Sample records for tight simultaneous limits

  1. Limited angle CT reconstruction by simultaneous spatial and Radon domain regularization based on TV and data-driven tight frame

    NASA Astrophysics Data System (ADS)

    Zhang, Wenkun; Zhang, Hanming; Wang, Linyuan; Cai, Ailong; Li, Lei; Yan, Bin

    2018-02-01

    Limited angle computed tomography (CT) reconstruction is widely performed in medical diagnosis and industrial testing because of the size of objects, engine/armor inspection requirements, and limited scan flexibility. Limited angle reconstruction necessitates usage of optimization-based methods that utilize additional sparse priors. However, most of conventional methods solely exploit sparsity priors of spatial domains. When CT projection suffers from serious data deficiency or various noises, obtaining reconstruction images that meet the requirement of quality becomes difficult and challenging. To solve this problem, this paper developed an adaptive reconstruction method for limited angle CT problem. The proposed method simultaneously uses spatial and Radon domain regularization model based on total variation (TV) and data-driven tight frame. Data-driven tight frame being derived from wavelet transformation aims at exploiting sparsity priors of sinogram in Radon domain. Unlike existing works that utilize pre-constructed sparse transformation, the framelets of the data-driven regularization model can be adaptively learned from the latest projection data in the process of iterative reconstruction to provide optimal sparse approximations for given sinogram. At the same time, an effective alternating direction method is designed to solve the simultaneous spatial and Radon domain regularization model. The experiments for both simulation and real data demonstrate that the proposed algorithm shows better performance in artifacts depression and details preservation than the algorithms solely using regularization model of spatial domain. Quantitative evaluations for the results also indicate that the proposed algorithm applying learning strategy performs better than the dual domains algorithms without learning regularization model

  2. Limited English Proficient Students: Progress of 2008-09 High School Cohort. Data Trends. D&A Report No. 13.14

    ERIC Educational Resources Information Center

    Baenen, Nancy

    2013-01-01

    Students with Limited English Proficiency (LEP) entering U.S. schools in grade 9 face a tight timeline to simultaneously learn English and graduate from high school in four or five years. This study focuses on student outcomes and progress indicators for the cohort of ninth graders new to WCPSS in 2008-09 who had limited English proficiency. Based…

  3. Linear Time Algorithms to Restrict Insider Access using Multi-Policy Access Control Systems

    PubMed Central

    Mell, Peter; Shook, James; Harang, Richard; Gavrila, Serban

    2017-01-01

    An important way to limit malicious insiders from distributing sensitive information is to as tightly as possible limit their access to information. This has always been the goal of access control mechanisms, but individual approaches have been shown to be inadequate. Ensemble approaches of multiple methods instantiated simultaneously have been shown to more tightly restrict access, but approaches to do so have had limited scalability (resulting in exponential calculations in some cases). In this work, we take the Next Generation Access Control (NGAC) approach standardized by the American National Standards Institute (ANSI) and demonstrate its scalability. The existing publicly available reference implementations all use cubic algorithms and thus NGAC was widely viewed as not scalable. The primary NGAC reference implementation took, for example, several minutes to simply display the set of files accessible to a user on a moderately sized system. In our approach, we take these cubic algorithms and make them linear. We do this by reformulating the set theoretic approach of the NGAC standard into a graph theoretic approach and then apply standard graph algorithms. We thus can answer important access control decision questions (e.g., which files are available to a user and which users can access a file) using linear time graph algorithms. We also provide a default linear time mechanism to visualize and review user access rights for an ensemble of access control mechanisms. Our visualization appears to be a simple file directory hierarchy but in reality is an automatically generated structure abstracted from the underlying access control graph that works with any set of simultaneously instantiated access control policies. It also provide an implicit mechanism for symbolic linking that provides a powerful access capability. Our work thus provides the first efficient implementation of NGAC while enabling user privilege review through a novel visualization approach. This may help transition from concept to reality the idea of using ensembles of simultaneously instantiated access control methodologies, thereby limiting insider threat. PMID:28758045

  4. Passive versus active stretching of hip flexor muscles in subjects with limited hip extension: a randomized clinical trial.

    PubMed

    Winters, Michael V; Blake, Charles G; Trost, Jennifer S; Marcello-Brinker, Toni B; Lowe, Lynne M; Garber, Matthew B; Wainner, Robert S

    2004-09-01

    Active stretching is purported to stretch the shortened muscle and simultaneously strengthen the antagonist muscle. The purpose of this study was to determine whether active and passive stretching results in a difference between groups at improving hip extension range of motion in patients with hip flexor muscle tightness. Thirty-three patients with low back pain and lower-extremity injuries who showed decreased range of motion, presumably due to hip flexor muscle tightness, completed the study. The subjects, who had a mean age of 23.6 years (SD = 5.3, range = 18-25), were randomly assigned to either an active home stretching group or a passive home stretching group. Hip extension range of motion was measured with the subjects in the modified Thomas test position at baseline and 3 and 6 weeks after the start of the study. Range of motion in both groups improved over time, but there were no differences between groups. The results indicate that passive and active stretching are equally effective for increasing range of motion, presumably due to increased flexibility of tight hip flexor muscles. Whether the 2 methods equally improve flexibility of other muscle groups or whether active stretching improves the function of the antagonist muscles is not known. Active and passive stretching both appeared to increase the flexibility of tight hip flexor muscles in patients with musculoskeletal impairments.

  5. Sparsity-aware tight frame learning with adaptive subspace recognition for multiple fault diagnosis

    NASA Astrophysics Data System (ADS)

    Zhang, Han; Chen, Xuefeng; Du, Zhaohui; Yang, Boyuan

    2017-09-01

    It is a challenging problem to design excellent dictionaries to sparsely represent diverse fault information and simultaneously discriminate different fault sources. Therefore, this paper describes and analyzes a novel multiple feature recognition framework which incorporates the tight frame learning technique with an adaptive subspace recognition strategy. The proposed framework consists of four stages. Firstly, by introducing the tight frame constraint into the popular dictionary learning model, the proposed tight frame learning model could be formulated as a nonconvex optimization problem which can be solved by alternatively implementing hard thresholding operation and singular value decomposition. Secondly, the noises are effectively eliminated through transform sparse coding techniques. Thirdly, the denoised signal is decoupled into discriminative feature subspaces by each tight frame filter. Finally, in guidance of elaborately designed fault related sensitive indexes, latent fault feature subspaces can be adaptively recognized and multiple faults are diagnosed simultaneously. Extensive numerical experiments are sequently implemented to investigate the sparsifying capability of the learned tight frame as well as its comprehensive denoising performance. Most importantly, the feasibility and superiority of the proposed framework is verified through performing multiple fault diagnosis of motor bearings. Compared with the state-of-the-art fault detection techniques, some important advantages have been observed: firstly, the proposed framework incorporates the physical prior with the data-driven strategy and naturally multiple fault feature with similar oscillation morphology can be adaptively decoupled. Secondly, the tight frame dictionary directly learned from the noisy observation can significantly promote the sparsity of fault features compared to analytical tight frames. Thirdly, a satisfactory complete signal space description property is guaranteed and thus weak feature leakage problem is avoided compared to typical learning methods.

  6. Numerical simulation of multi-dimensional NMR response in tight sandstone

    NASA Astrophysics Data System (ADS)

    Guo, Jiangfeng; Xie, Ranhong; Zou, Youlong; Ding, Yejiao

    2016-06-01

    Conventional logging methods have limitations in the evaluation of tight sandstone reservoirs. The multi-dimensional nuclear magnetic resonance (NMR) logging method has the advantage that it can simultaneously measure transverse relaxation time (T 2), longitudinal relaxation time (T 1) and diffusion coefficient (D). In this paper, we simulate NMR measurements of tight sandstone with different wettability and saturations by the random walk method and obtain the magnetization decays of Carr-Purcell-Meiboom-Gill pulse sequences with different wait times (TW) and echo spacings (TE) under a magnetic field gradient, resulting in D-T 2-T 1 maps by the multiple echo trains joint inversion method. We also study the effects of wettability, saturation, signal-to-noise ratio (SNR) of data and restricted diffusion on the D-T 2-T 1 maps in tight sandstone. The results show that with decreasing wetting fluid saturation, the surface relaxation rate of the wetting fluid gradually increases and the restricted diffusion phenomenon becomes more and more obvious, which leads to the wetting fluid signal moving along the direction of short relaxation and the direction of the diffusion coefficient decreasing in D-T 2-T 1 maps. Meanwhile, the non-wetting fluid position in D-T 2-T 1 maps does not change with saturation variation. With decreasing SNR, the ability to identify water and oil signals based on NMR maps gradually decreases. The wetting fluid D-T 1 and D-T 2 correlations in NMR diffusion-relaxation maps of tight sandstone are obtained through expanding the wetting fluid restricted diffusion models, and are further applied to recognize the wetting fluid in simulated D-T 2 maps and D-T 1 maps.

  7. Communication Dynamics in Finite Capacity Social Networks

    NASA Astrophysics Data System (ADS)

    Haerter, Jan O.; Jamtveit, Bjørn; Mathiesen, Joachim

    2012-10-01

    In communication networks, structure and dynamics are tightly coupled. The structure controls the flow of information and is itself shaped by the dynamical process of information exchanged between nodes. In order to reconcile structure and dynamics, a generic model, based on the local interaction between nodes, is considered for the communication in large social networks. In agreement with data from a large human organization, we show that the flow is non-Markovian and controlled by the temporal limitations of individuals. We confirm the versatility of our model by predicting simultaneously the degree-dependent node activity, the balance between information input and output of nodes, and the degree distribution. Finally, we quantify the limitations to network analysis when it is based on data sampled over a finite period of time.

  8. Systematically Ranking the Tightness of Membrane Association for Peripheral Membrane Proteins (PMPs)*

    PubMed Central

    Gao, Liyan; Ge, Haitao; Huang, Xiahe; Liu, Kehui; Zhang, Yuanya; Xu, Wu; Wang, Yingchun

    2015-01-01

    Large-scale quantitative evaluation of the tightness of membrane association for nontransmembrane proteins is important for identifying true peripheral membrane proteins with functional significance. Herein, we simultaneously ranked more than 1000 proteins of the photosynthetic model organism Synechocystis sp. PCC 6803 for their relative tightness of membrane association using a proteomic approach. Using multiple precisely ranked and experimentally verified peripheral subunits of photosynthetic protein complexes as the landmarks, we found that proteins involved in two-component signal transduction systems and transporters are overall tightly associated with the membranes, whereas the associations of ribosomal proteins are much weaker. Moreover, we found that hypothetical proteins containing the same domains generally have similar tightness. This work provided a global view of the structural organization of the membrane proteome with respect to divergent functions, and built the foundation for future investigation of the dynamic membrane proteome reorganization in response to different environmental or internal stimuli. PMID:25505158

  9. A new method of evaluating tight gas sands pore structure from nuclear magnetic resonance (NMR) logs

    NASA Astrophysics Data System (ADS)

    Xiao, Liang; Mao, Zhi-qiang; Xie, Xiu-hong

    2016-04-01

    Tight gas sands always display such characteristics of ultra-low porosity, permeability, high irreducible water, low resistivity contrast, complicated pore structure and strong heterogeneity, these make that the conventional methods are invalid. Many effective gas bearing formations are considered as dry zones or water saturated layers, and cannot be identified and exploited. To improve tight gas sands evaluation, the best method is quantitative characterizing rock pore structure. The mercury injection capillary pressure (MICP) curves are advantageous in predicting formation pore structure. However, the MICP experimental measurements are limited due to the environment and economy factors, this leads formation pore structure cannot be consecutively evaluated. Nuclear magnetic resonance (NMR) logs are considered to be promising in evaluating rock pore structure. Generally, to consecutively quantitatively evaluate tight gas sands pore structure, the best method is constructing pseudo Pc curves from NMR logs. In this paper, based on the analysis of lab experimental results for 20 core samples, which were drilled from tight gas sandstone reservoirs of Sichuan basin, and simultaneously applied for lab MICP and NMR measurements, the relationships of piecewise power function between nuclear magnetic resonance (NMR) transverse relaxation T2 time and pore-throat radius Rc are established. A novel method, which is used to transform NMR reverse cumulative curve as pseudo capillary pressure (Pc) curve is proposed, and the corresponding model is established based on formation classification. By using this model, formation pseudo Pc curves can be consecutively synthesized. The pore throat radius distribution, and pore structure evaluation parameters, such as the average pore throat radius (Rm), the threshold pressure (Pd), the maximum pore throat radius (Rmax) and so on, can also be precisely extracted. After this method is extended into field applications, several tight gas sandstone reservoirs are processed, and the predicted results are compared with core derived results. Good consistency between evaluated results with core derived results illustrates the dependability of the proposed method. Comparing with the previous methods, this presented model is much more theoretical, and the applicability is much improved. Combining with the evaluated results, our target tight gas sands are well evaluated, and many potential gas-bearing layers are effectively identified.

  10. Transferable self-welding silver nanowire network as high performance transparent flexible electrode.

    PubMed

    Zhu, Siwei; Gao, Yuan; Hu, Bin; Li, Jia; Su, Jun; Fan, Zhiyong; Zhou, Jun

    2013-08-23

    High performance transparent electrodes (TEs) with figures-of-merit as high as 471 were assembled using ultralong silver nanowires (Ag NWs). A room-temperature plasma was employed to enhance the conductivity of the Ag NW TEs by simultaneously removing the insulating PVP layer coating on the NWs and welding the junctions tightly. Furthermore, we developed a general way to fabricate TEs regardless of substrate limitations by transferring the as-fabricated Ag NW network onto various substrates directly, and the transmittance can remain as high as 91% with a sheet resistivity of 13 Ω/sq. The highly robust and stable flexible TEs will have broad applications in flexible optoelectronic and electronic devices.

  11. A dynamic traction splint for the management of extrinsic tendon tightness.

    PubMed

    Dovelle, S; Heeter, P K; Phillips, P D

    1987-02-01

    The dynamic traction splint designed by therapists at Walter Reed Army Medical Center is used for the management of extrinsic extensor tendon tightness commonly seen in brachial plexus injuries and traumatic soft tissue injuries of the upper extremity. The two components of the splint allow for simultaneous maximum flexion of the MCP and IP joints. This simple and economical splint provides an additional modality to any occupational therapy service involved in the management of upper extremity disorders.

  12. Seismic data interpolation and denoising by learning a tensor tight frame

    NASA Astrophysics Data System (ADS)

    Liu, Lina; Plonka, Gerlind; Ma, Jianwei

    2017-10-01

    Seismic data interpolation and denoising plays a key role in seismic data processing. These problems can be understood as sparse inverse problems, where the desired data are assumed to be sparsely representable within a suitable dictionary. In this paper, we present a new method based on a data-driven tight frame (DDTF) of Kronecker type (KronTF) that avoids the vectorization step and considers the multidimensional structure of data in a tensor-product way. It takes advantage of the structure contained in all different modes (dimensions) simultaneously. In order to overcome the limitations of a usual tensor-product approach we also incorporate data-driven directionality. The complete method is formulated as a sparsity-promoting minimization problem. It includes two main steps. In the first step, a hard thresholding algorithm is used to update the frame coefficients of the data in the dictionary; in the second step, an iterative alternating method is used to update the tight frame (dictionary) in each different mode. The dictionary that is learned in this way contains the principal components in each mode. Furthermore, we apply the proposed KronTF to seismic interpolation and denoising. Examples with synthetic and real seismic data show that the proposed method achieves better results than the traditional projection onto convex sets method based on the Fourier transform and the previous vectorized DDTF methods. In particular, the simple structure of the new frame construction makes it essentially more efficient.

  13. Energy density engineering via zero-admittance domains in all-dielectric stratified materials

    NASA Astrophysics Data System (ADS)

    Amra, Claude; Zerrad, Myriam; Lemarchand, Fabien; Lereu, Aude; Passian, Ali; Zapien, Juan Antonio; Lequime, Michel

    2018-02-01

    Emerging photonic, sensing, and quantum applications require high fields and tight localization but low power consumption. Spatial, spectral, and magnitude control of electromagnetic fields is of key importance for enabling experiments in atomic, molecular, and optical physics. We introduce the concept of zero-admittance domains as a mechanism for tailoring giant optical fields bound within or on the surface of dielectric media. The described mechanism permits the creation of highly localized fields of extreme amplitudes simultaneously for incident photons of multiple wavelengths and incidence angles but arbitrary polarization states. No material constraints are placed upon the bounding media. Both intrinsic and extrinsic potential practical limitations of the predicted field enhancement are analyzed and applications relevant to optical sensors and microsources are briefly discussed.

  14. Joint digital signal processing for superchannel coherent optical communication systems.

    PubMed

    Liu, Cheng; Pan, Jie; Detwiler, Thomas; Stark, Andrew; Hsueh, Yu-Ting; Chang, Gee-Kung; Ralph, Stephen E

    2013-04-08

    Ultra-high-speed optical communication systems which can support ≥ 1Tb/s per channel transmission will soon be required to meet the increasing capacity demand. However, 1Tb/s over a single carrier requires either or both a high-level modulation format (i.e. 1024QAM) and a high baud rate. Alternatively, grouping a number of tightly spaced "sub-carriers" to form a terabit superchannel increases channel capacity while minimizing the need for high-level modulation formats and high baud rate, which may allow existing formats, baud rate and components to be exploited. In ideal Nyquist-WDM superchannel systems, optical subcarriers with rectangular spectra are tightly packed at a channel spacing equal to the baud rate, thus achieving the Nyquist bandwidth limit. However, in practical Nyquist-WDM systems, precise electrical or optical control of channel spectra is required to avoid strong inter-channel interference (ICI). Here, we propose and demonstrate a new "super receiver" architecture for practical Nyquist-WDM systems, which jointly detects and demodulates multiple channels simultaneously and mitigates the penalties associated with the limitations of generating ideal Nyquist-WDM spectra. Our receiver-side solution relaxes the filter requirements imposed on the transmitter. Two joint DSP algorithms are developed for linear ICI cancellation and joint carrier-phase recovery. Improved system performance is observed with both experimental and simulation data. Performance analysis under different system configurations is conducted to demonstrate the feasibility and robustness of the proposed joint DSP algorithms.

  15. The role of microtubules in contractile ring function.

    PubMed

    Conrad, A H; Paulsen, A Q; Conrad, G W

    1992-05-01

    During cytokinesis, a cortical contractile ring forms around a cell, constricts to a stable tight neck and terminates in separation of the daughter cells. At first cleavage, Ilyanassa obsoleta embryos form two contractile rings simultaneously. The cleavage furrow (CF), in the animal hemisphere between the spindle poles, constricts to a stable tight neck and separates the daughter cells. The third polar lobe constriction (PLC-3), in the vegetal hemisphere below the spindle, constricts to a transient tight neck, but then relaxes, allowing the polar lobe cytoplasm to merge with one daughter cell. Eggs exposed to taxol, a drug that stabilizes microtubules, before the CF or the PLC-3 develop, fail to form CFs, but form stabilized tight PLCs. Eggs exposed to taxol at the time of PLC-3 formation develop varied numbers of constriction rings in their animal hemispheres and one PLC in their vegetal hemisphere, none of which relax. Eggs exposed to taxol after PLC-3 initiation form stabilized tight CFs and PLCs. At maximum constriction, control embryos display immunolocalization of nonextractable alpha-tubulin in their CFs, but not in their PLCs, and reveal, via electron microscopy, many microtubules extending through their CFs, but not through their PLCs. Embryos which form stabilized tightly constricted CFs and PLCs in the presence of taxol display immunolocalization of nonextractable alpha-tubulin in both constrictions and show many polymerized microtubules extending through both CFs and PLCs. These results suggest that the extension of microtubules through a tight contractile ring may be important for stabilizing that constriction and facilitating subsequent cytokinesis.

  16. The role of microtubules in contractile ring function

    NASA Technical Reports Server (NTRS)

    Conrad, A. H.; Paulsen, A. Q.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    During cytokinesis, a cortical contractile ring forms around a cell, constricts to a stable tight neck and terminates in separation of the daughter cells. At first cleavage, Ilyanassa obsoleta embryos form two contractile rings simultaneously. The cleavage furrow (CF), in the animal hemisphere between the spindle poles, constricts to a stable tight neck and separates the daughter cells. The third polar lobe constriction (PLC-3), in the vegetal hemisphere below the spindle, constricts to a transient tight neck, but then relaxes, allowing the polar lobe cytoplasm to merge with one daughter cell. Eggs exposed to taxol, a drug that stabilizes microtubules, before the CF or the PLC-3 develop, fail to form CFs, but form stabilized tight PLCs. Eggs exposed to taxol at the time of PLC-3 formation develop varied numbers of constriction rings in their animal hemispheres and one PLC in their vegetal hemisphere, none of which relax. Eggs exposed to taxol after PLC-3 initiation form stabilized tight CFs and PLCs. At maximum constriction, control embryos display immunolocalization of nonextractable alpha-tubulin in their CFs, but not in their PLCs, and reveal, via electron microscopy, many microtubules extending through their CFs, but not through their PLCs. Embryos which form stabilized tightly constricted CFs and PLCs in the presence of taxol display immunolocalization of nonextractable alpha-tubulin in both constrictions and show many polymerized microtubules extending through both CFs and PLCs. These results suggest that the extension of microtubules through a tight contractile ring may be important for stabilizing that constriction and facilitating subsequent cytokinesis.

  17. Do Equilibrium Constraints Modulate Postural Reaction when Viewing Imbalance?

    ERIC Educational Resources Information Center

    Tia, Banty; Paizis, Christos; Mourey, France; Pozzo, Thierry

    2012-01-01

    Action observation and action execution are tightly coupled on a neurophysiological and a behavioral level, such that visually perceiving an action can contaminate simultaneous and subsequent action execution. More specifically, observing a model in postural disequilibrium was shown to induce an increase in observers' body sway. Here we…

  18. Energy density engineering via zero-admittance domains in all-dielectric stratified materials

    DOE PAGES

    Amra, Claude; Zerrad, Myriam; Lemarchand, Fabien; ...

    2018-02-12

    Emerging photonic, sensing, and quantum applications require high fields and tight localization but low power consumption. Spatial, spectral, and magnitude control of electromagnetic fields is of key importance for enabling experiments in atomic, molecular, and optical physics. Here in this paper, we introduce the concept of zero-admittance domains as a mechanism for tailoring giant optical fields bound within or on the surface of dielectric media. The described mechanism permits the creation of highly localized fields of extreme amplitudes simultaneously for incident photons of multiple wavelengths and incidence angles but arbitrary polarization states. No material constraints are placed upon the boundingmore » media. Both intrinsic and extrinsic potential practical limitations of the predicted field enhancement are analyzed and applications relevant to optical sensors and microsources are briefly discussed.« less

  19. Energy density engineering via zero-admittance domains in all-dielectric stratified materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Amra, Claude; Zerrad, Myriam; Lemarchand, Fabien

    Emerging photonic, sensing, and quantum applications require high fields and tight localization but low power consumption. Spatial, spectral, and magnitude control of electromagnetic fields is of key importance for enabling experiments in atomic, molecular, and optical physics. Here in this paper, we introduce the concept of zero-admittance domains as a mechanism for tailoring giant optical fields bound within or on the surface of dielectric media. The described mechanism permits the creation of highly localized fields of extreme amplitudes simultaneously for incident photons of multiple wavelengths and incidence angles but arbitrary polarization states. No material constraints are placed upon the boundingmore » media. Both intrinsic and extrinsic potential practical limitations of the predicted field enhancement are analyzed and applications relevant to optical sensors and microsources are briefly discussed.« less

  20. Tight coordination of aerial flight maneuvers and sonar call production in insectivorous bats

    PubMed Central

    Falk, Benjamin; Kasnadi, Joseph; Moss, Cynthia F.

    2015-01-01

    ABSTRACT Echolocating bats face the challenge of coordinating flight kinematics with the production of echolocation signals used to guide navigation. Previous studies of bat flight have focused on kinematics of fruit and nectar-feeding bats, often in wind tunnels with limited maneuvering, and without analysis of echolocation behavior. In this study, we engaged insectivorous big brown bats in a task requiring simultaneous turning and climbing flight, and used synchronized high-speed motion-tracking cameras and audio recordings to quantify the animals' coordination of wing kinematics and echolocation. Bats varied flight speed, turn rate, climb rate and wingbeat rate as they navigated around obstacles, and they adapted their sonar signals in patterning, duration and frequency in relation to the timing of flight maneuvers. We found that bats timed the emission of sonar calls with the upstroke phase of the wingbeat cycle in straight flight, and that this relationship changed when bats turned to navigate obstacles. We also characterized the unsteadiness of climbing and turning flight, as well as the relationship between speed and kinematic parameters. Adaptations in the bats' echolocation call frequency suggest changes in beam width and sonar field of view in relation to obstacles and flight behavior. By characterizing flight and sonar behaviors in an insectivorous bat species, we find evidence of exquisitely tight coordination of sensory and motor systems for obstacle navigation and insect capture. PMID:26582935

  1. Tight ceramic UF membrane as RO pre-treatment: the role of electrostatic interactions on phosphate rejection.

    PubMed

    Shang, Ran; Verliefde, Arne R D; Hu, Jingyi; Zeng, Zheyi; Lu, Jie; Kemperman, Antoine J B; Deng, Huiping; Nijmeijer, Kitty; Heijman, Sebastiaan G J; Rietveld, Luuk C

    2014-01-01

    Phosphate limitation has been reported as an effective approach to inhibit biofouling in reverse osmosis (RO) systems for water purification. The rejection of dissolved phosphate by negatively charged TiO2 tight ultrafiltration (UF) membranes (1 kDa and 3 kDa) was observed. These membranes can potentially be adopted as an effective process for RO pre-treatment in order to constrain biofouling by phosphate limitation. This paper focuses on electrostatic interactions during tight UF filtration. Despite the larger pore size, the 3 kDa ceramic membrane exhibited greater phosphate rejection than the 1 kDa membrane, because the 3 kDa membrane has a greater negative surface charge and thus greater electrostatic repulsion against phosphate. The increase of pH from 6 to 8.5 led to a substantial increase in phosphate rejection by both membranes due to increased electrostatic repulsion. At pH 8.5, the maximum phosphate rejections achieved by the 1 kDa and 3 kDa membrane were 75% and 86%, respectively. A Debye ratio (ratio of the Debye length to the pore radius) is introduced in order to evaluate double layer overlapping in tight UF membranes. Threshold Debye ratios were determined as 2 and 1 for the 1 kDa and 3 kDa membranes, respectively. A Debye ratio below the threshold Debye ratio leads to dramatically decreased phosphate rejection by tight UF membranes. The phosphate rejection by the tight UF, in combination with chemical phosphate removal by coagulation, might accomplish phosphate-limited conditions for biological growth and thus prevent biofouling in the RO systems. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Argus: a new instrument for the measurement of the stratospheric dynamical tracers, N2O and CH4

    NASA Technical Reports Server (NTRS)

    Loewenstein, Max; Jost, H.; Grose, J.; Eilers, J.; Lynch, D.; Jensen, S.; Marmie, J.

    2002-01-01

    We describe here a new instrument for the simultaneous, in situ measurement of the stratospheric tracer molecules, nitrous oxide (N2O) and methane (CH4). Argus is unique in its small size making it well suited for limited payload atmospheric research platforms. Argus employs second harmonic spectroscopy using tunable lead-salt diode lasers emitting in the mid-infrared. We first explain the Argus design philosophy followed by detailed descriptions of the instrument's optical, mechanical, and thermal sub-systems. Argus employs an in-flight calibration system providing real time calibrations and tightly constrained uncertainty estimates of the returned data. Data analysis is carried out using non-linear least-squares model fits to the acquired second harmonic spectra. A sampling of Argus data acquired on a recent stratospheric research campaign in the Arctic winter is presented.

  3. Dielectric response of molecules in empirical tight-binding theory

    NASA Astrophysics Data System (ADS)

    Boykin, Timothy B.; Vogl, P.

    2002-01-01

    In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.

  4. Supercontinuum Emission from Water using 40 fs Pulses in the External Tight Focusing Limit

    NASA Astrophysics Data System (ADS)

    Sreeja, S.; Rao, S. Venugopal; Bagchi, Suman; Sreedhar, S.; Prashant, T. Shuvan; Radhakrishnan, P.; Tewari, Surya P.; Kiran, P. Prem

    2011-10-01

    We present our results from the measurements of Supereonlinuum emission (SCE) resulting from the propagation ol" tightly foe used 40 femtosecond laser pulses through distilled water. The e fleet of linearly polarized (LP) and circularly polarized (CP) light pulses on the SCE: in different external focal geometries (f/6 & f/12) is studied in detail. A considerable shift in the minimum wavelength of SCF under tighter focusing limit is observed.

  5. Design and Fabrication of a PDMS Microchip Based Immunoassay

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shao, Guocheng; Wang, Wanjun; Wang, Jun

    2010-07-01

    In this paper, we describe the design and fabrication process of a polydimethylsiloxane (PDMS) microchip for on-chip multiplex immunoassay application. The microchip consists of a PDMS microfluidic channel layer and a micro pneumatic valve control layer. By selectively pressurizing the pneumatic microvalves, immuno reagents were controlled to flow and react in certain fluidic channel sites. Cross contamination was prevented by tightly closed valves. Our design was proposed to utilize PDMS micro channel surface as the solid phase immunoassay substrate and simultaneously detect four targets antigens on chip. Experiment result shows that 20psi valve pressure is sufficient to tightly close amore » 200µm wide micro channel with flow rate up to 20µl/min.« less

  6. Pore Structure and Limit Pressure of Gas Slippage Effect in Tight Sandstone

    PubMed Central

    You, Lijun; Xue, Kunlin; Kang, Yili; Liao, Yi

    2013-01-01

    Gas slip effect is an important mechanism that the gas flow is different from liquid flow in porous media. It is generally considered that the lower the permeability in porous media is, the more severe slip effect of gas flow will be. We design and then carry out experiments with the increase of backpressure at the outlet of the core samples based on the definition of gas slip effect and in view of different levels of permeability of tight sandstone reservoir. This study inspects a limit pressure of the gas slip effect in tight sandstones and analyzes the characteristic parameter of capillary pressure curves. The experimental results indicate that gas slip effect can be eliminated when the backpressure reaches a limit pressure. When the backpressure exceeds the limit pressure, the measured gas permeability is a relatively stable value whose range is less than 3% for a given core sample. It is also found that the limit pressure increases with the decreasing in permeability and has close relation with pore structure of the core samples. The results have an important influence on correlation study on gas flow in porous medium, and are beneficial to reduce the workload of laboratory experiment. PMID:24379747

  7. How Tight is the Linkage Between Trees and Trout?

    Treesearch

    Margaret A. Wilzbach

    1989-01-01

    This paper explores the tightness of the linkage between stream-dwelling salmonids and ripar ian vegetation. Comparison of original distributions of salmonid species with that of vegetation types shows that distribution within a given salmonid species is not limited to a specific vegetation type, and that different salmonid species cooccur within a given vegetation...

  8. Tight coordination of aerial flight maneuvers and sonar call production in insectivorous bats.

    PubMed

    Falk, Benjamin; Kasnadi, Joseph; Moss, Cynthia F

    2015-11-01

    Echolocating bats face the challenge of coordinating flight kinematics with the production of echolocation signals used to guide navigation. Previous studies of bat flight have focused on kinematics of fruit and nectar-feeding bats, often in wind tunnels with limited maneuvering, and without analysis of echolocation behavior. In this study, we engaged insectivorous big brown bats in a task requiring simultaneous turning and climbing flight, and used synchronized high-speed motion-tracking cameras and audio recordings to quantify the animals' coordination of wing kinematics and echolocation. Bats varied flight speed, turn rate, climb rate and wingbeat rate as they navigated around obstacles, and they adapted their sonar signals in patterning, duration and frequency in relation to the timing of flight maneuvers. We found that bats timed the emission of sonar calls with the upstroke phase of the wingbeat cycle in straight flight, and that this relationship changed when bats turned to navigate obstacles. We also characterized the unsteadiness of climbing and turning flight, as well as the relationship between speed and kinematic parameters. Adaptations in the bats' echolocation call frequency suggest changes in beam width and sonar field of view in relation to obstacles and flight behavior. By characterizing flight and sonar behaviors in an insectivorous bat species, we find evidence of exquisitely tight coordination of sensory and motor systems for obstacle navigation and insect capture. © 2015. Published by The Company of Biologists Ltd.

  9. Boomerang pattern correction of gynecomastia.

    PubMed

    Hurwitz, Dennis J

    2015-02-01

    After excess skin and fat are removed, a body-lift suture advances skin and suspends ptotic breasts, the mons pubis, and buttocks. For women, the lift includes sculpturing adiposity. While some excess fat may need removal, muscular men should receive a deliberate effort to achieve generalized tight skin closure to reveal superficial muscular bulk. For skin to be tightly bound to muscle, the excess needs to be removed both horizontally and vertically. To aesthetically accomplish that goal, a series of oblique elliptical excisions have been designed. Twenty-four consecutive patients received boomerang pattern correction of gynecomastia. In the last 12 patients, a J torsoplasty extension replaced the transverse upper body lift. Indirect undermining and the opposing force of a simultaneous abdominoplasty obliterate the inframammary fold. To complete effacement of the entire torso in 11 patients, an abdominoplasty was extended by oblique excisions over bulging flanks. Satisfactory improvement was observed in all 24 boomerang cases. A disgruntled patient was displeased with distorted nipples after revision surgery. Scar maturation in the chest is lengthy, with scars taking years to flatten and fade. Complications were limited and no major revisions were needed. In selected patients, comprehensive body contouring surgery consists of a boomerang correction of gynecomastia. J torsoplasty with an abdominoplasty and oblique excisions of the flanks has proven to be a practical means to achieve aesthetic goals. Gender-specific body lift surgery that goes far beyond the treatment of gynecomastia best serves the muscular male patient after massive weight loss. Therapeutic, IV.

  10. Effects of Universal Mobile Telecommunications System (UMTS) electromagnetic fields on the blood-brain barrier in vitro.

    PubMed

    Franke, Helmut; Streckert, Joachim; Bitz, Andreas; Goeke, Johannes; Hansen, Volkert; Ringelstein, E Bernd; Nattkämper, Heiner; Galla, Hans-Joachim; Stögbauer, Florian

    2005-09-01

    The extensive use of mobile phone communication has raised public concerns about adverse health effects of radiofrequency (RF) electromagnetic fields (EMFs) in recent years. A central issue in this discussion is the question whether EMFs enhance the permeability of the blood-brain barrier (BBB). Here we report an investigation on the influence of a generic UMTS (Universal Mobile Telecommunications System) signal on barrier tightness, transport processes and the morphology of porcine brain microvascular endothelial cell cultures (PBEC) serving as an in vitro model of the BBB. An exposure device with integrated online monitoring system was developed for simultaneous exposure and measuring of transendothelial electrical resistance (TEER) to determine the tightness of the BBB. PBEC were exposed continuously for up to 84 h at an average electric-field strength of 3.4-34 V/m (maximum 1.8 W/kg) ensuring athermal conditions. We did not find any evidence of RF-field-induced disturbance of the function of the BBB. After and during exposure, the tightness of the BBB quantified by 14C-sucrose and serum albumin permeation as well as by TEER remained unchanged compared to sham-exposed cultures. Permeation of transporter substrates at the BBB as well as the localization and integrity of the tight-junction proteins occludin and ZO1 were not affected either.

  11. Replacement of Cetyltrimethylammoniumbromide Bilayer on Gold Nanorod by Alkanethiol Crosslinker for Enhanced Plasmon Resonance Sensitivity

    PubMed Central

    Casas, Justin; Venkataramasubramani, Meenakshi; Wang, Yanyan; Tang, Liang

    2013-01-01

    Surface modification of gold nanorods (GNRs) is often problematic due to tightly packed cetyltrimethylammoniumbromide (CTAB) bilayer. Herein, we performed a double phase transfer ligand exchange to achieve displacement of CTAB on nanorods. During the removal, 11-mercaptoundecanoic acid (MUDA) crosslinker is simultaneously assembled on nanorod surfaces to prevent aggregation. The resulting MUDA-GNRs retain the shape and position of plasmon peaks similar to CTAB-capped GNRs. The introduction of carboxyl groups allows covalent conjugation of biological receptors in a facile fashion to construct a robust, label-free biosensor based on localized surface plasmon resonance (LSPR) transduction of biomolecular interaction. More importantly, smaller MUDA layer on the GNRs reduces the distance of target binding to the plasmonic nanostructure interface, leading to a significant enhancement in LSPR assay sensitivity and specificity. Compared to modification using conventional electropolymer adsorption, MUDA-coated gold nanosensor exhibits five times lower detection limit for cardiac troponin I assay with a high selectivity. PMID:23816849

  12. Simultaneous cell death and desquamation of the embryonic diffusion barrier during epidermal development.

    PubMed

    Saathoff, Manuela; Blum, Barbara; Quast, Thomas; Kirfel, Gregor; Herzog, Volker

    2004-10-01

    The periderm is an epithelial layer covering the emerging epidermis in early embryogenesis of vertebrates. In the chicken embryo, an additional cellular layer, the subperiderm, occurs at later embryonic stages underneath the periderm. The questions arose what is the function of both epithelial layers and, as they are transitory structures, by which mechanism are they removed. By immunocytochemistry, the tight junction (TJ) proteins occludin and claudin-1 were localized in the periderm and in the subperiderm, and sites of close contact between adjacent cells were detected by electron microscopy. Using horseradish peroxidase (HRP) as tracer, these contacts were identified as tight junctions involved in the formation of the embryonic diffusion barrier. This barrier was lost by desquamation at the end of the embryonic period, when the cornified envelope of the emerging epidermis was formed. By TUNEL and DNA ladder assays, we detected simultaneous cell death in the periderm and the subperiderm shortly before hatching. The absence of caspases-3, -6, and -7 activity, key enzymes of apoptosis, and the lack of typical morphological criteria of apoptosis such as cell fragmentation or membrane blebbing point to a special form of programmed cell death (PCD) leading to the desquamation of the embryonic diffusion barrier. Copyright 2004 Elsevier Inc.

  13. Thermal emission from large solid particles in the coma of comet C/2012 S1 (ISON) around perihelion

    NASA Astrophysics Data System (ADS)

    Keane, J.; Milam, S.; Coulson, I.; Gicquel, A.; Meech, K.; Yang, B.; Riesen, T.; Remijan, A.; Villanueva, G.; Corrinder, M.; Charnley, S.; Mumma, M.

    2014-07-01

    We report submillimeter dust-continuum observations for comet C/2012 S1 (ISON) obtained during the time period immediately before perihelion on 2013 November 28 (r = 0.0125 au). The variability and time resolution obtained in these images has revealed significant dust outbursts and have likely captured the onset of the final disruption event of comet ISON. The measured 450-μ m and 850-μ m submillimeter continuua are the strongest yet detected from a comet. Data were obtained with the SCUBA-2 submillimetre camera on the James Clerk Maxwell Telescope (JCMT) located at the 4000-m level of Mauna Kea, Hawaii during a week of scheduled day-time observing. Imaging is achieved simultaneously at wavelengths of 850 μ m and 450 μ m. Conditions necessary to obtain valuable results at 450 μ m occur relatively infrequently, and while atmospheric zenith opacities on the days involved were good (low), ranging between 0.08 (nepers at 225 GHz on the first day) and 0.05 (on the day of perihelion), the relatively low elevations of the observations (30--45 degrees), and consequent high line-of-sight opacities, limit the impact of the 450-μ m data. Each of the focal planes of SCUBA-2 is populated with 5000 bolometers, and provides an instantaneous Field of View of almost 10 arc minutes. In order to account effectively for the rapidly varying sky transmissions, the observational strategies adopted at JCMT involve scanning the telescope rapidly around the target in a daisy pattern, which produces fairly uniform coverage in exposure time of an area of diameter 3 arc minutes around the target centre. When comet ISON was first detected at 850 μ m, the 1-mm-sized dust particles were tightly bound to the comet nucleus until at least November 23. Three days later the dust was less tightly bound and became elongated and diffuse, spread out over as much as 120 arc seconds (80,000 km) in the anti-solar direction. Preliminary analyses of these observations suggest the detection of either a large-scale fragmentation event and/or the comet's disruption. The ratio of fluxes at 450 μ m and 850 μ m is 3.5±0.4, which compares well with the expected value of 3.7 if both data come from the Rayleigh-Jeans tail of a black-body spectrum of these temperatures. We discuss both the significance and limitations of our findings and compare them to other investigations obtained simultaneously at complementary wavelengths (such as SOHO and STEREO).

  14. Evaluation of the Sparton tight-tolerance AXBT

    NASA Technical Reports Server (NTRS)

    Boyd, Janice D.; Linzell, Robert S.

    1993-01-01

    Forty-six near-simultaneous pairs of conductivity - temperature - depth (CTD) and Sparton 'tight tolerance' air expendable bathythermograph (AXBT) temperature profiles were obtained in summer 1991 from a location in the Sargasso Sea. The data were analyzed to assess the temperature and depth accuracies of the Sparton AXBTs. The tight-tolerance criterion was not achieved using the manufacturer's equations but may have been achieved using customized equations computed from the CTD data. The temperature data from the customized equations had a one standard deviation error of 0.13 C. A customized elapsed fall time-to-depth conversion equation was found to be z = 1.620t - 2.2384 x 10(exp -4) t(exp 2) + 1.291 x 10(exp -7) t(exp 3), with z the depth in meters and t the elapsed fall time after probe release in seconds. The standard deviation of the depth error was about 5 m; a rule of thumb for estimating maximum bounds on the depth error below 100 m could be expressed as +/-2% of depth or +/- 10 m, whichever is greater. This equation gave greater depth accuracy than either the manufacturer's supplied equation or the navy standard equation.

  15. Pinedale unit MHF experiments. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1976-10-01

    Three MHF experiments have been performed in a tight reservoir in the Northern Green River Basin at depths between 8,000 and 12,000 feet. A total of 894,190 gallons of fluid and 2,715,000 pounds of sand were pumped in three stages in two wells with the limited entry technique. Fluid viscosities were designed to give propped lengths of 1,000 to 1,500 feet and proppant sand beds having heights greater than 50 percent of the thickness of each sandstone fractured. The experiments included laboratory research to design limited entry with perforations through one and two strings of casing. Field data analysis tomore » determine fracture gradients and extent of perforation erosion has been complicated by a dependence of friction pressure in tubular goods upon sand concentration and by an apparent large variation in minimum principal in-situ stress between sandstones simultaneously fractured with the limited entry technique. A high proppant concentration was used to assure that production would be limited to reservoir characteristics, rather than fracture conductivity. Comparison was made with results of prior hydraulic fractures propped with a partial monolayer. Resulting production capacity to date has been only about one-fifth that projected in the National Gas Survey report. Evaluation of the resulting production capability and the cost of the hydraulic fracture treatmnet indicates that the stimulation technique employed is not commercially feasible at this time for the reservoir conditions tested. 10 fig, 6 tables.« less

  16. Simultaneous enhancement of sludge dewaterability and removal of sludge-borne heavy metals through a novel oxidative leaching induced by nano-CaO2.

    PubMed

    Wu, Boran; Dai, Xiaohu; Chai, Xiaoli

    2017-07-01

    The production of sewage sludge with the presence of various contaminants has been a serious issue for the operation of wastewater treatment plants on both the economical and environmental sides. To minimize the sludge volume to be handled and limit the potential environmental risk, this study developed a novel oxidative leaching process for enhanced sewage sludge dewatering and simultaneous removal of heavy metals based on nano-CaO 2 . Response surface methodology determined the following optimal conditioning parameters in terms of capillary suction time reduction: 0.0906 g/g dry solid (DS) nano-CaO 2 , 0.9969 mmol/g DS Fe 2+ , and pH of 5.59. The speciation partitioning analysis of the heavy metals pre and post nano-CaO 2 peroxidation indicated that the content of organically bound metals decreased and the percentage of soluble fraction increased substantially, which was beneficial for the removal of heavy metals through the dewatering unit. Nano-CaO 2 peroxidation could also induce the transformation of extracellular polymeric substances (EPS) from the tightly bound layers to the loosely bound layers of sewage sludge flocs. Through the decline of the Ryan-Weber constant of fluorescence titration and the pseudo-first-order kinetic constant of complexation, it was verified that the binding capacity of EPS with metal ions could be damaged by nano-CaO 2 peroxidation, which was the primary mechanism behind the substantial reduction of organically bound metals. This study is believed to provide novel insights into the application of nanotechnology in terms of the simultaneous volume and toxicity reduction of sewage sludge. Graphical abstract.

  17. Physiological strategies of co-occurring oaks in a water- and nutrient-limited ecosystem

    Treesearch

    Heidi Renninger; Nicholas Carlo; Kenneth L. Clark; Karina V.R. Schafer

    2014-01-01

    Oak species are well suited to water-limited conditions by either avoiding water stress through deep rooting or tolerating water stress through tight stomatal control. In co-occurring species where resources are limited, species may either partition resources in space and/or time or exhibit differing efficiencies in the use of limited resources. Therefore, this study...

  18. Program Manager. The Journal of the Defense Systems Management College. Volume 13, Number 4, July-August 1984,

    DTIC Science & Technology

    1984-08-01

    entrepreneurship -’team made up of J. Stanley programs for people (incentives, and innovation; stern disciplinarians; Baumgartner, Calvin Brown, training, hoopla...they let them know that they were Autonomy and Entrepreneurship important to the success of the pro- Simultaneous Loose-Tight ". ,. Every PM we talked to...account hand, managing a fast-food franchise $40,000 which is now his tax base. "-" (IRA) concept. These refreshing de- is a job that can easily be

  19. Vertical nanopillars for highly localized fluorescence imaging

    PubMed Central

    Xie, Chong; Hanson, Lindsey; Cui, Yi; Cui, Bianxiao

    2011-01-01

    Observing individual molecules in a complex environment by fluorescence microscopy is becoming increasingly important in biological and medical research, for which critical reduction of observation volume is required. Here, we demonstrate the use of vertically aligned silicon dioxide nanopillars to achieve below-the-diffraction-limit observation volume in vitro and inside live cells. With a diameter much smaller than the wavelength of visible light, a transparent silicon dioxide nanopillar embedded in a nontransparent substrate restricts the propagation of light and affords evanescence wave excitation along its vertical surface. This effect creates highly confined illumination volume that selectively excites fluorescence molecules in the vicinity of the nanopillar. We show that this nanopillar illumination can be used for in vitro single-molecule detection at high fluorophore concentrations. In addition, we demonstrate that vertical nanopillars interface tightly with live cells and function as highly localized light sources inside the cell. Furthermore, specific chemical modification of the nanopillar surface makes it possible to locally recruit proteins of interest and simultaneously observe their behavior within the complex, crowded environment of the cell. PMID:21368157

  20. Hydraulic fracture height limits and fault interactions in tight oil and gas formations

    NASA Astrophysics Data System (ADS)

    Flewelling, Samuel A.; Tymchak, Matthew P.; Warpinski, Norm

    2013-07-01

    widespread use of hydraulic fracturing (HF) has raised concerns about potential upward migration of HF fluid and brine via induced fractures and faults. We developed a relationship that predicts maximum fracture height as a function of HF fluid volume. These predictions generally bound the vertical extent of microseismicity from over 12,000 HF stimulations across North America. All microseismic events were less than 600 m above well perforations, although most were much closer. Areas of shear displacement (including faults) estimated from microseismic data were comparatively small (radii on the order of 10 m or less). These findings suggest that fracture heights are limited by HF fluid volume regardless of whether the fluid interacts with faults. Direct hydraulic communication between tight formations and shallow groundwater via induced fractures and faults is not a realistic expectation based on the limitations on fracture height growth and potential fault slip.

  1. Schematic baryon models, their tight binding description and their microwave realization

    NASA Astrophysics Data System (ADS)

    Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

    2013-12-01

    A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.

  2. Mammalian adaptation of influenza A(H7N9) virus is limited by a narrow genetic bottleneck

    PubMed Central

    Zaraket, Hassan; Baranovich, Tatiana; Kaplan, Bryan S.; Carter, Robert; Song, Min-Suk; Paulson, James C.; Rehg, Jerold E.; Bahl, Justin; Crumpton, Jeri C.; Seiler, Jon; Edmonson, Michael; Wu, Gang; Karlsson, Erik; Fabrizio, Thomas; Zhu, Huachen; Guan, Yi; Husain, Matloob; Schultz-Cherry, Stacey; Krauss, Scott; McBride, Ryan; Webster, Robert G.; Govorkova, Elena A.; Zhang, Jinghui; Russell, Charles J.; Webby, Richard J.

    2015-01-01

    Human infection with avian influenza A(H7N9) virus is associated mainly with the exposure to infected poultry. The factors that allow interspecies transmission but limit human-to-human transmission are unknown. Here we show that A/Anhui/1/2013(H7N9) influenza virus infection of chickens (natural hosts) is asymptomatic and that it generates a high genetic diversity. In contrast, diversity is tightly restricted in infected ferrets, limiting further adaptation to a fully transmissible form. Airborne transmission in ferrets is accompanied by the mutations in PB1, NP and NA genes that reduce viral polymerase and neuraminidase activity. Therefore, while A(H7N9) virus can infect mammals, further adaptation appears to incur a fitness cost. Our results reveal that a tight genetic bottleneck during avian-to-mammalian transmission is a limiting factor in A(H7N9) influenza virus adaptation to mammals. This previously unrecognized biological mechanism limiting species jumps provides a measure of adaptive potential and may serve as a risk assessment tool for pandemic preparedness. PMID:25850788

  3. A novel visual-inertial monocular SLAM

    NASA Astrophysics Data System (ADS)

    Yue, Xiaofeng; Zhang, Wenjuan; Xu, Li; Liu, JiangGuo

    2018-02-01

    With the development of sensors and computer vision research community, cameras, which are accurate, compact, wellunderstood and most importantly cheap and ubiquitous today, have gradually been at the center of robot location. Simultaneous localization and mapping (SLAM) using visual features, which is a system getting motion information from image acquisition equipment and rebuild the structure in unknown environment. We provide an analysis of bioinspired flights in insects, employing a novel technique based on SLAM. Then combining visual and inertial measurements to get high accuracy and robustness. we present a novel tightly-coupled Visual-Inertial Simultaneous Localization and Mapping system which get a new attempt to address two challenges which are the initialization problem and the calibration problem. experimental results and analysis show the proposed approach has a more accurate quantitative simulation of insect navigation, which can reach the positioning accuracy of centimeter level.

  4. Film-based delivery quality assurance for robotic radiosurgery: Commissioning and validation.

    PubMed

    Blanck, Oliver; Masi, Laura; Damme, Marie-Christin; Hildebrandt, Guido; Dunst, Jürgen; Siebert, Frank-Andre; Poppinga, Daniela; Poppe, Björn

    2015-07-01

    Robotic radiosurgery demands comprehensive delivery quality assurance (DQA), but guidelines for commissioning of the DQA method is missing. We investigated the stability and sensitivity of our film-based DQA method with various test scenarios and routine patient plans. We also investigated the applicability of tight distance-to-agreement (DTA) Gamma-Index criteria. We used radiochromic films with multichannel film dosimetry and re-calibration and our analysis was performed in four steps: 1) Film-to-plan registration, 2) Standard Gamma-Index criteria evaluation (local-pixel-dose-difference ≤2%, distance-to-agreement ≤2 mm, pass-rate ≥90%), 3) Dose distribution shift until maximum pass-rate (Maxγ) was found (shift acceptance <1 mm), and 4) Final evaluation with tight DTA criteria (≤1 mm). Test scenarios consisted of purposefully introduced phantom misalignments, dose miscalibrations, and undelivered MU. Initial method evaluation was done on 30 clinical plans. Our method showed similar sensitivity compared to the standard End-2-End-Test and incorporated an estimate of global system offsets in the analysis. The simulated errors (phantom shifts, global robot misalignment, undelivered MU) were detected by our method while standard Gamma-Index criteria often did not reveal these deviations. Dose miscalibration was not detected by film alone, hence simultaneous ion-chamber measurement for film calibration is strongly recommended. 83% of the clinical patient plans were within our tight DTA tolerances. Our presented methods provide additional measurements and quality references for film-based DQA enabling more sensitive error detection. We provided various test scenarios for commissioning of robotic radiosurgery DQA and demonstrated the necessity to use tight DTA criteria. Copyright © 2015 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  5. Dynamics of arbuscular mycorrhizal fungal community structure and functioning along a nitrogen enrichment gradient in an alpine meadow ecosystem.

    PubMed

    Jiang, Shengjing; Liu, Yongjun; Luo, Jiajia; Qin, Mingsen; Johnson, Nancy Collins; Öpik, Maarja; Vasar, Martti; Chai, Yuxing; Zhou, Xiaolong; Mao, Lin; Du, Guozhen; An, Lizhe; Feng, Huyuan

    2018-03-30

    Nitrogen (N) availability is increasing dramatically in many ecosystems, but the influence of elevated N on the functioning of arbuscular mycorrhizal (AM) fungi in natural ecosystems is not well understood. We measured AM fungal community structure and mycorrhizal function simultaneously across an experimental N addition gradient in an alpine meadow that is limited by N but not by phosphorus (P). AM fungal communities at both whole-plant-community (mixed roots) and single-plant-species (Elymus nutans roots) scales were described using pyro-sequencing, and the mycorrhizal functioning was quantified using a mycorrhizal-suppression treatment in the field (whole-plant-community scale) and a glasshouse inoculation experiment (single-plant-species scale). Nitrogen enrichment progressively reduced AM fungal abundance, changed AM fungal community composition, and shifted mycorrhizal functioning towards parasitism at both whole-plant-community and E. nutans scales. N-induced shifts in AM fungal community composition were tightly linked to soil N availability and/or plant species richness, whereas the shifts in mycorrhizal function were associated with the communities of specific AM fungal lineages. The observed changes in both AM fungal community structure and functioning across an N enrichment gradient highlight that N enrichment of ecosystems that are not P-limited can induce parasitic mycorrhizal functioning and influence plant community structure and ecosystem sustainability. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

  6. Identification of iron-regulated genes of Bifidobacterium breve UCC2003 as a basis for controlled gene expression

    PubMed Central

    Cronin, Michelle; Zomer, Aldert; Fitzgerald, Gerald; van Sinderen, Douwe

    2012-01-01

    Iron is an essential growth factor for virtually all organisms. However, iron is not readily available in most environments and microorganisms have evolved specialized mechanisms, such as the use of siderophores and high-affinity transport systems, to acquire iron when confronted with iron-limiting conditions. In general these systems are tightly regulated to prevent iron-induced toxicity and because they are quite costly to the microbe. Because of this tight regulation we chose to explore the response of Bifidobacterium breve UCC2003 to iron limitation. Through microarray and complementation analyses we identified and characterized a presumed ferrous iron uptake system, encoded by bfeUOB, from B. breve UCC2003 and exploited its regulated transcription to develop an inducible expression system for use in bifidobacteria. PMID:22179149

  7. Tightly coupled integration of ionosphere-constrained precise point positioning and inertial navigation systems.

    PubMed

    Gao, Zhouzheng; Zhang, Hongping; Ge, Maorong; Niu, Xiaoji; Shen, Wenbin; Wickert, Jens; Schuh, Harald

    2015-03-10

    The continuity and reliability of precise GNSS positioning can be seriously limited by severe user observation environments. The Inertial Navigation System (INS) can overcome such drawbacks, but its performance is clearly restricted by INS sensor errors over time. Accordingly, the tightly coupled integration of GPS and INS can overcome the disadvantages of each individual system and together form a new navigation system with a higher accuracy, reliability and availability. Recently, ionosphere-constrained (IC) precise point positioning (PPP) utilizing raw GPS observations was proven able to improve both the convergence and positioning accuracy of the conventional PPP using ionosphere-free combined observations (LC-PPP). In this paper, a new mode of tightly coupled integration, in which the IC-PPP instead of LC-PPP is employed, is implemented to further improve the performance of the coupled system. We present the detailed mathematical model and the related algorithm of the new integration of IC-PPP and INS. To evaluate the performance of the new tightly coupled integration, data of both airborne and vehicle experiments with a geodetic GPS receiver and tactical grade inertial measurement unit are processed and the results are analyzed. The statistics show that the new approach can further improve the positioning accuracy compared with both IC-PPP and the tightly coupled integration of the conventional PPP and INS.

  8. Paracellular tightness and the functional expression of efflux transporters P-gp and BCRP in bEnd3 cells.

    PubMed

    Yang, Shu; Jin, Hong; Zhao, Zhigang

    2018-04-23

    Objective The blood-brain barrier (BBB), regulating brain homeostasis and limiting the entry of most drugs, is characterized by intercellular tight junctions and the presence of transporters. In this study, the paracellular tightness and functional expression of efflux transporters P-glycoprotein (P-gp) and breast cancer resistance protein (BCRP) were evaluated in mouse brain immortalized cell line bEnd3 to prove it as a useful BBB-mimicking system for biological and pharmacological research. Methods The presence of P-gp, BCRP and tight junction proteins occludin, claudin-5 and ZO-1 were validated by RT-PCR and Western blot. The tightness of bEnd3 monolayers was evaluated by measuring the permeability of hydrophilic marker Lucifer yellow. The P-gp functionality was identified by intracellular uptake assay using Rhodamine 123 (R123) as P-gp substrate and verapamil as P-gp inhibitor. The BCRP functionality was identified by flow cytometric analysis of mitoxantrone accumulation and fluorescence microscopic analysis of Hoechst 33342 accumulation using Ko-143 as BCRP inhibitor. Results The bEnd3 cells demonstrated the expression of P-gp, BCRP and tight junction proteins occludin, claudin-5 and ZO-1 at mRNA and protein levels. The permeability coefficient of Lucifer yellow was 1.3 ± 0.13 × 10 -3  cm/min, indicating the moderate paracellular tightness barrier formed by bEnd3 cells. The verapamil induced a higher cellular uptake of Rhodamine 123, and Ko-143 significantly elevated cellular accumulation of mitoxantrone and Hoechst 33342, suggesting the P-gp and BCRP functionality shown by bEnd3 cells. Conclusions The bEnd3 cell line represents a useful in vitro tool for studying BBB characteristics and drug transport mechanisms at the BBB.

  9. Adaptive strategy for joint measurements

    NASA Astrophysics Data System (ADS)

    Uola, Roope; Luoma, Kimmo; Moroder, Tobias; Heinosaari, Teiko

    2016-08-01

    We develop a technique to find simultaneous measurements for noisy quantum observables in finite-dimensional Hilbert spaces. We use the method to derive lower bounds for the noise needed to make incompatible measurements jointly measurable. Using our strategy together with recent developments in the field of one-sided quantum information processing we show that the attained lower bounds are tight for various symmetric sets of quantum measurements. We use this characterisation to prove the existence of so called 4-Specker sets, i.e. sets of four incompatible observables with compatible subsets in the qubit case.

  10. Accurate modeling of defects in graphene transport calculations

    NASA Astrophysics Data System (ADS)

    Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

    2018-01-01

    We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.

  11. Expression patterns of tight junction components induced by CD24 in an oral epithelial cell-culture model correlated to affected periodontal tissues.

    PubMed

    Ye, P; Yu, H; Simonian, M; Hunter, N

    2014-04-01

    Previously we demonstrated uniformly strong expression of CD24 in the epithelial attachment to the tooth and in the migrating epithelium of the periodontitis lesion. Titers of serum antibodies autoreactive with CD24 peptide correlated with reduced severity of periodontal disease. Ligation of CD24 expressed by oral epithelial cells induced formation of tight junctions that limited paracellular diffusion. In this study, we aimed to reveal that the lack of uniform expression of tight junction components in the pocket epithelium of periodontitis lesions is likely to contribute to increased paracellular permeability to bacterial products. This is proposed as a potential driver of the immunopathology of periodontitis. An epithelial culture model with close correspondence for expression patterns for tight junction components in periodontal epithelia was used. Immunohistochemical staining and confocal laser scanning microscopy were used to analyse patterns of expression of gingival epithelial tight junction components. The minimally inflamed gingival attachment was characterized by uniformly strong staining at cell contacts for the tight junction components zona occludens-1, zona occludens-2, occludin, junction adhesion molecule-A, claudin-4 and claudin-15. In contrast, the pocket epithelium of the periodontal lesion showed scattered, uneven staining for these components. This pattern correlated closely with that of unstimulated oral epithelial cells in culture. Following ligation of CD24 expressed by these cells, the pattern of tight junction component expression of the minimally inflamed gingival attachment developed rapidly. There was evidence for non-uniform and focal expression only of tight junction components in the pocket epithelium. In the cell-culture model, ligation of CD24 induced a tight junction expression profile equivalent to that observed for the minimally inflamed gingival attachment. Ligation of CD24 expressed by gingival epithelial cells by lectin-like receptors of commensal oral streptococci could mediate the phenotype of health, whereas pathogenic organisms associated with periodontal disease might not signal effectively through CD24. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Tactile cues significantly modulate the perception of sweat-induced skin wetness independently of the level of physical skin wetness

    PubMed Central

    Fournet, Damien; Hodder, Simon; Havenith, George

    2015-01-01

    Humans sense the wetness of a wet surface through the somatosensory integration of thermal and tactile inputs generated by the interaction between skin and moisture. However, little is known on how wetness is sensed when moisture is produced via sweating. We tested the hypothesis that, in the absence of skin cooling, intermittent tactile cues, as coded by low-threshold skin mechanoreceptors, modulate the perception of sweat-induced skin wetness, independently of the level of physical wetness. Ten males (22 yr old) performed an incremental exercise protocol during two trials designed to induce the same physical skin wetness but to induce lower (TIGHT-FIT) and higher (LOOSE-FIT) wetness perception. In the TIGHT-FIT, a tight-fitting clothing ensemble limited intermittent skin-sweat-clothing tactile interactions. In the LOOSE-FIT, a loose-fitting ensemble allowed free skin-sweat-clothing interactions. Heart rate, core and skin temperature, galvanic skin conductance (GSC), and physical (wbody) and perceived skin wetness were recorded. Exercise-induced sweat production and physical wetness increased significantly [GSC: 3.1 μS, SD 0.3 to 18.8 μS, SD 1.3, P < 0.01; wbody: 0.26 no-dimension units (nd), SD 0.02, to 0.92 nd, SD 0.01, P < 0.01], with no differences between TIGHT-FIT and LOOSE-FIT (P > 0.05). However, the limited intermittent tactile inputs generated by the TIGHT-FIT ensemble reduced significantly whole-body and regional wetness perception (P < 0.01). This reduction was more pronounced when between 40 and 80% of the body was covered in sweat. We conclude that the central integration of intermittent mechanical interactions between skin, sweat, and clothing, as coded by low-threshold skin mechanoreceptors, significantly contributes to the ability to sense sweat-induced skin wetness. PMID:25878153

  13. 46 CFR 197.555 - Personal protective clothing and equipment.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... SAFETY AND HEALTH STANDARDS GENERAL PROVISIONS Benzene § 197.555 Personal protective clothing and..., tight-fitting eye goggles to limit dermal exposure to, and prevent eye contact with, liquid benzene. ...

  14. 46 CFR 197.555 - Personal protective clothing and equipment.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... SAFETY AND HEALTH STANDARDS GENERAL PROVISIONS Benzene § 197.555 Personal protective clothing and..., tight-fitting eye goggles to limit dermal exposure to, and prevent eye contact with, liquid benzene. ...

  15. 46 CFR 197.555 - Personal protective clothing and equipment.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... SAFETY AND HEALTH STANDARDS GENERAL PROVISIONS Benzene § 197.555 Personal protective clothing and..., tight-fitting eye goggles to limit dermal exposure to, and prevent eye contact with, liquid benzene. ...

  16. 7 CFR 305.1 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... unregistered use of a pesticide for a limited time. Vacuum fumigation. Fumigation performed in a gas-tight... in air and is toxic to the target organism. Fumigation. Releasing and dispersing a toxic chemical in...

  17. 7 CFR 305.1 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... unregistered use of a pesticide for a limited time. Vacuum fumigation. Fumigation performed in a gas-tight... in air and is toxic to the target organism. Fumigation. Releasing and dispersing a toxic chemical in...

  18. Multifocal laser surgery: cutting enhancement by hydrodynamic interactions between cavitation bubbles.

    PubMed

    Toytman, I; Silbergleit, A; Simanovski, D; Palanker, D

    2010-10-01

    Transparent biological tissues can be precisely dissected with ultrafast lasers using optical breakdown in the tight focal zone. Typically, tissues are cut by sequential application of pulses, each of which produces a single cavitation bubble. We investigate the hydrodynamic interactions between simultaneous cavitation bubbles originating from multiple laser foci. Simultaneous expansion and collapse of cavitation bubbles can enhance the cutting efficiency, by increasing the resulting deformations in tissue, and the associated rupture zone. An analytical model of the flow induced by the bubbles is presented and experimentally verified. The threshold strain of the material rupture is measured in a model tissue. Using the computational model and the experimental value of the threshold strain one can compute the shape of the rupture zone in tissue resulting from application of multiple bubbles. With the threshold strain of 0.7 two simultaneous bubbles produce a continuous cut when applied at the distance 1.35 times greater than that required in sequential approach. Simultaneous focusing of the laser in multiple spots along the line of intended cut can extend this ratio to 1.7. Counterpropagating jets forming during collapse of two bubbles in materials with low viscosity can further extend the cutting zone-up to approximately a factor of 1.5.

  19. Breaking mean-motion resonances during Type I planet migration

    NASA Astrophysics Data System (ADS)

    Hands, T. O.; Alexander, R. D.

    2018-03-01

    We present 2D hydrodynamical simulations of pairs of planets migrating simultaneously in the Type I regime in a protoplanetary disc. Convergent migration naturally leads to the trapping of these planets in mean-motion resonances. Once in resonance the planets' eccentricity grows rapidly, and disc-planet torques cause the planets to escape resonance on a time-scale of a few hundred orbits. The effect is more pronounced in highly viscous discs, but operates efficiently even in inviscid discs. We attribute this resonance-breaking to overstable librations driven by moderate eccentricity damping, but find that this mechanism operates differently in hydrodynamic simulations than in previous analytic calculations. Planets escaping resonance in this manner can potentially explain the observed paucity of resonances in Kepler multitransiting systems, and we suggest that simultaneous disc-driven migration remains the most plausible means of assembling tightly packed planetary systems.

  20. Scanning holographic optical tweezers.

    PubMed

    Shaw, L A; Panas, Robert M; Spadaccini, C M; Hopkins, J B

    2017-08-01

    The aim of this Letter is to introduce a new optical tweezers approach, called scanning holographic optical tweezers (SHOT), which drastically increases the working area (WA) of the holographic-optical tweezers (HOT) approach, while maintaining tightly focused laser traps. A 12-fold increase in the WA is demonstrated. The SHOT approach achieves its utility by combining the large WA of the scanning optical tweezers (SOT) approach with the flexibility of the HOT approach for simultaneously moving differently structured optical traps in and out of the focal plane. This Letter also demonstrates a new heuristic control algorithm for combining the functionality of the SOT and HOT approaches to efficiently allocate the available laser power among a large number of traps. The proposed approach shows promise for substantially increasing the number of particles that can be handled simultaneously, which would enable optical tweezers additive fabrication technologies to rapidly assemble microgranular materials and structures in reasonable build times.

  1. Allocation of attention during pursuit of large objects is no different than during fixation.

    PubMed

    Watamaniuk, Scott N J; Heinen, Stephen J

    2015-01-01

    Attention allocation during pursuit of a spot is usually characterized as asymmetric with more attention placed ahead of the target than behind it. However, attention is symmetrically allocated across larger pursuit stimuli. An unresolved issue is how tightly attention is constrained on large stimuli during pursuit. Although some work shows it is tightly locked to the fovea, other work shows it is allocated flexibly. To investigate this, we had observers perform a character identification task on large pursuit stimuli composed of arrays of five, nine, or 15 characters spaced between 0.6° and 4.0° apart. Initially, the characters were identical, but at a random time, they all changed briefly, rendering one of them unique. Observers identified the unique character. Consistent with previous literature, attention appeared narrow and symmetric around the pursuit target for tightly spaced (0.6°) characters. Increasing spacing dramatically expanded the attention scope, presumably by mitigating crowding. However, when we controlled for crowding, performance was limited by set size, suffering more for eccentric targets. Interestingly, the same limitations on attention allocation were observed with stationary and pursued stimuli-evidence that attention operates similarly during fixation and pursuit of a stimulus that extends into the periphery. The results suggest that attention is flexibly allocated during pursuit, but performance is limited by crowding and set size. In addition, performing the identification task did not hurt pursuit performance, further evidence that pursuit of large stimuli is relatively inattentive.

  2. Interactive Learning with Java Applets: Using Interactive, Web-Based Java Applets to Present Science in a Concrete, Meaningful Manner

    ERIC Educational Resources Information Center

    Corder, Greg

    2005-01-01

    Science teachers face challenges that affect the quality of instruction. Tight budgets, limited resources, school schedules, and other obstacles limit students' opportunities to experience science that is visual and interactive. Incorporating web-based Java applets into science instruction offers a practical solution to these challenges. The…

  3. Robust Weighted Sum Harvested Energy Maximization for SWIPT Cognitive Radio Networks Based on Particle Swarm Optimization.

    PubMed

    Tuan, Pham Viet; Koo, Insoo

    2017-10-06

    In this paper, we consider multiuser simultaneous wireless information and power transfer (SWIPT) for cognitive radio systems where a secondary transmitter (ST) with an antenna array provides information and energy to multiple single-antenna secondary receivers (SRs) equipped with a power splitting (PS) receiving scheme when multiple primary users (PUs) exist. The main objective of the paper is to maximize weighted sum harvested energy for SRs while satisfying their minimum required signal-to-interference-plus-noise ratio (SINR), the limited transmission power at the ST, and the interference threshold of each PU. For the perfect channel state information (CSI), the optimal beamforming vectors and PS ratios are achieved by the proposed PSO-SDR in which semidefinite relaxation (SDR) and particle swarm optimization (PSO) methods are jointly combined. We prove that SDR always has a rank-1 solution, and is indeed tight. For the imperfect CSI with bounded channel vector errors, the upper bound of weighted sum harvested energy (WSHE) is also obtained through the S-Procedure. Finally, simulation results demonstrate that the proposed PSO-SDR has fast convergence and better performance as compared to the other baseline schemes.

  4. A high-resolution, confocal laser-scanning microscope and flash photolysis system for physiological studies.

    PubMed

    Parker, I; Callamaras, N; Wier, W G

    1997-06-01

    We describe the construction of a high-resolution confocal laser-scanning microscope, and illustrate its use for studying elementary Ca2+ signalling events in cells. An avalanche photodiode module and simple optical path provide a high efficiency system for detection of fluorescence signals, allowing use of a small confocal aperture giving near diffraction-limited spatial resolution (< 300 nm lateral and < 400 nm axial). When operated in line-scan mode, the maximum temporal resolution is 1 ms, and the associated computer software allows complete flexibility to record line-scans continuously for long (minutes) periods or to obtain any desired pixel resolution in x-y scans. An independent UV irradiation system permits simultaneous photolysis of caged compounds over either a uniform, wide field (arc lamp source) or at a tightly focussed spot (frequency-tripled Nd:YAG laser). The microscope thus provides a versatile tool for optical studies of dynamic cellular processes, as well as excellent resolution for morphological studies. The confocal scanner can be added to virtually any inverted microscope for a component cost that is only a small fraction of that of comparable commercial instruments, yet offers better performance and greater versatility.

  5. Metabolic Recruitment and Directed Evolution of Nucleoside Triphosphate Uptake in Escherichia coli.

    PubMed

    Pezo, Valérie; Hassan, Camille; Louis, Dominique; Sargueil, Bruno; Herdewijn, Piet; Marlière, Philippe

    2018-05-18

    We report the design and elaboration of a selection protocol for importing a canonical substrate of DNA polymerase, thymidine triphosphate (dTTP) in Escherichia coli. Bacterial strains whose growth depend on dTTP uptake, through the action of an algal plastid transporter expressed from a synthetic gene inserted in the chromosome, were constructed and shown to withstand the simultaneous loss of thymidylate synthase and thymidine kinase. Such thyA tdk dual deletant strains provide an experimental model of tight nutritional containment for preventing dissemination of microbial GMOs. Our strains transported the four canonical dNTPs, in the following order of preference: dCTP > dATP ≥ dGTP > dTTP. Prolonged cultivation under limitation of exogenous dTTP led to the enhancement of dNTP transport by adaptive evolution. We investigated the uptake of dCTP analogues with altered sugar or nucleobase moieties, which were found to cause a loss of cell viability and an increase of mutant frequency, respectively. E. coli strains equipped with nucleoside triphosphate transporters should be instrumental for evolving organisms whose DNA genome is morphed chemically by fully substituting its canonical nucleotide components.

  6. Tightly Coupled Integration of Ionosphere-Constrained Precise Point Positioning and Inertial Navigation Systems

    PubMed Central

    Gao, Zhouzheng; Zhang, Hongping; Ge, Maorong; Niu, Xiaoji; Shen, Wenbin; Wickert, Jens; Schuh, Harald

    2015-01-01

    The continuity and reliability of precise GNSS positioning can be seriously limited by severe user observation environments. The Inertial Navigation System (INS) can overcome such drawbacks, but its performance is clearly restricted by INS sensor errors over time. Accordingly, the tightly coupled integration of GPS and INS can overcome the disadvantages of each individual system and together form a new navigation system with a higher accuracy, reliability and availability. Recently, ionosphere-constrained (IC) precise point positioning (PPP) utilizing raw GPS observations was proven able to improve both the convergence and positioning accuracy of the conventional PPP using ionosphere-free combined observations (LC-PPP). In this paper, a new mode of tightly coupled integration, in which the IC-PPP instead of LC-PPP is employed, is implemented to further improve the performance of the coupled system. We present the detailed mathematical model and the related algorithm of the new integration of IC-PPP and INS. To evaluate the performance of the new tightly coupled integration, data of both airborne and vehicle experiments with a geodetic GPS receiver and tactical grade inertial measurement unit are processed and the results are analyzed. The statistics show that the new approach can further improve the positioning accuracy compared with both IC-PPP and the tightly coupled integration of the conventional PPP and INS. PMID:25763647

  7. Nanofiltration and Tight Ultrafiltration Membranes for Natural Organic Matter Removal—Contribution of Fouling and Concentration Polarization to Filtration Resistance

    PubMed Central

    Winter, Joerg; Bérubé, Pierre

    2017-01-01

    Nanofiltration (NF) and tight ultrafiltration (tight UF) membranes are a viable treatment option for high quality drinking water production from sources with high concentrations of contaminants. To date, there is limited knowledge regarding the contribution of concentration polarization (CP) and fouling to the increase in resistance during filtration of natural organic matter (NOM) with NF and tight UF. Filtration tests were conducted with NF and tight UF membranes with molecular weight cut offs (MWCOs) of 300, 2000 and 8000 Da, and model raw waters containing different constituents of NOM. When filtering model raw waters containing high concentrations of polysaccharides (i.e., higher molecular weight NOM), the increase in resistance was dominated by fouling. When filtering model raw waters containing humic substances (i.e., lower molecular weight NOM), the increase in filtration resistance was dominated by CP. The results indicate that low MWCO membranes are better suited for NOM removal, because most of the NOM in surface waters consist mainly of humic substances, which were only effectively rejected by the lower MWCO membranes. However, when humic substances are effectively rejected, CP can become extensive, leading to a significant increase in filtration resistance by the formation of a cake/gel layer at the membrane surface. For this reason, cross-flow operation, which reduces CP, is recommended. PMID:28671604

  8. The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

    NASA Astrophysics Data System (ADS)

    Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

    2017-05-01

    We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.

  9. Quantum correlations are tightly bound by the exclusivity principle.

    PubMed

    Yan, Bin

    2013-06-28

    It is a fundamental problem in physics of what principle limits the correlations as predicted by our current description of nature, based on quantum mechanics. One possible explanation is the "global exclusivity" principle recently discussed in Phys. Rev. Lett. 110, 060402 (2013). In this work we show that this principle actually has a much stronger restriction on the probability distribution. We provide a tight constraint inequality imposed by this principle and prove that this principle singles out quantum correlations in scenarios represented by any graph. Our result implies that the exclusivity principle might be one of the fundamental principles of nature.

  10. Achieving Adherence to Evidence-Based Practices: Are Health IT and Hospital-Physician Integration Complementary or Substitutive Strategies?

    PubMed

    Everson, Jordan; Lee, Shoou-Yih Daniel; Adler-Milstein, Julia

    2016-12-01

    In response to evolving policies and conditions, hospitals have increased health information technology (HIT) adoption and strived to improve hospital-physician integration. While evidence suggests that both HIT and integration confer independent benefits, when combined, they may provide complementary means to achieve high performance or overlap to offset each other's contribution. We explore this relationship in the context of hospital adherence to evidence-based practices (EBPs). Using the American Hospital Association's Annual and IT Supplement surveys, and Centers for Medicare and Medicaid Services's Hospital Compare, we estimate the independent relationships and interactions between HIT and hospital-physician integration with respect to EBP adherence. HIT adoption and tight (but not loose) integration are independently associated with greater adherence to EBPs. The interaction between HIT adoption and tight integration is negative, consistent with an offsetting association between HIT adoption and integration in their relationship to EBP adherence. This finding reveals the need to be aware of potential substitutive effects from simultaneous pursuit of multiple approaches to performance improvement. © The Author(s) 2016.

  11. Role of mTOR in podocyte function and diabetic nephropathy in humans and mice

    PubMed Central

    Gödel, Markus; Hartleben, Björn; Herbach, Nadja; Liu, Shuya; Zschiedrich, Stefan; Lu, Shun; Debreczeni-Mór, Andrea; Lindenmeyer, Maja T.; Rastaldi, Maria-Pia; Hartleben, Götz; Wiech, Thorsten; Fornoni, Alessia; Nelson, Robert G.; Kretzler, Matthias; Wanke, Rüdiger; Pavenstädt, Hermann; Kerjaschki, Dontscho; Cohen, Clemens D.; Hall, Michael N.; Rüegg, Markus A.; Inoki, Ken; Walz, Gerd; Huber, Tobias B.

    2011-01-01

    Chronic glomerular diseases, associated with renal failure and cardiovascular morbidity, represent a major health issue. However, they remain poorly understood. Here we have reported that tightly controlled mTOR activity was crucial to maintaining glomerular podocyte function, while dysregulation of mTOR facilitated glomerular diseases. Genetic deletion of mTOR complex 1 (mTORC1) in mouse podocytes induced proteinuria and progressive glomerulosclerosis. Furthermore, simultaneous deletion of both mTORC1 and mTORC2 from mouse podocytes aggravated the glomerular lesions, revealing the importance of both mTOR complexes for podocyte homeostasis. In contrast, increased mTOR activity accompanied human diabetic nephropathy, characterized by early glomerular hypertrophy and hyperfiltration. Curtailing mTORC1 signaling in mice by genetically reducing mTORC1 copy number in podocytes prevented glomerulosclerosis and significantly ameliorated the progression of glomerular disease in diabetic nephropathy. These results demonstrate the requirement for tightly balanced mTOR activity in podocyte homeostasis and suggest that mTOR inhibition can protect podocytes and prevent progressive diabetic nephropathy. PMID:21606591

  12. Deoxynivalenol affects in vitro intestinal epithelial cell barrier integrity through inhibition of protein synthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van De Walle, Jacqueline; Sergent, Therese; Piront, Neil

    Deoxynivalenol (DON), one of the most common mycotoxin contaminants of raw and processed cereal food, adversely affects the gastrointestinal tract. Since DON acts as a protein synthesis inhibitor, the constantly renewing intestinal epithelium could be particularly sensitive to DON. We analyzed the toxicological effects of DON on intestinal epithelial protein synthesis and barrier integrity. Differentiated Caco-2 cells, as a widely used model of the human intestinal barrier, were exposed to realistic intestinal concentrations of DON (50, 500 and 5000 ng/ml) during 24 h. DON caused a concentration-dependent decrease in total protein content associated with a reduction in the incorporation ofmore » [{sup 3}H]-leucine, demonstrating its inhibitory effect on protein synthesis. DON simultaneously increased the paracellular permeability of the monolayer as reflected through a decreased transepithelial electrical resistance associated with an increased paracellular flux of the tracer [{sup 3}H]-mannitol. A concentration-dependent reduction in the expression level of the tight junction constituent claudin-4 was demonstrated by Western blot, which was not due to diminished transcription, increased degradation, or NF-{kappa}B, ERK or JNK activation, and was also observed for a tight junction independent protein, i.e. intestinal alkaline phosphatase. These results demonstrate a dual toxicological effect of DON on differentiated Caco-2 cells consisting in an inhibition of protein synthesis as well as an increase in monolayer permeability, and moreover suggest a possible link between them through diminished synthesis of the tight junction constituent claudin-4.« less

  13. Cellular thermosetting fluoropolymers and process for making them

    NASA Technical Reports Server (NTRS)

    Lee, Sheng Y.

    1988-01-01

    Thermosetting fluoropolymer foams are made by mixing fluid from thermosetting fluoropolymer components having a substantial fluoride content, placing the mixture in a pressure tight chamber, filling the chamber with a gas, at a relatively low pressure, that is unreactive with the fluoropolymer components, allowing the mixture to gel, removing the gelled fluoropolymer from the chamber and therafter heating the fluoropolymer at a relatively low temperature to simultaneously cure and foam the fluoropolymer. The resulting fluoropolymer product is closed celled with the cells storing the gas employed for foaming. The fluoropolymer resins employed may be any thermosetting fluoropolymer including fluoroepoxies, fluoropolyurethanes and fluoroacrylates.

  14. Cellular thermosetting fluorodiepoxide polymers

    NASA Technical Reports Server (NTRS)

    Lee, Sheng Y. (Inventor)

    1989-01-01

    Thermosetting fluoropolymer foams are made by mixing fluid form thermosetting fluoropolymer components having a substantial fluorine content, placing the mixture in a pressure tight chamber, filling the chamber with a gas, at relatively low pressure, that is unreactive with the fluoropolymer components, allowing the mixture to gel, removing the gelled fluoropolymer from the chamber and thereafter heating the fluoropolymer at a relatively low temperature to simultaneously sure and foam the fluoropolymer. The resulting fluoropolymer product is closed celled with the cells storing the gas employed for foaming. The fluoropolymer resins employed may be any thermosetting fluoropolymer including fluoroepoxies, fluoropolyurethanes and fluoroacrylates.

  15. Density control in ITER: an iterative learning control and robust control approach

    NASA Astrophysics Data System (ADS)

    Ravensbergen, T.; de Vries, P. C.; Felici, F.; Blanken, T. C.; Nouailletas, R.; Zabeo, L.

    2018-01-01

    Plasma density control for next generation tokamaks, such as ITER, is challenging because of multiple reasons. The response of the usual gas valve actuators in future, larger fusion devices, might be too slow for feedback control. Both pellet fuelling and the use of feedforward-based control may help to solve this problem. Also, tight density limits arise during ramp-up, due to operational limits related to divertor detachment and radiative collapses. As the number of shots available for controller tuning will be limited in ITER, in this paper, iterative learning control (ILC) is proposed to determine optimal feedforward actuator inputs based on tracking errors, obtained in previous shots. This control method can take the actuator and density limits into account and can deal with large actuator delays. However, a purely feedforward-based density control may not be sufficient due to the presence of disturbances and shot-to-shot differences. Therefore, robust control synthesis is used to construct a robustly stabilizing feedback controller. In simulations, it is shown that this combined controller strategy is able to achieve good tracking performance in the presence of shot-to-shot differences, tight constraints, and model mismatches.

  16. Tightening Quantum Speed Limits for Almost All States.

    PubMed

    Campaioli, Francesco; Pollock, Felix A; Binder, Felix C; Modi, Kavan

    2018-02-09

    Conventional quantum speed limits perform poorly for mixed quantum states: They are generally not tight and often significantly underestimate the fastest possible evolution speed. To remedy this, for unitary driving, we derive two quantum speed limits that outperform the traditional bounds for almost all quantum states. Moreover, our bounds are significantly simpler to compute as well as experimentally more accessible. Our bounds have a clear geometric interpretation; they arise from the evaluation of the angle between generalized Bloch vectors.

  17. Pharmaceutical Activation or Genetic Absence of ClC-2 Alters Tight Junctions During Experimental Colitis.

    PubMed

    Jin, Younggeon; Pridgen, Tiffany A; Blikslager, Anthony T

    2015-12-01

    We have previously reported that the ClC-2 chloride channel has an important role in regulation of tight junction barrier function during experimental colitis, and the pharmaceutical ClC-2 activator lubiprostone initiates intestinal barrier repair in ischemic-injured intestine. Thus, we hypothesized that pharmaceutical ClC-2 activation would have a protective and therapeutic effect in murine models of colitis, which would be absent in ClC-2 mice. We administered lubiprostone to wild-type or ClC-2 mice with dextran sulfate sodium (DSS) or 2, 4, 5-trinitrobenzene sulfonic acid-induced colitis. We determined the severity of colitis and assessed intestinal permeability. Selected tight junction proteins were analyzed by Western blotting and immunofluorescence/confocal microscopy, whereas proliferative and differentiated cells were examined with special staining and immunohistochemistry. Oral preventive or therapeutic administration of lubiprostone significantly reduced the severity of colitis and reduced intestinal permeability in both DSS and trinitrobenzene sulfonic acid-induced colitis. Preventive treatment with lubiprostone induced significant recovery of the expression and distribution of selected sealing tight junction proteins in mice with DSS-induced colitis. In addition, lubiprostone reduced crypt proliferation and increased the number of differentiated epithelial cells. Alternatively, when lubiprostone was administered to ClC-2 mice, the protective effect against DSS colitis was limited. This study suggests a central role for ClC-2 in restoration of barrier function and tight junction architecture in experimental murine colitis, which can be therapeutically targeted with lubiprostone.

  18. Notes on the uwainat oil rim development, Maydan Mahzam and Bul Hanine Fields, offshore Qatar

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamam, K.A.

    As a result of reservoir simulation studies of the Uwainat reservoirs (Maydan Mahzam and Bul Hanine Fields), drilling to the Uwainat oil rim target became very ''tight'' with a very limited vertical tolerance. To achieve drilling to the tight target requires a precise position of the well at the top of the Lower Arab IV reservoir (a reliable marker) and an accurate isochore of the Lower Arab IV - Uwainat. The discussion shows that the level of accuracy needed in determining both the actual subsea well position and in constructing the depth contours of the reservoirs is extremely high.

  19. Simultaneous inhibition of key growth pathways in melanoma cells and tumor regression by a designed bidentate constrained helical peptide.

    PubMed

    Dhar, Amlanjyoti; Mallick, Shampa; Ghosh, Piya; Maiti, Atanu; Ahmed, Israr; Bhattacharya, Seemana; Mandal, Tapashi; Manna, Asit; Roy, Koushik; Singh, Sandeep; Nayak, Dipak Kumar; Wilder, Paul T; Markowitz, Joseph; Weber, David; Ghosh, Mrinal K; Chattopadhyay, Samit; Guha, Rajdeep; Konar, Aditya; Bandyopadhyay, Santu; Roy, Siddhartha

    2014-07-01

    Protein-protein interactions are part of a large number of signaling networks and potential targets for drug development. However, discovering molecules that can specifically inhibit such interactions is a major challenge. S100B, a calcium-regulated protein, plays a crucial role in the proliferation of melanoma cells through protein-protein interactions. In this article, we report the design and development of a bidentate conformationally constrained peptide against dimeric S100B based on a natural tight-binding peptide, TRTK-12. The helical conformation of the peptide was constrained by the substitution of α-amino isobutyric acid--an amino acid having high helical propensity--in positions which do not interact with S100B. A branched bidentate version of the peptide was bound to S100B tightly with a dissociation constant of 8 nM. When conjugated to a cell-penetrating peptide, it caused growth inhibition and rapid apoptosis in melanoma cells. The molecule exerts antiproliferative action through simultaneous inhibition of key growth pathways, including reactivation of wild-type p53 and inhibition of Akt and STAT3 phosphorylation. The apoptosis induced by the bidentate constrained helix is caused by direct migration of p53 to mitochondria. At moderate intravenous dose, the peptide completely inhibits melanoma growth in a mouse model without any significant observable toxicity. The specificity was shown by lack of ability of a double mutant peptide to cause tumor regression at the same dose level. The methodology described here for direct protein-protein interaction inhibition may be effective for rapid development of inhibitors against relatively weak protein-protein interactions for de novo drug development. © 2014 Wiley Periodicals, Inc.

  20. Polychlorinated biphenyls impair blood-brain barrier integrity via disruption of tight junction proteins in cerebrum, cerebellum and hippocampus of female Wistar rats: neuropotential role of quercetin.

    PubMed

    Selvakumar, K; Prabha, R Lakshmi; Saranya, K; Bavithra, S; Krishnamoorthy, G; Arunakaran, J

    2013-07-01

    Polychlorinated biphenyls (PCBs) comprise a ubiquitous class of toxic substances associated with carcinogenic and tumor-promoting effects as well as neurotoxic properties. Reactive oxygen species, which is produced from PCBs, alters blood-brain barrier (BBB) integrity, which is paralleled by cytoskeletal rearrangements and redistribution and disappearance of tight junction proteins (TJPs) like claudin-5 and occludin. Quercetin, a potent antioxidant present in onion and other vegetables, appears to protect brain cells against oxidative stress, a tissue-damaging process associated with Alzheimer's and other neurodegenerative disorders. The aim of this study is to analyze the role of quercetin on oxidative stress markers and transcription of transmembrane and cytoplasmic accessory TJPs on cerebrum, cerebellum and hippocampus of female rats exposed to PCBs. Rats were divided into the following four groups. Group I: received only vehicle (corn oil) intraperitoneally (i.p.); group II: received Aroclor 1254 at a dose of 2 mg/kg body weight (bwt)/day (i.p); group III: received Aroclor 1254 (i.p.) and simultaneously quercetin 50 mg/kg bwt/day through gavage and group IV: received quercetin alone gavage. From the experiment, the levels of hydrogen peroxide, lipid peroxidation and thiobarbituric acid reactive substances were observed to increase significantly in cerebrum, cerebellum and hippocampus as 50%, 25% and 20%, respectively, after exposure to PCB, and the messenger RNA expression of TJP in rats exposed to PCBs is decreased and is retrieved to the normal level simultaneously in quercetin-treated rats. Hence, quercetin can be used as a preventive medicine to PCBs exposure and prevents neurodegenerative disorders.

  1. 40 CFR 65.85 - Procedures.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... permit limit applicable to the process vent. (4) Design analysis based on accepted chemical engineering principles, measurable process parameters, or physical or chemical laws or properties. (5) All data... tested for vapor tightness. (b) Engineering assessment. Engineering assessment to determine if a vent...

  2. 40 CFR 65.85 - Procedures.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... permit limit applicable to the process vent. (4) Design analysis based on accepted chemical engineering principles, measurable process parameters, or physical or chemical laws or properties. (5) All data... tested for vapor tightness. (b) Engineering assessment. Engineering assessment to determine if a vent...

  3. 40 CFR 65.85 - Procedures.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... permit limit applicable to the process vent. (4) Design analysis based on accepted chemical engineering principles, measurable process parameters, or physical or chemical laws or properties. (5) All data... tested for vapor tightness. (b) Engineering assessment. Engineering assessment to determine if a vent...

  4. 40 CFR 65.85 - Procedures.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... permit limit applicable to the process vent. (4) Design analysis based on accepted chemical engineering principles, measurable process parameters, or physical or chemical laws or properties. (5) All data... tested for vapor tightness. (b) Engineering assessment. Engineering assessment to determine if a vent...

  5. 40 CFR 65.85 - Procedures.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... permit limit applicable to the process vent. (4) Design analysis based on accepted chemical engineering principles, measurable process parameters, or physical or chemical laws or properties. (5) All data... tested for vapor tightness. (b) Engineering assessment. Engineering assessment to determine if a vent...

  6. Maximum likelihood decoding analysis of accumulate-repeat-accumulate codes

    NASA Technical Reports Server (NTRS)

    Abbasfar, A.; Divsalar, D.; Yao, K.

    2004-01-01

    In this paper, the performance of the repeat-accumulate codes with (ML) decoding are analyzed and compared to random codes by very tight bounds. Some simple codes are shown that perform very close to Shannon limit with maximum likelihood decoding.

  7. Tight focusing properties of the azimuthal discrete phase modulated radially polarized LG11* beam

    NASA Astrophysics Data System (ADS)

    Zhao, Jiang; Li, Bo; Zhao, Heng; Hu, Yi; Wang, Wenjin; Wang, Youqing

    2013-06-01

    An novel method for generating an annual periodic optical chain by tight focusing the rotational symmetric π/0 phase plate modulated first order radially polarized Laguerre Gaussian (LG11*) beam with a high-NA lens is proposed. The optical chain is composed of either bright spots or dark spots. Vector diffraction numerical calculation method is employed to analyze the tight focus properties. The analyses indicate that the properties of the optical chains are closely related to the number of phase plate sectors, beam width of radially polarized LG11* beam and the numerical aperture of focusing lens. Furthermore, the average Full Width at Half Maximum (FWHM) of hollow dark spots or bright spots in optical chain is breaking the diffraction limit. These kinds of annular optical chains are expected to be applied in trapping or arranging multiple bar-like micro particles whose refractive index are either higher or lower than that of the ambient.

  8. Transversal Fluctuations of the ASEP, Stochastic Six Vertex Model, and Hall-Littlewood Gibbsian Line Ensembles

    NASA Astrophysics Data System (ADS)

    Corwin, Ivan; Dimitrov, Evgeni

    2018-05-01

    We consider the ASEP and the stochastic six vertex model started with step initial data. After a long time, T, it is known that the one-point height function fluctuations for these systems are of order T 1/3. We prove the KPZ prediction of T 2/3 scaling in space. Namely, we prove tightness (and Brownian absolute continuity of all subsequential limits) as T goes to infinity of the height function with spatial coordinate scaled by T 2/3 and fluctuations scaled by T 1/3. The starting point for proving these results is a connection discovered recently by Borodin-Bufetov-Wheeler between the stochastic six vertex height function and the Hall-Littlewood process (a certain measure on plane partitions). Interpreting this process as a line ensemble with a Gibbsian resampling invariance, we show that the one-point tightness of the top curve can be propagated to the tightness of the entire curve.

  9. Injuries of the Sternoclavicular Joint - An Innovative Approach in the Management of a Rare Injury: Tight Rope Fixation of the Costo-Clavicular Ligament.

    PubMed

    Unterkofler, Jan; Merschin, David; Langenbach, Andreas; Ekkernkamp, Axel; Schulz-Drost, Stefan

    2017-01-01

    Background: The costoclavicular ligament (CCL) provides the most tight stability within the sternoclavicular joint (SCJ), followed by the most cited sternoclavicular ligaments (SCL). Their disruption may cause severe instability of the SCJ. Different treatment options, such as the use of plates, wires or autologous tendons are associated with mainly limited functional outcome. Could a stabilization of CCL next to an anatomic fixation of the SCL provide sufficient reconstruction of the SCJ? Methods: A 58-year-old male showed severe anterior and painful instability of the SCJ following a fall on his shoulder 8 weeks ago. The SCJ had been reconstructed in an open procedure with stabilization of the CCL employing 2 tight ropes and anatomical suture of the SCL. Follow-up was carried out 78 weeks after operation. Results: The reduction of the SCJ was successful. X-ray proved the anatomic position of the SCJ. Pain was decreased in between the first 6 weeks. The patient showed uneventful follow-up and returned to work 6 months after the procedureas a hard working farmer. Conclusions: Innovative stabilization of the CCL with tight ropes additional to a suture of the SCL may enable anatomic reconstruction of the SCJ considering cosmetic and functional results. Celsius.

  10. An Adaptive Low-Cost INS/GNSS Tightly-Coupled Integration Architecture Based on Redundant Measurement Noise Covariance Estimation.

    PubMed

    Li, Zheng; Zhang, Hai; Zhou, Qifan; Che, Huan

    2017-09-05

    The main objective of the introduced study is to design an adaptive Inertial Navigation System/Global Navigation Satellite System (INS/GNSS) tightly-coupled integration system that can provide more reliable navigation solutions by making full use of an adaptive Kalman filter (AKF) and satellite selection algorithm. To achieve this goal, we develop a novel redundant measurement noise covariance estimation (RMNCE) theorem, which adaptively estimates measurement noise properties by analyzing the difference sequences of system measurements. The proposed RMNCE approach is then applied to design both a modified weighted satellite selection algorithm and a type of adaptive unscented Kalman filter (UKF) to improve the performance of the tightly-coupled integration system. In addition, an adaptive measurement noise covariance expanding algorithm is developed to mitigate outliers when facing heavy multipath and other harsh situations. Both semi-physical simulation and field experiments were conducted to evaluate the performance of the proposed architecture and were compared with state-of-the-art algorithms. The results validate that the RMNCE provides a significant improvement in the measurement noise covariance estimation and the proposed architecture can improve the accuracy and reliability of the INS/GNSS tightly-coupled systems. The proposed architecture can effectively limit positioning errors under conditions of poor GNSS measurement quality and outperforms all the compared schemes.

  11. An Adaptive Low-Cost INS/GNSS Tightly-Coupled Integration Architecture Based on Redundant Measurement Noise Covariance Estimation

    PubMed Central

    Li, Zheng; Zhang, Hai; Zhou, Qifan; Che, Huan

    2017-01-01

    The main objective of the introduced study is to design an adaptive Inertial Navigation System/Global Navigation Satellite System (INS/GNSS) tightly-coupled integration system that can provide more reliable navigation solutions by making full use of an adaptive Kalman filter (AKF) and satellite selection algorithm. To achieve this goal, we develop a novel redundant measurement noise covariance estimation (RMNCE) theorem, which adaptively estimates measurement noise properties by analyzing the difference sequences of system measurements. The proposed RMNCE approach is then applied to design both a modified weighted satellite selection algorithm and a type of adaptive unscented Kalman filter (UKF) to improve the performance of the tightly-coupled integration system. In addition, an adaptive measurement noise covariance expanding algorithm is developed to mitigate outliers when facing heavy multipath and other harsh situations. Both semi-physical simulation and field experiments were conducted to evaluate the performance of the proposed architecture and were compared with state-of-the-art algorithms. The results validate that the RMNCE provides a significant improvement in the measurement noise covariance estimation and the proposed architecture can improve the accuracy and reliability of the INS/GNSS tightly-coupled systems. The proposed architecture can effectively limit positioning errors under conditions of poor GNSS measurement quality and outperforms all the compared schemes. PMID:28872629

  12. Cisplatin Cross-Linked Multifunctional Nanodrugplexes for Combination Therapy.

    PubMed

    Zhang, Weiqi; Tung, Ching-Hsuan

    2017-03-15

    Combination therapy efficiently tackles cancer by hitting multiple action mechanisms. However, drugs administered, simultaneously or sequentially, may not reach the targeted sites with the desired dose and ratio. The outcomes of combination therapy could be improved with a polymeric nanoparticle, which can simultaneously transport an optimal combination of drugs. We have demonstrated a simple one-pot strategy to formulate nanomedicines based on platinum coordination and the noncovalent interactions of the drugs. A naturally occurring polymer, hyaluronan (HA), was chosen as the building scaffold to form a nanodrugplex with cisplatin and aromatic-cationic drugs. The platinum coordination between cisplatin and HA induces the formation of a nanocomplex. The aromatic-cationic drugs are tightly packed by an electrostatic interaction and π-π stacking. The nanodrugplex bears excellent flexibility in drug combination and size control. It is stable in storage and has favorable release kinetics and targeting capabilities toward CD44, a receptor for HA that is highly expressed on many types of cancer cells.

  13. Beyond Ussing's chambers: contemporary thoughts on integration of transepithelial transport

    PubMed Central

    Herrmann, Jeremy R.

    2016-01-01

    In the mid-20th century, Hans Ussing developed a chamber that allowed for the simultaneous measurement of current and labeled probe flux across epithelia. Using frog skin as a model, Ussing used his results to propose mechanisms of transcellular Na+ and K+ transport across apical (exterior/luminal) and basolateral (interior) membranes that is essentially unchanged today. Others took advantage of Ussing's chambers to study mucosal tissues, including bladder and intestines. It quickly became clear that, in some tissues, passive paracellular flux, i.e., across the tight junction, was an important component of overall transepithelial transport. Subsequent work demonstrated that activation of the apical Na+-glucose cotransporter SGLT1 regulated paracellular permeability such that intestinal paracellular transport could coordinate with and amplify transcellular transport. Intermediates in this process include activation of p38 MAPK, the apical Na+/H+ exchanger NHE3, and myosin light chain kinase (MLCK). Investigators then focused on these processes in disease. They found that TNF induces barrier dysfunction via MLCK activation and downstream caveolin-1-dependent endocytosis of the tight junction protein occludin. TNF also inhibited NHE3, and both barrier loss and PKCα-dependent NHE3 inhibition were required for TNF-induced acute diarrhea, emphasizing the interplay between transcellular and paracellular transport. Finally, studies using immune-mediated inflammatory bowel disease models showed that mice lacking epithelial MLCK were initially protected, but became ill as epithelial damage progressed and provided a tight junction-independent means of barrier loss. None of these advances would have been possible without the insights provided by Ussing and others using Ussing's ingenious, and still useful, chambers. PMID:26702131

  14. Precision cosmology from X-ray AGN clustering

    NASA Astrophysics Data System (ADS)

    Basilakos, Spyros; Plionis, Manolis

    2009-11-01

    We place tight constraints on the main cosmological parameters of spatially flat cosmological models by using the recent angular clustering results of XMM-Newton soft (0.5-2keV) X-ray sources, which have a redshift distribution with a median of z ~ 1. Performing a standard likelihood procedure, assuming a constant in comoving coordinates active galactic nuclei (AGN) clustering evolution, the AGN bias evolution model of Basilakos, Plionis & Ragone-Figueroa and the Wilkinson Microwave Anisotropy Probe5 value of σ8, we find stringent simultaneous constraints in the (Ωm, w) plane, with Ωm = 0.26 +/- 0.05, w = -0.93+0.11-0.19.

  15. Electronic topological transitions in Zn under compression

    NASA Astrophysics Data System (ADS)

    Kechin, Vladimir V.

    2001-01-01

    The electronic structure of hcp Zn under pressure up to 10 GPa has been calculated self-consistently by means of the scalar relativistic tight-binding linear muffin-tin orbital method. The calculations show that three electronic topological transitions (ETT's) occur in Zn when the c/a axial ratio diminishes under compression. One transition occurs at c/a~=1.82 when the ``needles'' appear around the symmetry point K of the Brillouin zone. The other two transitions occur at c/a~=3, when the ``butterfly'' and ``cigar'' appear simultaneously both around the L point. It has been shown that these ETT's are responsible for a number of anomalies observed in Zn at compression.

  16. Multichannel Baseband Processor for Wideband CDMA

    NASA Astrophysics Data System (ADS)

    Jalloul, Louay M. A.; Lin, Jim

    2005-12-01

    The system architecture of the cellular base station modem engine (CBME) is described. The CBME is a single-chip multichannel transceiver capable of processing and demodulating signals from multiple users simultaneously. It is optimized to process different classes of code-division multiple-access (CDMA) signals. The paper will show that through key functional system partitioning, tightly coupled small digital signal processing cores, and time-sliced reuse architecture, CBME is able to achieve a high degree of algorithmic flexibility while maintaining efficiency. The paper will also highlight the implementation and verification aspects of the CBME chip design. In this paper, wideband CDMA is used as an example to demonstrate the architecture concept.

  17. Radiation pressure acceleration: The factors limiting maximum attainable ion energy

    DOE PAGES

    Bulanov, S. S.; Esarey, E.; Schroeder, C. B.; ...

    2016-04-15

    Radiation pressure acceleration (RPA) is a highly efficient mechanism of laser-driven ion acceleration, with near complete transfer of the laser energy to the ions in the relativistic regime. However, there is a fundamental limit on the maximum attainable ion energy, which is determined by the group velocity of the laser. The tightly focused laser pulses have group velocities smaller than the vacuum light speed, and, since they offer the high intensity needed for the RPA regime, it is plausible that group velocity effects would manifest themselves in the experiments involving tightly focused pulses and thin foils. However, in this case,more » finite spot size effects are important, and another limiting factor, the transverse expansion of the target, may dominate over the group velocity effect. As the laser pulse diffracts after passing the focus, the target expands accordingly due to the transverse intensity profile of the laser. Due to this expansion, the areal density of the target decreases, making it transparent for radiation and effectively terminating the acceleration. The off-normal incidence of the laser on the target, due either to the experimental setup, or to the deformation of the target, will also lead to establishing a limit on maximum ion energy.« less

  18. Enforcing dust mass conservation in 3D simulations of tightly coupled grains with the PHANTOM SPH code

    NASA Astrophysics Data System (ADS)

    Ballabio, G.; Dipierro, G.; Veronesi, B.; Lodato, G.; Hutchison, M.; Laibe, G.; Price, D. J.

    2018-06-01

    We describe a new implementation of the one-fluid method in the SPH code PHANTOM to simulate the dynamics of dust grains in gas protoplanetary discs. We revise and extend previously developed algorithms by computing the evolution of a new fluid quantity that produces a more accurate and numerically controlled evolution of the dust dynamics. Moreover, by limiting the stopping time of uncoupled grains that violate the assumptions of the terminal velocity approximation, we avoid fatal numerical errors in mass conservation. We test and validate our new algorithm by running 3D SPH simulations of a large range of disc models with tightly and marginally coupled grains.

  19. Beyond singular values and loop shapes

    NASA Technical Reports Server (NTRS)

    Stein, G.

    1985-01-01

    The status of singular value loop-shaping as a design paradigm for multivariable feedback systems is reviewed. It shows that this paradigm is an effective design tool whenever the problem specifications are spacially round. The tool can be arbitrarily conservative, however, when they are not. This happens because singular value conditions for robust performance are not tight (necessary and sufficient) and can severely overstate actual requirements. An alternate paradign is discussed which overcomes these limitations. The alternative includes a more general problem formulation, a new matrix function mu, and tight conditions for both robust stability and robust performance. The state of the art currently permits analysis of feedback systems within this new paradigm. Synthesis remains a subject of research.

  20. The stress polarity pathway: AMPK ‘GIV’-es protection against metabolic insults

    PubMed Central

    Ghosh, Pradipta

    2017-01-01

    Loss of cell polarity impairs organ development and function; it can also serve as one of the first triggers for oncogenesis. In 2006-2007 two groups simultaneously reported the existence of a special pathway for maintaining epithelial polarity in the face of environmental stressors. In this pathway, AMPK, a key sensor of metabolic stress stabilizes tight junctions, preserves cell polarity, and thereby, maintains epithelial barrier functions. Accumulating evidence since has shown that pharmacologic activation of AMPK by Metformin protects the epithelial barrier against multiple environmental and pathological stressful states and suppresses tumorigenesis. How AMPK protects the epithelium remained unknown until recently Aznar et al. identified GIV/Girdin as a novel effector of AMPK at the cell-cell junctions; phosphorylation of GIV at a single site by AMPK appears to be both necessary and sufficient for strengthening tight junctions and preserving cell polarity and epithelial barrier function in the face of energetic stress. Here we review the fundamentals of this specialized signaling pathway that buttresses cell-cell junctions against stress-induced collapse and discuss its pathophysiologic relevance in the context of a variety of diseases, including cancers, diabetes, aging, and the growing list of beneficial effects of the AMPK-activator, Metformin. PMID:28209925

  1. Multi-InDel Analysis for Ancestry Inference of Sub-Populations in China

    PubMed Central

    Sun, Kuan; Ye, Yi; Luo, Tao; Hou, Yiping

    2016-01-01

    Ancestry inference is of great interest in diverse areas of scientific researches, including the forensic biology, medical genetics and anthropology. Various methods have been published for distinguishing populations. However, few reports refer to sub-populations (like ethnic groups) within Asian populations for the limitation of markers. Several InDel loci located very tightly in physical positions were treated as one marker by us, which is multi-InDel. The multi-InDel shows potential as Ancestry Inference Marker (AIM). In this study, we performed a genome-wide scan for multi-InDels as AIM. After examining the FST distributions in the 1000 Genomes Database, 12 candidates were selected and validated for eastern Asian populations. A multiplexed assay was developed as a panel to genotype 12 multi-InDel markers simultaneously. Ancestry component analysis with STRUCTURE and principal component analysis (PCA) were employed to estimate its capability for ancestry inference. Furthermore, ancestry assignments of trial individuals were conducted. It proved to be very effective when 210 samples from Han and Tibetan individuals in China were tested. The panel consisting of multi-InDel markers exhibited considerable potency in ancestry inference, and was suggested to be applied in forensic practices and genetic population studies. PMID:28004788

  2. Using Dynamic Time Warping and Data Forensics to Examine Tradeoffs among Land-Energy-Water Networks Across the Conterminous United States

    NASA Astrophysics Data System (ADS)

    McManamay, R.; Allen, M. R.; Piburn, J.; Sanyal, J.; Stewart, R.; Bhaduri, B. L.

    2017-12-01

    Characterizing interdependencies among land-energy-water sectors, their vulnerabilities, and tipping points, is challenging, especially if all sectors are simultaneously considered. Because such holistic system behavior is uncertain, largely unmodeled, and in need of testable hypotheses of system drivers, these dynamics are conducive to exploratory analytics of spatiotemporal patterns, powered by tools, such as Dynamic Time Warping (DTW). Here, we conduct a retrospective analysis (1950 - 2010) of temporal trends in land use, energy use, and water use within US counties to identify commonalities in resource consumption and adaptation strategies to resource limitations. We combine existing and derived data from statistical downscaling to synthesize a temporally comprehensive land-energy-water dataset at the US county level and apply DTW and subsequent hierarchical clustering to examine similar temporal trends in resource typologies for land, energy, and water sectors. As expected, we observed tradeoffs among water uses (e.g., public supply vs irrigation) and land uses (e.g., urban vs ag). Strong associations between clusters amongst sectors reveal tight system interdependencies, whereas weak associations suggest unique behaviors and potential for human adaptations towards disruptive technologies and less resource-dependent population growth. Our framework is useful for exploring complex human-environmental system dynamics and generating hypotheses to guide subsequent energy-water-nexus research.

  3. Understanding the true shape of Au-catalyzed GaAs nanowires.

    PubMed

    Jiang, Nian; Wong-Leung, Jennifer; Joyce, Hannah J; Gao, Qiang; Tan, Hark Hoe; Jagadish, Chennupati

    2014-10-08

    With increasing interest in nanowire-based devices, a thorough understanding of the nanowire shape is required to gain tight control of the quality of nanowire heterostructures and improve the performance of related devices. We present a systematic study of the sidewalls of Au-catalyzed GaAs nanowires by investigating the faceting process from the beginning with vapor-liquid-solid (VLS) nucleation, followed by the simultaneous radial growth on the sidewalls, and to the end with sidewall transformation during annealing. The VLS nucleation interface of our GaAs nanowires is revealed by examining cross sections of the nanowire, where the nanowire exhibits a Reuleaux triangular shape with three curved surfaces along {112}A. These curved surfaces are not thermodynamically stable and adopt {112}A facets during radial growth. We observe clear differences in radial growth rate between the ⟨112⟩A and ⟨112⟩B directions with {112}B facets forming due to the slower radial growth rate along ⟨112⟩B directions. These sidewalls transform to {110} facets after high temperature (>500 °C) annealing. A nucleation model is proposed to explain the origin of the Reuleaux triangular shape of the nanowires, and the sidewall evolution is explained by surface kinetic and thermodynamic limitations.

  4. Analysis of a summary network of co-infection in humans reveals that parasites interact most via shared resources

    PubMed Central

    Griffiths, Emily C.; Pedersen, Amy B.; Fenton, Andy; Petchey, Owen L.

    2014-01-01

    Simultaneous infection by multiple parasite species (viruses, bacteria, helminths, protozoa or fungi) is commonplace. Most reports show co-infected humans to have worse health than those with single infections. However, we have little understanding of how co-infecting parasites interact within human hosts. We used data from over 300 published studies to construct a network that offers the first broad indications of how groups of co-infecting parasites tend to interact. The network had three levels comprising parasites, the resources they consume and the immune responses they elicit, connected by potential, observed and experimentally proved links. Pairs of parasite species had most potential to interact indirectly through shared resources, rather than through immune responses or other parasites. In addition, the network comprised 10 tightly knit groups, eight of which were associated with particular body parts, and seven of which were dominated by parasite–resource links. Reported co-infection in humans is therefore structured by physical location within the body, with bottom-up, resource-mediated processes most often influencing how, where and which co-infecting parasites interact. The many indirect interactions show how treating an infection could affect other infections in co-infected patients, but the compartmentalized structure of the network will limit how far these indirect effects are likely to spread. PMID:24619434

  5. Analysis of a summary network of co-infection in humans reveals that parasites interact most via shared resources.

    PubMed

    Griffiths, Emily C; Pedersen, Amy B; Fenton, Andy; Petchey, Owen L

    2014-05-07

    Simultaneous infection by multiple parasite species (viruses, bacteria, helminths, protozoa or fungi) is commonplace. Most reports show co-infected humans to have worse health than those with single infections. However, we have little understanding of how co-infecting parasites interact within human hosts. We used data from over 300 published studies to construct a network that offers the first broad indications of how groups of co-infecting parasites tend to interact. The network had three levels comprising parasites, the resources they consume and the immune responses they elicit, connected by potential, observed and experimentally proved links. Pairs of parasite species had most potential to interact indirectly through shared resources, rather than through immune responses or other parasites. In addition, the network comprised 10 tightly knit groups, eight of which were associated with particular body parts, and seven of which were dominated by parasite-resource links. Reported co-infection in humans is therefore structured by physical location within the body, with bottom-up, resource-mediated processes most often influencing how, where and which co-infecting parasites interact. The many indirect interactions show how treating an infection could affect other infections in co-infected patients, but the compartmentalized structure of the network will limit how far these indirect effects are likely to spread.

  6. 40 CFR 62.14455 - What if my HMIWI goes outside of a parameter limit?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... temperature (3-hour rolling average) simultaneously The PM, CO, and dioxin/furan emission limits. (c) Except..., daily average for batch HMIWI), and below the minimum dioxin/furan sorbent flow rate (3-hour rolling average) simultaneously The dioxin/furan emission limit. (3) Operates above the maximum charge rate (3...

  7. A Tight Fit.

    ERIC Educational Resources Information Center

    Williamson, Susan

    1999-01-01

    Describes the campus design of the University of Houston (Texas) as an example of an urban campus where space is limited; the siting of new buildings was straightforward; and the planning focused on the campus' identity, accessibility, and enhancement. Two drawings of the campus layout from the master plan are included. (GR)

  8. Genome-wide expression profiling of maize in response to individual and combined water and nitrogen stresses

    PubMed Central

    2013-01-01

    Background Water and nitrogen are two of the most critical inputs required to achieve the high yield potential of modern corn varieties. Under most agricultural settings however they are often scarce and costly. Fortunately, tremendous progress has been made in the past decades in terms of modeling to assist growers in the decision making process and many tools are now available to achieve more sustainable practices both environmentally and economically. Nevertheless large gaps remain between our empirical knowledge of the physiological changes observed in the field in response to nitrogen and water stresses, and our limited understanding of the molecular processes leading to those changes. Results This work examines in particular the impact of simultaneous stresses on the transcriptome. In a greenhouse setting, corn plants were grown under tightly controlled nitrogen and water conditions, allowing sampling of various tissues and stress combinations. A microarray profiling experiment was performed using this material and showed that the concomitant presence of nitrogen and water limitation affects gene expression to an extent much larger than anticipated. A clustering analysis also revealed how the interaction between the two stresses shapes the patterns of gene expression over various levels of water stresses and recovery. Conclusions Overall, this study suggests that the molecular signature of a specific combination of stresses on the transcriptome might be as unique as the impact of individual stresses, and hence underlines the difficulty to extrapolate conclusions obtained from the study of individual stress responses to more complex settings. PMID:23324127

  9. Biodegradation of sorbed chemicals in soil

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scow, K.M.; Fan, S.; Johnson, C.

    Rates of biodegradation of sorbed chemicals are usually lower in soil than in aqueous systems, in part because sorption reduces the availability of the chemical to microorganisms. Biodegradation, sorption, and diffusion occur simultaneously and are tightly coupled. In soil, the rate of biodegradation is a function of a chemical`s diffusion coefficient, sorption partition coefficient, the distance it must diffuse from the site of sorption to microbial populations that can degrade it, and its biodegradation rate constant. A model (DSB model) was developed that describes biodegradation of chemicals limited in the availability by sorption and diffusion. Different kinetics expressions describe biodegradationmore » depending on whether the reaction is controlled by mass transfer (diffusion and sorption) or the intrinsic biodegradation rate, and whether biodegradation begins during or after the majority of sorption has occurred. We tested the hypothesis that there is a direct relationship between how strongly a chemical is sorbed and the chemical`s biodegradation rate. In six soils with different organic carbon contents, there was no relationship between the extent or rate of biodegradation and the sorption partition coefficient for phenanthrene. Aging of phenanthrene residues in soil led to a substantial reduction in the rate of biodegradation compared to biodegradation rates of recently added phenanthrene. Considerable research has focused on identification and development of techniques for enhancing in situ biodegradation of sorbed chemicals. Development of such techniques, especially those involving inoculation with microbial strains, should consider physical mass transfer limitations and potential decreases in bioavailability over time. 4 refs., 3 figs., 1 tab.« less

  10. Hidden GeV-scale interactions of quarks.

    PubMed

    Dobrescu, Bogdan A; Frugiuele, Claudia

    2014-08-08

    We explore quark interactions mediated by new gauge bosons of masses in the 0.3-50 GeV range. A tight upper limit on the gauge coupling of light Z(') bosons is imposed by the anomaly cancellation conditions in conjunction with collider bounds on new charged fermions. Limits from quarkonium decays are model dependent, while electroweak constraints are mild. We derive the limits for a Z(') boson coupled to baryon number and then construct a Z(') model with relaxed constraints, allowing quark couplings as large as 0.2 for a mass of a few GeV.

  11. Edge currents in frustrated Josephson junction ladders

    NASA Astrophysics Data System (ADS)

    Marques, A. M.; Santos, F. D. R.; Dias, R. G.

    2016-09-01

    We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.

  12. Tightly coupled low cost 3D RISS/GPS integration using a mixture particle filter for vehicular navigation.

    PubMed

    Georgy, Jacques; Noureldin, Aboelmagd

    2011-01-01

    Satellite navigation systems such as the global positioning system (GPS) are currently the most common technique used for land vehicle positioning. However, in GPS-denied environments, there is an interruption in the positioning information. Low-cost micro-electro mechanical system (MEMS)-based inertial sensors can be integrated with GPS and enhance the performance in denied GPS environments. The traditional technique for this integration problem is Kalman filtering (KF). Due to the inherent errors of low-cost MEMS inertial sensors and their large stochastic drifts, KF, with its linearized models, has limited capabilities in providing accurate positioning. Particle filtering (PF) was recently suggested as a nonlinear filtering technique to accommodate for arbitrary inertial sensor characteristics, motion dynamics and noise distributions. An enhanced version of PF called the Mixture PF is utilized in this study to perform tightly coupled integration of a three dimensional (3D) reduced inertial sensors system (RISS) with GPS. In this work, the RISS consists of one single-axis gyroscope and a two-axis accelerometer used together with the vehicle's odometer to obtain 3D navigation states. These sensors are then integrated with GPS in a tightly coupled scheme. In loosely-coupled integration, at least four satellites are needed to provide acceptable GPS position and velocity updates for the integration filter. The advantage of the tightly-coupled integration is that it can provide GPS measurement update(s) even when the number of visible satellites is three or lower, thereby improving the operation of the navigation system in environments with partial blockages by providing continuous aiding to the inertial sensors even during limited GPS satellite availability. To effectively exploit the capabilities of PF, advanced modeling for the stochastic drift of the vertically aligned gyroscope is used. In order to benefit from measurement updates for such drift, which are loosely-coupled updates, a hybrid loosely/tightly coupled solution is proposed. This solution is suitable for downtown environments because of the long natural outages or degradation of GPS. The performance of the proposed 3D Navigation solution using Mixture PF for 3D RISS/GPS integration is examined by road test trajectories in a land vehicle and compared to the KF counterpart.

  13. Tightly Coupled Low Cost 3D RISS/GPS Integration Using a Mixture Particle Filter for Vehicular Navigation

    PubMed Central

    Georgy, Jacques; Noureldin, Aboelmagd

    2011-01-01

    Satellite navigation systems such as the global positioning system (GPS) are currently the most common technique used for land vehicle positioning. However, in GPS-denied environments, there is an interruption in the positioning information. Low-cost micro-electro mechanical system (MEMS)-based inertial sensors can be integrated with GPS and enhance the performance in denied GPS environments. The traditional technique for this integration problem is Kalman filtering (KF). Due to the inherent errors of low-cost MEMS inertial sensors and their large stochastic drifts, KF, with its linearized models, has limited capabilities in providing accurate positioning. Particle filtering (PF) was recently suggested as a nonlinear filtering technique to accommodate for arbitrary inertial sensor characteristics, motion dynamics and noise distributions. An enhanced version of PF called the Mixture PF is utilized in this study to perform tightly coupled integration of a three dimensional (3D) reduced inertial sensors system (RISS) with GPS. In this work, the RISS consists of one single-axis gyroscope and a two-axis accelerometer used together with the vehicle’s odometer to obtain 3D navigation states. These sensors are then integrated with GPS in a tightly coupled scheme. In loosely-coupled integration, at least four satellites are needed to provide acceptable GPS position and velocity updates for the integration filter. The advantage of the tightly-coupled integration is that it can provide GPS measurement update(s) even when the number of visible satellites is three or lower, thereby improving the operation of the navigation system in environments with partial blockages by providing continuous aiding to the inertial sensors even during limited GPS satellite availability. To effectively exploit the capabilities of PF, advanced modeling for the stochastic drift of the vertically aligned gyroscope is used. In order to benefit from measurement updates for such drift, which are loosely-coupled updates, a hybrid loosely/tightly coupled solution is proposed. This solution is suitable for downtown environments because of the long natural outages or degradation of GPS. The performance of the proposed 3D Navigation solution using Mixture PF for 3D RISS/GPS integration is examined by road test trajectories in a land vehicle and compared to the KF counterpart. PMID:22163846

  14. Tight Analysis of a Collisionless Robot Gathering Algorithm

    DTIC Science & Technology

    2015-09-28

    local-multiplicity detection. In SSS , pages 384– 398, Berlin, Heidelberg, 2009. Springer-Verlag. [20] T. Izumi, Y. Katayama, N. Inuzuka, and K. Wada...T. Izumi, M. G. Potop-Butucaru, and S. Tixeuil. Connectivity- preserving scattering of mobile robots with limited visibility. In SSS , pages 319–331

  15. College Recruiting on a Tight Budget.

    ERIC Educational Resources Information Center

    Keeton, Allison

    2002-01-01

    Even during the best economic times, many companies question the value of their college relations program and its place within their human resources function. To achieve positive recruiting outcomes despite limited means, college relations professionals need to know their market, use internal resources, be creative, and make smart decisions. (GCP)

  16. Examinations for leak tightness of actively cooled components in ITER and fusion devices

    NASA Astrophysics Data System (ADS)

    Hirai, T.; Barabash, V.; Carrat, R.; Chappuis, Ph; Durocher, A.; Escourbiac, F.; Merola, M.; Raffray, R.; Worth, L.; Boscary, J.; Chantant, M.; Chuilon, B.; Guilhem, D.; Hatchressian, J.-C.; Hong, S. H.; Kim, K. M.; Masuzaki, S.; Mogaki, K.; Nicolai, D.; Wilson, D.; Yao, D.

    2017-12-01

    Any leak in one of the ITER actively cooled components would cause significant consequences for machine operations; therefore, the risk of leak must be minimized as much as possible. In this paper, the strategy of examination to ensure leak tightness of the ITER internal components (i.e. examination of base materials, vacuum boundary joints and final components) and the hydraulic parameters for ITER internal components are summarized. The experiences of component tests, especially hot helium leak tests in recent fusion devices, were reviewed and the parameters were discussed. Through these experiences, it was confirmed that the hot He leak test was effective to detect small leak paths which were not always possible to detect by volumetric examination due to limited spatial resolution.

  17. Demonstration of a memory for tightly guided light in an optical nanofiber.

    PubMed

    Gouraud, B; Maxein, D; Nicolas, A; Morin, O; Laurat, J

    2015-05-08

    We report the experimental observation of slow-light and coherent storage in a setting where light is tightly confined in the transverse directions. By interfacing a tapered optical nanofiber with a cold atomic ensemble, electromagnetically induced transparency is observed and light pulses at the single-photon level are stored in and retrieved from the atomic medium. The decay of efficiency with storage time is also measured and related to concurrent decoherence mechanisms. Collapses and revivals can be additionally controlled by an applied magnetic field. Our results based on subdiffraction-limited optical mode interacting with atoms via the strong evanescent field demonstrate an alternative to free-space focusing and a novel capability for information storage in an all-fibered quantum network.

  18. Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

    NASA Astrophysics Data System (ADS)

    Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

    2018-04-01

    Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

  19. Beyond Ussing's chambers: contemporary thoughts on integration of transepithelial transport.

    PubMed

    Herrmann, Jeremy R; Turner, Jerrold R

    2016-03-15

    In the mid-20th century, Hans Ussing developed a chamber that allowed for the simultaneous measurement of current and labeled probe flux across epithelia. Using frog skin as a model, Ussing used his results to propose mechanisms of transcellular Na(+) and K(+) transport across apical (exterior/luminal) and basolateral (interior) membranes that is essentially unchanged today. Others took advantage of Ussing's chambers to study mucosal tissues, including bladder and intestines. It quickly became clear that, in some tissues, passive paracellular flux, i.e., across the tight junction, was an important component of overall transepithelial transport. Subsequent work demonstrated that activation of the apical Na(+)-glucose cotransporter SGLT1 regulated paracellular permeability such that intestinal paracellular transport could coordinate with and amplify transcellular transport. Intermediates in this process include activation of p38 MAPK, the apical Na(+)/H(+) exchanger NHE3, and myosin light chain kinase (MLCK). Investigators then focused on these processes in disease. They found that TNF induces barrier dysfunction via MLCK activation and downstream caveolin-1-dependent endocytosis of the tight junction protein occludin. TNF also inhibited NHE3, and both barrier loss and PKCα-dependent NHE3 inhibition were required for TNF-induced acute diarrhea, emphasizing the interplay between transcellular and paracellular transport. Finally, studies using immune-mediated inflammatory bowel disease models showed that mice lacking epithelial MLCK were initially protected, but became ill as epithelial damage progressed and provided a tight junction-independent means of barrier loss. None of these advances would have been possible without the insights provided by Ussing and others using Ussing's ingenious, and still useful, chambers. Copyright © 2016 the American Physiological Society.

  20. Tight swimming trunks to prevent post scrotal surgery: an experimental justification.

    PubMed

    Al-Abed, Yahya A; Carr, Thomas W

    2013-01-01

    To conduct a study to measure the pressure effects of the different scrotal supports applied on a simulated expanding scrotal hematoma. We created a model of an expanding hematoma with simultaneous pressure recording using a urodynamics system. Pressures were recorded independently first without application of any support. Then, three types of scrotal supports were tested, including Euron Net Knickers, scrotal suspensory bandage, and tight swimming trunks brand Speedo® brief and shorts. Subsequent pressures were recorded using the model created, which was applied inside the supports worn by two male volunteers A and B. Without any external compression, the pressure inside the simulated expanding hematoma "balloon" reached a maximum of 15 cmH2O. The pressures measured whilst wearing "Netelast knickers" in both subjects A and B reached a maximum of 15 cmH2O suggesting that this garment exerted no measurable compression. The suspensory scrotal support was then tested in both subjects. As the balloon started to fill with saline, the simulated hematoma pushed the scrotal support forward resulting in falling of the balloon outside the scrotal support. Subsequently, Speedo® briefs and shorts were tested. With Speedo® briefs, maximum filling pressures of 49 cmH2O and 40 cmH2O were reached in subjects A and B, respectively. When using Speedo® shorts, however, maximum pressures of 55 cmH2O in subject A and 54 cmH2O in subject B were reached at the end of the balloon filling to 300 mL of saline. The use of tight swimming trunks (Speedo®) has led to satisfactory results in the prevention of hematoma post scrotal surgery.

  1. Unitary scintillation detector and system

    DOEpatents

    McElhaney, Stephanie A.; Chiles, Marion M.

    1994-01-01

    The invention is a unitary alpha, beta, and gamma scintillation detector and system for sensing the presence of alpha, beta, and gamma radiations selectively or simultaneously. The scintillators are mounted in a light-tight housing provided with an entrance window for admitting alpha, beta, and gamma radiation and excluding ambient light from the housing. Light pulses from each scintillator have different decay constants that are converted by a photosensitive device into corresponding differently shaped electrical pulses. A pulse discrimination system identifies the electrical pulses by their respective pulse shapes which are determined by decay time. The identified electrical pulses are counted in separate channel analyzers to indicate the respective levels of sensed alpha, beta, and gamma radiations.

  2. Quantum-electrodynamic cascades in intense laser fields

    NASA Astrophysics Data System (ADS)

    Narozhny, N. B.; Fedotov, A. M.

    2015-01-01

    It is shown that in an intense laser field, along with cascades similar to extensive air showers, self-sustaining field-energized cascades can develop. For intensities of 1024~ \\text {W cm}-2 or higher, such cascades can even be initiated by a particle at rest in the focal area of a tightly focused laser pulse. The cascade appearance effect can considerably alter the progression of any process occurring in a high-intensity laser field. At very high intensities, the evolvement of such cascades can lead to the depletion of the laser field. This paper presents a design of an experiment to observe these two cascade types simultaneously already in next-generation laser facilities.

  3. Exospheric perturbations by radiation pressure. 2: Solution for orbits in the ecliptic plane

    NASA Technical Reports Server (NTRS)

    Chamberlain, J. W.

    1980-01-01

    The instantaneous rates of change for the orbital elements eccentricity, longitude of perigee from the Sun, and longitude from the Sun of the ascending node are integrated simultaneously for the case of the inclination i = 0. The results confirm the validity of using mean rates when the orbits are tightly bound to the planet and serve as examples to be reproduced by the complicated numerical solutions required for arbitrary inclination. Strongly bound hydrogen atoms escaping from Earth due to radiation pressure do not seem a likely cause of the geotail extending in the anti-sun direction. Instead, radiation pressure will cause those particles' orbits to deteriorate into the Earth's atmosphere.

  4. Unitary scintillation detector and system

    DOEpatents

    McElhaney, S.A.; Chiles, M.M.

    1994-05-31

    The invention is a unitary alpha, beta, and gamma scintillation detector and system for sensing the presence of alpha, beta, and gamma radiations selectively or simultaneously. The scintillators are mounted in a light-tight housing provided with an entrance window for admitting alpha, beta, and gamma radiation and excluding ambient light from the housing. Light pulses from each scintillator have different decay constants that are converted by a photosensitive device into corresponding differently shaped electrical pulses. A pulse discrimination system identifies the electrical pulses by their respective pulse shapes which are determined by decay time. The identified electrical pulses are counted in separate channel analyzers to indicate the respective levels of sensed alpha, beta, and gamma radiations. 10 figs.

  5. High power microwave components for space communications satellite

    NASA Technical Reports Server (NTRS)

    Jankowski, H.; Geia, A.

    1972-01-01

    Analyzed, developed, and tested were high power microwave components for communications satellites systems. Included were waveguide and flange configurations with venting, a harmonic filter, forward and reverse power monitors, electrical fault sensors, and a diplexer for two channel simultaneous transmission. The assembly of 8.36 GHz components was bench tested, and then operated for 60 hours at 3.5 kW CW in a high vacuum. The diplexer was omitted from this test pending a modification of its end irises. An RF leakage test showed only that care is required at flange junctions; all other components were RF tight. Designs were extrapolated for 12 GHz and 2.64 GHz high power satellite systems.

  6. Disrupted carbon cycling in restored and unrestored urban streams: Critical timescales and controls

    USGS Publications Warehouse

    Larsen, L. G.; Harvey, Judson

    2017-01-01

    Carbon fixation and respiration in flowing waterways play significant roles in global and regional carbon budgets, yet how land use and watershed management interact with temporal disturbances (storms) to influence metabolism remains poorly understood. Here, we combine long-term with synoptic sampling of metabolism and its variable controls in neighboring watersheds of the Chesapeake Bay to resolve limiting factors and critical timescales associated with recovery from disturbance. We found that, relative to predictions of the river continuum concept, focal streams have “disrupted” carbon cycles, with carbon balances closer to zero, and, in some cases, tighter coupling between gross primary production (GPP) and ecosystem respiration (ER), attributable to carbon limitation. Carbon became limiting to ER where flashy storm hydrographs and simplified channel geomorphology inhibited accumulation of fine sediment. Shannon entropy analysis of timescales revealed that fine sediment served as a time-release capsule for nutrients and carbon over 4–6 months, fueling biogeochemical transformations. Loss of fines through hydraulic disturbance had up to 30-d impacts on GPP and 50-d impacts on ER in the stream with carbon limitation. In contrast, where GPP and ER were not tightly coupled, recovery occurred within 1 d. Results suggest that a complex interplay between nutrient and carbon limitation and mechanical and chemical disturbance governs patterns and consequences of disrupted carbon cycling in urban streams. Carbon limitation and tight GPP/ER coupling enhance the vulnerability of stream ecosystem functions, but best management practices that target stormflow reduction and channel geomorphic diversity can break that coupling and minimize carbon cycle disruptions.

  7. Simultaneous Chandra/Swift Observations of the RT Cru Symbiotic System

    NASA Astrophysics Data System (ADS)

    Kashyap, Vinay; Kennea, J. A.; Karovska, M.; Calibration, Chandra

    2013-04-01

    The symbiotic star RT Cru was observed simultaneously by the Chandra/HRC-I and Swift/XRT in Dec 2012. The observations were carried out as part of a program to calibrate the Chandra PSF. The Chandra light curve shows a number of brightenings by factors of 2, with strong indications of a softening of the spectrum at these times. Swift observations cover a brief part of the Chandra light curve, and the intensities over this duration are tightly correlated. The Swift spectral data confirm the anticorrelation between intensity and spectral hardness. However, there are differences in the correlations at different periods that are not understood. We report on our analysis of the data, with emphasis on the spectral modeling at different times and intensity levels, and discuss the implications of the results on the emission mechanisms on symbiotic stars. We also report our inferences on the structure and energy dependence of the Chandra PSF anomaly, and on the high-energy cross-calibration between the HRC-I and XRT. This work is supported by the NASA contract NAS8-03060 to the Chandra X-ray Center.

  8. Solution for testing large high-power laser lenses having long focal length (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Fappani, Denis; IDE, Monique

    2017-05-01

    Many high power laser facilities are in operation all around the world and include various tight optical components such as large focussing lenses. Such lenses exhibit generally long focal lengths which induces some issues for their optical testing during manufacturing and inspection. Indeed, their transmitted wave fronts need to be very accurate and interferometric testing is the baseline to achieve that. But, it is always a problem to manage simultaneously long testing distances and fine accuracies in such interferometry testing. Taking example of the large focusing lenses produced for the Orion experimentation at AWE (UK), the presentation will describe which kind of testing method has been developed to demonstrate simultaneously good performances with sufficiently good repeatability and absolute accuracy. Special emphasis will be made onto the optical manufacturing issues and interferometric testing solutions. Some ZEMAX results presenting the test set-up and the calibration method will be presented as well. The presentation will conclude with a brief overview of the existing "state of the art" at Thales SESO for these technologies.

  9. In-situ electrochemically active surface area evaluation of an open-cathode polymer electrolyte membrane fuel cell stack

    NASA Astrophysics Data System (ADS)

    Torija, Sergio; Prieto-Sanchez, Laura; Ashton, Sean J.

    2016-09-01

    The ability to evaluate the electrochemically active surface area (ECSA) of fuel cell electrodes is crucial toward characterising designs and component suites in-situ, particularly when evaluating component durability in endurance testing, since it is a measure of the electrode area available to take part in the fuel cell reactions. Conventional methods to obtain the ECSA using cyclic voltammetry, however, rely on potentiostats that cannot be easily scaled to simultaneously evaluate all cells in a fuel cell stack of practical size, which is desirable in fuel cell development. In-situ diagnostics of an open-cathode fuel cell stack are furthermore challenging because the cells do not each possess an enclosed cathode compartment; instead, the cathodes are rather open to the environment. Here we report on a diagnostic setup that allows the electrochemically active surface area of each cell anode or cathode in an open-cathode fuel cell stack to be evaluated in-situ and simultaneously, with high resolution and reproducibility, using an easily scalable chronopotentiometry methodology and a gas-tight stack enclosure.

  10. Towards multifocal ultrasonic neural stimulation: pattern generation algorithms

    NASA Astrophysics Data System (ADS)

    Hertzberg, Yoni; Naor, Omer; Volovick, Alexander; Shoham, Shy

    2010-10-01

    Focused ultrasound (FUS) waves directed onto neural structures have been shown to dynamically modulate neural activity and excitability, opening up a range of possible systems and applications where the non-invasiveness, safety, mm-range resolution and other characteristics of FUS are advantageous. As in other neuro-stimulation and modulation modalities, the highly distributed and parallel nature of neural systems and neural information processing call for the development of appropriately patterned stimulation strategies which could simultaneously address multiple sites in flexible patterns. Here, we study the generation of sparse multi-focal ultrasonic distributions using phase-only modulation in ultrasonic phased arrays. We analyse the relative performance of an existing algorithm for generating multifocal ultrasonic distributions and new algorithms that we adapt from the field of optical digital holography, and find that generally the weighted Gerchberg-Saxton algorithm leads to overall superior efficiency and uniformity in the focal spots, without significantly increasing the computational burden. By combining phased-array FUS and magnetic-resonance thermometry we experimentally demonstrate the simultaneous generation of tightly focused multifocal distributions in a tissue phantom, a first step towards patterned FUS neuro-modulation systems and devices.

  11. Limits on fundamental limits to computation.

    PubMed

    Markov, Igor L

    2014-08-14

    An indispensable part of our personal and working lives, computing has also become essential to industries and governments. Steady improvements in computer hardware have been supported by periodic doubling of transistor densities in integrated circuits over the past fifty years. Such Moore scaling now requires ever-increasing efforts, stimulating research in alternative hardware and stirring controversy. To help evaluate emerging technologies and increase our understanding of integrated-circuit scaling, here I review fundamental limits to computation in the areas of manufacturing, energy, physical space, design and verification effort, and algorithms. To outline what is achievable in principle and in practice, I recapitulate how some limits were circumvented, and compare loose and tight limits. Engineering difficulties encountered by emerging technologies may indicate yet unknown limits.

  12. The Structure of Student Decision-Making at Community Colleges. CCRC Brief. Number 49

    ERIC Educational Resources Information Center

    Scott-Clayton, Judith

    2011-01-01

    Based on a longer review, this Brief summarizes research evidence and theoretical discussion regarding whether community college students are more likely to persist and succeed in programs that are tightly and consciously structured, with relatively little room for individuals to deviate from paths toward completion, and with limited bureaucratic…

  13. The Tight-interlocked Rhythm Section: Production and Perception of Synchronisation in Jazz Trio Performance.

    PubMed

    Hofmann, Alex; Wesolowski, Brian C; Goebl, Werner

    2017-01-01

    This study investigates the production and perception of timing, synchronisation and dynamics in jazz trio performances. In a production experiment, six trio combinations of one saxophonist, two bassists, and three drummers were recorded while they performed three popular jazz songs. Onset timing and dynamics of each performer were extracted and analysed. Results showed that the tempo was significantly influenced by the timing of the drummers and all performers showed higher temporal precision on the backbeats. The drummers demonstrated individual swing-ratios, accentuations of beats and intrapersonal asynchronies between simultaneous hi-hat and ride cymbal onsets, which resulted in a hi-hat played 2-26 ms ahead of the pulse of the music. In a subsequent perception test, participants ([Formula: see text]) rated 12 excerpts of the jazz recordings. They selected their preferred version from a pool of stimuli containing the original version, but also manipulations with artificially increased or reduced asynchronies. Stimuli with reduced asynchronies smaller than 19 ms were preferred by the listeners over the original or the fully quantised timing. This suggests that listeners endorse a 'tight-interlocked' jazz rhythm section, with asynchronies smaller than the perceptual threshold (temporal masking), but with natural timing variabilities that makes it distinguishable from a computer-generated playback.

  14. The Tight-interlocked Rhythm Section: Production and Perception of Synchronisation in Jazz Trio Performance

    PubMed Central

    Hofmann, Alex; Wesolowski, Brian C.; Goebl, Werner

    2017-01-01

    Abstract This study investigates the production and perception of timing, synchronisation and dynamics in jazz trio performances. In a production experiment, six trio combinations of one saxophonist, two bassists, and three drummers were recorded while they performed three popular jazz songs. Onset timing and dynamics of each performer were extracted and analysed. Results showed that the tempo was significantly influenced by the timing of the drummers and all performers showed higher temporal precision on the backbeats. The drummers demonstrated individual swing-ratios, accentuations of beats and intrapersonal asynchronies between simultaneous hi-hat and ride cymbal onsets, which resulted in a hi-hat played 2–26 ms ahead of the pulse of the music. In a subsequent perception test, participants () rated 12 excerpts of the jazz recordings. They selected their preferred version from a pool of stimuli containing the original version, but also manipulations with artificially increased or reduced asynchronies. Stimuli with reduced asynchronies smaller than 19 ms were preferred by the listeners over the original or the fully quantised timing. This suggests that listeners endorse a ‘tight-interlocked’ jazz rhythm section, with asynchronies smaller than the perceptual threshold (temporal masking), but with natural timing variabilities that makes it distinguishable from a computer-generated playback. PMID:29238387

  15. Tightly integrated single- and multi-crystal data collection strategy calculation and parallelized data processing in JBluIce beamline control system

    PubMed Central

    Pothineni, Sudhir Babu; Venugopalan, Nagarajan; Ogata, Craig M.; Hilgart, Mark C.; Stepanov, Sergey; Sanishvili, Ruslan; Becker, Michael; Winter, Graeme; Sauter, Nicholas K.; Smith, Janet L.; Fischetti, Robert F.

    2014-01-01

    The calculation of single- and multi-crystal data collection strategies and a data processing pipeline have been tightly integrated into the macromolecular crystallographic data acquisition and beamline control software JBluIce. Both tasks employ wrapper scripts around existing crystallographic software. JBluIce executes scripts through a distributed resource management system to make efficient use of all available computing resources through parallel processing. The JBluIce single-crystal data collection strategy feature uses a choice of strategy programs to help users rank sample crystals and collect data. The strategy results can be conveniently exported to a data collection run. The JBluIce multi-crystal strategy feature calculates a collection strategy to optimize coverage of reciprocal space in cases where incomplete data are available from previous samples. The JBluIce data processing runs simultaneously with data collection using a choice of data reduction wrappers for integration and scaling of newly collected data, with an option for merging with pre-existing data. Data are processed separately if collected from multiple sites on a crystal or from multiple crystals, then scaled and merged. Results from all strategy and processing calculations are displayed in relevant tabs of JBluIce. PMID:25484844

  16. A local leaky-box model for the local stellar surface density-gas surface density-gas phase metallicity relation

    NASA Astrophysics Data System (ADS)

    Zhu, Guangtun Ben; Barrera-Ballesteros, Jorge K.; Heckman, Timothy M.; Zakamska, Nadia L.; Sánchez, Sebastian F.; Yan, Renbin; Brinkmann, Jonathan

    2017-07-01

    We revisit the relation between the stellar surface density, the gas surface density and the gas-phase metallicity of typical disc galaxies in the local Universe with the SDSS-IV/MaNGA survey, using the star formation rate surface density as an indicator for the gas surface density. We show that these three local parameters form a tight relationship, confirming previous works (e.g. by the PINGS and CALIFA surveys), but with a larger sample. We present a new local leaky-box model, assuming star-formation history and chemical evolution is localized except for outflowing materials. We derive closed-form solutions for the evolution of stellar surface density, gas surface density and gas-phase metallicity, and show that these parameters form a tight relation independent of initial gas density and time. We show that, with canonical values of model parameters, this predicted relation match the observed one well. In addition, we briefly describe a pathway to improving the current semi-analytic models of galaxy formation by incorporating the local leaky-box model in the cosmological context, which can potentially explain simultaneously multiple properties of Milky Way-type disc galaxies, such as the size growth and the global stellar mass-gas metallicity relation.

  17. Tightly integrated single- and multi-crystal data collection strategy calculation and parallelized data processing in JBluIce beamline control system

    DOE PAGES

    Pothineni, Sudhir Babu; Venugopalan, Nagarajan; Ogata, Craig M.; ...

    2014-11-18

    The calculation of single- and multi-crystal data collection strategies and a data processing pipeline have been tightly integrated into the macromolecular crystallographic data acquisition and beamline control software JBluIce. Both tasks employ wrapper scripts around existing crystallographic software. JBluIce executes scripts through a distributed resource management system to make efficient use of all available computing resources through parallel processing. The JBluIce single-crystal data collection strategy feature uses a choice of strategy programs to help users rank sample crystals and collect data. The strategy results can be conveniently exported to a data collection run. The JBluIce multi-crystal strategy feature calculates amore » collection strategy to optimize coverage of reciprocal space in cases where incomplete data are available from previous samples. The JBluIce data processing runs simultaneously with data collection using a choice of data reduction wrappers for integration and scaling of newly collected data, with an option for merging with pre-existing data. Data are processed separately if collected from multiple sites on a crystal or from multiple crystals, then scaled and merged. Results from all strategy and processing calculations are displayed in relevant tabs of JBluIce.« less

  18. On-line estimation of O2 production, CO2 uptake, and growth kinetics of microalgal cultures in a gas-tight photobioreactor

    PubMed Central

    Riisgård, Frederik Kier; Gunther, William Stuart; Lønsmann Iversen, Jens Jørgen

    2006-01-01

    Growth of the green algae Chlamydomonas reinhardtii and Chlorella sp. in batch cultures was investigated in a novel gas-tight photobioreactor, in which CO2, H2, and N2 were titrated into the gas phase to control medium pH, dissolved oxygen partial pressure, and headspace pressure, respectively. The exit gas from the reactor was circulated through a loop of tubing and re-introduced into the culture. CO2 uptake was estimated from the addition of CO2 as acidic titrant and O2 evolution was estimated from titration by H2, which was used to reduce O2 over a Pd catalyst. The photosynthetic quotient, PQ, was estimated as the ratio between O2 evolution and CO2 up-take rates. NH4+, NO2−, or NO3− was the final cell density limiting nutrient. Cultures of both algae were, in general, characterised by a nitrogen sufficient growth phase followed by a nitrogen depleted phase in which starch was the major product. The estimated PQ values were dependent on the level of oxidation of the nitrogen source. The PQ was 1 with NH4+ as the nitrogen source and 1.3 when NO3− was the nitrogen source. In cultures grown on all nitrogen sources, the PQ value approached 1 when the nitrogen source was depleted and starch synthesis became dominant, to further increase towards 1.3 over a period of 3–4 days. This latter increase in PQ, which was indicative of production of reduced compounds like lipids, correlated with a simultaneous increase in the degree of reduction of the biomass. When using the titrations of CO2 and H2 into the reactor headspace to estimate the up-take of CO2, the production of O2, and the PQ, the rate of biomass production could be followed, the stoichiometrical composition of the produced algal biomass could be estimated, and different growth phases could be identified. PMID:19396354

  19. Surface Passivation in Empirical Tight Binding

    NASA Astrophysics Data System (ADS)

    He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann

    2016-03-01

    Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameters. This method is applied to a Si quantum well and a Si ultra-thin body transistor oxidized with SiO2 in several oxidation configurations. Comparison with ab-initio results and experiments verifies the presented method. Oxidation configurations that severely hamper the transistor performance are identified. It is also shown that the commonly used implicit H atom passivation overestimates the transistor performance.

  20. Activity monitoring reflects cardiovascular and metabolic variations in COPD patients across GOLD stages II to IV.

    PubMed

    Kortianou, E A; Louvaris, Z; Vasilopoulou, M; Nasis, I; Kaltsakas, G; Koulouris, N G; Vogiatzis, I

    2013-12-01

    We investigated whether activity monitoring reliably reflects variations in oxygen transport and utilization during walking in COPD patients. Forty-two patients (14 in each GOLD stage II, III and IV) performed an incremental treadmill protocol to the limit of tolerance. Breath-by-breath gas exchange, central hemodynamic variables and activity monitoring were simultaneously recorded. Physiological variables and accelerometer outputs rose linearly with walking speeds. Strong correlations (r[interquartile range, IQR]) were found between treadmill walking intensity (WI: range 0.8-2.0 ms(-2)) and oxygen consumption (0.95 [IQR 0.87-0.97]), (range 7.6-15.5 ml kg(-1)min(-1)); minute ventilation (0.95 [IQR 0.86-0.98]), (range 20-37 l min(-1)); cardiac output (0.89 [IQR 0.73-0.94]), (range 6.8-11.5 l min(-1)) and arteriovenous oxygen concentration difference (0.84 [IQR 0.76-0.90]), (range 7.7-12.1 ml O2100 ml(-1)). Correlations between WI and gas exchange or central hemodynamic parameters were not different across GOLD stages. In conclusion, central hemodynamic, respiratory and muscle metabolic variations during incremental treadmill exercise are tightly associated to changes in walking intensity as recorded by accelerometry across GOLD stages II to IV. Interestingly, the magnitude of these associations is not different across GOLD stages. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. [Can falls be prevented?].

    PubMed

    Dubousset, Jean

    2014-06-01

    Most recommendations and measures intended to prevent falls focus on the elderly (see HAS guideline of April 2009) but, in our opinion, this isfar too late: prevention must begin much earlier, not only by identifying persons at risk, but also by providing personalized lifestyle advice adapted to each individual's biomechanical, somatic, neurological and biological characteristics. The first preventive measure is to identify a possible deterioration of balance, starting with a physical examination at the age of 45 and repeated regularly throughout life. Extrinsic preventive measures focusing on the domestic and external environments are clearly necessary. But what is most important is to detect and, if necessary, correct any degradation of intrinsic (intracorporeal or somatic) factors starting at the age of 45 years; these include vision, vestibular function and balance, proprioception, and psychological and neurological status. Chronic illnesses and their treatments must also be taken into account: treatment must be limited to indispensable drugs; sedative psychotropics must be avoided if possible; and polymedication must be tightly controlled, as it is a major risk factor for falls. Prevention also requires a diet sufficiently rich in protein, calcium and vitamin D3 (to prevent osteoporosis), and regular daily exercise adapted to the individual, if possible associated with a simultaneous cognitive task. The last key point is the absolute need for thorough functional rehabilitation after any accidental or medical trauma, regardless of age, with the aim of restoring functional status to that existing prior to the accident.

  2. Load Fatigue Performance Evaluation on Two Internal Tapered Abutment-Implant Connection Implants Under Different Screw Tightening Torques.

    PubMed

    Jeng, Ming-Dih; Liu, Po-Yi; Kuo, Jia-Hum; Lin, Chun-Li

    2017-04-01

    This study evaluates the load fatigue performance of different abutment-implant connection implant types-retaining-screw (RS) and taper integrated screwed-in (TIS) types under 3 applied torque levels based on the screw elastic limit. Three torque levels-the recommended torque (25 Ncm), 10% less, and 10% more than the ratio of recommended torque to screw elastic limits of different implants were applied to the implants to perform static and dynamic testing according to the ISO 14801 method. Removal torque loss was calculated for each group after the endurance limitation was reached (passed 5 × 10 6 cycles) in the fatigue test. The static fracture resistance results showed that the fracture resistance in the TIS-type implant significantly increased (P < .05) when the abutment screw was inserted tightly. The dynamic testing results showed that the endurance limitations for the RS-type implant were 229 N, 197 N, and 224 N and those for the TIS-type implant were 322 N, 364 N, and 376 N when the screw insertion torques were applied from low to high. The corresponding significant (P < .05) removal torque losses for the TIS-type implant were 13.2%, 5.3%, and 2.6% but no significant difference was found for the RS-type implant. This study concluded that the static fracture resistance and dynamic endurance limitation of the TIS-type implant (1-piece solid abutment) increased when torque was applied more tightly on the screw. Less torque loss was also found when increasing the screw insertion torque.

  3. Mechanism-based population pharmacokinetic modelling in diabetes: vildagliptin as a tight binding inhibitor and substrate of dipeptidyl peptidase IV

    PubMed Central

    Landersdorfer, Cornelia B; He, Yan-Ling; Jusko, William J

    2012-01-01

    AIMS To assess the pharmacokinetics of vildagliptin at different doses and build a mechanism-based population model that simultaneously describes vildagliptin pharmacokinetics and its effects on DPP-4 activity based on underlying physiology and biology. METHODS Vildagliptin concentrations and DPP-4 activity vs. time from 13 type 2 diabetic patients after oral vildagliptin 10, 25 or 100 mg and placebo twice daily for 28 days were co-modelled. NONMEM VI and S-ADAPT were utilized for population modelling. RESULTS A target-mediated drug disposition (TMDD) model accounting for capacity-limited high affinity binding of vildagliptin to DPP-4 in plasma and tissues had good predictive performance. Modelling the full time course of the vildagliptin-DPP-4 interaction suggested parallel vildagliptin dissociation from DPP-4 by a slow first-order process and hydrolysis by DPP-4 to an inactive metabolite as a disposition mechanism. Due to limited amounts of DPP-4, vildagliptin concentrations increased slightly more than dose proportionally. This newly proposed model and the parameter estimates are supported by published in vitro studies. Mean parameter estimates (inter-individual coefficient of variation) were: non-saturable clearance 36 l h−1 (25%), central volume of distribution 22 l (37%), half-life of dissociation from DPP-4 1.1 h (94%) and half-life of hydrolysis 6.3 h (81%). CONCLUSIONS Vildagliptin is both an inhibitor and substrate for DPP-4. By utilizing the TMDD approach, slow dissociation of vildagliptin from DPP-4 was found in patients and the half-life of hydrolysis by DPP-4 estimated. This model can be used to predict DPP-4 inhibition effects of other dosage regimens and be modified for other DPP-4 inhibitors to differentiate their properties. PMID:22442826

  4. A systems approach to hemostasis: 4. How hemostatic thrombi limit the loss of plasma-borne molecules from the microvasculature

    PubMed Central

    Welsh, John D.; Muthard, Ryan W.; Stalker, Timothy J.; Taliaferro, Joshua P.; Diamond, Scott L.

    2016-01-01

    Previous studies have shown that hemostatic thrombi formed in response to penetrating injuries have a core of densely packed, fibrin-associated platelets overlaid by a shell of less-activated, loosely packed platelets. Here we asked, first, how the diverse elements of this structure combine to stem the loss of plasma-borne molecules and, second, whether antiplatelet agents and anticoagulants that perturb thrombus structure affect the re-establishment of a tight vascular seal. The studies combined high-resolution intravital microscopy with a photo-activatable fluorescent albumin marker to simultaneously track thrombus formation and protein transport following injuries to mouse cremaster muscle venules. The results show that protein loss persists after red cell loss has ceased. Blocking platelet deposition with an αIIbβ3 antagonist delays vessel sealing and increases extravascular protein accumulation, as does either inhibiting adenosine 5′-diphosphate (ADP) P2Y12 receptors or reducing integrin-dependent signaling and retraction. In contrast, sealing was unaffected by introducing hirudin to block fibrin accumulation or a Gi2α gain-of-function mutation to expand the thrombus shell. Collectively, these observations describe a novel approach for studying vessel sealing after injury in real time in vivo and show that (1) the core/shell architecture previously observed in arterioles also occurs in venules, (2) plasma leakage persists well beyond red cell escape and mature thrombus formation, (3) the most critical events for limiting plasma extravasation are the stable accumulation of platelets, ADP-dependent signaling, and the emergence of a densely packed core, not the accumulation of fibrin, and (4) drugs that affect platelet accumulation and packing can delay vessel sealing, permitting protein escape to continue. PMID:26738537

  5. An Upper Bound on Neutron Star Masses from Models of Short Gamma-Ray Bursts

    NASA Astrophysics Data System (ADS)

    Lawrence, Scott; Tervala, Justin G.; Bedaque, Paulo F.; Miller, M. Coleman

    2015-08-01

    The discovery of two neutron stars with gravitational masses ≈ 2 {M}⊙ has placed a strong lower limit on the maximum mass of nonrotating neutron stars, and with it a strong constraint on the properties of cold matter beyond nuclear density. Current upper mass limits are much looser. Here, we note that if most short gamma-ray bursts are produced by the coalescence of two neutron stars, and if the merger remnant collapses quickly, then the upper mass limit is constrained tightly. If the rotation of the merger remnant is limited only by mass-shedding (which seems probable based on numerical studies), then the maximum gravitational mass of a nonrotating neutron star is ≈ 2-2.2 {M}⊙ if the masses of neutron stars that coalesce to produce gamma-ray bursts are in the range seen in Galactic double neutron star systems. These limits would be increased by ˜4% in the probably unrealistic case that the remnants rotate at ˜30% below mass-shedding, and by ˜15% in the extreme case that the remnants do not rotate at all. Future coincident detection of short gamma-ray bursts with gravitational waves will strengthen these arguments because they will produce tight bounds on the masses of the components for individual events. If these limits are accurate, then a reasonable fraction of double neutron star mergers might not produce gamma-ray bursts. In that case, or in the case that many short bursts are produced instead by the mergers of neutron stars with black holes, the implied rate of gravitational wave detections will be increased.

  6. The effectiveness of whole-body-vibration training in improving hamstring flexibility in physically active adults.

    PubMed

    Houston, Megan N; Hodson, Victoria E; Adams, Kelda K E; Hoch, Johanna M

    2015-02-01

    Hamstring tightness is common among physically active individuals. In addition to limiting range of motion and increasing the risk of muscle strain, hamstring tightness contributes to a variety of orthopedic conditions. Therefore, clinicians continue to identify effective methods to increase flexibility. Although hamstring tightness is typically treated with common stretching techniques such as static stretching and proprioceptive neuromuscular facilitation, it has been suggested that whole-body-vibration (WBV) training may improve hamstring flexibility. Can WBV training, used in isolation or in combination with common stretching protocols or exercise, improve hamstring flexibility in physically active young adults? Summary of Key Findings: Of the included studies, 4 demonstrated statistically significant improvements in hamstring flexibility in the intervention group, and 1 study found minor improvements over time in the intervention group after treatment. Clinical Bottom Line: There is moderate evidence to support the use of WBV training to improve hamstring flexibility in physically active young adults. There is grade B evidence that WBV training improves hamstring flexibility in physically active adults. The Centre of Evidence Based Medicine recommends a grade of B for level 2 evidence with consistent findings.

  7. Cooperation in scale-free networks with limited associative capacities

    NASA Astrophysics Data System (ADS)

    Poncela, Julia; Gómez-Gardeñes, Jesús; Moreno, Yamir

    2011-05-01

    In this work we study the effect of limiting the number of interactions (the associative capacity) that a node can establish per round of a prisoner’s dilemma game. We focus on the way this limitation influences the level of cooperation sustained by scale-free networks. We show that when the game includes cooperation costs, limiting the associative capacity of nodes to a fixed quantity renders in some cases larger values of cooperation than in the unrestricted scenario. This allows one to define an optimum capacity for which cooperation is maximally enhanced. Finally, for the case without cooperation costs, we find that even a tight limitation of the associative capacity of nodes yields the same levels of cooperation as in the original network.

  8. Eye-Catching Calacas

    ERIC Educational Resources Information Center

    Crumpecker, Cheryl

    2012-01-01

    The Day of the Dead project is absolutely one of the author's favorite lessons. It's easy enough for almost any grade level--the author does it with her second-graders--yet can be detailed enough to keep eighth-graders interested. It uses a limited number of easy-to-acquire supplies, which is great for tight budgets. It can also be easily broken…

  9. Phage insertion in mlrA and variations in rpoS limit curli expression and biofilm formation in Escherichia coli serotype O157:H7

    USDA-ARS?s Scientific Manuscript database

    Biofilm formation in Escherichia coli is a tightly controlled process requiring the expression of adhesive curli fibers and certain polysaccharides such as cellulose. The transcriptional regulator CsgD is central to biofilm formation, controlling the expression of the curli structural and export pro...

  10. Does Household Income Matter for Children's Schooling? Evidence for Rural Sub-Saharan Africa

    ERIC Educational Resources Information Center

    Grimm, Michael

    2011-01-01

    Household income has been shown to matter for children's school enrolment, in particular in settings where households face tight liquidity constraints caused by the lack of insurance and limited possibilities to smooth consumption through credit and savings. However, so far only few studies have made an effort to quantify the income elasticity of…

  11. Language processing is not a race against time.

    PubMed

    Baggio, Giosuè; Vicario, Carmelo M

    2016-01-01

    We agree with Christiansen & Chater (C&C) that language processing and acquisition are tightly constrained by the limits of sensory and memory systems. However, the human brain supports a range of cognitive functions that mitigate the effects of information processing bottlenecks. The language system is partly organised around these moderating factors, not just around restrictions on storage and computation.

  12. Tight finite-key analysis for quantum cryptography

    PubMed Central

    Tomamichel, Marco; Lim, Charles Ci Wen; Gisin, Nicolas; Renner, Renato

    2012-01-01

    Despite enormous theoretical and experimental progress in quantum cryptography, the security of most current implementations of quantum key distribution is still not rigorously established. One significant problem is that the security of the final key strongly depends on the number, M, of signals exchanged between the legitimate parties. Yet, existing security proofs are often only valid asymptotically, for unrealistically large values of M. Another challenge is that most security proofs are very sensitive to small differences between the physical devices used by the protocol and the theoretical model used to describe them. Here we show that these gaps between theory and experiment can be simultaneously overcome by using a recently developed proof technique based on the uncertainty relation for smooth entropies. PMID:22252558

  13. Tight finite-key analysis for quantum cryptography.

    PubMed

    Tomamichel, Marco; Lim, Charles Ci Wen; Gisin, Nicolas; Renner, Renato

    2012-01-17

    Despite enormous theoretical and experimental progress in quantum cryptography, the security of most current implementations of quantum key distribution is still not rigorously established. One significant problem is that the security of the final key strongly depends on the number, M, of signals exchanged between the legitimate parties. Yet, existing security proofs are often only valid asymptotically, for unrealistically large values of M. Another challenge is that most security proofs are very sensitive to small differences between the physical devices used by the protocol and the theoretical model used to describe them. Here we show that these gaps between theory and experiment can be simultaneously overcome by using a recently developed proof technique based on the uncertainty relation for smooth entropies.

  14. Novel Chromosome Organization Pattern in Actinomycetales—Overlapping Replication Cycles Combined with Diploidy

    PubMed Central

    Böhm, Kati; Meyer, Fabian; Rhomberg, Agata; Kalinowski, Jörn; Donovan, Catriona

    2017-01-01

    ABSTRACT Bacteria regulate chromosome replication and segregation tightly with cell division to ensure faithful segregation of DNA to daughter generations. The underlying mechanisms have been addressed in several model species. It became apparent that bacteria have evolved quite different strategies to regulate DNA segregation and chromosomal organization. We have investigated here how the actinobacterium Corynebacterium glutamicum organizes chromosome segregation and DNA replication. Unexpectedly, we found that C. glutamicum cells are at least diploid under all of the conditions tested and that these organisms have overlapping C periods during replication, with both origins initiating replication simultaneously. On the basis of experimental data, we propose growth rate-dependent cell cycle models for C. glutamicum. PMID:28588128

  15. A Symmetric Two-Locus Fertility Model

    PubMed Central

    Feldman, Marcus W.; Liberman, Uri

    1985-01-01

    A model in which selection is mediated by differential fertilities among the genotypes at two diallelic loci is proposed. Fertility depends only on the number of heterozygous loci participating in the mating. Classes analogous to symmetric equilibria in symmetric viability models are determined explicitly and shown to exhibit stability behavior very different from the viability results. Linkage equilibrium is shown to occur in a relatively asymmetric fashion and to overlap in stability with linkage disequilibrium. In many cases single-locus or two-locus polymorphism is shown to be stable simultaneously with chromosome fixation even under very tight linkage. It is suggested that historical effects may be of great significance in the evolution of systems in which fertility is the primary agent of natural selection. PMID:3967817

  16. Surface alloy engineering in 2D trigonal lattice: giant Rashba spin splitting and two large topological gaps

    NASA Astrophysics Data System (ADS)

    Liu, Zhao; Jin, Yingdi; Yang, Yuchen; Wang, Z. F.; Yang, Jinlong

    2018-02-01

    We demonstrate that sp 2 based trigonal lattice can exhibit giant Rashba splitting and two large topological gaps simultaneously. First, an effective tight binding model is developed to describe the Rashba spin-orbit coupling (SOC) on a real surface and give a topological phase diagram based on two independent SOC parameters. Second, based on density functional theory calculations, it is proposed that Au/Si(111)-\\sqrt{3}× \\sqrt{3} surface with 1/3 monolayer Bi coverage is a good material candidate to realize both giant Rashba splitting and two large topological gaps. These results would inspire great research interests for searching two-dimensional topological insulator and manipulating Rashba spin splitting through surface alloy engineering.

  17. Coupled Low-thrust Trajectory and System Optimization via Multi-Objective Hybrid Optimal Control

    NASA Technical Reports Server (NTRS)

    Vavrina, Matthew A.; Englander, Jacob Aldo; Ghosh, Alexander R.

    2015-01-01

    The optimization of low-thrust trajectories is tightly coupled with the spacecraft hardware. Trading trajectory characteristics with system parameters ton identify viable solutions and determine mission sensitivities across discrete hardware configurations is labor intensive. Local independent optimization runs can sample the design space, but a global exploration that resolves the relationships between the system variables across multiple objectives enables a full mapping of the optimal solution space. A multi-objective, hybrid optimal control algorithm is formulated using a multi-objective genetic algorithm as an outer loop systems optimizer around a global trajectory optimizer. The coupled problem is solved simultaneously to generate Pareto-optimal solutions in a single execution. The automated approach is demonstrated on two boulder return missions.

  18. 75 FR 18497 - Guidance on Simultaneous Transmission Import Limit Studies for the Northwest Region; Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-12

    ... Conference ``Guidance on Simultaneous Transmission Import Limit Studies.'' To view the archive of the...?ID=5001&CalType=%20&CalendarID=116&Date=12/16/2009&View=Listview and click on ``free live webcast.'' To view the slides from that technical conference, click on ``Staff Presentation'' at the same...

  19. Study of the effect of soil disturbance on vapor transport through integrated modeling of the atmospheric boundary layer and shallow subsurface

    NASA Astrophysics Data System (ADS)

    Trautz, A.; Smits, K. M.; Cihan, A.; Wallen, B.

    2014-12-01

    Soil-water evaporation is one of the governing processes responsible for controlling water and energy exchanges between the land and atmosphere. Despite its wide relevance and application in many natural and manmade environments (e.g. soil tillage practices, wheel-track compaction, fire burn environments, textural layering and buried ordinances), there are very few studies of evaporation from disturbed soil profiles. The purpose of this study was to explore the effect of soil disturbance and capillary coupling on water distribution and fluxes. We modified a theory previously developed by the authors that allows for coupling single-phase (gas), two-component (air and water vapor) transfer in the atmosphere and two-phase (gas, liquid), two-component (air and water vapor) flow in porous media at the REV scale under non-isothermal, non-equilibrium conditions to better account for the hydraulic and thermal interactions within the media. Modeling results were validated and compared using precision data generated in a two-dimensional soil tank consisting of a loosely packed soil surrounded by a tightly packed soil. The soil tank was outfitted with an array of sensors for the measurement of wind velocity, soil and air temperature, relative humidity, soil moisture, and weight. Results demonstrated that, by using this coupling approach, it is possible to predict the different stages of the drying process in heterogeneous soils with good accuracy. Evaporation from a heterogeneous soil consisting of a loose and tight packing condition is larger than the homogeneous equivalent systems. Liquid water is supplied from the loosely packed soil region to the tightly packed soil regions, sustaining a longer Stage I evaporation in the tightly packed regions with overall greater evaporation rate than uniform homogeneous packing. In contrast, lower evaporation rates from the loosely packed regions are observed due to a limited liquid water supply resulting from capillary flow to the tightly packed regions and a shorter stage 1 evaporation period.

  20. Application of a Physics-Based Stabilization Criterion to Flight System Thermal Testing

    NASA Technical Reports Server (NTRS)

    Baker, Charles; Garrison, Matthew; Cottingham, Christine; Peabody, Sharon

    2010-01-01

    The theory shown here can provide thermal stability criteria based on physics and a goal steady state error rather than on an arbitrary "X% Q/mC(sub P)" method. The ability to accurately predict steady-state temperatures well before thermal balance is reached could be very useful during testing. This holds true for systems where components are changing temperature at different rates, although it works better for the components closest to the sink. However, the application to these test cases shows some significant limitations: This theory quickly falls apart if the thermal control system in question is tightly coupled to a large mass not accounted for in the calculations, so it is more useful in subsystem-level testing than full orbiter tests. Tight couplings to a fluctuating sink causes noise in the steady state temperature predictions.

  1. Dynamic array processing for computationally intensive expert systems in CLIPS

    NASA Technical Reports Server (NTRS)

    Athavale, N. N.; Ragade, R. K.; Fenske, T. E.; Cassaro, M. A.

    1990-01-01

    This paper puts forth an architecture for implementing a loop for advanced data structure of arrays in CLIPS. An attempt is made to use multi-field variables in such an architecture to process a set of data during the decision making cycle. Also, current limitations on the expert system shells are discussed in brief in this paper. The resulting architecture is designed to circumvent the current limitations set by the expert system shell and also by the operating environment. Such advanced data structures are needed for tightly coupling symbolic and numeric computation modules.

  2. Studying Like a Communist: Affect, the Party, and the Educational Limits to Capitalism

    ERIC Educational Resources Information Center

    Ford, Derek R.

    2017-01-01

    In an effort to theorize educational logics that are oppositional to capitalism, this article explores what it means to study like a communist. I begin by drawing out the tight connection between learning and capitalism, demonstrating that education is not a subset but a motor of political-economic relations. Next, I turn to the concept of study,…

  3. Development and evaluation of four molecular markers tightly linked to the Potato virus Y resistance gene Rychc in diploid potato populations

    USDA-ARS?s Scientific Manuscript database

    In the last 15 years, Potato virus Y (PVY) has been the main pathogen causing seed potato lot rejections in North America. The most efficient and environmentally sound method of limiting incidence and spread of PVY is the use virus resistant potato cultivars. Several genes for extreme resistance to ...

  4. Three-Dimensional Blood-Brain Barrier Model for in vitro Studies of Neurovascular Pathology

    NASA Astrophysics Data System (ADS)

    Cho, Hansang; Seo, Ji Hae; Wong, Keith H. K.; Terasaki, Yasukazu; Park, Joseph; Bong, Kiwan; Arai, Ken; Lo, Eng H.; Irimia, Daniel

    2015-10-01

    Blood-brain barrier (BBB) pathology leads to neurovascular disorders and is an important target for therapies. However, the study of BBB pathology is difficult in the absence of models that are simple and relevant. In vivo animal models are highly relevant, however they are hampered by complex, multi-cellular interactions that are difficult to decouple. In vitro models of BBB are simpler, however they have limited functionality and relevance to disease processes. To address these limitations, we developed a 3-dimensional (3D) model of BBB on a microfluidic platform. We verified the tightness of the BBB by showing its ability to reduce the leakage of dyes and to block the transmigration of immune cells towards chemoattractants. Moreover, we verified the localization at endothelial cell boundaries of ZO-1 and VE-Cadherin, two components of tight and adherens junctions. To validate the functionality of the BBB model, we probed its disruption by neuro-inflammation mediators and ischemic conditions and measured the protective function of antioxidant and ROCK-inhibitor treatments. Overall, our 3D BBB model provides a robust platform, adequate for detailed functional studies of BBB and for the screening of BBB-targeting drugs in neurological diseases.

  5. Information extraction during simultaneous motion processing.

    PubMed

    Rideaux, Reuben; Edwards, Mark

    2014-02-01

    When confronted with multiple moving objects the visual system can process them in two stages: an initial stage in which a limited number of signals are processed in parallel (i.e. simultaneously) followed by a sequential stage. We previously demonstrated that during the simultaneous stage, observers could discriminate between presentations containing up to 5 vs. 6 spatially localized motion signals (Edwards & Rideaux, 2013). Here we investigate what information is actually extracted during the simultaneous stage and whether the simultaneous limit varies with the detail of information extracted. This was achieved by measuring the ability of observers to extract varied information from low detail, i.e. the number of signals presented, to high detail, i.e. the actual directions present and the direction of a specific element, during the simultaneous stage. The results indicate that the resolution of simultaneous processing varies as a function of the information which is extracted, i.e. as the information extraction becomes more detailed, from the number of moving elements to the direction of a specific element, the capacity to process multiple signals is reduced. Thus, when assigning a capacity to simultaneous motion processing, this must be qualified by designating the degree of information extraction. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  6. Multicoordination Control Strategy Performance in Hybrid Power Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pezzini, Paolo; Bryden, Kenneth M.; Tucker, David

    This paper evaluates a state-space methodology of a multi-input multi-output (MIMO) control strategy using a 2 × 2 tightly coupled scenario applied to a physical gas turbine fuel cell hybrid power system. A centralized MIMO controller was preferred compared to a decentralized control approach because previous simulation studies showed that the coupling effect identified during the simultaneous control of the turbine speed and cathode airflow was better minimized. The MIMO controller was developed using a state-space dynamic model of the system that was derived using first-order transfer functions empirically obtained through experimental tests. The controller performance was evaluated in termsmore » of disturbance rejection through perturbations in the gas turbine operation, and setpoint tracking maneuver through turbine speed and cathode airflow steps. The experimental results illustrate that a multicoordination control strategy was able to mitigate the coupling of each actuator to each output during the simultaneous control of the system, and improved the overall system performance during transient conditions. On the other hand, the controller showed different performance during validation in simulation environment compared to validation in the physical facility, which will require a better dynamic modeling of the system for the implementation of future multivariable control strategies.« less

  7. Multicoordination Control Strategy Performance in Hybrid Power Systems

    DOE PAGES

    Pezzini, Paolo; Bryden, Kenneth M.; Tucker, David

    2018-04-11

    This paper evaluates a state-space methodology of a multi-input multi-output (MIMO) control strategy using a 2 × 2 tightly coupled scenario applied to a physical gas turbine fuel cell hybrid power system. A centralized MIMO controller was preferred compared to a decentralized control approach because previous simulation studies showed that the coupling effect identified during the simultaneous control of the turbine speed and cathode airflow was better minimized. The MIMO controller was developed using a state-space dynamic model of the system that was derived using first-order transfer functions empirically obtained through experimental tests. The controller performance was evaluated in termsmore » of disturbance rejection through perturbations in the gas turbine operation, and setpoint tracking maneuver through turbine speed and cathode airflow steps. The experimental results illustrate that a multicoordination control strategy was able to mitigate the coupling of each actuator to each output during the simultaneous control of the system, and improved the overall system performance during transient conditions. On the other hand, the controller showed different performance during validation in simulation environment compared to validation in the physical facility, which will require a better dynamic modeling of the system for the implementation of future multivariable control strategies.« less

  8. Successful pregnancy and delivery after simultaneous islet-kidney transplantation.

    PubMed

    Assalino, Michela; Podetta, Michele; Demuylder-Mischler, Sandrine; Francini, Katyuska; Pernin, Nadine; Randin, Jean-Pierre; Bosco, Domenico; Andres, Axel; Berney, Thierry

    2018-04-19

    Allogeneic islet of Langerhans transplantation is a recognized beta-cell replacement therapy for patients affected by type 1 diabetes mellitus. Type 1 diabetes mellitus is a condition associated with an increased risk of adverse outcomes for pregnant women and fetuses. We report the case of a 29-year-old woman with type 1 diabetes mellitus, who underwent successful allogeneic islet transplantation with simultaneous kidney transplantation. She achieved durable insulin independence after 2 islet infusions. Pregnancy was desired and planned 2 years after the last islet infusion. Multidisciplinary monitoring of pregnancy was carried out and the immunosuppressive regimen was adapted. Euglycemia was maintained throughout pregnancy without the need for exogenous insulin. After an uneventful pregnancy, she delivered on term an otherwise healthy male child with imperforate anus that was immediately surgically corrected. In conclusion, allogeneic islet transplantation is a suitable treatment for women of childbearing age with complicated type 1 diabetes mellitus, allowing physiologic glycemic control during pregnancy with a low risk of graft loss. This target can be achieved only by a tight multidisciplinary follow-up, including immunosuppressive therapy adaptation and adequate diabetes and obstetrical monitoring. © 2018 The American Society of Transplantation and the American Society of Transplant Surgeons.

  9. Influence of Th2 Cytokines on the Cornified Envelope, Tight Junction Proteins, and ß-Defensins in Filaggrin-Deficient Skin Equivalents.

    PubMed

    Hönzke, Stefan; Wallmeyer, Leonie; Ostrowski, Anja; Radbruch, Moritz; Mundhenk, Lars; Schäfer-Korting, Monika; Hedtrich, Sarah

    2016-03-01

    Atopic dermatitis is a chronic skin condition with complex etiology. It is characterized by skin barrier defects and T helper type 2 (Th2)-polarized inflammation. Although mutations in the filaggrin gene are known to be prominent genetic risk factors for the development of atopic dermatitis, the interdependency between these and an altered cytokine milieu is not fully understood. In this study, we evaluated the direct effects of filaggrin deficiency on the cornified envelope, tight junction proteins, and innate immune response, and report the effects of Th2 cytokines in normal and filaggrin-deficient skin equivalents. Supplementation with IL-4 and IL-13 led to distinct histologic changes and significantly increased skin surface pH, both of which were enhanced in filaggrin knockdown skin equivalents. We detected a compensatory up-regulation of involucrin and occludin in filaggrin-deficient skin that was dramatically disturbed when simultaneous inflammation occurred. Furthermore, we found that a lack of filaggrin triggered an up-regulation of human ?-defensin 2 via an unknown mechanism, which was abolished by Th2 cytokine supplementation. Taken together, these results indicate that defects in the epidermal barrier, skin permeability, and cutaneous innate immune response are not primarily linked to filaggrin deficiency but are rather secondarily induced by Th2 inflammation. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Simulation Study of CO2-EOR in Tight Oil Reservoirs with Complex Fracture Geometries

    PubMed Central

    Zuloaga-Molero, Pavel; Yu, Wei; Xu, Yifei; Sepehrnoori, Kamy; Li, Baozhen

    2016-01-01

    The recent development of tight oil reservoirs has led to an increase in oil production in the past several years due to the progress in horizontal drilling and hydraulic fracturing. However, the expected oil recovery factor from these reservoirs is still very low. CO2-based enhanced oil recovery is a suitable solution to improve the recovery. One challenge of the estimation of the recovery is to properly model complex hydraulic fracture geometries which are often assumed to be planar due to the limitation of local grid refinement approach. More flexible methods like the use of unstructured grids can significantly increase the computational demand. In this study, we introduce an efficient methodology of the embedded discrete fracture model to explicitly model complex fracture geometries. We build a compositional reservoir model to investigate the effects of complex fracture geometries on performance of CO2 Huff-n-Puff and CO2 continuous injection. The results confirm that the appropriate modelling of the fracture geometry plays a critical role in the estimation of the incremental oil recovery. This study also provides new insights into the understanding of the impacts of CO2 molecular diffusion, reservoir permeability, and natural fractures on the performance of CO2-EOR processes in tight oil reservoirs. PMID:27628131

  11. Ultrasonic cleaning of interior surfaces

    DOEpatents

    MacKenzie, D.; Odell, C.

    1994-03-01

    An ultrasonic cleaning apparatus is described for cleaning the interior surfaces of tubes. The apparatus includes an ultrasonic generator and reflector each coupled to opposing ends of the open-ended, fluid-filled tube. Fluid-tight couplings seal the reflector and generator to the tube, preventing leakage of fluid from the interior of the tube. The reflector and generator are operatively connected to actuators, whereby the distance between them can be varied. When the distance is changed, the frequency of the sound waves is simultaneously adjusted to maintain the resonant frequency of the tube so that a standing wave is formed in the tube, the nodes of which are moved axially to cause cavitation along the length of the tube. Cavitation maximizes mechanical disruption and agitation of the fluid, dislodging foreign material from the interior surface. 3 figures.

  12. Ultrasonic cleaning of interior surfaces

    DOEpatents

    Odell, D. MacKenzie C.

    1996-01-01

    An ultrasonic cleaning method for cleaning the interior surfaces of tubes. The method uses an ultrasonic generator and reflector each coupled to opposing ends of the open-ended, fluid-filled tube. Fluid-tight couplings seal the reflector and generator to the tube, preventing leakage of fluid from the interior of the tube. The reflector and generator are operatively connected to actuators, whereby the distance between them can be varied. When the distance is changed, the frequency of the sound waves is simultaneously adjusted to maintain the resonant frequency of the tube so that a standing wave is formed in the tube, the nodes of which are moved axially to cause cavitation along the length of the tube. Cavitation maximizes mechanical disruption and agitation of the fluid, dislodging foreign material from the interior surface.

  13. Ultrasonic cleaning of interior surfaces

    DOEpatents

    Odell, D. MacKenzie C.

    1994-01-01

    An ultrasonic cleaning apparatus for cleaning the interior surfaces of tubes. The apparatus includes an ultrasonic generator and reflector each coupled to opposing ends of the open-ended, fluid-filled tube. Fluid-tight couplings seal the reflector and generator to the tube, preventing leakage of fluid from the interior of the tube. The reflector and generator are operatively connected to actuators, whereby the distance between them can be varied. When the distance is changed, the frequency of the sound waves is simultaneously adjusted to maintain the resonant frequency of the tube so that a standing wave is formed in the tube, the nodes of which are moved axially to cause cavitation along the length of the tube. Cavitation maximizes mechanical disruption and agitation of the fluid, dislodging foreign material from the interior surface.

  14. Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes

    PubMed Central

    Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.

    2001-01-01

    Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926

  15. Note: A sample holder design for sensitive magnetic measurements at high temperatures in a magnetic properties measurement system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arauzo, A.; Guerrero, E.; Urtizberea, A.

    2012-06-15

    A sample holder design for high temperature measurements in a commercial MPMS SQUID magnetometer from Quantum Design is presented. It fulfills the requirements for the simultaneous use of the oven and reciprocating sample option (RSO) options, thus allowing sensitive magnetic measurements up to 800 K. Alternating current susceptibility can also be measured, since the holder does not induce any phase shift relative to the ac driven field. It is easily fabricated by twisting Constantan Copyright-Sign wires into a braid nesting the sample inside. This design ensures that the sample be placed tightly into a tough holder with its orientation fixed,more » and prevents any sample displacement during the fast movements of the RSO transport, up to high temperatures.« less

  16. Focusing on changing clinical practice to enhance rational prescribing--collaboration and networking enable comprehensive approaches.

    PubMed

    Helin-Salmivaara, Arja; Huupponen, Risto; Klaukka, Timo; Hoppu, Kalle

    2003-10-01

    Most western societies are enhancing rational pharmacotherapy to get best value for the constantly increasing expenditure on drugs. Government bodies and the medical profession took joint responsibility for the education programme for rational prescribing, launched in Finland at the end of the 1990s. The goals were to enhance critical thinking, and when appropriate, change prescribing behaviour. Various approaches that included evidence-based continuing medical education (CME), implementing clinical guidelines, delivering information, and providing prescribing feedback were used simultaneously. The commitment of the stakeholders and participants has been strong and the approaches have succeeded even though there is no clear outcome measure. The Government has recently decided to continue and widen the process, which started as a pilot programme, on a tight budget.

  17. Phase diagram of dilute cosmic matter

    NASA Astrophysics Data System (ADS)

    Iwata, Yoritaka

    2011-10-01

    Enhancement of nuclear pasta formation due to multi-nucleus simultaneous collision is presented based on time-dependent density functional calculations with periodic boundary condition. This calculation corresponds to the situation with density lower than the known low-density existence limit of the nuclear pasta phase. In order to evaluate the contribution from three-nucleus simultaneous collisions inside the cosmic matter, the possibility of multi-nucleus simultaneous collisions is examined by a systematic Monte-Carlo calculation, and the mean free path of a nucleus is obtained. Consequently the low-density existence limit of the nuclear pasta phase is formed to be lower than believed up to now.

  18. Full 3D modelling of pulse propagation enables efficient nonlinear frequency conversion with low energy laser pulses in a single-element tripler.

    PubMed

    Kardaś, Tomasz M; Nejbauer, Michał; Wnuk, Paweł; Resan, Bojan; Radzewicz, Czesław; Wasylczyk, Piotr

    2017-02-22

    Although new optical materials continue to open up access to more and more wavelength bands where femtosecond laser pulses can be generated, light frequency conversion techniques are still indispensable in filling the gaps on the ultrafast spectral scale. With high repetition rate, low pulse energy laser sources (oscillators) tight focusing is necessary for a robust wave mixing and the efficiency of broadband nonlinear conversion is limited by diffraction as well as spatial and temporal walk-off. Here we demonstrate a miniature third harmonic generator (tripler) with conversion efficiency exceeding 30%, producing 246 fs UV pulses via cascaded second order processes within a single laser beam focus. Designing this highly efficient and ultra compact frequency converter was made possible by full 3-dimentional modelling of propagation of tightly focused, broadband light fields in nonlinear and birefringent media.

  19. Tightness of the Ising-Kac Model on the Two-Dimensional Torus

    NASA Astrophysics Data System (ADS)

    Hairer, Martin; Iberti, Massimo

    2018-05-01

    We consider the sequence of Gibbs measures of Ising models with Kac interaction defined on a periodic two-dimensional discrete torus near criticality. Using the convergence of the Glauber dynamic proven by Mourrat and Weber (Commun Pure Appl Math 70:717-812, 2017) and a method by Tsatsoulis and Weber employed in (arXiv:1609.08447 2016), we show tightness for the sequence of Gibbs measures of the Ising-Kac model near criticality and characterise the law of the limit as the Φ ^4_2 measure on the torus. Our result is very similar to the one obtained by Cassandro et al. (J Stat Phys 78(3):1131-1138, 1995) on Z^2, but our strategy takes advantage of the dynamic, instead of correlation inequalities. In particular, our result covers the whole critical regime and does not require the large temperature/large mass/small coupling assumption present in earlier results.

  20. A Machine Learns to Predict the Stability of Tightly Packed Planetary Systems

    NASA Astrophysics Data System (ADS)

    Tamayo, Daniel; Silburt, Ari; Valencia, Diana; Menou, Kristen; Ali-Dib, Mohamad; Petrovich, Cristobal; Huang, Chelsea X.; Rein, Hanno; van Laerhoven, Christa; Paradise, Adiv; Obertas, Alysa; Murray, Norman

    2016-12-01

    The requirement that planetary systems be dynamically stable is often used to vet new discoveries or set limits on unconstrained masses or orbital elements. This is typically carried out via computationally expensive N-body simulations. We show that characterizing the complicated and multi-dimensional stability boundary of tightly packed systems is amenable to machine-learning methods. We find that training an XGBoost machine-learning algorithm on physically motivated features yields an accurate classifier of stability in packed systems. On the stability timescale investigated (107 orbits), it is three orders of magnitude faster than direct N-body simulations. Optimized machine-learning classifiers for dynamical stability may thus prove useful across the discipline, e.g., to characterize the exoplanet sample discovered by the upcoming Transiting Exoplanet Survey Satellite. This proof of concept motivates investing computational resources to train algorithms capable of predicting stability over longer timescales and over broader regions of phase space.

  1. Full 3D modelling of pulse propagation enables efficient nonlinear frequency conversion with low energy laser pulses in a single-element tripler

    NASA Astrophysics Data System (ADS)

    Kardaś, Tomasz M.; Nejbauer, Michał; Wnuk, Paweł; Resan, Bojan; Radzewicz, Czesław; Wasylczyk, Piotr

    2017-02-01

    Although new optical materials continue to open up access to more and more wavelength bands where femtosecond laser pulses can be generated, light frequency conversion techniques are still indispensable in filling the gaps on the ultrafast spectral scale. With high repetition rate, low pulse energy laser sources (oscillators) tight focusing is necessary for a robust wave mixing and the efficiency of broadband nonlinear conversion is limited by diffraction as well as spatial and temporal walk-off. Here we demonstrate a miniature third harmonic generator (tripler) with conversion efficiency exceeding 30%, producing 246 fs UV pulses via cascaded second order processes within a single laser beam focus. Designing this highly efficient and ultra compact frequency converter was made possible by full 3-dimentional modelling of propagation of tightly focused, broadband light fields in nonlinear and birefringent media.

  2. Endoscopes and robots for tight surgical spaces: use of precurved elastic elements to enhance curvature

    NASA Astrophysics Data System (ADS)

    Remirez, Andria A.; Webster, Robert J.

    2016-03-01

    Many applications in medicine require flexible surgical manipulators and endoscopes capable of reaching tight curvatures. The maximum curvature these devices can achieve is often restricted either by a strain limit, or by a maximum actuation force that the device's components can tolerate without risking mechanical failure. In this paper we propose the use of precurvature to "bias" the workspace of the device in one direction. Combined with axial shaft rotation, biasing increases the size of the device's workspace, enabling it to reach tighter curvatures than a comparable device without biasing can achieve, while still being able to fully straighten. To illustrate this effect, we describe several example prototype devices which use flexible nitinol strips that can be pushed and pulled to generate bending. We provide a statics model that relates the manipulator curvature to actuation force, and validate it experimentally.

  3. Fields of an ultrashort tightly focused radially polarized laser pulse in a linear response plasma

    NASA Astrophysics Data System (ADS)

    Salamin, Yousef I.

    2017-10-01

    Analytical expressions for the fields of a radially polarized, ultrashort, and tightly focused laser pulse propagating in a linear-response plasma are derived and discussed. The fields are obtained from solving the inhomogeneous wave equations for the vector and scalar potentials, linked by the Lorenz gauge, in a plasma background. First, the scalar potential is eliminated using the gauge condition, then the vector potential is synthesized from Fourier components of an initial uniform distribution of wavenumbers, and the inverse Fourier transformation is carried out term-by-term in a truncated series (finite sum). The zeroth-order term in, for example, the axial electric field component is shown to model a pulse much better than its widely used paraxial approximation counterpart. Some of the propagation characteristics of the fields are discussed and all fields are shown to have manifested the expected limits for propagation in a vacuum.

  4. Bessel-Gauss beams as rigorous solutions of the Helmholtz equation.

    PubMed

    April, Alexandre

    2011-10-01

    The study of the nonparaxial propagation of optical beams has received considerable attention. In particular, the so-called complex-source/sink model can be used to describe strongly focused beams near the beam waist, but this method has not yet been applied to the Bessel-Gauss (BG) beam. In this paper, the complex-source/sink solution for the nonparaxial BG beam is expressed as a superposition of nonparaxial elegant Laguerre-Gaussian beams. This provides a direct way to write the explicit expression for a tightly focused BG beam that is an exact solution of the Helmholtz equation. It reduces correctly to the paraxial BG beam, the nonparaxial Gaussian beam, and the Bessel beam in the appropriate limits. The analytical expression can be used to calculate the field of a BG beam near its waist, and it may be useful in investigating the features of BG beams under tight focusing conditions.

  5. Two-photon holographic optogenetics of neural circuits (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Yang, Weijian; Carrillo-Reid, Luis; Peterka, Darcy S.; Yuste, Rafael

    2016-03-01

    Optical manipulation of in vivo neural circuits with cellular resolution could be important for understanding cortical function. Despite recent progress, simultaneous optogenetic activation with cellular precision has either been limited to 2D planes, or a very small numbers of neurons over a limited volume. Here we demonstrate a novel paradigm for simultaneous 3D activation using a low repetition rate pulse-amplified fiber laser system and a spatial light modulator (SLM) to project 3D holographic excitation patterns on the cortex of mice in vivo for targeted volumetric 3D photoactivation. This method is compatible with two-photon imaging, and enables the simultaneous activation of multiple cells in 3D, using red-shifted opsins, such as C1V1 or ReaChR, while simultaneously imaging GFP-based sensors such as GCaMP6. This all-optical imaging and 3D manipulation approach achieves simultaneous reading and writing of cortical activity, and should be a powerful tool for the study of neuronal circuits.

  6. Calcium Channels and Oxidative Stress Mediate a Synergistic Disruption of Tight Junctions by Ethanol and Acetaldehyde in Caco-2 Cell Monolayers.

    PubMed

    Samak, Geetha; Gangwar, Ruchika; Meena, Avtar S; Rao, Roshan G; Shukla, Pradeep K; Manda, Bhargavi; Narayanan, Damodaran; Jaggar, Jonathan H; Rao, RadhaKrishna

    2016-12-13

    Ethanol is metabolized into acetaldehyde in most tissues. In this study, we investigated the synergistic effect of ethanol and acetaldehyde on the tight junction integrity in Caco-2 cell monolayers. Expression of alcohol dehydrogenase sensitized Caco-2 cells to ethanol-induced tight junction disruption and barrier dysfunction, whereas aldehyde dehydrogenase attenuated acetaldehyde-induced tight junction disruption. Ethanol up to 150 mM did not affect tight junction integrity or barrier function, but it dose-dependently increased acetaldehyde-mediated tight junction disruption and barrier dysfunction. Src kinase and MLCK inhibitors blocked this synergistic effect of ethanol and acetaldehyde on tight junction. Ethanol and acetaldehyde caused a rapid and synergistic elevation of intracellular calcium. Calcium depletion by BAPTA or Ca 2+ -free medium blocked ethanol and acetaldehyde-induced barrier dysfunction and tight junction disruption. Diltiazem and selective knockdown of TRPV6 or Ca V 1.3 channels, by shRNA blocked ethanol and acetaldehyde-induced tight junction disruption and barrier dysfunction. Ethanol and acetaldehyde induced a rapid and synergistic increase in reactive oxygen species by a calcium-dependent mechanism. N-acetyl-L-cysteine and cyclosporine A, blocked ethanol and acetaldehyde-induced barrier dysfunction and tight junction disruption. These results demonstrate that ethanol and acetaldehyde synergistically disrupt tight junctions by a mechanism involving calcium, oxidative stress, Src kinase and MLCK.

  7. Process for strengthening silicon based ceramics

    DOEpatents

    Kim, Hyoun-Ee; Moorhead, A. J.

    1993-01-01

    A process for strengthening silicon based ceramic monolithic materials and omposite materials that contain silicon based ceramic reinforcing phases that requires that the ceramic be exposed to a wet hydrogen atmosphere at about 1400.degree. C. The process results in a dense, tightly adherent silicon containing oxide layer that heals, blunts , or otherwise negates the detrimental effect of strength limiting flaws on the surface of the ceramic body.

  8. Process for strengthening silicon based ceramics

    DOEpatents

    Kim, Hyoun-Ee; Moorhead, A. J.

    1993-04-06

    A process for strengthening silicon based ceramic monolithic materials and omposite materials that contain silicon based ceramic reinforcing phases that requires that the ceramic be exposed to a wet hydrogen atmosphere at about 1400.degree. C. The process results in a dense, tightly adherent silicon containing oxide layer that heals, blunts , or otherwise negates the detrimental effect of strength limiting flaws on the surface of the ceramic body.

  9. Two atoms in an anisotropic harmonic trap

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Idziaszek, Z.; Centrum Fizyki Teoretycznej, Polska Akademia Nauk, 02-668 Warsaw; Calarco, T.

    2005-05-15

    We consider the system of two interacting atoms confined in axially symmetric harmonic trap. Within the pseudopotential approximation, we solve the Schroedinger equation exactly, discussing the limits of quasi-one-and quasi-two-dimensional geometries. Finally, we discuss the application of an energy-dependent pseudopotential, which allows us to extend the validity of our results to the case of tight traps and large scattering lengths.

  10. Vertical electronic transport in van de waals heterostructures

    NASA Astrophysics Data System (ADS)

    Qiao, Zhenhua; Zhenhua Qiao's Group Team

    In this work, we will introduce the theoretical investigation of the vertical electronic transport in various heterostructrues by using both tight-binding method and first-principles calculations. Counterintuitively, we find that the maximum electronic transport is achieved at very limited scattering regions but not at large overlapped catering regions. Based on this finding, we design a special setup to measure the tunneling effect in rotated bilayer systems.

  11. Experimental joint quantum measurements with minimum uncertainty.

    PubMed

    Ringbauer, Martin; Biggerstaff, Devon N; Broome, Matthew A; Fedrizzi, Alessandro; Branciard, Cyril; White, Andrew G

    2014-01-17

    Quantum physics constrains the accuracy of joint measurements of incompatible observables. Here we test tight measurement-uncertainty relations using single photons. We implement two independent, idealized uncertainty-estimation methods, the three-state method and the weak-measurement method, and adapt them to realistic experimental conditions. Exceptional quantum state fidelities of up to 0.999 98(6) allow us to verge upon the fundamental limits of measurement uncertainty.

  12. Cuba: Issues for the 111th Congress

    DTIC Science & Technology

    2010-03-25

    because of health reasons, and Raúl assumed provisional control of the government until February 2008 when he officially became President. His... government has implemented limited economic policy changes, but there has been disappointment that further reforms have not been forthcoming. The economy...was hard hit by storms in 2008 and the global financial crisis has caused further strains. Few observers expect the government to ease its tight

  13. Limits on Bilingualism Revisited: Stress Deafness in Simultaneous French-Spanish Bilinguals

    ERIC Educational Resources Information Center

    Dupoux, Emmanuel; Peperkamp, Sharon; Sebastian-Galles, Nuria

    2010-01-01

    We probed simultaneous French-Spanish bilinguals for the perception of Spanish lexical stress using three tasks, two short-term memory encoding tasks and a speeded lexical decision. In all three tasks, the performance of the group of simultaneous bilinguals was intermediate between that of native speakers of Spanish on the one hand and French late…

  14. Tight control of mild-moderate pre-existing or non-proteinuric gestational hypertension.

    PubMed

    Nabhan, Ashraf F; Elsedawy, Maged M

    2011-07-06

    The question of the target blood pressure in pregnant women with mild-moderate hypertension continues to be an area of debate. To compare tight versus very tight control of mild-moderate pre-existing or non-proteinuric gestational hypertension for improving outcomes We searched the Cochrane Pregnancy and Childbirth Group's Trials Register (31 March 2011), CENTRAL (The Cochrane Library 2011, Issue 3), MEDLINE (January 1966 to March 2011), and the metaRegister of Controlled Trials (31 March 2011). We handsearched citation lists of relevant publications, review articles, and included studies. Randomized controlled trials of tight versus very tight control in pregnant women with mild or moderate pre-existing or non-proteinuric gestational hypertension. Two authors independently assessed trial quality and extracted data. We expressed results as risk ratio (RR) or mean differences, together with their 95% confidence intervals (CI). We included two studies (256 participants) with mild-moderate pre-existing or non-proteinuric gestational hypertension. There was no evidence of a difference between tight and very tight control groups regarding severe pre-eclampsia (risk ratio (RR) 1.28, 95% CI 0.97 to 1.70; two trials, 256 participants). More women in the tight group were hospitalized during their pregnancy (RR 2.53, 95% CI 1.14 to 5.63; one trial, 125 participants). There was no evidence of a difference in other outcome measures including fetal distress, IUGR, neonatal admission to a NICU, perinatal deaths, induction of labor and cesarean delivery between the tight and the very tight control groups. Gestational age at delivery had a non-significant mean difference (MD) of -0.15 weeks between the tight and very tight control groups (MD -0.15, 95% CI -1.52 to 1.21, random-effects, T² = 0.75, I² = 77%; two trials, 256 participants). The MD in birthweight between the tight and the very tight control group was not significant (MD -100.00 grams, 95% CI -363.69 to 163.69; one trial, 125 participants). For pregnant women with non-severe pre-existing or non-proteinuric gestational hypertension, there is insufficient evidence to determine how tight control of hypertension should be achieved to improve maternal and fetal-neonatal outcomes.

  15. Terrestrial tight oil reservoir characteristics and Graded Resource Assessment in China

    NASA Astrophysics Data System (ADS)

    Wang, Shejiao; Wu, Xiaozhi; Guo, Giulin

    2016-04-01

    The success of shale/tight plays and the advanced exploitation technology applied in North America have triggered interest in exploring and exploiting tight oil in China. Due to the increased support of exploration and exploitation,great progress has been made in Erdos basin, Songliao basin, Junggar basin, Santanghu basin, Bohai Bay basin, Qaidam Basin, and Sichuan basin currently. China's first tight oil field has been found in Erdos basin in 2015, called xinanbian oil field, with over one hundred million tons oil reserves and one million tons of production scale. Several hundred million tons of tight oil reserve has been found in other basins, showing a great potential in China. Tight oil in China mainly developed in terrestrial sedimentary environment. According to the relations of source rock and reservoir, the source-reservoir combination of tight oil can be divided into three types, which are bottom generating and top storing tight oil,self- generating and self-storing tight oil,top generating and bottom storing tight oil. The self- generating and self-storing tight oil is the main type discovered at present. This type of tight oil has following characteristics:(1) The formation and distribution of tight oil are controlled by high quality source rocks. Terrestrial tight oil source rocks in China are mainly formed in the deep to half deep lacustrine facies. The lithology includes dark mudstone, shale, argillaceous limestone and dolomite. These source rocks with thickness between 20m-150m, kerogen type mostly I-II, and peak oil generation thermal maturity(Ro 0.6-1.4%), have great hydrocarbon generating potential. Most discovered tight oil is distributed in the area of TOC greater than 2 %.( 2) the reservoir with strong heterogeneity is very tight. In these low porosity and permeability reservoir,the resources distribution is controlled by the physical property. Tight sandstone, carbonate and hybrid sedimentary rocks are three main tight reservoir types in China. The porosity is 2-14%(average 5-10%)and the permeability is less than 1mD. The laboratory test and exploration practice confirmed that the oil content was positively related to physical property. The higher the porosity, the better the oil content will have. (3) Source rock and reservoir are superimposed. From the contact relationship of source rock and reservoir, the reservoir developed in the source rock has the advantage of capturing oil and gas, so the oil saturation can be as high as 70-80%. (4) The increased pressure caused by hydrocarbon generation and the connected fracture are the key factors for tight oil accumulation. The Fuyu tight oil formed underling source rock in Songliao Basin is a good example. The fracture system is the key factor for tight oil accumulation. Considering the strong heterogeneity of terrestrial tight oil reservoir in china, we create hierarchical resource abundance analogy, EUR analogy, cell element volumetric methods to evaluate tight oil resource potential. In order to find exploration "sweet spots", establishing tight oil resource classification evaluation standards are key steps to objectively evaluate tight oil resource distribution. The resource classification evaluation standards are established by the relationship analysis between reservoir properties and oil properties, and the correlation analysis between production, resource abundance, and reservoir thickness. The first-grade tight oil resource, which is recently available and can easily be developed, has following main parameters: the porosity is greater than 8%, thickness is over 10m, resource abundance is above 150,000 tons / km2, and pressure coefficient is greater than 1.3; The second-grade tight oil resource is currently unavailable, but with advanced technology can expected to be developed. The main parameters are as following: the porosity is 5% -8%, thickness is less than 5-10m, resource abundance is 50000-150000 tons / km2, the pressure coefficient is 1.0 to 1.3; The third-grade resource has poor quality, need long-term to be effective explored, has following main parameters: porosity is less than 5%, the thickness is less than 5m, resource abundance is less than 50,000 tons / km2, the pressure coefficient is less than 1.0. Using created resource evaluation methods, the tight oil resources has been calculated in china. The first-grade recoverable resource of tight oil is about 610 million tons. The second-grade recoverable resource is 450 million tons. And the third-grade recoverable resource is 400 million tons. The first-grade and second-grade recoverable resources are mainly distributed in the Ordos basin, Bohai Bay basin, Songliao basin, Junggar basin, and Qaidam Basin. The third-grade resources are mainly distributed in Sichuan and Santanghu basin.

  16. Smooth affine shear tight frames: digitization and applications

    NASA Astrophysics Data System (ADS)

    Zhuang, Xiaosheng

    2015-08-01

    In this paper, we mainly discuss one of the recent developed directional multiscale representation systems: smooth affine shear tight frames. A directional wavelet tight frame is generated by isotropic dilations and translations of directional wavelet generators, while an affine shear tight frame is generated by anisotropic dilations, shears, and translations of shearlet generators. These two tight frames are actually connected in the sense that the affine shear tight frame can be obtained from a directional wavelet tight frame through subsampling. Consequently, an affine shear tight frame indeed has an underlying filter bank from the MRA structure of its associated directional wavelet tight frame. We call such filter banks affine shear filter banks, which can be designed completely in the frequency domain. We discuss the digitization of affine shear filter banks and their implementations: the forward and backward digital affine shear transforms. Redundancy rate and computational complexity of digital affine shear transforms are also investigated in this paper. Numerical experiments and comparisons in image/video processing show the advantages of digital affine shear transforms over many other state-of-art directional multiscale representation systems.

  17. Heisenberg's uncertainty principle for simultaneous measurement of positive-operator-valued measures

    NASA Astrophysics Data System (ADS)

    Miyadera, Takayuki; Imai, Hideki

    2008-11-01

    A limitation on simultaneous measurement of two arbitrary positive-operator-valued measures is discussed. In general, simultaneous measurement of two noncommutative observables is only approximately possible. Following Werner’s formulation, we introduce a distance between observables to quantify an accuracy of measurement. We derive an inequality that relates the achievable accuracy with noncommutativity between two observables. As a byproduct a necessary condition for two positive-operator-valued measures to be simultaneously measurable is obtained.

  18. Picosecond laser bonding of highly dissimilar materials

    NASA Astrophysics Data System (ADS)

    Carter, Richard M.; Troughton, Michael; Chen, Jianyong; Elder, Ian; Thomson, Robert R.; Lamb, Robert A.; Esser, M. J. Daniel; Hand, Duncan P.

    2016-10-01

    We report on recent progress in developing an industrially relevant, robust technique to bond dissimilar materials through ultra-fast microwelding. This technique is based on the use of a 5.9ps, 400kHz Trumpf laser operating at 1030nm. Tight focusing of the laser radiation at, or around, the interface between two materials allows for simultaneous absorption in both. This absorption rapidly, and locally, heats the material forming plasma from both materials. With suitable surface preparation this plasma can be confined to the interface region where it mixes, cools and forms a weld between the two materials. The use of ps pulses results in a short interaction time. This enables a bond to form whilst limiting the heat affected zone (HAZ) to a region of only a few hundred micrometres across. This small scale allows for the bonding of materials with highly dissimilar thermal properties, and in particular coefficients of thermal expansion e.g. glass-metal bonding. We report on our results for a range of material combinations including, Al-Bk7, Al-SiO2 and Nd:YAG-AlSi. Emphasis will be laid on the technical requirements for bonding including the required surface preparation of the two materials and on the laser parameters required. The quality of the resultant bonds are characterized through shear force measurements (where strengths equal to and exceeding equivalent adhesives will be presented). The lifetime of the welds is also discussed, paying particular attention to the results of thermal cycling tests.

  19. Transcutaneous Measurement of Blood Analyte Concentration Using Raman Spectroscopy

    NASA Astrophysics Data System (ADS)

    Barman, Ishan; Singh, Gajendra P.; Dasari, Ramachandra R.; Feld, Michael S.

    2008-11-01

    Diabetes mellitus is a chronic disorder, affecting nearly 200 million people worldwide. Acute complications, such as hypoglycemia, cardiovascular disease and retinal damage, may occur if the disease is not adequately controlled. As diabetes has no known cure, tight control of glucose levels is critical for the prevention of such complications. Given the necessity for regular monitoring of blood glucose, development of non-invasive glucose detection devices is essential to improve the quality of life in diabetic patients. The commercially available glucose sensors measure the interstitial fluid glucose by electrochemical detection. However, these sensors have severe limitations, primarily related to their invasive nature and lack of stability. This necessitates the development of a truly non-invasive glucose detection technique. NIR Raman Spectroscopy, which combines the substantial penetration depth of NIR light with the excellent chemical specificity of Raman spectroscopy, provides an excellent tool to meet the challenges involved. Additionally, it enables simultaneous determination of multiple blood analytes. Our laboratory has pioneered the use of Raman spectroscopy for blood analytes' detection in biological media. The preliminary success of our non-invasive glucose measurements both in vitro (such as in serum and blood) and in vivo has provided the foundation for the development of feasible clinical systems. However, successful application of this technology still faces a few hurdles, highlighted by the problems of tissue luminescence and selection of appropriate reference concentration. In this article we explore possible avenues to overcome these challenges so that prospective prediction accuracy of blood analytes can be brought to clinically acceptable levels.

  20. Mobile infostation network technology

    NASA Astrophysics Data System (ADS)

    Rajappan, Gowri; Acharya, Joydeep; Liu, Hongbo; Mandayam, Narayan; Seskar, Ivan; Yates, Roy

    2006-05-01

    Inefficient use of network resources on the battlefield is a serious liability: if an asset communicates with the network command for data-a terrain map, for instance-it ties up the end-to-end network resources. When many such assets contend for data simultaneously, traffic is limited by the slowest link along the path from the network command to the asset. A better approach is for a local server, known as an infostation, to download data on an anticipated-need basis when the network load is low. The infostation can then dump data when needed to the assets over a high-speed wireless connection. The infostation serves the local assets over an OFDM-based wireless data link that has MIMO enhancements for high data rate and robustness. We aim for data rate in excess of 100 Mbps, spectral efficiency in excess of 5 bits/sec/Hz, and robustness to poor channel conditions and jammers. We propose an adaptive physical layer that determines power levels, modulation schemes, and the MIMO enhancements to use based on the channel state and the level of interference in the system. We also incorporate the idea of superuser: a user who is allowed preferential use of the high data rate link. We propose a MAC that allows for this priority-based bandwidth allocation scheme. The proposed infostation MAC is integrated tightly with the physical layer through a cross-layer design. We call the proposed infostation PHY, MAC, and network technology, collectively, as the Mobile Infostation Network Technology (MINT).

  1. Adaptive low-rank subspace learning with online optimization for robust visual tracking.

    PubMed

    Liu, Risheng; Wang, Di; Han, Yuzhuo; Fan, Xin; Luo, Zhongxuan

    2017-04-01

    In recent years, sparse and low-rank models have been widely used to formulate appearance subspace for visual tracking. However, most existing methods only consider the sparsity or low-rankness of the coefficients, which is not sufficient enough for appearance subspace learning on complex video sequences. Moreover, as both the low-rank and the column sparse measures are tightly related to all the samples in the sequences, it is challenging to incrementally solve optimization problems with both nuclear norm and column sparse norm on sequentially obtained video data. To address above limitations, this paper develops a novel low-rank subspace learning with adaptive penalization (LSAP) framework for subspace based robust visual tracking. Different from previous work, which often simply decomposes observations as low-rank features and sparse errors, LSAP simultaneously learns the subspace basis, low-rank coefficients and column sparse errors to formulate appearance subspace. Within LSAP framework, we introduce a Hadamard production based regularization to incorporate rich generative/discriminative structure constraints to adaptively penalize the coefficients for subspace learning. It is shown that such adaptive penalization can significantly improve the robustness of LSAP on severely corrupted dataset. To utilize LSAP for online visual tracking, we also develop an efficient incremental optimization scheme for nuclear norm and column sparse norm minimizations. Experiments on 50 challenging video sequences demonstrate that our tracker outperforms other state-of-the-art methods. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Tightness Entropic Uncertainty Relation in Quantum Markovian-Davies Environment

    NASA Astrophysics Data System (ADS)

    Zhang, Jun; Liu, Liang; Han, Yan

    2018-05-01

    In this paper, we investigate the tightness of entropic uncertainty relation in the absence (presence) of the quantum memory which the memory particle being weakly coupled to a decohering Davies-type Markovian environment. The results show that the tightness of the quantum uncertainty relation can be controlled by the energy relaxation time F, the dephasing time G and the rescaled temperature p, the perfect tightness can be arrived by dephasing and energy relaxation satisfying F = 2G and p = 1/2. In addition, the tightness of the memory-assisted entropic uncertainty relation and the entropic uncertainty relation can be influenced mainly by the purity. While in memory-assisted model, the purity and quantum correlation can also influence the tightness actively while the quantum entanglement can influence the tightness slightly.

  3. A mathematical model of the mevalonate cholesterol biosynthesis pathway.

    PubMed

    Pool, Frances; Currie, Richard; Sweby, Peter K; Salazar, José Domingo; Tindall, Marcus J

    2018-04-14

    We formulate, parameterise and analyse a mathematical model of the mevalonate pathway, a key pathway in the synthesis of cholesterol. Of high clinical importance, the pathway incorporates rate limiting enzymatic reactions with multiple negative feedbacks. In this work we investigate the pathway dynamics and demonstrate that rate limiting steps and negative feedbacks within it act in concert to tightly regulate intracellular cholesterol levels. Formulated using the theory of nonlinear ordinary differential equations and parameterised in the context of a hepatocyte, the governing equations are analysed numerically and analytically. Sensitivity and mathematical analysis demonstrate the importance of the two rate limiting enzymes 3-hydroxy-3-methylglutaryl-CoA reductase and squalene synthase in controlling the concentration of substrates within the pathway as well as that of cholesterol. The role of individual feedbacks, both global (between that of cholesterol and sterol regulatory element-binding protein 2; SREBP-2) and local internal (between substrates in the pathway) are investigated. We find that whilst the cholesterol SREBP-2 feedback regulates the overall system dynamics, local feedbacks activate within the pathway to tightly regulate the overall cellular cholesterol concentration. The network stability is analysed by constructing a reduced model of the full pathway and is shown to exhibit one real, stable steady-state. We close by addressing the biological question as to how farnesyl-PP levels are affected by CYP51 inhibition, and demonstrate that the regulatory mechanisms within the network work in unison to ensure they remain bounded. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Resonant thickening of self-gravitating discs: imposed or self-induced orbital diffusion in the tightly wound limit

    NASA Astrophysics Data System (ADS)

    Fouvry, Jean-Baptiste; Pichon, Christophe; Chavanis, Pierre-Henri; Monk, Laura

    2017-11-01

    The secular thickening of a self-gravitating stellar galactic disc is investigated using the dressed collisionless Fokker-Planck equation and the inhomogeneous multicomponent Balescu-Lenard equation. The thick WKB limits for the diffusion fluxes are found using the epicyclic approximation, while assuming that only radially tightly wound transient spirals are sustained by the disc. This yields simple quadratures for the drift and diffusion coefficients, providing a clear understanding of the positions of maximum vertical orbital diffusion within the disc, induced by fluctuations either external or due to the finite number of particles. These thick limits also offer a consistent derivation of a thick disc Toomre parameter, which is shown to be exponentially boosted by the ratio of the vertical to radial scaleheights. Dressed potential fluctuations within the disc statistically induce a vertical bending of a subset of resonant orbits, triggering the corresponding increase in vertical velocity dispersion. When applied to a tepid stable tapered disc perturbed by shot noise, these two frameworks reproduce qualitatively the formation of ridges of resonant orbits towards larger vertical actions, as found in direct numerical simulations, but overestimates the time-scale involved in their appearance. Swing amplification is likely needed to resolve this discrepancy, as demonstrated in the case of razor-thin discs. Other sources of thickening are also investigated, such as fading sequences of slowing bars, or the joint evolution of a population of giant molecular clouds within the disc.

  5. Tool For Driving Many Fasteners Simultaneously

    NASA Technical Reports Server (NTRS)

    Cook, Joseph S., Jr.

    1995-01-01

    Proposed tool tightens or loosens several bolts, screws, nuts, or other threaded fasteners arranged in circle on compressor head, automotive wheel, pipe-end flange, or similar object. Enables assembly or disassembly in fraction of time needed to tighten fasteners one at a time. Simultaneously applies same torque to all fasteners, preventing distortion and enhancing reliability. Concept not limited to circular fastener patterns. Adapted to rectangular configurations like on engine intake manifolds, by adding gears to drive train to provide proper spacing. Designed to deliver fixed or adjustable maximum torque. To ensure even seal loading, piston pressure simultaneously ramped from initial to final values to maintain relatively constant torque loading on all fasteners until final specifications limit achieved.

  6. GEOLOGIC ASPECTS OF TIGHT GAS RESERVOIRS IN THE ROCKY MOUNTAIN REGION.

    USGS Publications Warehouse

    Spencer, Charles W.

    1985-01-01

    The authors describe some geologic characteristics of tight gas reservoirs in the Rocky Mountain region. These reservoirs usually have an in-situ permeability to gas of 0. 1 md or less and can be classified into four general geologic and engineering categories: (1) marginal marine blanket, (2) lenticular, (3) chalk, and (4) marine blanket shallow. Microscopic study of pore/permeability relationships indicates the existence of two varieties of tight reservoirs. One variety is tight because of the fine grain size of the rock. The second variety is tight because the rock is relatively tightly cemented and the pores are poorly connected by small pore throats and capillaries.

  7. Characteristics of secondary migration driving force of tight oil and its geologic effect: a case study of Jurassic in Central Sichuan Basin

    NASA Astrophysics Data System (ADS)

    Pang, Zhenglian; Tao, Shizhen; Zhang, Bin; Wu, Songtao; Yang, Jiajing; Chen, Ruiyin

    2017-04-01

    As the rising of its production, tight oil is becoming more and more important. Much research has been done about it. Some articles mention that buoyancy is ineffective for tight oil secondary migration, and abnormal pressure is the alternative. Others believe that overpressure caused hydrocarbon generation is the very force. Though opinions have been given, there are two inadequacies. Firstly, the points are lack of sufficient evidences. Mostly, they are only one or two sentences in the papers. Secondly, geologic effect of the change of driving force hasn't been discussed. In this context, analog experiments, physical property testing, mercury injection, and oil/source comparison were utilized to study 3 issues: origin and value of tight oil secondary migration resistance, values and effectiveness of different potential driving forces, and geologic effect of tight oil secondary migration driving force. Firstly, resistance values of tight reservoir were detected by analog experiments. The value of tight limestone is 15.8MPa, while tight sandstone is 10.7MPa. Tiny size of pores and throats in tight reservoir is the main reason causing huge resistances. Over 90% of pores and throats in tight reservoir are smaller than 1μm. They form huge capillary force when oil migrating through them. Secondly, maximum of buoyancy in study area was confirmed, 0.09MPa, too small to overcome the resistances. Meanwhile, production data suggests that tight oil distribution pattern is not controlled by buoyancy. Conversely, analog experiment proves that overpressure caused by hydrocarbon generation can reach 38MPa, large enough to be the driving force. This idea is also supported by positive correlation between output and source rock formation pressure. Thirdly, is the geologic effect of tight oil secondary migration resistance and driving force. Tight oil can migrate only as non-darcy flow due to huge resistances according to percolation experiments. It needs to overcome the starting pressure gradient. As a result, it migrated a much shorter distance compared with conventional petroleum, coincident with the result of oil/source comparison. The effect of driving force is that boundary of tight oil profitable area is controlled by source rock. This boundary in the study area is the line of hydrocarbon generating strength of 40×104t/km2. By confirming controlling factors of tight oil formation and their evaluation index, it is of great significance during tight oil exploration.

  8. Tight Placement of Erich Arch Bar While Avoiding Wire Fatigue Failure.

    PubMed

    Kirk, Daniel; Whitney, Joseph; Shafer, David; Song, Liansheng

    2016-03-01

    To determine the number of wire twists needed to acquire ideal Erich arch bar tightness before wire fatigue failure (fracture) in relation to different distances and angles at which different gauge wires are grasped to provide information to improve the efficiency of arch bar application. This study mimicked surgical placement of arch bars with 24- and 26-gauge wires. The number of twists to tightness and failure was evaluated when the wire distance between the arch bar and wire holder tip changed (5 vs 10 mm) and when the degree at which the wire was held relative to the tooth axis was changed (45° vs 90°). A wire shearing test also was used to investigate the fatigability of wires tightened under these same conditions. Wires twisted to tightness, past tightness, and after shearing test movements were visualized with electron microscopy. For 24-gauge wire held at 5 mm, 2.6 to 2.8 twists were needed for wire tightness, with failure after 1.7 to 1.9 twists past tightness; for 24-gauge wire held at 10 mm, 4.4 to 4.9 twists produced tightness, with failure after 2.3 to 2.9 twists past tightness. For 26-gauge wire held at 5 mm, 3.3 to 3.5 twists provided tightness, with 1.6 to 1.8 twists past tightness causing failure; for 26-gauge wire held at 10 mm, 5.1 to 5.5 twists produced tightness, with 3.1 to 3.7 twists past tightness causing failure. At a 45° angle, the wire tightened with fewer twists and showed more resistance to failure with twists past tightness compared with 90° using 24- and 26-gauge wires. In contrast, 24-gauge wire held at a 5-mm distance showed the opposite result, with decreased resistance to failure at the 45° angle. However, the differences were not statistically meaningful. Scanning election microscopy showed no wire fatigue for either angle for 26-gauge wire held at a 5-mm distance and twisted to tightness. After overtightening and oscillation, the 90° angle trials showed fatigue, whereas the 45° angle trials did not. Holding a 24-gauge wire at 45° to the tooth axis is recommended owing to fewer twists to tightness and more resistance to failure. A 5-mm grasping distance is recommended for experienced surgeons owing to fewer twists to tightness, whereas a 10-mm grasping distance is recommended for novice surgeons owing to a greater tolerance for over-twisting before failure. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  9. Light-weight cyptography for resource constrained environments

    NASA Astrophysics Data System (ADS)

    Baier, Patrick; Szu, Harold

    2006-04-01

    We give a survey of "light-weight" encryption algorithms designed to maximise security within tight resource constraints (limited memory, power consumption, processor speed, chip area, etc.) The target applications of such algorithms are RFIDs, smart cards, mobile phones, etc., which may store, process and transmit sensitive data, but at the same time do not always support conventional strong algorithms. A survey of existing algorithms is given and new proposal is introduced.

  10. Changing Face of Warfare

    DTIC Science & Technology

    2015-06-12

    cohesion and contributed to morale, it also served to limit what a leader could do, especially in terms of imposing discipline. Thus the military...characterized by control through the use of tight battle formations to maintain cohesion and discipline. Offensive tactics ruled the day, despite...work, Operations of War, stressed the importance of the offensive to the "suicidal in the defender.Ŝ Hamley’s work became a text at West Point in

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, D.; Akis, R.; Brinkman, D.

    An improved model of copper p-type doping in CdTe absorbers is proposed that accounts for the mechanisms related to tightly bound Cu(i)-Cu(Cd) and Cd(i)-Cu(Cd) complexes that both limit diffusion and cause self-compensation of Cu species. The new model explains apparent discrepancy between DFT-calculated and fitted diffusion parameters of Cu reported in our previous work, and allows for better understanding of performance and metastabilities in CdTe PV devices.

  12. Controlling the Transport of an Ion: Classical and Quantum Mechanical Solutions

    DTIC Science & Technology

    2014-07-09

    quantum systems: tools, achievements, and limitations Christiane P Koch Shortcuts to adiabaticity for an ion in a rotating radially- tight trap M Palmero...Keywords: coherent control, ion traps, quantum information, optimal control theory 1. Introduction Control methods are key enabling techniques in many...figure 6. 3.4. Feasibility analysis of quantum optimal control Numerical optimization of the wavepacket motion is expected to become necessary once

  13. Health-hazard evaluation report HETA 90-232-2138, Schulte Corporation, Cincinnati, Ohio

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venable, H.L.; Kawamoto, M.M.

    1991-09-01

    In response to a confidential request from employees of the Schulte Corporation (SIC-3496), Cincinnati, Ohio, an evaluation was undertaken of complaints of chest tightness, itching, metallic taste in the mouth, and discharge of black dust from the noses of workers in the machine shop of the facility. The facility was involved in the manufacturing and shipping of epoxy coated steel wire shelving. Total dust samples taken in the breathing zone of the workers ranged from 0.49 to 4.78mg/cu m, well below the permissible limits. Respirable dust samples ranged from 0.05 to 0.43mg/cu m. Exposures to nitrogen oxides were well belowmore » acceptable limits. Aldehydes were not detected in samples evaluating exposure to two resistance welders. The NIOSH ceiling level of 0.1 part per million for ozone (10028156) was exceeded near welders. Six workers interviewed reported symptoms including black nasal discharge, headaches, sore throat, cough, hoarseness of voice, metallic taste and chest tightness. There was a potential ergonomic problem due to repetitive wrist motion. The authors conclude that a potential hazard from ozone exposure existed. The authors recommend measures to reduce exposures and development of a program for the prevention of cumulative trauma.« less

  14. A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.

    PubMed

    Quan, Yundi; Pickett, Warren E

    2018-02-21

    Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

  15. A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point

    NASA Astrophysics Data System (ADS)

    Quan, Yundi; Pickett, Warren E.

    2018-02-01

    Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

  16. Mobile spin impurity in an optical lattice

    NASA Astrophysics Data System (ADS)

    Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.

    2017-07-01

    We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.

  17. Decision-Theoretic Control of Planetary Rovers

    NASA Technical Reports Server (NTRS)

    Zilberstein, Shlomo; Washington, Richard; Bernstein, Daniel S.; Mouaddib, Abdel-Illah; Morris, Robert (Technical Monitor)

    2003-01-01

    Planetary rovers are small unmanned vehicles equipped with cameras and a variety of sensors used for scientific experiments. They must operate under tight constraints over such resources as operation time, power, storage capacity, and communication bandwidth. Moreover, the limited computational resources of the rover limit the complexity of on-line planning and scheduling. We describe two decision-theoretic approaches to maximize the productivity of planetary rovers: one based on adaptive planning and the other on hierarchical reinforcement learning. Both approaches map the problem into a Markov decision problem and attempt to solve a large part of the problem off-line, exploiting the structure of the plan and independence between plan components. We examine the advantages and limitations of these techniques and their scalability.

  18. Limits on plasma anisotropy in a tail-like magnetic field

    NASA Technical Reports Server (NTRS)

    Hill, T. W.; Voigt, G.-H.

    1992-01-01

    The condition of magnetohydrostatic equilibrium implies tight constraints on the degree of anisotropy that is supportable in a magnetotail field geometry. If the plasma pressure tensor is assumed to be gyrotropic at the tail midplane (z = 0), then equilibrium requires that it also be nearly isotropic there, with P-perpendicular sub 0/P-parallel sub 0 in the range 1 +/- delta square, where delta of about 0.1 is the ratio of the normal field component at the symmetry plane to the field strength in the tail lobe. The upper and the lower limits are essentially equivalent, respectively, to the marginal mirror and firehose stability conditions evaluated at z = 0, which have been invoked previously to limit the degree of anisotropy in the plasma sheet.

  19. Intestinal epithelial barrier function and tight junction proteins with heat and exercise

    PubMed Central

    Zuhl, Micah N.; Moseley, Pope L.

    2015-01-01

    A single layer of enterocytes and tight junctions (intercellular multiprotein complexes) form the intestinal epithelial barrier that controls transport of molecules through transcellular and paracellular pathways. A dysfunctional or “leaky” intestinal tight junction barrier allows augmented permeation of luminal antigens, endotoxins, and bacteria into the blood stream. Various substances and conditions have been shown to affect the maintenance of the intestinal epithelial tight junction barrier. The primary focus of the present review is to analyze the effects of exertional or nonexertional (passive hyperthermia) heat stress on tight junction barrier function in in vitro and in vivo (animals and humans) models. Our secondary focus is to review changes in tight junction proteins in response to exercise or hyperthermic conditions. Finally, we discuss some pharmacological or nutritional interventions that may affect the cellular mechanisms involved in maintaining homeostasis of the intestinal epithelial tight junction barrier during heat stress or exercise. PMID:26359485

  20. Intestinal epithelial barrier function and tight junction proteins with heat and exercise.

    PubMed

    Dokladny, Karol; Zuhl, Micah N; Moseley, Pope L

    2016-03-15

    A single layer of enterocytes and tight junctions (intercellular multiprotein complexes) form the intestinal epithelial barrier that controls transport of molecules through transcellular and paracellular pathways. A dysfunctional or "leaky" intestinal tight junction barrier allows augmented permeation of luminal antigens, endotoxins, and bacteria into the blood stream. Various substances and conditions have been shown to affect the maintenance of the intestinal epithelial tight junction barrier. The primary focus of the present review is to analyze the effects of exertional or nonexertional (passive hyperthermia) heat stress on tight junction barrier function in in vitro and in vivo (animals and humans) models. Our secondary focus is to review changes in tight junction proteins in response to exercise or hyperthermic conditions. Finally, we discuss some pharmacological or nutritional interventions that may affect the cellular mechanisms involved in maintaining homeostasis of the intestinal epithelial tight junction barrier during heat stress or exercise. Copyright © 2016 the American Physiological Society.

  1. Experimental Test of Heisenberg's Measurement Uncertainty Relation Based on Statistical Distances

    NASA Astrophysics Data System (ADS)

    Ma, Wenchao; Ma, Zhihao; Wang, Hengyan; Chen, Zhihua; Liu, Ying; Kong, Fei; Li, Zhaokai; Peng, Xinhua; Shi, Mingjun; Shi, Fazhan; Fei, Shao-Ming; Du, Jiangfeng

    2016-04-01

    Incompatible observables can be approximated by compatible observables in joint measurement or measured sequentially, with constrained accuracy as implied by Heisenberg's original formulation of the uncertainty principle. Recently, Busch, Lahti, and Werner proposed inaccuracy trade-off relations based on statistical distances between probability distributions of measurement outcomes [P. Busch et al., Phys. Rev. Lett. 111, 160405 (2013); P. Busch et al., Phys. Rev. A 89, 012129 (2014)]. Here we reformulate their theoretical framework, derive an improved relation for qubit measurement, and perform an experimental test on a spin system. The relation reveals that the worst-case inaccuracy is tightly bounded from below by the incompatibility of target observables, and is verified by the experiment employing joint measurement in which two compatible observables designed to approximate two incompatible observables on one qubit are measured simultaneously.

  2. Curli mediate bacterial adhesion to fibronectin via tensile multiple bonds

    NASA Astrophysics Data System (ADS)

    Oh, Yoo Jin; Hubauer-Brenner, Michael; Gruber, Hermann J.; Cui, Yidan; Traxler, Lukas; Siligan, Christine; Park, Sungsu; Hinterdorfer, Peter

    2016-09-01

    Many enteric bacteria including pathogenic Escherichia coli and Salmonella strains produce curli fibers that bind to host surfaces, leading to bacterial internalization into host cells. By using a nanomechanical force-sensing approach, we obtained real-time information about the distribution of molecular bonds involved in the adhesion of curliated bacteria to fibronectin. We found that curliated E. coli and fibronectin formed dense quantized and multiple specific bonds with high tensile strength, resulting in tight bacterial binding. Nanomechanical recognition measurements revealed that approximately 10 bonds were disrupted either sequentially or simultaneously under force load. Thus the curli formation of bacterial surfaces leads to multi-bond structural components of fibrous nature, which may explain the strong mechanical binding of curliated bacteria to host cells and unveil the functions of these proteins in bacterial internalization and invasion.

  3. Subwavelength InSb-based Slot wavguides for THz transport: concept and practical implementations.

    PubMed

    Ma, Youqiao; Zhou, Jun; Pištora, Jaromír; Eldlio, Mohamed; Nguyen-Huu, Nghia; Maeda, Hiroshi; Wu, Qiang; Cada, Michael

    2016-12-07

    Seeking better surface plasmon polariton (SPP) waveguides is of critical importance to construct the frequency-agile terahertz (THz) front-end circuits. We propose and investigate here a new class of semiconductor-based slot plasmonic waveguides for subwavelength THz transport. Optimizations of the key geometrical parameters demonstrate its better guiding properties for simultaneous realization of long propagation lengths (up to several millimeters) and ultra-tight mode confinement (~λ 2 /530) in the THz spectral range. The feasibility of the waveguide for compact THz components is also studied to lay the foundations for its practical implementations. Importantly, the waveguide is compatible with the current complementary metal-oxide-semiconductor (CMOS) fabrication technique. We believe the proposed waveguide configuration could offer a potential for developing a CMOS plasmonic platform and can be designed into various components for future integrated THz circuits (ITCs).

  4. Experimental Test of Heisenberg's Measurement Uncertainty Relation Based on Statistical Distances.

    PubMed

    Ma, Wenchao; Ma, Zhihao; Wang, Hengyan; Chen, Zhihua; Liu, Ying; Kong, Fei; Li, Zhaokai; Peng, Xinhua; Shi, Mingjun; Shi, Fazhan; Fei, Shao-Ming; Du, Jiangfeng

    2016-04-22

    Incompatible observables can be approximated by compatible observables in joint measurement or measured sequentially, with constrained accuracy as implied by Heisenberg's original formulation of the uncertainty principle. Recently, Busch, Lahti, and Werner proposed inaccuracy trade-off relations based on statistical distances between probability distributions of measurement outcomes [P. Busch et al., Phys. Rev. Lett. 111, 160405 (2013); P. Busch et al., Phys. Rev. A 89, 012129 (2014)]. Here we reformulate their theoretical framework, derive an improved relation for qubit measurement, and perform an experimental test on a spin system. The relation reveals that the worst-case inaccuracy is tightly bounded from below by the incompatibility of target observables, and is verified by the experiment employing joint measurement in which two compatible observables designed to approximate two incompatible observables on one qubit are measured simultaneously.

  5. Light Water Breeder Reactor fuel rod design and performance characteristics (LWBR Development Program)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Campbell, W.R.; Giovengo, J.F.

    1987-10-01

    Light Water Breeder Reactor (LWBR) fuel rods were designed to provide a reliable fuel system utilizing thorium/uranium-233 mixed-oxide fuel while simultaneously minimizing structural material to enhance fuel breeding. The fuel system was designed to be capable of operating successfully under both load follow and base load conditions. The breeding objective required thin-walled, low hafnium content Zircaloy cladding, tightly spaced fuel rods with a minimum number of support grid levels, and movable fuel rod bundles to supplant control rods. Specific fuel rod design considerations and their effects on performance capability are described. Successful completion of power operations to over 160 percentmore » of design lifetime including over 200 daily load follow cycles has proven the performance capability of the fuel system. 68 refs., 19 figs., 44 tabs.« less

  6. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  7. Tight junctions and human diseases.

    PubMed

    Sawada, Norimasa; Murata, Masaki; Kikuchi, Keisuke; Osanai, Makoto; Tobioka, Hirotoshi; Kojima, Takashi; Chiba, Hideki

    2003-09-01

    Tight junctions are intercellular junctions adjacent to the apical end of the lateral membrane surface. They have two functions, the barrier (or gate) function and the fence function. The barrier function of tight junctions regulates the passage of ions, water, and various macromolecules, even of cancer cells, through paracellular spaces. The barrier function is thus relevant to edema, jaundice, diarrhea, and blood-borne metastasis. On the other hand, the fence function maintains cell polarity. In other words, tight junctions work as a fence to prevent intermixing of molecules in the apical membrane with those in the lateral membrane. This function is deeply involved in cancer cell biology, in terms of loss of cell polarity. Of the proteins comprising tight junctions, integral membrane proteins occludin, claudins, and JAMs have been recently discovered. Of these molecules, claudins are exclusively responsible for the formation of tight-junction strands and are connected with the actin cytoskeleton mediated by ZO-1. Thus, both functions of tight junctions are dependent on the integrity of the actin cytoskeleton as well as ATP. Mutations in the claudin14 and the claudin16 genes result in hereditary deafness and hereditary hypomagnesemia, respectively. Some pathogenic bacteria and viruses target and affect the tight-junction function, leading to diseases. In this review, the relationship between tight junctions and human diseases is summarized.

  8. Influence of Gestational Age at Initiation of Antihypertensive Therapy: Secondary Analysis of CHIPS Trial Data (Control of Hypertension in Pregnancy Study).

    PubMed

    Pels, Anouk; Mol, Ben Willem J; Singer, Joel; Lee, Terry; von Dadelszen, Peter; Ganzevoort, Wessel; Asztalos, Elizabeth; Magee, Laura A

    2018-06-01

    For hypertensive women in CHIPS (Control of Hypertension in Pregnancy Study), we assessed whether the maternal benefits of tight control could be achieved, while minimizing any potentially negative effect on fetal growth, by delaying initiation of antihypertensive therapy until later in pregnancy. For the 981 women with nonsevere, chronic or gestational hypertension randomized to less-tight (target diastolic blood pressure, 100 mm Hg), or tight (target, 85 mm Hg) control, we used mixed-effects logistic regression to examine whether the effect of less-tight (versus tight) control on major outcomes was dependent on gestational age at randomization, adjusting for baseline factors as in the primary analysis and including an interaction term between gestational age at randomization and treatment allocation. Gestational age was considered categorically (quartiles) and continuously (linear or quadratic form), and the optimal functional form selected to provide the best fit to the data based on the Akaike information criterion. Randomization before (but not after) 24 weeks to less-tight (versus tight) control was associated with fewer babies with birth weight <10th centile ( P interaction =0.005), but more preterm birth ( P interaction =0.043), and no effect on perinatal death or high-level neonatal care >48 hours ( P interaction =0.354). For the mother, less-tight (versus tight) control was associated with more severe hypertension at all gestational ages but particularly so before 28 weeks ( P interaction =0.076). In women with nonsevere, chronic, or gestational hypertension, there seems to be no gestational age at which less-tight (versus tight) control is the preferred management strategy to optimize maternal or perinatal outcomes. URL: https://www.isrctn.com. Unique identifier: ISRCTN71416914. © 2018 The Authors.

  9. Decoupling of a tight-fit transceiver phased array for human brain imaging at 9.4T: Loop overlapping rediscovered.

    PubMed

    Avdievich, Nikolai I; Giapitzakis, Ioannis-Angelos; Pfrommer, Andreas; Henning, Anke

    2018-02-01

    To improve the decoupling of a transceiver human head phased array at ultra-high fields (UHF, ≥ 7T) and to optimize its transmit (Tx) and receive (Rx) performance, a single-row eight-element (1 × 8) tight-fit transceiver overlapped loop array was developed and constructed. Overlapping the loops increases the RF field penetration depth but can compromise decoupling by generating substantial mutual resistance. Based on analytical modeling, we optimized the loop geometry and relative positioning to simultaneously minimize the resistive and inductive coupling and constructed a 9.4T eight-loop transceiver head phased array decoupled entirely by overlapping loops. We demonstrated that both the magnetic and electric coupling between adjacent loops is compensated at the same time by overlapping and nearly perfect decoupling (below -30 dB) can be obtained without additional decoupling strategies. Tx-efficiency and SNR of the overlapped array outperformed that of a common UHF gapped array of similar dimensions. Parallel Rx-performance was also not compromised due to overlapping the loops. As a proof of concept we developed and constructed a 9.4T (400 MHz) overlapped transceiver head array based on results of the analytical modeling. We demonstrated that at UHF overlapping loops not only provides excellent decoupling but also improves both Tx- and Rx-performance. Magn Reson Med 79:1200-1211, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  10. Avian Influenza Virus Subtype H9N2 Affects Intestinal Microbiota, Barrier Structure Injury, and Inflammatory Intestinal Disease in the Chicken Ileum.

    PubMed

    Li, Hongxin; Liu, Xiaolin; Chen, Feiyang; Zuo, Kejing; Wu, Che; Yan, Yiming; Chen, Weiguo; Lin, Wencheng; Xie, Qingmei

    2018-05-18

    Avian influenza virus subtype H9N2 (H9N2 AIV) has caused significant losses to the poultry industry due to the high mortality associated with secondary infections attributable to E. coli . This study tries to address the underlying secondary mechanisms after H9N2 AIV infection. Initially, nine day-old specific pathogen-free chickens were assigned to control (uninfected) and H9N2-infected groups, respectively. Using Illumina sequencing, histological examination, and quantitative real-time PCR, it was found that H9N2 AIV caused intestinal microbiota disorder, injury, and inflammatory damage to the intestinal mucosa. Notably, the genera Escherichia , especially E. coli , significantly increased ( p < 0.01) at five days post-infection (dpi), while Lactobacillus , Enterococcus , and other probiotic organisms were significantly reduced ( p < 0.01). Simultaneously, the mRNA expression of tight junction proteins ( ZO-1 , claudin 3, and occludin), TFF2, and Muc2 were significantly reduced ( p < 0.01), indicating the destruction of the intestinal epithelial cell tight junctions and the damage of mucin layer construction. Moreover, the mRNA expression of proinflammatory cytokines IFN-γ, IL-22, IFN-α, and IL-17A in intestinal epithelial cells were significantly upregulated, resulting in the inflammatory response and intestinal injury. Our findings may provide a theoretical basis for observed gastroenteritis-like symptoms such as diarrhea and secondary E. coli infection following H9N2 AIV infection.

  11. Modeling extracellular fields for a three-dimensional network of cells using NEURON.

    PubMed

    Appukuttan, Shailesh; Brain, Keith L; Manchanda, Rohit

    2017-10-01

    Computational modeling of biological cells usually ignores their extracellular fields, assuming them to be inconsequential. Though such an assumption might be justified in certain cases, it is debatable for networks of tightly packed cells, such as in the central nervous system and the syncytial tissues of cardiac and smooth muscle. In the present work, we demonstrate a technique to couple the extracellular fields of individual cells within the NEURON simulation environment. The existing features of the simulator are extended by explicitly defining current balance equations, resulting in the coupling of the extracellular fields of adjacent cells. With this technique, we achieved continuity of extracellular space for a network model, thereby allowing the exploration of extracellular interactions computationally. Using a three-dimensional network model, passive and active electrical properties were evaluated under varying levels of extracellular volumes. Simultaneous intracellular and extracellular recordings for synaptic and action potentials were analyzed, and the potential of ephaptic transmission towards functional coupling of cells was explored. We have implemented a true bi-domain representation of a network of cells, with the extracellular domain being continuous throughout the entire model. This has hitherto not been achieved using NEURON, or other compartmental modeling platforms. We have demonstrated the coupling of the extracellular field of every cell in a three-dimensional model to obtain a continuous uniform extracellular space. This technique provides a framework for the investigation of interactions in tightly packed networks of cells via their extracellular fields. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Higher levels of motor competence are associated with reduced interference in action perception across the lifespan.

    PubMed

    Wermelinger, Stephanie; Gampe, Anja; Daum, Moritz M

    2017-11-07

    Action perception and action production are tightly linked and elicit bi-directional influences on each other when performed simultaneously. In this study, we investigated whether age-related differences in manual fine-motor competence and/or age affect the (interfering) influence of action production on simultaneous action perception. In a cross-sectional eye-tracking study, participants of a broad age range (N = 181, 20-80 years) observed a manual grasp-and-transport action while performing an additional motor or cognitive distractor task. Action perception was measured via participants' frequency of anticipatory gaze shifts towards the action goal. Manual fine-motor competence was assessed with the Motor Performance Series. The interference effect in action perception was greater in the motor than the cognitive distractor task. Furthermore, manual fine-motor competence and age in years were both associated with this interference. The better the participants' manual fine-motor competence and the younger they were, the smaller the interference effect. However, when both influencing factors (age and fine-motor competence) were taken into account, a model including only age-related differences in manual fine-motor competence best fit with our data. These results add to the existing literature that motor competence and its age-related differences influence the interference effects between action perception and production.

  13. Transferable tight-binding model for strained group IV and III-V materials and heterostructures

    NASA Astrophysics Data System (ADS)

    Tan, Yaohua; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

    2016-07-01

    It is critical to capture the effect due to strain and material interface for device level transistor modeling. We introduce a transferable s p3d5s* tight-binding model with nearest-neighbor interactions for arbitrarily strained group IV and III-V materials. The tight-binding model is parametrized with respect to hybrid functional (HSE06) calculations for varieties of strained systems. The tight-binding calculations of ultrasmall superlattices formed by group IV and group III-V materials show good agreement with the corresponding HSE06 calculations. The application of the tight-binding model to superlattices demonstrates that the transferable tight-binding model with nearest-neighbor interactions can be obtained for group IV and III-V materials.

  14. Constraints on Cosmology and Gravity from the Growth of X-ray Luminous Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Mantz, Adam; Allen, S. W.; Rapetti, D.; Ebeling, H.; Drlica-Wagner, A.

    2010-03-01

    I will present simultaneous constraints on galaxy cluster X-ray scaling relations and models of cosmology and gravity obtained from observations of the growth of massive clusters. The data set consists of 238 flux-selected clusters at redshifts z≤0.5 drawn from the ROSAT All-Sky Survey, and incorporates extensive Chandra follow-up observations. Our results on the scaling relations are consistent with excess heating of the intracluster medium, although the evolution of the relations remains consistent with the predictions of simple gravitational collapse models. For spatially flat, constant-w cosmological models, the cluster data yield Ωm=0.23±0.04, σ8=0.82±0.05, and w=-1.01±0.20, including conservative allowances for systematic uncertainties. Our results are consistent and competitive with a variety of independent cosmological data. In evolving-w models, marginalizing over transition redshifts in the range 0.05-1, the combination of the growth of structure data with the cosmic microwave background, supernovae, cluster gas mass fractions and baryon acoustic oscillations constrains the dark energy equation of state at late and early times to be respectively w0=-0.88±0.21 and wet=-1.05+0.20-0.36. Applying this combination of data to the problem of determining fundamental neutrino properties, we place an upper limit on the species-summed neutrino mass at 0.33eV (95% CL) and constrain the effective number of relativistic species to 3.4±0.6. In addition to dark energy and related problems, such data can be used to test the predictions of General Relativity. Introducing the standard Peebles/Linder parametrization of the linear growth rate, we use the cluster data to constrain the growth of structure, independent of the expansion of the Universe. Our analysis provides a tight constraint on the combination γ(σ8/0.8)6.8=0.55+0.13-0.10, and is simultaneously consistent with the predictions of relativity (γ=0.55) and the cosmological constant expansion model. This work was funded by NASA, the U.S. Department of Energy, and Stanford University.

  15. Technical options for processing additional light tight oil volumes within the United States

    EIA Publications

    2015-01-01

    This report examines technical options for processing additional LTO volumes within the United States. Domestic processing of additional LTO would enable an increase in petroleum product exports from the United States, already the world’s largest net exporter of petroleum products. Unlike crude oil, products are not subject to export limitations or licensing requirements. While this is one possible approach to absorbing higher domestic LTO production in the absence of a relaxation of current limitations on crude exports, domestic LTO would have to be priced at a level required to encourage additional LTO runs at existing refinery units, debottlenecking, or possible additions of processing capacity.

  16. Experimental Characterization and Validation of Simultaneous Gust Alleviation and Energy Harvesting for Multifunctional Wing Spars

    DTIC Science & Technology

    2012-08-01

    U0=15m/s,  Lv  =350m   Cloud Wind and Clear Sky Gust Simulation Using Dryden PSD* Harvested Energy from Normal Vibration (Red) to...energy control law based on limited energy constraints 4) Experimentally validated simultaneous energy harvesting and vibration control Summary...Experimental Characterization and Validation of Simultaneous Gust Alleviation and Energy Harvesting for Multifunctional Wing Spars AFOSR

  17. Quantitative analysis on electric dipole energy in Rashba band splitting.

    PubMed

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-09-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

  18. Quantitative analysis on electric dipole energy in Rashba band splitting

    PubMed Central

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-01-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493

  19. Manipulating membrane lipid profiles to restore T-cell function in autoimmunity.

    PubMed

    Waddington, Kirsty E; Jury, Elizabeth C

    2015-08-01

    Plasma membrane lipid rafts are heterogeneous cholesterol and glycosphingolipid (GSL)-enriched microdomains, within which the tight packing of cholesterol with the saturated-acyl chains of GSLs creates a region of liquid-order relative to the surrounding disordered membrane. Thus lipid rafts govern the lateral mobility and interaction of membrane proteins and regulate a plethora of signal transduction events, including T-cell antigen receptor (TCR) signalling. The pathways regulating homoeostasis of membrane cholesterol and GSLs are tightly controlled and alteration of these metabolic processes coincides with immune cell dysfunction as is evident in atherosclerosis, cancer and autoimmunity. Indeed, membrane lipid composition is emerging as an important factor influencing the ability of cells to respond appropriately to microenvironmental stimuli. Consequently, there is increasing interest in targeting membrane lipids or their metabolic control as a novel therapeutic approach to modulate immune cell behaviour and our recent work demonstrates that this is a promising strategy in T-cells from patients with the autoimmune disease systemic lupus erythematosus (SLE). © 2015 Authors; published by Portland Press Limited.

  20. Parameter Prediction of Hydraulic Fracture for Tight Reservoir Based on Micro-Seismic and History Matching

    NASA Astrophysics Data System (ADS)

    Zhang, Kai; Ma, Xiaopeng; Li, Yanlai; Wu, Haiyang; Cui, Chenyu; Zhang, Xiaoming; Zhang, Hao; Yao, Jun

    Hydraulic fracturing is an important measure for the development of tight reservoirs. In order to describe the distribution of hydraulic fractures, micro-seismic diagnostic was introduced into petroleum fields. Micro-seismic events may reveal important information about static characteristics of hydraulic fracturing. However, this method is limited to reflect the distribution area of the hydraulic fractures and fails to provide specific parameters. Therefore, micro-seismic technology is integrated with history matching to predict the hydraulic fracture parameters in this paper. Micro-seismic source location is used to describe the basic shape of hydraulic fractures. After that, secondary modeling is considered to calibrate the parameters information of hydraulic fractures by using DFM (discrete fracture model) and history matching method. In consideration of fractal feature of hydraulic fracture, fractal fracture network model is established to evaluate this method in numerical experiment. The results clearly show the effectiveness of the proposed approach to estimate the parameters of hydraulic fractures.

  1. Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

    DOE PAGES

    Zhang, Hong; Zapol, Peter; Dixon, David A.; ...

    2015-11-17

    The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

  2. Functional analysis of tight junction organization.

    PubMed

    DiBona, D R

    1985-01-01

    The functional basis of tight junction design has been examined from the point of view that this rate-limiting barrier to paracellular transport is a multicompartment system. Review of the osmotic sensitivity of these structures points to the need for this sort of analysis for meaningful correlation of structure and function under a range of conditions. A similar conclusion is drawn with respect to results from voltage-clamping protocols where reversal of spontaneous transmural potential difference elicits parallel changes in both structure and function in much the same way as does reversal of naturally occurring osmotic gradients. In each case, it becomes necessary to regard the junction as a functionally polarized structure to account for observations of its rectifying properties. Lastly, the details of experimentally-induced junction deformation are examined in light of current theories of its organization; arguments are presented in favor of the view that the primary components of intramembranous organization (as viewed with freeze-fracture techniques) are lipidic rather than proteinaceous.

  3. Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hong; Zapol, Peter; Dixon, David A.

    The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

  4. Does the low hole transport mass in <110> and <111> Si nanowires lead to mobility enhancements at high field and stress: A self-consistent tight-binding study

    NASA Astrophysics Data System (ADS)

    Kotlyar, R.; Linton, T. D.; Rios, R.; Giles, M. D.; Cea, S. M.; Kuhn, K. J.; Povolotskyi, Michael; Kubis, Tillmann; Klimeck, Gerhard

    2012-06-01

    The hole surface roughness and phonon limited mobility in the silicon <100>, <110>, and <111> square nanowires under the technologically important conditions of applied gate bias and stress are studied with the self-consistent Poisson-sp3d5s*-SO tight-binding bandstructure method. Under an applied gate field, the hole carriers in a wire undergo a volume to surface inversion transition diminishing the positive effects of the high <110> and <111> valence band nonparabolicities, which are known to lead to the large gains of the phonon limited mobility at a zero field in narrow wires. Nonetheless, the hole mobility in the unstressed wires down to the 5 nm size remains competitive or shows an enhancement at high gate field over the large wire limit. Down to the studied 3 nm sizes, the hole mobility is degraded by strong surface roughness scattering in <100> and <110> wires. The <111> channels are shown to experience less surface scattering degradation. The physics of the surface roughness scattering dependence on wafer and channel orientations in a wire is discussed. The calculated uniaxial compressive channel stress gains of the hole mobility are found to reduce in the narrow wires and at the high field. This exacerbates the stressed mobility degradation with size. Nonetheless, stress gains of a factor of 2 are obtained for <110> wires down to 3 nm size at a 5×1012 cm-2 hole inversion density per gate area.

  5. Tight junctions and the modulation of barrier function in disease

    PubMed Central

    2008-01-01

    Tight junctions create a paracellular barrier in epithelial and endothelial cells protecting them from the external environment. Two different classes of integral membrane proteins constitute the tight junction strands in epithelial cells and endothelial cells, occludin and members of the claudin protein family. In addition, cytoplasmic scaffolding molecules associated with these junctions regulate diverse physiological processes like proliferation, cell polarity and regulated diffusion. In many diseases, disruption of this regulated barrier occurs. This review will briefly describe the molecular composition of the tight junctions and then present evidence of the link between tight junction dysfunction and disease. PMID:18415116

  6. Possible Involvement of Tight Junctions, Extracellular Matrix and Nuclear Receptors in Epithelial Differentiation

    PubMed Central

    Ichikawa-Tomikawa, Naoki; Sugimoto, Kotaro; Satohisa, Seiro; Nishiura, Keisuke; Chiba, Hideki

    2011-01-01

    Tight junctions are intercellular junctions localized at the most apical end of the lateral plasma membrane. They consist of four kinds of transmembrane proteins (occludin, claudins, junctional adhesion molecules, and tricellulin) and huge numbers of scaffolding proteins and contribute to the paracellular barrier and fence function. The mutation and deletion of these proteins impair the functions of tight junctions and cause various human diseases. In this paper, we provide an overview of recent studies on transmembrane proteins of tight junctions and highlight the functional significance of tight junctions, extracellular matrix, and nuclear receptors in epithelial differentiation. PMID:22162632

  7. Less-tight versus tight control of hypertension in pregnancy.

    PubMed

    Magee, Laura A; von Dadelszen, Peter; Rey, Evelyne; Ross, Susan; Asztalos, Elizabeth; Murphy, Kellie E; Menzies, Jennifer; Sanchez, Johanna; Singer, Joel; Gafni, Amiram; Gruslin, Andrée; Helewa, Michael; Hutton, Eileen; Lee, Shoo K; Lee, Terry; Logan, Alexander G; Ganzevoort, Wessel; Welch, Ross; Thornton, Jim G; Moutquin, Jean-Marie

    2015-01-29

    The effects of less-tight versus tight control of hypertension on pregnancy complications are unclear. We performed an open, international, multicenter trial involving women at 14 weeks 0 days to 33 weeks 6 days of gestation who had nonproteinuric preexisting or gestational hypertension, office diastolic blood pressure of 90 to 105 mm Hg (or 85 to 105 mm Hg if the woman was taking antihypertensive medications), and a live fetus. Women were randomly assigned to less-tight control (target diastolic blood pressure, 100 mm Hg) or tight control (target diastolic blood pressure, 85 mm Hg). The composite primary outcome was pregnancy loss or high-level neonatal care for more than 48 hours during the first 28 postnatal days. The secondary outcome was serious maternal complications occurring up to 6 weeks post partum or until hospital discharge, whichever was later. Included in the analysis were 987 women; 74.6% had preexisting hypertension. The primary-outcome rates were similar among 493 women assigned to less-tight control and 488 women assigned to tight control (31.4% and 30.7%, respectively; adjusted odds ratio, 1.02; 95% confidence interval [CI], 0.77 to 1.35), as were the rates of serious maternal complications (3.7% and 2.0%, respectively; adjusted odds ratio, 1.74; 95% CI, 0.79 to 3.84), despite a mean diastolic blood pressure that was higher in the less-tight-control group by 4.6 mm Hg (95% CI, 3.7 to 5.4). Severe hypertension (≥160/110 mm Hg) developed in 40.6% of the women in the less-tight-control group and 27.5% of the women in the tight-control group (P<0.001). We found no significant between-group differences in the risk of pregnancy loss, high-level neonatal care, or overall maternal complications, although less-tight control was associated with a significantly higher frequency of severe maternal hypertension. (Funded by the Canadian Institutes of Health Research; CHIPS Current Controlled Trials number, ISRCTN71416914; ClinicalTrials.gov number, NCT01192412.).

  8. An Objective Measure of Noseband Tightness and Its Measurement Using a Novel Digital Tightness Gauge.

    PubMed

    Doherty, Orla; Conway, Thomas; Conway, Richard; Murray, Gerard; Casey, Vincent

    2017-01-01

    Noseband tightness is difficult to assess in horses participating in equestrian sports such as dressage, show jumping and three-day-eventing. There is growing concern that nosebands are commonly tightened to such an extent as to restrict normal equine behaviour and possibly cause injury. In the absence of a clear agreed definition of noseband tightness, a simple model of the equine nose-noseband interface environment was developed in order to guide further studies in this area. The normal force component of the noseband tensile force was identified as the key contributor to sub-noseband tissue compression. The model was used to inform the design of a digital tightness gauge which could reliably measure the normal force component of the noseband tensile force. A digital tightness gauge was developed to measure this parameter under nosebands fitted to bridled horses. Results are presented for field tests using two prototype designs. Prototype version three was used in field trial 1 (n = 15, frontal nasal plane sub-noseband site). Results of this trial were used to develop an ergonomically designed prototype, version 4, which was tested in a second field trial (n = 12, frontal nasal plane and lateral sub-noseband site). Nosebands were set to three tightness settings in each trial as judged by a single rater using an International Society for Equitation Science (ISES) taper gauge. Normal forces in the range 7-95 N were recorded at the frontal nasal plane while a lower range 1-28 N was found at the lateral site for the taper gauge range used in the trials. The digital tightness gauge was found to be simple to use, reliable, and safe and its use did not agitate the animals in any discernable way. A simple six point tightness scale is suggested to aid regulation implementation and the control of noseband tightness using normal force measurement as the objective tightness discriminant.

  9. Potential evaluation of CO2 storage and enhanced oil recovery of tight oil reservoir in the Ordos Basin, China.

    PubMed

    Tian, Xiaofeng; Cheng, Linsong; Cao, Renyi; Zhang, Miaoyi; Guo, Qiang; Wang, Yimin; Zhang, Jian; Cui, Yu

    2015-07-01

    Carbon -di-oxide (CO2) is regarded as the most important greenhouse gas to accelerate climate change and ocean acidification. The Chinese government is seeking methods to reduce anthropogenic CO2 gas emission. CO2 capture and geological storage is one of the main methods. In addition, injecting CO2 is also an effective method to replenish formation energy in developing tight oil reservoirs. However, exiting methods to estimate CO2 storage capacity are all based on the material balance theory. This was absolutely correct for normal reservoirs. However, as natural fractures widely exist in tight oil reservoirs and majority of them are vertical ones, tight oil reservoirs are not close. Therefore, material balance theory is not adaptive. In the present study, a new method to calculate CO2 storage capacity is presented. The CO2 effective storage capacity, in this new method, consisted of free CO2, CO2 dissolved in oil and CO2 dissolved in water. Case studies of tight oil reservoir from Ordos Basin was conducted and it was found that due to far lower viscosity of CO2 and larger solubility in oil, CO2 could flow in tight oil reservoirs more easily. As a result, injecting CO2 in tight oil reservoirs could obviously enhance sweep efficiency by 24.5% and oil recovery efficiency by 7.5%. CO2 effective storage capacity of Chang 7 tight oil reservoir in Longdong area was 1.88 x 10(7) t. The Chang 7 tight oil reservoir in Ordos Basin was estimated to be 6.38 x 10(11) t. As tight oil reservoirs were widely distributed in Songliao Basin, Sichuan Basin and so on, geological storage capacity of CO2 in China is potential.

  10. The potential of inductively coupled plasma mass spectrometry (ICP-MS) for the simultaneous determination of trace elements in whole blood, plasma and serum.

    PubMed

    Krachler, M; Irgolic, K J

    1999-11-01

    The advantages accruing to biochemical and clinical investigations from a method that allows the simultaneous quantification (RSD < or = 10%) of many elements in blood, plasma, and serum at concentrations equal to one-hundredth of the lower limits of the normal ranges are undeniable. The suitability of inductively coupled argon plasma low-resolution quadrupole mass spectrometry (ICP-MS), a simultaneous method with low detection limits, is evaluated for the quantification of inorganic constituents in whole blood, plasma, and serum with consideration of the dilution associated with the mineralization of the samples, of isobaric and polyatomic interferences and of normal ranges. Of the 3 bulk elements, the 3 major electrolytes, the 15 essential elements, the 8 toxic elements, the 4 therapeutic elements, and the 14 elements of potential interest (total of 47 elements) only 7 elements (Ca, Cu, K, Mg, Rb, Sr, Zn) can be simultaneously quantified under these rigorous conditions in serum and only 8 elements (additional element Pb) in whole blood. Quantification of elements in the Seronorm Standards "Whole Blood" and "Serum" showed, that this list of simultaneously determinable elements in these matrices is reasonable. Although this list is disappointingly short, the number of elements determinable simultaneously by ICP-MS is still larger than that by ICP-AES or GFAAS. Improved detectors, more efficient nebulizers, avoidance of interferences, better instrument design, and high-resolution mass spectrometers promise to increase the number of elements that can be determined simultaneously.

  11. Self-Directed Cooperative Planetary Rovers

    NASA Technical Reports Server (NTRS)

    Zilberstein, Shlomo; Morris, Robert (Technical Monitor)

    2003-01-01

    The project is concerned with the development of decision-theoretic techniques to optimize the scientific return of planetary rovers. Planetary rovers are small unmanned vehicles equipped with cameras and a variety of sensors used for scientific experiments. They must operate under tight constraints over such resources as operation time, power, storage capacity, and communication bandwidth. Moreover, the limited computational resources of the rover limit the complexity of on-line planning and scheduling. We have developed a comprehensive solution to this problem that involves high-level tools to describe a mission; a compiler that maps a mission description and additional probabilistic models of the components of the rover into a Markov decision problem; and algorithms for solving the rover control problem that are sensitive to the limited computational resources and high-level of uncertainty in this domain.

  12. Maximizing the information learned from finite data selects a simple model

    NASA Astrophysics Data System (ADS)

    Mattingly, Henry H.; Transtrum, Mark K.; Abbott, Michael C.; Machta, Benjamin B.

    2018-02-01

    We use the language of uninformative Bayesian prior choice to study the selection of appropriately simple effective models. We advocate for the prior which maximizes the mutual information between parameters and predictions, learning as much as possible from limited data. When many parameters are poorly constrained by the available data, we find that this prior puts weight only on boundaries of the parameter space. Thus, it selects a lower-dimensional effective theory in a principled way, ignoring irrelevant parameter directions. In the limit where there are sufficient data to tightly constrain any number of parameters, this reduces to the Jeffreys prior. However, we argue that this limit is pathological when applied to the hyperribbon parameter manifolds generic in science, because it leads to dramatic dependence on effects invisible to experiment.

  13. Data multiplexing in radio interferometric calibration

    NASA Astrophysics Data System (ADS)

    Yatawatta, Sarod; Diblen, Faruk; Spreeuw, Hanno; Koopmans, L. V. E.

    2018-03-01

    New and upcoming radio interferometers will produce unprecedented amount of data that demand extremely powerful computers for processing. This is a limiting factor due to the large computational power and energy costs involved. Such limitations restrict several key data processing steps in radio interferometry. One such step is calibration where systematic errors in the data are determined and corrected. Accurate calibration is an essential component in reaching many scientific goals in radio astronomy and the use of consensus optimization that exploits the continuity of systematic errors across frequency significantly improves calibration accuracy. In order to reach full consensus, data at all frequencies need to be calibrated simultaneously. In the SKA regime, this can become intractable if the available compute agents do not have the resources to process data from all frequency channels simultaneously. In this paper, we propose a multiplexing scheme that is based on the alternating direction method of multipliers with cyclic updates. With this scheme, it is possible to simultaneously calibrate the full data set using far fewer compute agents than the number of frequencies at which data are available. We give simulation results to show the feasibility of the proposed multiplexing scheme in simultaneously calibrating a full data set when a limited number of compute agents are available.

  14. 18 CFR 270.304 - Tight formation gas.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... determination that natural gas is tight formation gas must file with the jurisdictional agency an application... formation; (d) A complete copy of the well log, including the log heading identifying the designated tight...

  15. Gastrocnemius tightness on joint angle and work of lower extremity during gait.

    PubMed

    You, Jia-Yuan; Lee, Hsin-Min; Luo, Hong-Ji; Leu, Chwan-Chin; Cheng, Pen-Gang; Wu, Shyi-Kuen

    2009-11-01

    Muscular tightness is a common clinical musculoskeletal disorder and is regarded as a predisposing factor for muscle injuries. In this study, a two-way mixed design ANOVA was applied to investigate the effects of the gastrocnemius tightness on the joint angle and joint work during walking. Twenty-two patients with muscular tightness of gastrocnemius muscle (<12 degrees of ankle dorsiflexion with knee extended) and 22 age- and gender-matched subjects with normal gastrocnemius flexibility (>15 degrees of ankle dorsiflexion with knee extended) participated in this study. The joint angle and work at hip, knee, and ankle joints during the stance phase were analyzed at two preset cadences of 100 steps/min and 140 steps/min. Significantly greater flexion angles at hip (P=0.025) and knee (P=0.001) were found in the tightness group at the time of maximal ankle dorsiflexion. Significantly less work generation at knee (P=0.034) and greater work absorption at ankle (P=0.024) were detected in the tightness group. The subjects with gastrocnemius tightness revealed a compensatory gait pattern, which included the changes in the joint angles and associated work productions. The potential disturbance of the knee control and strain injuries of plantar flexors might be crucial in the clinical considerations for subjects with gastrocnemius tightness.

  16. Adaptive tight frame based medical image reconstruction: a proof-of-concept study for computed tomography

    NASA Astrophysics Data System (ADS)

    Zhou, Weifeng; Cai, Jian-Feng; Gao, Hao

    2013-12-01

    A popular approach for medical image reconstruction has been through the sparsity regularization, assuming the targeted image can be well approximated by sparse coefficients under some properly designed system. The wavelet tight frame is such a widely used system due to its capability for sparsely approximating piecewise-smooth functions, such as medical images. However, using a fixed system may not always be optimal for reconstructing a variety of diversified images. Recently, the method based on the adaptive over-complete dictionary that is specific to structures of the targeted images has demonstrated its superiority for image processing. This work is to develop the adaptive wavelet tight frame method image reconstruction. The proposed scheme first constructs the adaptive wavelet tight frame that is task specific, and then reconstructs the image of interest by solving an l1-regularized minimization problem using the constructed adaptive tight frame system. The proof-of-concept study is performed for computed tomography (CT), and the simulation results suggest that the adaptive tight frame method improves the reconstructed CT image quality from the traditional tight frame method.

  17. Measurement and Visualization of Tight Rock Exposed to CO2 Using NMR Relaxometry and MRI

    PubMed Central

    Wang, Haitao; Lun, Zengmin; Lv, Chengyuan; Lang, Dongjiang; Ji, Bingyu; Luo, Ming; Pan, Weiyi; Wang, Rui; Gong, Kai

    2017-01-01

    Understanding mechanisms of oil mobilization of tight matrix during CO2 injection is crucial for CO2 enhanced oil recovery (EOR) and sequestration engineering design. In this study exposure behavior between CO2 and tight rock of the Ordos Basin has been studied experimentally by using nuclear magnetic resonance transverse relaxation time (NMR T2) spectrum and magnetic resonance imaging (MRI) under the reservoir pressure and temperature. Quantitative analysis of recovery at the pore scale and visualization of oil mobilization are achieved. Effects of CO2 injection, exposure times and pressure on recovery performance have been investigated. The experimental results indicate that oil in all pores can be gradually mobilized to the surface of rock by CO2 injection. Oil mobilization in tight rock is time-consuming while oil on the surface of tight rock can be mobilized easily. CO2 injection can effectively mobilize oil in all pores of tight rock, especially big size pores. This understanding of process of matrix exposed to CO2 could support the CO2 EOR in tight reservoirs. PMID:28281697

  18. Transcriptomic Studies of Malaria: a Paradigm for Investigation of Systemic Host-Pathogen Interactions

    PubMed Central

    2018-01-01

    SUMMARY Transcriptomics, the analysis of genome-wide RNA expression, is a common approach to investigate host and pathogen processes in infectious diseases. Technical and bioinformatic advances have permitted increasingly thorough analyses of the association of RNA expression with fundamental biology, immunity, pathogenesis, diagnosis, and prognosis. Transcriptomic approaches can now be used to realize a previously unattainable goal, the simultaneous study of RNA expression in host and pathogen, in order to better understand their interactions. This exciting prospect is not without challenges, especially as focus moves from interactions in vitro under tightly controlled conditions to tissue- and systems-level interactions in animal models and natural and experimental infections in humans. Here we review the contribution of transcriptomic studies to the understanding of malaria, a parasitic disease which has exerted a major influence on human evolution and continues to cause a huge global burden of disease. We consider malaria a paradigm for the transcriptomic assessment of systemic host-pathogen interactions in humans, because much of the direct host-pathogen interaction occurs within the blood, a readily sampled compartment of the body. We illustrate lessons learned from transcriptomic studies of malaria and how these lessons may guide studies of host-pathogen interactions in other infectious diseases. We propose that the potential of transcriptomic studies to improve the understanding of malaria as a disease remains partly untapped because of limitations in study design rather than as a consequence of technological constraints. Further advances will require the integration of transcriptomic data with analytical approaches from other scientific disciplines, including epidemiology and mathematical modeling. PMID:29695497

  19. The Relationship between Membrane Potential and Calcium Dynamics in Glucose-Stimulated Beta Cell Syncytium in Acute Mouse Pancreas Tissue Slices

    PubMed Central

    Miller, Evan W.; Slak Rupnik, Marjan

    2013-01-01

    Oscillatory electrical activity is regarded as a hallmark of the pancreatic beta cell glucose-dependent excitability pattern. Electrophysiologically recorded membrane potential oscillations in beta cells are associated with in-phase oscillatory cytosolic calcium activity ([Ca2+]i) measured with fluorescent probes. Recent high spatial and temporal resolution confocal imaging revealed that glucose stimulation of beta cells in intact islets within acute tissue slices produces a [Ca2+]i change with initial transient phase followed by a plateau phase with highly synchronized [Ca2+]i oscillations. Here, we aimed to correlate the plateau [Ca2+]i oscillations with the oscillations of membrane potential using patch-clamp and for the first time high resolution voltage-sensitive dye based confocal imaging. Our results demonstrated that the glucose-evoked membrane potential oscillations spread over the islet in a wave-like manner, their durations and wave velocities being comparable to the ones for [Ca2+]i oscillations and waves. High temporal resolution simultaneous records of membrane potential and [Ca2+]i confirmed tight but nevertheless limited coupling of the two processes, with membrane depolarization preceding the [Ca2+]i increase. The potassium channel blocker tetraethylammonium increased the velocity at which oscillations advanced over the islet by several-fold while, at the same time, emphasized differences in kinetics of the membrane potential and the [Ca2+]i. The combination of both imaging techniques provides a powerful tool that will help us attain deeper knowledge of the beta cell network. PMID:24324777

  20. Ultrasmall Fe2GeO4 nanodots anchored on interconnected carbon nanosheets as high-performance anode materials for lithium and sodium ion batteries

    NASA Astrophysics Data System (ADS)

    Han, Jinzhi; Qin, Jian; Guo, Lichao; Qin, Kaiqiang; Zhao, Naiqin; Shi, Chunsheng; Liu, Enzuo; He, Fang; Ma, Liying; He, Chunnian

    2018-01-01

    Poor intrinsic conductivity and huge volume expansion during charge/discharge process greatly limit the development of Ge-based ternary oxide as anode material for both lithium-ion batteries and sodium-ion batteries. To alleviate these issues, an ideal strategy is developed to achieve active particle nanocrystallization and composite with conductive carbon materials, simultaneously. Therefore, ultrasmall Fe2GeO4 nanodots (∼4.6 nm) uniformly and tightly anchored on 3D interconnected N-doped ultrathin carbon nanosheets (3D Fe2GeO4/N-CNSs) were constructed via one-step high temperature calcination process. This unique hybrid nanostructure can not only effectively enhance electron conductivity but also restrict the aggregation and volume fluctuation of Fe2GeO4 during the charge/discharge process. As a result, the 3D Fe2GeO4/N-CNSs electrode exhibited excellent electrochemical performances for both lithium-ion and sodium-ion battery anodes. When utilized for lithium-ion battery anode, the electrode delivered a highly reversible specific capacity (1280 mA h g-1 at 0.4 A g-1 after 180 cycles). It is the first time that Fe2GeO4 was applied for sodium-ion battery anode, which showed a remarkable rate capability (350 mA h g-1 at 0.1 A g-1 and 180 mA h g-1 at 22.8 A g-1), and ultralong cycling stability (∼86% reversible capacity retention after 6000 cycles).

  1. Steel Sheet Piles - Applications and Elementary Design Issues

    NASA Astrophysics Data System (ADS)

    Sobala, Dariusz; Rybak, Jarosław

    2017-10-01

    High-intensity housing having been carried out in town’s centres causes that many complex issues related to earthworks and foundations must be resolved. Project owners are required to ensure respective number of parking bays, which in turn demands 2-3 storeys of underground car parks. It is especially difficult to fulfil in dense buildings of old town areas where apart from engineering problems, very stringent requirements of heritage conservator supervision are also raised. The problems with ensuring stability of excavation sidewalls need to be, at the same time, dealt with analysis of foundations of neighbouring structures, and possible strengthening them at the stages of installing the excavation protection walls, progressing the excavations and constructing basement storeys. A separate problem refers to necessity of constructing underground storeys below the level of local groundwater. This requires long-term lowering of water table inside excavation while at possibly limited intervention in hydrological regime beyond the project in progress. In river valleys such “hoarding off” the excavation and cutting off groundwater leads to temporary or permanent disturbances of groundwater run-off and local swellings. Traditional way to protect vertical fault and simultaneously to cut-off groundwater inflow consists in application of steel sheet pilings. They enable to construct monolithic reinforced concrete structures of underground storeys thus ensuring both their tightness and high rigidity of foundation. Depending on situation, steel sheet pilings can be in retrieving or staying-in-place versions. This study deals with some selected aspects of engineering design and fabrication of sheet piling for deep excavations and underground parts of buildings.

  2. Rice Husk Silica-Derived Nanomaterials for Battery Applications: A Literature Review.

    PubMed

    Shen, Yafei

    2017-02-08

    Silica-rich rice husk (RH) is an abundant and sustainable agricultural waste. The recovery of value-added products from RH or its ash to explore an economic way for the valorization of agricultural wastes has attracted wide attention. For instance, RH can be converted to biofuels and biochars simultaneously via thermochemical processes. In general, the applications of RH biochars include soil remediation, pollutant removal, silicon battery materials, and so forth. This review concludes recent progress in the synthesis of RH-derived silicon materials for lithium-ion battery (LIB) applications. Silica nanomaterials produced from RH are initially discussed. RH amorphous silica can also be fabricated to crystal silicon used for battery materials via widely used magnesiothermic reduction. However, the RH-derived Si nanoparticles suffer from a low Coulombic efficiency in the initial charge/discharge and limited cycle life as anode materials due to high surface reactions and low thermodynamic stability. The synthesis of Si materials with nano/microhierarchical structure would be an ideal way to improve their electrochemical performances. Embedding nano-Si into 3D conductive matrix is an effective way to improve the structural stability. Among the Si/carbon composite materials, carbon nanotubdes (CNTs) are a promising matrix due to the wired morphology, high electronic conductivity, and robust structure. Additionally, CNTs can easily form 3D cross-linked conducting networks, ensuring effective electron transportation among active particles. Si nanomaterials with microhierarchical structures in which CNTs are tightly intertwined between the RH-derived Si nanoparticles have been proven to be ideal LIB anode materials.

  3. Enhanced Antitumorigenic Effects in Glioblastoma on Double Targeting of Pleiotrophin and Its Receptor ALK1

    PubMed Central

    Grzelinski, Marius; Steinberg, Florian; Martens, Tobias; Czubayko, Frank; Lamszus, Katrin; Aigner, Achim

    2009-01-01

    In adults, glioblastomas are the most lethal and most frequent malignant brain tumors, and the poor prognosis despite aggressive treatment indicates the need to establish novel targets for molecular intervention. The secreted growth factor pleiotrophin (PTN, HB-GAM, HBNF, OSF-1) shows mitogenic, chemotactic, and transforming activity. Whereas PTN expression is tightly regulated during embryogenesis and is very limited in normal adult tissues, a marked PTN up-regulation is seen in tumors including glioblastomas. Likewise, the PTN receptor anaplastic lymphoma kinase (ALK) has been shown previously to be upregulated and functionally relevant in glioblastoma. In this study, we explore the antitumorigenic effects of the simultaneous ribozyme-mediated knockdown of both receptor and ligand. Various glioblastoma cell lines are analyzed for PTN and ALK expression. Beyond the individual efficacies of several specific ribozymes against PTN or ALK, respectively, antiproliferative and proapoptotic effects of a single gene targeting approach are strongly enhanced on double knockdown of both genes in vitro. More importantly, this results in the abolishment of tumor growth in an in vivo subcutaneous tumor xenograft model. Finally, the analysis of various downstream signaling pathways by antibody arrays reveals a distinct pattern of changes in the activation of signal transduction molecules on PTN/ALK double knockdown. Beyond the already known ones, it identifies additional pathways relevant for PTN/ALK signaling. We conclude that double targeting of PTN and ALK leads to enhanced antitumorigenic effects over single knockdown approaches, which offers novel therapeutic options owing to increased efficacy also after prolonged knockdown. PMID:19177199

  4. Transcriptomic Studies of Malaria: a Paradigm for Investigation of Systemic Host-Pathogen Interactions.

    PubMed

    Lee, Hyun Jae; Georgiadou, Athina; Otto, Thomas D; Levin, Michael; Coin, Lachlan J; Conway, David J; Cunnington, Aubrey J

    2018-06-01

    Transcriptomics, the analysis of genome-wide RNA expression, is a common approach to investigate host and pathogen processes in infectious diseases. Technical and bioinformatic advances have permitted increasingly thorough analyses of the association of RNA expression with fundamental biology, immunity, pathogenesis, diagnosis, and prognosis. Transcriptomic approaches can now be used to realize a previously unattainable goal, the simultaneous study of RNA expression in host and pathogen, in order to better understand their interactions. This exciting prospect is not without challenges, especially as focus moves from interactions in vitro under tightly controlled conditions to tissue- and systems-level interactions in animal models and natural and experimental infections in humans. Here we review the contribution of transcriptomic studies to the understanding of malaria, a parasitic disease which has exerted a major influence on human evolution and continues to cause a huge global burden of disease. We consider malaria a paradigm for the transcriptomic assessment of systemic host-pathogen interactions in humans, because much of the direct host-pathogen interaction occurs within the blood, a readily sampled compartment of the body. We illustrate lessons learned from transcriptomic studies of malaria and how these lessons may guide studies of host-pathogen interactions in other infectious diseases. We propose that the potential of transcriptomic studies to improve the understanding of malaria as a disease remains partly untapped because of limitations in study design rather than as a consequence of technological constraints. Further advances will require the integration of transcriptomic data with analytical approaches from other scientific disciplines, including epidemiology and mathematical modeling. Copyright © 2018 Lee et al.

  5. A permeability barrier surrounds taste buds in lingual epithelia

    PubMed Central

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa

    2014-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003–1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste. PMID:25209263

  6. Ant trophallactic networks: simultaneous measurement of interaction patterns and food dissemination

    NASA Astrophysics Data System (ADS)

    Greenwald, Efrat; Segre, Enrico; Feinerman, Ofer

    2015-07-01

    Eusocial societies and ants, in particular, maintain tight nutritional regulation at both individual and collective levels. The mechanisms that underlie this control are far from trivial since, in these distributed systems, information about the global supply and demand is not available to any single individual. Here we present a novel technique for non-intervening frequent measurement of the food load of all individuals in an ant colony, including during trophallactic events in which food is transferred by mouth-to-mouth feeding. Ants are imaged using a dual camera setup that produces both barcode-based identification and fluorescence measurement of labeled food. This system provides detailed measurements that enable one to quantitatively study the adaptive food distribution network. To demonstrate the capabilities of our method, we present sample observations that were unattainable using previous techniques, and could provide insight into the mechanisms underlying food exchange.

  7. Subtle spectral effects accompanying the assembly of bacteriochlorophylls into cyclic light harvesting complexes revealed by high-resolution fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Rätsep, Margus; Pajusalu, Mihkel; Linnanto, Juha Matti; Freiberg, Arvi

    2014-10-01

    We have observed that an assembly of the bacteriochloropyll a molecules into B850 and B875 groups of cyclic bacterial light-harvesting complexes LH2 and LH1, respectively, results an almost total loss of the intra-molecular vibronic structure in the fluorescence spectrum, and simultaneously, an essential enhancement of its phonon sideband due to electron-phonon coupling. While the suppression of the vibronic coupling in delocalized (excitonic) molecular systems is predictable, as also confirmed by our model calculations, a boost of the electron-phonon coupling is rather unexpected. The latter phenomenon is explained by exciton self-trapping, promoted by mixing the molecular exciton states with charge transfer states between the adjacent chromophores in the tightly packed B850 and B875 arrangements. Similar, although less dramatic trends were noted for the light-harvesting complexes containing chlorophyll pigments.

  8. A Small-Area and Low-Power SoC for Less-Invasive Pressure Sensing Capsules in Ambulatory Urodynamic Monitoring

    NASA Astrophysics Data System (ADS)

    Iwato, Hirofumi; Sakanushi, Keishi; Takeuchi, Yoshinori; Imai, Masaharu

    To measure the detrusor pressure for diagnosing lower urinary tract symptoms, we designed a small-area and low-power System on a Chip (SoC). The SoC should be small and low power because it is encapsulated in tiny air-tight capsules which are simultaneously inserted in the urinary bladder and rectum for several days. Since the SoC is also required to be programmable, we designed an Application Specific Instruction set Processor (ASIP) for pressure measurement and wireless communication, and implemented almost required functions on the ASIP. The SoC was fabricated using a 0.18µm CMOS mixed-signal process and the chip size is 2.5×2.5mm2. Evaluation results show that the power consumption of the SoC is 93.5µW, and that it can operate the capsule for seven days with a tiny battery.

  9. Hydrostatic pressure decreases membrane fluidity and lipid desaturase expression in chondrocyte progenitor cells.

    PubMed

    Montagne, Kevin; Uchiyama, Hiroki; Furukawa, Katsuko S; Ushida, Takashi

    2014-01-22

    Membrane biomechanical properties are critical in modulating nutrient and metabolite exchange as well as signal transduction. Biological membranes are predominantly composed of lipids, cholesterol and proteins, and their fluidity is tightly regulated by cholesterol and lipid desaturases. To determine whether such membrane fluidity regulation occurred in mammalian cells under pressure, we investigated the effects of pressure on membrane lipid order of mouse chondrogenic ATDC5 cells and desaturase gene expression. Hydrostatic pressure linearly increased membrane lipid packing and simultaneously repressed lipid desaturase gene expression. We also showed that cholesterol mimicked and cholesterol depletion reversed those effects, suggesting that desaturase gene expression was controlled by the membrane physical state itself. This study demonstrates a new effect of hydrostatic pressure on mammalian cells and may help to identify the molecular mechanisms involved in hydrostatic pressure sensing in chondrocytes. © 2013 Elsevier Ltd. All rights reserved.

  10. Cognition in action: imaging brain/body dynamics in mobile humans.

    PubMed

    Gramann, Klaus; Gwin, Joseph T; Ferris, Daniel P; Oie, Kelvin; Jung, Tzyy-Ping; Lin, Chin-Teng; Liao, Lun-De; Makeig, Scott

    2011-01-01

    We have recently developed a mobile brain imaging method (MoBI), that allows for simultaneous recording of brain and body dynamics of humans actively behaving in and interacting with their environment. A mobile imaging approach was needed to study cognitive processes that are inherently based on the use of human physical structure to obtain behavioral goals. This review gives examples of the tight coupling between human physical structure with cognitive processing and the role of supraspinal activity during control of human stance and locomotion. Existing brain imaging methods for actively behaving participants are described and new sensor technology allowing for mobile recordings of different behavioral states in humans is introduced. Finally, we review recent work demonstrating the feasibility of a MoBI system that was developed at the Swartz Center for Computational Neuroscience at the University of California, San Diego, demonstrating the range of behavior that can be investigated with this method.

  11. Flight Control Development for the ARH-70 Armed Reconnaissance Helicopter Program

    NASA Technical Reports Server (NTRS)

    Christensen, Kevin T.; Campbell, Kip G.; Griffith, Carl D.; Ivler, Christina M.; Tischler, Mark B.; Harding, Jeffrey W.

    2008-01-01

    In July 2005, Bell Helicopter won the U.S. Army's Armed Reconnaissance Helicopter competition to produce a replacement for the OH-58 Kiowa Warrior capable of performing the armed reconnaissance mission. To meet the U.S. Army requirement that the ARH-70A have Level 1 handling qualities for the scout rotorcraft mission task elements defined by ADS-33E-PRF, Bell equipped the aircraft with their generic automatic flight control system (AFCS). Under the constraints of the tight ARH-70A schedule, the development team used modem parameter identification and control law optimization techniques to optimize the AFCS gains to simultaneously meet multiple handling qualities design criteria. This paper will show how linear modeling, control law optimization, and simulation have been used to produce a Level 1 scout rotorcraft for the U.S. Army, while minimizing the amount of flight testing required for AFCS development and handling qualities evaluation of the ARH-70A.

  12. Chemodetection and Destruction of Host Urea Allows Helicobacter pylori to Locate the Epithelium

    PubMed Central

    Huang, Julie Y.; Sweeney, Emily Goers; Sigal, Michael; Zhang, Hai C.; Remington, S. James; Cantrell, Michael A.; Kuo, Calvin J.; Guillemin, Karen; Amieva, Manuel R.

    2015-01-01

    SUMMARY The gastric pathogen Helicobacter pylori interacts intimately with the gastric mucosa to avoid the microbicidal acid in the stomach lumen. The cues H. pylori senses to locate and colonize the gastric epithelium have not been well defined. We show that metabolites emanating from human gastric organoids rapidly attract H. pylori. This response is largely controlled by the bacterial chemoreceptor TlpB, and the main attractant emanating from epithelia is urea. Our previous structural analyses show that TlpB binds urea with high affinity. Here we demonstrate that this tight binding controls highly sensitive responses, allowing detection of urea concentrations as low as 50 nanomolar. Attraction to urea requires that H. pylori urease simultaneously destroys the signal. We propose that H. pylori has evolved a sensitive urea chemodetection and destruction system that allows the bacterium to dynamically and locally modify the host environment to locate the epithelium. PMID:26269952

  13. Helioviewer.org: Enhanced Solar & Heliospheric Data Visualization

    NASA Astrophysics Data System (ADS)

    Stys, J. E.; Ireland, J.; Hughitt, V. K.; Mueller, D.

    2013-12-01

    Helioviewer.org enables the simultaneous exploration of multiple heterogeneous solar data sets. In the latest iteration of this open-source web application, Hinode XRT and Yohkoh SXT join SDO, SOHO, STEREO, and PROBA2 as supported data sources. A newly enhanced user-interface expands the utility of Helioviewer.org by adding annotations backed by data from the Heliospheric Events Knowledgebase (HEK). Helioviewer.org can now overlay solar feature and event data via interactive marker pins, extended regions, data labels, and information panels. An interactive time-line provides enhanced browsing and visualization to image data set coverage and solar events. The addition of a size-of-the-Earth indicator provides a sense of the scale to solar and heliospheric features for education and public outreach purposes. Tight integration with the Virtual Solar Observatory and SDO AIA cutout service enable solar physicists to seamlessly import science data into their SSW/IDL or SunPy/Python data analysis environments.

  14. Meant to make a difference, the clinical experience of minimally invasive endodontics with the self-adjusting file system in India.

    PubMed

    Pawar, Ajinkya M; Pawar, Mansing G; Kokate, Sharad R

    2014-01-01

    The vital steps in any endodontic treatment are thorough mechanical shaping and chemical cleaning followed by obtaining a fluid tight impervious seal by an inert obturating material. For the past two decades, introduction and use of rotary nickel-titanium (Ni-Ti) files have changed our concepts of endodontic treatment from conventional to contemporary. They have reported good success rates, but still have many drawbacks. The Self-Adjusting File (SAF) introduces a new era in endodontics by performing the vital steps of shaping and cleaning simultaneously. The SAF is a hollow file in design that adapts itself three-dimensionally to the root canal and is a single file system, made up of Ni-Ti lattice. The case series presented in the paper report the clinical experience, while treating primary endodontic cases with the SAF system in India.

  15. Bottom-up synthesis of multifunctional nanoporous graphene

    NASA Astrophysics Data System (ADS)

    Moreno, César; Vilas-Varela, Manuel; Kretz, Bernhard; Garcia-Lekue, Aran; Costache, Marius V.; Paradinas, Markos; Panighel, Mirko; Ceballos, Gustavo; Valenzuela, Sergio O.; Peña, Diego; Mugarza, Aitor

    2018-04-01

    Nanosize pores can turn semimetallic graphene into a semiconductor and, from being impermeable, into the most efficient molecular-sieve membrane. However, scaling the pores down to the nanometer, while fulfilling the tight structural constraints imposed by applications, represents an enormous challenge for present top-down strategies. Here we report a bottom-up method to synthesize nanoporous graphene comprising an ordered array of pores separated by ribbons, which can be tuned down to the 1-nanometer range. The size, density, morphology, and chemical composition of the pores are defined with atomic precision by the design of the molecular precursors. Our electronic characterization further reveals a highly anisotropic electronic structure, where orthogonal one-dimensional electronic bands with an energy gap of ∼1 electron volt coexist with confined pore states, making the nanoporous graphene a highly versatile semiconductor for simultaneous sieving and electrical sensing of molecular species.

  16. The number and growth pattern of plasmacytoid dendritic cells vary in different types of reactive lymph nodes: an immunohistochemical study.

    PubMed

    Rollins-Raval, Marian A; Marafioti, Teresa; Swerdlow, Steven H; Roth, Christine G

    2013-06-01

    Plasmacytoid dendritic cells, which play a fundamental role in the innate immune response, are best known for their presence in hyaline-vascular Castleman disease and histiocytic necrotizing lymphadenitis. The relative number and distribution in many reactive entities as detected using more sensitive methods are uncertain, and their diagnostic implications are unknown. Immunohistochemical studies for plasmacytoid dendritic cell-associated markers CD123 and CD2AP were performed on 42 lymph nodes with hyaline-vascular Castleman disease, histiocytic necrotizing lymphadenitis, sarcoidosis, necrotizing granulomatous inflammation, viral infection, dermatopathic lymphadenopathy, autoimmune disease, and a histologic pattern compatible with toxoplasmosis. The overall plasmacytoid dendritic cell numbers and growth patterns (tight aggregates, loose aggregates/clusters, scattered single cells) were assessed. Plasmacytoid dendritic cells were present in all cases and were predominantly distributed in loose aggregates/clusters or singly. They were most numerous in granulomatous inflammation and histiocytic necrotizing lymphadenitis, whereas viral infections showed the fewest overall numbers and a predominant pattern of scattered single cells. Tight aggregates of plasmacytoid dendritic cells were most numerous in hyaline-vascular Castleman disease (100% sensitive, 68% specific). Plasmacytoid dendritic cells are not limited to a small number of reactive lymphadenopathies but are found in many reactive processes, often with a predominant pattern of loose aggregates/clusters and scattered single cells. However, tight aggregates were a characteristic feature of hyaline-vascular Castleman disease, and viral infections typically showed only few scattered cells distributed singly. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Tightness of hamstring- and psoas major muscles. A prospective study of back pain in young men during their military service.

    PubMed

    Hellsing, A L

    1988-01-01

    Muscular tightness and the therapeutic effect of stretching has been widely discussed during the last few years in sports training and physiotherapy. Within a prospective study of back function and pain before and after compulsory military service, tightness of hamstring- and psoas muscles was assessed. Around 600 young men were examined three times over a period of four years. Tight hamstring muscles were found to be very common in this group. Only 43% of the right and 35% of the left legs reached an angle of at least 80 degrees from the couch during the straight-leg-raising test (Lasegue's test). The test of muscular tightness showed a significant test-retest reliability over all examinations. Tight hamstring- or psoas muscles could not be shown to correlate to current back pain or to the incidence of back pain during the follow-up period.

  18. The SPACE 1.0 model: a Landlab component for 2-D calculation of sediment transport, bedrock erosion, and landscape evolution

    NASA Astrophysics Data System (ADS)

    Shobe, Charles M.; Tucker, Gregory E.; Barnhart, Katherine R.

    2017-12-01

    Models of landscape evolution by river erosion are often either transport-limited (sediment is always available but may or may not be transportable) or detachment-limited (sediment must be detached from the bed but is then always transportable). While several models incorporate elements of, or transition between, transport-limited and detachment-limited behavior, most require that either sediment or bedrock, but not both, are eroded at any given time. Modeling landscape evolution over large spatial and temporal scales requires a model that can (1) transition freely between transport-limited and detachment-limited behavior, (2) simultaneously treat sediment transport and bedrock erosion, and (3) run in 2-D over large grids and be coupled with other surface process models. We present SPACE (stream power with alluvium conservation and entrainment) 1.0, a new model for simultaneous evolution of an alluvium layer and a bedrock bed based on conservation of sediment mass both on the bed and in the water column. The model treats sediment transport and bedrock erosion simultaneously, embracing the reality that many rivers (even those commonly defined as bedrock rivers) flow over a partially alluviated bed. SPACE improves on previous models of bedrock-alluvial rivers by explicitly calculating sediment erosion and deposition rather than relying on a flux-divergence (Exner) approach. The SPACE model is a component of the Landlab modeling toolkit, a Python-language library used to create models of Earth surface processes. Landlab allows efficient coupling between the SPACE model and components simulating basin hydrology, hillslope evolution, weathering, lithospheric flexure, and other surface processes. Here, we first derive the governing equations of the SPACE model from existing sediment transport and bedrock erosion formulations and explore the behavior of local analytical solutions for sediment flux and alluvium thickness. We derive steady-state analytical solutions for channel slope, alluvium thickness, and sediment flux, and show that SPACE matches predicted behavior in detachment-limited, transport-limited, and mixed conditions. We provide an example of landscape evolution modeling in which SPACE is coupled with hillslope diffusion, and demonstrate that SPACE provides an effective framework for simultaneously modeling 2-D sediment transport and bedrock erosion.

  19. Limited Resources Induce Bistability in Microtubule Length Regulation

    NASA Astrophysics Data System (ADS)

    Rank, Matthias; Mitra, Aniruddha; Reese, Louis; Diez, Stefan; Frey, Erwin

    2018-04-01

    The availability of protein is an important factor for the determination of the size of the mitotic spindle. Involved in spindle-size regulation is kinesin-8, a molecular motor and microtubule (MT) depolymerase, which is known to tightly control MT length. Here, we propose and analyze a theoretical model in which kinesin-induced MT depolymerization competes with spontaneous polymerization while supplies of both tubulin and kinesin are limited. In contrast to previous studies where resources were unconstrained, we find that, for a wide range of concentrations, MT length regulation is bistable. We test our predictions by conducting in vitro experiments and find that the bistable behavior manifests in a bimodal MT length distribution.

  20. Tight Bounds for Minimax Grid Matching, with Applications to the Average Case Analysis of Algorithms.

    DTIC Science & Technology

    1986-05-01

    AD-ft?l 552 TIGHT BOUNDS FOR NININAX GRID MATCHING WITH i APPLICATIONS TO THE AVERAGE C.. (U) MASSACHUSETTS INST OF TECH CAMBRIDGE LAS FOR COMPUTER...MASSACHUSETTS LABORATORYFORNSTITUTE OF COMPUTER SCIENCE TECHNOLOGY MIT/LCS/TM-298 TIGHT BOUNDS FOR MINIMAX GRID MATCHING, WITH APPLICATIONS TO THE AVERAGE...PERIOD COVERED Tight bounds for minimax grid matching, Interim research with applications to the average case May 1986 analysis of algorithms. 6

  1. Plant-derived triterpene celastrol ameliorates oxygen glucose deprivation-induced disruption of endothelial barrier assembly via inducing tight junction proteins.

    PubMed

    Luo, Dan; Zhao, Jia; Rong, Jianhui

    2016-12-01

    The integrity and functions of blood-brain barrier (BBB) are regulated by the expression and organization of tight junction proteins. The present study was designed to explore whether plant-derived triterpenoid celastrol could regulate tight junction integrity in murine brain endothelial bEnd3 cells. We disrupted the tight junctions between endothelial bEnd3 cells by oxygen glucose deprivation (OGD). We investigated the effects of celastrol on the permeability of endothelial monolayers by measuring transepithelial electrical resistance (TEER). To clarify the tight junction composition, we analyzed the expression of tight junction proteins by RT-PCR and Western blotting techniques. We found that celastrol recovered OGD-induced TEER loss in a concentration-dependent manner. Celastrol induced occludin, claudin-5 and zonula occludens-1 (ZO-1) in endothelial cells. As a result, celastrol effectively maintained tight junction integrity and inhibited macrophage migration through endothelial monolayers against OGD challenge. Further mechanistic studies revealed that celastrol induced the expression of occludin and ZO-1) via activating MAPKs and PI3K/Akt/mTOR pathway. We also observed that celastrol regulated claudin-5 expression through different mechanisms. The present study demonstrated that celastrol effectively protected tight junction integrity against OGD-induced damage. Thus, celastrol could be a drug candidate for the treatment of BBB dysfunction in various diseases. Copyright © 2016 Elsevier GmbH. All rights reserved.

  2. Changes in intestinal tight junction permeability associated with industrial food additives explain the rising incidence of autoimmune disease.

    PubMed

    Lerner, Aaron; Matthias, Torsten

    2015-06-01

    The incidence of autoimmune diseases is increasing along with the expansion of industrial food processing and food additive consumption. The intestinal epithelial barrier, with its intercellular tight junction, controls the equilibrium between tolerance and immunity to non-self-antigens. As a result, particular attention is being placed on the role of tight junction dysfunction in the pathogenesis of AD. Tight junction leakage is enhanced by many luminal components, commonly used industrial food additives being some of them. Glucose, salt, emulsifiers, organic solvents, gluten, microbial transglutaminase, and nanoparticles are extensively and increasingly used by the food industry, claim the manufacturers, to improve the qualities of food. However, all of the aforementioned additives increase intestinal permeability by breaching the integrity of tight junction paracellular transfer. In fact, tight junction dysfunction is common in multiple autoimmune diseases and the central part played by the tight junction in autoimmune diseases pathogenesis is extensively described. It is hypothesized that commonly used industrial food additives abrogate human epithelial barrier function, thus, increasing intestinal permeability through the opened tight junction, resulting in entry of foreign immunogenic antigens and activation of the autoimmune cascade. Future research on food additives exposure-intestinal permeability-autoimmunity interplay will enhance our knowledge of the common mechanisms associated with autoimmune progression. Copyright © 2015. Published by Elsevier B.V.

  3. Bifunctional metamaterials with simultaneous and independent manipulation of thermal and electric fields.

    PubMed

    Lan, Chuwen; Bi, Ke; Fu, Xiaojian; Li, Bo; Zhou, Ji

    2016-10-03

    Metamaterials offer a powerful way to manipulate a variety of physical fields ranging from wave fields (electromagnetic field, acoustic field, elastic wave, etc.), static fields (static magnetic field, static electric field) to diffusive fields (thermal field, diffusive mass). However, the relevant reports and studies are usually limited to a single physical field or functionality. In this study, we proposed and experimentally demonstrated a bifunctional metamaterial which could manipulate thermal and electric fields simultaneously and independently. Specifically, a composite with independently controllable thermal and electric conductivity was introduced, on the basis of which a bifunctional device capable of shielding thermal flux and concentrating electric current simultaneously was designed, fabricated and characterized. This work provides an encouraging example of metamaterials transcending their natural limitations, which offers a promising future in building a broad platform for the manipulation of multi-physics fields.

  4. Bilayer Protograph Codes for Half-Duplex Relay Channels

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; VanNguyen, Thuy; Nosratinia, Aria

    2013-01-01

    Direct to Earth return links are limited by the size and power of lander devices. A standard alternative is provided by a two-hops return link: a proximity link (from lander to orbiter relay) and a deep-space link (from orbiter relay to Earth). Although direct to Earth return links are limited by the size and power of lander devices, using an additional link and a proposed coding for relay channels, one can obtain a more reliable signal. Although significant progress has been made in the relay coding problem, existing codes must be painstakingly optimized to match to a single set of channel conditions, many of them do not offer easy encoding, and most of them do not have structured design. A high-performing LDPC (low-density parity-check) code for the relay channel addresses simultaneously two important issues: a code structure that allows low encoding complexity, and a flexible rate-compatible code that allows matching to various channel conditions. Most of the previous high-performance LDPC codes for the relay channel are tightly optimized for a given channel quality, and are not easily adapted without extensive re-optimization for various channel conditions. This code for the relay channel combines structured design and easy encoding with rate compatibility to allow adaptation to the three links involved in the relay channel, and furthermore offers very good performance. The proposed code is constructed by synthesizing a bilayer structure with a pro to graph. In addition to the contribution to relay encoding, an improved family of protograph codes was produced for the point-to-point AWGN (additive white Gaussian noise) channel whose high-rate members enjoy thresholds that are within 0.07 dB of capacity. These LDPC relay codes address three important issues in an integrative manner: low encoding complexity, modular structure allowing for easy design, and rate compatibility so that the code can be easily matched to a variety of channel conditions without extensive re-optimization. The main problem of half-duplex relay coding can be reduced to the simultaneous design of two codes at two rates and two SNRs (signal-to-noise ratios), such that one is a subset of the other. This problem can be addressed by forceful optimization, but a clever method of addressing this problem is via the bilayer lengthened (BL) LDPC structure. This method uses a bilayer Tanner graph to make the two codes while using a concept of "parity forwarding" with subsequent successive decoding that removes the need to directly address the issue of uneven SNRs among the symbols of a given codeword. This method is attractive in that it addresses some of the main issues in the design of relay codes, but it does not by itself give rise to highly structured codes with simple encoding, nor does it give rate-compatible codes. The main contribution of this work is to construct a class of codes that simultaneously possess a bilayer parity- forwarding mechanism, while also benefiting from the properties of protograph codes having an easy encoding, a modular design, and being a rate-compatible code.

  5. Tissue-specific activities of the Fat1 cadherin cooperate to control neuromuscular morphogenesis

    PubMed Central

    2018-01-01

    Muscle morphogenesis is tightly coupled with that of motor neurons (MNs). Both MNs and muscle progenitors simultaneously explore the surrounding tissues while exchanging reciprocal signals to tune their behaviors. We previously identified the Fat1 cadherin as a regulator of muscle morphogenesis and showed that it is required in the myogenic lineage to control the polarity of progenitor migration. To expand our knowledge on how Fat1 exerts its tissue-morphogenesis regulator activity, we dissected its functions by tissue-specific genetic ablation. An emblematic example of muscle under such morphogenetic control is the cutaneous maximus (CM) muscle, a flat subcutaneous muscle in which progenitor migration is physically separated from the process of myogenic differentiation but tightly associated with elongating axons of its partner MNs. Here, we show that constitutive Fat1 disruption interferes with expansion and differentiation of the CM muscle, with its motor innervation and with specification of its associated MN pool. Fat1 is expressed in muscle progenitors, in associated mesenchymal cells, and in MN subsets, including the CM-innervating pool. We identify mesenchyme-derived connective tissue (CT) as a cell type in which Fat1 activity is required for the non–cell-autonomous control of CM muscle progenitor spreading, myogenic differentiation, motor innervation, and for motor pool specification. In parallel, Fat1 is required in MNs to promote their axonal growth and specification, indirectly influencing muscle progenitor progression. These results illustrate how Fat1 coordinates the coupling of muscular and neuronal morphogenesis by playing distinct but complementary actions in several cell types. PMID:29768404

  6. Co-extrusion of electrolyte/anode functional layer/anode triple-layer ceramic hollow fibres for micro-tubular solid oxide fuel cells-electrochemical performance study

    NASA Astrophysics Data System (ADS)

    Li, Tao; Wu, Zhentao; Li, K.

    2015-01-01

    In this study, the effects of an anode functional layer (AFL) with controlled thickness on physical and electrochemical properties of a micro-tubular SOFC have been systematically studied. A series of electrolyte/AFL/anode triple-layer hollow fibres with controllable AFL thicknesses (16.9-52.7 μm) have been fabricated via a single-step phase-inversion assisted co-extrusion technique. Both robustness of the cell and gas-tightness of the electrolyte layer are considerably improved by introducing the AFL of this type. The fracture force of the sample with the thickest AFL (9.67 N) almost doubles when compared to the electrolyte/anode dual-layer counterpart (5.24 N). Gas-tightness of the electrolyte layer is also considerably increased as AFL contributes to better-matched sintering behaviours between different components. Moreover, the formation of an AFL simultaneously with electrolyte and anode significantly improves the cell performances. The sample with the thinnest AFL (approximately 16.9 μm, 6% of the total anode thickness) leads to a 30% (from 0.89 to 1.21 W cm-2) increase in maximum power density, due to increased triple-phase boundaries (TPB). However, further increase in TPB from a thicker AFL is less effective for improving the cell performance, due to the substantially increased fuel diffusion resistance and subsequently higher concentration polarization. This indicates that the control over the AFL thickness is critically important in avoiding offsetting the benefits of extended TPB and consequently decreased cell performances.

  7. Calcium/Ask1/MKK7/JNK2/c-Src signalling cascade mediates disruption of intestinal epithelial tight junctions by dextran sulfate sodium.

    PubMed

    Samak, Geetha; Chaudhry, Kamaljit K; Gangwar, Ruchika; Narayanan, Damodaran; Jaggar, Jonathan H; Rao, RadhaKrishna

    2015-02-01

    Disruption of intestinal epithelial tight junctions is an important event in the pathogenesis of ulcerative colitis. Dextran sodium sulfate (DSS) induces colitis in mice with symptoms similar to ulcerative colitis. However, the mechanism of DSS-induced colitis is unknown. We investigated the mechanism of DSS-induced disruption of intestinal epithelial tight junctions and barrier dysfunction in Caco-2 cell monolayers in vitro and mouse colon in vivo. DSS treatment resulted in disruption of tight junctions, adherens junctions and actin cytoskeleton leading to barrier dysfunction in Caco-2 cell monolayers. DSS induced a rapid activation of c-Jun N-terminal kinase (JNK), and the inhibition or knockdown of JNK2 attenuated DSS-induced tight junction disruption and barrier dysfunction. In mice, DSS administration for 4 days caused redistribution of tight junction and adherens junction proteins from the epithelial junctions, which was blocked by JNK inhibitor. In Caco-2 cell monolayers, DSS increased intracellular Ca(2+) concentration, and depletion of intracellular Ca(2+) by 1,2-bis-(o-aminophenoxy)ethane-N,N,N',N'-tetra-acetic acid tetrakis(acetoxymethyl ester) (BAPTA/AM) or thapsigargin attenuated DSS-induced JNK activation, tight junction disruption and barrier dysfunction. Knockdown of apoptosis signal-regulated kinase 1 (Ask1) or MKK7 blocked DSS-induced tight junction disruption and barrier dysfunction. DSS activated c-Src by a Ca2+ and JNK-dependent mechanism. Inhibition of Src kinase activity or knockdown of c-Src blocked DSS-induced tight junction disruption and barrier dysfunction. DSS increased tyrosine phosphorylation of occludin, zonula occludens-1 (ZO-1), E-cadherin and β-catenin. SP600125 abrogated DSS-induced tyrosine phosphorylation of junctional proteins. Recombinant JNK2 induced threonine phosphorylation and auto-phosphorylation of c-Src. The present study demonstrates that Ca(2+)/Ask1/MKK7/JNK2/cSrc signalling cascade mediates DSS-induced tight junction disruption and barrier dysfunction.

  8. Sequential and simultaneous SLAR block adjustment. [spline function analysis for mapping

    NASA Technical Reports Server (NTRS)

    Leberl, F.

    1975-01-01

    Two sequential methods of planimetric SLAR (Side Looking Airborne Radar) block adjustment, with and without splines, and three simultaneous methods based on the principles of least squares are evaluated. A limited experiment with simulated SLAR images indicates that sequential block formation with splines followed by external interpolative adjustment is superior to the simultaneous methods such as planimetric block adjustment with similarity transformations. The use of the sequential block formation is recommended, since it represents an inexpensive tool for satisfactory point determination from SLAR images.

  9. Link between Hypoglycemia and Cardiac Arrhythmias: An Answer to Why Tight Glycemic Control May Increase Mortality in ...

    MedlinePlus

    ... Cardiac Arrhythmias: An Answer to Why Tight Glycemic Control May Increase Mortality in People with Diabetes and ... funded clinical trial that examined whether tight glycemic control could reduce cardiovascular events in people with type ...

  10. Transmembrane proteins of tight junctions.

    PubMed

    Chiba, Hideki; Osanai, Makoto; Murata, Masaki; Kojima, Takashi; Sawada, Norimasa

    2008-03-01

    Tight junctions contribute to the paracellular barrier, the fence dividing plasma membranes, and signal transduction, acting as a multifunctional complex in vertebrate epithelial and endothelial cells. The identification and characterization of the transmembrane proteins of tight junctions, claudins, junctional adhesion molecules (JAMs), occludin and tricellulin, have led to insights into the molecular nature of tight junctions. We provide an overview of recent progress in studies on these proteins and highlight their roles and regulation, as well as their functional significance in human diseases.

  11. Quantitative monitoring of two simultaneously binding species using Label-Enhanced surface plasmon resonance.

    PubMed

    Eng, Lars; Garcia, Brandon L; Geisbrecht, Brian V; Hanning, Anders

    2018-02-26

    Surface plasmon resonance (SPR) is a well-established method for biomolecular interaction studies. SPR monitors the binding of molecules to a solid surface, embodied as refractive index changes close to the surface. One limitation of conventional SPR is the universal nature of the detection that results in an inability to qualitatively discriminate between different binding species. Furthermore, it is impossible to directly discriminate two species simultaneously binding to different sites on a protein, which limits the utility of SPR, for example, in the study of allosteric binders or bi-specific molecules. It is also impossible in principle to discriminate protein conformation changes from actual binding events. Here we demonstrate how Label-Enhanced SPR can be utilized to discriminate and quantitatively monitor the simultaneous binding of two different species - one dye-labeled and one unlabeled - on a standard, single-wavelength SPR instrument. This new technique increases the versatility of SPR technology by opening up application areas where the usefulness of the approach has previously been limited. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Silicon Photonics: All-Optical Devices for Linear and Nonlinear Applications

    NASA Astrophysics Data System (ADS)

    Driscoll, Jeffrey B.

    Silicon photonics has grown rapidly since the first Si electro-optic switch was demonstrated in 1987, and the field has never grown more quickly than it has over the past decade, fueled by milestone achievements in semiconductor processing technologies for low loss waveguides, high-speed Si modulators, Si lasers, Si detectors, and an enormous toolbox of passive and active integrated devices. Silicon photonics is now on the verge of major commercialization breakthroughs, and optical communication links remain the force driving integrated and Si photonics towards the first commercial telecom and datacom transceivers; however other potential and future applications are becoming uncovered and refined as researchers reveal the benefits of manipulating photons on the nanoscale. This thesis documents an exploration into the unique guided-wave and nonlinear properties of deeply-scaled high-index-contrast sub-wavelength Si waveguides. It is found that the tight confinement inherent to single-mode channel waveguides on the silicon-on-insulator platform lead to a rich physics, which can be leveraged for new devices extending well beyond simple passive interconnects and electro-optic devices. The following chapters will concentrate, in detail, on a number of unique physical features of Si waveguides and extend these attributes towards new and interesting devices. Linear optical properties and nonlinear optical properties are investigated, both of which are strongly affected by tight optical confinement of the guided waveguide modes. As will be shown, tight optical confinement directly results in strongly vectoral modal components, where the electric and magnetic fields of the guided modes extend into all spatial dimensions, even along the axis of propagation. In fact, the longitudinal electric and magnetic field components can be just as strong as the transverse fields, directly affecting the modal group velocity and energy transport properties since the longitudinal fields are shown to contribute no time-averaged momentum. Furthermore, the vectoral modal components, in conjunction with the tensoral nature of the third-order susceptibility of Si, lead to nonlinear properties which are dependent on waveguide orientation with respect to the Si parent crystal and the construction of the modal electric field components. This consideration is used to maximize effective nonlinearity and realize nonlinear Kerr gratings along specific waveguide trajectories. Tight optical confinement leads to a natural enhancement of the intrinsically large effective nonlinearty of Si waveguides, and in fact, the effective nonlinearty can be made to be almost 106 times greater in Si waveguides than that of standard single-mode fiber. Such a large nonlinearity motivates chip-scale all-optical signal processing techniques. Wavelength conversion by both four-wave-mixing (FWM) and cross-phase-modulation (XPM) will be discussed, including a technique that allows for enhanced broadband discrete FWM over arbitrary spectral spans by modulating both the linear and nonlinear waveguide properties through periodic changes in waveguide geometry. This quasi-phase-matching approach has very real applications towards connecting mature telecom sources detectors and components to other spectral regimes, including the mid-IR. Other signal processing techniques such as all-optical modulation format conversion via XPM will also be discussed. This thesis will conclude by looking at ways to extend the bandwidth capacity of Si waveguide interconnects on chip. As the number of processing cores continues to scale as a means for computational performance gains, on-chip link capacity will become an increasingly important issue. Metallic traces have severe limitations and are envisioned to eventually bow to integrated photonic links. The aggregate bandwidth supported by a single waveguide link will therefore become a crucial consideration as integrated photonics approaches the CPU. One way to increase aggregate bandwidth is to utilize different eigen-modes of a multimode waveguide, and integrated waveguide mode-muxes and demuxes for achieving simultaneous mode-division-multiplexing and wavelength-division-multiplexing will be demonstrated.

  13. Targeting carbonic anhydrase to treat diabetic retinopathy: Emerging evidences and encouraging results

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weiwei, Zhang; Hu, Renming, E-mail: taylorzww@gmail.com

    2009-12-18

    Diabetic retinopathy (DR) is the leading cause of vision loss among working-age populations in developed countries. Current treatment options are limited to tight glycemic, blood pressure control and destructive laser surgery. Carbonic anhydrases (CAs) are a group of enzymes involving in the rapid conversion of carbon dioxide to bicarbonate and protons. Emerging evidences reveal CA inhibitors hold the promise for the treatment of DR. This article summarizes encouraging results from clinical and animal studies, and reviews the possible mechanisms.

  14. Indentification and Analysis of Occludin Phosphosites: A Combined Mass Spectroscoy and Bioinformatics Approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sundstrom, J.; Tash, B; Murakami, T

    2009-01-01

    The molecular function of occludin, an integral membrane component of tight junctions, remains unclear. VEGF-induced phosphorylation sites were mapped on occludin by combining MS data analysis with bioinformatics. In vivo phosphorylation of Ser490 was validated and protein interaction studies combined with crystal structure analysis suggest that Ser490 phosphorylation attenuates the interaction between occludin and ZO-1. This study demonstrates that combining MS data and bioinformatics can successfully identify novel phosphorylation sites from limiting samples.

  15. Laser ablation caused by geometrically constrained illumination and inventive target design

    NASA Astrophysics Data System (ADS)

    Inogamov, N. A.; Zhakhovsky, V. V.; Khokhlov, V. A.

    2018-01-01

    Modern laser technologies use very sophisticated manipulations with (i) a photon cloud forming an irradiation beam and with (ii) disign of a target. E.g. high numerical aperture illumination at very small, diffraction limited conditions is employed for fabrication of the tiny solitary nanoformations on surface of specially prepared thin films deposited onto usually dielectric or semiconductor substrate. In the paper below we list such cases and consider an example with a free standing gold nanofilm modified by tightly focused femtosecond laser pulse.

  16. Advances in Sensors and Their Integration into Aircraft Guidance and Control Systems,

    DTIC Science & Technology

    1983-06-01

    this function taking account of the limitations of the existing air- craft systems such as:- (a) Cockpit space (b) use of existing controls particularly...electrostatically focused under the influence of high potentials to form an electron image on a thin silicon wafer target upon which a very tightly spaced ...matrix of p-n junctions have been formed. The spacing of the diodes is of the order of n m. A gain mechanism is caused because the photo electrons

  17. Calcium oxalate crystals induces tight junction disruption in distal renal tubular epithelial cells by activating ROS/Akt/p38 MAPK signaling pathway.

    PubMed

    Yu, Lei; Gan, Xiuguo; Liu, Xukun; An, Ruihua

    2017-11-01

    Tight junction plays important roles in regulating paracellular transports and maintaining cell polarity. Calcium oxalate monohydrate (COM) crystals, the major crystalline composition of kidney stones, have been demonstrated to be able to cause tight junction disruption to accelerate renal cell injury. However, the cellular signaling involved in COM crystal-induced tight junction disruption remains largely to be investigated. In the present study, we proved that COM crystals induced tight junction disruption by activating ROS/Akt/p38 MAPK pathway. Treating Madin-Darby canine kidney (MDCK) cells with COM crystals induced a substantial increasing of ROS generation and activation of Akt that triggered subsequential activation of ASK1 and p38 mitogen-activated protein kinase (MAPK). Western blot revealed a significantly decreased expression of ZO-1 and occludin, two important structural proteins of tight junction. Besides, redistribution and dissociation of ZO-1 were observed by COM crystals treatment. Inhibition of ROS by N-acetyl-l-cysteine (NAC) attenuated the activation of Akt, ASK1, p38 MAPK, and down-regulation of ZO-1 and occludin. The redistribution and dissociation of ZO-1 were also alleviated by NAC treatment. These results indicated that ROS were involved in the regulation of tight junction disruption induced by COM crystals. In addition, the down-regulation of ZO-1 and occludin, the phosphorylation of ASK1 and p38 MAPK were also attenuated by MK-2206, an inhibitor of Akt kinase, implying Akt was involved in the disruption of tight junction upstream of p38 MAPK. Thus, these results suggested that ROS-Akt-p38 MAPK signaling pathway was activated in COM crystal-induced disruption of tight junction in MDCK cells.

  18. Calcium-Mediated Oxidative Stress: a Common Mechanism in Tight Junction Disruption by Different Types of Cellular Stress

    PubMed Central

    Gangwar, Ruchika; Meena, Avtar S.; Shukla, Pradeep K.; Nagaraja, Archana S.; Dorniak, Piotr L.; Pallikuth, Sandeep; Waters, Christopher M.; Sood, Anil; Rao, RadhaKrishna

    2017-01-01

    The role of reactive oxygen species (ROS) in osmotic stress, dextran sulfate sodium (DSS) and cyclic stretch-induced tight junction disruption was investigated in Caco-2 cell monolayers in vitro, and restraint stress-induced barrier dysfunction in mouse colon in vivo. Live cell imaging showed that osmotic stress, cyclic stretch and DSS triggered rapid production of ROS in Caco-2 cell monolayers, which was blocked by depletion of intracellular Ca2+ by BAPTA. Knockdown of CaV1.3 or TRPV6 channels blocked osmotic stress and DSS-induced ROS production and attenuated tight junction disruption and barrier dysfunction. N-acetyl L-cysteine (NAC) and L-nitroarginine methyl ester (L-NAME) blocked stress-induced tight junction disruption and barrier dysfunction. NAC and L-NAME also blocked stress-induced activation of JNK and c-Src. ROS was co-localized with the mitochondrial marker in stressed cells. Cyclosporin A blocked osmotic stress and DSS-induced ROS production, barrier dysfunction, tight junction disruption and JNK activation. Mitochondria-targeted Mito-TEMPO blocked osmotic stress and DSS-induced barrier dysfunction and tight junction disruption. Chronic restraint stress in mice resulted in the elevation of intracellular Ca2+, activation of JNK and c-Src, and disruption of tight junction in the colonic epithelium. Furthermore, corticosterone administration induced JNK and c-Src activation, tight junction disruption and protein thiol oxidation in colonic mucosa. This study demonstrates that oxidative stress is a common signal in the mechanism of tight junction disruption in the intestinal epithelium by different types of cellular stress in vitro and bio behavioral stress in vivo. PMID:28057718

  19. The Cost Implications of Less Tight Versus Tight Control of Hypertension in Pregnancy (CHIPS Trial).

    PubMed

    Ahmed, Rashid J; Gafni, Amiram; Hutton, Eileen K; Hu, Zheng Jing; Pullenayegum, Eleanor; von Dadelszen, Peter; Rey, Evelyne; Ross, Susan; Asztalos, Elizabeth; Murphy, Kellie E; Menzies, Jennifer; Sanchez, J Johanna; Ganzevoort, Wessel; Helewa, Michael; Lee, Shoo K; Lee, Terry; Logan, Alexander G; Moutquin, Jean-Marie; Singer, Joel; Thornton, Jim G; Welch, Ross; Magee, Laura A

    2016-10-01

    The CHIPS randomized controlled trial (Control of Hypertension in Pregnancy Study) found no difference in the primary perinatal or secondary maternal outcomes between planned "less tight" (target diastolic 100 mm Hg) and "tight" (target diastolic 85 mm Hg) blood pressure management strategies among women with chronic or gestational hypertension. This study examined which of these management strategies is more or less costly from a third-party payer perspective. A total of 981 women with singleton pregnancies and nonsevere, nonproteinuric chronic or gestational hypertension were randomized at 14 to 33 weeks to less tight or tight control. Resources used were collected from 94 centers in 15 countries and costed as if the trial took place in each of 3 Canadian provinces as a cost-sensitivity analysis. Eleven hospital ward and 24 health service costs were obtained from a similar trial and provincial government health insurance schedules of medical benefits. The mean total cost per woman-infant dyad was higher in less tight versus tight control, but the difference in mean total cost (DM) was not statistically significant in any province: Ontario ($30 191.62 versus $24 469.06; DM $5723, 95% confidence interval, -$296 to $12 272; P=0.0725); British Columbia ($30 593.69 versus $24 776.51; DM $5817; 95% confidence interval, -$385 to $12 349; P=0.0725); or Alberta ($31 510.72 versus $25 510.49; DM $6000.23; 95% confidence interval, -$154 to $12 781; P=0.0637). Tight control may benefit women without increasing risk to neonates (as shown in the main CHIPS trial), without additional (and possibly lower) cost to the healthcare system. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01192412. © 2016 The Authors.

  20. Tight junction disruption: Helicobacter pylori and dysregulation of the gastric mucosal barrier

    PubMed Central

    Caron, Tyler J; Scott, Kathleen E; Fox, James G; Hagen, Susan J

    2015-01-01

    Long-term chronic infection with Helicobacter pylori (H. pylori) is a risk factor for gastric cancer development. In the multi-step process that leads to gastric cancer, tight junction dysfunction is thought to occur and serve as a risk factor by permitting the permeation of luminal contents across an otherwise tight mucosa. Mechanisms that regulate tight junction function and structure in the normal stomach, or dysfunction in the infected stomach, however, are largely unknown. Although conventional tight junction components are expressed in gastric epithelial cells, claudins regulate paracellular permeability and are likely the target of inflammation or H. pylori itself. There are 27 different claudin molecules, each with unique properties that render the mucosa an intact barrier that is permselective in a way that is consistent with cell physiology. Understanding the architecture of tight junctions in the normal stomach and then changes that occur during infection is important but challenging, because most of the reports that catalog claudin expression in gastric cancer pathogenesis are contradictory. Furthermore, the role of H. pylori virulence factors, such as cytotoxin-associated gene A and vacoulating cytotoxin, in regulating tight junction dysfunction during infection is inconsistent in different gastric cell lines and in vivo, likely because non-gastric epithelial cell cultures were initially used to unravel the details of their effects on the stomach. Hampering further study, as well, is the relative lack of cultured cell models that have tight junction claudins that are consistent with native tissues. This summary will review the current state of knowledge about gastric tight junctions, normally and in H. pylori infection, and make predictions about the consequences of claudin reorganization during H. pylori infection. PMID:26523106

  1. Validation of an analytical method for simultaneous high-precision measurements of greenhouse gas emissions from wastewater treatment plants using a gas chromatography-barrier discharge detector system.

    PubMed

    Pascale, Raffaella; Caivano, Marianna; Buchicchio, Alessandro; Mancini, Ignazio M; Bianco, Giuliana; Caniani, Donatella

    2017-01-13

    Wastewater treatment plants (WWTPs) emit CO 2 and N 2 O, which may lead to climate change and global warming. Over the last few years, awareness of greenhouse gas (GHG) emissions from WWTPs has increased. Moreover, the development of valid, reliable, and high-throughput analytical methods for simultaneous gas analysis is an essential requirement for environmental applications. In the present study, an analytical method based on a gas chromatograph (GC) equipped with a barrier ionization discharge (BID) detector was developed for the first time. This new method simultaneously analyses CO 2 and N 2 O and has a precision, measured in terms of relative standard of variation RSD%, equal to or less than 6.6% and 5.1%, respectively. The method's detection limits are 5.3ppm v for CO 2 and 62.0ppb v for N 2 O. The method's selectivity, linearity, accuracy, repeatability, intermediate precision, limit of detection and limit of quantification were good at trace concentration levels. After validation, the method was applied to a real case of N 2 O and CO 2 emissions from a WWTP, confirming its suitability as a standard procedure for simultaneous GHG analysis in environmental samples containing CO 2 levels less than 12,000mg/L. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Novel bifunctional cap for simultaneous electroencephalography and transcranial electrical stimulation.

    PubMed

    Wunder, Sophia; Hunold, Alexander; Fiedler, Patrique; Schlegelmilch, Falk; Schellhorn, Klaus; Haueisen, Jens

    2018-05-08

    Neuromodulation induced by transcranial electric stimulation (TES) exhibited promising potential for clinical practice. However, the underlying mechanisms remain subject of research. The combination of TES and electroencephalography (EEG) offers great potential for investigating these mechanisms and brain function in general, especially when performed simultaneously. In conventional applications, the combination of EEG and TES suffers from limitations on the electrode level (gel for electrode-skin interface) and the usability level (preparation time, reproducibility of positioning). To overcome these limitations, we designed a bifunctional cap for simultaneous TES-EEG applications. We used novel electrode materials, namely textile stimulation electrodes and dry EEG electrodes integrated in a flexible textile cap. We verified the functionality of this cap by analysing the effect of TES on visual evoked potentials (VEPs). In accordance with previous reports using standard TES, the amplitude of the N75 component was significantly decreased post-stimulation, indicating the feasibility of using this novel flexible cap for simultaneous TES and EEG. Further, we found a significant reduction of the P100 component only during TES, indicating a different brain modulation effect during and after TES. In conclusion, the novel bifunctional cap offers a novel tool for simultaneous TES-EEG applications in clinical research, therapy monitoring and closed-loop stimulation.

  3. On the self-association potential of transmembrane tight junction proteins.

    PubMed

    Blasig, I E; Winkler, L; Lassowski, B; Mueller, S L; Zuleger, N; Krause, E; Krause, G; Gast, K; Kolbe, M; Piontek, J

    2006-02-01

    Tight junctions seal intercellular clefts via membrane-related strands, hence, maintaining important organ functions. We investigated the self-association of strand-forming transmembrane tight junction proteins. The regulatory tight junction protein occludin was differently tagged and cotransfected in eucaryotic cells. These occludins colocalized within the plasma membrane of the same cell, coprecipitated and exhibited fluorescence resonance energy transfer. Differently tagged strand-forming claudin-5 also colocalized in the plasma membrane of the same cell and showed fluorescence resonance energy transfer. This demonstrates self-association in intact cells both of occludin and claudin-5 in one plasma membrane. In search of dimerizing regions of occludin, dimerization of its cytosolic C-terminal coiledcoil domain was identified. In claudin-5, the second extracellular loop was detected as a dimer. Since the transmembrane junctional adhesion molecule also is known to dimerize, the assumption that homodimerization of transmembrane tight junction proteins may serve as a common structural feature in tight junction assembly is supported.

  4. SYSTEM OPTIMIZATION FOR THE AUTOMATIC SIMULTANEOUS DETERMINATION OF ARSENIC, SELENIUM, AND ANTIMONY, USING HYDRIDE GENERATION INTRODUCTION TO AN INDUCTIVELY COUPLED PLASMA.

    USGS Publications Warehouse

    Pyen, Grace S.; Browner, Richard F.; Long, Stephen

    1986-01-01

    A fixed-size simplex has been used to determine the optimum conditions for the simultaneous determination of arsenic, selenium, and antimony by hydride generation and inductively coupled plasma emission spectrometry. The variables selected for the simplex were carrier gas flow rate, rf power, viewing height, and reagent conditions. The detection limit for selenium was comparable to the preoptimized case, but there were twofold and fourfold improvements in the detection limits for arsenic and antimony, respectively. Precision of the technique was assessed with the use of artificially prepared water samples.

  5. Technical note: Simultaneous carotenoid and vitamin analysis of milk from total mixed ration-fed cows optimized for xanthophyll detection.

    PubMed

    Stout, M A; Benoist, D M; Drake, M A

    2018-06-01

    Concentrations of retinol, α-tocopherol, and major carotenoids in dairy products are often determined simultaneously by liquid chromatography. These compounds have different polarity and solubility; thus, extracting them simultaneously can be difficult and inefficient. In milks with low carotenoid concentrations, the xanthophylls lutein and zeaxanthin may not be completely resolved using common extraction techniques. A simplified method was developed to optimize extraction efficiency and the limit of detection and limit of quantification (LoQ) of lutein and zeaxanthin in bovine milk without decreasing sensitivity to other vitamins or carotenoids. The developed method evaluates lutein, zeaxanthin, β-carotene, retinol, and α-tocopherol simultaneously by ultra-high performance liquid chromatography-photodiode array detection. Common saponification temperatures (40-60°C) and concentrations of KOH in water (10-50% KOH wt/vol) were evaluated. Multiple solvents were evaluated for optimal xanthophyll extraction (diethyl ether, dichloromethane, hexane, and tetrahydrofuran) following saponification. The limit of detection and LoQ were defined as 3:1 and 10:1 signal-to-noise ratio, respectively. All experiments were performed in triplicate. The optimal saponification procedure was a concentration of 25% KOH at either 40 or 50°C. Saponified extracts solubilized in solutions containing diethyl ether had greater concentrations of lutein- than hexane- or tetrahydrofuran-based solutions, with peak areas above LoQ values. The solution containing diethyl ether solubilized similar concentrations of retinol, α-tocopherol, and β-carotene when compared with other solutions. The proposed optimized method allows for the simultaneous determination of carotenoids from milk with increased lutein and zeaxanthin sensitivity without sacrificing recovery of retinol, α-tocopherol, and β-carotene. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Claudins and the Modulation of Tight Junction Permeability

    PubMed Central

    Günzel, Dorothee

    2013-01-01

    Claudins are tight junction membrane proteins that are expressed in epithelia and endothelia and form paracellular barriers and pores that determine tight junction permeability. This review summarizes our current knowledge of this large protein family and discusses recent advances in our understanding of their structure and physiological functions. PMID:23589827

  7. Performance Improvement of Receivers Based on Ultra-Tight Integration in GNSS-Challenged Environments

    PubMed Central

    Qin, Feng; Zhan, Xingqun; Du, Gang

    2013-01-01

    Ultra-tight integration was first proposed by Abbott in 2003 with the purpose of integrating a global navigation satellite system (GNSS) and an inertial navigation system (INS). This technology can improve the tracking performances of a receiver by reconfiguring the tracking loops in GNSS-challenged environments. In this paper, the models of all error sources known to date in the phase lock loops (PLLs) of a standard receiver and an ultra-tightly integrated GNSS/INS receiver are built, respectively. Based on these models, the tracking performances of the two receivers are compared to verify the improvement due to the ultra-tight integration. Meanwhile, the PLL error distributions of the two receivers are also depicted to analyze the error changes of the tracking loops. These results show that the tracking error is significantly reduced in the ultra-tightly integrated GNSS/INS receiver since the receiver's dynamics are estimated and compensated by an INS. Moreover, the mathematical relationship between the tracking performances of the ultra-tightly integrated GNSS/INS receiver and the quality of the selected inertial measurement unit (IMU) is derived from the error models and proved by the error comparisons of four ultra-tightly integrated GNSS/INS receivers aided by different grade IMUs.

  8. A randomized controlled comparison of stretching procedures for posterior shoulder tightness.

    PubMed

    McClure, Philip; Balaicuis, Jenna; Heiland, David; Broersma, Mary Ellen; Thorndike, Cheryl K; Wood, April

    2007-03-01

    Randomized controlled trial, To compare changes in shoulder internal rotation range of motion (ROM), for 2 stretching exercises, the "cross-body stretch" and the "sleeper stretch," in individuals with posterior shoulder tightness. Recently, some authors have expressed the belief that the sleeper stretch is better than the cross-body stretch to address glenohumeral posterior tightness because the scapula is stabilized. Fifty-four asymptomatic subjects (20 males, 34 females) participated in the study. The control group (n=24) consisted of subjects with a between-shoulder difference in internal rotation ROM of less than 10 degrees, whereas those subjects with more than a 10 degrees difference were randomly assigned to 1 of 2 intervention groups, the sleeper stretch group (n=15) or the cross-body stretch group (n=15). Shoulder internal rotation ROM, with the arm abducted to 90 degrees and scapula motion prevented, was measured before and after a 4-week intervention period. Subjects in the control group were asked not to engage in any new stretching activities, while subjects in the 2 stretching groups were asked to perform stretching exercises on the more limited side only, once daily for 5 repetitions, holding each stretch for 30 seconds. The improvements in internal rotation ROM for the subjects in the cross-body stretch group (mean +/- SD, 20.0 degrees +/- 12.9 degrees) were significantly greater than for the subjects in the control group (5.9 degrees +/- 9.4 degrees, P = .009). The gains in the sleeper stretch group (12.4 degrees +/- 10.4 degrees) were not significant compared to those of the control group (P = .586) and those of the cross-body stretch group (P = .148). The cross-body stretch in individuals with limited shoulder internal rotation ROM appears to be more effective than no stretching in controls without internal rotation asymmetry to improve shoulder internal rotation ROM. While the improvement in internal rotation from the cross-body stretch was greater than for the sleeper stretch and of a magnitude that could be clinically significant, the small sample size likely precluded statistical significance between groups.

  9. The Virtue of Just Enough Stress: A Molecular Model

    PubMed Central

    Bishopric, Nanette H.

    2012-01-01

    Molecular biology emphasizes the study of all-or-nothing phenomena and molecular events with a large dynamic range. However, many important physiologic parameters in the clinical setting are tightly constrained (e.g., serum sodium concentration, body mass, venous oxygen saturation, sleep duration). Stress responses exhibit both a wide dynamic range and a potential for important effects at a “just-enough” threshold activation level. Stress responses occur in a number of body systems (e.g., neuropsychiatric, immune, cardiovascular) and are essential for short-term damage control, but also must be tightly constrained in range and duration to permit the organism to walk the narrow homeostatic path to long-term survival. Using an example of a newly appreciated stress-responsive molecule in the heart, acetyltransferase p300, as well as examples from the literature, this article discusses the advantages of self-limited stress, the adverse effects of sustained stress, and the built-in mechanisms that feed back on and terminate stress signals, and advances a hypothesis regarding stress as a pharmacological target in the heart. PMID:23303984

  10. Ultrastructural study of the semicircular canal cells of the frog Rana esculenta.

    PubMed

    Oudar, O; Ferrary, E; Feldmann, G

    1988-03-01

    The ultrastructure of the nonsensory cells (dark cells, transitional cells, and undifferentiated cells) of the frog semicircular canal was studied by using transmission electron microscopy in an attempt to correlate the structure with the functions of these epithelial cells. All the nonsensory cells were linked by tight junctions and desmosomes; this suggested that there is little paracellular ionic transport from perilymph to endolymph. In the dark cell epithelium, the apical intercellular spaces were dilated; in the basal part, numerous basolateral plasma membrane infoldings, containing mitochondria, delimited electron-lucent spaces. The undifferentiated cells and the transitional cells were devoid of any basal membrane infolding. Surrounding the semicircular canal, very flattened and interdigitated mesothelial cells constituted a thin multilayer tissue which limited the perilymphatic space. The morphological aspect of the dark cells suggests that they may play a role in the secretion and/or in the reabsorption of endolymph, which bathes the apical pole of these cells. The undifferentiated and transitional cells can play a role in the maintenance of the endolymphatic ionic composition because of their apical tight junctions and desmosomes.

  11. Spatial arrangement of legionella colonies in intact biofilms from a model cooling water system.

    PubMed

    Taylor, Michael; Ross, Kirstin; Bentham, Richard

    2013-01-01

    There is disagreement among microbiologists about whether Legionella requires a protozoan host in order to replicate. This research sought to determine where in biofilm Legionellae are found and whether all biofilm associated Legionella would be located within protozoan hosts. While it is accepted that Legionella colonizes biofilm, its life cycle and nutritional fastidiousness suggest that Legionella employs multiple survival strategies to persist within microbial systems. Fluorescent in situ hybridization (FISH) and confocal laser scanning microscopy (CLSM) demonstrated an undulating biofilm surface architecture and a roughly homogenous distribution of heterotrophic bacteria with clusters of protozoa. Legionella displayed 3 distinct spatial arrangements either contained within or directly associated with protozoa, or dispersed in loosely associated clusters or in tightly packed aggregations of cells forming dense colonial clusters. The formation of discreet clusters of tightly packed Legionella suggests that colony formation is influenced by specific environmental conditions allowing for limited extracellular replication. This work represents the first time that an environmentally representative, multispecies biofilm containing Legionella has been fluorescently tagged and Legionella colony morphology noted within a complex microbial system.

  12. 3D-Printing inside the Glovebox: A Versatile Tool for Inert-Gas Chemistry Combined with Spectroscopy.

    PubMed

    Lederle, Felix; Kaldun, Christian; Namyslo, Jan C; Hübner, Eike G

    2016-04-01

    3D-Printing with the well-established 'Fused Deposition Modeling' technology was used to print totally gas-tight reaction vessels, combined with printed cuvettes, inside the inert-gas atmosphere of a glovebox. During pauses of the print, the reaction flasks out of acrylonitrile butadiene styrene were filled with various reactants. After the basic test reactions to proof the oxygen tightness and investigations of the influence of printing within an inert-gas atmosphere, scope and limitations of the method are presented by syntheses of new compounds with highly reactive reagents, such as trimethylaluminium, and reaction monitoring via UV/VIS, IR, and NMR spectroscopy. The applicable temperature range, the choice of solvents, the reaction times, and the analytical methods have been investigated in detail. A set of reaction flasks is presented, which allow routine inert-gas syntheses and combined spectroscopy without modifications of the glovebox, the 3D-printer, or the spectrometers. Overall, this demonstrates the potential of 3D-printed reaction cuvettes to become a complementary standard method in inert-gas chemistry.

  13. Human proximal tubule epithelial cells cultured on hollow fibers: living membranes that actively transport organic cations

    PubMed Central

    Jansen, J.; De Napoli, I. E; Fedecostante, M.; Schophuizen, C. M. S.; Chevtchik, N. V.; Wilmer, M. J.; van Asbeck, A. H.; Croes, H. J.; Pertijs, J. C.; Wetzels, J. F. M.; Hilbrands, L. B.; van den Heuvel, L. P.; Hoenderop, J. G.; Stamatialis, D.; Masereeuw, R.

    2015-01-01

    The bioartificial kidney (BAK) aims at improving dialysis by developing ‘living membranes’ for cells-aided removal of uremic metabolites. Here, unique human conditionally immortalized proximal tubule epithelial cell (ciPTEC) monolayers were cultured on biofunctionalized MicroPES (polyethersulfone) hollow fiber membranes (HFM) and functionally tested using microfluidics. Tight monolayer formation was demonstrated by abundant zonula occludens-1 (ZO-1) protein expression along the tight junctions of matured ciPTEC on HFM. A clear barrier function of the monolayer was confirmed by limited diffusion of FITC-inulin. The activity of the organic cation transporter 2 (OCT2) in ciPTEC was evaluated in real-time using a perfusion system by confocal microscopy using 4-(4-(dimethylamino)styryl)-N-methylpyridinium iodide (ASP+) as a fluorescent substrate. Initial ASP+ uptake was inhibited by a cationic uremic metabolites mixture and by the histamine H2-receptor antagonist, cimetidine. In conclusion, a ‘living membrane’ of renal epithelial cells on MicroPES HFM with demonstrated active organic cation transport was successfully established as a first step in BAK engineering. PMID:26567716

  14. A nonlinear OPC technique for laser beam control in turbulent atmosphere

    NASA Astrophysics Data System (ADS)

    Markov, V.; Khizhnyak, A.; Sprangle, P.; Ting, A.; DeSandre, L.; Hafizi, B.

    2013-05-01

    A viable beam control technique is critical for effective laser beam transmission through turbulent atmosphere. Most of the established approaches require information on the impact of perturbations on wavefront propagated waves. Such information can be acquired by measuring the characteristics of the target-scattered light arriving from a small, preferably diffraction-limited, beacon. This paper discusses an innovative beam control approach that can support formation of a tight laser beacon in deep turbulence conditions. The technique employs Brillouin enhanced fourwave mixing (BEFWM) to generate a localized beacon spot on a remote image-resolved target. Formation of the tight beacon doesn't require a wavefront sensor, AO system, or predictive feedback algorithm. Unlike conventional adaptive optics methods which allow wavefront conjugation, the proposed total field conjugation technique is critical for beam control in the presence of strong turbulence and can be achieved by using this non-linear BEFWM technique. The phase information retrieved from the established beacon beam can then be used in conjunction with an AO system to propagate laser beams in deep turbulence.

  15. Implementation and benchmark of a long-range corrected functional in the density functional based tight-binding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lutsker, V.; Niehaus, T. A., E-mail: thomas.niehaus@physik.uni-regensburg.de; Aradi, B.

    2015-11-14

    Bridging the gap between first principles methods and empirical schemes, the density functional based tight-binding method (DFTB) has become a versatile tool in predictive atomistic simulations over the past years. One of the major restrictions of this method is the limitation to local or gradient corrected exchange-correlation functionals. This excludes the important class of hybrid or long-range corrected functionals, which are advantageous in thermochemistry, as well as in the computation of vibrational, photoelectron, and optical spectra. The present work provides a detailed account of the implementation of DFTB for a long-range corrected functional in generalized Kohn-Sham theory. We apply themore » method to a set of organic molecules and compare ionization potentials and electron affinities with the original DFTB method and higher level theory. The new scheme cures the significant overpolarization in electric fields found for local DFTB, which parallels the functional dependence in first principles density functional theory (DFT). At the same time, the computational savings with respect to full DFT calculations are not compromised as evidenced by numerical benchmark data.« less

  16. Serial consolidation of orientation information into visual short-term memory.

    PubMed

    Liu, Taosheng; Becker, Mark W

    2013-06-01

    Previous research suggests that there is a limit to the rate at which items can be consolidated in visual short-term memory (VSTM). This limit could be due to either a serial or a limited-capacity parallel process. Historically, it has proven difficult to distinguish between these two types of processes. In the present experiment, we took a novel approach that allowed us to do so. Participants viewed two oriented gratings either sequentially or simultaneously and reported one of the gratings' orientation via method of adjustment. Performance was worse for the simultaneous than for the sequential condition. We fit the data with a mixture model that assumes performance is limited by a noisy memory representation plus random guessing. Critically, the serial and limited-capacity parallel processes made distinct predictions regarding the model's guessing and memory-precision parameters. We found strong support for a serial process, which implies that one can consolidate only a single orientation into VSTM at a time.

  17. Selection of Behavior Modification Programs Using the Simultaneous Treatment Design: Two Case Studies.

    ERIC Educational Resources Information Center

    Lowe, Warren C.

    This report outlines the limitations and weaknesses of singlecase, time-series research designs, of which the ABAB design is one of the widely used. An alternative design, the simultaneous treatment design, proposed by Browning and Stover (1971), has several advantages over the ABAB design. The design enables an experimenter to simultaneously…

  18. Genetic improvement of leaf photosynthesis and intrinsic water use efficiency in C3 plants: Why so much little success?

    PubMed

    Flexas, J

    2016-10-01

    There is an urgent need for simultaneously increasing photosynthesis/yields and water use efficiency (WUE) in C3 crops. Potentially, this can be achieved by genetic manipulation of the key traits involved. However, despite significant efforts in the past two decades very limited success has been achieved. Here I argue that this is mostly due to the fact that single gene/single trait approaches have been used thus far. Photosynthesis models demonstrate that only limited improving of photosynthesis can be expected by large improvements of any of its single limiting factors, i.e. stomatal conductance, mesophyll conductance, and the biochemical capacity for photosynthesis, the latter co-limited by Rubisco and the orchestrated activity of thylakoid electron transport and the Calvin cycle enzymes. Accordingly, only limited improvements of photosynthesis have been obtained by genetic manipulation of any of these single factors. In addition, improving photosynthesis by genetic manipulation in general reduced WUE, and vice-versa, and in many cases pleiotropic effects appear that cancel out some of the expected benefits. I propose that success in genetic manipulation for simultaneous improvement of photosynthesis and WUE efficiency may take longer than suggested in previous reports, and that it can be achieved only by joint projects addressing multi-gene manipulation for simultaneous alterations of all the limiting factors of photosynthesis, including the often neglected phloem capacity for loading and transport the expected surplus of carbohydrates in plants with improved photosynthesis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. Surface roughness and packaging tightness affect calcium lactate crystallization on Cheddar cheese.

    PubMed

    Rajbhandari, P; Kindstedt, P S

    2014-01-01

    Calcium lactate crystals that sometimes form on Cheddar cheese surfaces are a significant expense to manufacturers. Researchers have identified several postmanufacture conditions such as storage temperature and packaging tightness that contribute to crystal formation. Anecdotal reports suggest that physical characteristics at the cheese surface, such as roughness, cracks, and irregularities, may also affect crystallization. The aim of this study was to evaluate the combined effects of surface roughness and packaging tightness on crystal formation in smoked Cheddar cheese. Four 20-mm-thick cross-section slices were cut perpendicular to the long axis of a retail block (~300g) of smoked Cheddar cheese using a wire cutting device. One cut surface of each slice was lightly etched with a cheese grater to create a rough, grooved surface; the opposite cut surface was left undisturbed (smooth). The 4 slices were vacuum packaged at 1, 10, 50, and 90kPa (very tight, moderately tight, loose, very loose, respectively) and stored at 1°C. Digital images were taken at 1, 4, and 8 wk following the first appearance of crystals. The area occupied by crystals and number of discrete crystal regions (DCR) were quantified by image analysis. The experiment was conducted in triplicate. Effects of storage time, packaging tightness, surface roughness, and their interactions were evaluated by repeated-measures ANOVA. Surface roughness, packaging tightness, storage time, and their 2-way interactions significantly affected crystal area and DCR number. Extremely heavy crystallization occurred on both rough and smooth surfaces when slices were packaged loosely or very loosely and on rough surfaces with moderately tight packaging. In contrast, the combination of rough surface plus very tight packaging resulted in dramatic decreases in crystal area and DCR number. The combination of smooth surface plus very tight packaging virtually eliminated crystal formation, presumably by eliminating available sites for nucleation. Cut-and-wrap operations may significantly influence the crystallization behavior of Cheddar cheeses that are saturated with respect to calcium lactate and thus predisposed to form crystals. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  20. Uropathogenic E. coli Promote a Paracellular Urothelial Barrier Defect Characterized by Altered Tight Junction Integrity, Epithelial Cell Sloughing and Cytokine Release

    PubMed Central

    Wood, M. W.; Breitschwerdt, E. B.; Nordone, S. K.; Linder, K. E.; Gookin, J. L.

    2013-01-01

    Summary The urinary bladder is a common site of bacterial infection with a majority of cases attributed to uropathogenic Escherichia coli. Sequels of urinary tract infections (UTIs) include the loss of urothelial barrier function and subsequent clinical morbidity secondary to the permeation of urine potassium, urea and ammonia into the subepithelium. To date there has been limited research describing the mechanism by which this urothelial permeability defect develops. The present study models acute uropathogenic E. coli infection in vitro using intact canine bladder mucosa mounted in Ussing chambers to determine whether infection induces primarily a transcellular or paracellular permeability defect. The Ussing chamber sustains tissue viability while physically separating submucosal and lumen influences, so this model is ideal for quantitative measurement of transepithelial electrical resistance (TER) to assess alterations of urothelial barrier function. Using this model, changes in both tissue ultrastructure and TER indicated that uropathogenic E. coli infection promotes a paracellular permeability defect associated with the failure of umbrella cell tight junction formation and umbrella cell sloughing. In addition, bacterial interaction with the urothelium promoted secretion of cytokines from the urinary bladder with bioactivity capable of modulating epithelial barrier function including tumour necrosis factor-α, interleukin (IL)-6 and IL-15. IL-15 secretion by the infected bladder mucosa is a novel finding and, because IL-15 plays key roles in reconstitution of tight junction function in damaged intestine, this study points to a potential role for IL-15 in UTI-induced urothelial injury. PMID:22014415

  1. Mode of action of claudin peptidomimetics in the transient opening of cellular tight junction barriers.

    PubMed

    Staat, Christian; Coisne, Caroline; Dabrowski, Sebastian; Stamatovic, Svetlana M; Andjelkovic, Anuska V; Wolburg, Hartwig; Engelhardt, Britta; Blasig, Ingolf E

    2015-06-01

    In epithelial/endothelial barriers, claudins form tight junctions, seal the paracellular cleft, and limit the uptake of solutes and drugs. The peptidomimetic C1C2 from the C-terminal half of claudin-1's first extracellular loop increases drug delivery through epithelial claudin-1 barriers. However, its molecular and structural mode of action remains unknown. In the present study, >100 μM C1C2 caused paracellular opening of various barriers with different claudin compositions, ranging from epithelial to endothelial cells, preferentially modulating claudin-1 and claudin-5. After 6 h incubation, C1C2 reversibly increased the permeability to molecules of different sizes; this was accompanied by redistribution of claudins and occludin from junctions to cytosol. Internalization of C1C2 in epithelial cells depended on claudin-1 expression and clathrin pathway, whereby most C1C2 was retained in recyclosomes >2 h. In freeze-fracture electron microscopy, C1C2 changed claudin-1 tight junction strands to a more parallel arrangement and claudin-5 strands from E-face to P-face association - drastic and novel effects. In conclusion, C1C2 is largely recycled in the presence of a claudin, which explains the delayed onset of barrier and junction loss, the high peptide concentration required and the long-lasting effect. Epithelial/endothelial barriers are specifically modulated via claudin-1/claudin-5, which can be targeted to improve drug delivery. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. An Adaptive Low-Cost GNSS/MEMS-IMU Tightly-Coupled Integration System with Aiding Measurement in a GNSS Signal-Challenged Environment

    PubMed Central

    Zhou, Qifan; Zhang, Hai; Li, You; Li, Zheng

    2015-01-01

    The main aim of this paper is to develop a low-cost GNSS/MEMS-IMU tightly-coupled integration system with aiding information that can provide reliable position solutions when the GNSS signal is challenged such that less than four satellites are visible in a harsh environment. To achieve this goal, we introduce an adaptive tightly-coupled integration system with height and heading aiding (ATCA). This approach adopts a novel redundant measurement noise estimation method for an adaptive Kalman filter application and also augments external measurements in the filter to aid the position solutions, as well as uses different filters to deal with various situations. On the one hand, the adaptive Kalman filter makes use of the redundant measurement system’s difference sequence to estimate and tune noise variance instead of employing a traditional innovation sequence to avoid coupling with the state vector error. On the other hand, this method uses the external height and heading angle as auxiliary references and establishes a model for the measurement equation in the filter. In the meantime, it also changes the effective filter online based on the number of tracked satellites. These measures have increasingly enhanced the position constraints and the system observability, improved the computational efficiency and have led to a good result. Both simulated and practical experiments have been carried out, and the results demonstrate that the proposed method is effective at limiting the system errors when there are less than four visible satellites, providing a satisfactory navigation solution. PMID:26393605

  3. An Adaptive Low-Cost GNSS/MEMS-IMU Tightly-Coupled Integration System with Aiding Measurement in a GNSS Signal-Challenged Environment.

    PubMed

    Zhou, Qifan; Zhang, Hai; Li, You; Li, Zheng

    2015-09-18

    The main aim of this paper is to develop a low-cost GNSS/MEMS-IMU tightly-coupled integration system with aiding information that can provide reliable position solutions when the GNSS signal is challenged such that less than four satellites are visible in a harsh environment. To achieve this goal, we introduce an adaptive tightly-coupled integration system with height and heading aiding (ATCA). This approach adopts a novel redundant measurement noise estimation method for an adaptive Kalman filter application and also augments external measurements in the filter to aid the position solutions, as well as uses different filters to deal with various situations. On the one hand, the adaptive Kalman filter makes use of the redundant measurement system's difference sequence to estimate and tune noise variance instead of employing a traditional innovation sequence to avoid coupling with the state vector error. On the other hand, this method uses the external height and heading angle as auxiliary references and establishes a model for the measurement equation in the filter. In the meantime, it also changes the effective filter online based on the number of tracked satellites. These measures have increasingly enhanced the position constraints and the system observability, improved the computational efficiency and have led to a good result. Both simulated and practical experiments have been carried out, and the results demonstrate that the proposed method is effective at limiting the system errors when there are less than four visible satellites, providing a satisfactory navigation solution.

  4. CD134/CD137 Dual Costimulation-Elicited IFN-γ Maximizes Effector T Cell Function but Limits Treg Expansion

    PubMed Central

    Rose, Marie-Clare St.; Taylor, Roslyn A.; Bandyopadhyay, Suman; Qui, Harry Z.; Hagymasi, Adam T.; Vella, Anthony T.; Adler, Adam J.

    2012-01-01

    T cell tolerance to tumor antigens represents a major hurdle in generating tumor immunity. Combined administration of agonistic monoclonal antibodies to the costimulatory receptors CD134 plus CD137 can program T cells responding to tolerogenic antigen to undergo expansion and effector T cell differentiation, and also elicits tumor immunity. Nevertheless, CD134 and CD137 agonists can also engage inhibitory immune components. To understand how immune stimulatory versus inhibitory components are regulated during CD134 plus CD137 dual costimulation, the current study utilized a model where dual costimulation programs T cells encountering a highly tolerogenic self-antigen to undergo effector differentiation. IFN-γ was found to play a pivotal role in maximizing the function of effector T cells while simultaneously limiting the expansion of CD4+CD25+Foxp3+ Tregs. In antigen-responding effector T cells, IFN-γ operates via a direct cell-intrinsic mechanism to cooperate with IL-2 to program maximal expression of granzyme B. Simultaneously, IFN-γ limits expression of the IL-2 receptor alpha chain (CD25) and IL-2 signaling through a mechanism that does not involve T-bet-mediated repression of IL-2. IFN-γ also limited CD25 and Foxp3 expression on bystanding CD4+Foxp3+ Tregs, and limited the potential of these Tregs to expand. These effects could not be explained by the ability of IFN-γ to limit IL-2 availability. Taken together, during dual costimulation IFN-γ interacts with IL-2 through distinct mechanisms to program maximal expression of effector molecules in antigen-responding T cells while simultaneously limiting Treg expansion. PMID:23295363

  5. Mechanism reduction for multicomponent surrogates: A case study using toluene reference fuels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niemeyer, Kyle E.; Sung, Chih-Jen

    Strategies and recommendations for performing skeletal reductions of multicomponent surrogate fuels are presented, through the generation and validation of skeletal mechanisms for a three-component toluene reference fuel. Using the directed relation graph with error propagation and sensitivity analysis method followed by a further unimportant reaction elimination stage, skeletal mechanisms valid over comprehensive and high-temperature ranges of conditions were developed at varying levels of detail. These skeletal mechanisms were generated based on autoignition simulations, and validation using ignition delay predictions showed good agreement with the detailed mechanism in the target range of conditions. When validated using phenomena other than autoignition, suchmore » as perfectly stirred reactor and laminar flame propagation, tight error control or more restrictions on the reduction during the sensitivity analysis stage were needed to ensure good agreement. In addition, tight error limits were needed for close prediction of ignition delay when varying the mixture composition away from that used for the reduction. In homogeneous compression-ignition engine simulations, the skeletal mechanisms closely matched the point of ignition and accurately predicted species profiles for lean to stoichiometric conditions. Furthermore, the efficacy of generating a multicomponent skeletal mechanism was compared to combining skeletal mechanisms produced separately for neat fuel components; using the same error limits, the latter resulted in a larger skeletal mechanism size that also lacked important cross reactions between fuel components. Based on the present results, general guidelines for reducing detailed mechanisms for multicomponent fuels are discussed.« less

  6. Cathelicidins Inhibit Escherichia coli–Induced TLR2 and TLR4 Activation in a Viability-Dependent Manner

    PubMed Central

    Coorens, Maarten; Schneider, Viktoria A. F.; Meijerink, Marjolein; Wells, Jerry M.; Scheenstra, Maaike R.

    2017-01-01

    Activation of the immune system needs to be tightly regulated to provide protection against infections and, at the same time, to prevent excessive inflammation to limit collateral damage to the host. This tight regulation includes regulating the activation of TLRs, which are key players in the recognition of invading microbes. A group of short cationic antimicrobial peptides, called cathelicidins, have previously been shown to modulate TLR activation by synthetic or purified TLR ligands and may play an important role in the regulation of inflammation during infections. However, little is known about how these cathelicidins affect TLR activation in the context of complete and viable bacteria. In this article, we show that chicken cathelicidin-2 kills Escherichia coli in an immunogenically silent fashion. Our results show that chicken cathelicidin-2 kills E. coli by permeabilizing the bacterial inner membrane and subsequently binds the outer membrane–derived lipoproteins and LPS to inhibit TLR2 and TLR4 activation, respectively. In addition, other cathelicidins, including human, mouse, pig, and dog cathelicidins, which lack antimicrobial activity under cell culture conditions, only inhibit macrophage activation by nonviable E. coli. In total, this study shows that cathelicidins do not affect immune activation by viable bacteria and only inhibit inflammation when bacterial viability is lost. Therefore, cathelicidins provide a novel mechanism by which the immune system can discriminate between viable and nonviable Gram-negative bacteria to tune the immune response, thereby limiting collateral damage to the host and the risk for sepsis. PMID:28710255

  7. Non-proximate mass spectrometry using a heated 1-m long PTFE tube and an air-tight APCI ion source.

    PubMed

    Usmanov, Dilshadbek T; Hiraoka, Kenzo; Wada, Hiroshi; Matsumura, Masaya; Sanada-Morimura, Sachiyo; Nonami, Hiroshi; Yamabe, Shinichi

    2017-06-22

    Direct and rapid trace-level gas analysis is highly needed in various fields such as safety and security, quality control, food analysis, and forensic medicine. In many cases, the real samples are bulky and are not accessible to the space-limited ion source of the mass spectrometer. In order to circumvent this problem, we developed an airtight atmospheric-pressure chemical ionization (APCI) ion source equipped with a flexible 1-m-long, 2-mm-i.d. PTFE sniffing tube. The ambient air bearing sample gas was sucked into the heated PTFE tube (130 °C) and was transported to the air-tight ion source without using any extra pumping system or a Venturi device. Analytes were ionized by an ac corona discharge located at 1.5 mm from the inlet of the mass spectrometer. By using the airtight ion source, all the ionized gas in the ion source was introduced into the vacuum of the mass spectrometer via only the evacuation of the mass spectrometer (1.6 l min -1 ). Sub-pg limits of detection were obtained for carbaryl and trinitrotoluene. Owing to its flexibility and high sensitivity, the sniffing tube coupled with a mass spectrometer can be used as the stethoscope for the high-sensitive gas analysis. The experimental results obtained for drugs, hydrogen peroxide and small alkanes were discussed by DFT calculations. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A permeability barrier surrounds taste buds in lingual epithelia.

    PubMed

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D

    2015-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003-1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste. Copyright © 2015 the American Physiological Society.

  9. Mechanism reduction for multicomponent surrogates: A case study using toluene reference fuels

    DOE PAGES

    Niemeyer, Kyle E.; Sung, Chih-Jen

    2014-11-01

    Strategies and recommendations for performing skeletal reductions of multicomponent surrogate fuels are presented, through the generation and validation of skeletal mechanisms for a three-component toluene reference fuel. Using the directed relation graph with error propagation and sensitivity analysis method followed by a further unimportant reaction elimination stage, skeletal mechanisms valid over comprehensive and high-temperature ranges of conditions were developed at varying levels of detail. These skeletal mechanisms were generated based on autoignition simulations, and validation using ignition delay predictions showed good agreement with the detailed mechanism in the target range of conditions. When validated using phenomena other than autoignition, suchmore » as perfectly stirred reactor and laminar flame propagation, tight error control or more restrictions on the reduction during the sensitivity analysis stage were needed to ensure good agreement. In addition, tight error limits were needed for close prediction of ignition delay when varying the mixture composition away from that used for the reduction. In homogeneous compression-ignition engine simulations, the skeletal mechanisms closely matched the point of ignition and accurately predicted species profiles for lean to stoichiometric conditions. Furthermore, the efficacy of generating a multicomponent skeletal mechanism was compared to combining skeletal mechanisms produced separately for neat fuel components; using the same error limits, the latter resulted in a larger skeletal mechanism size that also lacked important cross reactions between fuel components. Based on the present results, general guidelines for reducing detailed mechanisms for multicomponent fuels are discussed.« less

  10. Petri Net-Based Model of Helicobacter pylori Mediated Disruption of Tight Junction Proteins in Stomach Lining during Gastric Carcinoma

    PubMed Central

    Naz, Anam; Obaid, Ayesha; Awan, Faryal M.; Ikram, Aqsa; Ahmad, Jamil; Ali, Amjad

    2017-01-01

    Tight junctions help prevent the passage of digestive enzymes and microorganisms through the space between adjacent epithelial cells lining. However, Helicobacter pylori encoded virulence factors negatively regulate these tight junctions and contribute to dysfunction of gastric mucosa. Here, we have predicted the regulation of important tight junction proteins, such as Zonula occludens-1, Claudin-2 and Connexin32 in the presence of pathogenic proteins. Molecular events such as post translational modifications and crosstalk between phosphorylation, O-glycosylation, palmitoylation and methylation are explored which may compromise the integrity of these tight junction proteins. Furthermore, the signaling pathways disrupted by dysregulated kinases, proteins and post-translational modifications are reviewed to design an abstracted computational model showing the situation-dependent dynamic behaviors of these biological processes and entities. A qualitative hybrid Petri Net model is therefore constructed showing the altered host pathways in the presence of virulence factor cytotoxin-associated gene A, leading to the disruption of tight junction proteins. The model is qualitative logic-based, which does not depend on any kinetic parameter and quantitative data and depends on knowledge derived from experiments. The designed model provides insights into the tight junction disruption and disease progression. Model is then verified by the available experimental data, nevertheless formal in vitro experimentation is a promising way to ensure its validation. The major findings propose that H. pylori activated kinases are responsible to trigger specific post translational modifications within tight junction proteins, at specific sites. These modifications may favor alterations in gastric barrier and provide a route to bacterial invasion into host cells. PMID:28932213

  11. Short-term outcomes of arthroscopic TightRope® fixation are better than hook plate fixation in acute unstable acromioclavicular joint dislocations.

    PubMed

    Bin Abd Razak, Hamid Rahmatullah; Yeo, Eng-Meng Nicholas; Yeo, William; Lie, Tijauw-Tjoen Denny

    2018-07-01

    The aim of this study was to compare the short-term outcomes of arthroscopic TightRope ® fixation with that of hook plate fixation in patients with acute unstable acromioclavicular joint dislocations. We conducted a prospective case-control study of twenty-six patients with an acute ACJ dislocation who underwent surgical repair with either an arthroscopic TightRope ® fixation or a hook plate from 2013 to 2016. Clinical and radiological data were collected prospectively. Clinical outcomes were evaluated using the Constant Score, the University of California at Los Angeles (UCLA) Shoulder Score, Oxford Shoulder Score as well as the visual analogue scale. Radiological outcomes were assessed with the coracoclavicular distance (CCD). Sixteen patients underwent arthroscopic TightRope ® fixation, while 10 patients underwent hook plate fixation. There were no significant differences in the preoperative variables except for the mean UCLA 4b infraspinatus score (TightRope ® 2.8 vs. hook plate 3.8; p = 0.030). Duration of surgery was significantly longer in the TightRope ® group. At 1 year post-operatively, the TightRope ® group had a significantly better Constant Score and CCD with no complications. All patients with hook plate fixation had to undergo a second procedure for removal of implant, and 3 patients had complications. Arthroscopic TightRope ® fixation is a good option for the treatment of acute unstable ACJ dislocations. It has better short-term clinical and radiological outcomes as well as lesser complications when compared to hook plate fixation. Therapeutic, Level III.

  12. Relationship between the skeletal maturation of the distal attachment of the patellar tendon and physical features in preadolescent male football players.

    PubMed

    Nakase, Junsuke; Aiba, Tomohiro; Goshima, Kenichi; Takahashi, Ryohei; Toratani, Tatsuhiro; Kosaka, Masahiro; Ohashi, Yoshinori; Tsuchiya, Hiroyuki

    2014-01-01

    The aim of this study was to compare ultrasonography stages of the tibial tuberosity development and physical features. This study examined 200 knees in 100 male football players aged 10-15 years. Tibial tuberosity development on ultrasonography was divided into 3 stages: Sonolucent stage (stage S), Individual stage (stage I), and Connective stage (stage C). Age, height, quadriceps and hamstring muscle tightness, and muscle strength in knee extension and flexion were determined. These findings were compared with the respective stages of development. The tibial tuberosity was stage S in 27 knees, stage I in 69 knees, and stage C in 104 knees, with right and left sides at the same stage in 95 %. Average age and height significantly increased with advancing tibial tuberosity development. Quadriceps tightness increased with tibial tuberosity development. Hamstring tightness decreased with development. The strength of both knee extension and flexion increased with advancing development, with a greater change seen in knee extension, hamstring/quadriceps ratio: stage C, 0.74; stage A, 0.64; stage E, 0.53. Osgood-Schlatter pathogenesis reportedly involves increased quadriceps tightness with rapidly increasing femoral length during tibial tuberosity development. In this study, it was confirmed that quadriceps tightness increased, yet hamstring tightness decreased, suggesting that quadriceps tightness is not due to femoral length alone. Other factors, including muscle strength, may be involved. The study shows that thigh muscle tightness and thigh muscle performance change with the skeletal maturation of the distal attachment of the patellar tendon. These results add new information to the pathogenesis of Osgood-Schlatter disease.

  13. Petri Net-Based Model of Helicobacter pylori Mediated Disruption of Tight Junction Proteins in Stomach Lining during Gastric Carcinoma.

    PubMed

    Naz, Anam; Obaid, Ayesha; Awan, Faryal M; Ikram, Aqsa; Ahmad, Jamil; Ali, Amjad

    2017-01-01

    Tight junctions help prevent the passage of digestive enzymes and microorganisms through the space between adjacent epithelial cells lining. However, Helicobacter pylori encoded virulence factors negatively regulate these tight junctions and contribute to dysfunction of gastric mucosa. Here, we have predicted the regulation of important tight junction proteins, such as Zonula occludens-1, Claudin-2 and Connexin32 in the presence of pathogenic proteins. Molecular events such as post translational modifications and crosstalk between phosphorylation, O-glycosylation, palmitoylation and methylation are explored which may compromise the integrity of these tight junction proteins. Furthermore, the signaling pathways disrupted by dysregulated kinases, proteins and post-translational modifications are reviewed to design an abstracted computational model showing the situation-dependent dynamic behaviors of these biological processes and entities. A qualitative hybrid Petri Net model is therefore constructed showing the altered host pathways in the presence of virulence factor cytotoxin-associated gene A, leading to the disruption of tight junction proteins. The model is qualitative logic-based, which does not depend on any kinetic parameter and quantitative data and depends on knowledge derived from experiments. The designed model provides insights into the tight junction disruption and disease progression. Model is then verified by the available experimental data, nevertheless formal in vitro experimentation is a promising way to ensure its validation. The major findings propose that H. pylori activated kinases are responsible to trigger specific post translational modifications within tight junction proteins, at specific sites. These modifications may favor alterations in gastric barrier and provide a route to bacterial invasion into host cells.

  14. 40 CFR 721.10607 - Aliphatic diisocyanate, homopolymer, alkanol-blocked (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-purifying, tight-fitting half-face respirator equipped with N100 (if oil aerosols absent), R100, or P100 filters. (B) NIOSH-certified air-purifying, tight-fitting full-face respirator equipped with N100 (if oil...-certified powered air-purifying respirator equipped with a tight-fitting facepiece (either half-face or full...

  15. 40 CFR 721.9719 - Tris carbamoyl triazine (generic).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... the requirements for § 721.63(a)(4): (A) Air purifying, tight-fitting half-face respirator equipped... filter (N100 if oil aerosols are absent, R100, or P100); (B) Air purifying, tight-fitting full-face...) filter; powered air-purifying respirator equipped with tight-fitting facepiece (either half-face or full...

  16. Tight junctions negatively regulate mechanical forces applied to adherens junctions in vertebrate epithelial tissue.

    PubMed

    Hatte, Guillaume; Prigent, Claude; Tassan, Jean-Pierre

    2018-02-05

    Epithelia are layers of polarised cells tightly bound to each other by adhesive contacts. Epithelia act as barriers between an organism and its external environment. Understanding how epithelia maintain their essential integrity while remaining sufficiently plastic to allow events such as cytokinesis to take place is a key biological problem. In vertebrates, the remodelling and reinforcement of adherens junctions maintains epithelial integrity during cytokinesis. The involvement of tight junctions in cell division, however, has remained unexplored. Here, we examine the role of tight junctions during cytokinesis in the epithelium of the Xenopus laevis embryo. Depletion of the tight junction-associated proteins ZO-1 and GEF-H1 leads to altered cytokinesis duration and contractile ring geometry. Using a tension biosensor, we show that cytokinesis defects originate from misregulation of tensile forces applied to adherens junctions. Our results reveal that tight junctions regulate mechanical tension applied to adherens junctions, which in turn impacts cytokinesis.This article has an associated First Person interview with the first author of the paper. © 2018. Published by The Company of Biologists Ltd.

  17. JAM-C regulates tight junctions and integrin-mediated cell adhesion and migration.

    PubMed

    Mandicourt, Guillaume; Iden, Sandra; Ebnet, Klaus; Aurrand-Lions, Michel; Imhof, Beat A

    2007-01-19

    Junctional Adhesion Molecules (JAMs) have been described as major components of tight junctions in endothelial and epithelial cells. Tight junctions are crucial for the establishment and maintenance of cell polarity. During tumor development, they are remodeled, enabling neoplastic cells to escape from constraints imposed by intercellular junctions and to adopt a migratory behavior. Using a carcinoma cell line we tested whether JAM-C could affect tight junctions and migratory properties of tumor cells. We show that transfection of JAM-C improves the tight junctional barrier in tumor cells devoid of JAM-C expression. This is dependent on serine 281 in the cytoplasmic tail of JAM-C because serine mutation into alanine abolishes the specific localization of JAM-C in tight junctions and establishment of cell polarity. More importantly, the same mutation stimulates integrin-mediated cell migration and adhesion via the modulation of beta1 and beta3 integrin activation. These results highlight an unexpected function for JAM-C in controlling epithelial cell conversion from a static, polarized state to a pro-migratory phenotype.

  18. Pseudomonas aeruginosa elastase causes transient disruption of tight junctions and downregulation of PAR-2 in human nasal epithelial cells.

    PubMed

    Nomura, Kazuaki; Obata, Kazufumi; Keira, Takashi; Miyata, Ryo; Hirakawa, Satoshi; Takano, Ken-ichi; Kohno, Takayuki; Sawada, Norimasa; Himi, Tetsuo; Kojima, Takashi

    2014-02-18

    Pseudomonas aeruginosa causes chronic respiratory disease, and the elastase enzyme that it produces increases the permeability of airway epithelial cells owing to the disruption of tight junctions. P. aeruginosa is also implicated in prolonged chronic rhinosinusitis. However, the effects of P. aeruginosa elastase (PE) against the barrier formed by human nasal epithelial cells (HNECs) remain unknown. To investigate the mechanisms involved in the disruption of tight junctions by PE in HNECs, primary cultures of HNECs transfected with human telomerase reverse transcriptase (hTERT-HNECs) were used. The hTERT-HNECs were pretreated with inhibitors of various signal transduction pathways, PKC, MAPK, p38MAPK, PI3K, JNK, NF-κB, EGF receptor, proteasome, COX1 and COX2 before treatment with PE. Some cells were pretreated with siRNA and agonist of protease activated receptor-2 (PAR-2) before treatment with PE. Expression and structures of tight junctions were determined by Western blotting, real-time PCR, immunostaining and freeze-fracture. Transepithelial electrical resistance (TER) was examined as the epithelial barrier function. PE treatment transiently disrupted the epithelial barrier and downregulated the transmembrane proteins claudin-1 and -4, occludin, and tricellulin, but not the scaffold PDZ-expression proteins ZO-1 and -2 and adherens junction proteins E-cadherin and β-catenin. The transient downregulation of tight junction proteins was controlled via distinct signal transduction pathways such as the PKC, MAPK, PI3K, p38 MAPK, JNK, COX-1 and -2, and NF-κB pathways. Furthermore, treatment with PE transiently decreased PAR-2 expression, which also regulated the expression of the tight junction proteins. Treatment with a PAR-2 agonist prevented the downregulation of the tight junction proteins after PE treatment in HNECs. PE transiently disrupts tight junctions in HNECs and downregulates PAR-2. The transient disruption of tight junctions by PE might occur repeatedly during chronic rhinosinusitis.

  19. Pseudomonas aeruginosa elastase causes transient disruption of tight junctions and downregulation of PAR-2 in human nasal epithelial cells

    PubMed Central

    2014-01-01

    Background Pseudomonas aeruginosa causes chronic respiratory disease, and the elastase enzyme that it produces increases the permeability of airway epithelial cells owing to the disruption of tight junctions. P. aeruginosa is also implicated in prolonged chronic rhinosinusitis. However, the effects of P. aeruginosa elastase (PE) against the barrier formed by human nasal epithelial cells (HNECs) remain unknown. Methods To investigate the mechanisms involved in the disruption of tight junctions by PE in HNECs, primary cultures of HNECs transfected with human telomerase reverse transcriptase (hTERT-HNECs) were used. The hTERT-HNECs were pretreated with inhibitors of various signal transduction pathways, PKC, MAPK, p38MAPK, PI3K, JNK, NF-κB, EGF receptor, proteasome, COX1 and COX2 before treatment with PE. Some cells were pretreated with siRNA and agonist of protease activated receptor-2 (PAR-2) before treatment with PE. Expression and structures of tight junctions were determined by Western blotting, real-time PCR, immunostaining and freeze-fracture. Transepithelial electrical resistance (TER) was examined as the epithelial barrier function. Results PE treatment transiently disrupted the epithelial barrier and downregulated the transmembrane proteins claudin-1 and -4, occludin, and tricellulin, but not the scaffold PDZ-expression proteins ZO-1 and -2 and adherens junction proteins E-cadherin and β-catenin. The transient downregulation of tight junction proteins was controlled via distinct signal transduction pathways such as the PKC, MAPK, PI3K, p38 MAPK, JNK, COX-1 and -2, and NF-κB pathways. Furthermore, treatment with PE transiently decreased PAR-2 expression, which also regulated the expression of the tight junction proteins. Treatment with a PAR-2 agonist prevented the downregulation of the tight junction proteins after PE treatment in HNECs. Conclusions PE transiently disrupts tight junctions in HNECs and downregulates PAR-2. The transient disruption of tight junctions by PE might occur repeatedly during chronic rhinosinusitis. PMID:24548792

  20. Loss of thermal refugia near equatorial range limits.

    PubMed

    Lima, Fernando P; Gomes, Filipa; Seabra, Rui; Wethey, David S; Seabra, Maria I; Cruz, Teresa; Santos, António M; Hilbish, Thomas J

    2016-01-01

    This study examines the importance of thermal refugia along the majority of the geographical range of a key intertidal species (Patella vulgata Linnaeus, 1758) on the Atlantic coast of Europe. We asked whether differences between sun-exposed and shaded microhabitats were responsible for differences in physiological stress and ecological performance and examined the availability of refugia near equatorial range limits. Thermal differences between sun-exposed and shaded microhabitats are consistently associated with differences in physiological performance, and the frequency of occurrence of high temperatures is most probably limiting the maximum population densities supported at any given place. Topographical complexity provides thermal refugia throughout most of the distribution range, although towards the equatorial edges the magnitude of the amelioration provided by shaded microhabitats is largely reduced. Importantly, the limiting effects of temperature, rather than being related to latitude, seem to be tightly associated with microsite variability, which therefore is likely to have profound effects on the way local populations (and consequently species) respond to climatic changes. © 2015 John Wiley & Sons Ltd.

  1. The brain parenchyma has a type I interferon response that can limit virus spread.

    PubMed

    Drokhlyansky, Eugene; Göz Aytürk, Didem; Soh, Timothy K; Chrenek, Ryan; O'Loughlin, Elaine; Madore, Charlotte; Butovsky, Oleg; Cepko, Constance L

    2017-01-03

    The brain has a tightly regulated environment that protects neurons and limits inflammation, designated "immune privilege." However, there is not an absolute lack of an immune response. We tested the ability of the brain to initiate an innate immune response to a virus, which was directly injected into the brain parenchyma, and to determine whether this response could limit viral spread. We injected vesicular stomatitis virus (VSV), a transsynaptic tracer, or naturally occurring VSV-derived defective interfering particles (DIPs), into the caudate-putamen (CP) and scored for an innate immune response and inhibition of virus spread. We found that the brain parenchyma has a functional type I interferon (IFN) response that can limit VSV spread at both the inoculation site and among synaptically connected neurons. Furthermore, we characterized the response of microglia to VSV infection and found that infected microglia produced type I IFN and uninfected microglia induced an innate immune response following virus injection.

  2. The efficacy of two electrodes radiofrequency technique: comparison study using a cadaveric interspinous ligament and temperature measurement using egg white.

    PubMed

    Lee, Chang-Hyung; Derby, Richard; Choi, Hyun-Seok; Lee, Sang-Heon; Kim, Se Hoon; Kang, Yoon Kyu

    2010-01-01

    One technique in radiofrequency neurotomies uses 2 electrodes that are simultaneously placed to lie parallel to one another. Comparing lesions on cadaveric interspinous ligament tissue and measuring the temperature change in egg white allows us to accurately measure quantitatively the area of the lesion. Fresh cadaver spinal tissue and egg white tissue were used. A series of samples were prepared with the electrodes placed 1 to 7 mm apart. Using radiofrequency, the needle electrodes were heated in sequential or simultaneous order and the distance of the escaped lesion area and temperature were measured. Samples of cadaver interspinous ligament showed sequential heating of the needles limits the placement of the needle electrodes up to 2 mm apart from each other and up to 4 mm apart when heated simultaneously. The temperature at the escaped lesion area decreased according to the distance for egg white. There was a significant difference in temperature at the escaped lesion area up to 6 mm apart and the temperature was above 50 degrees celsius up to 5 mm in simultaneous lesion and 3 mm in the sequential lesion. The limitations of this study include cadaveric experimentation and use of intraspinous ligament rather than medial branch of the dorsal ramus which is difficult to identify. Heating the 2 electrodes simultaneously appears to coagulate a wider area and potentially produce better results in less time.

  3. 40 CFR 721.10581 - Brominated polyurethane prepolymers of methylene diphenyl diisocyanate (MDI) (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., tight-fitting half-face respirator equipped with N100 (if oil aerosols absent), R100, or P100 filters. (B) NIOSH-certified air-purifying, tight-fitting full-face respirator equipped with N100 (if oil...-certified powered air-purifying respirator equipped with a tight-fitting facepiece (either half-face or full...

  4. Hydration forces between aligned DNA helices undergoing B to A conformational change: In-situ X-ray fiber diffraction studies in a humidity and temperature controlled environment.

    PubMed

    Case, Ryan; Schollmeyer, Hauke; Kohl, Phillip; Sirota, Eric B; Pynn, Roger; Ewert, Kai E; Safinya, Cyrus R; Li, Youli

    2017-12-01

    Hydration forces between DNA molecules in the A- and B-Form were studied using a newly developed technique enabling simultaneous in situ control of temperature and relative humidity. X-ray diffraction data were collected from oriented calf-thymus DNA fibers in the relative humidity range of 98%-70%, during which DNA undergoes the B- to A-form transition. Coexistence of both forms was observed over a finite humidity range at the transition. The change in DNA separation in response to variation in humidity, i.e. change of chemical potential, led to the derivation of a force-distance curve with a characteristic exponential decay constant of∼2Å for both A- and B-DNA. While previous osmotic stress measurements had yielded similar force-decay constants, they were limited to B-DNA with a surface separation (wall-to-wall distance) typically>5Å. The current investigation confirms that the hydration force remains dominant even in the dry A-DNA state and at surface separation down to∼1.5Å, within the first hydration shell. It is shown that the observed chemical potential difference between the A and B states could be attributed to the water layer inside the major and minor grooves of the A-DNA double helices, which can partially interpenetrate each other in the tightly packed A phase. The humidity-controlled X-ray diffraction method described here can be employed to perform direct force measurements on a broad range of biological structures such as membranes and filamentous protein networks. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Joint annotation of chromatin state and chromatin conformation reveals relationships among domain types and identifies domains of cell-type-specific expression

    PubMed Central

    Libbrecht, Maxwell W.; Ay, Ferhat; Hoffman, Michael M.; Gilbert, David M.; Bilmes, Jeffrey A.; Noble, William Stafford

    2015-01-01

    The genomic neighborhood of a gene influences its activity, a behavior that is attributable in part to domain-scale regulation. Previous genomic studies have identified many types of regulatory domains. However, due to the difficulty of integrating genomics data sets, the relationships among these domain types are poorly understood. Semi-automated genome annotation (SAGA) algorithms facilitate human interpretation of heterogeneous collections of genomics data by simultaneously partitioning the human genome and assigning labels to the resulting genomic segments. However, existing SAGA methods cannot integrate inherently pairwise chromatin conformation data. We developed a new computational method, called graph-based regularization (GBR), for expressing a pairwise prior that encourages certain pairs of genomic loci to receive the same label in a genome annotation. We used GBR to exploit chromatin conformation information during genome annotation by encouraging positions that are close in 3D to occupy the same type of domain. Using this approach, we produced a model of chromatin domains in eight human cell types, thereby revealing the relationships among known domain types. Through this model, we identified clusters of tightly regulated genes expressed in only a small number of cell types, which we term “specific expression domains.” We found that domain boundaries marked by promoters and CTCF motifs are consistent between cell types even when domain activity changes. Finally, we showed that GBR can be used to transfer information from well-studied cell types to less well-characterized cell types during genome annotation, making it possible to produce high-quality annotations of the hundreds of cell types with limited available data. PMID:25677182

  6. Joint annotation of chromatin state and chromatin conformation reveals relationships among domain types and identifies domains of cell-type-specific expression.

    PubMed

    Libbrecht, Maxwell W; Ay, Ferhat; Hoffman, Michael M; Gilbert, David M; Bilmes, Jeffrey A; Noble, William Stafford

    2015-04-01

    The genomic neighborhood of a gene influences its activity, a behavior that is attributable in part to domain-scale regulation. Previous genomic studies have identified many types of regulatory domains. However, due to the difficulty of integrating genomics data sets, the relationships among these domain types are poorly understood. Semi-automated genome annotation (SAGA) algorithms facilitate human interpretation of heterogeneous collections of genomics data by simultaneously partitioning the human genome and assigning labels to the resulting genomic segments. However, existing SAGA methods cannot integrate inherently pairwise chromatin conformation data. We developed a new computational method, called graph-based regularization (GBR), for expressing a pairwise prior that encourages certain pairs of genomic loci to receive the same label in a genome annotation. We used GBR to exploit chromatin conformation information during genome annotation by encouraging positions that are close in 3D to occupy the same type of domain. Using this approach, we produced a model of chromatin domains in eight human cell types, thereby revealing the relationships among known domain types. Through this model, we identified clusters of tightly regulated genes expressed in only a small number of cell types, which we term "specific expression domains." We found that domain boundaries marked by promoters and CTCF motifs are consistent between cell types even when domain activity changes. Finally, we showed that GBR can be used to transfer information from well-studied cell types to less well-characterized cell types during genome annotation, making it possible to produce high-quality annotations of the hundreds of cell types with limited available data. © 2015 Libbrecht et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Two facets of world arsenic problem solution: crop poisoning restriction and enforcement of phytoremediation.

    PubMed

    Kofroňová, Monika; Mašková, Petra; Lipavská, Helena

    2018-05-07

    This review provides insights into As toxicity in plants with focus on photosynthesis and sugar metabolism as important arsenic targets and simultaneously defence tools against accompanying oxidative stress. Heavy metal contamination is a great problem all over the world. Arsenic, a metalloid occurring naturally in the Earth's crust, also massively spreads out in the environment by human activities. Its accumulation in crops poses a severe health risk to humans and animals. Besides the restriction of human-caused contamination, there are two basic ways how to cope with the problem: first, to limit arsenic accumulation in harvestable parts of the crops; second, to make use of some arsenic hyperaccumulating plants for phytoremediation of contaminated soils and waters. Progress in the use of both strategies depends strongly on the level of our knowledge on the physiological and morphological processes resulting from arsenic exposure. Arsenic uptake is mediated preferentially by P and Si transporters and its accumulation substantially impairs plant metabolism at numerous levels including damages through oxidative stress. Rice is a predominantly studied crop where substantial progress has been made in understanding of the mechanisms of arsenic uptake, distribution, and detoxification, though many questions still remain. Full exploitation of plant potential for soil and water phytoremediations also requires deep understanding of the plant response to this toxic metalloid. The aim of this review is to summarize data regarding the effect of arsenic on plant physiology with a focus on mechanisms providing increased arsenic tolerance and/or hyperaccumulation. The emphasis is placed on the topic unjustifiably neglected in the previous reviews - i.e., carbohydrate metabolism, tightly connected to photosynthesis, and beside others involved in plant ability to cope with arsenic-induced oxidative and nitrosative stresses.

  8. Detecting regulatory gene-environment interactions with unmeasured environmental factors.

    PubMed

    Fusi, Nicoló; Lippert, Christoph; Borgwardt, Karsten; Lawrence, Neil D; Stegle, Oliver

    2013-06-01

    Genomic studies have revealed a substantial heritable component of the transcriptional state of the cell. To fully understand the genetic regulation of gene expression variability, it is important to study the effect of genotype in the context of external factors such as alternative environmental conditions. In model systems, explicit environmental perturbations have been considered for this purpose, allowing to directly test for environment-specific genetic effects. However, such experiments are limited to species that can be profiled in controlled environments, hampering their use in important systems such as human. Moreover, even in seemingly tightly regulated experimental conditions, subtle environmental perturbations cannot be ruled out, and hence unknown environmental influences are frequent. Here, we propose a model-based approach to simultaneously infer unmeasured environmental factors from gene expression profiles and use them in genetic analyses, identifying environment-specific associations between polymorphic loci and individual gene expression traits. In extensive simulation studies, we show that our method is able to accurately reconstruct environmental factors and their interactions with genotype in a variety of settings. We further illustrate the use of our model in a real-world dataset in which one environmental factor has been explicitly experimentally controlled. Our method is able to accurately reconstruct the true underlying environmental factor even if it is not given as an input, allowing to detect genuine genotype-environment interactions. In addition to the known environmental factor, we find unmeasured factors involved in novel genotype-environment interactions. Our results suggest that interactions with both known and unknown environmental factors significantly contribute to gene expression variability. and implementation: Software available at http://pmbio.github.io/envGPLVM/. Supplementary data are available at Bioinformatics online.

  9. Cardiovascular and haematological responses of Atlantic cod (Gadus morhua) to acute temperature increase.

    PubMed

    Gollock, M J; Currie, S; Petersen, L H; Gamperl, A K

    2006-08-01

    For fish to survive large acute temperature increases (i.e. >10.0 degrees C) that may bring them close to their critical thermal maximum (CTM), oxygen uptake at the gills and distribution by the cardiovascular system must increase to match tissue oxygen demand. To examine the effects of an acute temperature increase ( approximately 1.7 degrees C h(-1) to CTM) on the cardiorespiratory physiology of Atlantic cod, we (1) carried out respirometry on 10.0 degrees C acclimated fish, while simultaneously measuring in vivo cardiac parameters using Transonic probes, and (2) constructed in vitro oxygen binding curves on whole blood from 7.0 degrees C acclimated cod at a range of temperatures. Both cardiac output (Q) and heart rate (fh) increased until near the fish's CTM (22.2+/-0.2 degrees C), and then declined rapidly. Q(10) values for Q and fh were 2.48 and 2.12, respectively, and increases in both parameters were tightly correlated with O(2) consumption. The haemoglobin (Hb)-oxygen binding curve at 24.0 degrees C showed pronounced downward and rightward shifts compared to 20.0 degrees C and 7.0 degrees C, indicating that both binding capacity and affinity decreased. Further, Hb levels were lower at 24.0 degrees C than at 20.0 degrees C and 7.0 degrees C. This was likely to be due to cell swelling, as electrophoresis of Hb samples did not suggest protein denaturation, and at 24.0 degrees C Hb samples showed peak absorbance at the expected wavelength (540 nm). Our results show that cardiac function is unlikely to limit metabolic rate in Atlantic cod from Newfoundland until close to their CTM, and we suggest that decreased blood oxygen binding capacity may contribute to the plateau in oxygen consumption.

  10. Mass effect of redox reactions: A novel mode for surface plasmon resonance-based bioanalysis.

    PubMed

    Yuan, Pei-Xin; Deng, Sheng-Yuan; Xin, Peng; Ji, Xu-Bo; Shan, Dan; Cosnier, Serge

    2015-12-15

    The pursuit of more specific and sensitive response is a perpetual goal for modern bioassays. This work proposed a novel label-free strategy about redox-related mass effect based on the surface plasmon resonance (SPR) technique for ultrasensitive determination of DNA. The protocol starts with the modification of SPR gilded disk with the capture DNA (cDNA). After the conjugation of immobilized cDNA with the target DNA (tDNA), the hybridization chain reaction was triggered by the introduction of mutual partial complementary primers to elongate the terminal into a nanoscale duplex. As it is reported that porphyrin could intercalate into the grooves of the double-stranded DNA (dsDNA) scaffold, multiple positive-charged Fe(III)meso-tetra(N-methyl-4-pyridyl) porphine (FeTMPyP) with symmetric structure were uptaken for in situ formation of porphyrin-dsDNA complex. Given FeTMPyP a highly efficient catalysis for the peroxide reduction, its presence as a biomimetic cofactor was validated via circular dichroism and UV-vis spectroscopy, demonstrating a tight binding as well as high catalytic activity and stability. Using 4-chloro-1-naphthol as a proton donor, the catalytic reduction of H2O2 would oxidize it into insoluble benzo-4-chloro-hexadienone, which simultaneously deposited on the heterogeneous interface, leading to a significant amplification in both SPR response and topological height profile. The signal increment was proportional to the concentration of tDNA, thus an ultrasensitive SPR-based DNA assay was developed with a linear range over four orders of magnitudes and a sub-femtomolar detection limit of 0.73 fM. The developed methodology exemplifies a different way of thinking about mass-sensing modes, extending conventional SPR-based DNA analysis to relevant biomedical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Canine orbital meningiomas: a review of 22 cases.

    PubMed

    Mauldin, E.A.; Deehr, A.J.; Hertzke, D.; Dubielzig, R.R.

    2000-01-01

    Clinical and pathologic features of primary orbital meningiomas in the dog were reviewed. Twenty-two meningiomas, confined to the orbit, were identified from the Comparative Ophthalmic Pathology Laboratory of Wisconsin from 1981 to 1997. The dogs ranged in age from 3 to 17 years (mean = 9.2 years). The clinical presentation, reported in 20 cases, was indicative of a retrobulbar mass and included exophthalmos and orbital swelling (18/20), and papilledema or abnormalities of the posterior segment (7/20). Visual acuity was reported in 15 cases; of those, 12 dogs were blind in the affected eye. Follow-up information was obtained on 17 cases; six dogs developed local recurrence of the neoplasm. Two dogs with recurrent neoplasms simultaneously developed blindness in the opposite eye. Extension along the optic nerve to the optic chiasm was suspected. No metastasis was found at the time of the study. Enucleation with excisional biopsy was effective therapy to date in 11 cases (0.2-4.5 years follow-up time). All neoplasms were located within the vicinity of the optic nerve and, when sectioned through the optic nerve head, appeared to completely envelope the nerve. The neoplastic cells were arranged in tight whorls and bundles characteristic of meningiomas. Most tumors had islands of chondroid and osseous metaplasia (17/22). Ocular invasion was limited to small foci in the posterior choroid or optic nerve head of six dogs. Immunoperoxidase stains on 10 cases were positive for vimentin and S-100, but negative for cytokeratin. Electron microscopy revealed complex interdigitations between cell membranes and few desmosomal intercellular attachments. Primary orbital meningiomas have a characteristic histologic appearance and may recur locally after surgical excision.

  12. Conditioned medium from LS 174T goblet cells treated with oxyresveratrol strengthens tight junctions in Caco-2 cells.

    PubMed

    Hwang, Dahyun; Jo, HyunA; Hwang, Seonwook; Kim, Jeong-Keun; Kim, In-Ho; Lim, Young-Hee

    2017-01-01

    Strengthening of intestinal tight junctions provides an effective barrier from the external environment. Goblet cell-derived trefoil factor 3 (TFF3) increases transepithelial resistance by upregulating the expression of tight junction proteins. Oxyresveratrol (OXY) is a hydroxyl-substituted stilbene found in the roots, leaves, stems, and fruit of many plants and known to have various biological activities. In this study, we investigated the strengthening effect of OXY on intestinal tight junctions through stimulation of TFF production in goblet cells. We prepared conditioned medium from LS 174T goblet cells treated with OXY (GCO-CM) and investigated the effect of GCO-CM on strengthening tight junctions of Caco-2 cells. The mRNA and protein expression levels of major tight junction components (claudin-1, occludin, and ZO-1) were measured by quantitative real-time PCR and western blotting, respectively. Transepithelial electric resistance (TEER) was measured using an ohm/V meter. Monolayer permeability was evaluated by paracellular transport of fluorescein isothiocyanate-dextran. OXY showed a strong antioxidant activity. It significantly increased the expression level of TFF3 in LS 174T goblet cells. GCO-CM prepared by treatment with 2.5, 5, and 10μg/ml OXY did not show cytotoxicity in Caco-2 cells. GCO-CM increased the mRNA and protein expression levels of claudin-1, occludin, and ZO-1. It also significantly increased tight junction integrity and reduced permeability in a dose-dependent manner. OXY stimulates the expression of TFF3 in goblet cells, which might increase the integrity of the intestinal tight junction barrier. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  13. Evaluation production index of test well about tight gas reservoir

    NASA Astrophysics Data System (ADS)

    Huang, Xiaoliang; Yan, Wende; Yuan, Yingzhong; Li, Jiqiang; Li, Xiaoxue

    2018-03-01

    It is important that the tight gas reservoir is developed with test wells in the first place for the reasonable development, and it is necessary evaluation production index of test well. So, the paper will evaluate gas wells capacity, reasonable production, production decline law and producing reserves. Combining with calculation theory, comparison of adjacent wells and field practice, obtained reasonable production, production decline law and production reserves about test well, and through analysis the adjacent well obtained development experience and lessons about tight gas reservoir. The results show that the gas well development should pay attention to reasonable production and prevent energy falling too fast in tight gas reservoirs, The decline rule of wells with long production time should be analyzed by two stages. Through study, it will provide some reference and guidance for the development of gas wells in tight gas reservoirs.

  14. The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

    PubMed Central

    Balda, Maria S.; Matter, Karl

    2000-01-01

    Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

  15. Effects of Cultural Tightness-Looseness and Social Network Density on Expression of Positive and Negative Emotions: A Large-Scale Study of Impression Management by Facebook Users.

    PubMed

    Liu, Pan; Chan, David; Qiu, Lin; Tov, William; Tong, Victor Joo Chuan

    2018-05-01

    Using data from 13,789 Facebook users across U.S. states, this study examined the main effects of societal-level cultural tightness-looseness and its interaction effects with individuals' social network density on impression management (IM) in terms of online emotional expression. Results showed that individuals from culturally tight (vs. loose) states were more likely to express positive emotions and less likely to express negative emotions. Meanwhile, for positive emotional expression, there was a tightness-looseness by social network density interaction effect. In culturally tight states, individuals with dense (vs. sparse) networks were more likely to express positive emotions, while in culturally loose states this pattern was reversed. For negative emotional expression, however, no such interaction was observed. Our findings highlight the influence of cultural norms and social network structure on emotional expressions as IM strategies.

  16. a Fractal Permeability Model Coupling Boundary-Layer Effect for Tight Oil Reservoirs

    NASA Astrophysics Data System (ADS)

    Wang, Fuyong; Liu, Zhichao; Jiao, Liang; Wang, Congle; Guo, Hu

    A fractal permeability model coupling non-flowing boundary-layer effect for tight oil reservoirs was proposed. Firstly, pore structures of tight formations were characterized with fractal theory. Then, with the empirical equation of boundary-layer thickness, Hagen-Poiseuille equation and fractal theory, a fractal torturous capillary tube model coupled with boundary-layer effect was developed, and verified with experimental data. Finally, the parameters influencing effective liquid permeability were quantitatively investigated. The research results show that effective liquid permeability of tight formations is not only decided by pore structures, but also affected by boundary-layer distributions, and effective liquid permeability is the function of fluid type, fluid viscosity, pressure gradient, fractal dimension, tortuosity fractal dimension, minimum pore radius and maximum pore radius. For the tight formations dominated with nanoscale pores, boundary-layer effect can significantly reduce effective liquid permeability, especially under low pressure gradient.

  17. Locus and persistence of capacity limitations in visual information processing.

    PubMed

    Kleiss, J A; Lane, D M

    1986-05-01

    Although there is considerable evidence that stimuli such as digits and letters are extensively processed in parallel and without capacity limitations, recent data suggest that only the features of stimuli are processed in parallel. In an attempt to reconcile this discrepancy, we used the simultaneous/successive detection paradigm with stimuli from experiments indicating parallel processing and with stimuli from experiments indicating that only features can be processed in parallel. In Experiment 1, large differences between simultaneous and successive presentations were obtained with an R target among P and Q distractors and among P and B distractors, but not with digit targets among letter distractors. As predicted by the feature integration theory of attention, false-alarm rates in the simultaneous condition were much higher than in the successive condition with the R/PQ stimuli. In Experiment 2, the possibility that attention is required for any difficult discrimination was ruled out as an explanation of the discrepancy between the digit/letter results and the R/PQ and R/PB results. Experiment 3A replicated the R/PQ and R/PB results of Experiment 1, and Experiment 3B extended these findings to a new set of stimuli. In Experiment 4, we found that large amounts of consistent practice did not generally eliminate capacity limitations. From this series of experiments we strongly conclude that the notion of capacity-free letter perception has limited generality.

  18. Effect of various absorption enhancers based on tight junctions on the intestinal absorption of forsythoside A in Shuang-Huang-Lian, application to its antivirus activity.

    PubMed

    Zhou, Wei; Zhu, Xuan Xuan; Yin, Ai Ling; Cai, Bao Chang; Wang, Hai Dan; Di, Liuqing; Shan, Jin Jun

    2014-01-01

    Forsythoside A (FTA), one of the main active ingredients in Shuang-Huang-Lian (SHL), possesses strong antibacterial, antioxidant and antiviral effects, and its pharmacological effects was higher than that of other ingredients, but the absolute bioavailability orally was approximately 0.72%, which was significantly low, influencing clinical efficacies of its oral preparations seriously. In vitro Caco-2 cell and in vivo pharmacokinetics study were simultaneously performed to investigate the effects of absorption enhancers based on tight junctions: sodium caprate and water-soluble chitosan on the intestinal absorption of FTA, and the eventual mucosal epithelial damage resulted from absorption enhancers was evaluated by MTT test and morphology observation, respectively. The pharmacological effects such as antivirus activity improvement by absorption enhancers were verified by MDCK damage inhibition rate after influenza virus propagation. The observations from in vitro Caco-2 cell showed that the absorption of FTA in SHL could be improved by absorption enhancers. Meanwhile, the absorption enhancing effect of water-soluble chitosan may be almost saturable up to 0.0032% (w/v), and sodium caprate at concentrations up to 0.64 mg/mL was safe, but water-soluble chitosan at different concentrations was all safe for these cells. In pharmacokinetics study, water-soluble chitosan at dosage of 50 mg/kg improved the bioavailability of FTA in SHL to the greatest extent, and was safe for gastrointestine from morphological observation. Besides, treatment with SHL with water-soluble chitosan at dosage of 50 mg/kg prevented MDCK damage after influenza virus propagation better significantly than that of control. Water-soluble chitosan at dosage of 50 mg/kg might be safe and effective absorption enhancer for improving the bioavailability of FTA and the antivirus activity in vitro in SHL.

  19. Respiratory pattern in awake rats: effects of motor activity and of alerting stimuli.

    PubMed

    Kabir, Muammar M; Beig, Mirza I; Baumert, Mathias; Trombini, Mimosa; Mastorci, Francesca; Sgoifo, Andrea; Walker, Frederick R; Day, Trevor A; Nalivaiko, Eugene

    2010-08-04

    Our aim was to assess the impact of motor activity and of arousing stimuli on respiratory rate in the awake rats. The study was performed in male adult Sprague-Dawley (SD, n=5) and Hooded Wistar (HW, n=5) rats instrumented for ECG telemetry. Respiratory rate was recorded using whole-body plethysmograph, with a piezoelectric sensor attached for the simultaneous assessment of motor activity. All motor activity was found to be associated with an immediate increase in respiratory rate that remained elevated for the whole duration of movement; this was reflected by: i) bimodal distribution of respiratory intervals (modes for slow peak: 336+/-19 and 532+/-80 ms for HW and SD, p<0.05; modes for fast peak 128+/-6 and 132+/-7 ms for HW and SD, NS); and ii) a tight correlation between total movement time and total time of tachypnoea, with an R(2) ranging 0.96-0.99 (n=10, p<0001). The extent of motor-related tachypnoea was significantly correlated with the intensity of associated movement. Mild alerting stimuli produced stereotyped tachypnoeic responses, without affecting heart rate: tapping the chamber raised respiratory rate from 117+/-7 to 430+/-15 cpm; sudden side move--from 134+/-13 to 487+/-16 cpm, and turning on lights--from 136+/-12 to 507+/-14 cpm (n=10; p<0.01 for all; no inter-strain differences). We conclude that: i) sniffing is an integral part of the generalized arousal response and does not depend on the modality of sensory stimuli; ii) tachypnoea is a sensitive index of arousal; and iii) respiratory rate is tightly correlated with motor activity. Copyright 2010 Elsevier Inc. All rights reserved.

  20. Exciton-phonon cooperative mechanism of the triple-q charge-density-wave and antiferroelectric electron polarization in TiSe2

    NASA Astrophysics Data System (ADS)

    Kaneko, Tatsuya; Ohta, Yukinori; Yunoki, Seiji

    2018-04-01

    We investigate the microscopic mechanisms of the charge-density-wave (CDW) formation in a monolayer TiSe2 using a realistic multiorbital d -p model with electron-phonon coupling and intersite Coulomb (excitonic) interactions. First, we estimate the tight-binding bands of Ti 3 d and Se 4 p orbitals in the monolayer TiSe2 on the basis of the first-principles band-structure calculations. We thereby show orbital textures of the undistorted band structure near the Fermi level. Next, we derive the electron-phonon coupling using the tight-binding approximation and show that the softening occurs in the transverse phonon mode at the M point of the Brillouin zone. The stability of the triple-q CDW state is thus examined to show that the transverse phonon modes at the M1, M2, and M3 points are frozen simultaneously. Then, we introduce the intersite Coulomb interactions between the nearest-neighbor Ti and Se atoms that lead to the excitonic instability between the valence Se 4 p and conduction Ti 3 d bands. Treating the intersite Coulomb interactions in the mean-field approximation, we show that the electron-phonon and excitonic interactions cooperatively stabilize the triple-q CDW state in TiSe2. We also calculate a single-particle spectrum in the CDW state and reproduce the band folding spectra observed in photoemission spectroscopies. Finally, to clarify the nature of the CDW state, we examine the electronic charge density distribution and show that the CDW state in TiSe2 is of a bond type and induces a vortexlike antiferroelectric polarization in the kagome network of Ti atoms.

  1. Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2

    PubMed Central

    Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.

    2009-01-01

    Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464

  2. Interferon-β induced in female genital epithelium by HIV-1 glycoprotein 120 via Toll-like-receptor 2 pathway acts to protect the mucosal barrier.

    PubMed

    Nazli, Aisha; Dizzell, Sara; Zahoor, Muhammad Atif; Ferreira, Victor H; Kafka, Jessica; Woods, Matthew William; Ouellet, Michel; Ashkar, Ali A; Tremblay, Michel J; Bowdish, Dawn Me; Kaushic, Charu

    2018-03-19

    More than 40% of HIV infections occur via female reproductive tract (FRT) through heterosexual transmission. Epithelial cells that line the female genital mucosa are the first line of defense against HIV-1 and other sexually transmitted pathogens. These sentient cells recognize and respond to external stimuli by induction of a range of carefully balanced innate immune responses. Previously, we have shown that in response to HIV-1 gp120, the genital epithelial cells (GECs) from upper reproductive tract induce an inflammatory response that may facilitate HIV-1 translocation and infection. In this study, we report that the endometrial and endocervical GECs simultaneously induce biologically active interferon-β (IFNβ) antiviral responses following exposure to HIV-1 that act to protect the epithelial tight junction barrier. The innate antiviral response was directly induced by HIV-1 envelope glycoprotein gp120 and addition of gp120 neutralizing antibody inhibited IFNβ production. Interferon-β was induced by gp120 in upper GECs through Toll-like receptor 2 signaling and required presence of heparan sulfate on epithelial cell surface. The induction of IFNβ was dependent upon activation of transcription factor IRF3 (interferon regulatory factor 3). The IFNβ was biologically active, had a protective effect on epithelial tight junction barrier and was able to inhibit HIV-1 infection in TZM-bl indicator cells and HIV-1 replication in T cells. This is the first report that recognition of HIV-1 by upper GECs leads to induction of innate antiviral pathways. This could explain the overall low infectivity of HIV-1 in the FRT and could be exploited for HIV-1 prophylaxis.Cellular and Molecular Immunology advance online publication, 19 March 2018; doi:10.1038/cmi.2017.168.

  3. Corticosterone mediates stress-related increased intestinal permeability in a region-specific manner

    PubMed Central

    Zheng, Gen; Wu, Shu-Pei; Hu, Yongjun; Smith, David E; Wiley, John W.; Hong, Shuangsong

    2012-01-01

    Background Chronic psychological stress (CPS) is associated with increased intestinal epithelial permeability and visceral hyperalgesia. It is unknown whether corticosterone (CORT) plays a role in mediating alterations of epithelial permeability in response to CPS. Methods Male rats were subjected to 1-hour water avoidance (WA) stress or subcutaneous CORT injection daily for 10 consecutive days in the presence or absence of corticoid-receptor antagonist RU-486. The visceromotor response (VMR) to colorectal distension (CRD) was measured. The in situ single-pass intestinal perfusion was used to measure intestinal permeability in jejunum and colon simultaneously. Key Results We observed significant decreases in the levels of glucocorticoid receptor (GR) and tight junction proteins in the colon but not the jejunum in stressed rats. These changes were largely reproduced by serial CORT injections in control rats and were significantly reversed by RU-486. Stressed and CORT-injected rats demonstrated a 3-fold increase in permeability for PEG-400 (MW) in colon but not jejunum and significant increase in VMR to CRD, which was significantly reversed by RU-486. In addition, no differences in permeability to PEG-4,000 and PEG-35,000 were detected between control and WA groups. Conclusions & Inferences Our findings indicate that CPS was associated with region-specific decrease in epithelial tight junction protein levels in the colon, increased colon epithelial permeability to low-molecular weight macromolecules which were largely reproduced by CORT treatment in control rats and prevented by RU-486. These observations implicate a novel, region-specific role for CORT as a mediator of CPS-induced increased permeability to macromolecules across the colon epithelium. PMID:23336591

  4. Roles of ZO-1 and ZO-2 in establishment of the belt-like adherens and tight junctions with paracellular permselective barrier function.

    PubMed

    Tsukita, Sachiko; Katsuno, Tatsuya; Yamazaki, Yuji; Umeda, Kazuaki; Tamura, Atsushi; Tsukita, Shoichiro

    2009-05-01

    Tight junctions (TJs) create the primary permselective barrier to diffusion of solutes and ions through the paracellular pathway. The molecular architecture of TJs has gradually been unraveled in recent years, providing the basis for "barriology" (defined by Shoichiro Tsukita as the science of the barrier in multicellular organisms). Claudins are now considered to be the essential basic components of TJ strands, with which other integral membrane proteins, such as occludin, tricellulin, JAMs, and CAR, are associated. Peripherally associated scaffolding proteins are required for the organization of the integral membrane proteins. Among these, ZO-1, -2, and -3 have attracted a great deal of attention as TJ organizers, since ZO-1 (and in some cases, also ZO-2/3) was reported to be directly associated with claudins, occludin, and JAMs, as well as with AF-6/afadin and alpha-catenin. Here we summarize recent studies on ZO-1/2/3-deficiency in mice and cells, which have provided clear and important information regarding the functions of ZO-1/2/3 in vivo. In addition to the respective suppression of ZO-1/2/3 expression, simultaneous suppression of all three proteins has revealed the essential and nonessential in vivo roles of ZO-1/2 and ZO-3, respectively. ZO-3 shows an epithelial-specific TJ localization in a ZO-1/2-dependent fashion. ZO-1 and ZO-2 play pivotal roles in the final establishment of the belt-like adherens junctions (zonula adherens), followed by the formation of the belt-like TJs (zonula occludens) with paracellular barrier function, thereby providing the general basis for selective paracellular permeability in epithelial and endothelial cells.

  5. Natural abundance N stable isotopes in plants and soils as an indicator of N deposition hotspots in urban environments

    NASA Astrophysics Data System (ADS)

    Trammell, T. L.

    2017-12-01

    The natural abundance of stable isotopes in plants and soils has been utilized to understand ecological phenomenon. Foliar δ15N is an integrator of soil δ15N, atmospheric N sources, and fractionation processes that occur during plant N uptake, plant N assimilation, and mycorrhizal associations. The amount of reactive N in the environment has greatly increased due to human activities, and urban ecosystems experience excess N deposition that can have cascading effects on plants and soils. Foliar δ15N has been shown to increase with increasing N deposition and nitrification rates suggesting increased foliar δ15N occurs with greater N inputs as a result of accelerated soil N cycling. Thus, foliar δ15N can be an indication of soil N availability for plant uptake and soil N cycling rates, since high N availability results in increased soil N cycling and subsequent loss of 14N. Limited research has utilized foliar and soil δ15N in urban forests to assess the importance of plant uptake of atmospheric N deposition and to gain insight about ecosystem processes. Previous investigations found foliar δ15N of mature trees in urban forests is not only related to elevated pollutant-derived N deposition, but also to soil N availability and soil N cycling rates. Similarly, enriched foliar δ15N of urban saplings was attributed to soil characteristics that indicated higher nitrification, thus, greater nitrate leaching and low N retention in the urban soils. These studies demonstrate the need for measuring the δ15N of various plant and soil N sources while simultaneously measuring soil N processes (e.g., net nitrification rates) in order to use natural abundance δ15N of plants and soils to assess N sources and cycling in urban forests. A conceptual framework that illustrates biogenic and anthropogenic controls on nitrogen isotope composition in urban plants and soils will be presented along with foliar and soil δ15N from urban forests across several cities as a proof of concept. Foliar and soil 15N can be extremely useful when N sources are isotopically distinct, patterns are detectable, or multiple tools are used simultaneously to understand N cycling. N cycles tightly in most ecosystems, thus δ15N in plants and soils can provide information about N source and availability to ecosystems.

  6. Voluntary movement affects simultaneous perception of auditory and tactile stimuli presented to a non-moving body part.

    PubMed

    Hao, Qiao; Ora, Hiroki; Ogawa, Ken-Ichiro; Ogata, Taiki; Miyake, Yoshihiro

    2016-09-13

    The simultaneous perception of multimodal sensory information has a crucial role for effective reactions to the external environment. Voluntary movements are known to occasionally affect simultaneous perception of auditory and tactile stimuli presented to the moving body part. However, little is known about spatial limits on the effect of voluntary movements on simultaneous perception, especially when tactile stimuli are presented to a non-moving body part. We examined the effect of voluntary movement on the simultaneous perception of auditory and tactile stimuli presented to the non-moving body part. We considered the possible mechanism using a temporal order judgement task under three experimental conditions: voluntary movement, where participants voluntarily moved their right index finger and judged the temporal order of auditory and tactile stimuli presented to their non-moving left index finger; passive movement; and no movement. During voluntary movement, the auditory stimulus needed to be presented before the tactile stimulus so that they were perceived as occurring simultaneously. This subjective simultaneity differed significantly from the passive movement and no movement conditions. This finding indicates that the effect of voluntary movement on simultaneous perception of auditory and tactile stimuli extends to the non-moving body part.

  7. Radiation reaction studies in an all-optical set-up: experimental limitations

    NASA Astrophysics Data System (ADS)

    Samarin, G. M.; Zepf, M.; Sarri, G.

    2018-06-01

    The recent development of ultra-high intensity laser facilities is finally opening up the possibility of studying high-field quantum electrodynamics in the laboratory. Arguably, one of the central phenomena in this area is that of quantum radiation reaction experienced by an ultra-relativistic electron beam as it propagates through the tight focus of a laser beam. In this paper, we discuss the major experimental challenges that are to be faced in order to extract meaningful and quantitative information from this class of experiments using existing and near-term laser facilities.

  8. Atomic Structure and Properties of Extended Defects in Silicon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buczko, R.; Chisholm, M.F.; Kaplan, T.

    1998-10-15

    The Z-contrast technique represents a new approach to high-resolution electron microscopy allowing for the first time incoherent imaging of materials on the atomic scale. The key advantages of the technique, an intrinsically higher resolution limit and directly interpretable, compositionally sensitive imaging, allow a new level of insight into the atomic configurations of extended defects in silicon. This experimental technique has been combined with theoretical calculations (a combination of first principles, tight binding, and classical methods) to extend this level of insight by obtaining the energetic and electronic structure of the defects.

  9. Soliton-sound interactions in quasi-one-dimensional Bose-Einstein condensates.

    PubMed

    Parker, N G; Proukakis, N P; Leadbeater, M; Adams, C S

    2003-06-06

    Longitudinal confinement of dark solitons in quasi-one-dimensional Bose-Einstein condensates leads to sound emission and reabsorption. We perform quantitative studies of the dynamics of a soliton oscillating in a tight dimple trap, embedded in a weaker harmonic trap. The dimple depth provides a sensitive handle to control the soliton-sound interaction. In the limit of no reabsorption, the power radiated is found to be proportional to the soliton acceleration squared. An experiment is proposed to detect sound emission as a change in amplitude and frequency of soliton oscillations.

  10. Nonlinear susceptibilities of finite conjugated organic polymers

    NASA Technical Reports Server (NTRS)

    Beratan, David N.; Onuchic, Jose Nelson; Perry, Joseph W.

    1987-01-01

    Tight-binding calculations of the length dependence of the third-order molecular hyperpolarizability for polyenes and polyynes are reported. The pi-electron wave functions were determined by exploiting the limited translational symmetry of the molecules. Perturbation theory was used to calculate the longitudinal component of the electronic nonresonant hyperpolarizability. This is the first two-'band' calculation of third-order hyperpolarizabilities on finite pi-electron systems of varying length. In contrast to the results of the one-'band' models, the hyperpolarizability densities increase rapidly and then, after about 10-15 repeating units, approach an asymptotic value.

  11. Fabrication of computer-generated holograms using femtosecond laser direct writing.

    PubMed

    Berlich, René; Richter, Daniel; Richardson, Martin; Nolte, Stefan

    2016-04-15

    We demonstrate a single-step fabrication method for computer-generated holograms based on femtosecond laser direct writing. Therefore, a tightly arranged longitudinal waveguide array is directly inscribed into a transparent material. By tailoring the individual waveguide length, the phase profile of an incident laser beam can be arbitrarily adapted. The approach is verified in common borosilicate glass by inscribing a designed phase hologram, which forms the desired intensity pattern in its far field. The resulting performance is analyzed, and the potential as well as limitations of the method are discussed.

  12. Exploring a Transformative Orientation to Sustainability in Universities: A Question of Loose and Tight Framings

    ERIC Educational Resources Information Center

    Scott, William A. H.

    2015-01-01

    This review essay examines three new books on higher education and sustainability. It explores a number of the issues raised in the books, in particular, the meaning of a transformative orientation towards sustainability. The idea of loose and tight conceptual framings of sustainability is employed. A tight framing is where an institution embodies…

  13. Bile duct epithelial tight junctions and barrier function

    PubMed Central

    Rao, R.K.; Samak, G.

    2013-01-01

    Bile ducts play a crucial role in the formation and secretion of bile as well as excretion of circulating xenobiotic substances. In addition to its secretory and excretory functions, bile duct epithelium plays an important role in the formation of a barrier to the diffusion of toxic substances from bile into the hepatic interstitial tissue. Disruption of barrier function and toxic injury to liver cells appear to be involved in the pathogenesis of a variety of liver diseases such as primary sclerosing cholangitis, primary biliary cirrhosis and cholangiocarcinoma. Although the investigations into understanding the structure and regulation of tight junctions in gut, renal and endothelial tissues have expanded rapidly, very little is known about the structure and regulation of tight junctions in the bile duct epithelium. In this article we summarize the current understanding of physiology and pathophysiology of bile duct epithelium, the structure and regulation of tight junctions in canaliculi and bile duct epithelia and different mechanisms involved in the regulation of disruption and protection of bile duct epithelial tight junctions. This article will make a case for the need of future investigations toward our understanding of molecular organization and regulation of canalicular and bile duct epithelial tight junctions. PMID:24665411

  14. Expression of ZO-1 and claudin-1 in a 3D epidermal equivalent using canine progenitor epidermal keratinocytes.

    PubMed

    Teramoto, Keiji; Asahina, Ryota; Nishida, Hidetaka; Kamishina, Hiroaki; Maeda, Sadatoshi

    2018-05-21

    Previous studies indicate that tight junctions are involved in the pathogenesis of canine atopic dermatitis (cAD). An in vitro skin model is needed to elucidate the specific role of tight junctions in cAD. A 3D epidermal equivalent model using canine progenitor epidermal keratinocytes (CPEK) has been established; the expression of tight junctions within this model is uncharacterized. To investigate the expression of tight junctions in the 3D epidermal equivalent. Two normal laboratory beagle dogs served as donors of full-thickness skin biopsy samples for comparison to the in vitro model. Immunohistochemical techniques were employed to investigate the expression of tight junctions including zonula occludens (ZO)-1 and claudin-1 in normal canine skin, and in the CPEK 3D epidermal equivalent. Results demonstrated the expression of ZO-1 and claudin-1 in the CPEK 3D epidermal equivalent, with staining patterns that were similar to those in normal canine skin. The CPEK 3D epidermal equivalent has the potential to be a suitable in vitro research tool for clarifying the specific role of tight junctions in cAD. © 2018 ESVD and ACVD.

  15. Tight junction-associated MARVEL proteins marveld3, tricellulin, and occludin have distinct but overlapping functions.

    PubMed

    Raleigh, David R; Marchiando, Amanda M; Zhang, Yong; Shen, Le; Sasaki, Hiroyuki; Wang, Yingmin; Long, Manyuan; Turner, Jerrold R

    2010-04-01

    In vitro studies have demonstrated that occludin and tricellulin are important for tight junction barrier function, but in vivo data suggest that loss of these proteins can be overcome. The presence of a heretofore unknown, yet related, protein could explain these observations. Here, we report marvelD3, a novel tight junction protein that, like occludin and tricellulin, contains a conserved four-transmembrane MARVEL (MAL and related proteins for vesicle trafficking and membrane link) domain. Phylogenetic tree reconstruction; analysis of RNA and protein tissue distribution; immunofluorescent and electron microscopic examination of subcellular localization; characterization of intracellular trafficking, protein interactions, dynamic behavior, and siRNA knockdown effects; and description of remodeling after in vivo immune activation show that marvelD3, occludin, and tricellulin have distinct but overlapping functions at the tight junction. Although marvelD3 is able to partially compensate for occludin or tricellulin loss, it cannot fully restore function. We conclude that marvelD3, occludin, and tricellulin define the tight junction-associated MARVEL protein family. The data further suggest that these proteins are best considered as a group with both redundant and unique contributions to epithelial function and tight junction regulation.

  16. Women's views and postpartum follow-up in the CHIPS Trial (Control of Hypertension in Pregnancy Study).

    PubMed

    Vidler, Marianne; Magee, Laura A; von Dadelszen, Peter; Rey, Evelyne; Ross, Susan; Asztalos, Elizabeth; Murphy, Kellie E; Menzies, Jennifer; Sanchez, Johanna; Singer, Joel; Gafni, Amiram; Gruslin, Andrée; Helewa, Michael; Hutton, Eileen; Lee, Shoo K; Lee, Terry; Logan, Alexander G; Ganzevoort, Wessel; Welch, Ross; Thornton, Jim G; Moutquin, Jean-Marie

    2016-11-01

    To compare women's views about blood pressure (BP) control in CHIPS (Control of Hypertension In Pregnancy Study) (NCT01192412). Quantitative and qualitative analysis of questionnaire responses. International randomised trial (94 sites, 15 countries). 911 (92.9%) women randomised to 'tight' (target diastolic blood pressure, 85mmHg) or 'less tight' (target diastolic blood pressure, 100mmHg) who completed questionnaires. A questionnaire was administered at ∼6-12 weeks postpartum regarding post-discharge morbidity and views about trial participation. Questionnaires were administered by the site co-ordinator, and contact was made by phone, home or clinic visit; rarely, data was collected from medical records. Quantitative analyses were Chi-square or Fisher's exact test for categorical variables, mixed effects multinomial logistic regression to adjust for confounders, and p<0.001 for statistical significance. NVivo software was used for thematic analysis of women's views. Satisfaction, measured as willingness to have the same treatment in another pregnancy or recommend that treatment to a friend. Among the 533 women in 'tight' (N=265) vs. 'less tight' (N=268) control who provided comments for qualitative analysis, women in 'tight' (vs. 'less tight') control made fewer positive comments about the amount of medication taken (5 vs. 28 women, respectively) and intensity of BP monitoring (7 vs. 17, respectively). However, this did not translate into less willingness to either have the same treatment in another pregnancy (434, 95.8% vs. 423, 92.4%, respectively; p=0.14) or recommend that treatment to a friend (435, 96.0% and 428, 93.4%, respectively; p=0.17). Importantly, although satisfaction remained high among women with an adverse outcome, those in 'tight' control who suffered an adverse outcome (vs. those who did not) were not consistently less satisfied, whereas this was not the case among women in 'less tight' control among whom satisfaction was consistently lower for the CHIPS primary outcome (p<0.001), severe hypertension (p≤0.01), and pre-eclampsia (p<0.001). Women in 'tight' (vs. 'less tight') control were equally satisfied with their care, and more so in the face of adverse perinatal or maternal outcomes. Copyright © 2016 The Author(s). Published by Elsevier Ireland Ltd.. All rights reserved.

  17. Regulation of tight junction permeability with switch-like speed.

    PubMed

    Beyenbach, Klaus W

    2003-09-01

    The case is made that tight junctions can undergo large reversible conductance changes in a matter of seconds and yet preserve their permselectivity. The diuretic peptide leucokinin transforms (renal) Malpighian tubules of the yellow fever mosquito from a moderately tight epithelium to a leaky epithelium by increasing the chloride-conductance of the paracellular shunt pathway. The nine-fold increase in the paracellular chloride-conductance brings about a non-selective stimulation of transepithelial sodium chloride and potassium chloride secretion, as expected from a conductance increase in the pathway taken by the counterion of sodium and potassium. The leucokinin signaling pathway consists in part of a receptor coupled G-protein, phospholipase C, inositol-1,4,5-trisphosphate, and increased intracellular calcium concentration that bring about the increase in the paracellular, tight junction chloride-conductance. As the conductance of the tight junction pathway increases it becomes more selective for the transepithelial passage of chloride. Epithelial cells in Malpighian tubules taper to tight junctions at their lateral edges exposing them directly to apical and serosal solutions. Furthermore, evolutionary pressures to excrete salt and water at high rates without the aid of glomerular filtration have led to powerful mechanisms of tubular secretion, capable of diuresis when the mosquito is challenged with the volume expansion of a blood meal. The tubular diuresis is mediated in part by increasing the paracellular chloride conductance. Thus, anatomical and physiological specializations in Malpighian tubules combine to yield the evidence for the dynamic hormonal regulation of the tight junction pathway.

  18. Hepatic immunohistochemical localization of the tight junction protein ZO-1 in rat models of cholestasis.

    PubMed Central

    Anderson, J. M.; Glade, J. L.; Stevenson, B. R.; Boyer, J. L.; Mooseker, M. S.

    1989-01-01

    Structural alterations in hepatocyte tight junctions accompanying cholestasis were investigated using immunolocalization of ZO-1, the first known protein component of the tight junction. Disruption in the paracellular barrier function of the tight junction has been proposed to allow reflux of bile into the blood. Cholestasis was induced in 210 to 235 g male Sprague-Dawley rats either by five consecutive daily subcutaneous injections of 17-alpha-ethinyl estradiol (0.5 mg/kg/d in propylene glycol) or ligation of the common bile duct for 72 hours. The structural organization of the tight junction was assessed in each model by indirect immunofluorescent and immunoperoxidase staining for ZO-1 on frozen sections of liver and compared with controls. In control, sham-operated, and estradiol-injected animals, ZO-1 localizes in a uniform continuous manner along the margins of the canaliculi. In contrast, bile duct ligation results in the appearance of numerous discontinuities in ZO-1 staining accompanied by dilation or collapse of the lumenal space. Tissue content of the ZO-1 protein, as determined by quantitative immunoblotting, was unaffected in either cholestatic model compared with controls. These findings indicate that the molecular organization of the tight junction can be assessed from immunostaining patterns of ZO-1 in frozen sections of cholestatic livers. Under these experimental conditions, the organization of the tight junction at the level of the ZO-1 protein is altered by bile duct obstruction but not by ethinyl estradiol. Images Figure 1 Figure 2 PMID:2719075

  19. Man-Portable Simultaneous Magnetometer and EM System (MSEMS)

    DTIC Science & Technology

    2008-12-01

    limited to cesium vapor magnetometers outputting a Larmor signal. It cannot, as presently configured, be used with less expensive fluxgate magnetometers ...pulses to convert the frequency-based Larmor signal into nT. A fluxgate magnetometer does not employ the resonance mechanism of an alkali vapor...Simultaneous Magnetometer and EM System (MSEMS) December 2008 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting burden for the

  20. Simultaneous calibrations of Voyager celestial and inertial attitude control systems in flight

    NASA Technical Reports Server (NTRS)

    Jahanshahi, M. H.

    1982-01-01

    A mathematical description of the data reduction technique used to simultaneously calibrate the Voyager celestial and inertial attitude control subsystems is given. It is shown that knowledge of the spacecraft limit cycle motion, as measured by the celestial and the inertial sensors, is adequate to result in the estimates of a selected number of errors which adversely affect the spacecraft attitude knowledge.

  1. Whole-central nervous system functional imaging in larval Drosophila

    PubMed Central

    Lemon, William C.; Pulver, Stefan R.; Höckendorf, Burkhard; McDole, Katie; Branson, Kristin; Freeman, Jeremy; Keller, Philipp J.

    2015-01-01

    Understanding how the brain works in tight concert with the rest of the central nervous system (CNS) hinges upon knowledge of coordinated activity patterns across the whole CNS. We present a method for measuring activity in an entire, non-transparent CNS with high spatiotemporal resolution. We combine a light-sheet microscope capable of simultaneous multi-view imaging at volumetric speeds 25-fold faster than the state-of-the-art, a whole-CNS imaging assay for the isolated Drosophila larval CNS and a computational framework for analysing multi-view, whole-CNS calcium imaging data. We image both brain and ventral nerve cord, covering the entire CNS at 2 or 5 Hz with two- or one-photon excitation, respectively. By mapping network activity during fictive behaviours and quantitatively comparing high-resolution whole-CNS activity maps across individuals, we predict functional connections between CNS regions and reveal neurons in the brain that identify type and temporal state of motor programs executed in the ventral nerve cord. PMID:26263051

  2. A novel cluster-tube self-adaptive robot hand.

    PubMed

    Fu, Hong; Yang, Haokun; Song, Weishu; Zhang, Wenzeng

    2017-01-01

    This paper proposes a novel cluster-tube self-adaptive robot hand (CTSA Hand). The CTSA Hand consists of a base, a motor, a transmission mechanism, multiple elastic tendons, and a group of sliding-tube assemblies. Each sliding-tube assembly is composed of a sliding tube, a guide rod, two springs and a hinge. When the hand grasping an object, the object pushes some sliding tubes to different positions according to the surface shape of the object, the motor pulls the tendons tight to cluster tubes. The CTSA Hand can realize self-adaptive grasping of objects of different sizes and shapes. The CTSA Hand can grasp multiple objects simultaneously because the grasping of the hand acts as many grippers in different directions and heights. The grasping forces of the hand are adjusted by a closed-loop control system with potentiometer. Experimental results show that the CTSA Hand has the features of highly self-adaption and large grasping forces when grasping various objects.

  3. Lean Management—The Journey from Toyota to Healthcare

    PubMed Central

    Teich, Sorin T.; Faddoul, Fady F.

    2013-01-01

    The evolution of production systems is tightly linked to the story of Toyota Motor Company (TMC) that has its roots around 1918. The term “lean” was coined in 1990 following the exploration of the Toyota model that led to the “transference” thesis sustaining the concept that manufacturing problems and technologies are universal problems faced by management and that these concepts can be emulated in non-Japanese enterprises. Lean is a multi-faceted concept and requires organizations to exert effort along several dimensions simultaneously; some consider a successful implementation either achieving major strategic components of lean, implementing practices to support operational aspects, or providing evidence that the improvements are sustainable in the long term. The article explores challenges and opportunities faced by organizations that intend incorporating lean management principles and presents the specific context of the healthcare industry. Finally, the concepts of “essential few” and customer value are illustrated through a simple example of process change following lean principles, which was implemented in a dental school in the United States. PMID:23908857

  4. Ballistocardiogram of avian eggs determined by an electromagnetic induction coil.

    PubMed

    Ono, H; Akiyama, R; Sakamoto, Y; Pearson, J T; Tazawa, H

    1997-07-01

    As an avian embryo grows within an eggshell, the whole egg is moved by embryonic activity and also by the embryonic heartbeat. A technical interest in detecting minute biological movements has prompted the development of techniques and systems to measure the cardiogenic ballistic movement of the egg or ballistocardiogram (BCG). In this context, there is interest in using an electromagnetic induction coil (solenoid) as another simple sensor to measure the BCG and examining its possibility for BCG measurement. A small permanent magnet is attached tightly to the surface of an incubated egg, and then the egg with the magnet is placed in a solenoid. Preliminary model analysis is made to design a setup of the egg, magnet and solenoid coupling system. Then, simultaneous measurement with a laser displacement measuring system, developed previously, is made for chicken eggs, indicating that the solenoid detects the minute cardiogenic ballistic movements and that the BCG determined is a measure of the velocity of egg movements.

  5. Massive outflow properties suggest AGN fade slowly

    NASA Astrophysics Data System (ADS)

    Zubovas, Kastytis

    2018-01-01

    Massive large-scale active galactic nucleus (AGN) outflows are an important element of galaxy evolution, being a way through which the AGN can affect most of the host galaxy. However, outflows evolve on time-scales much longer than typical AGN episode durations, therefore most AGN outflows are not observed simultaneously with the AGN episode that inflated them. It is therefore remarkable that rather tight correlations between outflow properties and AGN luminosity exist. In this paper, I show that such correlations can be preserved during the fading phase of the AGN episode, provided that the AGN luminosity evolves as a power law with exponent αd ∼ 1 at late times. I also show that subsequent AGN episodes that illuminate an ongoing outflow are unlikely to produce outflow momentum or energy rates rising above the observed correlations. However, there may be many difficult-to-detect outflows with momentum and energy rates lower than expected from the current AGN luminosity. Detailed observations of AGN outflow properties might help constrain the activity histories of typical and/or individual AGN.

  6. Unsupervised image matching based on manifold alignment.

    PubMed

    Pei, Yuru; Huang, Fengchun; Shi, Fuhao; Zha, Hongbin

    2012-08-01

    This paper challenges the issue of automatic matching between two image sets with similar intrinsic structures and different appearances, especially when there is no prior correspondence. An unsupervised manifold alignment framework is proposed to establish correspondence between data sets by a mapping function in the mutual embedding space. We introduce a local similarity metric based on parameterized distance curves to represent the connection of one point with the rest of the manifold. A small set of valid feature pairs can be found without manual interactions by matching the distance curve of one manifold with the curve cluster of the other manifold. To avoid potential confusions in image matching, we propose an extended affine transformation to solve the nonrigid alignment in the embedding space. The comparatively tight alignments and the structure preservation can be obtained simultaneously. The point pairs with the minimum distance after alignment are viewed as the matchings. We apply manifold alignment to image set matching problems. The correspondence between image sets of different poses, illuminations, and identities can be established effectively by our approach.

  7. In vivo oral imaging with integrated portable photoacoustic microscopy and optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Qin, Wei; Qi, Weizhi; Jin, Tian; Guo, Heng; Xi, Lei

    2017-12-01

    Oral diseases, especially oral cancers, are becoming serious health problems in humans. To image vasculatures and structures simultaneously in the human oral cavity which are tightly associated with various oral diseases, we develop a dual-modality portable optical resolution photoacoustic microscopy (ORPAM) and optical coherence tomography (OCT) system. This system utilizes a new rotary scanning mechanism and a compact design of the imaging head, making it portable and free of translation of the imaging interface or samples. Through the phantom experiments, both modalities yield high lateral resolutions of 8.1 μm (ORPAM) and 8.56 μm (OCT), respectively. The axial resolutions are measured to be 116.5 μm for ORPAM and 6.1 μm for OCT. In vivo imaging of a mouse ear was carried out to evaluate the performance of the system in biological tissues. In addition, in vivo oral imaging of a healthy human lip and monitoring recovery progress of a lip ulcer demonstrate the clinical potential of this system.

  8. Par3 integrates Tiam1 and phosphatidylinositol 3-kinase signaling to change apical membrane identity

    PubMed Central

    Ruch, Travis R.; Bryant, David M.; Mostov, Keith E.; Engel, Joanne N.

    2017-01-01

    Pathogens can alter epithelial polarity by recruiting polarity proteins to the apical membrane, but how a change in protein localization is linked to polarity disruption is not clear. In this study, we used chemically induced dimerization to rapidly relocalize proteins from the cytosol to the apical surface. We demonstrate that forced apical localization of Par3, which is normally restricted to tight junctions, is sufficient to alter apical membrane identity through its interactions with phosphatidylinositol 3-kinase (PI3K) and the Rac1 guanine nucleotide exchange factor Tiam1. We further show that PI3K activity is required upstream of Rac1, and that simultaneously targeting PI3K and Tiam1 to the apical membrane has a synergistic effect on membrane remodeling. Thus, Par3 coordinates the action of PI3K and Tiam1 to define membrane identity, revealing a signaling mechanism that can be exploited by human mucosal pathogens. PMID:27881661

  9. Multipartite entanglement verification resistant against dishonest parties.

    PubMed

    Pappa, Anna; Chailloux, André; Wehner, Stephanie; Diamanti, Eleni; Kerenidis, Iordanis

    2012-06-29

    Future quantum information networks will consist of quantum and classical agents, who have the ability to communicate in a variety of ways with trusted and untrusted parties and securely delegate computational tasks to untrusted large-scale quantum computing servers. Multipartite quantum entanglement is a fundamental resource for such a network and, hence, it is imperative to study the possibility of verifying a multipartite entanglement source in a way that is efficient and provides strong guarantees even in the presence of multiple dishonest parties. In this Letter, we show how an agent of a quantum network can perform a distributed verification of a source creating multipartite Greenberger-Horne-Zeilinger (GHZ) states with minimal resources, which is, nevertheless, resistant against any number of dishonest parties. Moreover, we provide a tight tradeoff between the level of security and the distance between the state produced by the source and the ideal GHZ state. Last, by adding the resource of a trusted common random source, we can further provide security guarantees for all honest parties in the quantum network simultaneously.

  10. Chemisorption of hydrogen atoms and hydroxyl groups on stretched graphene: A coupled QM/QM study

    NASA Astrophysics Data System (ADS)

    Katin, Konstantin P.; Prudkovskiy, Vladimir S.; Maslov, Mikhail M.

    2017-09-01

    Using the density functional theory coupled with the nonorthogonal tight-binding model, we analyze the chemisorption of hydrogen atoms and hydroxyl groups on the unstrained and stretched graphene sheets. Drawback of finite cluster model of graphene for the chemisorption energy calculation in comparison with the QM/QM approach applied is discussed. It is shown that the chemisorption energy for the hydroxyl group is sufficiently lower than for hydrogen at stretching up to 7.5%. The simultaneous paired chemisorption of hydrogen and hydroxyl groups on the same hexagon has also been examined. Adsorption of two radicals in ortho and para positions is found to be more energetically favorable than those in meta position at any stretching considered. In addition the energy difference between adsorbent pairs in ortho and para positions decreases as the stretching rises. It could be concluded that the graphene stretching leads to the loss of preferred mutual arrangement of two radicals on its surface.

  11. Lean management-the journey from toyota to healthcare.

    PubMed

    Teich, Sorin T; Faddoul, Fady F

    2013-04-01

    The evolution of production systems is tightly linked to the story of Toyota Motor Company (TMC) that has its roots around 1918. The term "lean" was coined in 1990 following the exploration of the Toyota model that led to the "transference" thesis sustaining the concept that manufacturing problems and technologies are universal problems faced by management and that these concepts can be emulated in non-Japanese enterprises. Lean is a multi-faceted concept and requires organizations to exert effort along several dimensions simultaneously; some consider a successful implementation either achieving major strategic components of lean, implementing practices to support operational aspects, or providing evidence that the improvements are sustainable in the long term. The article explores challenges and opportunities faced by organizations that intend incorporating lean management principles and presents the specific context of the healthcare industry. Finally, the concepts of "essential few" and customer value are illustrated through a simple example of process change following lean principles, which was implemented in a dental school in the United States.

  12. Two-dimensional MoS2-graphene hybrid nanosheets for high gravimetric and volumetric lithium storage

    NASA Astrophysics Data System (ADS)

    Deng, Yakai; Ding, Lixin; Liu, Qixing; Zhan, Liang; Wang, Yanli; Yang, Shubin

    2018-04-01

    Two-dimensional (2D) MoS2-graphene (MoS2-G) hybrid is fabricated simultaneously and scalablely with an efficient electrochemical exfoliation approach from the combined bulk MoS2-graphite wafer. The as-prepared 2D MoS2-G hybrid is tightly covered with each other with lateral sizes of 600 nm to few micrometers and can be directly assembled to flexible films for lithium storage. When used as anode material for lithium ion battery, the resultant MoS2-G hybrid film exhibits both high gravimetric (750 mA h g-1 at 50 mA g-1) and volumetric capacities (1200 mA h cm-3 at 0.1 mA cm-2). Such excellent electrochemical performance should attributed to the unique 2D structure and good conductive graphene network, which not only facilitates the diffusion of lithium ions, but also improves the fast transfer of electrons, satisfying the kinetics requirements for rapid lithium storage.

  13. Do galaxy global relationships emerge from local ones? The SDSS IV MaNGA surface mass density-metallicity relation

    NASA Astrophysics Data System (ADS)

    Barrera-Ballesteros, Jorge K.; Heckman, Timothy M.; Zhu, Guangtun B.; Zakamska, Nadia L.; Sánchez, Sebastian F.; Law, David; Wake, David; Green, Jenny E.; Bizyaev, Dmitry; Oravetz, Daniel; Simmons, Audrey; Malanushenko, Elena; Pan, Kaike; Roman Lopes, Alexandre; Lane, Richard R.

    2016-12-01

    We present the stellar surface mass density versus gas metallicity (Σ*-Z) relation for more than 500 000 spatially resolved star-forming resolution elements (spaxels) from a sample of 653 disc galaxies included in the SDSS IV MaNGA survey. We find a tight relation between these local properties, with higher metallicities as the surface density increases. This relation extends over three orders of magnitude in the surface mass density and a factor of 4 in metallicity. We show that this local relationship can simultaneously reproduce two well-known properties of disc galaxies: their global mass-metallicity relationship and their radial metallicity gradients. We also find that the Σ*-Z relation is largely independent of the galaxy's total stellar mass and specific star formation rate (sSFR), except at low stellar mass and high sSFR. These results suggest that in the present-day universe local properties play a key role in determining the gas-phase metallicity in typical disc galaxies.

  14. Attention Modulates Spatial Precision in Multiple-Object Tracking.

    PubMed

    Srivastava, Nisheeth; Vul, Ed

    2016-01-01

    We present a computational model of multiple-object tracking that makes trial-level predictions about the allocation of visual attention and the effect of this allocation on observers' ability to track multiple objects simultaneously. This model follows the intuition that increased attention to a location increases the spatial resolution of its internal representation. Using a combination of empirical and computational experiments, we demonstrate the existence of a tight coupling between cognitive and perceptual resources in this task: Low-level tracking of objects generates bottom-up predictions of error likelihood, and high-level attention allocation selectively reduces error probabilities in attended locations while increasing it at non-attended locations. Whereas earlier models of multiple-object tracking have predicted the big picture relationship between stimulus complexity and response accuracy, our approach makes accurate predictions of both the macro-scale effect of target number and velocity on tracking difficulty and micro-scale variations in difficulty across individual trials and targets arising from the idiosyncratic within-trial interactions of targets and distractors. Copyright © 2016 Cognitive Science Society, Inc.

  15. Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

    NASA Astrophysics Data System (ADS)

    Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

    2015-07-01

    The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

  16. WT1 controls antagonistic FGF and BMP-pSMAD pathways in early renal progenitors.

    PubMed

    Motamedi, Fariba Jian; Badro, Danielle A; Clarkson, Michael; Lecca, M Rita; Bradford, Stephen T; Buske, Fabian A; Saar, Kathrin; Hübner, Norbert; Brändli, André W; Schedl, Andreas

    2014-07-17

    Kidney organogenesis requires the tight control of proliferation, differentiation and apoptosis of renal progenitor cells. How the balance between these cellular decisions is achieved remains elusive. The Wilms' tumour suppressor Wt1 is required for progenitor survival, but the molecular cause for renal agenesis in mutants is poorly understood. Here we demonstrate that lack of Wt1 abolishes fibroblast growth factor (FGF) and induces BMP/pSMAD signalling within the metanephric mesenchyme. Addition of recombinant FGFs or inhibition of pSMAD signalling rescues progenitor cell apoptosis induced by the loss of Wt1. We further show that recombinant BMP4, but not BMP7, induces an apoptotic response within the early kidney that can be suppressed by simultaneous addition of FGFs. These data reveal a hitherto unknown sensitivity of early renal progenitors to pSMAD signalling, establishes FGF and pSMAD signalling as antagonistic forces in early kidney development and places WT1 as a key regulator of pro-survival FGF signalling pathway genes.

  17. Application of genetic algorithm in integrated setup planning and operation sequencing

    NASA Astrophysics Data System (ADS)

    Kafashi, Sajad; Shakeri, Mohsen

    2011-01-01

    Process planning is an essential component for linking design and manufacturing process. Setup planning and operation sequencing is two main tasks in process planning. Many researches solved these two problems separately. Considering the fact that the two functions are complementary, it is necessary to integrate them more tightly so that performance of a manufacturing system can be improved economically and competitively. This paper present a generative system and genetic algorithm (GA) approach to process plan the given part. The proposed approach and optimization methodology analyses the TAD (tool approach direction), tolerance relation between features and feature precedence relations to generate all possible setups and operations using workshop resource database. Based on these technological constraints the GA algorithm approach, which adopts the feature-based representation, optimizes the setup plan and sequence of operations using cost indices. Case study show that the developed system can generate satisfactory results in optimizing the setup planning and operation sequencing simultaneously in feasible condition.

  18. Characteristics of Deoxyribonucleic Acid Polymerase Isolated from Spores of Rhizopus stolonifer1

    PubMed Central

    Gong, Cheng-Shung; Dunkle, Larry D.; Van Etten, James L.

    1973-01-01

    Deoxyribonucleic acid (DNA)-dependent DNA polymerase was purified several hundredfold from germinated and ungerminated spores of the fungus Rhizopus stolonifer. The partially purified enzymes from both spore stages exhibited identical characteristics; incorporation of [3H]deoxythymidine monophosphate into DNA required Mg2+, DNA, a reducing agent, and the simultaneous presence of deoxyguanosine triphosphate, deoxycytidine triphosphate, and deoxyadenosine triphosphate. Heat-denatured and activated DNAs were better templates than were native DNAs. The buoyant density of the radioactive product of the reaction was similar to that of the template DNA. The enzyme is probably composed of a single polypeptide chain with an S value of 5.12 and an estimated molecular weight of 70,000 to 75,000. During the early stages of purification, the enzyme fraction from ungerminated spores required exogenous DNA for maximum activity, whereas the corresponding enzyme fraction from germinated spores did not require added DNA. Apparently DNA polymerase from germinated spores was more tightly bound to endogenous DNA than was the enzyme from ungerminated spores. PMID:4728271

  19. Simultaneous effects of food limitation and inducible resistance on herbivore population dynamics.

    PubMed

    Abbott, Karen C; Morris, William F; Gross, Kevin

    2008-02-01

    Many herbivore populations fluctuate temporally, but the causes of those fluctuations remain unclear. Plant inducible resistance can theoretically cause herbivore population fluctuations, because herbivory may induce plant changes that reduce the survival or reproduction of later-feeding herbivores. Herbivory can also simply reduce the quantity of food available for later feeders and this, too, can cause population fluctuations. Inducible resistance and food limitation often occur simultaneously, yet whether they jointly facilitate or suppress herbivore fluctuations remains largely unexplored. We present models that suggest that food limitation and inducible resistance may have synergistic effects on herbivore population dynamics. The population-level response of the food plant to herbivory and the details of how inducible resistance affects herbivore performance both influence the resulting herbivore dynamics. Our results identify some biological properties of plant-herbivore systems that might determine whether or not cycles occur, and suggest that future empirical and theoretical population dynamics studies should account for the effects of both food limitation and inducible resistance.

  20. [Simultaneous determination of delta-9-tetrahydrocannabinol cannabidiol and cannabinol in edible oil using ultra performance liquid chromatography-tandem mass spectrometry].

    PubMed

    Zhang, Aizhi; Wang, Quanlin; Mo, Shijie

    2010-11-01

    A method for the simultaneous determination of delta-9-tetrahydrocannabinol (THC), cannabidiol (CBD) and cannabinol (CBN) in edible oil was developed using ultra performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). The target compounds were extracted with methanol, purified by an LC-Alumina-N solid phase extraction cartridge, separated and detected by the UPLC-MS/MS. Quantitative analysis was corrected by an isotope internal standard method using delta-9-THC-D3 as internal standard. Average recoveries for the target compounds varied from 68.0% to 101.6% with the relative standard deviations ranging from 7.0% to 20.1% at three spiked levels. The limits of detection (LOD) of the method were from 0.06-0.17 microg/kg and the limits of quantification (LOQ) were in the range of 0.20-0.52 microg/kg. The results showed that the method is able to meet the requirements for the simultaneous determination of THC, CBD and CBN in edible oil.

  1. Action potentials in retinal ganglion cells are initiated at the site of maximal curvature of the extracellular potential.

    PubMed

    Eickenscheidt, Max; Zeck, Günther

    2014-06-01

    The initiation of an action potential by extracellular stimulation occurs after local depolarization of the neuronal membrane above threshold. Although the technique shows remarkable clinical success, the site of action and the relevant stimulation parameters are not completely understood. Here we identify the site of action potential initiation in rabbit retinal ganglion cells (RGCs) interfaced to an array of extracellular capacitive stimulation electrodes. We determine which feature of the extracellular potential governs action potential initiation by simultaneous stimulation and recording RGCs interfaced in epiretinal configuration. Stimulation electrodes were combined to areas of different size and were presented at different positions with respect to the RGC. Based on stimulation by electrodes beneath the RGC soma and simultaneous sub-millisecond latency measurement we infer axonal initiation at the site of maximal curvature of the extracellular potential. Stimulation by electrodes at different positions along the axon reveals a nearly constant threshold current density except for a narrow region close to the cell soma. These findings are explained by the concept of the activating function modified to consider a region of lower excitability close to the cell soma. We present a framework how to estimate the site of action potential initiation and the stimulus required to cross threshold in neurons tightly interfaced to capacitive stimulation electrodes. Our results underscore the necessity of rigorous electrical characterization of the stimulation electrodes and of the interfaced neural tissue.

  2. Picosecond laser welding of optical to metal components

    NASA Astrophysics Data System (ADS)

    Carter, Richard M.; Troughton, Michael; Chen, Jinanyong; Elder, Ian; Thomson, Robert R.; Lamb, Robert A.; Esser, M. J. Daniel; Hand, Duncan P.

    2016-03-01

    We report on practical, industrially relevant, welding of optical components to themselves and aluminum alloy components. Weld formation is achieved through the tight focusing of a 5.9ps, 400kHz Trumpf laser operating at 1030nm. By selecting suitable surface preparation, clamping and laser parameters, the plasma can be confined, even with comparatively rough surfaces, by exploiting the melt properties of the glass. The short interaction time allows for a permanent weld to form between the two materials with heating limited to a region ~300 µm across. Practical application of these weld structures is typically limited due to the induced stress within the glass and, critically, the issues surrounding post-weld thermal expansion. We report on the measured strength of the weld, with a particular emphasis on laser parameters and surface preparation.

  3. Enhancement of maximum attainable ion energy in the radiation pressure acceleration regime using a guiding structure

    DOE PAGES

    Bulanov, S. S.; Esarey, E.; Schroeder, C. B.; ...

    2015-03-13

    Radiation Pressure Acceleration is a highly efficient mechanism of laser driven ion acceleration, with the laser energy almost totally transferrable to the ions in the relativistic regime. There is a fundamental limit on the maximum attainable ion energy, which is determined by the group velocity of the laser. In the case of a tightly focused laser pulses, which are utilized to get the highest intensity, another factor limiting the maximum ion energy comes into play, the transverse expansion of the target. Transverse expansion makes the target transparent for radiation, thus reducing the effectiveness of acceleration. Utilization of an external guidingmore » structure for the accelerating laser pulse may provide a way of compensating for the group velocity and transverse expansion effects.« less

  4. Emission factors for hydraulically fractured gas wells derived using well- and battery-level reported data for Alberta, Canada.

    PubMed

    Tyner, David R; Johnson, Matthew R

    2014-12-16

    A comprehensive technical analysis of available industry-reported well activity and production data for Alberta in 2011 has been used to derive flaring, venting, and diesel combustion greenhouse gas and criteria air contaminant emission factors specifically linked to drilling, completion, and operation of hydraulically fractured natural gas wells. Analysis revealed that in-line ("green") completions were used at approximately 53% of wells completed in 2011, and in other cases the majority (99.5%) of flowback gases were flared rather than vented. Comparisons with limited analogous data available in the literature revealed that reported total flared and vented natural gas volumes attributable to tight gas well-completions were ∼ 6 times larger than Canadian Association of Petroleum Producers (CAPP) estimates for natural gas well-completion based on wells ca. 2000, but 62% less than an equivalent emission factor that can be derived from U.S. EPA data. Newly derived emission factors for diesel combustion during well drilling and completion are thought to be among the first such data available in the open literature, where drilling-related emissions for tight gas wells drilled in Alberta in 2011 were found to have increased by a factor of 2.8 relative to a typical well drilled in Canada in 2000 due to increased drilling lengths. From well-by-well analysis of production phase flared, vented, and fuel usage natural gas volumes reported at 3846 operating tight gas wells in 2011, operational emission factors were developed. Overall results highlight the importance of operational phase GHG emissions at upstream well sites (including on-site natural gas fuel use), and the critical levels of uncertainty in current estimates of liquid unloading emissions.

  5. Enabling High-performance Interactive Geoscience Data Analysis Through Data Placement and Movement Optimization

    NASA Astrophysics Data System (ADS)

    Zhu, F.; Yu, H.; Rilee, M. L.; Kuo, K. S.; Yu, L.; Pan, Y.; Jiang, H.

    2017-12-01

    Since the establishment of data archive centers and the standardization of file formats, scientists are required to search metadata catalogs for data needed and download the data files to their local machines to carry out data analysis. This approach has facilitated data discovery and access for decades, but it inevitably leads to data transfer from data archive centers to scientists' computers through low-bandwidth Internet connections. Data transfer becomes a major performance bottleneck in such an approach. Combined with generally constrained local compute/storage resources, they limit the extent of scientists' studies and deprive them of timely outcomes. Thus, this conventional approach is not scalable with respect to both the volume and variety of geoscience data. A much more viable solution is to couple analysis and storage systems to minimize data transfer. In our study, we compare loosely coupled approaches (exemplified by Spark and Hadoop) and tightly coupled approaches (exemplified by parallel distributed database management systems, e.g., SciDB). In particular, we investigate the optimization of data placement and movement to effectively tackle the variety challenge, and boost the popularization of parallelization to address the volume challenge. Our goal is to enable high-performance interactive analysis for a good portion of geoscience data analysis exercise. We show that tightly coupled approaches can concentrate data traffic between local storage systems and compute units, and thereby optimizing bandwidth utilization to achieve a better throughput. Based on our observations, we develop a geoscience data analysis system that tightly couples analysis engines with storages, which has direct access to the detailed map of data partition locations. Through an innovation data partitioning and distribution scheme, our system has demonstrated scalable and interactive performance in real-world geoscience data analysis applications.

  6. Effects of two stretching methods on shoulder range of motion and muscle stiffness in baseball players with posterior shoulder tightness: a randomized controlled trial.

    PubMed

    Yamauchi, Taishi; Hasegawa, Satoshi; Nakamura, Masatoshi; Nishishita, Satoru; Yanase, Ko; Fujita, Kosuke; Umehara, Jun; Ji, Xiang; Ibuki, Satoko; Ichihashi, Noriaki

    2016-09-01

    The cross-body stretch and sleeper stretch are widely used for improving flexibility of the posterior shoulder. These stretching methods were modified by Wilk. However, few quantitative data are available on the new, modified stretching methods. A recent study reported the immediate effects of stretching and soft tissue mobilization on the shoulder range of motion (ROM) and muscle stiffness in subjects with posterior shoulder tightness. However, the long-term effect of stretching for muscle stiffness is unknown. The objective of this study was to examine the effects of 2 stretching methods, the modified cross-body stretch (MCS) and the modified sleeper stretch (MSS), on shoulder ROM and muscle stiffness in baseball players with posterior shoulder tightness. Twenty-four college baseball players with ROM limitations in shoulder internal rotation were randomly assigned to the MCS or MSS group. We measured shoulder internal rotation and horizontal adduction ROM and assessed posterior shoulder muscle stiffness with ultrasonic shear wave elastography before and after a 4-week intervention. Subjects were asked to perform 3 repetitions of the stretching exercises every day, for 30 seconds, with their dominant shoulder. In both groups, shoulder internal rotation and horizontal adduction ROM were significantly increased after the 4-week intervention. Muscle stiffness of the teres minor decreased in the MCS group, and that of the infraspinatus decreased in the MSS group. The MCS and MSS are effective for increasing shoulder internal rotation and horizontal adduction ROM and decreasing muscle stiffness of the infraspinatus or teres minor. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  7. Glutamine enhances tight junction protein expression and modulates corticotropin-releasing factor signaling in the jejunum of weanling piglets.

    PubMed

    Wang, Hao; Zhang, Chen; Wu, Guoyao; Sun, Yuli; Wang, Bin; He, Beibei; Dai, Zhaolai; Wu, Zhenlong

    2015-01-01

    Dysfunction of tight junction integrity is associated with decreased nutrient absorption and numerous gastrointestinal diseases in humans and piglets. Although l-glutamine has been reported to enhance intestinal-mucosal mass and barrier function under stressful conditions, in vivo data to support a functional role for l-glutamine on intestinal tight junction protein (TJP) expression in weanling mammals are limited. This study tested the hypothesis that glutamine regulates expression of TJPs and stress-related corticotropin-releasing factor (CRF) signaling in the jejunum of weanling piglets. Piglets were reared by sows or weaned at 21 d of age to a corn and soybean meal-based diet that was or was not supplemented with 1% l-glutamine for 7 d. Growth performance, intestinal permeability, TJP abundance, and CRF expression were examined. Weaning caused increases (P < 0.05) in intestinal permeability by 40% and in CRF concentrations by 4.7 times in association with villus atrophy (P < 0.05). Western blot analysis showed reductions (P < 0.05) in jejunal expression of occludin, claudin-1, zonula occludens (ZO) 2, and ZO-3, but no changes in the abundance of claudin-3, claudin-4, or ZO-1 in weanling piglets compared with age-matched suckling controls. Glutamine supplementation improved (P < 0.05) intestinal permeability and villus height, while reducing (P < 0.05) jejunal mRNA and protein levels for CRF and attenuating (P < 0.05) weanling-induced decreases in occludin, claudin-1, ZO-2, and ZO-3 protein abundances. Collectively, our results support an important role for l-glutamine in regulating expression of TJPs and CRF in the jejunum of weanling piglets. © 2015 American Society for Nutrition.

  8. Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

    NASA Astrophysics Data System (ADS)

    Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

    2018-02-01

    We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.

  9. Epithelial cell specific properties and genetic complementation in a delta F508 cystic fibrosis nasal polyp cell line.

    PubMed

    Kunzelmann, K; Lei, D C; Eng, K; Escobar, L C; Koslowsky, T; Gruenert, D C

    1995-09-01

    Analysis of vectorial ion transport and protein trafficking in transformed cystic fibrosis (CF) epithelial cells has been limited because the cells tend to lose their tight junctions with multiple subcultures. To elucidate ion transport and protein trafficking in CF epithelial cells, a polar cell line with apical and basolateral compartments will facilitate analysis of the efficacy of different gene therapy strategies in a "tight epithelium" in vitro. This study investigates the genotypic and phenotypic properties of a CF nasal polyp epithelial, delta F508 homozygote, cell line that has tight junctions pre-crisis. The cells (sigma CFNPE14o-) were transformed with an origin-of-replication defective SV40 plasmid. They develop transepithelial resistance in Ussing chambers and are defective in cAMP-dependent Cl- transport as measured by efflux of radioactive Cl-, short circuit current (Isc), or whole-cell patch clamp. Stimulation of the cells by bradykinin, histamine, or ATP seems to activate both K(+)- and Ca(+2)-dependent Cl- transport. Measurement of 36Cl- efflux following stimulation with A23187 and ionomycin indicate a Ca(+2)-dependent Cl- transport. Volume regulatory capacity of the cells is indicated by cell swelling conductance. Expression of the CF transmembrane conductance regulator mRNA was indicated by RT-PCR amplification. When cells are grown at 26 degrees C for 48 h there is no indication of cAMP-dependent Cl- as has been previously indicated in heterologous expression systems. Antibodies specific for secretory cell antigens indicate the presence of antigens found in goblet, serous, and mucous cells; in goblet and serous cells; or in goblet and mucous cells; but not antigens found exclusively in mucous or serous cells.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Numerical simulation of the environmental impact of hydraulic fracturing of tight/shale gas reservoirs on near-surface groundwater: Background, base cases, shallow reservoirs, short-term gas, and water transport.

    PubMed

    Reagan, Matthew T; Moridis, George J; Keen, Noel D; Johnson, Jeffrey N

    2015-04-01

    Hydrocarbon production from unconventional resources and the use of reservoir stimulation techniques, such as hydraulic fracturing, has grown explosively over the last decade. However, concerns have arisen that reservoir stimulation creates significant environmental threats through the creation of permeable pathways connecting the stimulated reservoir with shallower freshwater aquifers, thus resulting in the contamination of potable groundwater by escaping hydrocarbons or other reservoir fluids. This study investigates, by numerical simulation, gas and water transport between a shallow tight-gas reservoir and a shallower overlying freshwater aquifer following hydraulic fracturing operations, if such a connecting pathway has been created. We focus on two general failure scenarios: (1) communication between the reservoir and aquifer via a connecting fracture or fault and (2) communication via a deteriorated, preexisting nearby well. We conclude that the key factors driving short-term transport of gas include high permeability for the connecting pathway and the overall volume of the connecting feature. Production from the reservoir is likely to mitigate release through reduction of available free gas and lowering of reservoir pressure, and not producing may increase the potential for release. We also find that hydrostatic tight-gas reservoirs are unlikely to act as a continuing source of migrating gas, as gas contained within the newly formed hydraulic fracture is the primary source for potential contamination. Such incidents of gas escape are likely to be limited in duration and scope for hydrostatic reservoirs. Reliable field and laboratory data must be acquired to constrain the factors and determine the likelihood of these outcomes. Short-term leakage fractured reservoirs requires high-permeability pathways Production strategy affects the likelihood and magnitude of gas release Gas release is likely short-term, without additional driving forces.

  11. Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

    NASA Astrophysics Data System (ADS)

    Leleyter, M.; Olivi-Tran, N.

    2008-12-01

    We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.

  12. Numerical simulation of the environmental impact of hydraulic fracturing of tight/shale gas reservoirs on near-surface groundwater: Background, base cases, shallow reservoirs, short-term gas, and water transport

    DOE PAGES

    Reagan, Matthew T.; Moridis, George J.; Keen, Noel D.; ...

    2015-04-18

    Hydrocarbon production from unconventional resources and the use of reservoir stimulation techniques, such as hydraulic fracturing, has grown explosively over the last decade. However, concerns have arisen that reservoir stimulation creates significant environmental threats through the creation of permeable pathways connecting the stimulated reservoir with shallower freshwater aquifers, thus resulting in the contamination of potable groundwater by escaping hydrocarbons or other reservoir fluids. This study investigates, by numerical simulation, gas and water transport between a shallow tight-gas reservoir and a shallower overlying freshwater aquifer following hydraulic fracturing operations, if such a connecting pathway has been created. We focus on twomore » general failure scenarios: (1) communication between the reservoir and aquifer via a connecting fracture or fault and (2) communication via a deteriorated, preexisting nearby well. We conclude that the key factors driving short-term transport of gas include high permeability for the connecting pathway and the overall volume of the connecting feature. Production from the reservoir is likely to mitigate release through reduction of available free gas and lowering of reservoir pressure, and not producing may increase the potential for release. We also find that hydrostatic tight-gas reservoirs are unlikely to act as a continuing source of migrating gas, as gas contained within the newly formed hydraulic fracture is the primary source for potential contamination. Such incidents of gas escape are likely to be limited in duration and scope for hydrostatic reservoirs. Reliable field and laboratory data must be acquired to constrain the factors and determine the likelihood of these outcomes.« less

  13. Divergences and estimating tight bounds on Bayes error with applications to multivariate Gaussian copula and latent Gaussian copula

    NASA Astrophysics Data System (ADS)

    Thelen, Brian J.; Xique, Ismael J.; Burns, Joseph W.; Goley, G. Steven; Nolan, Adam R.; Benson, Jonathan W.

    2017-04-01

    In Bayesian decision theory, there has been a great amount of research into theoretical frameworks and information- theoretic quantities that can be used to provide lower and upper bounds for the Bayes error. These include well-known bounds such as Chernoff, Battacharrya, and J-divergence. Part of the challenge of utilizing these various metrics in practice is (i) whether they are "loose" or "tight" bounds, (ii) how they might be estimated via either parametric or non-parametric methods, and (iii) how accurate the estimates are for limited amounts of data. In general what is desired is a methodology for generating relatively tight lower and upper bounds, and then an approach to estimate these bounds efficiently from data. In this paper, we explore the so-called triangle divergence which has been around for a while, but was recently made more prominent in some recent research on non-parametric estimation of information metrics. Part of this work is motivated by applications for quantifying fundamental information content in SAR/LIDAR data, and to help in this, we have developed a flexible multivariate modeling framework based on multivariate Gaussian copula models which can be combined with the triangle divergence framework to quantify this information, and provide approximate bounds on Bayes error. In this paper we present an overview of the bounds, including those based on triangle divergence and verify that under a number of multivariate models, the upper and lower bounds derived from triangle divergence are significantly tighter than the other common bounds, and often times, dramatically so. We also propose some simple but effective means for computing the triangle divergence using Monte Carlo methods, and then discuss estimation of the triangle divergence from empirical data based on Gaussian Copula models.

  14. Claudin expression in follicle-associated epithelium of rat Peyer's patches defines a major restriction of the paracellular pathway.

    PubMed

    Markov, A G; Falchuk, E L; Kruglova, N M; Radloff, J; Amasheh, S

    2016-01-01

    Members of the tight junction protein family of claudins have been demonstrated to specifically determine paracellular permeability of the intestinal epithelium. In small intestinal mucosa, which is generally considered to be a leaky epithelium, Peyer's patches are a primary part of the immune system. The aim of this study was to analyse the tight junctional barrier of follicle-associated epithelium covering Peyer's patches (lymphoid follicles). Employing small intestinal tissue specimens of male Wistar rats, electrophysiological analyses including the Ussing chamber technique, marker flux measurements and one-path impedance spectroscopy were performed. Morphometry of HE-stained tissue sections was taken into account. Claudin expression and localization was analysed by immunoblotting and confocal laser scanning immunofluorescence microscopy. Almost twofold higher parameters of epithelial and transepithelial tissue resistance and a markedly lower permeability for the paracellular permeability markers 4 and 20 kDa FITC-dextran were detected in follicle-associated epithelium compared to neighbouring villous epithelium. Analysis of claudin expression and localization revealed a stronger expression of major sealing proteins in follicle-associated epithelium, including claudin-1, claudin-4, claudin-5 and claudin-8. Therefore, the specific expression and localization of claudins is in accordance with barrier properties of follicle-associated epithelium vs. neighbouring villous epithelium. We demonstrate that follicle-associated epithelium is specialized to ensure maximum restriction of the epithelial paracellular pathway in Peyer's patches by selective sealing of tight junctions. This results in an exclusive transcellular pathway of epithelial cells as the limiting and mandatory route for a controlled presentation of antigens to the underlying lymphocytes under physiological conditions. © 2015 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  15. In vitro porcine blood-brain barrier model for permeability studies: pCEL-X software pKa(FLUX) method for aqueous boundary layer correction and detailed data analysis.

    PubMed

    Yusof, Siti R; Avdeef, Alex; Abbott, N Joan

    2014-12-18

    In vitro blood-brain barrier (BBB) models from primary brain endothelial cells can closely resemble the in vivo BBB, offering valuable models to assay BBB functions and to screen potential central nervous system drugs. We have recently developed an in vitro BBB model using primary porcine brain endothelial cells. The model shows expression of tight junction proteins and high transendothelial electrical resistance, evidence for a restrictive paracellular pathway. Validation studies using small drug-like compounds demonstrated functional uptake and efflux transporters, showing the suitability of the model to assay drug permeability. However, one limitation of in vitro model permeability measurement is the presence of the aqueous boundary layer (ABL) resulting from inefficient stirring during the permeability assay. The ABL can be a rate-limiting step in permeation, particularly for lipophilic compounds, causing underestimation of the permeability. If the ABL effect is ignored, the permeability measured in vitro will not reflect the permeability in vivo. To address the issue, we explored the combination of in vitro permeability measurement using our porcine model with the pKa(FLUX) method in pCEL-X software to correct for the ABL effect and allow a detailed analysis of in vitro (transendothelial) permeability data, Papp. Published Papp using porcine models generated by our group and other groups are also analyzed. From the Papp, intrinsic transcellular permeability (P0) is derived by simultaneous refinement using a weighted nonlinear regression, taking into account permeability through the ABL, paracellular permeability and filter restrictions on permeation. The in vitro P0 derived for 22 compounds (35 measurements) showed good correlation with P0 derived from in situ brain perfusion data (r(2)=0.61). The analysis also gave evidence for carrier-mediated uptake of naloxone, propranolol and vinblastine. The combination of the in vitro porcine model and the software analysis provides a useful tool to better predict BBB permeability in vivo and gain better mechanistic information about BBB permeation. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Global-scale carbon and energy flows through the marine planktonic food web: An analysis with a coupled physical-biological model

    NASA Astrophysics Data System (ADS)

    Stock, Charles A.; Dunne, John P.; John, Jasmin G.

    2014-01-01

    Global-scale planktonic ecosystem models exhibit large differences in simulated net primary production (NPP) and assessment of planktonic food web fluxes beyond primary producers has been limited, diminishing confidence in carbon flux estimates from these models. In this study, a global ocean-ice-ecosystem model was assessed against a suite of observation-based planktonic food web flux estimates, many of which were not considered in previous modeling studies. The simulation successfully captured cross-biome differences and similarities in these fluxes after calibration of a limited number of highly uncertain yet influential parameters. The resulting comprehensive carbon budgets suggested that shortened food webs, elevated growth efficiencies, and tight consumer-resource coupling enable oceanic upwelling systems to support 45% of pelagic mesozooplankton production despite accounting for only 22% of ocean area and 34% of NPP. In seasonally stratified regions (42% of ocean area and 40% of NPP), weakened consumer-resource coupling tempers mesozooplankton production to 41% and enhances export below 100 m to 48% of the global total. In oligotrophic systems (36% of ocean area and 26% of NPP), the dominance of small phytoplankton and low consumer growth efficiencies supported only 14% of mesozooplankton production and 17% of export globally. Bacterial production, in contrast, was maintained in nearly constant proportion to primary production across biomes through the compensating effects of increased partitioning of NPP to the microbial food web in oligotrophic ecosystems and increased bacterial growth efficiencies in more productive areas. Cross-biome differences in mesozooplankton trophic level were muted relative to those invoked by previous work such that significant differences in consumer growth efficiencies and the strength of consumer-resource coupling were needed to explain sharp cross-biome differences in mesozooplankton production. Lastly, simultaneous consideration of multiple flux constraints supports a highly distributed view of respiration across the planktonic food web rather than one dominated by heterotrophic bacteria. The solution herein is unlikely unique in its ability to explain observed cross-biome energy flow patterns and notable misfits remain. Resolution of existing uncertainties in observed biome-scale productivity and increasingly mechanistic physical and biological model components should yield significant refinements to estimates herein.

  17. The Unconventional Revolution in Exploration Geophysics

    NASA Astrophysics Data System (ADS)

    House, N. J.

    2014-12-01

    During the last 25 years, 3D seismic imaging has revolutionized hydrocarbon exploration by delivering an accurate 3 dimensional picture of the subsurface. The image is capable of detecting fluids within the reservoir, and has significantly reduced the risk of locating and developing hydrocarbon deposits. In late 1990s, deregulation of natural gas prices allowed long recognized deposits of natural gas locked in tight rocks be economic. It sparked factory drilling (repeatable high density evenly spaced) wells and hydraulic fracturing that would help unlock the reservoirs. All that was needed was a geologist to determine depths and limits of the reservoir and engineers to drill and complete the wells. If 3D seismic data was available, it might have been used to define both the limits of the field and drilling hazards. Generally the cost and time required to process and interpret 3D Seismic was considered too high to affect the perceived geologic risk of the Factory approach. Completion costs in unconventional reservoirs account for over 50% of the well costs. It's therefore critical to understand the geometry of how the rock is fracturing and determine optimum well spacing to balance the cost of development with the value of the gas or oil being produced. By extending AVO to the pre-stack domain, it's possible to simultaneously invert for Vp, Vs and density. Armed with these three fundamental rock properties that dictate elastic and inelastic rock response, researchers were able to combine those properties to tie directly to how well a rock will respond to hydraulic fracturing, or which rocks contain a higher TOC, or other rock properties that control how a rock responds to seismic waves or hydraulic fracturing. Combining these results allows interpreters to map areas of higher productivity, and identify bypassed reserves. Currently hundreds of different seismic attributes that are generated from 3D seismic data are used to identify the highest productive areas and how to develop them. MicroSeismic mapping has made completion more efficient and safe. While the geophysics involved in unconventional resource development may not be the first thought in the board room, thier data has become an accepted early development tool of successful oil and gas companies.

  18. Constant lift rotor for a heavier than air craft

    NASA Technical Reports Server (NTRS)

    Stroub, R. H. (Inventor)

    1979-01-01

    A rotor blade extended radially from a hub, characterized by an elongated spar and a plurality of axially aligned shells pivotally mounted on the spar is presented. Each has an aerodynamic center located in trailing relation with the spar and supported thereby for simultaneous axial and angular displacement as centrifugal forces are applied, a pitch controller plus a plurality of pivotal pitch limiting arms transversely related to the spar. A push-pull link interconnecting the arms is used for imparting simultaneous pivotal motion, whereby the angular relationship of the arms to the spar is varied for varying the motion of the trucks along the arms for thus limiting the pitch of the segments about the spar.

  19. A proposed route to independent measurements of tight junction conductance at discrete cell junctions

    PubMed Central

    Zhou, Lushan; Zeng, Yuhan; Baker, Lane A; Hou, Jianghui

    2015-01-01

    Direct recording of tight junction permeability is of pivotal importance to many biologic fields. Previous approaches bear an intrinsic disadvantage due to the difficulty of separating tight junction conductance from nearby membrane conductance. Here, we propose the design of Double whole-cell Voltage Clamp - Ion Conductance Microscopy (DVC-ICM) based on previously demonstrated potentiometric scanning of local conductive pathways. As proposed, DVC-ICM utilizes two coordinated whole-cell patch-clamps to neutralize the apical membrane current during potentiometric scanning, which in models described here will profoundly enhance the specificity of tight junction recording. Several potential pitfalls are considered, evaluated and addressed with alternative countermeasures. PMID:26716077

  20. Altering wettability to recover more oil from tight formations

    DOE PAGES

    Brady, Patrick V.; Bryan, Charles R.; Thyne, Geoffrey; ...

    2016-06-03

    We describe here a method for chemically modifying fracturing fluids and overflushes to chemically increase oil recovery from tight formations. Oil wetting of tight formations is usually controlled by adhesion to illite, kerogen, or both; adhesion to carbonate minerals may also play a role. Oil-illite adhesion is sensitive to salinity, dissolved divalent cation content, and pH. We measure oil-rock adhesion with middle Bakken formation oil and core to verify a surface complexation model of reservoir wettability. The agreement between the model and experiments suggests that wettability trends in tight formations can be quantitatively predicted and that fracturing fluid and overflushmore » compositions can be individually tailored to increase oil recovery.« less

  1. Altering wettability to recover more oil from tight formations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brady, Patrick V.; Bryan, Charles R.; Thyne, Geoffrey

    We describe here a method for chemically modifying fracturing fluids and overflushes to chemically increase oil recovery from tight formations. Oil wetting of tight formations is usually controlled by adhesion to illite, kerogen, or both; adhesion to carbonate minerals may also play a role. Oil-illite adhesion is sensitive to salinity, dissolved divalent cation content, and pH. We measure oil-rock adhesion with middle Bakken formation oil and core to verify a surface complexation model of reservoir wettability. The agreement between the model and experiments suggests that wettability trends in tight formations can be quantitatively predicted and that fracturing fluid and overflushmore » compositions can be individually tailored to increase oil recovery.« less

  2. First results of a simultaneous measurement of tritium and 14C in an ultra-low-background proportional counter for environmental sources of methane

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mace, Emily K.; Aalseth, Craig E.; Day, Anthony R.

    Abstract Simultaneous measurement of tritium and 14C would provide an added tool for tracing organic compounds through environmental systems and is possible via beta energy spectroscopy of sample-derived methane in internal-source gas proportional counters. Since the mid-1960’s atmospheric tritium and 14C have fallen dramatically as the isotopic injections from above-ground nuclear testing have been diluted into the ocean and biosphere. In this work, the feasibility of simultaneous tritium and 14C measurements via proportional counters is revisited in light of significant changes in both the atmospheric and biosphere isotopics and the development of new ultra-low-background gas proportional counting capabilities for smallmore » samples (roughly 50 cc methane). A Geant4 Monte Carlo model of a Pacific Northwest National Laboratory (PNNL) proportional counter response to tritium and 14C is used to analyze small samples of two different methane sources to illustrate the range of applicability of contemporary simultaneous measurements and their limitations. Because the two methane sources examined were not sample size limited, we could compare the small-sample measurements performed at PNNL with analysis of larger samples performed at a commercial laboratory. The dual-isotope simultaneous measurement is well matched for methane samples that are atmospheric or have an elevated source of tritium (i.e. landfill gas). For samples with low/modern tritium isotopics (rainwater), commercial separation and counting is a better fit.« less

  3. Quantification of the enhanced effectiveness of NOx control from simultaneous reductions of VOC and NH3 for reducing air pollution in the Beijing-Tianjin-Hebei region, China

    NASA Astrophysics Data System (ADS)

    Xing, Jia; Ding, Dian; Wang, Shuxiao; Zhao, Bin; Jang, Carey; Wu, Wenjing; Zhang, Fenfen; Zhu, Yun; Hao, Jiming

    2018-06-01

    As one common precursor for both PM2.5 and O3 pollution, NOx gains great attention because its controls can be beneficial for reducing both PM2.5 and O3. However, the effectiveness of NOx controls for reducing PM2.5 and O3 are largely influenced by the ambient levels of NH3 and VOC, exhibiting strong nonlinearities characterized as NH3-limited/NH3-poor and NOx-/VOC-limited conditions, respectively. Quantification of such nonlinearities is a prerequisite for making suitable policy decisions but limitations of existing methods were recognized. In this study, a new method was developed by fitting multiple simulations of a chemical transport model (i.e., Community Multiscale Air Quality Modeling System, CMAQ) with a set of polynomial functions (denoted as pf-RSM) to quantify responses of ambient PM2.5 and O3 concentrations to changes in precursor emissions. The accuracy of the pf-RSM is carefully examined to meet the criteria of a mean normalized error within 2 % and a maximal normalized error within 10 % by using 40 training samples with marginal processing. An advantage of the pf-RSM method is that the nonlinearity in PM2.5 and O3 responses to precursor emission changes can be characterized by quantitative indicators, including (1) a peak ratio (denoted as PR) representing VOC-limited or NOx-limited conditions, (2) a suggested ratio of VOC reduction to NOx reduction to avoid increasing O3 under VOC-limited conditions, (3) a flex ratio (denoted as FR) representing NH3-poor or NH3-rich conditions, and (4) enhanced benefits in PM2.5 reductions from simultaneous reduction of NH3 with the same reduction rate of NOx. A case study in the Beijing-Tianjin-Hebei region suggested that most urban areas present strong VOC-limited conditions with a PR from 0.4 to 0.8 in July, implying that the NOx emission reduction rate needs to be greater than 20-60 % to pass the transition from VOC-limited to NOx-limited conditions. A simultaneous VOC control (the ratio of VOC reduction to NOx reduction is about 0.5-1.2) can avoid increasing O3 during the transition. For PM2.5, most urban areas present strong NH3-rich conditions with a PR from 0.75 to 0.95, implying that NH3 is sufficiently abundant to neutralize extra nitric acid produced by an additional 5-35 % of NOx emissions. Enhanced benefits in PM2.5 reductions from simultaneous reduction of NH3 were estimated to be 0.04-0.15 µg m-3 PM2.5 per 1 % reduction of NH3 along with NOx, with greater benefits in July when the NH3-rich conditions are not as strong as in January. Thus, the newly developed pf-RSM model has successfully quantified the enhanced effectiveness of NOx control, and simultaneous reduction of VOC and NH3 with NOx can assure the control effectiveness of PM2.5 and O3.

  4. Effects of pH and seasonal temperature variation on simultaneous partial nitrification and anammox in free-water surface wetlands.

    PubMed

    He, Yuling; Tao, Wendong; Wang, Ziyuan; Shayya, Walid

    2012-11-15

    Design considerations to enhance simultaneous partial nitrification and anammox in constructed wetlands are largely unknown. This study examined the effects of pH and seasonal temperature variation on simultaneous partial nitrification and anammox in two free-water surface wetlands. In order to enhance partial nitrification and inhibit nitrite oxidation, furnace slag was placed on the rooting substrate to maintain different pH levels in the wetland water. The wetlands were batch operated for dairy wastewater treatment under oxygen-limited conditions at a cycle time of 7 d. Fluorescence in situ hybridization analysis found that aerobic ammonium oxidizing bacteria and anammox bacteria accounted for 42-73% of the bacterial populations in the wetlands, which was the highest relative abundance of ammonium oxidizing and anammox bacteria in constructed wetlands enhancing simultaneous partial nitrification and anammox. The two wetlands removed total inorganic nitrogen efficiently, 3.36-3.38 g/m(2)/d in the warm season with water temperatures at 18.9-24.9 °C and 1.09-1.50 g/m(2)/d in the cool season at 13.8-18.9 °C. Plant uptake contributed 2-45% to the total inorganic nitrogen removal in the growing season. A seasonal temperature variation of more than 6 °C would affect simultaneous partial nitrification and anammox significantly. Significant pH effects were identified only when the temperatures were below 18.9 °C. Anammox was the limiting stage of simultaneous partial nitrification and anammox in the wetlands. Water pH should be controlled along with influent ammonium concentration and temperature to avoid toxicity of free ammonia to anammox bacteria. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. AUV Positioning Method Based on Tightly Coupled SINS/LBL for Underwater Acoustic Multipath Propagation.

    PubMed

    Zhang, Tao; Shi, Hongfei; Chen, Liping; Li, Yao; Tong, Jinwu

    2016-03-11

    This paper researches an AUV (Autonomous Underwater Vehicle) positioning method based on SINS (Strapdown Inertial Navigation System)/LBL (Long Base Line) tightly coupled algorithm. This algorithm mainly includes SINS-assisted searching method of optimum slant-range of underwater acoustic propagation multipath, SINS/LBL tightly coupled model and multi-sensor information fusion algorithm. Fuzzy correlation peak problem of underwater LBL acoustic propagation multipath could be solved based on SINS positional information, thus improving LBL positional accuracy. Moreover, introduction of SINS-centered LBL locating information could compensate accumulative AUV position error effectively and regularly. Compared to loosely coupled algorithm, this tightly coupled algorithm can still provide accurate location information when there are fewer than four available hydrophones (or within the signal receiving range). Therefore, effective positional calibration area of tightly coupled system based on LBL array is wider and has higher reliability and fault tolerance than loosely coupled. It is more applicable to AUV positioning based on SINS/LBL.

  6. AUV Positioning Method Based on Tightly Coupled SINS/LBL for Underwater Acoustic Multipath Propagation

    PubMed Central

    Zhang, Tao; Shi, Hongfei; Chen, Liping; Li, Yao; Tong, Jinwu

    2016-01-01

    This paper researches an AUV (Autonomous Underwater Vehicle) positioning method based on SINS (Strapdown Inertial Navigation System)/LBL (Long Base Line) tightly coupled algorithm. This algorithm mainly includes SINS-assisted searching method of optimum slant-range of underwater acoustic propagation multipath, SINS/LBL tightly coupled model and multi-sensor information fusion algorithm. Fuzzy correlation peak problem of underwater LBL acoustic propagation multipath could be solved based on SINS positional information, thus improving LBL positional accuracy. Moreover, introduction of SINS-centered LBL locating information could compensate accumulative AUV position error effectively and regularly. Compared to loosely coupled algorithm, this tightly coupled algorithm can still provide accurate location information when there are fewer than four available hydrophones (or within the signal receiving range). Therefore, effective positional calibration area of tightly coupled system based on LBL array is wider and has higher reliability and fault tolerance than loosely coupled. It is more applicable to AUV positioning based on SINS/LBL. PMID:26978361

  7. An ultra-wide bandwidth-based range/GPS tight integration approach for relative positioning in vehicular ad hoc networks

    NASA Astrophysics Data System (ADS)

    Shen, Feng; Wayn Cheong, Joon; Dempster, Andrew G.

    2015-04-01

    Relative position awareness is a vital premise for the implementation of emerging intelligent transportation systems, such as collision warning. However, commercial global navigation satellite systems (GNSS) receivers do not satisfy the requirements of these applications. Fortunately, cooperative positioning (CP) techniques, through sharing the GNSS measurements between vehicles, can improve the performance of relative positioning in a vehicular ad hoc network (VANET). In this paper, while assuming there are no obstacles between vehicles, a new enhanced tightly coupled CP technique is presented by adding ultra-wide bandwidth (UWB)-based inter-vehicular range measurements. In the proposed CP method, each vehicle fuses the GPS measurements and the inter-vehicular range measurements. Based on analytical and experimental results, in the full GPS coverage environment, the new tight integration CP method outperforms the INS-aided tight CP method, tight CP method, and DGPS by 11%, 15%, and 24%, respectively; in the GPS outage scenario, the performance improvement achieves 60%, 65%, and 73%, respectively.

  8. Inline Electrical Connector Mate/Demate Pliers

    NASA Technical Reports Server (NTRS)

    Yutko, Brian; Dininny, Michael; Moscoso, Gerand; Dokos, Adam

    2010-01-01

    Military and aerospace industries use Mil-Spec type electrical connections on bulkhead panels that require inline access for mate and demate operations. These connectors are usually in tight proximity to other connectors, or recessed within panels. The pliers described here have been designed to work in such tight spaces, and consist of a mirrored set of parallel handles, two cross links, two return springs, and replaceable polyurethane-coated end effectors. The polyurethane eliminates metal-to-metal contact and provides a high-friction surface between the jaw and the connector. Operationally, the user would slide the pliers over the connector shell until the molded polyurethane lip makes contact with the connector shell edge. Then, by squeezing the handles, the end effector jaws grip the connector shell, allowing the connector to be easily disconnected by rotating the pliers. Mating the connector occurs by reversing the prescribed procedure, except the connector shell is placed into the jaws by hand. The molded lip within the jaw allows the user to apply additional force for difficult-to-mate connectors. Handle design has been carefully examined to maximize comfort, limit weight, incorporate tether locations, and improve ergonomics. They have been designed with an off-axis offset for wiring harness clearance, while placing the connector axis of rotation close to the user s axis of wrist rotation. This was done to eliminate fatigue during multiple connector panel servicing. To limit handle opening width, with user ergonomics in mind, the pliers were designed using a parallel jaw mechanism. A cross-link mechanism was used to complete this task, while ensuring smooth operation.

  9. Simultaneous, proportional, multi-axis prosthesis control using multichannel surface EMG.

    PubMed

    Yatsenko, Dimitri; McDonnall, Daniel; Guillory, K Shane

    2007-01-01

    Most upper limb prosthesis controllers only allow the individual selection and control of single joints of the limb. The main limiting factor for simultaneous multi-joint control is usually the availability of reliable independent control signals that can intuitively be used. In this paper, a novel method is presented for extraction of individual muscle source signals from surface EMG array recordings, based on EMG energy orthonormalization along principle movement vectors. In cases where independently-controllable muscles are present in residual limbs, this method can be used to provide simultaneous, multi-axis, proportional control of prosthetic systems. Initial results are presented for simultaneous control of wrist rotation, wrist flexion/extension, and grip open/close for two intact subjects under both isometric and non-isometric conditions and for one subject with transradial amputation.

  10. Simultaneous biodegradation of phenol and carbon tetrachloride mediated by humic acids.

    PubMed

    Martínez, Claudia M; Alvarez, Luis H; Cervantes, Francisco J

    2012-09-01

    The capacity of an anaerobic sediment to achieve the simultaneous biodegradation of phenol and carbon tetrachloride (CT) was evaluated, using humic acids (HA) as redox mediator. The presence of HA in sediment incubations increased the rate of biodegradation of phenol and the rate of dehalogenation (2.5-fold) of CT compared to controls lacking HA. Further experiments revealed that the electron-accepting capacity of HA derived from different organic-rich environments was not associated with their reducing capacity to achieve CT dechlorination. The collected kinetic data suggest that the reduction of CT by reduced HA was the rate-limiting step during the simultaneous biodegradation of phenol and CT. To our knowledge, the present study constitutes the first demonstration of the simultaneous biodegradation of two priority pollutants mediated by HA.

  11. JPRS Report West Europe.

    DTIC Science & Technology

    1988-09-08

    the burden of a tight fiscal policy. On her part, Gro Harlem Brundtland seems to console herself with the thought that, as soon as the fiscal ...policy gives noticable and positive results, the voters will return. But the tight fiscal policy seems to be leading to increased unemployment and the...the beginning of the design phase, it is not possible today to make specific comments about this project. However, the tight fiscal situation might

  12. Cellular entry of G3.5 poly (amido amine) dendrimers by clathrin- and dynamin-dependent endocytosis promotes tight junctional opening in intestinal epithelia.

    PubMed

    Goldberg, Deborah S; Ghandehari, Hamidreza; Swaan, Peter W

    2010-08-01

    This study investigates the mechanisms of G3.5 poly (amido amine) dendrimer cellular uptake, intracellular trafficking, transepithelial transport and tight junction modulation in Caco-2 cells in the context of oral drug delivery. Chemical inhibitors blocking clathrin-, caveolin- and dynamin-dependent endocytosis pathways were used to investigate the mechanisms of dendrimer cellular uptake and transport across Caco-2 cells using flow cytometry and confocal microscopy. Dendrimer cellular uptake was found to be dynamin-dependent and was reduced by both clathrin and caveolin endocytosis inhibitors, while transepithelial transport was only dependent on dynamin- and clathrin-mediated endocytosis. Dendrimers were quickly trafficked to the lysosomes after 15 min of incubation and showed increased endosomal accumulation at later time points, suggesting saturation of this pathway. Dendrimers were unable to open tight junctions in cell monolayers treated with dynasore, a selective inhibitor of dynamin, confirming that dendrimer internalization promotes tight junction modulation. G3.5 PAMAM dendrimers take advantage of several receptor-mediated endocytosis pathways for cellular entry in Caco-2 cells. Dendrimer internalization by dynamin-dependent mechanisms promotes tight junction opening, suggesting that dendrimers act on intracellular cytoskeletal proteins to modulate tight junctions, thus catalyzing their own transport via the paracellular route.

  13. In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization.

    PubMed

    Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst

    2013-01-15

    Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.

  14. Model many-body Stoner Hamiltonian for binary FeCr alloys

    NASA Astrophysics Data System (ADS)

    Nguyen-Manh, D.; Dudarev, S. L.

    2009-09-01

    We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.

  15. A Study of the Effect of Surfactants on the Aggregation Behavior of Crude Oil Aqueous Dispersions through Steady-State Fluorescence Spectrometry.

    PubMed

    Vallejo-Cardona, Alba A; Cerón-Camacho, Ricardo; Karamath, James R; Martínez-Palou, Rafael; Aburto, Jorge

    2017-07-01

    Unconventional crude oil as heavy, extra heavy, bitumen, tight, and shale oils will meet 10% of worldwide needs for 2035, perhaps earlier. Petroleum companies will face problems concerning crude oil extraction, production, transport, and refining, and some of these are addressed by the use of surfactants and other chemicals. For example, water-in-crude oil emulsions are frequently found during the production of mature wells where enhanced recovery techniques have been deployed. Nevertheless, the selection of adequate surfactant, dosage, type of water (sea, tap or oilfield), kind of crude oil (light, heavy, extra heavy, tight, shale, bitumen) affect the effectivity of treatment and usual bottle tests give limited information. We developed a fluorescence technique to study the effect of surfactants on medium, heavy, and extra heavy crude oil employing the natural fluorophore molecules from petroleum. We first carried out the characterization of commercial and synthetic surfactants, then dispersions of petroleum in water were studied by steady-state fluorometry and the size of petroleum aggregates were measured. The aggregation of petroleum incremented from medium to extra heavy crude oil and we discussed the effect of different surfactants on such aggregation.

  16. Electronic Structure and Properties of Deformed Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Yang, Liu; Arnold, Jim (Technical Monitor)

    2001-01-01

    A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.

  17. Dose conformation to the spine during palliative treatments using dynamic wedges

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ormsby, Matthew A., E-mail: Matthew.Ormsby@usoncology.com; Herndon, R. Craig; Kaczor, Joseph G.

    2013-07-01

    Radiation therapy is commonly used to alleviate pain associated with metastatic disease of the spine. Often, isodose lines are manipulated using dynamic or physical wedges to encompass the section of spine needing treatment while minimizing dose to normal tissue. We will compare 2 methods used to treat the entire thoracic spine. The first method treats the thoracic spine with a single, nonwedged posterior-anterior (PA) field. Dose is prescribed to include the entire spine. Isodose lines tightly conform to the top and bottom vertebrae, but vertebrae between these 2 received more than enough coverage. The second method uses a combination ofmore » wedges to create an isodose line that mimics the curvature of the thoracic spine. This “C”-shaped curvature is created by overlapping 2 fields with opposing dynamic wedges. Machine constraints limit the treatment length and therefore 2 isocenters are used. Each of the 2 PA fields contributes a portion of the total daily dose. This technique creates a “C”-shaped isodose line that tightly conforms to the thoracic spine, minimizing normal tissue dose. Spinal cord maximum dose is reduced, as well as mean dose to the liver, esophagus, and heart.« less

  18. Self-Consistent Optimization of Excited States within Density-Functional Tight-Binding.

    PubMed

    Kowalczyk, Tim; Le, Khoa; Irle, Stephan

    2016-01-12

    We present an implementation of energies and gradients for the ΔDFTB method, an analogue of Δ-self-consistent-field density functional theory (ΔSCF) within density-functional tight-binding, for the lowest singlet excited state of closed-shell molecules. Benchmarks of ΔDFTB excitation energies, optimized geometries, Stokes shifts, and vibrational frequencies reveal that ΔDFTB provides a qualitatively correct description of changes in molecular geometries and vibrational frequencies due to excited-state relaxation. The accuracy of ΔDFTB Stokes shifts is comparable to that of ΔSCF-DFT, and ΔDFTB performs similarly to ΔSCF with the PBE functional for vertical excitation energies of larger chromophores where the need for efficient excited-state methods is most urgent. We provide some justification for the use of an excited-state reference density in the DFTB expansion of the electronic energy and demonstrate that ΔDFTB preserves many of the properties of its parent ΔSCF approach. This implementation fills an important gap in the extended framework of DFTB, where access to excited states has been limited to the time-dependent linear-response approach, and affords access to rapid exploration of a valuable class of excited-state potential energy surfaces.

  19. Vector fields in a tight laser focus: comparison of models.

    PubMed

    Peatross, Justin; Berrondo, Manuel; Smith, Dallas; Ware, Michael

    2017-06-26

    We assess several widely used vector models of a Gaussian laser beam in the context of more accurate vector diffraction integration. For the analysis, we present a streamlined derivation of the vector fields of a uniformly polarized beam reflected from an ideal parabolic mirror, both inside and outside of the resulting focus. This exact solution to Maxwell's equations, first developed in 1920 by V. S. Ignatovsky, is highly relevant to high-intensity laser experiments since the boundary conditions at a focusing optic dictate the form of the focus in a manner analogous to a physical experiment. In contrast, many models simply assume a field profile near the focus and develop the surrounding vector fields consistent with Maxwell's equations. In comparing the Ignatovsky result with popular closed-form analytic vector models of a Gaussian beam, we find that the relatively simple model developed by Erikson and Singh in 1994 provides good agreement in the paraxial limit. Models involving a Lax expansion introduce a divergences outside of the focus while providing little if any improvement in the focal region. Extremely tight focusing produces a somewhat complicated structure in the focus, and requires the Ignatovsky model for accurate representation.

  20. Performance analysis of optimal power allocation in wireless cooperative communication systems

    NASA Astrophysics Data System (ADS)

    Babikir Adam, Edriss E.; Samb, Doudou; Yu, Li

    2013-03-01

    Cooperative communication has been recently proposed in wireless communication systems for exploring the inherent spatial diversity in relay channels.The Amplify-and-Forward (AF) cooperation protocols with multiple relays have not been sufficiently investigated even if it has a low complexity in term of implementation. We consider in this work a cooperative diversity system in which a source transmits some information to a destination with the help of multiple relay nodes with AF protocols and investigate the optimality of allocating powers both at the source and the relays system by optimizing the symbol error rate (SER) performance in an efficient way. Firstly we derive a closedform SER formulation for MPSK signal using the concept of moment generating function and some statistical approximations in high signal to noise ratio (SNR) for the system under studied. We then find a tight corresponding lower bound which converges to the same limit as the theoretical upper bound and develop an optimal power allocation (OPA) technique with mean channel gains to minimize the SER. Simulation results show that our scheme outperforms the equal power allocation (EPA) scheme and is tight to the theoretical approximation based on the SER upper bound in high SNR for different number of relays.

  1. Sensitive electrochemical sensors for simultaneous determination of ascorbic acid, dopamine, and uric acid based on Au@Pd-reduced graphene oxide nanocomposites.

    PubMed

    Jiang, Jingjing; Du, Xuezhong

    2014-10-07

    Sensitive electrochemical sensors were fabricated with reduced graphene oxide-supported Au@Pd (Au@Pd-RGO) nanocomposites by one-step synthesis for individual and simultaneous determination of ascorbic acid (AA), dopamine (DA), and uric acid (UA) with low detection limits and wide concentration ranges. From the Au@Pd-RGO-modified electrodes, well-separated oxidation peaks and enhanced peak currents of AA, DA, and UA were observed owing to the superior conductivity of RGO and the excellent catalytic activity of Au@Pd nanoparticles. For individual detection, the linear responses of AA, DA, and UA were in the concentration ranges of 0.1-1000, 0.01-100, and 0.02-500 μM with detection limits of 0.02, 0.002, and 0.005 μM (S/N = 3), respectively. For simultaneous detection by synchronous change of the concentrations of AA, DA, and UA, the linear response ranges were 1-800, 0.1-100, and 0.1-350 μM with detection limits of 0.28, 0.024, and 0.02 μM (S/N = 3), respectively. The fabricated sensors were further applied to the detection of AA, DA, and UA in urine samples. The Au@Pd-RGO nanocomposites have promising applications in highly sensitive and selective electrochemical sensing.

  2. A new modal-based approach for modelling the bump foil structure in the simultaneous solution of foil-air bearing rotor dynamic problems

    NASA Astrophysics Data System (ADS)

    Bin Hassan, M. F.; Bonello, P.

    2017-05-01

    Recently-proposed techniques for the simultaneous solution of foil-air bearing (FAB) rotor dynamic problems have been limited to a simple bump foil model in which the individual bumps were modelled as independent spring-damper (ISD) subsystems. The present paper addresses this limitation by introducing a modal model of the bump foil structure into the simultaneous solution scheme. The dynamics of the corrugated bump foil structure are first studied using the finite element (FE) technique. This study is experimentally validated using a purpose-made corrugated foil structure. Based on the findings of this study, it is proposed that the dynamics of the full foil structure, including bump interaction and foil inertia, can be represented by a modal model comprising a limited number of modes. This full foil structure modal model (FFSMM) is then adapted into the rotordynamic FAB problem solution scheme, instead of the ISD model. Preliminary results using the FFSMM under static and unbalance excitation conditions are proven to be reliable by comparison against the corresponding ISD foil model results and by cross-correlating different methods for computing the deflection of the full foil structure. The rotor-bearing model is also validated against experimental and theoretical results in the literature.

  3. Validation of a screening method for the simultaneous identification of fat-soluble and water-soluble vitamins (A, E, B1, B2 and B6) in an aqueous micellar medium of hexadecyltrimethylammonium chloride.

    PubMed

    León-Ruiz, V; Vera, S; San Andrés, M P

    2005-04-01

    Simultaneous determination of the fat-soluble vitamins A and E and the water-soluble vitamins B1, B2 and B6 has been carried using a screening method from fluorescence contour graphs. These graphs show different colour zones in relation to the fluorescence intensity measured for the pair of excitation/emission wavelengths. The identification of the corresponding excitation/emission wavelength zones allows the detection of different vitamins in an aqueous medium regardless of the fat or water solubility of each vitamin, owing to the presence of a surfactant which forms micelles in water at the used concentration (over the critical micelle concentration). The micelles dissolve very water insoluble compounds, such as fat-soluble vitamins, inside the aggregates. This approach avoids the use of organic solvents in determining these vitamins and offers the possibility of analysing fat- and water-soluble vitamins simultaneously. The method has been validated in terms of detection limit, cut-off limit, sensitivity, number of false positives, number of false negatives and uncertainty range. The detection limit is about microg L(-1). The screening method was applied to different samples such as pharmaceuticals, juices and isotonic drinks.

  4. Second derivative synchronous fluorimetric method for simultaneous determination of harman and norharman in coffee samples

    NASA Astrophysics Data System (ADS)

    Wabaidur, Saikh Mohammad; Lee, Sang Hak; Alothman, Zeid Abdullah; Siddiqui, Masoom Raza; Alam, Seikh Mafiz

    2013-06-01

    The simultaneous determination of harman and norharman using second derivative synchronous fluorescence method has been developed based on their natural fluorescence. Due to their similar molecular structures, it is difficult to determine them simultaneously in the mixture using conventional fluorimetry. Overlapping of fluorescence spectra was resolved by using a constant second derivative synchronous fluorimetry. The derivative synchronous spectrum, maintaining a constant difference of Δλ = 150 nm between emission and excitation for both the compounds, has been selected for the analysis. The range of application is between 0.182 and 18.2 μg/mL (correlation coefficient, R = 0.9982) for harman and between 0.504 and 16.8 μg/mL (correlation coefficient, R = 0.9962) for norharman. The recovery ranges of 98.5-101.1% for harman and 97.5-99.1% for norharman from their synthetic mixture was reported. The detection limits are 0.016 μg/mL and 0.038 μg/mL for harman and norharman, respectively. Similarly, the quantitation limit of the two compounds was found to be 0.049 and 0.109 μg/mL, respectively. The method was applied to the simultaneous determination of both compounds in coffee samples with satisfactory results.

  5. Second derivative synchronous fluorimetric method for simultaneous determination of harman and norharman in coffee samples.

    PubMed

    Wabaidur, Saikh Mohammad; Lee, Sang Hak; Alothman, Zeid Abdullah; Siddiqui, Masoom Raza; Alam, Seikh Mafiz

    2013-06-01

    The simultaneous determination of harman and norharman using second derivative synchronous fluorescence method has been developed based on their natural fluorescence. Due to their similar molecular structures, it is difficult to determine them simultaneously in the mixture using conventional fluorimetry. Overlapping of fluorescence spectra was resolved by using a constant second derivative synchronous fluorimetry. The derivative synchronous spectrum, maintaining a constant difference of Δλ=150 nm between emission and excitation for both the compounds, has been selected for the analysis. The range of application is between 0.182 and 18.2 μg/mL (correlation coefficient, R=0.9982) for harman and between 0.504 and 16.8 μg/mL (correlation coefficient, R=0.9962) for norharman. The recovery ranges of 98.5-101.1% for harman and 97.5-99.1% for norharman from their synthetic mixture was reported. The detection limits are 0.016 μg/mL and 0.038 μg/mL for harman and norharman, respectively. Similarly, the quantitation limit of the two compounds was found to be 0.049 and 0.109 μg/mL, respectively. The method was applied to the simultaneous determination of both compounds in coffee samples with satisfactory results. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Quantifying full phenological event distributions reveals simultaneous advances, temporal stability and delays in spring and autumn migration timing in long-distance migratory birds.

    PubMed

    Miles, Will T S; Bolton, Mark; Davis, Peter; Dennis, Roy; Broad, Roger; Robertson, Iain; Riddiford, Nick J; Harvey, Paul V; Riddington, Roger; Shaw, Deryk N; Parnaby, David; Reid, Jane M

    2017-04-01

    Phenological changes in key seasonally expressed life-history traits occurring across periods of climatic and environmental change can cause temporal mismatches between interacting species, and thereby impact population and community dynamics. However, studies quantifying long-term phenological changes have commonly only measured variation occurring in spring, measured as the first or mean dates on which focal traits or events were observed. Few studies have considered seasonally paired events spanning spring and autumn or tested the key assumption that single convenient metrics accurately capture entire event distributions. We used 60 years (1955-2014) of daily bird migration census data from Fair Isle, Scotland, to comprehensively quantify the degree to which the full distributions of spring and autumn migration timing of 13 species of long-distance migratory bird changed across a period of substantial climatic and environmental change. In most species, mean spring and autumn migration dates changed little. However, the early migration phase (≤10th percentile date) commonly got earlier, while the late migration phase (≥90th percentile date) commonly got later. Consequently, species' total migration durations typically lengthened across years. Spring and autumn migration phenologies were not consistently correlated within or between years within species and hence were not tightly coupled. Furthermore, different metrics quantifying different aspects of migration phenology within seasons were not strongly cross-correlated, meaning that no single metric adequately described the full pattern of phenological change. These analyses therefore reveal complex patterns of simultaneous advancement, temporal stability and delay in spring and autumn migration phenologies, altering species' life-history structures. Additionally, they demonstrate that this complexity is only revealed if multiple metrics encompassing entire seasonal event distributions, rather than single metrics, are used to quantify phenological change. Existing evidence of long-term phenological changes detected using only one or two metrics should consequently be interpreted cautiously because divergent changes occurring simultaneously could potentially have remained undetected. © 2016 John Wiley & Sons Ltd.

  7. Coding of vocalizations by single neurons in ventrolateral prefrontal cortex.

    PubMed

    Plakke, Bethany; Diltz, Mark D; Romanski, Lizabeth M

    2013-11-01

    Neuronal activity in single prefrontal neurons has been correlated with behavioral responses, rules, task variables and stimulus features. In the non-human primate, neurons recorded in ventrolateral prefrontal cortex (VLPFC) have been found to respond to species-specific vocalizations. Previous studies have found multisensory neurons which respond to simultaneously presented faces and vocalizations in this region. Behavioral data suggests that face and vocal information are inextricably linked in animals and humans and therefore may also be tightly linked in the coding of communication calls in prefrontal neurons. In this study we therefore examined the role of VLPFC in encoding vocalization call type information. Specifically, we examined previously recorded single unit responses from the VLPFC in awake, behaving rhesus macaques in response to 3 types of species-specific vocalizations made by 3 individual callers. Analysis of responses by vocalization call type and caller identity showed that ∼19% of cells had a main effect of call type with fewer cells encoding caller. Classification performance of VLPFC neurons was ∼42% averaged across the population. When assessed at discrete time bins, classification performance reached 70 percent for coos in the first 300 ms and remained above chance for the duration of the response period, though performance was lower for other call types. In light of the sub-optimal classification performance of the majority of VLPFC neurons when only vocal information is present, and the recent evidence that most VLPFC neurons are multisensory, the potential enhancement of classification with the addition of accompanying face information is discussed and additional studies recommended. Behavioral and neuronal evidence has shown a considerable benefit in recognition and memory performance when faces and voices are presented simultaneously. In the natural environment both facial and vocalization information is present simultaneously and neural systems no doubt evolved to integrate multisensory stimuli during recognition. This article is part of a Special Issue entitled "Communication Sounds and the Brain: New Directions and Perspectives". Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Simultaneous Tumor Segmentation, Image Restoration, and Blur Kernel Estimation in PET Using Multiple Regularizations

    PubMed Central

    Li, Laquan; Wang, Jian; Lu, Wei; Tan, Shan

    2016-01-01

    Accurate tumor segmentation from PET images is crucial in many radiation oncology applications. Among others, partial volume effect (PVE) is recognized as one of the most important factors degrading imaging quality and segmentation accuracy in PET. Taking into account that image restoration and tumor segmentation are tightly coupled and can promote each other, we proposed a variational method to solve both problems simultaneously in this study. The proposed method integrated total variation (TV) semi-blind de-convolution and Mumford-Shah segmentation with multiple regularizations. Unlike many existing energy minimization methods using either TV or L2 regularization, the proposed method employed TV regularization over tumor edges to preserve edge information, and L2 regularization inside tumor regions to preserve the smooth change of the metabolic uptake in a PET image. The blur kernel was modeled as anisotropic Gaussian to address the resolution difference in transverse and axial directions commonly seen in a clinic PET scanner. The energy functional was rephrased using the Γ-convergence approximation and was iteratively optimized using the alternating minimization (AM) algorithm. The performance of the proposed method was validated on a physical phantom and two clinic datasets with non-Hodgkin’s lymphoma and esophageal cancer, respectively. Experimental results demonstrated that the proposed method had high performance for simultaneous image restoration, tumor segmentation and scanner blur kernel estimation. Particularly, the recovery coefficients (RC) of the restored images of the proposed method in the phantom study were close to 1, indicating an efficient recovery of the original blurred images; for segmentation the proposed method achieved average dice similarity indexes (DSIs) of 0.79 and 0.80 for two clinic datasets, respectively; and the relative errors of the estimated blur kernel widths were less than 19% in the transversal direction and 7% in the axial direction. PMID:28603407

  9. 50 CFR 660.130 - Trawl fishery-management measures.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... “skirt”) may encircle the net under transfer cables, lifting or splitting straps (chokers), but must be... board, either simultaneously or successively, at any time during a cumulative limit period, then the... of small footrope gear onboard the vessel at any time during the cumulative limit period, the most...

  10. 50 CFR 660.130 - Trawl fishery-management measures.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... “skirt”) may encircle the net under transfer cables, lifting or splitting straps (chokers), but must be... board, either simultaneously or successively, at any time during a cumulative limit period, then the... of small footrope gear onboard the vessel at any time during the cumulative limit period, the most...

  11. Sensitive electrochemical sensors for simultaneous determination of ascorbic acid, dopamine, and uric acid based on Au@Pd-reduced graphene oxide nanocomposites

    NASA Astrophysics Data System (ADS)

    Jiang, Jingjing; Du, Xuezhong

    2014-09-01

    Sensitive electrochemical sensors were fabricated with reduced graphene oxide-supported Au@Pd (Au@Pd-RGO) nanocomposites by one-step synthesis for individual and simultaneous determination of ascorbic acid (AA), dopamine (DA), and uric acid (UA) with low detection limits and wide concentration ranges. From the Au@Pd-RGO-modified electrodes, well-separated oxidation peaks and enhanced peak currents of AA, DA, and UA were observed owing to the superior conductivity of RGO and the excellent catalytic activity of Au@Pd nanoparticles. For individual detection, the linear responses of AA, DA, and UA were in the concentration ranges of 0.1-1000, 0.01-100, and 0.02-500 μM with detection limits of 0.02, 0.002, and 0.005 μM (S/N = 3), respectively. For simultaneous detection by synchronous change of the concentrations of AA, DA, and UA, the linear response ranges were 1-800, 0.1-100, and 0.1-350 μM with detection limits of 0.28, 0.024, and 0.02 μM (S/N = 3), respectively. The fabricated sensors were further applied to the detection of AA, DA, and UA in urine samples. The Au@Pd-RGO nanocomposites have promising applications in highly sensitive and selective electrochemical sensing.Sensitive electrochemical sensors were fabricated with reduced graphene oxide-supported Au@Pd (Au@Pd-RGO) nanocomposites by one-step synthesis for individual and simultaneous determination of ascorbic acid (AA), dopamine (DA), and uric acid (UA) with low detection limits and wide concentration ranges. From the Au@Pd-RGO-modified electrodes, well-separated oxidation peaks and enhanced peak currents of AA, DA, and UA were observed owing to the superior conductivity of RGO and the excellent catalytic activity of Au@Pd nanoparticles. For individual detection, the linear responses of AA, DA, and UA were in the concentration ranges of 0.1-1000, 0.01-100, and 0.02-500 μM with detection limits of 0.02, 0.002, and 0.005 μM (S/N = 3), respectively. For simultaneous detection by synchronous change of the concentrations of AA, DA, and UA, the linear response ranges were 1-800, 0.1-100, and 0.1-350 μM with detection limits of 0.28, 0.024, and 0.02 μM (S/N = 3), respectively. The fabricated sensors were further applied to the detection of AA, DA, and UA in urine samples. The Au@Pd-RGO nanocomposites have promising applications in highly sensitive and selective electrochemical sensing. Electronic supplementary information (ESI) available: pH optimization, comparison of sensor performances, interference experiments, and detection in urine samples. See DOI: 10.1039/c4nr01774a

  12. Using a fiber loop and fiber bragg grating as a fiber optic sensor to simultaneously measure temperature and displacement.

    PubMed

    Chang, Yao-Tang; Yen, Chih-Ta; Wu, Yue-Shiun; Cheng, Hsu-Chih

    2013-05-16

    This study integrated a fiber loop manufactured by using commercial fiber (SMF-28, Corning) and a fiber Bragg grating (FBG) to form a fiber optic sensor that could simultaneously measure displacement and temperature. The fiber loop was placed in a thermoelectric cooling module with FBG affixed to the module, and, consequently, the center wavelength displacement of FBG was limited by only the effects of temperature change. Displacement and temperature were determined by measuring changes in the transmission of optical power and shifts in Bragg wavelength. This study provides a simple and economical method to measure displacement and temperature simultaneously.

  13. H-point standard additions method for simultaneous determination of sulfamethoxazole and trimethoprim in pharmaceutical formulations and biological fluids with simultaneous addition of two analytes

    NASA Astrophysics Data System (ADS)

    Givianrad, M. H.; Saber-Tehrani, M.; Aberoomand-Azar, P.; Mohagheghian, M.

    2011-03-01

    The applicability of H-point standard additions method (HPSAM) to the resolving of overlapping spectra corresponding to the sulfamethoxazole and trimethoprim is verified by UV-vis spectrophotometry. The results show that the H-point standard additions method with simultaneous addition of both analytes is suitable for the simultaneous determination of sulfamethoxazole and trimethoprim in aqueous media. The results of applying the H-point standard additions method showed that the two drugs could be determined simultaneously with the concentration ratios of sulfamethoxazole to trimethoprim varying from 1:18 to 16:1 in the mixed samples. Also, the limits of detections were 0.58 and 0.37 μmol L -1 for sulfamethoxazole and trimethoprim, respectively. In addition the means of the calculated RSD (%) were 1.63 and 2.01 for SMX and TMP, respectively in synthetic mixtures. The proposed method has been successfully applied to the simultaneous determination of sulfamethoxazole and trimethoprim in some synthetic, pharmaceutical formulation and biological fluid samples.

  14. H-point standard additions method for simultaneous determination of sulfamethoxazole and trimethoprim in pharmaceutical formulations and biological fluids with simultaneous addition of two analytes.

    PubMed

    Givianrad, M H; Saber-Tehrani, M; Aberoomand-Azar, P; Mohagheghian, M

    2011-03-01

    The applicability of H-point standard additions method (HPSAM) to the resolving of overlapping spectra corresponding to the sulfamethoxazole and trimethoprim is verified by UV-vis spectrophotometry. The results show that the H-point standard additions method with simultaneous addition of both analytes is suitable for the simultaneous determination of sulfamethoxazole and trimethoprim in aqueous media. The results of applying the H-point standard additions method showed that the two drugs could be determined simultaneously with the concentration ratios of sulfamethoxazole to trimethoprim varying from 1:18 to 16:1 in the mixed samples. Also, the limits of detections were 0.58 and 0.37 μmol L(-1) for sulfamethoxazole and trimethoprim, respectively. In addition the means of the calculated RSD (%) were 1.63 and 2.01 for SMX and TMP, respectively in synthetic mixtures. The proposed method has been successfully applied to the simultaneous determination of sulfamethoxazole and trimethoprim in some synthetic, pharmaceutical formulation and biological fluid samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Surface 3D nanostructuring by tightly focused laser pulse: simulations by Lagrangian code and molecular dynamics

    NASA Astrophysics Data System (ADS)

    Inogamov, Nail A.; Zhakhovsky, Vasily V.

    2016-02-01

    There are many important applications in which the ultrashort diffraction-limited and therefore tightly focused laser pulses irradiates metal films mounted on dielectric substrate. Here we present the detailed picture of laser peeling and 3D structure formation of the thin (relative to a depth of a heat affected zone in the bulk targets) gold films on glass substrate. The underlying physics of such diffraction-limited laser peeling was not well understood previously. Our approach is based on a physical model which takes into consideration the new calculations of the two-temperature (2T) equation of state (2T EoS) and the two-temperature transport coefficients together with the coupling parameter between electron and ion subsystems. The usage of the 2T EoS and the kinetic coefficients is required because absorption of an ultrashort pulse with duration of 10-1000 fs excites electron subsystem of metal and transfers substance into the 2T state with hot electrons (typical electron temperatures 1-3 eV) and much colder ions. It is shown that formation of submicrometer-sized 3D structures is a result of the electron-ion energy transfer, melting, and delamination of film from substrate under combined action of electron and ion pressures, capillary deceleration of the delaminated liquid metal or semiconductor, and ultrafast freezing of molten material. We found that the freezing is going in non-equilibrium regime with strongly overcooled liquid phase. In this case the Stefan approximation is non-applicable because the solidification front speed is limited by the diffusion rate of atoms in the molten material. To solve the problem we have developed the 2T Lagrangian code including all this reach physics in. We also used the high-performance combined Monte- Carlo and molecular dynamics code for simulation of surface 3D nanostructuring at later times after completion of electron-ion relaxation.

  16. White Dwarf/M Dwarf Binaries as Single Degenerate Progenitors of Type Ia Supernovae

    NASA Astrophysics Data System (ADS)

    Wheeler, J. Craig

    2012-10-01

    Limits on the companions of white dwarfs in the single-degenerate scenario for the origin of Type Ia supernovae (SNe Ia) have gotten increasingly tight, yet igniting a nearly Chandrasekhar mass C/O white dwarf from a condition of near hydrostatic equilibrium provides compelling agreement with observed spectral evolution. The only type of non-degenerate stars that survive the tight limits, MV >~ 8.4 on the SN Ia in SNR 0509-67.5 and MV >~ 9.5 in the remnant of SN 1572, are M dwarfs. While M dwarfs are observed in cataclysmic variables, they have special properties that have not been considered in most work on the progenitors of SNe Ia: they have small but finite magnetic fields and they flare frequently. These properties are explored in the context of SN Ia progenitors. White dwarf/M dwarf pairs may be sufficiently plentiful to provide, in principle, an adequate rate of explosions even with slow orbital evolution due to magnetic braking or gravitational radiation. Even modest magnetic fields on the white dwarf and M dwarf will yield adequate torques to lock the two stars together, resulting in a slowly rotating white dwarf, with the magnetic poles pointing at one another in the orbital plane. The mass loss will be channeled by a "magnetic bottle" connecting the two stars, landing on a concentrated polar area on the white dwarf. This enhances the effective rate of accretion compared to spherical accretion. Luminosity from accretion and hydrogen burning on the surface of the white dwarf may induce self-excited mass transfer. The combined effects of self-excited mass loss, polar accretion, and magnetic inhibition of mixing of accretion layers give possible means to beat the "nova limit" and grow the white dwarf to the Chandrasekhar mass even at rather moderate mass accretion rates.

  17. Hamstring tightness and Scheuermann's disease a pilot study.

    PubMed

    Fisk, J W; Baigent, M L

    1981-06-01

    The lateral radiographs of the dorsal spines of 20 patients presenting with mainly low back pain are studied. These patients had clinically evident loss of flexion in the low dorsal spine and very tight hamstring muscles. 85% of them showed definite evidence of previous Scheuermann's Disease. The possibility that tight hamstrings may be an important factor in the aetiology of this disease is discussed, and a further large scale study is proposed.

  18. The Role of the Rock on Hydraulic Fracturing of Tight Shales

    NASA Astrophysics Data System (ADS)

    Suarez-Rivera, R.; Green, S.; Stanchits, S.; Yang, Y.

    2011-12-01

    Successful economic production of oil and gas from nano-darcy-range permeability, tight shale reservoirs, is achieved via massive hydraulic fracturing. This is so despite their limited hydrocarbon in place, on per unit rock volume basis. As a reference, consider a typical average porosity of 6% and an average hydrocarbon saturation of 50% to 75%. The importance of tight shales results from their large areal extent and vertical thickness. For example, the areal extent of the Anwar field in Saudi Arabia of 3230 square miles (and 300 ft thick), while the Marcellus shale alone is over 100,000 square miles (and 70 to 150 ft thick). The low permeability of the rock matrix, the predominantly mineralized rock fabric, and the high capillary forces to both brines and hydrocarbons, restrict the mobility of pore fluids in these reservoirs. Thus, one anticipates that fluids do not move very far within tight shales. Successful production, therefore results from maximizing the surface area of contact with the reservoir by massive hydraulic fracturing from horizontal bore holes. This was the conceptual breakthrough of the previous decade and the one that triggered the emergence of gas shales, and recently oily shales, as important economic sources of energy. It is now understood that the process can be made substantially more efficient, more sustainable, and more cost effective by understanding the rock. This will be the breakthrough of this decade. Microseismic monitoring, mass balance calculations, and laboratory experiments of hydraulic fracturing on tight shales indicate the development of fracture complexity and fracture propagation that can not be explained in detail in this layered heterogeneous media. It is now clear that in tight shales the large-scale formation fabric is responsible for fracture complexity. For example, the presence and pervasiveness of mineralized fractures, bed interfaces, lithologic contacts, and other types of discontinuities, and their orientation in relation to the in-situ stresses, have a dominant role in promoting fracture branching and abrupt changes in direction. In general, the problem can be conceptualized as a competition between the effect of stresses (traditional mechanics of homogeneous media) and the effect of rock fabric (the mechanics of heterogeneous media). When the stress difference is low and the rock fabric pronounced, the rock fabric defines the direction of propagation. When the stress difference is high and the fabric is weak, the stress contrast dominates the process. In real systems, both effects compete and result in the complexity that we infer from indirect observations. In this paper we discuss the role of rock fabric on fracture complexity during hydraulic fracture propagation. We show that understanding the far field stresses is not enough to understand fracture propagation and complexity. Understanding the rock-specifically the larger-scale textural features that define the reservoir fabric-is fundamental to understand fracture complexity and fracture containment. We use laboratory experiments with acoustic emission localization to monitor fracturing and making inferences about the large-scale rock behavior. We also show that the fracture geometry, even for the same connected surface area, has significant well production and reservoir recovery implications.

  19. Tight Fits for Americas Next Moon Rocket, Ares V

    NASA Technical Reports Server (NTRS)

    Jaap, John; Fisher, Wyatt; Richardson, Lea

    2010-01-01

    America has begun the development of a new heavy lift rocket which will enable humans to return to the moon and reach even farther destinations. Five decades ago, the National Aeronautics and Space Administration designed a system (called Saturn/Apollo) to carry men to the moon and back; the rocket which boosted them to the moon was the Saturn V. Saturn V was huge relative to contemporary rockets and is still the largest rocket ever launched. The new moon rocket is called Ares V. It will insert 40% more payload into low earth orbit than Saturn V; and after docking with the crew spacecraft, it will insert 50% more payload onto the translunar trajectory than Saturn V. The current design of Ares V calls for two liquid-fueled stages and 2 "strap-on" solid rockets. The solid rockets are extended-length versions of the solid rockets used on the Shuttle. The diameter of the liquid stages is at least as large as the first stage of the Saturn V; the height of the lower liquid stage (called the core stage) is longer than the external tank of the Shuttle. Huge rockets require huge infrastructure and, during the Saturn/Apollo era, America invested significantly in manufacturing, assembly and launch facilities which are still in use today. Since the Saturn/Apollo era, America has invested in additional infrastructure for the Shuttle program. Ares V must utilize this existing infrastructure, with reasonable modifications. Building a rocket with 50% more capability in the same buildings, testing it in the same test stands, shipping on the same canals under the same bridges, assembling it in the same building, rolling it to the pad on the same crawler, and launching it from the same launch pad is an engineering and logistics challenge which goes hand-in-hand with designing the structure, tanks, turbines, engines, software, etc. necessary to carry such a large payload to earth orbit and to the moon. This paper quantitatively discusses the significant "tight fits" that are constraining Ares V. The engineers designing and building the infrastructure for the Saturn/Apollo program usually added margins and growth capability; sometimes the size of existing facilities (such as the width of a draw bridge) was not a constraint. Ares V may utilize the "extra" space in the existing facilities and expand other tight fits. Some of the tight fits cannot be overcome without great expense; raising the roof on the Vertical Assembly Building for example. Other tight fits are easily overcome; the transporter at the manufacturing facility for the core stage can pass under low ceilings and later over a dike (without dragging the middle) by retracting or extending the struts which support the stage. Tight fits discussed in this paper include manufacturing (jigs, widths, heights, and local transportation), testing (test stand sizes and crane capability), transportation to the test stands and the launch site (barge, waterway, and rail), assembly (VAB internal dimensions and door size), roll-out limits, and launch pad size.

  20. SIMULTANEOUS USE OF NON-MEDICAL ADHD PRESCRIPTION STIMULANTS AND ALCOHOL AMONG UNDERGRADUATE STUDENTS

    PubMed Central

    Egan, Kathleen L.; Reboussin, Beth A.; Blocker, Jill N.; Wolfson, Mark; Sutfin, Erin L.

    2013-01-01

    Background Use of prescription stimulants used to treat Attention Deficit/Hyperactivity Disorder (ADHD) for reasons other than prescribed, known as non-medical use, is a growing problem among undergraduates. Previous studies show that non-medical prescription stimulant (NMPS) users consume more alcohol than individuals who do not use NMPS. However, research on simultaneous use of NMPS and alcohol is limited. The objectives of this study were to: (1) determine the prevalence of simultaneous use of alcohol and NMPS; (2) examine predictors and consequences of simultaneous NMPS and alcohol use among undergraduates. Methods In fall 2009, 4,090 students from eight North Carolina universities completed a web-based survey. Results Past year prevalence of NMPS use among this sample was 10.6% and simultaneous use of NMPS with alcohol was 4.9%. Among NMPS users, 46.4% used NMPS simultaneously with alcohol within the past year. Multivariable analysis revealed that simultaneous NMPS and alcohol use was associated with low grade point averages, use of other substances, and increased alcohol-related consequences. Simultaneous NMPS and alcohol users reported experiencing significantly more negative consequences than either past year drinkers who did not use prescription stimulants and concurrent NMPS and alcohol users (use over the past year but not at the same time). Conclusions Simultaneous use of NMPS and alcohol is high among NMPS users in our sample of undergraduate students. Simultaneous users are at increased risk of experiencing negative consequences. Thus, prevention and intervention efforts should include a focus on simultaneous NMPS and alcohol use. PMID:23274057

  1. Two-Finger Tightness: What Is It? Measuring Torque and Reproducibility in a Simulated Model.

    PubMed

    Acker, William B; Tai, Bruce L; Belmont, Barry; Shih, Albert J; Irwin, Todd A; Holmes, James R

    2016-05-01

    Residents in training are often directed to insert screws using "two-finger tightness" to impart adequate torque but minimize the chance of a screw stripping in bone. This study seeks to quantify and describe two-finger tightness and to assess the variability of its application by residents in training. Cortical bone was simulated using a polyurethane foam block (30-pcf density) that was prepared with predrilled holes for tightening 3.5 × 14-mm long cortical screws and mounted to a custom-built apparatus on a load cell to capture torque data. Thirty-three residents in training, ranging from the first through fifth years of residency, along with 8 staff members, were directed to tighten 6 screws to two-finger tightness in the test block, and peak torque values were recorded. The participants were blinded to their torque values. Stripping torque (2.73 ± 0.56 N·m) was determined from 36 trials and served as a threshold for failed screw placement. The average torques varied substantially with regard to absolute torque values, thus poorly defining two-finger tightness. Junior residents less consistently reproduced torque compared with other groups (0.29 and 0.32, respectively). These data quantify absolute values of two-finger tightness but demonstrate considerable variability in absolute torque values, percentage of stripping torque, and ability to consistently reproduce given torque levels. Increased years in training are weakly correlated with reproducibility, but experience does not seem to affect absolute torque levels. These results question the usefulness of two-finger tightness as a teaching tool and highlight the need for improvement in resident motor skill training and development within a teaching curriculum. Torque measuring devices may be a useful simulation tools for this purpose.

  2. Ischemia-reperfusion impairs blood-brain barrier function and alters tight junction protein expression in the ovine fetus

    PubMed Central

    Chen, Xiaodi; Threlkeld, Steven W.; Cummings, Erin E.; Juan, Ilona; Makeyev, Oleksandr; Besio, Walter G.; Gaitanis, John; Banks, William A.; Sadowska, Grazyna B.; Stonestreet, Barbara S.

    2012-01-01

    The blood-brain barrier is a restrictive interface between the brain parenchyma and the intravascular compartment. Tight junctions contribute to the integrity of the blood-brain barrier. Hypoxic-ischemic damage to the blood-brain barrier could be an important component of fetal brain injury. We hypothesized that increases in blood-brain barrier permeability after ischemia depend upon the duration of reperfusion and that decreases in tight junction proteins are associated with the ischemia-related impairment in blood-brain barrier function in the fetus. Blood-brain barrier function was quantified with the blood-to-brain transfer constant (Ki) and tight junction proteins by Western immunoblot in fetal sheep at 127 days-of-gestation without ischemia, and 4-, 24-, or 48-h after ischemia. The largest increase in Ki (P<0.05) was 4-h after ischemia. Occludin and claudin-5 expressions decreased at 4-h, but returned toward control levels 24- and 48-h after ischemia. Zonula occludens-1 and -2 decreased after ischemia. Inverse correlations between Ki and tight junction proteins suggest that the decreases in tight junction proteins contribute to impaired blood-brain barrier function after ischemia. We conclude that impaired blood-brain barrier function is an important component of hypoxic-ischemic brain injury in the fetus, and that increases in quantitatively measured barrier permeability (Ki) change as a function of the duration of reperfusion after ischemia. The largest increase in permeability occurs 4-h after ischemia and blood-brain barrier function improves early after injury because the blood-brain barrier is less permeable 24- and 48- than 4-h after ischemia. Changes in the tight junction molecular composition are associated with increases in blood-brain barrier permeability after ischemia. PMID:22986172

  3. Mapping the nanoscale energetic landscape in conductive polymer films with spatially super-resolved exciton dynamics

    NASA Astrophysics Data System (ADS)

    Ginsberg, Naomi

    2015-03-01

    The migration of Frenkel excitons, tightly-bound electron-hole pairs, in polymeric organic semiconducting films is critical to the efficiency of bulk heterojunction solar cells. While these materials exhibit a high degree of structural heterogeneity on the nanoscale, traditional measurements of exciton diffusion lengths are performed on bulk samples. Since both the characteristic length scales of structural heterogeneity and the reported bulk diffusion lengths are smaller than the optical diffraction limit, we adapt far-field super-resolution fluorescence imaging to uncover the correlations between the structural and energetic landscapes that the excitons explore.

  4. On the formation of suspended noble-metal monatomic chains

    NASA Astrophysics Data System (ADS)

    Hasmy, A.; Rincón, L.; Hernández, R.; Mujica, V.; Márquez, M.; González, C.

    2008-09-01

    We present a tight-binding molecular-dynamics investigation of the geometrical and the electronic structure of suspended monatomic noble-metal chains. We show that linear monatomic chains are formed at temperatures equal to or smaller than 500 K for Au, 200 K for Ag, and 4 K for Cu and that they are stable for at least 10 ns. We also evidence that such stability is associated with the persisting sd orbital hybridization along the chains. The study highlights fundamental limitations of conductance measurement experiments to detect these chains in the breaking process of nanowires.

  5. Design and Synthesis of Tight Pitch FLCs for Analog Voltage-Limited Electro-Optic Modulators

    DTIC Science & Technology

    1994-05-27

    or decision, unless so designated b other documentation. 12a. DISTRIBUTION/AVAILABILITY STATEMENT 𔃼b, DISTRIBUTION CODE Approved for public release...other end, a wide variety of cores can be synthesized. This is the preferred method for making about 40% of the cores shown in Figure 1. [PGO(Ar) -- B ...methanol, and finally dehydration to the nitrile 51 using phosphorus pentoxide. 0 OHO %%’QL X1) Bu2 BOTf A). 482 ) CH3CHO 49 it N •N O =Xc DEAD, TPP C8H17 O H

  6. Diabetes management at the end of life: transitioning from tight glycemic control to comfort.

    PubMed

    Tice, Martha A

    2006-05-01

    Tight glycemic control has become the standard of care for prevention of the long-term side effects of diabetes mellitus. When individuals with diabetes approach the end of life from advanced cancer or another chronic illness, they often become anorexic. The result is an increased risk for hypoglycemic episodes. It is appropriate to shift the goal of therapy from tight control of blood sugar to maintaining comfort and enhancing quality of life.

  7. The RealGas and RealGasH2O options of the TOUGH+ code for the simulation of coupled fluid and heat flow in tight/shale gas systems

    EPA Science Inventory

    We developed two new EOS additions to the TOUGH+ family of codes, the RealGasH2O and RealGas. The RealGasH2O EOS option describes the non-isothermal two-phase flow of water and a real gas mixture in gas reservoirs, with a particular focus in ultra-tight (such as tight-sand and sh...

  8. Simultaneous Dual Species Matter Wave Interferometry

    NASA Astrophysics Data System (ADS)

    Schlippert, Dennis; Albers, Henning; Richardson, Logan; Meiners, Christian; Hartwig, Jonas; Ertmer, Wolfgang; Rasel, Ernst

    2014-05-01

    We report on the first realization of a simultaneous 39K-87Rb-dual species matter wave interferometer measuring gravitational acceleration with the aim to test Einstein's Equivalence Principle (EEP). Compared to classical tests such as torsion pendulum experiments and Lunar Laser Ranging, chemical elements suitable for performing matter wave interferometry can provide complementary information. We show the performance of our apparatus and discuss current limitations and future improvements towards highly sensitive matter wave tests of EEP.

  9. Disruptions of occludin and claudin-5 in brain endothelial cells in vitro and in brains of mice with acute liver failure

    PubMed Central

    Chen, Florence; Ohashi, Norifumi; Li, Wensheng; Eckman, Christopher; Nguyen, Justin H.

    2010-01-01

    Brain edema in acute liver failure (ALF) remains lethal. The role of vasogenic mechanisms of brain edema has not been explored. We previously demonstrated that matrix metalloproteinase-9 (MMP-9) contributes to the pathogenesis of brain edema. Here, we show that MMP-9 mediates disruptions in tight junction proteins in vitro and in brains of mice with ALF. We transfected murine brain endothelial cells with MMP-9 cDNA using pc DNA3.1 (+)/Myc-His A expression vector. Tissue inhibitor of matrix metalloproteinases (TIMP-1) cDNA transfection or GM6001 was used to inhibit MMP-9. ALF was induced in mice with azoxymethane. Endogenous overexpression of MMP-9 in brain endothelial cells resulted in significant degradation of tight junction proteins occludin and claudin-5. The alterations in tight junction proteins correlated with increased permeability to FITC-dextran molecules. The degradation of tight junction proteins and the increased permeability were reversed by TIMP-1 and GM6001. Similar results were found when MMP-9 was exogenously added to brain EC. We also found that tight junction proteins degradation was reversed with GM6001 in brains of mice with ALF. Conclusions Tight junction proteins are significantly perturbed in brains of mice with ALF. These data corroborate the important role of MMP-9 in the vasogenic mechanism of brain edema in ALF. PMID:19821483

  10. The media of sociology: tight or loose translations?

    PubMed

    Guggenheim, Michael

    2015-06-01

    Sociologists have increasingly come to recognize that the discipline has unduly privileged textual representations, but efforts to incorporate visual and other media are still only in their beginning. This paper develops an analysis of the ways objects of knowledge are translated into other media, in order to understand the visual practices of sociology and to point out unused possibilities. I argue that the discourse on visual sociology, by assuming that photographs are less objective than text, is based on an asymmetric media-determinism and on a misleading notion of objectivity. Instead, I suggest to analyse media with the concept of translations. I introduce several kinds of translations, most centrally the distinction between tight and loose ones. I show that many sciences, such as biology, focus on tight translations, using a variety of media and manipulating both research objects and representations. Sociology, in contrast, uses both tight and loose translations, but uses the latter only for texts. For visuals, sociology restricts itself to what I call 'the documentary': focusing on mechanical recording technologies without manipulating either the object of research or the representation. I conclude by discussing three rare examples of what is largely excluded in sociology: visual loose translations, visual tight translations based on non-mechanical recording technologies, and visual tight translations based on mechanical recording technologies that include the manipulation of both object and representation. © London School of Economics and Political Science 2015.

  11. Claudin gene expression patterns do not associate with interspecific differences in paracellular nutrient absorption.

    PubMed

    Price, Edwin R; Rott, Katherine H; Caviedes-Vidal, Enrique; Karasov, William H

    2016-01-01

    Bats exhibit higher paracellular absorption of glucose-sized molecules than non-flying mammals, a phenomenon that may be driven by higher permeability of the intestinal tight junctions. The various claudins, occludin, and other proteins making up the tight junctions are thought to determine their permeability properties. Here we show that absorption of the paracellular probe l-arabinose is higher in a bat (Eptesicus fuscus) than in a vole (Microtus pennsylvanicus) or a hedgehog (Atelerix albiventris). Furthermore, histological measurements demonstrated that hedgehogs have many more enterocytes in their intestines, suggesting that bats cannot have higher absorption of arabinose simply by having more tight junctions. We therefore investigated the mRNA levels of several claudins and occludin, because these proteins may affect permeability of tight junctions to macronutrients. To assess the expression levels of claudins per tight junction, we normalized the mRNA levels of the claudins to the constitutively expressed tight junction protein ZO-1, and combined these with measurements previously made in a bat and a rodent to determine if there were among-species differences. Although expression ratios of several genes varied among species, there was not a consistent difference between bats and non-flyers in the expression ratio of any particular gene. Protein expression patterns may differ from mRNA expression patterns, and might better explain differences among species in arabinose absorption. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Optical Imaging of Nonuniform Ferroelectricity and Strain at the Diffraction Limit

    PubMed Central

    Vlasin, Ondrej; Casals, Blai; Dix, Nico; Gutiérrez, Diego; Sánchez, Florencio; Herranz, Gervasi

    2015-01-01

    We have imaged optically the spatial distributions of ferroelectricity and piezoelectricity at the diffraction limit. Contributions to the birefringence from electro-optics –linked to ferroelectricity– as well as strain –arising from converse piezoelectric effects– have been recorded simultaneously in a BaTiO3 thin film. The concurrent recording of electro-optic and piezo-optic mappings revealed that, far from the ideal uniformity, the ferroelectric and piezoelectric responses were strikingly inhomogeneous, exhibiting significant fluctuations over the scale of the micrometer. The optical methods here described are appropriate to study the variations of these properties simultaneously, which are of great relevance when ferroelectrics are downscaled to small sizes for applications in data storage and processing. PMID:26522345

  13. A fast, reliable, ultra high performance liquid chromatography method for the simultaneous determination of amino acids, biogenic amines and ammonium ions in cheese, using diethyl ethoxymethylenemalonate as a derivatising agent.

    PubMed

    Redruello, Begoña; Ladero, Victor; Cuesta, Isabel; Álvarez-Buylla, Jorge R; Martín, María Cruz; Fernández, María; Alvarez, Miguel A

    2013-08-15

    Derivatisation treatment with diethyl ethoxymethylenemalonate followed by ultra-HPLC allowed the simultaneous quantification of 22 amino acids, 7 biogenic amines and ammonium ions in cheese samples in under 10 min. This is the fastest elution time ever reported for such a resolution. The proposed method shows good linearity (R(2)>0.995) and sensitivity (detection limit 0.08-3.91 μM; quantification limit <13.02 μM). Intra- and inter-day repeatability ranged from 0.35% to 1.25% and from 0.85% to 5.2%, respectively. No significant effect of the cheese matrix was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Simultaneous quantitative analysis of arsenic, bismuth, selenium, and tellurium in soil samples using multi-channel hydride-generation atomic fluorescence spectrometry.

    PubMed

    Wang, Fang; Zhang, Gai

    2011-03-01

    The basic principles and the application of hydride-generation multi-channel atomic fluorescence spectrometry (HG-MC-AFS) in soil analysis are described. It is generally understood that only one or two elements can be simultaneously detected by commonly used one- or two-channel HG-AFS. In this work, a new sample-sensitive and effective method for the analysis of arsenic, bismuth, tellurium, and selenium in soil samples by simultaneous detection using HG-MC-AFS was developed. The method detection limits for arsenic, bismuth, tellurium, and selenium are 0.19 μg/g, 0.10 μg/g, 0.11 μg/g, and 0.08 μg/g, respectively. This method was successfully applied to the simultaneous determination of arsenic, bismuth, tellurium, and selenium in soil samples.

  15. Hierarchical learning induces two simultaneous, but separable, prediction errors in human basal ganglia.

    PubMed

    Diuk, Carlos; Tsai, Karin; Wallis, Jonathan; Botvinick, Matthew; Niv, Yael

    2013-03-27

    Studies suggest that dopaminergic neurons report a unitary, global reward prediction error signal. However, learning in complex real-life tasks, in particular tasks that show hierarchical structure, requires multiple prediction errors that may coincide in time. We used functional neuroimaging to measure prediction error signals in humans performing such a hierarchical task involving simultaneous, uncorrelated prediction errors. Analysis of signals in a priori anatomical regions of interest in the ventral striatum and the ventral tegmental area indeed evidenced two simultaneous, but separable, prediction error signals corresponding to the two levels of hierarchy in the task. This result suggests that suitably designed tasks may reveal a more intricate pattern of firing in dopaminergic neurons. Moreover, the need for downstream separation of these signals implies possible limitations on the number of different task levels that we can learn about simultaneously.

  16. Effect of Extracorporeal Shock Wave Therapy on Hamstring Tightness in Healthy Subjects: A Pilot Study

    PubMed Central

    Kim, Yong Wook; Chang, Won Hyuk; Kim, Na Young; Kwon, Jun Beom

    2017-01-01

    Purpose To assess the effect of extracorporeal shock wave therapy (ESWT) for healthy participants with hamstring tightness. Materials and Methods This study was performed at a university rehabilitation hospital. Twenty nine healthy adults with hamstring tightness were enrolled and randomly allocated into four groups (ESWT, stretching exercise, ESWT with stretching exercise, and control). The effects of individual treatments were compared by the finger-to-floor test and popliteal angle. Results The ESWT group, stretching exercise group and ESWT with stretching exercise group had decreased finger-to-floor distances and right popliteal angles immediately after intervention, compared with the control group (p<0.05). At 4 weeks after completion of the interventions, finger-to-floor distances and the right popliteal angle in only the ESWT with stretching exercise group showed a significant improvement, compared with the control group (p=0.008 and 0.023). Conclusion While ESWT and stretching both reduced hamstring tightness immediately after interventions, only ESWT with stretching exercise maintained the significantly improved relief of hamstring tightness significantly after 4 weeks. PMID:28332373

  17. Endothelial Notch signalling limits angiogenesis via control of artery formation

    PubMed Central

    Hasan, Sana S.; Tsaryk, Roman; Lange, Martin; Wisniewski, Laura; Moore, John C.; Lawson, Nathan D.; Wojciechowska, Karolina; Schnittler, Hans; Siekmann, Arndt F.

    2017-01-01

    Angiogenic sprouting needs to be tightly controlled. It has been suggested that the Notch ligand dll4 expressed in leading tip cells restricts angiogenesis by activating Notch signalling in trailing stalk cells. Here, we show using live imaging in zebrafish that activation of Notch signalling is rather required in tip cells. Notch activation initially triggers expression of the chemokine receptor cxcr4a. This allows for proper tip cell migration and connection to the pre-existing arterial circulation, ultimately establishing functional arterial-venous blood flow patterns. Subsequently, Notch signalling reduces cxcr4a expression, thereby preventing excessive blood vessel growth. Finally, we find that Notch signalling is dispensable for limiting blood vessel growth during venous plexus formation that does not generate arteries. Together, these findings link the role of Notch signalling in limiting angiogenesis to its role during artery formation and provide a framework for our understanding of the mechanisms underlying blood vessel network expansion and maturation. PMID:28714969

  18. Stabilizing detached Bridgman melt crystal growth: Proportional-integral feedback control

    NASA Astrophysics Data System (ADS)

    Yeckel, Andrew; Daoutidis, Prodromos; Derby, Jeffrey J.

    2012-10-01

    The dynamics, operability limits, and tuning of a proportional-integral feedback controller to stabilize detached vertical Bridgman crystal growth are analyzed using a capillary model of shape stability. The manipulated variable is the pressure difference between upper and lower vapor spaces, and the controlled variable is the gap width at the triple-phase line. Open and closed loop dynamics of step changes in these state variables are analyzed under both shape stable and shape unstable growth conditions. Effects of step changes in static contact angle and growth angle are also studied. Proportional and proportional-integral control can stabilize unstable growth, but only within tight operability limits imposed by the narrow range of allowed meniscus shapes. These limits are used to establish safe operating ranges of controller gain. Strong nonlinearity of the capillary model restricts the range of perturbations that can be stabilized, and under some circumstances, stabilizes a spurious operating state far from the set point. Stabilizing detachment at low growth angle proves difficult and becomes impossible at zero growth angle.

  19. Nature of a single doped hole in two-leg Hubbard and t - J ladders

    DOE PAGES

    Liu, Shenxiu; Jiang, Hong -Chen; Devereaux, Thomas P.

    2016-10-15

    In this study, we have systematically studied the single-hole problem in two-leg Hubbard and t–J ladders by large-scale density-matrix renormalization-group calculations. We found that the doped holes in both models behave similarly, while the three-site correlated hopping term is not important in determining the ground-state properties. For more insights, we have also calculated the elementary excitations, i.e., the energy gaps to the excited states of the system. In the strong-rung limit, we found that the doped hole behaves as a Bloch quasiparticle in both systems where the spin and charge of the doped hole are tightly bound together. In themore » isotropic limit, while the hole still behaves like a quasiparticle in the long-wavelength limit, our results show that its spin and charge components are only loosely bound together inside the quasiparticle, whose internal structure can lead to a visible residual effect which dramatically changes the local structure of the ground-state wave function.« less

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Shenxiu; Jiang, Hong -Chen; Devereaux, Thomas P.

    In this study, we have systematically studied the single-hole problem in two-leg Hubbard and t–J ladders by large-scale density-matrix renormalization-group calculations. We found that the doped holes in both models behave similarly, while the three-site correlated hopping term is not important in determining the ground-state properties. For more insights, we have also calculated the elementary excitations, i.e., the energy gaps to the excited states of the system. In the strong-rung limit, we found that the doped hole behaves as a Bloch quasiparticle in both systems where the spin and charge of the doped hole are tightly bound together. In themore » isotropic limit, while the hole still behaves like a quasiparticle in the long-wavelength limit, our results show that its spin and charge components are only loosely bound together inside the quasiparticle, whose internal structure can lead to a visible residual effect which dramatically changes the local structure of the ground-state wave function.« less

  1. Multitasking vs. multiplexing: Toward a normative account of limitations in the simultaneous execution of control-demanding behaviors

    PubMed Central

    Feng, S. F.; Schwemmer, M.; Gershman, S. J.; Cohen, J. D.

    2014-01-01

    Why is it that behaviors that rely on control, so striking in their diversity and flexibility, are also subject to such striking limitations? Typically, people cannot engage in more than a few — and usually only a single — control-demanding task at a time. This limitation was a defining element in the earliest conceptualizations of controlled processing, it remains one of the most widely accepted axioms of cognitive psychology, and is even the basis for some laws (e.g., against the use of mobile devices while driving). Remarkably, however, the source of this limitation is still not understood. Here, we examine one potential source of this limitation, in terms of a tradeoff between the flexibility and efficiency of representation (“multiplexing”) and the simultaneous engagement of different processing pathways (“multitasking”). We show that even a modest amount of multiplexing rapidly introduces cross-talk among processing pathways, thereby constraining the number that can be productively engaged at once. We propose that, given the large number of advantages of efficient coding, the human brain has favored this over the capacity for multitasking of control-demanding processes. PMID:24481850

  2. Multitasking versus multiplexing: Toward a normative account of limitations in the simultaneous execution of control-demanding behaviors.

    PubMed

    Feng, S F; Schwemmer, M; Gershman, S J; Cohen, J D

    2014-03-01

    Why is it that behaviors that rely on control, so striking in their diversity and flexibility, are also subject to such striking limitations? Typically, people cannot engage in more than a few-and usually only a single-control-demanding task at a time. This limitation was a defining element in the earliest conceptualizations of controlled processing; it remains one of the most widely accepted axioms of cognitive psychology, and is even the basis for some laws (e.g., against the use of mobile devices while driving). Remarkably, however, the source of this limitation is still not understood. Here, we examine one potential source of this limitation, in terms of a trade-off between the flexibility and efficiency of representation ("multiplexing") and the simultaneous engagement of different processing pathways ("multitasking"). We show that even a modest amount of multiplexing rapidly introduces cross-talk among processing pathways, thereby constraining the number that can be productively engaged at once. We propose that, given the large number of advantages of efficient coding, the human brain has favored this over the capacity for multitasking of control-demanding processes.

  3. Spherical cows in the sky with fab four

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaloper, Nemanja; Sandora, McCullen, E-mail: kaloper@physics.ucdavis.edu, E-mail: mesandora@ucdavis.edu

    2014-05-01

    We explore spherically symmetric static solutions in a subclass of unitary scalar-tensor theories of gravity, called the 'Fab Four' models. The weak field large distance solutions may be phenomenologically viable, but only if the Gauss-Bonnet term is negligible. Only in this limit will the Vainshtein mechanism work consistently. Further, classical constraints and unitarity bounds constrain the models quite tightly. Nevertheless, in the limits where the range of individual terms at large scales is respectively Kinetic Braiding, Horndeski, and Gauss-Bonnet, the horizon scale effects may occur while the theory satisfies Solar system constraints and, marginally, unitarity bounds. On the other hand,more » to bring the cutoff down to below a millimeter constrains all the couplings scales such that 'Fab Fours' can't be heard outside of the Solar system.« less

  4. Respiratory symptoms and airflow limitation in asphalt workers

    PubMed Central

    Randem, B; Ulvestad, B; Burstyn, I; Kongerud, J

    2004-01-01

    Aims: To assess the occurrence of respiratory symptoms and signs of airflow limitations in a group of asphalt workers. Methods: All 64 asphalt workers and a reference group of 195 outdoor construction workers from the same company participated in a cross-sectional study. Spirometric tests and a questionnaire on respiratory symptoms and smoking habits were administered. Respiratory symptoms and lung function were adjusted for age and smoking. Results: The FEV1/FVC% ratio was significantly lower in the asphalt workers than in the referents. Symptoms of eye irritation, chest tightness, shortness of breath on exertion, chest wheezing, physician diagnosed asthma, and chronic obstructive pulmonary disease (COPD) were all significantly more prevalent among the asphalt workers. Conclusion: In asphalt workers there is an increased risk of respiratory symptoms, lung function decline, and COPD compared to other construction workers. PMID:15031397

  5. How Low Can You Go? Maximum Constraints on Hydrogen Concentrations Prior to the Great Oxidation Event

    NASA Technical Reports Server (NTRS)

    Domagal-Goldman, Shawn

    2014-01-01

    Shaw postulates that Earth's early atmosphere was rich in reducing gases such as hydrogen, brought to Earth via impact events. This commentary seeks to place constraints on this idea through a very brief review of existing geological and geochemical upper limits on the reducing power of Earth's atmosphere prior to the rise of oxygen. While these constraints place tight limits on this idea for rocks younger than 3.8 Ga, few constraints exist prior to that time, due to a paucity of rocks of that age. The time prior to these constraints is also a time frame for which the proposal is most plausible, and for which it carries the greatest potential to explain other mysteries. Given this potential, several tests are suggested for the H2-rich early Earth hypothesis.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valentino, Eleonora Di; Mersini-Houghton, Laura, E-mail: valentin@iap.fr, E-mail: mersini@physics.unc.edu

    The 2015 Planck data release has placed tight constraints on the allowed class of inflationary models. The current data favors concave downwards inflationary potentials while offering interesting hints on possible deviations from the standard picture of CMB perturbations. We here test the predictions of the theory of the origin of the universe from the landscape multiverse, against the most recent Planck data, for the case of concave downwards inflationary potentials, such as the Starobinsky model of inflation. By considering the quantum entanglement correction of the multiverse, we can place a lower limit on the local 'SUSY breaking' scale b >more » 1.2 × 10{sup 7} GeV at 95% c.l. from Planck TT+lowTEB. We find that this limit is consistent with the range for b that allows the landscape multiverse to explain a serie of anomalies present in the current data.« less

  7. Simultaneous determination of macronutrients, micronutrients and trace elements in mineral fertilizers by inductively coupled plasma optical emission spectrometry

    NASA Astrophysics Data System (ADS)

    de Oliveira Souza, Sidnei; da Costa, Silvânio Silvério Lopes; Santos, Dayane Melo; dos Santos Pinto, Jéssica; Garcia, Carlos Alexandre Borges; Alves, José do Patrocínio Hora; Araujo, Rennan Geovanny Oliveira

    2014-06-01

    An analytical method for simultaneous determination of macronutrients (Ca, Mg, Na and P), micronutrients (Cu, Fe, Mn and Zn) and trace elements (Al, As, Cd, Pb and V) in mineral fertilizers was optimized. Two-level full factorial design was applied to evaluate the optimal proportions of reagents used in the sample digestion on hot plate. A Doehlert design for two variables was used to evaluate the operating conditions of the inductively coupled plasma optical emission spectrometer in order to accomplish the simultaneous determination of the analyte concentrations. The limits of quantification (LOQs) ranged from 2.0 mg kg- 1 for Mn to 77.3 mg kg- 1 for P. The accuracy and precision of the proposed method were evaluated by analysis of standard reference materials (SRMs) of Western phosphate rock (NIST 694), Florida phosphate rock (NIST 120C) and Trace elements in multi-nutrient fertilizer (NIST 695), considered to be adequate for simultaneous determination. Twenty-one samples of mineral fertilizers collected in Sergipe State, Brazil, were analyzed. For all samples, the As, Ca, Cd and Pb concentrations were below the LOQ values of the analytical method. For As, Cd and Pb the obtained LOQ values were below the maximum limit allowed by the Brazilian Ministry of Agriculture, Livestock and Food Supply (Ministério da Agricultura, Pecuária e Abastecimento - MAPA). The optimized method presented good accuracy and was effectively applied to quantitative simultaneous determination of the analytes in mineral fertilizers by inductively coupled plasma optical emission spectrometry (ICP OES).

  8. Tight junctions in inflammatory bowel diseases and inflammatory bowel disease associated colorectal cancer

    PubMed Central

    Landy, Jonathan; Ronde, Emma; English, Nick; Clark, Sue K; Hart, Ailsa L; Knight, Stella C; Ciclitira, Paul J; Al-Hassi, Hafid Omar

    2016-01-01

    Inflammatory bowel diseases are characterised by inflammation that compromises the integrity of the epithelial barrier. The intestinal epithelium is not only a static barrier but has evolved complex mechanisms to control and regulate bacterial interactions with the mucosal surface. Apical tight junction proteins are critical in the maintenance of epithelial barrier function and control of paracellular permeability. The characterisation of alterations in tight junction proteins as key players in epithelial barrier function in inflammatory bowel diseases is rapidly enhancing our understanding of critical mechanisms in disease pathogenesis as well as novel therapeutic opportunities. Here we give an overview of recent literature focusing on the role of tight junction proteins, in particular claudins, in inflammatory bowel diseases and inflammatory bowel disease associated colorectal cancer. PMID:27003989

  9. Method Of Making A Vacuum-Tight Continuous Cable Feedthrough Device

    DOEpatents

    Bazizi, Kamel Abdel; Haelen, Thomas Eugene; Lobkowicz, Frederick; Slattery, Paul Francis

    2001-07-17

    A vacuum-tight cable feedthrough device includes a metallic first flange that is penetrated by a slot. Passing through the slot is a flat stripline cable that includes a plurality of conductive signal channels encompassed by a dielectric material on whose upper and lower surfaces is disposed a conductive material includes a ground. The stripline cable is sealed within the slot to provide a substantially vacuum-tight seal between the cable and the first flange. In a preferred embodiment, the cable feedthrough device includes a plurality, at least 16, of stripline cables. In a further preferred embodiment, the device includes a second flange and a bellows sealably connecting the first and second flanges, thereby providing a substantially vacuum-tight, flexible housing for the plurality of cables.

  10. Map of assessed tight-gas resources in the United States

    USGS Publications Warehouse

    Biewick, Laura R. H.; ,

    2014-01-01

    This report presents a digital map of tight-gas resource assessments in the United States as part of the U.S. Geological Survey’s (USGS) National Assessment of Oil and Gas Project. Using a geology-based assessment methodology, the USGS quantitatively estimated potential volumes of undiscovered, technically recoverable natural gas resources within tight-gas assessment units (AUs). This is the second digital map product in a series of USGS unconventional oil and gas resource maps. The map plate included in this report can be printed in hard-copy form or downloaded in a Geographic Information System (GIS) data package, including an ArcGIS ArcMap document (.mxd), geodatabase (.gdb), and published map file (.pmf). In addition, the publication access table contains hyperlinks to current USGS tight-gas assessment publications and web pages.

  11. Intensive Insulin Therapy: Tight Blood Sugar Control

    MedlinePlus

    Intensive insulin therapy: Tight blood sugar control Intensive insulin therapy can help prevent long-term diabetes complications. Consider the benefits — and understand the commitment. By Mayo Clinic Staff If ...

  12. Development of an innovative immunoassay for CP4EPSPS and Cry1AB genetically modified protein detection and quantification.

    PubMed

    Ermolli, M; Prospero, A; Balla, B; Querci, M; Mazzeo, A; Van Den Eede, G

    2006-09-01

    An innovative immunoassay, called enzyme-linked immunoabsorbant assay (ELISA) Reverse, based on a new conformation of the solid phase, was developed. The solid support was expressly designed to be immersed directly in liquid samples to detect the presence of protein targets. Its application is proposed in those cases where a large number of samples have to be screened simultaneously or when the simultaneous detection of different proteins is required. As a first application, a quantitative immunoassay for Cry1AB protein in genetically modified maize was optimized. The method was tested using genetically modified organism concentrations from 0.1 to 2.0%. The limit of detection and limit of quantitation of the method were determined as 0.0056 and 0.0168 (expressed as the percentage of genetically modified organisms content), respectively. A qualitative multiplex assay to assess the presence of two genetically modified proteins simultaneously was also established for the case of the Cry1AB and the CP4EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) present in genetically modified maize and soy, respectively.

  13. Simultaneous determination of flavonoids, isochlorogenic acids and triterpenoids in Ilex hainanensis Using high performance liquid chromatography coupled with diode array and evaporative light scattering detection.

    PubMed

    Peng, Bo; Qiao, Chun-Feng; Zhao, Jing; Huang, Wei-Hua; Hu, De-Jun; Liu, Hua-Gang; Li, Shao-Ping

    2013-03-04

    A high performance liquid chromatography coupled with diode array and evaporative light scattering detection (HPLC-DAD-ELSD) method for simultaneous determination of eight major bioactive compounds including two flavonoids (rutin and eriodictyol-7-O-β-D-glucopyranoside), two isochlorogenic acids (isochlorogenic acid A and isochlorogenic acid C) and four triterpenoids (ilexhainanoside D, ilexsaponin A1, ilexgenin A and ursolic acid) in Ilex hainanensis has been developed for the first time. The 283 nm wavelength was chosen for determination of two flavonoids and two isochlorogenic acids. ELSD was applied to determine four triterpenoids. The analysis was performed on an Agilent Zorbax SB-C18 column (250 × 4.6 mm i.d., 5 µm) with gradient elution of 0.2% formic acid in water and acetonitrile. The method was validated for linearity, limit of detection, limit of quantification, precision, repeatability and accuracy. The proposed method has been successfully applied for simultaneous quantification of the analytes in four samples of Ilex hainanensis, which is helpful for quality control of this plant.

  14. Multichannel waveguides for the simultaneous detection of disease biomarkers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mukundan, Harshini; Price, Dominique Z; Grace, Wynne K

    2009-01-01

    The sensor team at the Los Alamos National Laboratory has developed a waveguide-based optical biosensor that has previously been used for the detection of biomarkers associated with diseases such as tuberculosis, breast cancer, anthrax and influenza in complex biological samples (e.g., serum and urine). However, no single biomarker can accurately predict disease. To address this issue, we developed a multiplex assay for the detection of components of the Bacillus anthracis lethal toxin on single mode planar optical waveguides with tunable quantum dots as the fluorescence reporter. This limited ability to multiplex is still insufficient for accurate detection of disease ormore » for monitoring prognosis. In this manuscript, we demonstrate for the first time, the design, fabrication and successful evaluation of a multichannel planar optical waveguide for the simultaneous detection of at least three unknown samples in quadruplicate. We demonstrate the simultaneous, rapid (30 min), quantitative (with internal standard) and sensitive (limit of detection of 1 pM) detection of protective antigen and lethal factor of Bacillus anthracis in complex biological samples (serum) using specific monoclonal antibodies labeled with quantum dots as the fluorescence reporter.« less

  15. Simultaneous determination of hydroquinone and catechol at gold nanoparticles mesoporous silica modified carbon paste electrode.

    PubMed

    Tashkhourian, J; Daneshi, M; Nami-Ana, F; Behbahani, M; Bagheri, A

    2016-11-15

    A new electrochemical sensor based on gold nanoparticles mesoporous silica modified carbon paste electrode (AuNPs-MPS) was developed for simultaneous determination of hydroquinone and catechol. Morphology and structure of the AuNPs-MPS were characterized by transmission electron microscopy, X-ray diffraction and Fourier transform infrared spectroscopy. The electrochemical behavior of hydroquinone and catechol were investigated using square wave voltammetry and the results indicate that the electrochemical responses are improved significantly at the modified electrode. The observed oxidative peaks separation of about 120mV made possible the simultaneous determination of hydroquinone and catechol in their binary-mixture. Under the optimized condition, a linear dynamic range of 10.0μM-1.0mM range for hydroquinone with the detection limit of 1.2μM and from 30.0μM-1.0mM for catechol with the detection limit of 1.1μM were obtained. The applicability of the method was demonstrated by the recovery studies of hydroquinone and catechol in spiked tap water samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Wounds caused by tight contact with the barrel-cylinder gap of revolvers.

    PubMed

    Rogers, D R

    1984-06-01

    A case is presented in which the recognition of a tight cylinder gap contact wound was crucial. Experiments were carried out to reproduce the wound which was noted on the hand of a robbery suspect. Tight contact with the cylinder gap of a revolver produces a characteristic, readily recognizable wound. It is characterized by an L-shaped pattern of powder residue. Along one axis a searing burn may occur which may be deep and which may lead to significant tissue destruction.

  17. Negativity and tight constraints of multiqubit entanglement

    NASA Astrophysics Data System (ADS)

    Kim, Jeong San

    2018-01-01

    We provide a characterization of multiqubit entanglement constraints in terms of negativity. By using the square of convex-roof extended negativity (SCREN) and the Hamming weight of the binary vector related with the distribution of subsystems, we show that the α th power of SCREN provides a class of monogamy inequalities of multiqubit entanglement in a tight way for α ≥1 . We further show that the β th power of SCREN also provides a class of tight polygamy inequalities for 0 ≤β ≤1 .

  18. Discussion of case study of a stimulation experiment in a fluvial, tight-sandstone gas reservoir

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azari, M.; Wooden, W.

    The authors found Warpinski et al.'s paper (Case Study of a Stimulation Experiment in Fluvial, Tight-Sandstone Gas Reservoir. Nov. 1990 SPE Production Engineering, Pages 403-10) to be very thorough and informative. That paper considered geological, logging, completion, and pressure-transient data to produce a comprehensive formation evaluation of a fluvial, tight-sandstone gas reservoir. The purpose of this paper is to present the author's view on the peculiar pressure-transient responses shown.

  19. Tight Diabetes Control

    MedlinePlus

    ... results? Here's what they found in the tight-control group as compared with the standard-treatment group: Diabetic ... where you stand. sticky en -- Chef Ronaldo's Sabores de Cuba - 2016-08-book-sabores-de-cuba.html ...

  20. Imaging RF Phased Array Receivers using Optically-Coherent Up-conversion for High Beam-Bandwidth Processing

    DTIC Science & Technology

    2017-03-01

    It does so by using an optical lens to perform an inverse spatial Fourier Transform on the up-converted RF signals, thereby rendering a real-time... simultaneous beams or other engineered beam patterns. There are two general approaches to array-based beam forming: digital and analog. In digital beam...of significantly limiting the number of beams that can be formed simultaneously and narrowing the operational bandwidth. An alternate approach that

Top