pro-inflammatory cytokines/adipokines, which are the systemic inflammatory markers, are associated with IH closely and are proportional to the severity of IH. Because IR and glucose intolerance are linked with inflammation tightly, our results may implicate the clinical relationships between OSA and IR. PMID:24466027

  16. Uncoupling protein 1 binds one nucleotide per monomer and is stabilized by tightly bound cardiolipin

    PubMed Central

    Lee, Yang; Willers, Chrissie; Kunji, Edmund R. S.; Crichton, Paul G.

    2015-01-01

    Uncoupling protein 1 (UCP1) catalyzes fatty acid-activated, purine nucleotide-sensitive proton leak across the mitochondrial inner membrane of brown adipose tissue to produce heat, and could help combat obesity and metabolic disease in humans. Studies over the last 30 years conclude that the protein is a dimer, binding one nucleotide molecule per two proteins, and unlike the related mitochondrial ADP/ATP carrier, does not bind cardiolipin. Here, we have developed novel methods to purify milligram amounts of UCP1 from native sources by using covalent chromatography that, unlike past methods, allows the protein to be prepared in defined conditions, free of excess detergent and lipid. Assessment of purified preparations by TLC reveal that UCP1 retains tightly bound cardiolipin, with a lipid phosphorus content equating to three molecules per protein, like the ADP/ATP carrier. Cardiolipin stabilizes UCP1, as demonstrated by reconstitution experiments and thermostability assays, indicating that the lipid has an integral role in the functioning of the protein, similar to other mitochondrial carriers. Furthermore, we find that UCP1 is not dimeric but monomeric, as indicated by size exclusion analysis, and has a ligand titration profile in isothermal calorimetric measurements that clearly shows that one nucleotide binds per monomer. These findings reveal the fundamental composition of UCP1, which is essential for understanding the mechanism of the protein. Our assessment of the properties of UCP1 indicate that it is not unique among mitochondrial carriers and so is likely to use a common exchange mechanism in its primary function in brown adipose tissue mitochondria. PMID:26038550

  17. NMR Studies of the C-Terminus of alpha4 Reveal Possible Mechanism of Its Interaction with MID1 and Protein Phosphatase 2A

    PubMed Central

    Du, Haijuan; Massiah, Michael A.

    2011-01-01

    Alpha4 is a regulatory subunit of the protein phosphatase family of enzymes and plays an essential role in regulating the catalytic subunit of PP2A (PP2Ac) within the rapamycin-sensitive signaling pathway. Alpha4 also interacts with MID1, a microtubule-associated ubiquitin E3 ligase that appears to regulate the function of PP2A. The C-terminal region of alpha4 plays a key role in the binding interaction of PP2Ac and MID1. Here we report on the solution structure of a 45-amino acid region derived from the C-terminus of alpha4 (alpha45) that binds tightly to MID1. In aqueous solution, alpha45 has properties of an intrinsically unstructured peptide although chemical shift index and dihedral angle estimation based on chemical shifts of backbone atoms indicate the presence of a transient α-helix. Alpha45 adopts a helix-turn-helix HEAT-like structure in 1% SDS micelles, which may mimic a negatively charged surface for which alpha45 could bind. Alpha45 binds tightly to the Bbox1 domain of MID1 in aqueous solution and adopts a structure consistent with the helix-turn-helix structure observed in 1% SDS. The structure of alpha45 reveals two distinct surfaces, one that can interact with a negatively charged surface, which is present on PP2A, and one that interacts with the Bbox1 domain of MID1. PMID:22194938

  18. The VirD2 pilot protein of Agrobacterium-transferred DNA interacts with the TATA box-binding protein and a nuclear protein kinase in plants

    PubMed Central

    Bakó, László; Umeda, Masaaki; Tiburcio, Antonio F.; Schell, Jeff; Koncz, Csaba

    2003-01-01

    The bacterial virulence protein VirD2 plays an important role in nuclear import and chromosomal integration of Agrobacterium-transferred DNA in fungal, plant, animal, and human cells. Here we show that in nuclei of alfalfa cells, VirD2 interacts with and is phosphorylated by CAK2Ms, a conserved plant ortholog of cyclin-dependent kinase-activating kinases. CAK2Ms binds to and phosphorylates the C-terminal regulatory domain of RNA polymerase II largest subunit, which can recruit the TATA box-binding protein. VirD2 is found in tight association with the TATA box-binding protein in vivo. These results indicate that recognition of VirD2 is mediated by widely conserved nuclear factors in eukaryotes. PMID:12900506

  19. Anion-induced reconstitution of a self-assembling system to express a chloride-binding Co10L15 pentagonal prism.

    PubMed

    Riddell, Imogen A; Smulders, Maarten M J; Clegg, Jack K; Hristova, Yana R; Breiner, Boris; Thoburn, John D; Nitschke, Jonathan R

    2012-09-01

    Biochemical systems are adaptable, capable of reconstitution at all levels to achieve the functions associated with life. Synthetic chemical systems are more limited in their ability to reorganize to achieve new functions; they can reconfigure to bind an added substrate (template effect) or one binding event may modulate a receptor's affinity for a second substrate (allosteric effect). Here we describe a synthetic chemical system that is capable of structural reconstitution on receipt of one anionic signal (perchlorate) to create a tight binding pocket for another anion (chloride). The complex, barrel-like structure of the chloride receptor is templated by five perchlorate anions. This second-order templation phenomenon allows chemical networks to be envisaged that express more complex responses to chemical signals than is currently feasible.

  20. Tunnel Field-Effect Transistors in 2-D Transition Metal Dichalcogenide Materials

    NASA Astrophysics Data System (ADS)

    Ilatikhameneh, Hesameddin; Tan, Yaohua; Novakovic, Bozidar; Klimeck, Gerhard; Rahman, Rajib; Appenzeller, Joerg

    2015-12-01

    In this work, the performance of Tunnel Field-Effect Transistors (TFETs) based on two-dimensional Transition Metal Dichalcogenide (TMD) materials is investigated by atomistic quantum transport simulations. One of the major challenges of TFETs is their low ON-currents. 2D material based TFETs can have tight gate control and high electric fields at the tunnel junction, and can in principle generate high ON-currents along with a sub-threshold swing smaller than 60 mV/dec. Our simulations reveal that high performance TMD TFETs, not only require good gate control, but also rely on the choice of the right channel material with optimum band gap, effective mass and source/drain doping level. Unlike previous works, a full band atomistic tight binding method is used self-consistently with 3D Poisson equation to simulate ballistic quantum transport in these devices. The effect of the choice of TMD material on the performance of the device and its transfer characteristics are discussed. Moreover, the criteria for high ON-currents are explained with a simple analytic model, showing the related fundamental factors. Finally, the subthreshold swing and energy-delay of these TFETs are compared with conventional CMOS devices.

  1. Temperature-dependent band structure of SrTiO3 interfaces

    NASA Astrophysics Data System (ADS)

    Raslan, Amany; Lafleur, Patrick; Atkinson, W. A.

    2017-02-01

    We build a theoretical model for the electronic properties of the two-dimensional (2D) electron gas that forms at the interface between insulating SrTiO3 and a number of polar cap layers, including LaTiO3, LaAlO3, and GdTiO3. The model treats conduction electrons within a tight-binding approximation and the dielectric polarization via a Landau-Devonshire free energy that incorporates strontium titanate's strongly nonlinear, nonlocal, and temperature-dependent dielectric response. The self-consistent band structure comprises a mix of quantum 2D states that are tightly bound to the interface and quasi-three-dimensional (3D) states that extend hundreds of unit cells into the SrTiO3 substrate. We find that there is a substantial shift of electrons away from the interface into the 3D tails as temperature is lowered from 300 K to 10 K. This shift is least important at high electron densities (˜1014cm-2 ) but becomes substantial at low densities; for example, the total electron density within 4 nm of the interface changes by a factor of two for 2D electron densities ˜1013cm-2 . We speculate that the quasi-3D tails form the low-density high-mobility component of the interfacial electron gas that is widely inferred from magnetoresistance measurements.

  2. Adenosylcobinamide methyl phosphate as a pseudocoenzyme for diol dehydrase.

    PubMed

    Ishida, A; Toraya, T

    1993-02-16

    Adenosylcobinamide methyl phosphate, a novel analog of adenosylcobalamin lacking the nucleotide loop moiety, was synthesized. It did not show detectable coenzymic activity but behaved as a strong competitive inhibitor against AdoCbl with relatively high affinity (Ki = 2.5 microM). When apoenzyme was incubated at 37 degrees C with this analog in the presence of substrate, the Co-C bond of the analog was almost completely and irreversibly cleaved within 10 min, forming an enzyme-bound Co(II)-containing species. The cleavage was not observed in the absence of substrate. The Co-C bond cleavage in the presence of substrate was not catalytic but stoichiometric, implying that the Co-C bond of the analog undergoes activation when the analog binds to the active site of the enzyme. 5'-Deoxyadenosine was the only product derived from the adenosyl group of the analog upon the Co-C bond cleavage. Apoenzyme did not undergo modification during this process. Therefore, it seems likely that adenosylcobinamide methyl phosphate acts as a pseudocoenzyme or a potent suicide coenzyme. Since adenosylcobinamide neither functions as coenzyme nor binds tightly to apoenzyme, it can be concluded that the phosphodiester moiety of the nucleotide loop of adenosylcobalamin is essential for tight binding to apoenzyme and therefore for subsequent activation of the Co-C bond and catalysis. It is also evident that the nucleotide loop is obligatory for the normal progress of catalytic cycle.

  3. NMR Model of PrgI-SipD Interaction and its Implications in the Needle-Tip Assembly of the Salmonella Type III Secretion System

    PubMed Central

    Rathinavelan, Thenmalarchelvi; Lara-Tejero, Maria; Lefebre, Matthew; Chatterjee, Srirupa; McShan, Andrew C.; Guo, Da-Chuan; Tang, Chun; Galan, Jorge E.; De Guzman, Roberto N.

    2014-01-01

    Salmonella and other pathogenic bacteria use the type III secretion system (T3SS) to inject virulence proteins into human cells to initiate infections. The structural component of the T3SS contains a needle and a needle tip. The needle is assembled from PrgI needle protomers and the needle tip is capped with several copies of the SipD tip protein. How a tip protein docks on the needle is unclear. A crystal structure of a PrgI-SipD fusion protein docked on the PrgI needle results in steric clash of SipD at the needle tip when modeled on the recent atomic structure of the needle. Thus, there is currently no good model of how SipD is docked on the PrgI needle tip. Previously, we showed by NMR paramagnetic relaxation enhancement (PRE) methods that a specific region in the SipD coiled-coil is the binding site for PrgI. Others have hypothesized that a domain of the tip protein – the N-terminal α-helical hairpin, has to swing away during the assembly of the needle apparatus. Here, we show by PRE methods that a truncated form of SipD lacking the α-helical hairpin domain binds more tightly to PrgI. Further, PRE-based structure calculations revealed multiple PrgI binding sites on the SipD coiled-coil. Our PRE results together with the recent NMR-derived atomic structure of the Salmonella needle suggest a possible model of how SipD might dock at the PrgI needle tip. SipD and PrgI are conserved in other bacterial T3SSs, thus our results have wider implication in understanding other needle-tip complexes. PMID:24951833

  4. Social Justice and Social Order: Binding Moralities across the Political Spectrum

    PubMed Central

    2016-01-01

    Two studies explored the relationship between political ideology and endorsement of a range of moral principles. Political liberals and conservatives did not differ on intrapersonal or interpersonal moralities, which require self-regulation. However differences emerged on collective moralities, which involve social regulation. Contrary to Moral Foundations Theory, both liberals and conservatives endorsed a group-focused binding morality, specifically Social Justice and Social Order respectively. Libertarians were the group without a binding morality. Although Social Justice and Social Order appear conflictual, analyses based on earlier cross-cultural work on societal tightness-looseness suggest that countries actually benefit in terms of economic success and societal well-being when these group-based moralities co-exist and serve as counterweights in social regulation. PMID:27031103

  5. Crystal structure of coelenterazine-binding protein from Renilla muelleri at 1.7 A: why it is not a calcium-regulated photoprotein.

    PubMed

    Stepanyuk, Galina A; Liu, Zhi-Jie; Markova, Svetlana S; Frank, Ludmila A; Lee, John; Vysotski, Eugene S; Wang, Bi-Cheng

    2008-04-01

    Bioluminescence in the sea pansy Renilla involves two distinct proteins, a Ca2+-triggered coelenterazine-binding protein (CBP), and Renilla luciferase. CBP contains one tightly bound coelenterazine molecule, which becomes available for reaction with luciferase and O2 only subsequent to Ca2+ binding. CBP belongs to the EF-hand superfamily of Ca2+-binding proteins and contains three "EF-hand" Ca2+-binding sites. The overall spatial structure of recombinant selenomethionine-labeled CBP determined at 1.7 A, is found to approximate the protein scaffold characteristic of the class of Ca2+-regulated photoproteins. Photoproteins however, catalyze molecular oxygen addition to coelenterazine producing a 2-hydroperoxycoelenterazine intermediate, which is stabilized within the binding cavity in the absence of Ca2+. Addition of Ca2+ triggers the bioluminescence reaction. However in CBP this first step of oxygen addition is not allowed. The different amino acid environments and hydrogen bond interactions within the binding cavity, are proposed to account for the different properties of the two classes of proteins.

  6. MCM ring hexamerization is a prerequisite for DNA-binding

    DOE PAGES

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

    2015-09-13

    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

  7. Expression of ZO-1 and claudin-1 in a 3D epidermal equivalent using canine progenitor epidermal keratinocytes.

    PubMed

    Teramoto, Keiji; Asahina, Ryota; Nishida, Hidetaka; Kamishina, Hiroaki; Maeda, Sadatoshi

    2018-05-21

    Previous studies indicate that tight junctions are involved in the pathogenesis of canine atopic dermatitis (cAD). An in vitro skin model is needed to elucidate the specific role of tight junctions in cAD. A 3D epidermal equivalent model using canine progenitor epidermal keratinocytes (CPEK) has been established; the expression of tight junctions within this model is uncharacterized. To investigate the expression of tight junctions in the 3D epidermal equivalent. Two normal laboratory beagle dogs served as donors of full-thickness skin biopsy samples for comparison to the in vitro model. Immunohistochemical techniques were employed to investigate the expression of tight junctions including zonula occludens (ZO)-1 and claudin-1 in normal canine skin, and in the CPEK 3D epidermal equivalent. Results demonstrated the expression of ZO-1 and claudin-1 in the CPEK 3D epidermal equivalent, with staining patterns that were similar to those in normal canine skin. The CPEK 3D epidermal equivalent has the potential to be a suitable in vitro research tool for clarifying the specific role of tight junctions in cAD. © 2018 ESVD and ACVD.

  8. Near transferable phenomenological n-body potentials for noble metals

    NASA Astrophysics Data System (ADS)

    Pontikis, Vassilis; Baldinozzi, Gianguido; Luneville, Laurence; Simeone, David

    2017-09-01

    We present a semi-empirical model of cohesion in noble metals with suitable parameters reproducing a selected set of experimental properties of perfect and defective lattices in noble metals. It consists of two short-range, n-body terms accounting respectively for attractive and repulsive interactions, the former deriving from the second moment approximation of the tight-binding scheme and the latter from the gas approximation of the kinetic energy of electrons. The stability of the face centred cubic versus the hexagonal compact stacking is obtained via a long-range, pairwise function of customary use with ionic pseudo-potentials. Lattice dynamics, molecular statics, molecular dynamics and nudged elastic band calculations show that, unlike previous potentials, this cohesion model reproduces and predicts quite accurately thermodynamic properties in noble metals. In particular, computed surface energies, largely underestimated by existing empirical cohesion models, compare favourably with measured values, whereas predicted unstable stacking-fault energy profiles fit almost perfectly ab initio evaluations from the literature. All together the results suggest that this semi-empirical model is nearly transferable.

  9. Near transferable phenomenological n-body potentials for noble metals.

    PubMed

    Pontikis, Vassilis; Baldinozzi, Gianguido; Luneville, Laurence; Simeone, David

    2017-09-06

    We present a semi-empirical model of cohesion in noble metals with suitable parameters reproducing a selected set of experimental properties of perfect and defective lattices in noble metals. It consists of two short-range, n-body terms accounting respectively for attractive and repulsive interactions, the former deriving from the second moment approximation of the tight-binding scheme and the latter from the gas approximation of the kinetic energy of electrons. The stability of the face centred cubic versus the hexagonal compact stacking is obtained via a long-range, pairwise function of customary use with ionic pseudo-potentials. Lattice dynamics, molecular statics, molecular dynamics and nudged elastic band calculations show that, unlike previous potentials, this cohesion model reproduces and predicts quite accurately thermodynamic properties in noble metals. In particular, computed surface energies, largely underestimated by existing empirical cohesion models, compare favourably with measured values, whereas predicted unstable stacking-fault energy profiles fit almost perfectly ab initio evaluations from the literature. All together the results suggest that this semi-empirical model is nearly transferable.

  10. Multi-level molecular modelling for plasma medicine

    NASA Astrophysics Data System (ADS)

    Bogaerts, Annemie; Khosravian, Narjes; Van der Paal, Jonas; Verlackt, Christof C. W.; Yusupov, Maksudbek; Kamaraj, Balu; Neyts, Erik C.

    2016-02-01

    Modelling at the molecular or atomic scale can be very useful for obtaining a better insight in plasma medicine. This paper gives an overview of different atomic/molecular scale modelling approaches that can be used to study the direct interaction of plasma species with biomolecules or the consequences of these interactions for the biomolecules on a somewhat longer time-scale. These approaches include density functional theory (DFT), density functional based tight binding (DFTB), classical reactive and non-reactive molecular dynamics (MD) and united-atom or coarse-grained MD, as well as hybrid quantum mechanics/molecular mechanics (QM/MM) methods. Specific examples will be given for three important types of biomolecules, present in human cells, i.e. proteins, DNA and phospholipids found in the cell membrane. The results show that each of these modelling approaches has its specific strengths and limitations, and is particularly useful for certain applications. A multi-level approach is therefore most suitable for obtaining a global picture of the plasma-biomolecule interactions.

  11. Modeling Carbon and Hydrocarbon Molecular Structures in EZTB

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; vonAllmen, Paul

    2007-01-01

    A software module that models the electronic and mechanical aspects of hydrocarbon molecules and carbon molecular structures on the basis of first principles has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure, which is summarized briefly in the immediately preceding article. Of particular interest, this module can model carbon crystals and nanotubes characterized by various coordinates and containing defects, without need to adjust parameters of the physical model. The module has been used to study the changes in electronic properties of carbon nanotubes, caused by bending of the nanotubes, for potential utility as the basis of a nonvolatile, electriccharge- free memory devices. For example, in one application of the module, it was found that an initially 50-nmlong carbon, (10,10)-chirality nanotube, which is a metallic conductor when straight, becomes a semiconductor with an energy gap of .3 meV when bent to a lateral displacement of 4 nm at the middle.

  12. Interacting quasi-band model for electronic states in compound semiconductor alloys: Zincblende structure

    NASA Astrophysics Data System (ADS)

    Shinozuka, Yuzo; Oda, Masato

    2015-09-01

    The interacting quasi-band model proposed for electronic states in simple alloys is extended for compound semiconductor alloys with general lattice structures containing several atoms per unit cell. Using a tight-binding model, a variational electronic wave function for quasi-Bloch states yields a non-Hermitian Hamiltonian matrix characterized by matrix elements of constituent crystals and concentration of constituents. Solving secular equations for each k-state yields the alloy’s energy spectrum for any type of randomness and arbitrary concentration. The theory is used to address III-V (II-VI) alloys with a zincblende lattice with crystal band structures well represented by the sp3s* model. Using the resulting 15 × 15 matrix, the concentration dependence of valence and conduction bands is calculated in a unified scheme for typical alloys: Al1-xGaxAs, GaAs1-xPx, and GaSb1-xPx. Results agree well with experiments and are discussed with respect to the concentration dependence, direct-indirect gap transition, and band-gap-bowing origin.

  13. QM/QM approach to model energy disorder in amorphous organic semiconductors.

    PubMed

    Friederich, Pascal; Meded, Velimir; Symalla, Franz; Elstner, Marcus; Wenzel, Wolfgang

    2015-02-10

    It is an outstanding challenge to model the electronic properties of organic amorphous materials utilized in organic electronics. Computation of the charge carrier mobility is a challenging problem as it requires integration of morphological and electronic degrees of freedom in a coherent methodology and depends strongly on the distribution of polaron energies in the system. Here we represent a QM/QM model to compute the polaron energies combining density functional methods for molecules in the vicinity of the polaron with computationally efficient density functional based tight binding methods in the rest of the environment. For seven widely used amorphous organic semiconductor materials, we show that the calculations are accelerated up to 1 order of magnitude without any loss in accuracy. Considering that the quantum chemical step is the efficiency bottleneck of a workflow to model the carrier mobility, these results are an important step toward accurate and efficient disordered organic semiconductors simulations, a prerequisite for accelerated materials screening and consequent component optimization in the organic electronics industry.

  14. a Fractal Permeability Model Coupling Boundary-Layer Effect for Tight Oil Reservoirs

    NASA Astrophysics Data System (ADS)

    Wang, Fuyong; Liu, Zhichao; Jiao, Liang; Wang, Congle; Guo, Hu

    A fractal permeability model coupling non-flowing boundary-layer effect for tight oil reservoirs was proposed. Firstly, pore structures of tight formations were characterized with fractal theory. Then, with the empirical equation of boundary-layer thickness, Hagen-Poiseuille equation and fractal theory, a fractal torturous capillary tube model coupled with boundary-layer effect was developed, and verified with experimental data. Finally, the parameters influencing effective liquid permeability were quantitatively investigated. The research results show that effective liquid permeability of tight formations is not only decided by pore structures, but also affected by boundary-layer distributions, and effective liquid permeability is the function of fluid type, fluid viscosity, pressure gradient, fractal dimension, tortuosity fractal dimension, minimum pore radius and maximum pore radius. For the tight formations dominated with nanoscale pores, boundary-layer effect can significantly reduce effective liquid permeability, especially under low pressure gradient.

  15. The ribonucleoprotein Csr network.

    PubMed

    Seyll, Ethel; Van Melderen, Laurence

    2013-11-08

    Ribonucleoprotein complexes are essential regulatory components in bacteria. In this review, we focus on the carbon storage regulator (Csr) network, which is well conserved in the bacterial world. This regulatory network is composed of the CsrA master regulator, its targets and regulators. CsrA binds to mRNA targets and regulates translation either negatively or positively. Binding to small non-coding RNAs controls activity of this protein. Expression of these regulators is tightly regulated at the level of transcription and stability by various global regulators (RNAses, two-component systems, alarmone). We discuss the implications of these complex regulations in bacterial adaptation.

  16. Exciton-phonon cooperative mechanism of the triple-q charge-density-wave and antiferroelectric electron polarization in TiSe2

    NASA Astrophysics Data System (ADS)

    Kaneko, Tatsuya; Ohta, Yukinori; Yunoki, Seiji

    2018-04-01

    We investigate the microscopic mechanisms of the charge-density-wave (CDW) formation in a monolayer TiSe2 using a realistic multiorbital d -p model with electron-phonon coupling and intersite Coulomb (excitonic) interactions. First, we estimate the tight-binding bands of Ti 3 d and Se 4 p orbitals in the monolayer TiSe2 on the basis of the first-principles band-structure calculations. We thereby show orbital textures of the undistorted band structure near the Fermi level. Next, we derive the electron-phonon coupling using the tight-binding approximation and show that the softening occurs in the transverse phonon mode at the M point of the Brillouin zone. The stability of the triple-q CDW state is thus examined to show that the transverse phonon modes at the M1, M2, and M3 points are frozen simultaneously. Then, we introduce the intersite Coulomb interactions between the nearest-neighbor Ti and Se atoms that lead to the excitonic instability between the valence Se 4 p and conduction Ti 3 d bands. Treating the intersite Coulomb interactions in the mean-field approximation, we show that the electron-phonon and excitonic interactions cooperatively stabilize the triple-q CDW state in TiSe2. We also calculate a single-particle spectrum in the CDW state and reproduce the band folding spectra observed in photoemission spectroscopies. Finally, to clarify the nature of the CDW state, we examine the electronic charge density distribution and show that the CDW state in TiSe2 is of a bond type and induces a vortexlike antiferroelectric polarization in the kagome network of Ti atoms.

  17. The role of cytosine methylation on charge transport through a DNA strand

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu; Govind, Niranjan, E-mail: niri.govind@pnnl.gov

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance throughmore » the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.« less

  18. Inhibition of Neuronal Voltage-Gated Sodium Channels by Brilliant Blue G

    PubMed Central

    Jo, Sooyeon

    2011-01-01

    Brilliant blue G (BBG), best known as an antagonist of P2X7 receptors, was found to inhibit voltage-gated sodium currents in N1E-115 neuroblastoma cells. Sodium currents elicited from a holding potential of −60 mV were blocked with an IC50 of 2 μM. Block was enhanced in a use-dependent manner at higher stimulation rates. The voltage-dependence of inactivation was shifted in the hyperpolarizing direction, and recovery from inactivation was slowed by BBG. The most dramatic effect of BBG was to slow recovery from inactivation after long depolarizations, with 3 μM BBG increasing half-time for recovery (measured at −120 mV) from 24 to 854 ms after a 10-s step to 0 mV. These results were mimicked by a kinetic model in which BBG binds weakly to resting channels (Kd = 170 μM) but tightly to fast-inactivated channels (Kd = 5 μM) and even more tightly (Kd = 0.2 μM) to slow-inactivated channels. In contrast to BBG, the structurally related food-coloring dye Brilliant Blue FCF had very little effect at concentrations up to 30 μM. These results show that BBG inhibits voltage-gated sodium channels at micromolar concentrations. Although BBG inhibition of sodium channels is less potent than inhibition of P2X7 receptors, there may be significant inhibition of sodium channels at BBG concentrations achieved in spinal cord or brain during experimental treatment of spinal cord injury or Huntington's disease. Considered as a sodium channel blocker, BBG is remarkably potent, acting with more than 10-fold greater potency than lacosamide, another blocker thought to bind to slow-inactivated channels. PMID:21536754

  19. Multi-scale predictive modeling of nano-material and realistic electron devices

    NASA Astrophysics Data System (ADS)

    Palaria, Amritanshu

    Among the challenges faced in further miniaturization of electronic devices, heavy influence of the detailed atomic configuration of the material(s) involved, which often differs significantly from that of the bulk material(s), is prominent. Device design has therefore become highly interrelated with material engineering at the atomic level. This thesis aims at outlining, with examples, a multi-scale simulation procedure that allows one to integrate material and device aspects of nano-electronic design to predict behavior of novel devices with novel material. This is followed in four parts: (1) An approach that combines a higher time scale reactive force field analysis with density functional theory to predict structure of new material is demonstrated for the first time for nanowires. Novel stable structures for very small diameter silicon nanowires are predicted. (2) Density functional theory is used to show that the new nanowire structures derived in 1 above have properties different from diamond core wires even though the surface bonds in some may be similar to the surface of bulk silicon. (3) Electronic structure of relatively large-scale germanium sections of realistically strained Si/strained Ge/ strained Si nanowire heterostructures is computed using empirical tight binding and it is shown that the average non-homogeneous strain in these structures drives their interesting non-conventional electronic characteristics such as hole effective masses which decrease as the wire cross-section is reduced. (4) It is shown that tight binding, though empirical in nature, is not necessarily limited to the material and atomic structure for which the parameters have been empirically derived, but that simple changes may adapt the derived parameters to new bond environments. Si (100) surface electronic structure is obtained from bulk Si parameters.

  20. The role of cytosine methylation on charge transport through a DNA strand

    NASA Astrophysics Data System (ADS)

    Qi, Jianqing; Govind, Niranjan; Anantram, M. P.

    2015-09-01

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

  1. The Relationship of Ethics to Quality: A Particular Case of Research in Autism

    ERIC Educational Resources Information Center

    Waltz, Mitzi

    2007-01-01

    To look for the answers of "What is the relationship between "ethics" and "quality" in education research?," this article explores factors that bind the two too tightly together for extrication, including representation of subject and researcher mindsets, the setting of research agendas, research design and funding. Using research in autism as a…

  2. Transmission eigenchannels from nonequilibrium Green's functions

    NASA Astrophysics Data System (ADS)

    Paulsson, Magnus; Brandbyge, Mads

    2007-09-01

    The concept of transmission eigenchannels is described in a tight-binding nonequilibrium Green’s function (NEGF) framework. A simple procedure for calculating the eigenchannels is derived using only the properties of the device subspace and quantities normally available in a NEGF calculation. The method is exemplified by visualization in real space of the eigenchannels for three different molecular and atomic wires.

  3. Atomic resolution x-ray structure of the substrate recognition domain of higher plant rubisco activase

    USDA-ARS?s Scientific Manuscript database

    The rapid release of tight-binding inhibitors from dead-end Rubisco complexes requires the activity of Rubisco activase, an AAA+ ATPase that utilizes chemo-mechanical energy to catalyze the reactivation of Rubisco. Activase is thought to play a central role in coordinating the rate of CO2 fixation w...

  4. Magnetic field effects on charge structure factors of gapped graphene structure

    NASA Astrophysics Data System (ADS)

    Rezania, Hamed; Tawoose, Nasrin

    2018-02-01

    We present the behaviors of dynamical and static charge susceptibilities of undoped gapped graphene using the Green's function approach in the context of tight binding model Hamiltonian. Specially, the effects of magnetic field on the plasmon modes of gapped graphene structure are investigated via calculating correlation function of charge density operators. Our results show the increase of magnetic field leads to disappear high frequency plasmon mode for gapped case. We also show that low frequency plasmon mode has not affected by increase of magnetic field and chemical potential. Finally the temperature dependence of static charge structure factor of gapp graphene structure is studied. The effects of both magnetic field and gap parameter on the static structure factor are discusses in details.

  5. The effects of Rashba spin-orbit coupling on spin-polarized transport in hexagonal graphene nano-rings and flakes

    NASA Astrophysics Data System (ADS)

    Laghaei, M.; Heidari Semiromi, E.

    2018-03-01

    Quantum transport properties and spin polarization in hexagonal graphene nanostructures with zigzag edges and different sizes were investigated in the presence of Rashba spin-orbit interaction (RSOI). The nanostructure was considered as a channel to which two semi-infinite armchair graphene nanoribbons were coupled as input and output leads. Spin transmission and spin polarization in x, y, and z directions were calculated through applying Landauer-Buttiker formalism with tight binding model and the Green's function to the system. In these quantum structures it is shown that changing the size of system, induce and control the spin polarized currents. In short, these graphene systems are typical candidates for electrical spintronic devices as spin filtering.

  6. Non-hermitian quantum thermodynamics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardas, Bartłomiej; Deffner, Sebastian; Saxena, Avadh

    Thermodynamics is the phenomenological theory of heat and work. Here we analyze to what extent quantum thermodynamic relations are immune to the underlying mathematical formulation of quantum mechanics. As a main result, we show that the Jarzynski equality holds true for all non-hermitian quantum systems with real spectrum. This equality expresses the second law of thermodynamics for isothermal processes arbitrarily far from equilibrium. In the quasistatic limit however, the second law leads to the Carnot bound which is fulfilled even if some eigenenergies are complex provided they appear in conjugate pairs. Lastly, we propose two setups to test our predictions,more » namely with strongly interacting excitons and photons in a semiconductor microcavity and in the non-hermitian tight-binding model.« less

  7. Non-hermitian quantum thermodynamics

    DOE PAGES

    Gardas, Bartłomiej; Deffner, Sebastian; Saxena, Avadh

    2016-03-22

    Thermodynamics is the phenomenological theory of heat and work. Here we analyze to what extent quantum thermodynamic relations are immune to the underlying mathematical formulation of quantum mechanics. As a main result, we show that the Jarzynski equality holds true for all non-hermitian quantum systems with real spectrum. This equality expresses the second law of thermodynamics for isothermal processes arbitrarily far from equilibrium. In the quasistatic limit however, the second law leads to the Carnot bound which is fulfilled even if some eigenenergies are complex provided they appear in conjugate pairs. Lastly, we propose two setups to test our predictions,more » namely with strongly interacting excitons and photons in a semiconductor microcavity and in the non-hermitian tight-binding model.« less

  8. Energy band gaps in graphene nanoribbons with corners

    NASA Astrophysics Data System (ADS)

    Szczȩśniak, Dominik; Durajski, Artur P.; Khater, Antoine; Ghader, Doried

    2016-05-01

    In the present paper, we study the relation between the band gap size and the corner-corner length in representative chevron-shaped graphene nanoribbons (CGNRs) with 120° and 150° corner edges. The direct physical insight into the electronic properties of CGNRs is provided within the tight-binding model with phenomenological edge parameters, developed against recent first-principle results. We show that the analyzed CGNRs exhibit inverse relation between their band gaps and corner-corner lengths, and that they do not present a metal-insulator transition when the chemical edge modifications are introduced. Our results also suggest that the band gap width for the CGNRs is predominantly governed by the armchair edge effects, and is tunable through edge modifications with foreign atoms dressing.

  9. Photoelectron emission from LiF surfaces by ultrashort electromagnetic pulses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Acuna, M. A.; Gravielle, M. S.; Departamento de Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires

    2011-03-15

    Energy- and angle-resolved electron emission spectra produced by incidence of ultrashort electromagnetic pulses on a LiF(001) surface are studied by employing a distorted-wave method named the crystal surface-Volkov (CSV) approximation. The theory makes use of the Volkov phase to describe the action of the external electric field on the emitted electron, while the electron-surface interaction is represented within the tight-binding model. The CSV approach is applied to investigate the effects introduced by the crystal lattice when the electric field is oriented parallel to the surface plane. These effects are essentially governed by the vector potential of the external field, whilemore » the influence of the crystal orientation was found to be negligible.« less

  10. Perfect Spin Filter by Periodic Drive of a Ferromagnetic Quantum Barrier

    NASA Astrophysics Data System (ADS)

    Thuberg, Daniel; Muñoz, Enrique; Eggert, Sebastian; Reyes, Sebastián A.

    2017-12-01

    We consider the problem of particle tunneling through a periodically driven ferromagnetic quantum barrier connected to two leads. The barrier is modeled by an impurity site representing a ferromagnetic layer or a quantum dot in a tight-binding Hamiltonian with a local magnetic field and an ac-driven potential, which is solved using the Floquet formalism. The repulsive interactions in the quantum barrier are also taken into account. Our results show that the time-periodic potential causes sharp resonances of perfect transmission and reflection, which can be tuned by the frequency, the driving strength, and the magnetic field. We demonstrate that a device based on this configuration could act as a highly tunable spin valve for spintronic applications.

  11. Wavepacket dynamics in one-dimensional system with long-range correlated disorder

    NASA Astrophysics Data System (ADS)

    Yamada, Hiroaki S.

    2018-03-01

    We numerically investigate dynamical property in the one-dimensional tight-binding model with long-range correlated disorder having power spectrum 1 /fα (α: spectrum exponent) generated by Fourier filtering method. For relatively small α <αc (=2) time-dependence of mean square displacement (MSD) of the initially localized wavepacket shows ballistic spread and localizes as time elapses. It is shown that α-dependence of the dynamical localization length determined by the MSD exhibits a simple scaling law in the localization regime for the relatively weak disorder strength W. Furthermore, scaled MSD by the dynamical localization length almost obeys an universal function from the ballistic to the localization regime in the various combinations of the parameters α and W.

  12. Why are Buckyonions Round?

    NASA Technical Reports Server (NTRS)

    Bates, Kevin R.; Scuseria, Gustavo E.

    1998-01-01

    Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite. However. theoretical models or large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations or round buckyonions and theoretical predictions of faceted icosahedral fullerenes.

  13. Electron-ion coupling in semiconductors beyond Fermi's Golden Rule [On the electron-ion coupling in semiconductors beyond Fermi's Golden Rule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Medvedev, Nikita; Li, Zheng; Tkachenko, Victor

    2017-01-31

    In the present study, a theoretical study of electron-phonon (electron-ion) coupling rates in semiconductors driven out of equilibrium is performed. Transient change of optical coefficients reflects the band gap shrinkage in covalently bonded materials, and thus, the heating of atomic lattice. Utilizing this dependence, we test various models of electron-ion coupling. The simulation technique is based on tight-binding molecular dynamics. Our simulations with the dedicated hybrid approach (XTANT) indicate that the widely used Fermi's golden rule can break down describing material excitation on femtosecond time scales. In contrast, dynamical coupling proposed in this work yields a reasonably good agreement ofmore » simulation results with available experimental data.« less

  14. Carbon dioxide is tightly bound in the [Co(Pyridine)(CO2)]- anionic complex

    NASA Astrophysics Data System (ADS)

    Graham, Jacob D.; Buytendyk, Allyson M.; Zhang, Xinxing; Kim, Seong K.; Bowen, Kit H.

    2015-11-01

    The [Co(Pyridine)(CO2)]- anionic complex was studied through the combination of photoelectron spectroscopy and density functional theory calculations. This complex was envisioned as a primitive model system for studying CO2 binding to negatively charged sites in metal organic frameworks. The vertical detachment energy (VDE) measured via the photoelectron spectrum is 2.7 eV. Our calculations imply a structure for [Co(Pyridine)(CO2)]- in which a central cobalt atom is bound to pyridine and CO2 moieties on either sides. This structure was validated by acceptable agreement between the calculated and measured VDE values. Based on our calculations, we found CO2 to be bound within the anionic complex by 1.4 eV.

  15. Carbon dioxide is tightly bound in the [Co(Pyridine)(CO2)](-) anionic complex.

    PubMed

    Graham, Jacob D; Buytendyk, Allyson M; Zhang, Xinxing; Kim, Seong K; Bowen, Kit H

    2015-11-14

    The [Co(Pyridine)(CO2)](-) anionic complex was studied through the combination of photoelectron spectroscopy and density functional theory calculations. This complex was envisioned as a primitive model system for studying CO2 binding to negatively charged sites in metal organic frameworks. The vertical detachment energy (VDE) measured via the photoelectron spectrum is 2.7 eV. Our calculations imply a structure for [Co(Pyridine)(CO2)](-) in which a central cobalt atom is bound to pyridine and CO2 moieties on either sides. This structure was validated by acceptable agreement between the calculated and measured VDE values. Based on our calculations, we found CO2 to be bound within the anionic complex by 1.4 eV.

  16. Energy transfer between two vacuum-gapped metal plates: Coulomb fluctuations and electron tunneling

    NASA Astrophysics Data System (ADS)

    Zhang, Zu-Quan; Lü, Jing-Tao; Wang, Jian-Sheng

    2018-05-01

    Recent experimental measurements for near-field radiative heat transfer between two bodies have been able to approach the gap distance within 2 nm , where the contributions of Coulomb fluctuation and electron tunneling are comparable. Using the nonequilibrium Green's function method in the G0W0 approximation, based on a tight-binding model, we obtain for the energy current a Caroli formula from the Meir-Wingreen formula in the local equilibrium approximation. Also, the Caroli formula is consistent with the evanescent part of the heat transfer from the theory of fluctuational electrodynamics. We go beyond the local equilibrium approximation to study the energy transfer in the crossover region from electron tunneling to Coulomb fluctuation based on a numerical calculation.

  17. Effects of edge magnetism on the Kohn anomalies of zigzag graphene nanoribbons.

    PubMed

    Culchac, F J; Capaz, Rodrigo B

    2016-02-12

    The effects of edge magnetism on the Kohn anomaly (KA) of the G-band phonons of zigzag graphene nanoribbons (ZGNRs) are studied using a combination of the tight-binding and mean-field Hubbard models. We show that the opening of an energy gap, induced by magnetic ordering, significantly changes the KA effects, particularly for narrow ribbons in which the gap is larger than the phonon energy. Therefore, the G-band phonon frequency and lifetime are altered for a magnetically-ordered edge state with respect to an unpolarized edge state. The effects of temperature, ZGNR width, doping and transverse electric fields are systematically investigated. We propose using this effect to probe the magnetic order of edge states in graphene nanoribbons using Raman spectroscopy.

  18. Angle and frequency dependence of self-energy from spin fluctuation mediated d-wave pairing for high temperature superconductors.

    PubMed

    Hong, Seung Hwan; Choi, Han-Yong

    2013-09-11

    We investigated the characteristics of spin fluctuation mediated superconductivity employing the Eliashberg formalism. The effective interaction between electrons was modeled in terms of the spin susceptibility measured by inelastic neutron scattering experiments on single crystal La(2-x)Sr(x)CuO4 superconductors. The diagonal self-energy and off-diagonal self-energy were calculated by solving the coupled Eliashberg equation self-consistently for the chosen spin susceptibility and tight-binding dispersion of electrons. The full momentum and frequency dependence of the self-energy is presented for optimally doped, overdoped, and underdoped LSCO cuprates in a superconductive state. These results may be compared with the experimentally deduced self-energy from ARPES experiments.

  19. Surface alloy engineering in 2D trigonal lattice: giant Rashba spin splitting and two large topological gaps

    NASA Astrophysics Data System (ADS)

    Liu, Zhao; Jin, Yingdi; Yang, Yuchen; Wang, Z. F.; Yang, Jinlong

    2018-02-01

    We demonstrate that sp 2 based trigonal lattice can exhibit giant Rashba splitting and two large topological gaps simultaneously. First, an effective tight binding model is developed to describe the Rashba spin-orbit coupling (SOC) on a real surface and give a topological phase diagram based on two independent SOC parameters. Second, based on density functional theory calculations, it is proposed that Au/Si(111)-\\sqrt{3}× \\sqrt{3} surface with 1/3 monolayer Bi coverage is a good material candidate to realize both giant Rashba splitting and two large topological gaps. These results would inspire great research interests for searching two-dimensional topological insulator and manipulating Rashba spin splitting through surface alloy engineering.

  20. Molecular modeling studies of HIV-1 reverse transcriptase nonnucleoside inhibitors: total energy of complexation as a predictor of drug placement and activity.

    PubMed Central

    Kroeger Smith, M. B.; Rouzer, C. A.; Taneyhill, L. A.; Smith, N. A.; Hughes, S. H.; Boyer, P. L.; Janssen, P. A.; Moereels, H.; Koymans, L.; Arnold, E.

    1995-01-01

    Computer modeling studies have been carried out on three nonnucleoside inhibitors complexed with human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT), using crystal coordinate data from a subset of the protein surrounding the binding pocket region. Results from the minimizations of solvated complexes of 2-cyclopropyl-4-methyl-5,11-dihydro-5H-dipyrido[3,2-b :2',3'-e][1,4] diazepin-6-one (nevirapine), alpha-anilino-2, 6-dibromophenylacetamide (alpha-APA), and 8-chloro-tetrahydro-imidazo(4,5,1-jk)(1,4)-benzodiazepin-2(1H)-thi one (TIBO) show that all three inhibitors maintain a very similar conformational shape, roughly overlay each other in the binding pocket, and appear to function as pi-electron donors to aromatic side-chain residues surrounding the pocket. However, side-chain residues adapt to each bound inhibitor in a highly specific manner, closing down around the surface of the drug to make tight van der Waals contacts. Consequently, the results from the calculated minimizations reveal that only when the inhibitors are modeled in a site constructed from coordinate data obtained from their particular RT complex can the calculated binding energies be relied upon to predict the correct orientation of the drug in the pocket. In the correct site, these binding energies correlate with EC50 values determined for all three inhibitors in our laboratory. Analysis of the components of the binding energy reveals that, for all three inhibitors, solvation of the drug is endothermic, but solvation of the protein is exothermic, and the sum favors complex formation. In general, the protein is energetically more stable and the drug less stable in their complexes as compared to the reactant conformations. For all three inhibitors, interaction with the protein in the complex is highly favorable. Interactions of the inhibitors with individual residues correlate with crystallographic and site-specific mutational data. pi-Stacking interactions are important in binding and correlate with drug HOMO RHF/6-31G* energies. Modeling results are discussed with respect to the mechanism of complex formation and the design of nonnucleoside inhibitors that will be more effective against mutants of HIV-1 RT that are resistant to the currently available drugs. PMID:8535257

  1. RAI14 (retinoic acid induced protein 14) is an F-actin regulator

    PubMed Central

    Qian, Xiaojing; Mruk, Dolores D.; Cheng, Yan-ho; Cheng, C. Yan

    2013-01-01

    RAI14 (retinoic acid induced protein 14) is an actin-binding protein first identified in the liver. In the testis, RAI14 is expressed by both Sertoli and germ cells in the seminiferous epithelium. Besides binding to actin in the testis, RAI14 is also a binding protein for palladin, an actin cross-linking and bundling protein. A recent report has shown that RAI14 displays stage-specific and spatiotemporal expression at the ES [ectoplasmic specialization, a testis-specific filamentous (F)-actin-rich adherens junction] in the seminiferous epithelium of adult rat testes during the epithelial cycle of spermatogenesis, illustrating its likely involvement in F-actin organization at the ES. Functional studies in which RAI14 was knocked down by RNAi in Sertoli cells in vitro and also in testicular cells in vivo have illustrated its role in conferring the integrity of actin filament bundles at the ES, perturbing the Sertoli cell tight junction (TJ)-pemeability barrier function in vitro, and also spermatid polarity and adhesion in vivo, thereby regulating spermatid transport at spermiation. Herein, we critically evaluate these earlier findings and also provide a likely hypothetic model based on the functional role of RAI14 at the ES, and how RAI14 is working with palladin and other actin regulatory proteins in the testis to regulate the transport of (1) spermatids and (2) preleptotene spermatocytes across the seminiferous epithelium and the blood-testis barrier (BTB), respectively, during spermatogenesis. This model should serve as a framework upon which functional experiments can be designed to better understand the biology of RAI14 and other actin-binding and regulatory proteins in the testis. PMID:23885305

  2. Conformational dynamics and ligand binding in the multi-domain protein PDC109.

    PubMed

    Kim, Hyun Jin; Choi, Moo Young; Kim, Hyung J; Llinás, Miguel

    2010-02-18

    PDC109 is a modular multi-domain protein with two fibronectin type II (Fn2) repeats joined by a linker. It plays a major role in bull sperm binding to the oviductal epithelium through its interactions with phosphorylcholines (PhCs), a head group of sperm cell membrane lipids. The crystal structure of the PDC109-PhC complex shows that each PhC binds to the corresponding Fn2 domain, while the two domains are on the same face of the protein. Long timescale explicit solvent molecular dynamics (MD) simulations of PDC109, in the presence and absence of PhC, suggest that PhC binding strongly correlates with the relative orientation of choline-phospholipid binding sites of the two Fn2 domains; unless the two domains tightly bind PhCs, they tend to change their relative orientation by deforming the flexible linker. The effective PDC109-PhC association constant of 28 M(-1), estimated from their potential of mean force is consistent with the experimental result. Principal component analysis of the long timescale MD simulations was compared to the significantly less expensive normal mode analysis of minimized structures. The comparison indicates that difference between relative domain motions of PDC109 with bound and unbound PhC is captured by the first principal component in the principal component analysis as well as the three lowest normal modes in the normal mode analysis. The present study illustrates the use of detailed MD simulations to clarify the energetics of specific ligand-domain interactions revealed by a static crystallographic model, as well as their influence on relative domain motions in a multi-domain protein.

  3. Host range and cell cycle activation properties of polyomavirus large T-antigen mutants defective in pRB binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Freund, R.; Bauer, P.H.; Benjamin, T.L.

    1994-11-01

    The authors have examined the growth properties of polyomavirus large T-antigen mutants that ar unable to bind pRB, the product of the retinoblastoma tumor suppressor gene. These mutants grow poorly on primary mouse cells yet grow well on NIH 3T3 and other established mouse cell lines. Preinfection of primary baby mouse kidney (BMK) epithelial cells with wild-type simian virus 40 renders these cells permissive to growth of pRB-binding polyomavirus mutants. Conversely, NIH 3T3 cells transfected by and expressing wild-type human pRB become nonpermissive. Primary fibroblasts for mouse embryos that carry a homozygous knockout of the RB gene are permissive, whilemore » those from normal littermates are nonpermissive. The host range of polyomavirus pRB-binding mutants is thus determined by expression or lack of expression of functional pRB by the host. These results demonstrate the importance of pRB binding by large T antigen for productive viral infection in primary cells. Failure of pRB-binding mutants to grow well in BMK cells correlates with their failure to induce progression from G{sub 0} or G{sub 1} through the S phase of the cell cycle. Time course studies show delayed synthesis and lower levels of accumulation of large T antigen, viral DNA, and VP1 in mutant compared with wild-type virus-infected BMK cells. These results support a model in which productive infection by polyomavirus in normal mouse cells is tightly coupled to the induction and progression of the cell cycle. 48 refs., 6 figs., 5 tabs.« less

  4. Environment sensitive fluorescent analogue of biologically active oxazoles differentially recognizes human serum albumin and bovine serum albumin: Photophysical and molecular modeling studies

    NASA Astrophysics Data System (ADS)

    Maiti, Jyotirmay; Biswas, Suman; Chaudhuri, Ankur; Chakraborty, Sandipan; Chakraborty, Sibani; Das, Ranjan

    2017-03-01

    An environment sensitive fluorophore, 4-(5-(4-(dimethylamino)phenyl)oxazol-2-yl)benzoic acid (DMOBA), that closely mimics biologically active 2,5-disubstituited oxazoles has been designed to probe two homologous serum proteins, human serum albumin (HSA) and bovine serum albumin (BSA) by means of photophysical and molecular modeling studies. This fluorescent analogue exhibits solvent polarity sensitive fluorescence due to an intramolecular charge transfer in the excited state. In comparison to water, the steady state emission spectra of DMOBA in BSA is characterized by a greater blue shift ( 10 nm) and smaller Stokes' shift ( 5980 cm- 1) in BSA than HSA (Stokes'shift 6600 cm- 1), indicating less polar and more hydrophobic environment of the dye in the former than the latter. The dye-protein binding interactions are remarkably stronger for BSA than HSA which is evident from higher value of the association constant for the DMOBA-BSA complex (Ka 5.2 × 106 M- 1) than the DMOBA-HSA complex (Ka 1.0 × 106 M- 1). Fӧrster resonance energy transfer studies revealed remarkably less efficient energy transfer (8%) between the donor tryptophans in BSA and the acceptor DMOBA dye than that (30%) between the single tryptophan moiety in HSA and the dye, which is consistent with a much larger distance between the donor (tryptophan)-acceptor (dye) pair in BSA (34.5 Å) than HSA (25.4 Å). Site specific competitive binding assays have confirmed on the location of the dye in Sudlow's site II of BSA and in Sudlow's site I of HSA, respectively. Molecular modeling studies have shown that the fluorescent analogue is tightly packed in the binding site of BSA due to strong steric complementarity, where, binding of DMOBA to BSA is primarily dictated by the van der Waals and hydrogen bonding interactions. In contrast, in HSA the steric complementarity is less significant and binding is primarily guided by polar interactions and van der Waals interactions appear to be less significant in the formation of the HSA-DMOBA complex. Electrostatic interactions contribute significantly in the binding of DMOBA to HSA (- 2.09 kcal/mol) compared to BSA (- 0.47 kcal/mol). Electrostatic surface potential calculation reveals that the DMOBA binding site within HSA is highly charged compared to BSA.

  5. The yeast transcription elongation factor Spt4/5 is a sequence‐specific RNA binding protein

    PubMed Central

    Blythe, Amanda J.; Yazar‐Klosinski, Berra; Webster, Michael W.; Chen, Eefei; Vandevenne, Marylène; Bendak, Katerina; Mackay, Joel P.; Hartzog, Grant A.

    2016-01-01

    Abstract The heterodimeric transcription elongation factor Spt4/Spt5 (Spt4/5) tightly associates with RNAPII to regulate both transcriptional elongation and co‐transcriptional pre‐mRNA processing; however, the mechanisms by which Spt4/5 acts are poorly understood. Recent studies of the human and Drosophila Spt4/5 complexes indicate that they can bind nucleic acids in vitro. We demonstrate here that yeast Spt4/5 can bind in a sequence‐specific manner to single stranded RNA containing AAN repeats. Furthermore, we show that the major protein determinants for RNA‐binding are Spt4 together with the NGN domain of Spt5 and that the KOW domains are not required for RNA recognition. These findings attribute a new function to a domain of Spt4/5 that associates directly with RNAPII, making significant steps towards elucidating the mechanism behind transcriptional control by Spt4/5. PMID:27376968

  6. Structural analysis of a class III preQ1 riboswitch reveals an aptamer distant from a ribosome-binding site regulated by fast dynamics

    PubMed Central

    Liberman, Joseph A.; Suddala, Krishna C.; Aytenfisu, Asaminew; Chan, Dalen; Belashov, Ivan A.; Salim, Mohammad; Mathews, David H.; Spitale, Robert C.; Walter, Nils G.; Wedekind, Joseph E.

    2015-01-01

    PreQ1-III riboswitches are newly identified RNA elements that control bacterial genes in response to preQ1 (7-aminomethyl-7-deazaguanine), a precursor to the essential hypermodified tRNA base queuosine. Although numerous riboswitches fold as H-type or HLout-type pseudoknots that integrate ligand-binding and regulatory sequences within a single folded domain, the preQ1-III riboswitch aptamer forms a HLout-type pseudoknot that does not appear to incorporate its ribosome-binding site (RBS). To understand how this unusual organization confers function, we determined the crystal structure of the class III preQ1 riboswitch from Faecalibacterium prausnitzii at 2.75 Å resolution. PreQ1 binds tightly (KD,app 6.5 ± 0.5 nM) between helices P1 and P2 of a three-way helical junction wherein the third helix, P4, projects orthogonally from the ligand-binding pocket, exposing its stem-loop to base pair with the 3′ RBS. Biochemical analysis, computational modeling, and single-molecule FRET imaging demonstrated that preQ1 enhances P4 reorientation toward P1–P2, promoting a partially nested, H-type pseudoknot in which the RBS undergoes rapid docking (kdock ∼0.6 s−1) and undocking (kundock ∼1.1 s−1). Discovery of such dynamic conformational switching provides insight into how a riboswitch with bipartite architecture uses dynamics to modulate expression platform accessibility, thus expanding the known repertoire of gene control strategies used by regulatory RNAs. PMID:26106162

  7. Performance Improvement of Receivers Based on Ultra-Tight Integration in GNSS-Challenged Environments

    PubMed Central

    Qin, Feng; Zhan, Xingqun; Du, Gang

    2013-01-01

    Ultra-tight integration was first proposed by Abbott in 2003 with the purpose of integrating a global navigation satellite system (GNSS) and an inertial navigation system (INS). This technology can improve the tracking performances of a receiver by reconfiguring the tracking loops in GNSS-challenged environments. In this paper, the models of all error sources known to date in the phase lock loops (PLLs) of a standard receiver and an ultra-tightly integrated GNSS/INS receiver are built, respectively. Based on these models, the tracking performances of the two receivers are compared to verify the improvement due to the ultra-tight integration. Meanwhile, the PLL error distributions of the two receivers are also depicted to analyze the error changes of the tracking loops. These results show that the tracking error is significantly reduced in the ultra-tightly integrated GNSS/INS receiver since the receiver's dynamics are estimated and compensated by an INS. Moreover, the mathematical relationship between the tracking performances of the ultra-tightly integrated GNSS/INS receiver and the quality of the selected inertial measurement unit (IMU) is derived from the error models and proved by the error comparisons of four ultra-tightly integrated GNSS/INS receivers aided by different grade IMUs.

  8. Binding of trivalent chromium to serum transferrin is sufficiently rapid to be physiologically relevant.

    PubMed

    Deng, Ge; Wu, Kristi; Cruce, Alex A; Bowman, Michael K; Vincent, John B

    2015-02-01

    Transferrin, the major iron transport protein in the blood, also transports trivalent chromium in vivo. Recent in vitro studies have, however, suggested that the binding of chromic ions to apotransferrin is too slow to be biologically relevant. Nevertheless, the in vitro studies have generally failed to adequately take physiological bicarbonate concentrations into account. In aqueous buffer (with ambient (bi)carbonate concentrations), the binding of chromium to transferrin is too slow to be physiologically relevant, taking days to reach equilibrium with the protein's associated conformational changes. However, in the presence of 25mM (bi)carbonate, the concentration in human blood, chromic ions bind rapidly and tightly to transferrin. Details of the kinetics of chromium binding to human serum transferrin and conalbumin (egg white transferrin) in the presence of bicarbonate and other major potential chromium ligands are described and are consistent with transferrin being the major chromic ion transporter from the blood to tissues. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

    PubMed Central

    Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

    2003-01-01

    Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

  10. The Possible Mechanism of Idiosyncratic Lapatinib-Induced Liver Injury in Patients Carrying Human Leukocyte Antigen-DRB1*07:01

    PubMed Central

    Hirasawa, Makoto; Hagihara, Katsunobu; Okudaira, Noriko; Izumi, Takashi

    2015-01-01

    Idiosyncratic lapatinib-induced liver injury has been reported to be associated with human leukocyte antigen (HLA)-DRB1*07:01. In order to investigate its mechanism, interaction of lapatinib with HLA-DRB1*07:01 and its ligand peptide derived from tetanus toxoid, has been evaluated in vitro. Here we show that lapatinib enhances binding of the ligand peptide to HLA-DRB1*07:01. Furthermore in silico molecular dynamics analysis revealed that lapatinib could change the β chain helix in the HLA-DRB1*07:01 specifically to form a tightly closed binding groove structure and modify a large part of the binding groove. These results indicate that lapatinib affects the ligand binding to HLA-DRB1*07:01 and idiosyncratic lapatinib-induced liver injury might be triggered by this mechanism. This is the first report showing that the clinically available drug can enhance the binding of ligand peptide to HLA class II molecules in vitro and in silico. PMID:26098642

  11. Crystal structure of the Escherichia coli regulator of sigma70, Rsd, in complex with sigma70 domain 4.

    PubMed

    Patikoglou, Georgia A; Westblade, Lars F; Campbell, Elizabeth A; Lamour, Valérie; Lane, William J; Darst, Seth A

    2007-09-21

    The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) sigma(70) factor. Rsd plays a role in alternative sigma factor-dependent transcription by biasing the competition between sigma(70) and alternative sigma factors for the available core RNAP. Here, we determined the 2.6 A-resolution X-ray crystal structure of Rsd bound to sigma(70) domain 4 (sigma(70)(4)), the primary determinant for Rsd binding within sigma(70). The structure reveals that Rsd binding interferes with the two primary functions of sigma(70)(4), core RNAP binding and promoter -35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the sigma(70)(4)-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between sigma(70)(4) binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.

  12. Crystal structure of the Escherichia coli regulator of σ70, Rsd, in complex with σ70 domain 4

    PubMed Central

    Patikoglou, Georgia A.; Westblade, Lars F.; Campbell, Elizabeth A.; Lamour, Valérie; Lane, William J.; Darst, Seth A.

    2007-01-01

    Summary The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) σ70 factor. Rsd plays a role in alternative σ factor-dependent transcription by biasing the competition between σ70 and alternative σ factors for the available core RNAP. Here, we determined the 2.6 Å-resolution X-ray crystal structure of Rsd bound to σ70 domain 4 (σ704), the primary determinant for Rsd binding within σ70. The structure reveals that Rsd binding interferes with the two primary functions of σ704, core RNAP binding and promoter –35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the σ704-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between σ704 binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation. PMID:17681541

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patikoglou,G.; Westblade, L.; Campbell, E.

    The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) {sigma}{sup 70} factor. Rsd plays a role in alternative {sigma} factor-dependent transcription by biasing the competition between {sigma}{sup 70} and alternative {sigma} factors for the available core RNAP. Here, we determined the 2.6 {angstrom}-resolution X-ray crystal structure of Rsd bound to {sigma}{sup 70} domain 4 ({sigma}{sup 70}{sub 4}), the primary determinant for Rsd binding within {sigma}{sup 70}. The structure reveals that Rsd binding interferes with the two primary functions of {sigma}{sup 70}{sub 4}, core RNAP binding and promoter -35 element binding. Interestingly, the most highly conservedmore » Rsd residues form a network of interactions through the middle of the Rsd structure that connect the {sigma}{sup 70}{sub 4}-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between {sigma}{sup 70}{sub 4} binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.« less

  14. Problems in hard and soft matter: From brain folds and Levy localization to active elasticity

    NASA Astrophysics Data System (ADS)

    Mayett, David

    This thesis presents a study of condensed matter systems at different length scales. The first part presents a study of elastic instabilities in biological systems ranging from the cerebral cortex in the brain to the lining of the intestines. Such instabilities lead to a zoo of morphologies ranging from primary folds to villi and crypts to secondary folds and are brought about by growth, mechanical stresses, or a combination of the two. We propose a novel model for the description of primary folds in the cerebral cortex. Motivated by the spatial structure of the cortex, we model its elasticity as a smectic liquid crystal. With this novel description we show that vertical pulling forces via axonal tension from the brain underlying white matter can lead to buckling, which initiates the primary folds. Moreover, we are able to obtain a reasonable estimate of the critical wavelength and strain for buckling. We also model the formation of secondary folds in the cortex to obtain a more comprehensive theory. We continue this study of elastic instabilities due to growth by studying a more general system comprised of two coupled elastic membranes, one of which undergoes growth and one that does not. We employ an active formulation of growth and compare it to the one due to Rodriguez (Rodriguez). We show that different morphologies corresponding to different systems, such as the cerebral cortex and the lining of the intestines, can be obtained from our model by choosing different active stress functional forms to begin to classify the zoo of morphologies observed in seemingly different biological systems. In the second part of this thesis, to work towards a more microscopic view of biological tissues such as the brain tissue, which is composed of neurons, glial cells, and progenitor cells, we model an experiment (Theveneau) studying the dynamic interaction between neural crest cells and placodal cells in which the placodal cells run away from the neural crest cells following contact between the two. Our modeling contributes towards generalizing the rules governing the interplay between different cell types, particularly during collective cell migration. In the final part of this thesis, we move to an even smaller length scale. Our main motivations come from a series of experiments on the localization of light and the application of tight-binding models to the electronic transport properties of DNA sequences. To this end, we study the statistical properties of the conductance distribution and Lyapunov exponents in the Anderson tight-binding model with Levy-type disorder.

  15. Edge states in gated bilayer-monolayer graphene ribbons and bilayer domain walls

    NASA Astrophysics Data System (ADS)

    Mirzakhani, M.; Zarenia, M.; Peeters, F. M.

    2018-05-01

    Using the effective continuum model, the electron energy spectrum of gated bilayer graphene with a step-like region of decoupled graphene layers at the edge of the sample is studied. Different types of coupled-decoupled interfaces are considered, i.e., zigzag (ZZ) and armchair junctions, which result in significant different propagating states. Two non-valley-polarized conducting edge states are observed for ZZ type, which are mainly located around the ZZ-ended graphene layers. Additionally, we investigated both BA-BA and BA-AB domain walls in the gated bilayer graphene within the continuum approximation. Unlike the BA-BA domain wall, which exhibits gapped insulating behaviour, the domain walls surrounded by different stackings of bilayer regions feature valley-polarized edge states. Our findings are consistent with other theoretical calculations, such as from the tight-binding model and first-principles calculations, and agree with experimental observations.

  16. Electrical control of spin dynamics in finite one-dimensional systems

    NASA Astrophysics Data System (ADS)

    Pertsova, A.; Stamenova, M.; Sanvito, S.

    2011-10-01

    We investigate the possibility of the electrical control of spin transfer in monoatomic chains incorporating spin impurities. Our theoretical framework is the mixed quantum-classical (Ehrenfest) description of the spin dynamics, in the spirit of the s-d model, where the itinerant electrons are described by a tight-binding model while localized spins are treated classically. Our main focus is on the dynamical exchange interaction between two well-separated spins. This can be quantified by the transfer of excitations in the form of transverse spin oscillations. We systematically study the effect of an electrostatic gate bias Vg on the interconnecting channel and we map out the long-range dynamical spin transfer as a function of Vg. We identify regions of Vg giving rise to significant amplification of the spin transmission at low frequencies and relate this to the electronic structure of the channel.

  17. Realization of a mixed-symmetry superconducting gap in correlated organic metals

    NASA Astrophysics Data System (ADS)

    Altmeyer, Michaela; Guterding, Daniel; Jeschke, Harald O.; Diehl, Sandra; Methfessel, Torsten; Tutsch, Ulrich; Schubert, Harald; Lang, Michael; Müller, Jens; Huth, Michael; Jourdan, Martin; Elmers, Hans-Joachim; Valenti, Roser

    Recent scanning tunneling spectroscopy measurements on the organic charge tranfer salt κ-(BEDT-TTF)2Cu[N(CN)2]Br show clear evidence of a highly anisotropic gap structure. Based on an ab initio derived model Hamiltonian we employ random phase approximation spin fluctuation theory yielding a composite order parameter of (extended) s+dx2-y2 symmetry. Taking explicitly also the shape of the Fermi surface into account we calculate STS spectra that are in excellent agreement to the experimental observations [1]. Moreover we determine the minimal tight binding model to describe the general lattice structure of these compounds accurately and generate a phase diagram for the gap symmetry by varying the hopping parameters. Based on ab initio derived parameter sets we predict the gap symmetry of other superconducting κ charge transfer salts. This work was supported by Deutsche Forschungsgemeinschaft under Grant No. SFB/TR 49.

  18. Excitonic structure of the optical conductivity in MoS2 monolayers

    NASA Astrophysics Data System (ADS)

    Ridolfi, Emilia; Lewenkopf, Caio H.; Pereira, Vitor M.

    2018-05-01

    We investigate the excitonic spectrum of MoS2 monolayers and calculate its optical absorption properties over a wide range of energies. Our approach takes into account the anomalous screening in two dimensions and the presence of a substrate, both cast by a suitable effective Keldysh potential. We solve the Bethe-Salpeter equation using as a basis a Slater-Koster tight-binding model parameterized to fit the ab initio MoS2 band structure calculations. The resulting optical conductivity is in good quantitative agreement with existing measurements up to ultraviolet energies. We establish that the electronic contributions to the C excitons arise not from states at the Γ point, but from a set of k points over extended portions of the Brillouin zone. Our results reinforce the advantages of approaches based on effective models to expeditiously explore the properties and tunability of excitons in TMD systems.

  19. Magnetic-flux-driven topological quantum phase transition and manipulation of perfect edge states in graphene tube.

    PubMed

    Lin, S; Zhang, G; Li, C; Song, Z

    2016-08-24

    We study the tight-binding model for a graphene tube with perimeter N threaded by a magnetic field. We show exactly that this model has different nontrivial topological phases as the flux changes. The winding number, as an indicator of topological quantum phase transition (QPT) fixes at N/3 if N/3 equals to its integer part [N/3], otherwise it jumps between [N/3] and [N/3] + 1 periodically as the flux varies a flux quantum. For an open tube with zigzag boundary condition, exact edge states are obtained. There exist two perfect midgap edge states, in which the particle is completely located at the boundary, even for a tube with finite length. The threading flux can be employed to control the quantum states: transferring the perfect edge state from one end to the other, or generating maximal entanglement between them.

  20. Origami rules for the construction of localized eigenstates of the Hubbard model in decorated lattices

    NASA Astrophysics Data System (ADS)

    Dias, R. G.; Gouveia, J. D.

    2015-11-01

    We present a method of construction of exact localized many-body eigenstates of the Hubbard model in decorated lattices, both for U = 0 and U → ∞. These states are localized in what concerns both hole and particle movement. The starting point of the method is the construction of a plaquette or a set of plaquettes with a higher symmetry than that of the whole lattice. Using a simple set of rules, the tight-binding localized state in such a plaquette can be divided, folded and unfolded to new plaquette geometries. This set of rules is also valid for the construction of a localized state for one hole in the U → ∞ limit of the same plaquette, assuming a spin configuration which is a uniform linear combination of all possible permutations of the set of spins in the plaquette.

  1. Quantum spin Hall phase in 2D trigonal lattice

    PubMed Central

    Wang, Z. F.; Jin, Kyung-Hwan; Liu, Feng

    2016-01-01

    The quantum spin Hall (QSH) phase is an exotic phenomena in condensed-matter physics. Here we show that a minimal basis of three orbitals (s, px, py) is required to produce a QSH phase via nearest-neighbour hopping in a two-dimensional trigonal lattice. Tight-binding model analyses and calculations show that the QSH phase arises from a spin–orbit coupling (SOC)-induced s–p band inversion or p–p bandgap opening at Brillouin zone centre (Γ point), whose topological phase diagram is mapped out in the parameter space of orbital energy and SOC. Remarkably, based on first-principles calculations, this exact model of QSH phase is shown to be realizable in an experimental system of Au/GaAs(111) surface with an SOC gap of ∼73 meV, facilitating the possible room-temperature measurement. Our results will extend the search for substrate supported QSH materials to new lattice and orbital types. PMID:27599580

  2. Electric field control of spin transfer torque in multiferroic tunnel junctions

    NASA Astrophysics Data System (ADS)

    Useinov, Artur; Kalitsov, Alan; Velev, Julian; Kioussis, Nicholas

    2014-03-01

    Based on model calculations we predict that the spin transfer torque (STT) in magnetic tunnel junctions with ferroelectric barriers can be strongly influenced by the saturated polarization of the barrier. The STT in such multiferroic tunnel junctions is calculated within the non-equilibrium Keldysh formalism generalized for non-collinear transport and implemented in the framework of a single-band tight-binding (TB) model. We calculate the bias dependence of both the in-plane (T∥) and out-of-plane (T⊥) components of STT as a function of the ferroelectric polarization (P) in the barrier. We find that the components of STT strongly depend on both the magnitude and the direction of the polarization. In particular switching of the polarization direction can dramatically alter the value of the STT and can even lead to a change of sign of T∥ and the voltage-induced part of T⊥. The effect is proportional to the magnitude of the polarization.

  3. Scattering of an electronic wave packet by a one-dimensional electron-phonon-coupled structure

    NASA Astrophysics Data System (ADS)

    Brockt, C.; Jeckelmann, E.

    2017-02-01

    We investigate the scattering of an electron by phonons in a small structure between two one-dimensional tight-binding leads. This model mimics the quantum electron transport through atomic wires or molecular junctions coupled to metallic leads. The electron-phonon-coupled structure is represented by the Holstein model. We observe permanent energy transfer from the electron to the phonon system (dissipation), transient self-trapping of the electron in the electron-phonon-coupled structure (due to polaron formation and multiple reflections at the structure edges), and transmission resonances that depend strongly on the strength of the electron-phonon coupling and the adiabaticity ratio. A recently developed TEBD algorithm, optimized for bosonic degrees of freedom, is used to simulate the quantum dynamics of a wave packet launched against the electron-phonon-coupled structure. Exact results are calculated for a single electron-phonon site using scattering theory and analytical approximations are obtained for limiting cases.

  4. Effective lattice Hamiltonian for monolayer tin disulfide: Tailoring electronic structure with electric and magnetic fields

    NASA Astrophysics Data System (ADS)

    Yu, Jin; van Veen, Edo; Katsnelson, Mikhail I.; Yuan, Shengjun

    2018-06-01

    The electronic properties of monolayer tin dilsulfide (ML -Sn S2 ), a recently synthesized metal dichalcogenide, are studied by a combination of first-principles calculations and tight-binding (TB) approximation. An effective lattice Hamiltonian based on six hybrid s p -like orbitals with trigonal rotation symmetry are proposed to calculate the band structure and density of states for ML -Sn S2 , which demonstrates good quantitative agreement with relativistic density-functional-theory calculations in a wide energy range. We show that the proposed TB model can be easily applied to the case of an external electric field, yielding results consistent with those obtained from full Hamiltonian results. In the presence of a perpendicular magnetic field, highly degenerate equidistant Landau levels are obtained, showing typical two-dimensional electron gas behavior. Thus, the proposed TB model provides a simple way in describing properties in ML -Sn S2 .

  5. Unified modelling of the thermoelectric properties in SrTiO3

    NASA Astrophysics Data System (ADS)

    Bouzerar, G.; Thébaud, S.; Adessi, Ch.; Debord, R.; Apreutesei, M.; Bachelet, R.; Pailhès, S.

    2017-06-01

    Thermoelectric materials are opening a promising pathway to address energy conversion issues governed by a competition between thermal and electronic transport. Improving the efficiency is a difficult task, a challenge that requires new strategies to unearth optimized compounds. We present a theory of thermoelectric transport in electron-doped SrTiO3, based on a realistic tight-binding model that includes relevant scattering processes. We compare our calculations against a wide panel of experimental data, both bulk and thin films. We find a qualitative and quantitative agreement over both a wide range of temperatures and carrier concentrations, from light to heavily doped. Moreover, the results appear insensitive to the nature of the dopant La, B, Gd and Nb. Thus, the quantitative success found in the case of SrTiO3, reveals an efficient procedure to explore new routes to improve the thermoelectric properties in oxides.

  6. General theoretical description of angle-resolved photoemission spectroscopy of van der Waals structures

    NASA Astrophysics Data System (ADS)

    Amorim, B.

    2018-04-01

    We develop a general theory to model the angle-resolved photoemission spectroscopy (ARPES) of commensurate and incommensurate van der Waals (vdW) structures, formed by lattice mismatched and/or misaligned stacked layers of two-dimensional materials. The present theory is based on a tight-binding description of the structure and the concept of generalized umklapp processes, going beyond previous descriptions of ARPES in incommensurate vdW structures, which are based on continuous, low-energy models, being limited to structures with small lattice mismatch/misalignment. As applications of the general formalism, we study the ARPES bands and constant energy maps for two structures: twisted bilayer graphene and twisted bilayer MoS2. The present theory should be useful in correctly interpreting experimental results of ARPES of vdW structures and other systems displaying competition between different periodicities, such as two-dimensional materials weakly coupled to a substrate and materials with density wave phases.

  7. Multiple period s-p hybridization in nano-strip embedded photonic crystal.

    PubMed

    Han, Seunghoon; Lee, Il-Min; Kim, Hwi; Lee, Byoungho

    2005-04-04

    We report and analyze hybridization of s-state and p-state modes in photonic crystal one-dimensional defect cavity array. When embedding a nano-strip into a dielectric rod photonic crystal, an effective cavity array is made, where each cavity possesses two cavity modes: s-state and p-state. The two modes are laterally even versus the nano-strip direction, and interact with each other, producing defect bands, of which the group velocity becomes zero within the first Brillouin zone. We could model and describe the phenomena by using the tight-binding method, well agreeing with the plane-wave expansion method analysis. We note that the reported s- and p-state mode interaction corresponds to the hybridization of atomic orbital in solid-state physics. The concept of multiple period s-p hybridization and the proposed model can be useful for analyzing and developing novel photonic crystal waveguides and devices.

  8. Specificity in Transition State Binding: The Pauling Model Revisited

    PubMed Central

    Amyes, Tina L.; Richard, John P.

    2013-01-01

    Linus Pauling proposed that the large rate accelerations for enzymes are due to the high specificity of the protein catalyst for binding the reaction transition state. The observation that stable analogs of the transition states for enzymatic reactions often act as tight-binding binding inhibitors provided early support for this simple and elegant proposal. We review experimental results which support the proposal that Pauling’s model provides a satisfactory explanation for the rate accelerations for many heterolytic enzymatic reactions through high energy reaction intermediates, such as proton transfer and decarboxylation. Specificity in transition state binding is obtained when the total intrinsic binding energy of the substrate is significantly larger than the binding energy observed at the Michaelis complex. The results of recent studies to characterize the specificity in binding of the enolate oxygen at the transition state for the 1,3-isomerization reaction catalyzed by ketosteroid isomerase are reviewed. Interactions between pig heart succinyl-CoA:3-oxoacid coenzyme A transferase (SCOT) and the nonreacting portions of CoA are responsible for a rate increase of 3 × 1012-fold, which is close to the estimated total 5 × 1013-fold enzymatic rate acceleration. Studies that partition the interactions between SCOT and CoA into their contributing parts are reviewed. Interactions of the protein with the substrate phosphodianion group provide a ca. 12 kcal/mol stabilization of the transition state for the reactions catalyzed by triosephosphate isomerase, orotidine 5′-monophosphate decarboxylase and α-glycerol phosphate dehydrogenase. The interactions of these enzymes with the substrate piece phosphite dianion provide a 6 – 8 kcal/mol stabilization of the transition state for reaction of the appropriate truncated substrate. Enzyme activation by phosphite dianion reflects the higher dianion affinity for binding to the enzyme-transition state complex compared with the free enzyme. Evidence is presented that supports a model in which the binding energy of the phosphite dianion piece, or the phosphodianion group of the whole substrate, is utilized to drive an enzyme conformational change from an inactive open form EO to an active closed form EC, by closure of a phosphodianion gripper loop. Members of the enolase and haloalkanoic acid dehalogenase superfamilies use variable capping domains to interact with nonreacting portions of the substrate and sequester the substrate from interaction with bulk solvent. Interactions of this capping domain with the phenyl group of mandelate have been shown to activate mandelate racemase for catalysis of deprotonation of α-carbonyl carbon. We propose that an important function of these capping domains is to utilize the binding interactions with nonreacting portions of the substrate to activate the enzyme for catalysis. PMID:23327224

  9. Quantitative relation between intermolecular and intramolecular binding of pro-rich peptides to SH3 domains.

    PubMed

    Zhou, Huan-Xiang

    2006-11-01

    Flexible linkers are often found to tether binding sequence motifs or connect protein domains. Here we analyze three usages of flexible linkers: 1), intramolecular binding of proline-rich peptides (PRPs) to SH3 domains for kinase regulation; 2), intramolecular binding of PRP for increasing the folding stability of SH3 domains; and 3), covalent linking of PRPs and other ligands for high-affinity bivalent binding. The basis of these analyses is a quantitative relation between intermolecular and intramolecular binding constants. This relation has the form K(i) = K(e0)p for intramolecular binding and K(e) = K(e01)K(e02)p for bivalent binding. The effective concentration p depends on the length of the linker and the distance between the linker attachment points in the bound state. Several applications illustrate the usefulness of the quantitative relation. These include intramolecular binding to the Itk SH3 domain by an internal PRP and to a circular permutant of the alpha-spectrin SH3 domain by a designed PRP, and bivalent binding to the two SH3 domains of Grb2 by two linked PRPs. These and other examples suggest that flexible linkers and sequence motifs tethered to them, like folded protein domains, are also subject to tight control during evolution.

  10. A positron emission tomography study of the serotonergic system in relation to anxiety in depression.

    PubMed

    Iscan, Zafer; Rakesh, Gopalkumar; Rossano, Samantha; Yang, Jie; Zhang, Mengru; Miller, Jeffrey; Sullivan, Gregory M; Sharma, Priya; McClure, Matthew; Oquendo, Maria A; Mann, J John; Parsey, Ramin V; DeLorenzo, Christine

    2017-10-01

    Symptoms of anxiety are highly comorbid with major depressive disorder (MDD) and are known to alter the course of the disease. To help elucidate the biological underpinnings of these prevalent disorders, we previously examined the relationship between components of anxiety (somatic, psychic and motoric) and serotonin 1A receptor (5-HT 1A ) binding in MDD and found that higher psychic and lower somatic anxiety was associated with greater 5-HT 1A binding. In this work, we sought to examine the correlation between these anxiety symptom dimensions and 5-HTT binding. Positron emission tomography with [ 11 C]-3-amino-4-(3-dimethylamino-methylphenylsulfanyl)-benzonitrile ([ 11 C]DASB) and a metabolite-corrected arterial input function were used to estimate regional 5-HTT binding in 55 subjects with MDD and anxiety symptoms. Somatic anxiety was negatively correlated with 5-HTT binding in the thalamus (β=-.33, p=.025), amygdala (β=-.31, p=.007) and midbrain (β=-.72, p<.001). Psychic anxiety was positively correlated with 5-HTT binding in midbrain only (β=.46, p=.0025). To relate to our previous study, correlation between 5-HT 1A and 5-HTT binding was examined, and none was found. We also examined how much of the variance in anxiety symptom dimensions could be explained by both 5-HTT and 5-HT 1A binding. The developed model was able to explain 68% (p<.001), 38% (p=.012) and 32% (p=.038) of the total variance in somatic, psychic, and motoric anxiety, respectively. Results indicate the tight coupling between the serotonergic system and anxiety components, which may be confounded when using aggregate anxiety measures. Uncovering serotonin's role in anxiety and depression in this way may give way to a new generation of therapeutics and treatment strategies. Copyright © 2017 Elsevier B.V. and ECNP. All rights reserved.

  11. Small Molecules Engage Hot Spots through Cooperative Binding To Inhibit a Tight Protein-Protein Interaction.

    PubMed

    Liu, Degang; Xu, David; Liu, Min; Knabe, William Eric; Yuan, Cai; Zhou, Donghui; Huang, Mingdong; Meroueh, Samy O

    2017-03-28

    Protein-protein interactions drive every aspect of cell signaling, yet only a few small-molecule inhibitors of these interactions exist. Despite our ability to identify critical residues known as hot spots, little is known about how to effectively engage them to disrupt protein-protein interactions. Here, we take advantage of the ease of preparation and stability of pyrrolinone 1, a small-molecule inhibitor of the tight interaction between the urokinase receptor (uPAR) and its binding partner, the urokinase-type plasminogen activator uPA, to synthesize more than 40 derivatives and explore their effect on the protein-protein interaction. We report the crystal structure of uPAR bound to previously discovered pyrazole 3 and to pyrrolinone 12. While both 3 and 12 bind to uPAR and compete with a fluorescently labeled peptide probe, only 12 and its derivatives inhibit the full uPAR·uPA interaction. Compounds 3 and 12 mimic and engage different hot-spot residues on uPA and uPAR, respectively. Interestingly, 12 is involved in a π-cation interaction with Arg-53, which is not considered a hot spot. Explicit-solvent molecular dynamics simulations reveal that 3 and 12 exhibit dramatically different correlations of motion with residues on uPAR. Free energy calculations for the wild-type and mutant uPAR bound to uPA or 12 show that Arg-53 interacts with uPA or with 12 in a highly cooperative manner, thereby altering the contributions of hot spots to uPAR binding. The direct engagement of peripheral residues not considered hot spots through π-cation or salt-bridge interactions could provide new opportunities for enhanced small-molecule engagement of hot spots to disrupt challenging protein-protein interactions.

  12. Triazolopyridinyl-acrylonitrile derivatives as antimicrotubule agents: Synthesis, in vitro and in silico characterization of antiproliferative activity, inhibition of tubulin polymerization and binding thermodynamics.

    PubMed

    Briguglio, Irene; Laurini, Erik; Pirisi, Maria Antonietta; Piras, Sandra; Corona, Paola; Fermeglia, Maurizio; Pricl, Sabrina; Carta, Antonio

    2017-12-01

    In this paper we report the synthesis, in vitro anticancer activity, and the experimental/computational characterization of mechanism of action of a new series of E isomers of triazolo[4,5-b/c]pyridin-acrylonitrile derivatives (6c-g, 7d-e, 8d-e, 9c-f, 10d-e, 11d-e). All new compounds are endowed with moderate to interesting antiproliferative activity against 9 different cancer cell lines derived from solid and hematological human tumors. Fluorescence-based assays prove that these molecules interfere with tubulin polymerization. Furthermore, isothermal titration calorimetry (ITC) provides full tubulin/compound binding thermodynamics, thereby ultimately qualifying and quantifying the interactions of these molecular series with the target protein. Lastly, the analysis based on the tight coupling of in vitro and in silico modeling of the interactions between tubulin and the title compounds allows to propose a molecular rationale for their biological activity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  13. Fractional charge and inter-Landau-level states at points of singular curvature.

    PubMed

    Biswas, Rudro R; Son, Dam Thanh

    2016-08-02

    The quest for universal properties of topological phases is fundamentally important because these signatures are robust to variations in system-specific details. Aspects of the response of quantum Hall states to smooth spatial curvature are well-studied, but challenging to observe experimentally. Here we go beyond this prevailing paradigm and obtain general results for the response of quantum Hall states to points of singular curvature in real space; such points may be readily experimentally actualized. We find, using continuum analytical methods, that the point of curvature binds an excess fractional charge and sequences of quantum states split away, energetically, from the degenerate bulk Landau levels. Importantly, these inter-Landau-level states are bound to the topological singularity and have energies that are universal functions of bulk parameters and the curvature. Our exact diagonalization of lattice tight-binding models on closed manifolds demonstrates that these results continue to hold even when lattice effects are significant. An important technological implication of these results is that these inter-Landau-level states, being both energetically and spatially isolated quantum states, are promising candidates for constructing qubits for quantum computation.

  14. CD70 is downregulated by interaction with CD27

    PubMed Central

    Kuka, Mirela; Munitic, Ivana; Torchia, Maria Letizia Giardino; Ashwell, Jonathan D.

    2013-01-01

    Engagement of the receptor CD27 by CD70 affects the magnitude and quality of T cell responses in a variety of infection models, and exaggerated signaling via this pathway results in enhanced immune responses and autoimmunity. One means by which signaling is regulated is tight control of cell surface CD70, which is expressed on dendritic, T, and B cells only upon activation. Here we show that there is a second level of regulation. First, although undetectable on the cell surface by flow cytometry, immature dendritic cells (DC) have a small pool of CD70 that continuously recycles from the plasma membrane. In addition, surface levels of CD70 on DC and T cells were higher in mice deficient in CD27, or on DC for which the interaction between CD70 and CD27 was precluded by blocking antibodies. Binding of CD70 by its receptor resulted in downregulation of CD70 transcription and protein levels, suggesting that CD70-mediated “reverse signals” regulate its own levels. Therefore, the ability of CD70 to trigger costimulation is self-regulated when it binds its complementary receptor. PMID:23913967

  15. RIM-binding protein 2 regulates release probability by fine-tuning calcium channel localization at murine hippocampal synapses

    PubMed Central

    Grauel, M. Katharina; Reddy-Alla, Suneel; Willmes, Claudia G.; Brockmann, Marisa M.; Trimbuch, Thorsten; Rosenmund, Tanja; Pangalos, Maria; Vardar, Gülçin; Stumpf, Alexander; Walter, Alexander M.; Rost, Benjamin R.; Eickholt, Britta J.; Haucke, Volker; Schmitz, Dietmar; Sigrist, Stephan J.; Rosenmund, Christian

    2016-01-01

    The tight spatial coupling of synaptic vesicles and voltage-gated Ca2+ channels (CaVs) ensures efficient action potential-triggered neurotransmitter release from presynaptic active zones (AZs). Rab-interacting molecule-binding proteins (RIM-BPs) interact with Ca2+ channels and via RIM with other components of the release machinery. Although human RIM-BPs have been implicated in autism spectrum disorders, little is known about the role of mammalian RIM-BPs in synaptic transmission. We investigated RIM-BP2–deficient murine hippocampal neurons in cultures and slices. Short-term facilitation is significantly enhanced in both model systems. Detailed analysis in culture revealed a reduction in initial release probability, which presumably underlies the increased short-term facilitation. Superresolution microscopy revealed an impairment in CaV2.1 clustering at AZs, which likely alters Ca2+ nanodomains at release sites and thereby affects release probability. Additional deletion of RIM-BP1 does not exacerbate the phenotype, indicating that RIM-BP2 is the dominating RIM-BP isoform at these synapses. PMID:27671655

  16. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  17. Expression of Ulex europaeus agglutinin I lectin-binding sites in squamous cell carcinomas and their absence in basal cell carcinomas. Indicator of tumor type and differentiation.

    PubMed

    Heng, M C; Fallon-Friedlander, S; Bennett, R

    1992-06-01

    Lectins bind tightly to carbohydrate moieties on cell surfaces. Alterations in lectin binding have been reported to accompany epidermal cell differentiation, marking alterations in membrane sugars during this process. The presence of UEA I (Ulex europaeus agglutinin I) L-fucose-specific lectin-binding sites has been used as a marker for terminally differentiated (committed) keratinocytes. In this article, we report the presence of UEA-I-binding sites on squamous keratinocytes of well-differentiated squamous cell carcinomas, with patchy loss of UEA I positivity on poorly differentiated cells of squamous cell carcinomas, suggesting a possible use for this technique in the rapid assessment of less differentiated areas within the squamous cell tumor. The absence of UEA-I-binding sites on basal cell carcinomas may be related to an inability of cells comprising this tumor to convert the L-D-pyranosyl moiety on basal cells to the L-fucose moiety, resulting in an inability of basal cell carcinoma cell to undergo terminal differentiation into a committed keratinocyte.

  18. Flies expand the repertoire of protein structures that bind ice.

    PubMed

    Basu, Koli; Graham, Laurie A; Campbell, Robert L; Davies, Peter L

    2015-01-20

    An antifreeze protein (AFP) with no known homologs has been identified in Lake Ontario midges (Chironomidae). The midge AFP is expressed as a family of isoforms at low levels in adults, which emerge from fresh water in spring before the threat of freezing temperatures has passed. The 9.1-kDa major isoform derived from a preproprotein precursor is glycosylated and has a 10-residue tandem repeating sequence xxCxGxYCxG, with regularly spaced cysteines, glycines, and tyrosines comprising one-half its 79 residues. Modeling and molecular dynamics predict a tightly wound left-handed solenoid fold in which the cysteines form a disulfide core to brace each of the eight 10-residue coils. The solenoid is reinforced by intrachain hydrogen bonds, side-chain salt bridges, and a row of seven stacked tyrosines on the hydrophobic side that forms the putative ice-binding site. A disulfide core is also a feature of the similar-sized beetle AFP that is a β-helix with seven 12-residue coils and a comparable circular dichroism spectrum. The midge and beetle AFPs are not homologous and their ice-binding sites are radically different, with the latter comprising two parallel arrays of outward-pointing threonines. However, their structural similarities is an amazing example of convergent evolution in different orders of insects to cope with change to a colder climate and provide confirmation about the physical features needed for a protein to bind ice.

  19. The common food additive carrageenan is not a ligand for Toll-Like- Receptor 4 (TLR4) in an HEK293-TLR4 reporter cell-line model.

    PubMed

    McKim, James M; Wilga, Paul C; Pregenzer, Jeffrey F; Blakemore, William R

    2015-04-01

    Carrageenan (CGN) is widely used in the food manufacturing industry as an additive that stabilizes and thickens food products. Standard animal safety studies in which CGN was administered in diet showed no adverse effects. However, several in vitro studies have reported that intestinal inflammation is caused by CGN and that this effect is mediated through Toll-Like-Receptor 4 (TLR4). The purpose of this study was to evaluate the ability of different types of CGN to bind and activate TLR4 signaling. To accomplish this a TLR4/MD-2/CD14/NFκB/SEAP reporter construct in a HEK293 cell line was used. The reporter molecule, secretable alkaline phosphatase (SEAP), was measured as an indicator of TLR4 activation. The test compounds were exposed to this system at concentrations of 0.1, 1, 10, 50, 100, 500, 1000, and 5000 ng/mL for 24 h. Cytotoxicity was evaluated following the 24 h exposure period by LDH leakage and ATP. CGN binding to serum proteins was characterized by Toluidine Blue. The results show that CGN does not bind to TLR4 and is not cytotoxic to the HEK293 cells at the concentrations and experimental conditions tested and that CGN binds tightly to serum proteins. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Assessment of the Activation of Rho Family GTP-Binding Proteins in Breast Cancer Cells and Specimens

    DTIC Science & Technology

    2001-08-01

    lymphopenia Vav2 GEF for Rho, Rac, and Cdc42 proto-oncogene product; NM009500 Vav3 GEF for Rho and Rac proto-oncogene product; NM020505 hPEM -2 GEF for...junctions, and desmosomes play a fundamental role in maintaining the polarized phenotype and vectorial transport functions of epithelial cells. The tight

Top